ISBN 978-979-3145-63-1

Pengembangan Teknologi Produksi

berbasis pemberdayaan masyarakat
Editor: Sulistyo A. Siran; Maman Turjaman

PENGEMBANGAN TEKNOLOGI PRODUKSI GAHARU BERBASIS PEMBERDAYAAN MASYARAKAT SEKITAR HUTAN
Editor: Sulistyo A. Siran; Maman Turjaman ISBN: 978-979-3145-63-1 Penerbit: Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Kampus Balitbang Kehutanan Jl. Gunung Batu No. 5, Bogor 16110 Telp. (0251) 8633234, 7520067; Fax. (0251) 8638111 E-mail: p3hka_pp@yahoo.co.id

Petikan Undang-Undang Nomor 19 Tahun 2002 tentang Hak Cipta Ketentuan Pidana Pasal 72 (1) Barangsiapa dengan sengaja dan tanpa hak melakukan perbuatan sebagaimana dimaksud dalam Pasal 2 ayat (1) atau Pasal 49 ayat (1) dan ayat (2) dipidana dengan pidana penjara masing-masing paling singkat 1 (satu) bulan dan/atau denda paling sedikit Rp 1.000.000,00 (satu juta rupiah), atau pidana penjara paling lama 7 (tujuh) tahun dan/atau denda paling banyak Rp 5.000.000.000,00 (lima miliar rupiah). (2) Barangsiapa dengan sengaja menyiarkan, memamerkan, mengedarkan, atau menjual kepada umum suatu Ciptaan atau barang hasil pelanggaran Hak Cipta atau Hak Terkait sebagaimana dimaksud pada ayat (1) dipidana dengan pidana penjara paling lama 5 (lima) tahun dan/atau denda paling banyak Rp 500.000.000,00 (lima ratus juta rupiah).

ii

KATA PENGANTAR
Terdapat enam tantangan pembangunan kehutanan yang kita hadapi saat ini, yaitu: degradasi hutan, bencana alam dan lingkungan, pemanasan global, share sektor kehutanan terhadap pertumbuhan ekonomi nasional, desentralisasi sektor kehutanan, dan kontribusi kehutanan dalam hal food, water scarcity, energy, and medicine. Namun, kita masih melihat ada peluang yang merupakan sebuah anugerah bagi bangsa kita, yang bila dibudidayakan dan dikelola secara serius akan dapat menjawab paling tidak lima dari enam tantangan tadi. Anu-gerah yang juga merupakan peluang usaha sektor kehutanan dari jenis HHBK ini bernama “gaharu”. Ide dan gagasan membangun hutan tanaman gaharu juga menarik untuk kita kaji bersama. Kalau selama ini perusahaanperusahaan HTI telah eksis dengan komoditi-komoditi kayu seperti mangium, sengon, mahoni, dan jenis tumbuhan penghasil kayu lainnya, maka bukanlah hal yang mustahil untuk mengembangkan hutan tanaman penghasil gaharu apabila secara finansial menjajikan dan memungkinkan setelah dianalisis kelayakan usahanya. Pengembangan usaha budidaya tanaman HHBK unggulan akan berhasil dengan baik apabila didukung oleh semua stakeholder yang berkepentingan, baik Pemerintah Pusat dalam hal ini Departemen Kehutanan, Pemerintah Daerah, pengusaha, dan petani. Disampaikan terima kasih dan penghargaan yang setinggitingginya kepada semua pihak yang telah berkontribusi hingga terbitnya buku ini.
Jakarta, Nopember 2010

Kepala Badan Litbang Kehutanan

Dr. Ir. Tachrir Fathoni, MSc.

iii

iv

....... PADA Aquilaria microcarpa Eka Novriyanti ....................... UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto.............................................................................. Erdy Santoso .............. 115 6.. Aryanto.......................... DI PERSEMAIAN Irnayuli R................................................ Erdy Santoso........ Sugeng Santosa......... DAN Fusarium sp....... Sugeng Sentosa........... Maman Turjaman ... Sitepu....................................................................................................... Yasuyuki Hashidoko..... Sitepu........................................ Maman Turjaman.. Ahmad Yani.............................. PENGEMBANGAN GAHARU DI SUMATERA Mucharromah.............................. Ragil Setio Budi Irianto..........................1 STATUS RISET GAHARU ................. Irianto..................................... Siran .................................................................................. KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp............... Ahmad Yani.............................................................................. Irnayuli R..... Maman Turjaman ............... Sitepu..35 2.... Aryanto ............. TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso...............................31 Aspek PRODUKSI ................. DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu ................DAFTAR ISI KATA PENGANTAR.................53 3........................................ Aryanto................................. APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp.................iii DAFTAR ISI ................ Ragil S............. 113 5................. EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp.97 Aspek SILVIKULTUR ............. Irnayuli R..... Najmulah............ v PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A...33 1.................................................. 123 7........77 4............... 139 v ......... Najmulah. PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman........B......

........................) DI PROVINSI LAMPUNG DAN BENGKULU............................................. 181 11.......................................................................... PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti .... KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi ............... Irnayuli R. 159 10.................................................................... 213 vi ....... THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo ....................Daftar Isi 8........................... POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk.............. Maman Turjaman............................................................................................... HAMA PADA TANAMAN PENGHASIL GAHARU Ragil SB Irianto..... Sitepu ........... Erdy Santoso................ 193 12................. 151 Aspek SOSIAL EKONOMI DAN KONSERVASI ............................................................ 157 9.......................... SUMATERA Titiek Setyawati..................................

Gaharu sebenarnya sebuah produk yang berbentuk gumpalan padat berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar tanaman pohon inang (misalnya: Aquilaria sp. yaitu karena pengambilan jauh lebih besar daripada produksinya. Siran Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu sebuah nama komoditi hasil hutan non kayu yang saat ini menjadi perbincangan banyak kalangan. Dalam kehidupan seharihari telah dikenal pepatah “sudah gaharu cendana pula”. lantas kenapa komoditi yang telah populer tersebut sepertinya menghilang begitu lama dan saat ini muncul kembali. Pertanyaan yang muncul. Pepatah ini mengindikasikan bahwa sebenarnya komonditi gaharu sudah dipopulerkan oleh nenek moyang kita dan menjadi bukti sejarah bahwa keharuman gaharu telah dikenal sejak ratusan tahun yang lalu. Jawaban yang sudah pasti adalah rumus umum. gaharu sejak zaman dahulu kala sudah digunakan. Oleh sebab itu tidak semua pohon penghasil gaharu mengandung gaharu. baik oleh kalangan elit kerajaan. Dari sisi manfaat. Dilihat dari wujud dan manfaatnya.PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A. maupun masyarakat 1 .) yang telah mengalami proses perubahan fisika dan kimia akibat terinfeksi oleh sejenis jamur. gaharu memang sangat unik.

suku pedalaman di Sumatera dan Kalimantan. disusul kualitas Tanggung dengan harga rata-rata per kilogram Rp 20... dan masuk dalam lampiran Convention on International Trade on Endangered Spcies of Flora and Fauana (Appendix II CITES).000. baik sebagai sumber pendapatan masyarakat maupun penerimaan daerah. aroma terapi. bahan obatobatan yang memiliki khasiat sebagai anti asmatik.000.000.000. keberadaan pohon penghasil gaharu tersebut di Indonesia tidak terkecuali di Sumatera dan Kalimantan semakin langka. bahan kosmetik dan obat-obatan sederhana. Saat ini pemanfaatan gaharu telah berkembang demikian meluas antara lain untuk parfum. Walaupun sejak 1994 Indonesia berkewajiban melindungi pohon penghasil gaharu.000. Besarnya permintaan pasar.000.-. kualitas Kacangan dengan harga rata-rata Rp15.s/d Rp14.000.-).. Tarakan. harga gaharu dengan kualitas Super di pasaran lokal Samarinda. sabun.-. maka jenis-jenis tertentu misalnya Aquilaria dan Gyrinops saat ini sudah tergolong langka. Gaharu dengan demikian mempunyai nilai sosial. Meningkatnya perdagangan gaharu sejak tiga dasawarsa terakhir ini telah menimbulkan kelangkaan produksi gubal gaharu dari alam. namun menurut kenyataan. Secara tradisional gaharu dimanfaatkan antara lain dalam bentuk dupa untuk acara ritual dan keagamaan.000. Kalimantan Timur mencapai Rp 40.000.per kilogram. body lotion. Bertahun-tahun masyarakat dan pemerintah daerah Kalimantan dan Sumatera menikmati berkah dari keberadaan gaharu. Berdasarkan informasi. dan pola pemanenan yang berlebihan serta perdagangan yang masih mengandalkan pada alam tersebut. Selama ini masyarakat hanya tinggal memanen gaharu yang dihasilkan oleh alam.000. kualitas Kemedangan (Rp 1. dan Suloan (Rp75.000.-).s/d Rp 50.-). dan ekonomi yang cukup tinggi.. budaya.000. pengharum tubuh dan ruangan. dan stimulan kerja syaraf dan pencernaan. dan Nunukan.000.s/d Rp 4. kualitas Teri (Rp 10. harga jual yang tinggi.000. anti mikrobia.000.000.000. Seringkali masyarakat tidak tahu pasti kapan pohon penghasil gaharu mulai membentuk gaharu dan bagaimana prosesnya. Kelangkaan terjadi karena pohon penghasil gaharu ditebang tanpa memperhatikan 2 .

Indikasi menurunnya pupulasi pohon penghasil gaharu ditunjukkan oleh kecenderungan produksi gaharu dari Kalimantan dan Sumatera dari tahun ke tahun. pengusaha 3 . mungkin puluhan atau bahkan ratusan pohon penghasil gaharu yang harus ditebang. Siran) ada atau tidak adanya gaharu pada pohon tersebut.. Oleh karena itu dapat dibayangkan kalau pencari gaharu mendapatkan gaharu kira-kira 5 kilogram.. baik in-situ (dalam habitat) maupun ek-situ (di luar habitat) dan budidaya pohon penghasil gaharu. Guna menghindari agar tumbuhan jenis gaharu di alam tidak punah dan pemanfaatannya dapat lestari maka perlu diupayakan untuk konservasi.Perkembangan Pemanfaatan Gaharu . di mana realisasi produksi gaharu pada dekade 80’an pernah mencapai ribuan ton dengan kualitas yang tinggi. perguruan tinggi. Kalaupun ada pohon yang mengandung gaharu. (Sulistyo A.. dari 20 pohon penghasil gaharu yang ditebang di hutan alam hanya ada satu atau sering sama sekali tidak ada yang mengandung gaharu. Namun upaya tersebut tidak mudah dilaksanakan. Peningkatan produksi gaharu dimaksud (yang kegiatannya terdiri dari kegiatan di bagian hulu sampai hilir) selanjutnya akan berdampak pada peningkatan penerimaan oleh masyarakat petani. Menurut hasil kajian. Prospek untuk mengembalikan gaharu menjadi komoditi andalan kembali terbuka dengan ditemukannya teknologi rekayasa produksi gaharu. Sementara masyarakat secara luas enggan untuk melakukan budidaya pohon penghasil gaharu karena memang tidak memberikan keuntungan apa-apa. Dengan teknologi inokulasi maka produksi gaharu dapat direncanakan dan dipercepat melalui induksi jamur pembentuk gaharu pada pohon penghasil gaharu. Praktek semacam inilah yang mengakibatkan jumlah pohon pengahasil gaharu di alam semakin menurun dari tahun ke tahun. sedangkan saat ini produksi tersebut merosot drastis hanya kira-kira puluhan ton saja dengan kualitas yang bervariasi. maka jumlah gaharu yang ada di pohon tersebut hanya beberapa gram saja. dan LSM konservasi. dan kalaupun ada usaha konservasi dan budidaya namun skalanya terbatas dan hanya dilakukan oleh lembaga penelitian..

konservasi.gaharu. Dari pengamatan sebaran Aquilaria spp. Tulisan ini dipaparkan dengan maksud untuk memberikan gambaran secara umum mengenai pemanfaatan gaharu. berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar dari jenis tumbuhan penghasil gaharu yang telah mengalami proses perubahan kimia dan fisika akibat terinfeksi oleh sejenis jamur. perlunya budidaya. dan rekayasa pembentukan gaharu yang dapat mengembalikan status komoditi dari kelangkaan menjadi produk andalan. Berdasarkan sebaran tempat tumbuh. Pulau Sulawesi (2 jenis). Di lndonesia hingga saat ini diperkirakan terdapat lebih kurang 25 jenis tumbuhan penghasil gaharu yang dikelompokkan ke dalam delapan marga dan tiga suku. Kalimantan Barat. yang dilaksanakan pada tahun 2000 ditemukan bahwa Aquilaria spp. Pulau Papua (2 jenis). GAMBARAN UMUM TUMBUHAN PENGHASIL GAHARU Hutan hujan tropis di Indonesia semenjak tiga puluh tahun yang lalu dikenal sebagai salah satu penghasil utama kayu bulat (log) untuk bahan baku industri perkayuan. pemahaman mengenai pentingnya nilai gaharu. Selain itu hutan hujan tropis Kalimantan juga sangat kaya dengan hasil hutan bukan kayu (HHBK). dan Kepulauan Maluku (1 jenis). kemudian dalam jumlah terbatas tumbuh di Kepulauan Nusa Tenggara (3 jenis). tumbuh tersebar secara luas di Kalimantan Timur. Oleh sebab itu tidak semua tanaman penghasil gaharu menghasilkan gaharu. tumbuhan penghasil gaharu umumnya tumbuh di Pulau Kalimantan (12 jenis) dan Pulau Sumatera (10 jenis). di mana salah satu di antaranya adalah gaharu yang bernilai ekonomis tinggi. dan penerimaan pendapatan asli daerah serta devisa negara. Gaharu adalah gumpalan berbentuk padat. Kalimantan 4 . Pulau Jawa (2 jenis).

. Indikasi dari menurunnya populasi Aquilaria spp. Walaupun realisasi produksi gaharu tidak menggambarkan besarnya potensi. kusunol. Menyadari semakin langkanya tumbuhan penghasil gaharu. Bahkan sejak tahun 2004. Akibatnya. jinkohol. Aquilaria malaccensis. seluruh jenis Aquilaria telah dimasukkan dalam Appendix II CITES. (-agarofuran. Untuk mencegah dari kepunahan maka pada pertemuan CITES (The Convention on International Trade in Endangered Species of Wild Flora and Fauna) ke-IX di Florida. jinkohol II serta oxo-aga-rospirol. dihydrokaranone. salah satu tumbuhan penghasil gaharu terpenting yang banyak tumbuh di Kalimantan telah dimasukkan ke dalam Appendix II sebagai tumbuhan yang terancam punah sehingga dalam penebangan dan perdagangannya perlu dibatasi. Siran) Tengah.Perkembangan Pemanfaatan Gaharu ... namun dengan semakin sulitnya mendapatkan gaharu dari waktu ke waktu menunjukkan populasi Aquilaria spp. nor-ketoaaga-rofuran. dan Kalimantan Selatan. (Sulistyo A. agarospirol. baik lokal maupun pendatang untuk melakukan eksploitasi gaharu secara besar-besaran. Amerika Serikat pada tahun 1994. (-)-10-epi-y-eudesmol. Lebih lanjut Susilo (2003) mengatakan bahwa terdapat 17 macam 5 . terus mengalami penurunan. beberapa instansi pemerintah dan masyarakat telah melakukan inisiatif untuk mengadakan pelestarian tumbuhan penghasil gaharu dan sekaligus membudidayakan. populasi Aquilaria spp. di pedalaman hutan Kalimantan Barat dan Kalimanatan Tengah serta menurunnya realisasi produksi gaharu dari tahun ke tahun.. KANDUNGAN DAN MANFAAT GAHARU Terdapat beberapa zat penting yang terkandung dalam gubal gaharu yaitu (-agarofuran. di hutan alam semakin menurun dan bahkan pada suatu saat menjadi punah. antara lain dari pergerakan pencari gaharu yang telah mengarah pada bagian utara Kalimantan Timur. Tingginya permintaan pasar dunia akan gaharu dan harga jual gaharu yang cukup tinggi telah menarik minat masyarakat. jinkohon-eremol. baik untuk kepentingan konservasi maupun ekonomi.

TBC. dan obatobatan. antara lain: noroxoagarofuran. Cara Pendugaan Kandungan Gaharu Karena tidak semua tumbuhan penghasil gaharu berisi gaharu. gubal gaharu diperdagangkan sebagai komoditi elit untuk keperluan industri parfum. Selanjutnya Oiler (tanpa tahun) dalam Suhartono dan Mardiastuti (2003) menyebutkan terdapat 31 unsur kimia yang terkandung di dalam gaharu dan bahan kimia penyusun utamanya adalah 2-(2-(4 methoxyphenyl)ethil)chromone (27%) dan 2-(2-phenylethyl)chromone (15%). kebugaran serta bahan minuman (kopi) oleh masyarakat di Kabupaten Berau. dan aquillochin. dan tumor yang masih dalam proses uji klinis.4 –dihydroxy-dihydro-agarufuran. saat ini berbagai negara memanfaatkan gaharu selain sebagai bahan pengharum (parfum) dan kosmetik. reumatik. tumor. bahan antibiotic. dan pengawet berbagai jenis asesori. Karena aromanya harum. Di samping itu dengan perkembangan ilmu dan teknologi industri. agarospirol. untuk pengobatan stres. tasbih. radang lambung dan ginjal. juga telah berkembang industri pemanfaatan gaharu sebagai bahan baku industri obat herbal alami. asma. kosmetik. Limbah bekas gaharu yang telah disuling digunakan untuk dupa dan bahan untuk upacara agama. Di Cina. liver. PEMUNGUTAN DAN PENGOLAHAN GAHARU A. p-methoxybenzylaceton. gangguan ginjal. membakar jenazah bagi umat hindu. kosmetika. Selain itu gaharu telah dipergunakan sebagai bahan baku industri parfum. asma. Gaharu dengan aromanya yang khas digunakan masyarakat di Timur Tengah sebagai bahan wewangian. maka pengetahuan cara pendugaan kandungan gaharu pada tumbuhan penghasil gaharu yang terinfeksi jamur pembentuk gaharu perlu diketahui terutama oleh para pemungut pemula 6 . hio. kanker. malaria. sedangkan air suling gaharu dimanfaatkan untuk kesehatan. setanggi (dupa). hepatitis. gaharu dimanfaatkan sebagai obat sakit perut. kanker. 3.senyawa yang terdapat pada gaharu. dan stres. kecantikan.

Harga minyak gaharu di pasaran Jakarta Rp 750. Siran) sehingga tidak terjadi salah tebang pada pohon yang tidak berisi gaharu. banyak terdapat benjolan dan lekukan sepanjang batang atau cabang pohon. tajuk pohon kecil dan tipis.Perkembangan Pemanfaatan Gaharu . Pengolahan Gaharu Sampai saat ini produk gaharu yang berasal dari alam umumnya dipasarkan dalam bentuk bongkahan namun ada pula dalam bentuk minyak hasil sulingan. kemudian dipotong-potong dan dibelah untuk diambil gaharunya. Untuk lebih meyakinkan biasanya serpihan kayu tadi selanjutnya dibakar untuk mengetahui apakah mengeluarkan bau/ aroma wangi khas gaharu. Adapun ciri dari tumbuhan penghasil gaharu berisi gaharu antara lain adalah: daun berwarna kuning dan rontok. 7 . Cara ini disebut tubuk. Setelah ditemukan ciri-ciri tersebut maka dilakukan uji pelukaan pada batang pohon dengan menggunakan kapak atau parang. C. Potongan kayu berisi gaharu kemudian dikumpulkan dan secara perlahan bagian kayu dipisahkan dari gaharu dengan menggunakan pisau kecil atau pahat cekung.. Cara lain yang berlaku pada masyarakat Dayak Kenyah dan Punan di Kalimantan Timur adalah dengan mengiris dan memotong bagian kayu dari tumbuhan penghasil gaharu yang terkena infeksi penyakit hingga ke bagian tengah batang. (Sulistyo A..000/tolak (1 tolak = 12 cc). kulit kayu kering dan rapuh serta bila ditarik mudah putus.. puncut atau pahat.. Bilamana terdapat alur coklat kehitaman pada batang menunjukkan adanya kandungan gaharu. cabang pohon banyak yang patah. B. Cara penyulingan minyak gaharu dapat dilakukan dengan dua sistem yaitu sistem kukus dan tekanan uap. Cara pemungutan gaharu semacam ini di Sumatera dan Kalimantan disebut servis. Sistem Pemungutan Gaharu Pohon dari tumbuhan penghasil gaharu yang telah diyakini mengandung gaharu ditebang.

4. Lokasi Super Tanggung Kacangan Kacangan A Kacangan B Kacangan C Teri Teri A Teri B Teri C Teri kulit A Teri kulit B Kemedangan Kemedangan A Kemedangan B Kemedangan community Sudokan Serbuk Serbuk Cincangan Samarinda Super king Super A Super AB 2.KLASIFIKASI MUTU GAHARU Klasifikasi mutu gaharu di Kalimantan Timur khususnya di Kota Samarinda dan daerah sekitarnya hingga saat ini masih belum seragam (Tabel 1) dan penentuannya dilakukan secara visual. kemedangan. dan cincangan dan setiap kelas mutu dibedakan lagi menjadi beberapa sub kelas mutu.1-1999) diharapkan standar mutu tersebut dapat segera menjadi bahan acuan para pengusaha gaharu. TangKacangan isi Teri super gung isi Kacangan Teri laying Tangkosong gung kosong Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan. 1. Klasifikasi mutu gaharu di Kota Samarinda dan daerah sekitarnya Klasifikasi mutu No. Keragaman dan ketidakjelasan di dalam penentuan mutu tersebut menyebabkan harga jual yang berbeda dengan kelas mutu yang sama. dan pemungut gaharu di dalam menentukan kelas mutu gaharu. tanggung. teri. pedagang pengumpul. Muara Kaman Kota Bangun Muara Wahau Super A Super B Super A Super B Kacangan isi Teri isi Kacangan Teri kulit kosong Kacangan A Kacangan B Teri A Teri B 3. 2007 8 . Tabel 1. Pada Tabel 1 disajikan kriteria dan klasifikasi mutu gaharu. Dengan telah ditetapkannya standar nasional untuk mutu gaharu (SNI 01-5009. kacangan. Secara umum klasifikasi mutu gaharu dapat dikelompokkan menjadi enam kelas mutu yaitu super.

Gaharu berwarna hitam dan coklat. padat.per kg..71/ 09/99.000. Teri Kulit A Teri Kulit B Kemedangan A Kemedangan B Kemedangan C Suloan 300.25.2. bercampur kayu. Teri C 500.000.000.000. dan pada umumnya Super AB 15. 2006 Berdasarkan informasi pasar di Samarinda (Tabel 3) harga gaharu dengan kualitas super dapat Tabel 3..500. Kualitas gaharu yang paling 1. Gaharu berwarna hitam terkadang bercampur coklat.000.75.Perkembangan Pemanfaatan Gaharu .000.000. Dalam 5. Siran) Tabel 2.4.000. 1.000.000.1-1999. kadang bercampur serat kayu dan berukuran tanggung. Kriteria dan klasifikasi mutu gaharu No.000.per No. bercampur kayu. padat. Gaharu berwarna hitam terkadang bercampur coklat. Teri A 1. Harga jual gaharu di mencapai Rp 30. Potongan kecil kayu dari pemisahan gaharu. Super King 30. Tanggung 10.500. bagian dalam tidak berlubang.50. disusul kualitas tanggung dengan Kalimantan Timur harga rata-rata Rp 10.digunakan sebagai bahan baku 3. Kacangan 4.penyulingan untuk menghasilkan Kacangan B 5. Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan. berupa butiran-butiran lebih kecil dari biji kacang dan lebih tipis atau berdiameter sekitar 1 mm.500.000. Kacangan A 7..000. tidak ada campuran dengan serat kayu.250. 2. berupa bongkahan atau butiran berukuran besar.000. pasaran Samarinda. Kelas mutu Harga (Rp/Kg) kg. keras. 2006 9 .000.. bagian dalam kadang berlubang.beberapa sampel gaharu dapat Teri B 750. mengkilap dan sangat berbau.000. (Sulistyo A. berupa butiran-butiran sebesar biji kacang atau berdiameter sekitar 2 mm. Teri 5.000. keras.000. Kemedangan Cincangan Sumber : Balai Penelitian dan Pengembangan Kehutanan Kalimantan.000..- 6. Kayu yang mengandung getah gaharu. Klasifikasi Super Kriteria Gaharu berwarna hitam pekat. 1386/BSN-I/HK. 6. Secara visual Kacangan C 2.000 Super 20.dilihat pada Gambar 3.100.000.rendah berharga sekitar Rp 25.Berdasarkan Keputusan Kepala Badan Standarisasi Nasional (BSN) No.000 per kg.minyak gaharu.000.000. telah ditetapkan Standar Nasional mutu gaharu dengan judul dan nomor: Gaharu SNI 01-5009. Tanggung 3.000.000.

Setiap kelas mutu selanjutnya dibedakan lagi menjadi beberapa sub kelas berdasarkan ukuran. lambang dan singkatan. Sampel gaharu (a) gaharu adalah kayu yang berasal kelas tanggung. dan abu gaharu. Klasifikasi mutu gaharu terdiri dari gubal gaharu. berserat kasar dan kayunya yang lunak. ditandai oleh warnanya yang hitam atau kehitaman berseling coklat. kandungan damar wangi. syarat lulus uji dan syarat penandaan. kemedangan. spesifikasi. (c) teri dan dari pohon atau bagian pohon (d) kemedangan penghasil gaharu. syarat mutu.1-1999 yang dimaksud dengan gubal Gambar 1. bobot. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia dapat dilihat pada Tabel 4. cara pemungutan. dan aroma ketika dibakar.standar ini diuraikan mengenai definisi gaharu. Abu gaharu adalah serbuk kayu sisa pemisahan gaharu dari kayu. dengan aroma yang kuat. memiliki kandungan damar wangi dengan aroma yang lemah. ditandai oleh warnanya yang putih keabu-abuan sampai kecoklat-coklatan. warna. (b) kacangan. istilah. Kemudian yang dimaksud dengan kemedangan adalah kayu yang berasal dari pohon atau bagian pohon penghasil gaharu. serat. Menurut SNI 01-5009. klasifikasi. pengambilan contoh. cara uji. 10 .

Mutu VII Abu gaharu Mutu Utama Mutu I Mutu II Kurang Kurang kuat Cincangan Hitam Tinggi Sedang Kurang Kuat Sedang Kurang TATA NIAGA GAHARU Proses pemasaran gaharu di berbagai tempat di Indonesia dimulai dari pemungut gaharu yang menjual gaharu yang ditemukannya kepada pedagang pengumpul di desa atau di kecamatan dan selanjutnya oleh pedagang pengumpul dijual ke pedagang besar (eksportir) di Ibukota Propinsi. C.. 4.. 3. 2. 1. (Sulistyo A. 1. Super Super AB Sabah Super Hitam merata Hitam kecoklatan Hitam kecoklatan Tinggi Cukup Sedang Kuat Kuat Agak kuat Tanggung A Sabah I Tanggung AB Tanggung C Coklat kehitaman Coklat bergaris hitam Coklat bergaris putih tipis Kecoklatan bergaris putih tipis Kecoklatan bergaris putih lebar Putih keabuabuan garis hitam tipis Putih keabuabuan Tinggi Cukup Sedang Sedang Agak kuat Agak kuat Agak kuat Agak kuat 5. 3. 1.. Mutu VI Kemedangan II Kemedangan III Kurang Kurang kuat 7. B. Siran) Tabel 4. Mutu V Kemedangan I Sedang Agak kuat 6. 11 . Klasifikasi mutu gaharu menurut Standar Nasional Indonesia Kesetaraan dengan standar mutu di pasaran Kandungan damar wangi No Klasifikasi mutu Gubal Mutu Utama Mutu I Mutu II Kemedangan Mutu I Mutu II Mutu III Mutu IV Warna Bau/aroma (dibakar) A.Perkembangan Pemanfaatan Gaharu . 2. 3. 2..

Hasil pembelian dari pedagang perantara ini kemudian dikumpulkan oleh pedagang pengumpul di kecamatan untuk selanjutnya dijual kepada pedagang besar karena adanya ikatan kontrak. Contoh alur tata niaga gaharu di Kalimantan dan Sumatra Pedagang pengumpul terdiri dari pedagang perantara di desa yang langsung melakukan pembelian gaharu yang diperoleh para pemungut. Pemungut terikat adalah pemungut gaharu yang dimodali sehingga waktu pencarian dan penjualan hasil perolehannya terikat pada pemberi modal yaitu pedagang pengumpul yang merupakan perpanjangan dari pedagang besar. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 2. Pembelian meningkat bilamana permintaan pasar terhadap gaharu tinggi. pedagang pengumpul di kecamatan maupun langsung kepada pedagang besar (eksportir) di Kota Samarinda. baik kepada pedagang pengumpul di desa. Pembelian gaharu dilakukan sepanjang tahun melalui pedagang pengumpul atau pemungut bebas. bahkan untuk mendapatkan jumlah yang diinginkan mereka menanamkan modal yang disalurkan melalui 12 . Pedagang besar selain memiliki modal besar juga izin usaha yang dikeluarkan oleh instansi pemerintah. Pemungut bebas adalah pemungut gaharu dengan modal kerja sendiri sehingga bebas di dalam menentukan waktu pencarian gaharu dan menjual hasil perolehannya. Pemungut gaharu terdiri dari pemungut bebas dan pemungut terikat.Salah satu contoh alur tata niaga gaharu di Kalimantan Timur dapat diuraikan seperti pada Gambar 2.

Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 3. Alur tata niaga Gaharu di daerah (Kalimantan) PEMASARAN GAHARU Dalam dunia perdagangan gaharu. Pemasaran gaharu yang merupakan salah satu bentuk pemanfaatan tumbuhan dan satwa liar diatur berdasarkan Peraturan Pemerintah Nomor 8 Tahun 1999 dan Konvensi Perdagangan Internasional tentang jenis flora dan fauna liar yang terancam punah (CITES). sedangkan jenis gaharu Gyrinops lebih banyak diproduksi dari Nusa Tenggara. (Sulistyo A. Apabila diperhatikan maka perdagangan gaharu hasil alam di Indonesia dari dulu hingga saat ini lebih banyak bertumpu pada peyebaran secara ekologis jenis-jenis gaharu tersebut... pengambilan dari alam atau hasil budidaya (penangkaran). gaharu dari Papua. Gaharu yang diperdagangkan di Indonesia terdiri dari tiga jenis. Sulawesi dan Maluku lebih dikenal dengan nama Aquilaria filaria. gaharu menjadi komoditi primadona dan memiliki nilai komersial yang cukup tinggi sehingga banyak diburu oleh konsumen.Perkembangan Pemanfaatan Gaharu . yaitu: penentuan kuota. Oleh karena itu maka secara umum pemanfaatan gaharu harus mengikuti tahapan dan aturan-aturannya. baik di Indonesia maupun di luar negeri. pengangkutan untuk peredaran dalam negeri dan pengangkutan untuk pemasaran luar negeri... Siran) pedagang pengumpul ataupun secara langsung kepada pemungut untuk modal kerja mencari gaharu. 13 . yaitu: gaharu dari Sumatera dan Kalimantan dengan jenis Aquilaria malaccensis dan A. microcarpa.

pembersih muka. obat nyamuk. produk gaharu yang diperdagangkan dalam negeri saat ini tidak saja terbatas pada chip atau serpihan dengan bermacam-macam kelas. Beberapa contoh produk dimaksud dapat dilihat pada gambar 3 dan 4 berikut. pemanfaatan untuk obat-obatan dan aroma terapi. antara lain: minyak. Karena perkembangan teknologi. lulur. lulur dan lotion 14 . sabun. lotion.A. hio. makmul. Pemasaran Dalam Negeri Pemasaran dalam negeri dimulai dari aktivitas pengambilan. Gambar 4. tapi juga sudah mengarah ke produk turunannya. Bahkan saat ini sudah dikembangkan daun jenis Aquilaria dan Gyrinops untuk bahan pembuatan minuman teh karena kandungan zat anti oksidan dalam daun yang cukup tinggi. pengangkutan dan peredaran secara domestik produk sampai akhirnya ke konsumen. Produk turunan gaharu: sabun transparan. cream whitening.

baik sebagai individu (perorangan). yaitu sumatera. termasuk Riau. Di duga banyak gaharu yang di perdagangkan secara illegal dari sumatera lewat Riau ke Singapura dan Malaysia. yaitu pasar yang dikuasai oleh pembeli. Pemasaran gaharu dalam negeri terbentuk karena adanya hubungan antara daerah pemasok dengan kota/pusat penerima. 15 . baik dalam menentukan harga maupun kualitas gaharu. Secara tradisional daerah pemasok gaharu untuk kota Surabaya adalah Kalimantan. Daerahdaerah ini walaupun letaknya di Indonesia bagian timur. Karena jumlah pelaku usaha pemasaran. Sulawesi. namun karena akses yang mudah memasok gaharu pula ke Jakarta. Produk sirup dan teh untuk bahan minuman Dilihat dari pelaku usaha. Papua. maka terdapat kecenderungan untuk saling menekan harga. NTT. misalnya pencari gaharu dan pedagang pengumpul di bagian hulu (hutan atau desa sekitar hutan) lebih banyak dibandingkan dengan pedagang menengah dan besar yang berdomisili di ibukota kabupaten atau propinsi.Sirup daun gaharu Gaharu leaf tea Gambar 5. NTB. Oleh karena itu bentuk pemasaran gaharu di Indonesia lebih cocok dikatakan sebagai pasar “monopsoni”. kelompok masyarakat maupun lembaga. Maluku. ditambah dari daerah Indonesia bagian barat. banyak fihak yang terlibat dalam perdagangan gaharu.

filaria dan Gyrinops diatur perdagangannya oleh konvensi perdagangan internasional yaitu CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) melalui sistem quota. A. Oleh karena kekhawatiran salah satu species penghasil gaharu yang mungkin bisa cepat punah. microcarpa. yaitu konsumen dan produsen. Lalu lintas perdagangan gaharu dalam negeri Beberapa permasalahan yang sering dijumpai di lapangan antara lain: sulitnya menentukan jenis gaharu. lalu lintas perdagangan gaharu di dalam negeri dapat dilihat pada gambar berikut. Demikian pula dari sisi warna dan aroma sangat sulit bagi orang awam atau pedagang pemula untuk dapat memilah-milahnya. maka jenis Aquilaria yang ada. Pemasaran Luar Negeri Secara fisik. . yaitu: A.Secara garis besar. malaccensis. standar dan kualitas serta harga yang layak sehingga menguntungkan bagi kedua belah fihak. Kalimantan Sulawesi Papua Maluku Riau  Sumatera Sumatera Jakarta NTT NTB Surabaya Gambar 6. produk gaharu sulit dibedakan berdasarkan asal jenis tumbuhan dan asal daerahnya. B. A.

Nilai keseluruhan dari gaharu tersebut tidak kurang dari Rp 600 juta. Gaharu dengan kualitas super (superking. produk gaharu yang diperdagangkan ke luar negeri mengikuti selera konsumen. ekspor lebih banyak dilakukan ke negara-negara Asia Selatan untuk digunakan sebagai bahan baku pembuatan minyak wangi dan untuk acara-acara ritual dalam bentuk hio. super A dan AB) umumnya dipasarkan ke negaranegara Timur Tengah untuk digunakan sebagai bahan acara ritual keagamaan. Dalam beberapa tahun terakhir terdapat kecenderungan pembeli dari Taiwan untuk mengimpor gaharu dari Indonesia dalam bentuk log. Kayu gaharu yang bentuknya masih gelondongan dan hanya sedikit mengandung gaharu tersebut digunakan sebagai hiasan yang dipasang di suatu ruangan dengan diberikan sedikit sentuan teknologi ukir sehingga terkesan mewah dan mempunyai nilai seni yang sangat tinggi. wewangian dan aroma terapi. Gambar 7. dapat dilihat beberapa gaharu yang masih dalam bentuk gelondongan yang siap untuk diekspor. Gaharu dalam bentuk gelondongan yang siap dikirim ke Taiwan. makmul dan lain-lain. 17 . Untuk gaharu yang berkualitas menengah ke bawah. Pada gambar 6 berikut.Menurut ASGARIN.

hal ini terjadi karena ditemukannya potensi baru yang sebelumnya luput dari inventarisasi.000 (K) 76.000 (K) 25. filaria sebanyak tujuh kali lipat.000 (R) 455. Dua negara ini pula yang menjadi daerah atau negara tujuan utama ekspor gaharu dari Indonesia.000(K) 326. seperti dapat dilihat pada gambar berikut. misalnya untuk jenis A. malaccensis sebanyak hampir enam kali lipat. filaria.Selama 3 (tiga) tahun terakhir jumlah kuota dan realisasi gaharu yang diekspor sebagaimana dapat dilihat pada tabel berikut. Sedangkan gaharu yang masuk ke Saudi Arabia di distribusikan lagi ke negara-negara lain di sekitarnya dan sebagian lagi di ekspor ke Inggris dan perancis. 18 . Malaccensis 30.000 (K) 65. lonjakan kuota yang signifikan terjadi pada jenis A. Hongkong. dan sebagian lagi ke Timur Tengah. sedangkan untuk A. Tabel 5. Pada tahun 2008. Perkembangan kuota dan realisasi ekspor gaharu Indonesia Tahun 2007 2008 2009 A. realisasi ekspor gaharu untuk ketiga jenis dapat terpenuhi 100% dari kuota yang ditetapkan.890 (R) A.000 (K) - Tabel diatas memperlihatkan bahwa kuota ekspor gaharu pada tahun 2007 dari ketiga jenis yang dapat dipenuhi hanya dari jenis A. filaria 76. Oleh Singapura gaharu yang masuk dilakukan penyortiran dan pengemasan dan kemudian di ekspor kembali ke India.000 (K) 23. dan bahkan untuk Gyrinops realisasi ekspornya hanya mencapai 30% dari kuota yang ditetapkan.000 (K) 8.000 (R) 173.250 (K) 74. Taiwan dan Jepang.000 (R) 65. China. filaria yang banyak terpendam di rawa-rawa di Papua. misalnya Vietnam dan Kamboja.882(R) Gyrinops 24. Menurut sebuah sumber. Pada tahun 2009. malaccensis tidak dapat dipenuhi. pusat perdagangan gaharu dunia yang sangat penting adalah Singapura dan Riyad (Saudi Arabia). Singapura selain mendapat pasokan gaharu dari Indonesia juga dari negara Asia Tenggara.709 (R) 30.000 (R) 25. sedangkan pada A.000 (K) 30. Menurut ASGARIN.

Rekayasa produksi gaharu diarahkan untuk pohon-pohon penghasil gaharu hasil budidaya. Teknik budidaya dimaksud meliputi kegiatan perbanyakan bibit.. sedangkan pohon-pohon penghasil gaharu yang tumbuh secara alami perlu dikonservasi dan dipelihara dengan baik untuk dijadikan pohon induk penghasil anakan. Luka tersebut menyebabkan pohon terinfeksi oleh penyakit (bakteri. 19 . pemeliharaan. (Sulistyo A. penanaman. Secara garis besar proses pembentukan gaharu terdiri dari dua. yang dua-duanya berkaitan dengan proses patologis yang dirangsang oleh adanya luka pada batang patah cabang atau ranting.. Siran) Hongkong Prancis UK India China Japan Malaysia Taiwan Kwait Oman Qatar Saudi Arabia UAE SINGAPORE Bahrain Middle East Riyadh Indonesia Iraq Iran Afrika Gambar 8.. Lalu lintas perdagangan gaharu luar negeri REKAYASA PEMBENTUKAN GAHARU Teknik budidaya perlu dikuasai dengan baik untuk dapat membudidayakan pohon penghasil gaharu. yaitu secara alami dan buatan.. jamur) yang diduga mengubah pentosan atau selulosa menjadi resin atau damar. pemberantasan hama dan penyakit hingga tumbuhan tersebut memiliki volume yang cukup memadai. virus.Perkembangan Pemanfaatan Gaharu .

Eksplorasi.Semakin lama kinerja penyakit berlangsung. Tahapan rekayasa produksi gaharu meliputi banyak kegiatan. 3. Kegiatan yang “berskala laboratorium” dimulai dari kegiatan lapangan. 7. Identifikasi jamur secara molekuler Penyaringan (screening) Uji efektivitas Formulasi media Produksi inokulan (jamur) Pembangunan plot demonstrasi untuk ujicoba di lapangan Observasi dan evaluasi Alur kegiatan rekayasa produksi gaharu secara garis besar dapat dilihat sebagaimana gambar berikut: Gambar 9. 8. kegiatan lapangan dan kombinasi keduanya. dimulai dari kegiatan laboratorium. 4. kegiatan di laboratorium dan kegiatan uji lapangan yaitu: 1. Oleh karena itu untuk dapat mengamati secara langsung proses pembentukan gaharu dilakukan rekayasa dengan cara inokulasi (penyuntikan) jamur atau cendawan pada pohon penghasil gaharu. 5. kadar gaharu menjadi semakin tinggi. 2. Proses pembentukan gaharu di hutan alam sulit dipantau dan diamati. koleksi dan isolasi jamur. Rekayasa pembentukan gaharu dengan inokulasi telah dilakukan oleh banyak fihak. 6. Alur kegiatan rekayasa produksi gaharu. 20 . dengan teknik induksi yang bermacam-macam dan jenis jamur yang bervariasi.

maka secara resmi ke empat jenis isolat tersebut telah di “launching” Menteri Kehutanan (lihat gambar 8) pada Pameran Indo Green yang berlangsung di Jakarta Convention Center (JCC) pada tahun 1999. Berdasarkan bukti-bukti keberhasilan tersebut. Keterbatasan tersebut dimaksudkan hanya kepada masyarakat petani gaharu atau pelaku usaha gaharu yang telah mendapatkan pelatihan dari P3HKA saja yang boleh menggunakan inokulan tersebut.. (Sulistyo A. beberapa isolat lain yang juga cocok dan memberikan hasil yang cukup bagus adalah Jambi dan Kalimantan selatan. Gambar 10. 21 .. Launching tersebut juga dimaksudkan untuk memberikan akses kepada publik agar dapat memanfaatkan isolat tersebut untuk ujicoba produksi gaharu. Siran) Sampai saat sudah berhasil dikoleksi 23 inokulan (isolat) dari sebagian besar propinsi di Indonesia. Diantara isolat tersebut empat isolat sudah diujicoba pada beberapa jenis pohon penghasil gaharu di beberapa daerah dan memberikan hasil yang cukup bagus. Sumatera Barat. Gorontalo dan Papua.Perkembangan Pemanfaatan Gaharu . Launching Inokulan Gaharu oleh Menteri Kehutanan Dengan adanya launching tersebut maka secara resmi inokulan prododuksi Puslitbang Hutan dan Konservasi Alam (P3HKA) telah dilepas di pasaran namun masih terbatas. Berdasarkan pengamatan sementara.. Ke empat isolat tersebut adalah: isolat dari Kalimantan Barat..

Bioinduction : 15 locations Gambar 11. Ujicoba tersebut dilaksanakan di lokasi dengan kondisi yang berbeda. Bogor (Jabar). Lombok (NB). Sijunjung dan Padang Pariaman (Sumbar). untuk mengetahui perkembangan inokulasi. Penyebaran plot inokulasi pembentukan gaharu (gambar bintang warna kuning) Evaluasi dan pengamatan terus menerus dilakukan. Sumsel. jenis asal isolat dan jenis pohon penghasil gaharu yang diinokulasi. Kalimantan Barat.Untuk melihat efektivitas pembentukan gaharu. ujicoba ke enam isolat telah dilaksanakan di 15 (lima belas) lokasi yang tersebar di beberapa propinsi di Indonesia. baik kondisi ekologis. Bangka. yaitu: Bohorok (sumut). jarak titik lubang dan lain sebagainya. 22 . baik kegagalan maupun keberhasilanya. keterbukaan tajuk. Menado dan Seram. Sukabumi. Jambi. Bali. virulensi inokulan yang digunakan. Penyebaran plot inokulasi dapat dilihat sebagaimana gamber berikut. Beberapa faktor penting yang diamati adalah: kondisi kelembaban dan suhu udara. Kalimantan Tengah. Kalimantan Selatan. Carita (Banten).

Tabel 6. Perkembangan hasil inokulasi menurut waktu Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun 2 tahun 3 tahun Kualitas Kemedangan Kemedangan B Kemedangan A teri kacangan tanggung Apabila di sejajarkan dengan kualitas gaharu hasil alam yang ada di pasaran dalam negeri. maka hasil gaharu yang dipanen setelah 3 bulan inokulasi memiliki kualitas kemedangan. dan terus meningkat menjadi kelas teri setelah 1 tahun. Kualitas gaharu tersebut terus meningkat menjadi kacangan setelah 2 tahun inokulasi dan secara signifikan meningkat menjadi tanggung pada 3 tahun setelah inokulasi.Perkembangan Pemanfaatan Gaharu . dengan harapan bahwa gaharu yang akan dipanen tersebut akan mempunyai kualitas` yang lebih bagus lagi dari sebelumnya. 23 . (Sulistyo A.. Menurut rencana pada tahun 2011 akan dilakukan pemanen lagi untuk melihat perkembangan kualitas gaharu.. Pada saat ini pohon yang ditebang secara bertahap tersebut masih hidup dan masih tumbuh baik di lapangan. Contoh gaharu hasil panen yang dilakukan secara bertahap adalah sebagai berikut.. Siran) Perkembangan hasil inokulasi yang dilaksanakan di salah satu lplot penelitian yaitu daerah Sukabumi dari waktu ke waktu dapat dilihat sebagaimana tabel berikut..

24 .Gambar 12. Gambar 13. dengan kualitas kemedangan C. Gaharu hasil panen 3 bulan setelah penyuntikan. Gaharu hasil panen 9 bulan setelah penyuntikan (inokulasi) dengan kualitas kemedangan A.

.. Siran) Grade Kemedangan (US $ 100/kg) Gambar 14. Gaharu hasil panen satu tahun setelah penyuntikan dengan kualitas teri Grade Gubah AB (US $ 200-250/kg) Gambar 15..Perkembangan Pemanfaatan Gaharu .. Gaharu hasil panen dua tahun setelah penyuntikan dengan kualitas kacangan 25 . (Sulistyo A.

000 1.000 200. Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun Harga (Rp) 50. estimasi harga gaharu hasil panen dari plot penelitian P3HKA dapat dilihat sebagai mana tabel berikut. referensi harga gaharu hasil alam di pasaran dalam negeri dan penawaran dari pedagang gaharu dari Riyad (gambar sudut kanan atas). Gaharu hasil panen 3 (tiga) tahun setelah penyuntikan dengan kualitas tanggung Berdasarkan survey pasar.000 26 . Harga gaharu yang cenderung meningkat dengan semakin tertundanya waktu panen.> US $ 800 Gambar 16.000. Tabel 7.000 750.

000 ? Hubungan antara kualitas gaharu... Berdasarkan pemeriksaan laboratorium. waktu penundaan panen dan harga di pasaran sangan erat sekali.000 US$ 800 atau 7.Perkembangan Pemanfaatan Gaharu . Grafik hubungan antara terbentuknya gaharu dengan waktu dapat dilihat pada grafik sebagai berikut. Grafik hubungan antara terbentuknya gaharu dengan waktu penundaan panen. Siran) Umur Setelah Inokulasi 2 tahun 3 tahun 4 tahun Harga (Rp) 2.500.500. Semakin lama proses pembentukan gaharu di pohon maka akan semakin meningkat kualitas gaharu yang akan dihasilkan dan dengan sendirinya akan meningkatkan harga gaharu tersebut. Kualitas Hasil rekayasa Super Tanggung Kacangan Teri Kemedangan Hasil alam 1 Hasil alam 2 Hasil alam 3 Hasil alam 4 1 2 3 4 Tahun 5 6 7 8 9 10 Gambar 17. gaharu hasil panen 9 bulan setelah penyuntikan mengandung zat aktif yang cukup 27 ... (Sulistyo A.

setidaknya terdapat 12 (dua belas) komponen kimia sebagaimana dapat dilihat pada gambar berikut. komponen volatile dan kokoa Dumasin = wangi mint. manis buah & bunga 1 2 3 4 5 Tahun Gambar 18. wangi & warna biru Benzylacetone = wangi manis bunga. Pemeriksaan kandungan kimia pada gaharu hasil alam menunjukkan hasil yang sama dengan gaharu hasil rekayasa jika dua-duanya diambil dari kualitas yang sama. 28 .konsituen utama dalam minyak melati Maltol = wangi caramel (manis). anti inflamantory Ambrettolide = wangi musk. Kandungan kimia yang terdapat pada gaharu hasil rekayasa. memiliki sifat pestisida Cadinene = konstituen minyak esensial berbagai tanaman Limonene = terpen aroma bunga & buah. teh dan daun tembakau Valerolactone = wangi herbal Ambrox = odorant tipe amber. insektisida botani. Azulene = komponen minyak esensial tanaman. bahan kosemtik Isolongifolen = bahan odorant & parfum Indole = wangi bunga & parfum.banyak. penguat rasa/aroma pada roti &kue Komponen Kimia Ketoisophorone = wangi manis campuran kayu.

... pendidikan dan pelatihan. pemberantasan hama dan penyakit). subsistem tengah (penyuntikan. tranportasi. terbukalah peluang yang besar untuk kegiatan pengusahaan gaharu yang dimulai dari subsistem hulu (penyiapan lahan. Untuk dapat mewujudkan kondisi dan harapan tersebut. pengolahan. penanaman. Hanya dengan koordinasi dan integrasi yang baik di antara seluruh komponen masyarakat dan pemerintah. peluang penyerapan tenaga kerja yang besar dan penerimaan asli daerah yang cukup signifikan. peralatan inokulasi. penyediaan inokulan. pemasaran). 29 . penyediaan pupuk. infrastruktur.Perkembangan Pemanfaatan Gaharu . maka seluruh sektor harus memainkan peran sesuai dengan tugas pokok dan fungsinya masing-masing. subsistem hilir (pemanenan. riset dan pengembangan. Siran) PENUTUP Dengan ditemukannya teknologi inokulasi pembentukan gaharu. Ketiga subsistem tersebut di atas memerlukan investasi yang cukup besar. skema kredit dan asuransi). pengangkutan. (Sulistyo A. subsistem pendukung (kebijakan pemerintah. maka produk gaharu akan menjadi produk andalan dimasa depan. penyiapan bibit. dan pengamanan)..

30 .

STATUS RISET GAHARU 31 .

32 .

Aspek PRODUKSI 33 .

.

Dalam pengembangan gaharu. masyarakat di sekitar hutan merupakan sasaran ideal yang dapat melipatgandakan peran dan fungsi program tersebut. kecuali dengan campur tangan manusia. mengingat 35 . Pengembangan gaharu ini perlu dilakukan. Dari aspek keamanan lingkungan dan keragaman hayati. sehingga sangat potensial untuk dikembangkan. sehingga tidak menyebar jauh. khususnya untuk menjaga kesinambungan produksi. sekaligus untuk melindungi ragam pohon penghasil gaharu yang ada di Indonesia. Dari segi keberadaan material bibitnya lokasi sekitar hutan memiliki jumlah tegakan gaharu alam terbanyak. pada umumnya masyarakat yang tinggal di sekitar hutan sudah mengenal gaharu. mengingat buah pohon ini bersifat rekalsitran. Dari segi kesiapan masyarakat. pengembangan gaharu di sekitar hutan juga akan membantu pengamanan keragaman hayati dan kelestarian hutan. sehingga pemahaman dan keterampilannya untuk mendukung pengembangan cluster industri gaharu telah sangat memadai. sebagian bahkan pernah menjadi pengumpul.PENGEMBANGAN GAHARU DI SUMATERA Mucharromah Fakultas Pertanian Jurusan Perlindungan Tanaman Universitas Bengkulu PENDAHULUAN Gaharu merupakan produk kehutanan yang memiliki nilai ekonomi sangat tinggi dibanding produk kehutanan lainnya.

menguatkan tanah. kekurangan air bersih. di samping pemberdayaan dan pemakmuran masyarakat di sekitar wilayah hutan. Dengan demikian. sehingga tidak mudah longsor serta menyerap CO2 dan menghasilkan O2 yang sangat penting dalam mendukung kehidupan. Sejauh ini produksi gaharu Indonesia masih banyak diambil dari alam sehingga disebut sebagai gaharu alam. bangsa. polusi. Bentuk gaharu super sangat beragam. khususnya yang memiliki kualitas super dan di atasnya. Namun demikian. produksi gaharu justru tidak akan terjadi bila pohonnya tumbuh sangat baik dan tidak terganggu sedikit pun. berwarna hitam mengkilat dan berat hingga tenggelam dalam air. Oleh karenanya. dan kekurangan oksigen. dan negara di samping menghindarkan dari bahaya bencana alam kekeringan. khususnya yang berkaitan dengan pendanaan proses produksi yang memerlukan dana cukup besar. Dengan nilai ekonomi gaharu yang sangat tinggi dan permintaan pasar dunia yang terus meningkat. Sementara gaharu 36 . maka pengembangan gaharu sangat berpotensi mensejahterakan masyarakat. longsor. paningkatan temperatur udara. pengembangan gaharu di wilayah sekitar hutan akan memperkuat fungsi hutan tersebut. pengembangan produksi gaharu tidak cukup hanya dilakukan dengan penanaman bibit pohon penghasilnya saja. mengingat pohon penghasil gaharu memiliki morfologi yang sangat mendukung perannya sebagai ’penjaga lingkungan’. Pada pohon penghasil gaharu. tetapi juga perlu didukung dengan pengembangan teknik produksi dan pengembangan sistem yang akan mendukung pengembangan produksi. Gaharu kualitas super sudah mengeluarkan aroma harum meski tanpa dipanasi atau dibakar. dengan tekstur yang sangat keras dan halus tidak berserat. termasuk dari wilayah barat Indonesia atau Sumatera dan dihargai sangat mahal. Selain itu. Gaharu alam telah dikenal sejak ribuan tahun lalu diperdagangkan ke Timur Tengah oleh para pedagang India dan Indo-China.Aspek PRODUKSI masyarakat sudah dapat memperoleh penghasilan dari usaha pengembangan gaharu yang sangat prospektif secara ekonomi. pengembangan gaharu tidak sama dengan pengembangan tanaman pertanian yang dapat langsung menghasilkan. yaitu meningkatkan kapasitas absorbsi dan retensi air tanah.

B. banyak masyarakat di sekitar hutan yang terampil membersihkan gaharu sehingga cukup siap untuk mendukung pengembangan gaharu di daerahnya. Kesiapan SDM Pendukung Proses Produksi Meskipun gaharu sudah sangat lama menjadi salah satu komoditi ekspor Indonesia. namun banyak masyarakat umum yang tidak mengetahui apa yang disebut gaharu. sehingga lebih mampu menjaga keamanan lingkungan dan keragaman sumberdaya alam di sekitarnya. Dengan makin meningkatnya permintaan pasar internasional. maka volume perdagangan gaharu makin meningkat. sehingga membutuhkan banyak tenaga kerja terampil. Dengan upaya ini.Pengembangan Gaharu di ... kecuali masyarakat di sekitar wilayah hutan yang sudah pernah terlibat dalam pencarian. KESIAPAN PENGEMBANGAN GAHARU A. hampir seperti seni memahat. Kesiapan Teknologi Produksi Berbeda dengan produk pepohonan lainnya yang selalu dihasilkan selama tanaman tumbuh sehat atau dengan kata lain 37 . sehingga keberadaan pohon penghasil gaharu juga makin terancam akibat banyak yang ditebangi dan dicacah masyarakat untuk diambil gaharunya. Proses ini sangat lambat. khususnya pada proses pasca panen. Dengan pengalaman mencari gaharu alam yang sudah cukup lama. pembersihan gaharu dari sisa kayu putihnya. maka produksi gaharu Indonesia akan tetap melimpah dan masyarakat yang memproduksinya juga makin makmur dan sejahtera. Kondisi ini tak akan dapat diatasi kecuali dengan melakukan pengembangan gaharu secara besar-besaran. pembersihan... khususnya di area yang paling potensial yaitu wilayah sekitar hutan. dan perdagangan gaharu. Karenanya mereka merupakan kelompok sasaran yang sudah siap menjadi SDM untuk pengembangan gaharu. (Mucharromah) yang memiliki kualitas lebih rendah (kemedangan dan abuk) disuling untuk diambil resinnya dan ampasnya dibuat makmul atau hio untuk ritual keagamaan.

maka teknik produksi inokulan dan induksi pembentukan gaharu dengan inokulasi telah siap untuk dilatihkan kepada masyarakat guna mendukung pengembangan produksi gaharu melalui pemberdayaan masyarakat di sekitar wilayah hutan. Temuan tentang adanya jenis jasad renik yang dapat menginduksi terjadinya akumulasi resin wangi yang selanjutnya membentuk gaharu inilah yang mendasari adanya temuan tentang teknik induksi pembentukan gaharu yang dapat digunakan untuk mendukung proses produksi gaharu dalam skala industri. Santoso et al. Selain itu juga perlu dilakukan teknik pelatihan produksi inokulan sehingga proses produksi dapat berlangsung lebih efisien. Sementara pembentukan gaharu oleh faktor biotik dapat disebabkan oleh infeksi jasad renik terhadap tanaman.d. C.c. 2008. Kesiapan Kontrol Kualitas Produk Untuk keberhasilan dan kesinambungan suatu proses produksi umumnya selalu dilakukan monitoring kualitas produk. 2009). Kebanyakan gaharu justru ditemukan pada pohon yang terganggu. baik pelatihan teknik inokulasi maupun pelatihan teknik monitoring pembentukan gaharu. Namun mengingat teknik yang diterapkan belum biasa dilakukan masyarakat. Kadir. Beberapa kelompok peneliti telah mampu melakukan inokulasi yang merangsang pembentukan gaharu (Mucharromah et al. gaharu justru tidak akan didapat pada pohon yang tumbuh sehat tanpa ada gangguan apapun. Faktor abiotik dapat berupa angin atau hujan angin dan petir. baik secara alami oleh faktor abiotik maupun biotik ataupun telah diinduksi oleh manusia..b. selain akibat gesekan hewan dan perilaku manusia yang tidak direncanakan. Untuk itu penyiapan SDM pendukung pengembangan gaharu juga perlu mempersiapkan personil yang mampu mengenali kualitas 38 .Aspek PRODUKSI produksi merupakan fungsi dari pertumbuhan tanaman sehat. 2008a. 2006.. Namun kejadian pembentukan gaharu oleh faktor abiotik dari alam ini sulit ditiru sehingga tidak dapat dijadikan dasar pada proses produksi dalam bentuk industri. maka untuk persiapan pelaksanaannya dalam proses produksi dibutuhkan pelatihanpelatihan. Dengan dukungan operasional.

mutu ketujuh = setara dengan M3 3. mutu pertama 39 . dengan 3 tanda mutu. dan abu gaharu. mutu TGB/TK2 c. gaharu merupakan jaringan kayu dari pohon jenis tertentu (penghasil gaharu) dengan kandungan resin sesuiterpenoid volatil beraroma harum gaharu yang cukup tinggi. aroma. Selain itu jaringan yang mengandung resin wangi gaharu juga hanya didapati pada bagian pohon yang mengalami proses tertentu. dan tingkat kekerasan dan berat jenis berbeda. kemedangan. Hal ini membuat gaharu menjadi makin mahal dan nilainya sangat ditentukan oleh kualitas kadar dan kemurnian resin yang dikandungnya. Adanya aroma harum yang khas dan tahan lama inilah yang membuat gaharu sangat disukai dan dihargai dengan nilai ekonomi yang sangat tinggi. mutu utama = mutu super b.dan mensortasi atau mengumpulkan gaharu yang dihasilkan berdasarkan gradasi kualitas dan kegunaannya. yaitu gubal gaharu. seperti pelukaan yang disertai infeksi patogen melalui inokulasi atau proses lainnya.1-1999. mutu TGD/TK4 e. Dalam standar ini kualitas gaharu dibedakan menjadi tiga sortimen. mutu TGC/TK3 d. mutu utama b. mutu TGF/TK6 g. dengan 7 kelas mutu. mutu pertama = mutu AB c. mutu TGE/TK5 f. Abu gaharu yang terbagi dalam 3 kelas mutu. yaitu: a. yang terdiri dari: 1. Pada gaharu alam gradasi kualitas ditentukan berdasarkan standar mutu yang telah ditetapkan secara nasional dalam SNI 015009. Ketiga sortimen tersebut dibagi lagi dalam 13 kelas kualitas. yaitu: a. tekstur. mutu kedua = mutu sabah super 2. yang selanjutnya membuat jaringan kayu tersebut memiliki warna. Gubal gaharu. Dari segi bentuknya. Kemedangan. mutu pertama = mutu TGA/TK1 b. yaitu: a.

Namun pembedaan kelas kualitas tersebut secara detil sangat sulit dilakukan sehingga pada prakteknya hingga saat ini konsumenlah yang menentukan tingkat mutu produk dan harga gaharu. mutu kedua. proses pembentukan gaharu telah semakin cepat terjadi. standar kualitas gaharu dan harganya akan lebih terjamin. di mana pemilik barang merupakan penentu harga. di samping lebih besar manfaatnya bagi pengamanan lingkungan dan pemberdayaan serta pemakmuran masyarakat. D. Pada hasil uji lanjut teknik produksi gaharu yang dilakukan beberapa bulan lalu di Provinsi Bengkulu. Teknik inokulasi untuk induksi pembentukan gaharu juga telah makin efisien dan murah. khususnya dari jenis Aquilaria dan Gyrinops. seperti yang telah dilakukan di Kota Bengkulu dan sekitarnya. Hal ini menjadi modal utama yang membuat proses produksi gaharu menjadi jauh lebih 40 . Kesiapan Modal dan Kelembagaan Indonesia merupakan negara yang sangat kaya dengan beragam jenis pohon penghasil gaharu. 2008). Saat ini sudah cukup banyak pohon penghasil gaharu yang telah diinokulasi. Dengan demikian pengembangan gaharu siap dilaksanakan. Pada 6 bulan setelah inokulasi telah dicapai produk kualitas kemedangan TGB dan TGA. Namun pengembangan gaharu di sekitar wilayah hutan kemungkinan akan jauh lebih efisien proses produksinya. yang biasanya baru dapat dicapai pada 12-18 bulan setelah inokulasi.Aspek PRODUKSI c. tidak hanya di sekitar wilayah hutan tetapi bahkan hingga ke halaman rumah dan perkantoran serta sekolah. Perkembangan keberhasilan teknik inokulasi ini sangat prospektif untuk mendukung pengembangan produksi gaharu yang pohon penghasilnya telah mulai banyak dibudidayakan di Sumatera dan wilayah lain di Indonesia. Namun dengan tingkat keahlian sortasi. meskipun sebagian besar masih berada pada mutu TGC (Mucharromah et al. Hal ini merupakan anomali dari kondisi perdagangan komoditi lainnya.. Untuk itu pelatihan SDM dalam teknik monitoring perkembangan pembentukan gaharu dan kontrol kualitasnya sangat penting dilakukan.

satu famili Leguminoceae. 2002). pelatihan monitoring pembentukan gaharu serta upaya produksi gaharu hasil inokulasi. Sejauh ini keberadaan pohon penghasil gaharu di lapangan telah banyak membantu pelaksanaan uji efektivitas inokulasi.. Namun dari 41 . Saat ini pembentukan gaharu di alam telah dilaporkan terjadi pada sedikitnya 16 jenis pohon dari beberapa genus famili Thymelaceae. dan satu famili Euphorbiaceae (Wiriadinata. uji produksi. Selain itu juga diperlukan adanya kerjasama dan komitmen semua pihak untuk membantu mengawali usaha ini berdasarkan expertise dan bidang pekerjaannya. pelatihan inokulasi.3 hingga 14 kg dan umumnya semakin banyak dengan makin besarnya diameter pohon (MacMahon.. proses produksi gaharu sangat ditentukan kuantitasnya oleh jumlah lubang atau luka yang diinokulasi dan kualitasnya tergantung dengan lamanya waktu sejak inokulasi hingga panen.. Dengan demikian.Pengembangan Gaharu di . sebagaimana disajikan pada analisis usaha inokulasi gaharu (Lampiran 1) dan analisis budidaya gaharu (Lampiran 2). maka pengembangan gaharu hasil budidaya dan inokulasi dapat jauh lebih efisien dibandingkan produksi yang mengandalkan gaharu bentukan alam. 1998). Semakin lama maka semakin banyak resin wangi yang terakumulasi dan semakin tinggi kualitas gaharu yang dihasilkan. Di alam tidak semua pohon penghasil gaharu membentuk gaharu atau hanya sedikit sekali menghasilkan gaharu.. (Mucharromah) mudah dan murah. 2008 dan Sumarna. Hal ini membuat proses produksi gaharu alam menjadi kian mahal. Selain itu. Berdasarkan hasil analisis tersebut maka pengembangan gaharu paling efisien bila dilakukan di area sekitar hutan yang masih kaya dengan tegakan gaharu berdiameter > 20 cm yang dapat diinokulasi untuk mempercepat produksi dan menambah modal awal untuk penanaman pada area yang lebih luas untuk kesinambungan usaha pengembangan gaharu. Jumlah gaharu yang dihasilkan per pohon di hutan alam sangat bervariasi dari 0. Namun demikian pengembangan gaharu tetap memerlukan dukungan dana yang relatif besar meskipun rasio keuntungannya terhadap modal juga cukup besar. tidak semua pohon menghasilkan gaharu. Pada gaharu budidaya.

Mucharromah dan Surya. khususnya cendawan pelapuk kayu.000 per kg di tingkat ’end-consumer’ di luar negeri. double super. Saat ini kualitas gaharu hasil inokulasi sudah jauh lebih baik dan pada beberapa hasil penelitian sudah mendekati mutu gubal kualitas kemedangan B/C (Santoso. 2009).Aspek PRODUKSI segi kualitas. 2008. gaharu hasil inokulasi hingga kini belum dapat mencapai kualitas tertinggi gaharu alam. Bila kualitas seperti ini dapat dihasilkan dari inokulasi pohon pada awal proses pengembangan. 2008 . sehingga mampu menutupi pembiayaan untuk pengembangan selanjutnya. Dengan demikian. 42 . Akibatnya jaringan kayu tersebut menjadi halus seperti dilapisi agar dan berwarna coklat kemerahan atau kehitaman. akumulasi resin wangi terjadi maksimal hingga luber dan menutupi sel-sel di sekitarnya.komunikasi pribadi. Sementara kehadiran jenis cendawan lainnya. justru mendegradasi kembali resin gaharu yang sudah dideposisi bahkan hingga menghancurkan selnya sehingga gaharu yang sudah mulai terbentuk menjadi hancur dan lapuk minimal sebagian dan kualitas gaharu yang dihasilkan akan menurun. tergantung intensitas atau kadar resin gaharu yang dikandungnya. dan lebih tinggi. Terbentuknya gaharu kualitas super atau yang sering disebut gubal super ini kemungkinan akan dapat dicapai seiring dengan pengembangan penelitian inokulan unggul yang terus dilakukan. 2006) atau bahkan B (Surya. Secara teoritis keunggulan inokulan dalam menginduksi pembentukan gaharu berkaitan dengan jenis dan kemurnian mikroorganisme yang digunakan. yaitu super. yaitu USD 2. karena kualitas seperti gaharu alam tersebut bernilai sangat tinggi. sebagaimana ditunjukkan oleh data mikroskopis perkembangan deposisi resin gaharu pada area jaringan sekitar lubang yang diinokulasi atau hanya dilukai (Mucharromah dan Marantika. maka penggunaan inokulan unggul dan teknik inokulasi yang meminimalkan kontaminasi akan dapat meningkatkan kualitas gaharu yang dihasilkan dan mengefisienkan proses produksi hingga dapat dilaksanakan dengan modal lebih rendah. maka produksi gaharu selanjutnya tidak banyak memerlukan bantuan modal lagi.000 hingga 16. Pada gaharu kualitas gubal.

dan A. 2009) menunjukkan bahwa pada jaringan yang terkontaminasi resin gaharu yang awalnya berwarna coklat bening kemerahan berubah menjadi berwarna kehitaman dan menghilang sebelum akhirnya selnya menjadi hancur. Pada pengamatan mikroskopis (Mucharromah dan Marantika. Oleh karena itu dalam proses produksi gaharu dengan inokulasi perlu diterapkan prinsip-prinsip aseptik yang akan membatasi peluang terjadinya kontaminasi (Mucharromah et al. hirta. A. Oleh karenanya pengembangan gaharu di wilayah sekitar hutan dengan cara memperbanyak pohon-pohon jenis Aquilaria yang ada di lokasi tersebut dan menginokulasi pohon yang sudah tua untuk membiayai peremajaannya akan dapat mengembalikan potensi produksi gaharu yang dahulu dimiliki Sumatera dan wilayah Indonesia lainnya. agallocha yang banyak dijumpai di Sumatera. 2008).c. Selain karena kandungan resinnya yang jauh lebih tinggi. A. Jenisjenis pohon penghasil gaharu dari spesies Aquilaria malaccensis. 2002). A...b. MODEL PENGEMBANGAN GAHARU DI SUMATERA Secara teoritis akumulasi resin wangi gaharu telah dilaporkan distimulasi oleh infeksi cendawan dari jenis tertentu (Mucharromah dan Surya. dikenal menghasilkan gaharu yang disukai konsumen mancanegara sejak jaman dahulu.. Santoso et al.... maka kualitas gubal super mungkin akan dapat dicapai. 2008). 2008a. microcarpa. aroma resin gaharu juga sangat menentukan kualitas. 2006.. 2006. beccariana. Sumarna. 2007)..Pengembangan Gaharu di . Selain itu kekhasan aroma gaharu juga dipengaruhi oleh jenis pohon penghasilnya dan kemungkinan juga jenis mikro organisme inokulannya. Sejauh ini aroma gaharu alam lebih lembut dibanding hasil inokulasi. kemungkinan karena kemurnian resin yang dikandungnya. sehingga aroma gubal gaharu kualitas terbaik dari berbagai wilayah dapat berbeda (Mucharromah et al. Dengan teknik inokulasi dan jenis isolat yang lebih murni dan potensial serta waktu antara inokulasi dan panen yang lebih panjang. 43 . (Mucharromah) Mucharromah et al.

Selanjutnya pohon yang sudah cukup besar (diameter > 44 . 2004. khususnya pada masyarakat yang tidak memiliki modal dan hanya mengandalkan sumberdaya alam dan keterampilan. Pertama. Sejauh ini telah dilakukan pengembangan gaharu sebanyak > 10. Mucharromah. ketepatan teknik inokulasi. Meskipun gaharu yang dipanen akan menghasilkan produk yang dapat dijual. Oleh karenanya pengembangan gaharu tidak dapat dilakukan secara mandiri. maka kepada masyarakat pemilik tegakan gaharu yang diameternya telah mencapai > 20 cm ditawarkan kerjasama pengembangan gaharu dengan penanaman kembali dan inokulasi. Namun kerjasama ini masih membutuhkan cukup banyak modal untuk menjadi usaha pengembangan gaharu yang mandiri. Selain itu. Oleh karenanya campur tangan pemerintah sangat diharapkan. Oleh karenanya di Bengkulu pengembangan gaharu diawali dengan pengujian efektivitas berbagai isolat cendawan yang berpotensi menginduksi pembentukan gaharu dan diikuti dengan pengembangan inokulan unggul yang masih terus dilakukan untuk peningkatan kualitas. namun untuk pelaksanaan proses panen dan pembersihan tersebut diperlukan modal yang cukup besar. 2005. anakan alam atau bibit harus ditanam dan dipelihara. Dengan demikian maka penggunaan jenis inokulan tertentu dan kemurniannya serta penerapan teknik aseptik dalam penyiapan dan aplikasi inokulan.000 batang yang ditanam di sekitar pohon induk yang diinokulasi. Kerjasama ini meliputi pemeliharaan dan penanaman kembali anakan alam yang ada di sekitar tegakan induk hingga mencapai populasi minimal 10-100 batang tanaman muda per pohon induk diinokulasi untuk produksi gaharu. karena masih harus melakukan panen dan proses pembersihan gaharu yang bersifat padat karya. setelah didapat inokulan efektif dan hasil inokulasi yang cukup menjanjikan.Aspek PRODUKSI Kemampuan cendawan inokulan dalam menstimulir produksi resin juga sangat terkait dengan tingkat akumulasi resin yang merupakan hasil netto dari proses sintesis dikurangi dengan degradasinya serta jenis resin dan kemurniannya (Agrios. dan keterampilan pekerja akan sangat mempengaruhi proses produksi dan kualitas produk. Sebagaimana diuraikan sebelumnya. Langenhein. 2004). pengembangan gaharu memerlukan modal yang cukup besar karena prosesnya cukup kompleks.

Jumlah ini cukup besar dan akan mampu mempekerjakan masyarakat sekitar hutan sebanyak 280 hingga 340 orang/tahun dengan 200 hari kerja/tahun. tetapi dari segi keamanan pekerja dan lingkungan.Pengembangan Gaharu di . sementara gaharu alam akan makin habis. Proses induksi pembentukan gaharu dilakukan dengan memberikan inokulan pada sejumlah besar lubang yang dibuat spiral dengan jarak 7-10 cm horisontal dan 12-20 cm vertikal dari pangkal batang hingga ujung pucuk yang masih bisa dipanjat. untuk membersihkan 1 kg gaharu umumnya diperlukan 4-5 orang hari kerja. sehingga untuk menghasilkan gaharu sebanyak 270 ton sebagaimana jumlah yang diekspor pada tahun 2000-an akan mampu menyerap tenaga kerja sebanyak 56.000 orang/hari. dilakukan proses pembersihan untuk memisahkan gaharu dari jaringan kayu yang lebih sedikit kandungan resin wanginya.000-68. Selanjutnya pohon yang telah diinokulasi dimonitor hingga waktu panen. maka jumlah tenaga kerja yang dikaryakan juga akan semakin meningkat. pengembangan gaharu hasil budidaya dan inokulasi makin lama makin memberikan keuntungan melimpah dan makin ’sustainable’. Selain itu. Dengan peningkatan permintaan dan kapasitas produksi. Proses ini dilakukan secara manual dengan melibatkan sejumlah besar tenaga kerja. maka perlu ada suatu kelembagaan yang bertugas untuk membantu penyiapan dan pelaksanaan proses produksinya hingga berhasil berkembang menjadi industri gaharu yang mandiri.. Dari segi jumlah tenaga kerja yang menangani proses pembersihan produk ini kemungkinan tidak banyak berbeda antara produksi gaharu alam dengan gaharu budidaya.. Oleh karenanya pengembangan gaharu harus dilakukan secara serius. (Mucharromah) 20 cm) perlu diinduksi dengan inokulasi jasad renik atau perlakuan lainnya agar membentuk gaharu.. sehingga upaya-upaya yang dilakukan akan memberi hasil yang berkelanjutan. juga keberanian dan ketersediaan personil dengan kondisi fisik yang mendukung pelaksanaan pekerjaan. sehingga tidak berkelanjutan. mengingat proses produksi gaharu jauh lebih rumit dibandingkan proses produksi komoditi hasil hutan dan perkebunan atau pertanian lainnya.. Setelah dipanen secara total. Pada gaharu hasil inokulasi. Proses inokulasi ini selain memerlukan keterampilan. Kelembagaan tersebut dapat sangat sederhana 45 .

Aspek PRODUKSI bila pengembangan gaharu dapat diberlakukan seperti komoditi pertanian atau perkebunan hasil budidaya. Sejauh ini pengembangan gaharu yang dilakukan di Provinsi Bengkulu. dibuat secara sangat sederhana dengan kontrak kerjasama antara pemilik pohon/lahan dengan pelaksana yaitu perguruan tinggi. Mengingat pohon yang diinokulasi atau bibit yang ditanam berada di lahan pribadi. maka proses pengembangan gaharu yang telah dilakukan sejauh ini berjalan aman. perguruan tinggi dapat memainkan peran yang dapat menguntungkan semua pihak. pengembangan inokulan unggul untuk peningkatan mutu serta pengembangan teknik pengawasan kualitas produk. swasta atau kelompok masyarakat. Dalam hal ini peran perguruan tinggi yang mengembangkan penelitian gaharu dapat dilakukan dalam bentuk pembinaan kelompok produksi gaharu di sekitar wilayah hutan serta penelitian untuk pemutakhiran teknik produksi. baik halaman maupun kebun. Namun bila perdagangan gaharu masih diatur oleh kuota yang dalam proses perdagangannya melibatkan banyak pihak. sehingga cukup menyulitkan meskipun prosesnya sederhana. Bila sudah mencapai tahap produksi. justru akan dapat menghambat pengembangan gaharu yang dituju. penjualan gaharu hingga kini masih memerlukan adanya sertifikasi jumlah untuk memastikan bahwa batas kuota belum terlewati. maka pengembangan gaharu perlu dilakukan dengan melibatkan berbagai pihak yang terkait dengan perdagangannya. baik oleh pihak swasta maupun perguruan tinggi dan kelompok masyarakat. tidak hanya dengan pihak yang dapat membantu pengembangannya. Hal ini dikarenakan upaya pengembangan yang dilakukan masih belum mencapai tahap produksi gaharu yang siap diperdagangkan. Dalam hal pengembangan gaharu. Peran tersebut dapat dilakukan melalui kegiatan penelitian dan pengabdian pada masyarakat yang sudah secara 46 . maka dengan adanya aturan kuota. mengingat wilayah sekitar hutan yang menjadi area pengembangan gaharu umumnya cukup jauh dari lokasi institusi yang mensertifikasi produknya. Hal ini mungkin perlu disederhanakan dalam upaya pengembangan gaharu yang dilakukan. pelibatan banyak pihak ini bila tidak dipayungi dengan deskripsi tugas yang mendetil dan tidak saling tumpang-tindih. Dalam pelaksanaannya.

Plant Pathology. PENUTUP 1. 2. tetapi juga karena upaya ini memerlukan investasi teknologi dan modal yang cukup besar bagi keberhasilannya. polusi. Pengembangan gaharu merupakan suatu program yang sangat besar. 20 Oktober1995. Oleh karenanya pengembangan gaharu perlu dilaksanakan dengan perencanaan yang sangat matang dari setiap tahapan prosesnya sehingga dapat berjalan dan meningkatkan kemandirian masyarakat di wilayah sekitar hutan. sehingga keberhasilannya akan lebih terjamin. Hal ini sangat penting dilakukan. tetapi juga untuk melindungi hutan dan keragaman hayati yang ada di sekitarnya serta meningkatkan kapasitas hutan dalam menanggulangi potensi bahaya bencana alam yang disebabkan oleh longsor. Makalah Dipresentasikan pada Temu Pertama Pakar Gaharu.N..Pengembangan Gaharu di . (Mucharromah) rutin dilakukan perguruan tinggi dengan dukungan pendanaan dari instansi pemerintah maupun swasta. 1988.... 1995. tidak hanya karena menghasilkan produk bernilai ekonomi yang sangat tinggi. 47 . kekeringan. yang berpotensi sangat besar untuk pemberdayaan masyarakat di sekitar wilayah hutan. Anonim. Jakarta. DAFTAR PUSTAKA Agrios. Untuk lebih mengefisienkan proses produksi dan menekan pembiayaan maka program pengembangan gaharu perlu dilakukan dengan mengadopsi model yang paling efisien dan praktis. sebagaimana produk pertanian atau perkebunan dan kehutanan lainnya. Hal ini sangat penting untuk diperhatikan mengingat proses pembentukan gaharu tidak berjalan secara otomatis pada tanaman yang tumbuh sehat. dan beragam kerusakan lingkungan lainnya. tidak hanya untuk menjamin peningkatan dan kesinambungan produksi gaharu. Analisa Penyebab Terjadinya Gubal dan Kemedangan pada Pohon Gaharu. Academic Press. banjir. New York. G.

dan U. 12 Agustus 2008. 48 . Laporan Penelitian Fundamental. Hartal. 18 November 2006. Mucharromah. Rahayu dan E. Santoso. Mucharromah.). ”http://en. Agarwood. Potensi Tiga Isolat Fusarium sp. Updated April 16th. 14-16 Mei 2008. Studi Mekanisme Akumulasi Resin Wangi Aquilaria malaccensis (Lamk. Fakultas Pertanian Universitas Mataram Bekerjasama dengan Balai Pengelolaan Daerah Aliran Sungai Dodokan Moyosari Nusa Tenggara Barat (BP DAS Dodokan Moyosari NTB). Accessed 16 April 2006. Tingkat Akumulasi Resin Gaharu Akibat Inokulasi Fusarium sp. (unpublished). Mucharromah. Lombok. Hipotesa Mekanisme Pembentukan Gubal Gaharu. Makalah Semirata Bidang MIPA.) Merespon Pelukaan dan Infeksi Cendawan. Respon Acremonium sp. Makalah Semirata Bidang MIPA. BKS-PTN Wilayah Barat. DIKTI. Santoso.wikipedia. Mucharromah. Terakhir dimodifikasi 11:11. com/ratrani/ Agarwood.Aspek PRODUKSI Anonim. Nusa Tenggara Barat. N. dalam Menginduksi Akumulasi Resin Wangi Gaharu pada Batang Aquilaria malaccensis (Lamk. Universitas Mataram. Misnawaty.aol. Prosiding Seminar Nasional Gaharu. Hartal. 2006.).). 2005. 2008. Bogor. dan Hartal. White Lotus Aromatics. Mucharromah.org/wiki /Agarwood”. Asal Gaharu terhadap Alginate dan CaCl2. Makalah Seminar. 1998. Teknologi Budidaya dan Produksi Gubal Gaharu di Provinsi Bengkulu. 14-16 Mei 2008. 2008. Universitas Bengkulu. Makalah Seminar Nasional Pengembangan Produksi Gaharu Provinsi Bengkulu untuk Mendukung Peningkatan Ekspor Gaharu Indonesia. Mucharromah. pada Berbagai Waktu Setelah Pengeboran Batang Aquilaria malaccensis (Lamk. Universitas Bengkulu. BKS-PTN Wilayah Barat. http://members.. G. Maryani. 2008. FAPERTA UNIB. html. Bengkulu. 2001. MacMahon. Seameo-Biotrop. dan Surani. Indonesia. C. 31 Oktober 2006. 1-2 Desember 2005. 2008. Fenomena Pembentukan Gubal Gaharu pada Aquilaria malaccensis (Lamk. 2006a. 2006.

Pengembangan Gaharu di . Database Entry For Aquilaria agallocha. Surabaya. E. Santoso. 2006. Skripsi Fakultas Pertanian Universitas Bengkulu. Ngatiman dan Armansyah. dan Y. A Review on Agar (Gaharu) Producing Aquilaria Species. 1-2 Desember 2005. Bogor. Strategi Budidaya dan Pengembangan Produksi Gaharu. Surabaya 11-13 September 2006. Uji Coba Pembentukan Gaharu dengan Cara Inokulasi.K. Makalah Workshop Gaharu Tingkat Nasional. Inc.N. (Mucharromah) Mucharromah dan J.A. 2001. 2006b. L. D. Teknik Inokulasi dan Produksi Gaharu..rain-tree. Kanwil Dephut Propinsi NTB.S. Mulyaningsih.. 49 . L. Seameo-Biotrop. Surabaya 12 September 2006. 2007. Purba. Wahyuno. Sumarna.. Y. Irianto.. Kerjasama Dirjen PHKA dan ASGARIN. T. 1-2 Desember 2005.T. Agustini. Makalah Temu Pakar Gaharu. Parman. Chang and A. 2005.) dan Gubal Gaharu Hasil Inokulasi serta Potensinya untuk Menginfeksi Bibit Gaharu. 2005. Journal of Tropical Forest Products 2 : 272-285. Y. Y. Parman dan T.com/ aquilaria. R. Sumarna. Prosiding Seminar Nasional Gaharu “Peluang dan Tantangan Pengembangan Gaharu di Indonesia”. Bogor. Raintree. Surya. Prosiding Seminar Nasional Gaharu. Mataram.B. 11-12 April 1996.. Makalah disampaikan pada Workshop Gaharu Tingkat Nasional. Ng. Kerjasama Dirjen PHKA dan ASGARIN. Teknologi Budidaya Tanaman Gaharu untuk Menuju Sistem Produksi Gubal Gaharu secara Berkelanjutan. Texas.S. Studi Etiologi Gubal Gaharu pada Tanaman Ketimunan. Austin. 1997.. J. Biodiversitas dan Karakterisasi Jamur Potensial Penginduksi Resin Gaharu. SEAMEO BIOTROP. Date 3/3/06.htm. Azizil. 11-13 September 2006. Sites : hhtp//www. Mulyaningsih. Raintree Nutrition. M.. Identifikasi Genus Cendawan yang Berasosiasi dengan Pohon Aquilaria malaccensis (Lamk. Makalah Workshop Gaharu Tingkat Nasional. 2006.. Turjaman. 1996. Rahman.

30 kg/batang (Kemedangan) Total proyeksi hasil : 50 kg/batang Penjualan kelas BC per batang : 60 kg Penjualan powder : 100 kg/batang No A.307 1 1 50 50 Btg Btg Kg Kg 50 50 25 2 50 50 1. Proyeksi penghasilan Penjualan kelas BC Penjualan powder Total proyeksi penghasilan C. Analisis usaha inokulasi gaharu Waktu inokulasi Jumlah tegakan gaharu Proyeksi hasil : 3 tahun : 1 batang : 20 kg/batang (Kelas BC). Uraian Beban operasional Pembelian batang/tanah Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga ahli inokulasi Tenaga kerja Pemeliharaan/perawatan Operasi lainnya Total A.Aspek PRODUKSI Lampiran 1.500 6.031 10.826 QTY Unit Harga/unit (Rp’000) Total cost (Rp’000) Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.168 50 50 50 1 50 Kg Kg Kg Btg Kg 5 10 5 6 0. 2006 50 . D. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Pengurusan surat-surat Umum lainnya Total Total beban operasi B.000 5 120. Beban panen dan pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total A.250 100 1.000 90 1.2.000 90 1.5 250 500 250 6 25 1.500 200 600 36 300 7.025 104.000 500 120.450 1 1 1 1 1 1 3 1 Btg Btg Set Btg Btg Btg Thn Btg 100 5.500 200 600 12 300 100 5.1. Beban zakat/pajak Proyeksi keuntungan 5% % 60 100 Kg Kg 2.

500 1. Biaya pra operasi (start-up cost) Sarana & prasarana TBM Rumah jaga Sarana penerangan (PLN) Sarana komunikasi Sarana lainnya Total 1 1 1 1 Total biaya (direkapitulasi) Beban operasi Penanaman pohon baru Land clearing Pembelian bibit Pembuatan lubang Penanaman pohon gaharu Pemupukan Perawatan dan pengamanan Total 1 1..1. Analisis usaha budidaya gaharu Waktu budidaya Luas lahan Populasi tegakan Rasio jumlah suntikan Jumlah lubang Proyeksi hasil panen per batang Exchange rate IDR : 7 tahun : 1 ha : 1.000/ha : 80 lubang/kg : 160/batang : 160/80 = 2 kg : 9. Uraian Biaya akuisisi lahan Pembelian lahan Perizinan/sertifikat/notariat Total QTY Unit 1 1 ha Surat* B.000 10 5 10 1 20.000 Harga/ unit (Rp’000) 15.000 1.000 1 1.000 4.000 Total Btg Set Btg Btg Btg Btg 20 3.000 1.000 1.Pengembangan Gaharu di .000 1.000 500 5.000 5.000 4.000 49.000 3.000 1. Beban inokulasi Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga kerja Pemelihaaan/perawatan Operasi lainnya 51 .000 1.000 1..000 6.000 1.000 Unit Unit Unit 2. C.000 A+B C C.000 1 ha Btg Btg Btg Btg ha 1.5 5 24.000 10.000 2.000 1.000 1.000 2.000 10.000 No A.000 Total cost (Rp’000) 15.000 19.2..000 1..000 36.000 24.000 1.000 5.000 1.000 2. (Mucharromah) Lampiran 2.000 25.000 5 1 0.

3. Uraian Beban panen & pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total QTY Unit Harga/ unit (Rp’000) 5 5 10 2 Total cost (Rp’000) 5.000 1.500 D Proyeksi penghasilan Penjualan kelas C 2.000.000 2.4.000 34.000 Total proyeksi penghasilan 5% Proyeksi keuntungan E F Beban zakat /pajak Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.000 20.Aspek PRODUKSI No C.000 Kg Kg Kg Kg 5 10 20 0.000 4.000 1.5 10.000 40.000 190.500 Kg % 2.000 200.609. 2006 52 .000 20.000 4.000 2.000 2.000.000 5.000 Btg Btg Kg Kg C.000 1.000 3.000 71.000 2.000 2. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Umum lainnya Total Total beban operasi 2.000 4.

sebagai pengharum ruangan sembayang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. Sementara itu. Pada prinsipnya. Kalimantan...... mulai dari 300 ribu rupiah hingga 25 juta rupiah untuk kualitas double super. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti 53 . incense.(Eka Novriyanti) 2 KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp. dan Irian (Sumarna.. PADA Aquilaria microcarpa Eka Novriyanti Balai Penelitian Hutan Penghasil Serat Kuok PENDAHULUAN Gaharu adalah komoditas hasil hutan non-kayu yang bernilai ekonomi tinggi dengan harga pasar bervariasi tergantung kualitasnya. Produk ini dihasilkan beberapa spesies penghasil gaharu dalam famili Thymeleaceae. 2000). Indonesia yang merupakan salah satu pemasok gaharu terbesar memiliki kekayaan jenis penghasil gaharu tertinggi di dunia.Kajian Kimia Gaharu . Incense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagaman. 2000). Maluku. meskipun pengunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. Gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut memiliki scent of God’. yaitu 27 spesies dari 8 genus dan 3 famili yang tersebar di Sumatera. pemanfaatan gaharu adalah untuk pengobatan. 2005). dan parfum (Barden et al.

Suhartono dan Mardiastuti. dan lain-lain pengembangan yang masih sangat luas untuk dilakukan. rangsangan fisiologi. 2004). (Hayne. diare. atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Commission GIFNFC. dalam Isnaini. pengembangan senyawa-senyawa dalam gaharu dengan bio-teknologi. akar. Gaharu adalah senyawa fitoaleksin yang merupakan metabolit sekunder dari pohon gaharu sebagai mekanisme pertahanannya. malaria. 2004. Informasi mengenai bahan-bahan kimia yang terkandung dalam gaharu penting untuk pemanfaatan produk ini. obat kuat pada masa kehamilan dan bersalin. liver. 2007). Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. hal ini 54 . informasi jalur biosintetis gaharu itu sendiri sehingga mungkin dapat dibuat sintetis senyawa. stimulan kerja saraf dan pencernaan. antar pohon dalam spesies yang sama. 2002).. Barden et al. pengembangan pemanfaatan lain dengan terbukanya kemungkinan diidentifikasinya senyawa-senyawa baru dengan manfaat yang baru pula. rematik. anti serangga. maupun keadaan cekaman (Goodman et al. dan jaringan luka). antar spesies. kayu teras. 1987. anti mikrobia. hepatitis.. cacar. Konsentrasi metabolit sekunder ini bervariasi antar spesies. tumor. Adelina. diuretic. 1987). 2000. Pohon gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. Arah pemanfaatan informasi kimia gaharu di antaranya adalah penyusunan standar produk berdasarkan komposisi kimia yang dikandungnya sehingga lebih seragam dalam praktek penentuan kualitas produk. Metabolit sekunder atau zat ekstraktif tanaman dapat efektif dalam melawan hama dan agen penyakit karena analog dengan komponen vital tertentu dari sistem sinyal seluler. Namun begitu. 2004). asma. juga memiliki sifat anti racun. 2007). dan bermanfaat untuk mengatasi berbagai panyakit seperti sakit gigi. Metabolit sekunder pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills.Aspek PRODUKSI inflamatory (Trupti et al. 2007). pangkal percabangan. dan antar musim (Forestry Commission GIFNFC. antar jaringan (konsentrasi tertinggi berada di kulit. ginjal. kanker.

asal Bahorok. sedangkan analisis kimia dilakukan untuk sampel berumur ± 1 tahun... Pengukuran luasan infeksi dilakukan pada umur inokulasi 6 bulan. Analisis komponen kimia dilakukan untuk gaharu rekayasa hasil inokulasi isolat Fusarium sp.25 μm). ketebalan film 0. analisis kimia gaharu dilakukan dengan analisis GCMS pirolisis menggunakan aparatus Shimadzu GCMSQP2010. Injeksi dilakukan dalam mode split. namun secara statistik. dan ditahan pada suhu ini hingga menit ke-60. dan perlu dicatat tidak satupun isolat yang origin dari lokasi di mana penelitian dilakukan yaitu asal Carita. microcarpa. daerah asal isolat tidak berpengaruh nyata terhadap luasan infeksi yang terjadi pada batang pohon penghasil gaharu ini.. Mentawai. Kalimantan Tengah Tamiang Layang. dioperasikan dengan electron impact (EI) mode pada 70 eV dan suhu ion source 2000C.. Kondisi kromatografi adalah sebagai berikut: suhu oven kolom 500C. Meskipun secara deskriptif isolat asal Bahorok sepertinya menyebabkan infeksi yang paling besar.8 ml/min) yang dilengkapi dengan kolom kapiler DB-5 MS (60 mm x 0. pada batang A. kemudian increased mencapai 2800C hingga 30 menit. ANALISIS KIMIA GAHARU HASIL INOKULASI ISOLAT DARI BEBERAPA DAERAH ASAL Dalam tulisan ini. namun setelah sekian waktu ternyata pengaruhnya terhadap luasan infeksi menjadi tidak signifikan lagi.Kajian Kimia Gaharu . 55 . Gambar 1 menyajikan luasan infeksi Fusarium sp. dan Maluku. Tidak signifikannya pengaruh asal isolat terhadap luas infeksi diduga disebabkan karena isolat yang diinokulasikan sama-sama Fusarium sp. yaitu isothermal 500C selama 5 menit.25 mm. Identifikasi senyawa dilakukan berdasarkan waktu retensi dan analisis MS.. suhu injeksi 2800C. Meskipun di awal inokulasi masing-masing isolat memperlihatkan kecepatan pembentukan infeksi yang berbeda sesuai virulensinya.(Eka Novriyanti) masih memerlukan pemikiran dan terus melakukan penelitianpenelitian lanjutan yang akan membuka satu demi satu kebenaran yang saat ini masih belum terungkap. Helium digunakan sebagai gas pembawa (carrier) (0.

2002. Sampel yang dianalisi adalah sampel masing-masing dari titik-titik inokulasi dengan jarak suntik 5 cm dan 20 cm. Konishi. Panjang infeksi pada umur inokulasi 6 bulan di batang A. 2005. microcarpa dengan pembeda daerah asal isolat Meskipun secara luasan infeksi tidak menunjukkan pengaruh yang nyata. 2006.. 2003. 2005. 2005. yaitu: 1.Aspek PRODUKSI Gambar 1. namun analisis komponen kimia dari gaharu hasil rekayasa ini menunjukkan adanya perbedaan. Kelompok C: senyawa yang belum dikonfirmasi merupakan konstituen gaharu namun memiliki karakter odorant. Lampiran 1 menyajikan komponen kimia hasil analisis py-GCMS terhadap sampel gaharu inokulasi umur satu tahun. Bhuiyan et al. Kelompok A pada Lampiran 1. Burfield. Kelompok B: senyawa berkarakter odorant namun merupakan hasil pirolisis komponen kayu seperti selulosa dan lignin 3. dengan tanpa membedakan jarak suntik menunjukkan bahwa akumulasi konsentrasi relatif tertinggi untuk konstituen terkonfirmasi (Yagura et al.. Nor Azhah et al. Alkhathlan et al. Lampiran 1 dibagi menjadi 3 kelompok. 2009. 56 . kelompok A: konstituen gaharu yang sudah diidentifikasi pada pekerjaan beberapa peneliti sebelumnya 2. Tamuli. Pojanagaroon dan Kaewrak...

dan Mentawai (11.47%). Mentawai (24.37%).23%). Keberadaan senyawasenyawa odorant hasil pirolisis komponen kayu ini kemungkinan memiliki peran pada kesatuan wangi yang dihasilkan incense gaharu yang dibakar..27%). Secara kuantitas maupun kualitas (komponen kimia terkonfirmasi).. 57 . dan Kalimantan Tengah Tamiang Layang.. Untuk Kelompok C.31%). Maluku.40%)..61%). Kalimantan Tengah Tamiang Layang (12. diikuti masing-masing Maluku (10. dan terakhir Kalimantan Tengah Tamiang Layang (18. Namun kontribusi komponen-komponen berkarakter odorant tersebut terhadap wangi gaharu masih memerlukan observasi yang lebih dalam lagi.Kajian Kimia Gaharu . Bahorok (22.71%).89%.47%). Kelompok B pada Lampiran 1 merupakan kelompok senyawa berkarakter odorant yang merupakan hasil pirolisis selulosa dan lignin.(Eka Novriyanti) 2008) terjadi pada isolat asal Kalimantan Tengah Tamiang Layang sebesar 12. Ditampilkannya fakta tersebut karena penggunaan gaharu pada umumnya sebagai incense yang menghasilkan wangi hanya jika kayu yang mengandung resinnya dibakar. Pola urutan konsentrasi yang sama juga terjadi untuk total konsentrasi relatif komponen berkarakter odorant. Untuk kelompok odorant yang merupakan pirolisis komponen kayu ini. diikuti Bahorok (12. Pengaruh kontribusi senyawa dalam kelompok ini pada wangi gaharu memerlukan investigasi lebih lanjut.96%). Bahorok. maka keberadaan senyawa dalam kelompok B tidak bisa dikesampingkan walaupun bukan merupakan konstituen resin gaharu yang sebenarnya. Dengan kata lain. akumulasi konsentrasi relatif tertinggi dihasilkan oleh isolat asal Maluku (26.14%). Bahorok (10. karena digunakan sebagai incense yang mengumbar wangi saat dibakar. isolat asal Kalimantan Tengah Tamiang Layang memberikan hasil gaharu artifisial yang relatif terbaik yang ditunjukan oleh relatif lebih besarnya infeksi yang terjadi dan akumulasi senyawa gaharu terkonfirmasi tertinggi. konsentrasi relatif tertinggi justru dihasilkan oleh isolat asal Maluku (12. diikuti Mentawai. Perbedaan konsentrasi ini kemungkinan sangat dipengaruhi oleh konsentrasi selulosa dan lignin dari bagian batang yang dijadikan sampel. dan Mentawai (8.

2008). produk ini dibuat sintetisnya dengan menggunakan indole (Wikipedia Online. Komponen ini menyajikan wangi caramel dan digunakan untuk menghasilkan wangi yang manis pada fragrance. Indole merupakan konstituen utama dalam minyak melati dan karena minyak melati ini berharga mahal.. daun tembakau (The Good Scent Company. 2008). Inc. microcarpa yang memiliki karakterisitik odorant penting Komponen Ambrettolide Ambrox Keterangan Senyawa ini memiliki karakter wangi musk. Isolongifolene merupakan bahan yang sangat berguna sebagai odorant dan minyak parfum (Bunke dan Schatkowski. 2008) Ambrox memiliki karakter odorant tipe amber dan juga merupakan anti-inflamatory yang potensial untuk bidang pengobatan (Castro et al. secara umum jarak suntik 5 cm menghasilkan akumulasi konsentrasi yang lebih tinggi. jarak suntik 5 cm dan 20 cm menghasilkan akumulasi konsentrasi relatif masing-masing sebesar 11.11%. 1997).17% dan 12. Valerolactone Ketoisophorone Maltol Indole Isolongifolen 58 .. dan.11% untuk jarak suntik 5 cm dan 20 cm. Komponen dalam gaharu hasil inokulasi berbagai daerah asal isolat Fusarium sp. kecuali untuk isolat asal Kalimantan Tengah Tamiang Layang yang justru lebih tinggi akumulasi konsentrasinya pada jarak suntik 20 cm (Tabel 1). biasanya dimanfaatkan sebagai penguat rasa dan aroma (flavor enhancer) pada roti dan kue (Wikipedia Online. Ketoisophorone mengumbar wangi manis campuran kayu. Secara umum untuk kelompok A. Angka-angka ini tidak jauh berbeda karena diduga konsentrasi komponen kayu yang relatif sama pada pohon-pohon sampel yang relatif berumur sama dan tumbuh pada kondisi yang relatif sama. Senyawa ini memiliki wangi herbal yang dimanfaatkan dalam industri parfum dan pewangi (Wikipedia Online. manis buah. 2008).25% dan 10.Aspek PRODUKSI Untuk komponen gaharu terkonfirmasi (Kelompok A). 2008). dan bunga (International Flavor and Fragrance. 2002). dihasilkan akumulasi masing-masing sebesar 12. pada A. Senyawa ini pada konsentrasi rendah menyajikan wangi bunga dan merupakan konstituen dalam berbagai wangi bunga dan parfum. teh. Untuk kelompok B. Tabel 1.

Limonen merupakan monoterpeneoid yang digunakan sebagai insektisida botani.. Cadinene Dumasin Benzylacetone Azulene Akumulasi total untuk komponen berkarakter odorant menunjukkan bahwa jarak suntik 20 cm (52. yang ditunjukan oleh infeksi yang lebih kecil. Azulene sangat sering ditemukan sebagai komponen dalam minyak esensial tanaman dalam family Asteraceae dan memiliki wangi dan warna biru pada minyak dan ekstraknya (LyndShiveley.23%). selain sebagai bahan kosmetik dan flavouring karena memberi wangi sitrus. ada kemungkinan proses sintesis terjadi lebih cepat dibandingkan jarak injeksi yang lebih besar sehingga dihasilkan senyawa-senyawa baru yang lain yang berkarakter odorant namun akumulasinya belum cukup tinggi saat observasi dilakukan. proses yang lambat ini kemungkinan memberi waktu dan kesempatan bagi senyawa tertentu untuk disintesis atau diakumulasikan hingga diperoleh konsentrasi yang relatif lebih tinggi.. 2008).Kajian Kimia Gaharu . 59 . 2008. Benzylacetone memiliki wangi manis bunga yang merupakan komponen atraktan yang melimpah pada bunga. The Good Scent Company.96% untuk jarak suntik 20 cm dan 5 cm. Geraniol dan limonen juga dimanfaatkan dalam pengobatan herbal dan konstituen dalam berbagai tanaman obat (Wikipedia Online.. 2008). Merupakan material wewangian dan untuk pengobatan serta memiliki sifat pestisida (ChemYQ. Namun. Dikenal juga sebagai cyclopentanone yang memiliki wangi mint. Mann et al. Pola yang sama juga terlihat untuk akumulasi konsentrasi relatif pada kelompok senyawa C. Di pihak lain. Senyawa ini muncul sebagai konstituen minyak esensial berbagai tanaman (Wikipedia Online.. Dengan besarnya spasi injeksi akan menyebabkan proses pembentukan senyawa yang terjadi berlangsung relatif lebih lambat. dengan spasi injeksi yang lebih kecil di mana infeksi terjadi lebih cepat dan lebih besar. 2004).59%) yang menghasilkan konsentrasi relatif lebih tinggi dibandingkan jarak suntik 5 cm (50. 1994. masing-masing 24. juga merupakan komponen volatil pada kokoa (Wikipedia Online. Blake.81% dan 20.(Eka Novriyanti) Komponen Limonene Keterangan Limonene merupakan terpen yang memiliki aroma bunga dan buah. 2008). 2008. Kajian lebih dalam lagi diperlukan untuk mengetahui perkembangan atau perubahan yang terjadi dengan semakin lamanya waktu inokulasi. 2004)..

. Dalam Hua (2001) disebutkan bahwa konsentrasi asetosiringon meningkat 10 kali lipat ketika suatu jaringan aktif tanaman dilukai.Aspek PRODUKSI Hasil analisis py-GCMS juga menunjukkan adanya senyawasenyawa yang pada beberapa hasil penelitian lain disebutkan sebagai senyawa pertahananan. derivat cyclopentane (Wikipedia Onlie. senyawa 4H-pyran-4-one dan derivatnya (Abrishami et a. Koeduka et al. 2008). isoeugenol. dan elimicin (Rossi et al. syringal-dehyde (Pedroso et al. PubChem Compound. Eugenol serta isoeugenol digunakan dalam produksi vanilin yang merupakan bahan penting dalam industri wewangian (Cowan.. 1999). Sedangkan koniferil alkohol merupakan intermediet dalam biosintetis eugenol dan isoeugenol (Cowan.. Fotouhi et al. eugenol (Cowan. 2007). Eugenol. 2008). 2002. 2008).. 1986). dan isometileugenol merupakan empat senyawa fenilpropanoid dari 12 senyawa volatil yang diketahui menyebabkan wangi yang manis pada Clarkia breweri (Rhodes. benzoic acid (NBCI. 2008. 2007... Rho et al. 2006). Senyawa asetosiringon juga tercatat pada semua gaharu hasil inokulasi kelima daerah asal isolat dalam penelitian ini. 2004).. dumasin (ChemYQ. Rhodes. 60 . 2008). metileugenol. 1999. Asetosiringon merupakan bioaktif dalam interaksi tanamanmikroba yang mempercepat pendeteksian kehadiran patogen oleh tanaman di mana konsentrasi senyawa ini meningkat dalam tanaman seiring dengan meningkatnya konsentrasi mikroba (Baker et al. 2008). di mana senyawa ini merupakan fenolik yang dihasilkan tanaman sebagai respon alami terhadap pelukaan (Sheikholeslam dan Weeks. 1999). Beberapa di antara komponen ini bahkan juga memiliki karakter wangi yang diketahui merupakan konstituen minyak esensial dan digunakan secara komersil dalam industri parfum dan pengharum seperti vanillin. 2008). 2000). dan guaiakol merupakan intermediet dalam pembuatan eugenol dan vanilin (Li dan Rosazza.

memiliki sifat antimikrobial (Torssel. 1983. 2008a). Hasil inokulasi Fusarium sp. Letak dan jumlah grup hidroksil pada grup fenol diduga berkaitan dengan daya racun relative-nya terhadap mikroorganisme. 2. minyak esensial. Merupakan dimetil eter dari pirokatekol. deodoran.. Adalah fenol terhidroksilasi yang bersifat toksik pada mikroorganisme. pada A. ekspektoran.(Eka Novriyanti) Tabel 2. contohnya adalah yang terdapat pada Linum usitiltissimum (Sengbusch. Senyawa ini digunakan untuk menghasilkan isoeugenol yang diperlukan untuk membuat vanilin yang juga merupakan bahan yang penting dalam obat-obatan dan industri parfum dan pengharum. microcarpa ditemukan beberapa komponen senyawa yang sudah diidentifikasi merupakan konstituen gaharu dan beberapa senyawa lain yang memiliki karakter odorant dan secara komersil digunakan dalam industri perfumery dan flavoring. 2008). 1999). Pada gaharu rekayasa hasil inokulasi Fusarium sp. Eugenol dan isoeugenol diturunkan dari prekursor lignin. 2000).. Merupakan senyawa pertahanan tipe fitoaleksin yang termasuk dalam grup fenilpropanoid. Merupakan intermediet dalam pembuatan eugenol dan vanilin. Konstituen resveratrol yang diturunkan dari asam p-hidroksisinamat dan 3 unit malonat. yang juga digunakan sebagai antiseptik dan parasitisida (Li dan Rosazza. p:144).Kajian Kimia Gaharu . pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masinng sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. 2008).. dan parasitisida (Wikipedia. Koniferil alkohol Guaiakol Katekol dan pirogalol Veratrol KESIMPULAN 1. 1999). sedatif. di mana daya racun akan semakin meningkat dengan semakin tingginya hidroksilasi (Cowan. Eugenol digunakan dalam pembuatan parfum.. Senyawa-senyawa yang berdasarkan beberapa referensi diketahui merupakan pertahanan pada tanaman tertentu dan terdeteksi pada gaharu hasil inokulasi Senyawa Eugenol Keterangan Bersifat bakteriostatik terhadap jamur dan bakteri (Cowan. yaitu asam ferulat ataupun koniferil alkohol (Rhodes. dan obat-obatan. 61 . Kedua senyawa ini dan turunannya digunakan sebagai antiseptik.

freepatentsonline. Hasnida. Y. Song. United State Patent. A.com [31 Desember 2008]. H. Comparison of Chemical Profiles of Selected Gaharu Oils from Peninsular Malayia. 1997..ars. N. [2 Februari 2007]. B. Chang. 2002. Synthesis of Some Aldoxime Derivatives of 4H-Pyran-4-ones. htm. Y. C. . L. 2008. S. A. A.usda. namun isolat asal Maluku menunjukkan konsentrasi yang relatif lebih tinggi untuk total senyawa dengan karakter odoran. N. D. www. Husni. Secara umum.. D. 2004. Sustainable Agarwood Production in Aquilaria Trees. Teimuri-Mofrad. 2000. Mulliken. J. http://www. http://www. M. A. P.traffic. [22 Mei 2007]. J. The Malaysian Journal of Analytical Sciences 12 (2): 338-340. gov/research/publications/publications. Schatkowski. E. [20 Juni 2008]. Meskipun secara statistik tidak memperlihatkan perbedaan yang signifikan terhadap luasan infeksi yang terbentuk setelah 6 bulan inokulasi..org. asal Kalimantan Tengah menunjukkan konsentrasi senyawa konstituen gaharu terkonfirmasi yang lebih tinggi. Averyanov.3. [21 Juni 2008]. Said. inokulasi Fusarium sp. Stimulatory Effect of Acetosyringone on Plant/Pathogen Recognition. R. http://www. Bayat. Heart of the Matter: Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. Majid.therainforestproject. Shahrisa. A. Robert. Deahl. their Production and their Use. www. naturalhealthwizards. Baker. Blake. A. Mock. Molecules 7: 239–244. S. D. Azah. N. Barden. Yasmin. J. Whitaker. daerah asal isolat menunjukkan perbedaan dalam konsentrasi senyawa-senyawa gaharu yang terbentuk.net. 2006.pdf. DAFTAR PUSTAKA Abrishami. Rice. Blanchette. Bunke. K. A. Mailina. Isolongifolanol Derivates. Anak. M. com/MedicinalPlantConstituents. F. C. S. A. A. M. A. N. R. T. J. 2004 Medicinal Plant Constituents. N. S. Y.

M. L. Phytochemistry 30 (2): 563566. K. 1987. S. M.Burfield. CITES. http://www. Agarwood Chemistry. Plant Products as Antimicrobial Agents. T. T. Sci. A.gov. FAO. http: // treechemicals. E.cfm. Tsuneya. Forestry Commission GIFNFC. J. Tetrahedron 58 (29): 5941-5949. 63 .nsf/0/45BD7B214C6F661E8025699000 5D79C2 [31 Desember 2008]. Electrochem. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. 2005a. Uneyama.. Investigation of Electrooxidation Reaction of Some Tetrahydrobenzo[b]pyran Derivatives.pdf. ChemYQ. Convention on International Trade in endangered Species of Wild Fauna and flora: Amendments to Appendices I and II of CITES. Fotouhi.org/ ag/agn/jecfa-flav/index. 1991. Cowan. 2008.. Fatehi. Heartwood and Tree Exudates. Sánchez. Badan Litbang Kehutanan Jakarta. Hayne. Applied Microbiology 32: 278-281. [2 Februari 2007].com/ Ingredients. Int. 2008.31 pm]. M.html?showSynonyms=1 [ 1 November 2008: 2. Three Sesquiterpenes from Agarwood. M. International Flavor and Fragrance. Clinical Microbiology Review 12 (4): 564-582. http://www. csl. J.chemyq. www. 1999.cites. Dumasin. 2002. hlm: 1467-1469. Synthesis of Ambrox® from Labdanolic Acid. M. 3: 721-726.org. and K. Shiga.iff. S. A. 2008. 2007. M. Berlin: SpringerVerlag. Heravi. Yayasan Sarana Wana Jaya. Food safety and Quality: Flavoruing Index. Salido. Ishihara. W. Hills.com/ En/xz/xz11 [3 April 2008]. M. Chemicals from Trees.fao. Altarejos. Nogueras. Thymelaceae. J. http://www. 2001.cropwatch. Terjemahan dari: Nuttige Planten Van Indonesie. [14 Juli 2007]. Tumbuhan Berguna Indonesia Jilid III. T. 2004. Hua. Succinaldehyde.org/common/cop/13/raw / props/ID-Aguilaria-Gyrinops. 1987. Inc.. S. Castro. http://www.uk/review/extraction.

28 (3): 471-473. M. Biavatti. 2002. Chem. S. Koeduka. Proc. E.ncbi. T. Noel.. C. Biocatalytic Synthesis of Vanillin. Lynd-Shiveley. J. Shimada. Campos. H. [1 Desember 2008]. Kiyosawa. B. M.. S. K. Characteristic Aromatic Constituents of Spices. P. N. 50 (3): 419-422. Benzoic acid. R.cgi?cid=243. Chang. H. Vassão. J. Kim. ISHS Acta Hort 676.actahort. J. B. H.. 2006. Lab. New 5-Hydroxy-2-(hydroxymethyl)-4H-pyran-4one Derivative has Both Tyrosinase Inhibitory and Antioxidant Properties. www. and P. Gang. P. T. Santos. E. N. Dudareva. are Biosynthesized via Reduction of a Coniferyl Alcohol Ester. http://pubchem. T. Pedroso. 1962. S. Kish. Eugenol and Isoeugenol. Steil. Kaewrak. Pojanagaroon. Y. G. Konishi. Program Pascasarjana Institut Pertanian Bogor. Konoshima. M. C. Six New 2-(2-Phenylethyl)chromones from Agarwood. A. Rho. Y. 64 . Lewis. Natl. USA. Applied and Environmental Microbiology 66 (2): 684-687. Baiga. F. D. S. [22 Mei 2007]. Li... Isolation of Syringaldehyde from Mikania laevigata Medicinal: Extract and its Influence on the Fatty Acid Profile of Mice. M. N. Sci. Bull. Kim. Orlova. S.nih. D. of Pharmacognosy 18(1): 63-69. Deschamps.. Microbial Transformation of Terpenes. [20 Juni 2008]. I. D. P. R. 2006. Bull. 2007. A. Spassova. Korean Chem.com. Acad. www. 2004. Y. Nat. F. and I. T. T. You. gov/summary/ summary. Lee. W. L.nlm. C. E. India. Aromaticplant project.Aspek PRODUKSI Isnaini. Barison. 2004. A. Pharm. Mechanical Methods to Stimulate Aloes Wood Formation in Aquiliria crassna Pierre ex H Lec (Kritsana) Trees. 2008. S. Bogor.org. J. NCBI PubChem. Prema. Induksi Produksi Gubal Gaharu melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik (Disertasi). A. Bhattacharrya. Azulene and Chamomile. Rosazza. 2000. Chem. S. Pichersky. D. Fridman. Jackson. Baek. Brazilian Jour. 2008. G. S. J. Soc. W.

Kajian Kimia Gaharu .....(Eka Novriyanti)

Rhodes, D. 2008. Secondary Products Derived from Aromatic Amino Acids: Eugenol and Isoeugenol. www.hort.purdue.edu. [20 Juni 2008]. Rossi, P. G., L. Bao, A. Luciani, P. Panighi, J. M. Desjobert, J. Costa, J. Casanova, J. M. Bolla, and L. Berti. 2007. (E)-Methy-lisoeugenol and Elemicin: Antibacterial Components of Daucus carota L. Essential Oil Against Campylobacter jejuni. J. Agric. Food Chem. 55 (18): 7332-7336. Sengbusch, P. V. 2008. Phenolic Compounds. http://www.biologie. unihamburg. de/b-online/e20/20d.htm. [10 April 2008]. Sheikholeslam, S. N., D. P. Weeks. 1987. Acetosyringone Promotes High Efficiency Transformation of Arabidopsis thaliana Explants by Agrobacterium tumafacien. Plant Molecular Biology 8: 291198. Sumarna, Y. 2005. Budidaya Gaharu. Seri Agribusines. Penebar Swadaya. Jakarta. The Good Scent Company. 2008. Limonene; Ketoisophorone; Syringaldehyde, Tiglaldehyde. http://www.thegoodscents company.com/gca/gc1014951.html [20 Juni 2008]. Torssell, K. B. G. 1983. Natural Product Chemistry. John Wiley & Son Limited. Chichester, New Tork, brisbane, Toronto, Singapore. Trupti, C., P. Bhutada, K. Nandakumar, R. Somani, P. Miniyar, Y. Mundhada, S. Gore, K. Kain. 2007. Analgesik and Antiimflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. Pharmacologyonline 1: 288-298. Vidhyasekaran, P. 2000. Physiology of Disease Resistant in Plant. CRC Press Inc. Boca Raton, Florida. Verpoorte, R., R. van der Heijden, J. Memelink. 2000. General Strategies. In Verpoorte, R. and A. W. Alfermann (eds). Metabolic Engineering of Plant Secondary Metabolism. Kluwer Academic Publisher. Dordrecht, Boston, London. p: 31-50. Wikipedia Online. 2008. Pyrrolidine; Propargyl Alcohol; Ptalic Acid; Mesityl Oxide; Maltol; Indole; Glutanic Acid, Furanone; Elemicin; DABCO; Crotonic Acid; Cadinene; Butyric Acid; Benzylacetone; Caprylic Acid. http://en.wikipedia.org/wiki/. [1 juni 2008].

65

Aspek PRODUKSI

Yagura, T., N. Shibayama, M. Ito, F. Kiuchi, G. Honda. 2005. Three Novel Diepoxy Tetrahydrochromones from Agarwood Artificially Produced by Intentional Wounding. Tetrahedron Letters 46: 4395-4398. Yagura, T., M. Ito, F. Kiuchi, G. Honda, Y. Shimada. 2003. Four New 2-(2-Phenylethyl) Chromone Derivatives from Withered Wood of Aquilaria sinensis. Chem. Pharm. Bull. 51:560-564. Zaika, E. I., R. A. Perlow, E. Matz, S. Broyde, R. Gilboa. 2004. Sub-strate Discrimination by Formamidopyrimidine-DNA Glycosylase. The Jour. of Biol. Chem. 279 (6) issue 6: 4849-4861.

66

Kajian Kimia Gaharu .....(Eka Novriyanti)

Lampiran 1. Komponen dalam gaharu hasil inokulasi Fusarium sp. pada A. microcarpa
Konsentrasi Relatif (%) Nama senyawa 5 cm Bo 20 cm 5 cm Kt 20 cm Me 5 cm 20 cm Mu 5 cm 20 cm

A. Komponen aromatis yang sudah diidentifikasi sebagai konstituen gaharu 4-(2’-Methyl-3’-butenyl) azulene 2,5-DIMETHOXY-4ETHYLBENZALDEHYDE 2-Hydroxy-4methylbenzaldehyde 4-Ethoxy-3methoxybenzaldehyde 4-METHYL-2,5DIMETHOXYBENZALDEHYDE Benzaldehyde, 2,4-dihydroxy Benzaldehyde, 2,4-dimethoxy- (CAS) 2,4-Dimethoxybenzaldehyde Benzaldehyde, 3,4-dihydroxy- (CAS) 3,4-Dihydroxybenzaldehyde Benzaldehyde, 3-hydroxy- (CAS) m-Hydroxybenzaldehyde Benzaldehyde, 4,6-dimethoxy2,3-dimethyl- (CAS) 2,4-Dimethoxy-5,6-dimethyl Benzaldehyde, 4-[[4-(acetyloxy)-3,5dimethoxyphenyl]methoxy]3-methoxy Benzaldehyde, 4-hydroxy(CAS) p-Hydroxybenzaldehyde 1,2-benzenedicarboxylic acid, diisooctyl ester (CAS) Isooctyl phthalate 2-Butanone, 4-phenyl- (CAS) Benzylacetone 2-Butanone, 3,3-dimethyl(CAS) 3,3-Dimethyl-2butanone 0,09 0,09 4,35 0,42 0,06 0,08 0,08 2,37 0,30 0,49 3,66 0,08 0,06 0,21 1,52 0,22 0,07 4,65 0,10 1,45 0,09 4,42 0,11 4,60 0,25 -

-

-

0,32

0,29

0,26

-

0,24

0,28

-

0,37

-

-

0,39

-

-

0,29

-

-

0,36

-

-

-

-

-

-

-

0,37

-

-

0,54

0,48

-

-

0,07

-

0,12

0,43 -

0,23 -

0,44 -

-

0,24 -

0,04

-

0,41 0,04

-

0,53 -

0,05

-

67

Aspek PRODUKSI

Konsentrasi Relatif (%) Nama senyawa 5 cm 2-Butanone, 3-phenyl- (CAS) 4H-1-Benzopyran-4-one, 2-(3,4-dihydroxyphenyl)-7-(. beta.-D-glucopyranosyl) 4H-1-Benzopyran-4one, 2-methyl- (CAS) 2-Methylchromone 4H-1-Benzopyran-4-one, 5,7-dihydroxy-2-methyl- (CAS) 2-Methyl-5,7-dihydroxy 4H-1-Benzopyran-4-one, 6-dihydroxy-2-methyl- (CAS) 6-Hydroxy-2-methylchromone 2-Coumaranone .gamma.-Eudesmol Hexadecanoic acid, 2-(octadecyloxy)-, tetradecyl ester (CAS) TETRADECYL Hexadecanoic acid, methyl ester (CAS) Methyl palmitate 2,4-Hexadienedioic acid, 3,4-diethyl-, dimethyl ester, (Z,Z)- (CAS) CIS.CIS.D 2,4-Hexadienedioic acid, 3-methyl-4-propyl-, dimethyl ester, (Z,E)- (CAS) .alpha.-humulene 1-Naphthalenol, 1,2,3,4-tetrahydro- (CAS) 1-Tetralol 1-Ethynyl-3,4-dihydro-2naphthalenecarbadehyde Phenol, 2,6-dimethoxy- (CAS) 2,6-Dimethoxyphenol Phenol, 3,4-dimethoxy- (CAS) 3,4-dimethoxyphenol Benzenepropanoic acid, methyl ester (CAS) Methyl hydrocinnamate Bo 20 cm 5 cm Kt 20 cm 0,05 Me 5 cm 20 cm Mu 5 cm 0,15 20 cm -

-

-

-

0,18

-

-

-

-

-

0,06

-

0,36

-

-

0,34

-

-

-

-

0,46

-

-

-

-

-

0,04 -

-

-

-

-

0,28 -

0,03

-

-

-

-

0,69

-

0,05 0,85

-

-

0,12

-

0,16

-

0,09

0,17

-

-

-

-

-

-

0,11 0,07

-

-

2,94 0,25 -

0,08 3,37 0,33 -

2,74 0,33 -

3,67 0,40 0,25

3,11 0,24 -

3,05 0,42 -

4,22 0,40 -

2,83 0,22 -

68

50 4.(CAS) Maltol 4H-Pyran-4-one.66 0.74 16.66 0.61 0.58 13..46 1.. 1-(4-hydroxy3-methoxyphenyl).38 0.14 0.30 12.15 4.5.17 0.4A.59 8.04 3.4.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm Propanoic acid.56 0. 3-(2-propynyloxy)-.49 2. Komponen aromatis yang merupakan pyrolisis dari bagian kayu 4H-Pyran-4-one.49 6.28 69 .84 0. ethenyl ester (CAS) vinyl propionate CYCLOPENTANEPROPANOIC ACID.58 0.58 3.96 B.6. 1-hydroxy.2.6.31 - 1. 3-methyl(CAS) 3-methylpyrocathecol 0. 1-(acetyloxy)(CAS) Acetol acetate 2-Propanone.22 0.26 0.28 5 cm Kt 20 cm 0.17 0.(CAS) 5-hydroxy-2methyl-4H-pyran-4-one 2-Propanone.7.25 0.24 Me 5 cm 20 cm Mu 5 cm 20 cm 0. 1-(4-hydroxy-3.95 6.95 10.30 8. anhydride (CAS) Propionic anhydride Propanoic acid.44 - - 12.87 0. 1-ACETYL-2.02 - 0.4.03 - - 0.49 - 0.Kajian Kimia Gaharu .17 5.67 6.79 0.14 0.83 0.12 0.29 0. METHYL Benzenepropanoic acid (CAS) Phenylpropionic acid 3.74 0.19 0. ethyl ester (CAS) ETHYL 3-PROPARGYL Propanoic acid.8A-OCTAHYDRONAPHTHALENE Jumlah Rataan untuk kedua jarak suntik Bo 20 cm 0.(CAS) Acetol Ethanone.94 0.19 0.15 3.20 0.12 5.(CAS) Acetosyringone ACETOVANILLONE Ethanone.12 - 0. 3-Hydroxy-2methyl.57 0.2DIMETHYL-.20 1.60 4.28 8.2-Benzenediol (CAS) Pyrocathecol 1.62 10.66 2.89 9.21 0.99 0.17 0.2-benzenediol.65 - - 0.20 9.3..5dimethoxyphenyl).5.27 0.17 0. 5-Hydroxy2-methyl.27 0.86 1.(CAS) Acetovanillone 1..8-HEXAHYDRO-2HCHROMENE 1.20 0.18 0.55 0.66 0.

19 0.13 0.63 20 cm 1.31 0.14 0.57 2. 3-methyl.47 Mu 5 cm 1.57 0.82 0.(CAS) p -Cresol Phenol. 4-methyl.71 1. 3-methoxy.82 0.52 0. 2-methoxy.31 11.40 5 cm 1.VALEROLACTONE Oxacycloheptadec-8-en-2-one (CAS) Ambrettolide Oxacycloheptadecan-2-one (CAS) Dihydroambrettolide Benzoic acid.70 0.13 0.34 11.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 3-Methoxy-pyrocathecol 4-METHYL CATHECOL Phenol.35 0.36 0.22 0.37 0.14 0.46 0.05 0.18 0.11 1.07 - - - - - - 70 . 4-ethyl-2-methoxy(CAS) p-Ethylguaiacol Phenol (CAS) Izal Jumlah Rataan untuk kedua jarak suntik 1.14 - 0.07 14. 3.5-Trimethoxybenzoic Benzoic acid.(CAS) m-Cresol Phenol.92 0.69 0.18 12.36 13.01 0. 2-methoxy-4-propyl(CAS) 5-PROPYL-GUAIACOL Phenol. Komponen berkarakter odorant lainnya yang belum disebutkan sebagai konstituen gaharu Ascaridole 2H-Pyran-2-one.64 - 0.18 1.12 0.39 13.28 Kt 20 cm 2.82 0.19 0. 4-(methylamino)Benzoic acid.(CAS) Guaiacol Phenol.43 12.64 - 0. methyl ester (CAS) 3.27 1.(CAS) m-Guaiacol Phenol.30 1.35 11.50 0.24 - 0.45 2.4.37 Bo 20 cm 1.52 11.43 1.03 - 0.40 20 cm 1. 6-ethyltetrahydro.89 10.08 0. 2-methyl.DELTA.(CAS) o-Cresol Phenol.4.16 - - 0.(CAS) 6-ETHYL-.40 0.15 0.47 C.87 11.23 Me 5 cm 1.24 0. 4-ethenyl-.35 1.18 0.54 12.39 0.06 - - 0.11 0. methyl ester (CAS) METHYL 4-VINYLBENZOATE 2.23 0.90 0.5-trimethoxy-.06 0.

7-triol.93 0.7.32 1.31 - 0.25 1.(CAS) Eugenol 5-BUTYL-2-VALERYLFURAN 2(3H)-Furanone. m-nitrophenyl ester (CAS) m-Nitrophenyl butyrate Carveol. (3.61 - 4.61 - - - - - - - 0. dihydro-.5. 3-acetyldihydro.5-dihydroxyphenyl)(CAS) Quinacetophenone Phenol.-Cyclocitral Cyclopentanone.33 - 6.45 0.6.84 - 0.(CAS) 2.65 0.42 4.70 0. 1-(2.55 Mu 5 cm 1.22 - - 1.20 71 . dimethylhydrazone (CAS) Cyclopentanone dimethylhydrazone Cyclopropyl carbinol Cyclopentanone (CAS) Dumasin 1-Eicosanol (CAS) n-Eicosanol TRANS-ISOELEMICIN Ethanone.24 - 0. 2-methoxy-4-(1propenyl).).09 Me 5 cm 1..12 - 0.28 1.. beta..beta.98 1.5-furandione.93 - 0..beta.95 0.03 0.93 - 3.22 - 0.beta.(CAS) Isoeugenol Phenol.38 0..76 0.30 0.67 0. 2-methoxy-4-(2propenyl).(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm . (E).45 1.(CAS) 2-acetylbutyrolactone 0.85 - - - - - 0.04 - 0.Kajian Kimia Gaharu .78 Bo 20 cm 0.53 0.. 2-methoxy-4-(1propenyl)-..14 1.38 - 4.alpha. 3-methyl(CAS) Citraconic anhydride Citronellyl acetate .(CAS) (E)isoeugenol Phenol.99 - 4.-bisabolene 2-Butanone (CAS) Mehtyl ethyl ketone Butyric acid.66 20 cm 2.98 Kt 20 cm 0.17 1.6.66 5 cm 0.23 20 cm 0.71 0.51 0.33 - - 0.20 - 4.07 0.beta.26 0. cisCholestane-3.

5.55 0. delta.39 0. 2-methyl.98 0.11 - 0.GAMMA.56 0.76 - 0.31 0.03 - 0.54 - 0.26 - 0.(CAS) 2-methylindole 6-Nitro-5-hydroxy-1. 5-hexyldihydro.64 0.63 - 0.03 0. 1-methylethyl ester (CAS) Isopropyl hexanoate 3-Hexenoic acid 1H-Indole (CAS) Indole 1H-Indole.5-Dihydrodecanoic acid.56 0.06 0.69 - 0.21 0. 5-methyl(identity?) (CAS) 2-Penten-4olide 2(3H)-Furanone.09 - 0.09 - 0.35 - 0.04 0.93 - - 0.25 - - 0.38 0. tetrahydro(CAS) Tetrahydrofurfuryl alcohol 2-Heptanol.59 0. 3-methyl.60 0.14 0. acetate (CAS) 2-HEPTYL ACETATE 2-Heptanone.48 0.23 0.18 0.75 1.54 - 0.54 0.65 - 0.4-Dimethylbut-2enolide 2(5H)-Furanone.51 0.(CAS) 3-Methyl-2-heptanone Hexanoic acid.02 - 72 .66 - 0.5-dimethyl(CAS) 4.13 0.36 0.03 0.2dimethylindole Indolizine (CAS) Indolizin Ionol 2 3-pentanone CAS) Diethyl ketone 1-Penten-3-one (CAS) Ethyl vinyl ketone .21 0.77 0.HEXALACTONE 3.28 0.(CAS) 4-decanolide 2-Furancarboxaldehyde (CAS) Furfural 2-Furanmethanol (CAS) Furfuryl alcohol 2-Furanmethanol.70 - 0.71 0.09 Mu 5 cm 20 cm - - - - - - 0.-lactone Muskolactone Bo 20 cm 5 cm 0.65 0.30 0.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 2(5H)-Furanone.18 Kt 20 cm Me 5 cm 20 cm 0.09 - - - - - - - 0.31 - 0.40 0.74 1.

89 2.34 - 0.(CAS) 6-METHYLPURINE.89 0.47 0.45 3.(CAS) NITROSOPIPERIDINE PIPERIDINE.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm L-isoleucine.58 0.52 0.50 0.13 20 cm 0. 1-nitroso. 6-methyl-9(trimethylsilyl).3.01 0.21 0.(CAS) Syringaldehyde Bo 20 cm 0.17 - 0.20 Me 5 cm 20 cm 0. 1-methoxy-4-methyl(CAS) p-methylanisole NEROLIDOL ISOMER 4-Nonanol.(CAS) N-Acetyl-L-isoleucine 5.6. 1-(1-METHYLPENTYL)3-(2.20 0. 5-methyl(CAS) Orcinol Benzaldehyde..22 0.48 2.21 Mu 5 cm 0.5-DIMETHOXY-PHENYL)PROPIONIC ACID 3-PHENYL-PROPIONIC ACID ISOPROPYL ESTER 2-PROPYNOIC ACID 9H-Purine.5-DIHYDROXYNORBORNANE Piperidine.65 3.3-Benzenediol.50 - 0.(CAS) 4-methyl-4-nonanol 2.21 0.Kajian Kimia Gaharu .13 0.58 73 .57 0.5-dimethoxy.93 - 0. 4-hydroxy3.42 0.52 0.19 0.40 0.86 - 0.04 5 cm 0.19 Kt 20 cm 0.04 0. 4-ethyl.04 0.3-Benzenediol. 4-methyl.11 0.5-Norbornanediol (CAS) 2.15 - 0...57 3.29 - 0..50 5.(CAS) 4-Ethylresorcinol 1.7-dimethoxy-2-methylindan1-one Lineolone METHYL MALONIC ACID p-Menthane-2-one-1. N-acetyl.13 0.6-TRIDEUTERIO-OMENTHONE Benzene.56 - 0. 9-TRIMETHYLSILYL 1.3-d3 (CAS) 2.43 0.70 0.15 0.

13 0.39 1.3DIHYDROFURAN 2(3H)-Furanone.97 0.52 Mu 5 cm 0. 5-methyl(CAS) 5-Methyl-2-oxo-2.27 0.77 0.38 Bo 20 cm 0.hydroxy-2-methoxy.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm (E)-2-hydroxy-4’phenylstilbene 1-TRICOSENE Benzaldehyde.72 0.15 - 0.04 0. 4-hydroxy-3-methoxy.45 0.50 Kt 20 cm 0.14 - 1.23 - - 0.63 - - - - - 0.01 20 cm 0.09 0.20 0.55 0.59 20 cm 0.26 74 .4-dimethoxy(CAS) Vanillin methyl ether Benzaldehyde.(CAS) 2-methoxymandelic acid Benzeneacetic acid. 3. hexahydro3-methylene.(CAS) Vanillin Benzeneacetic acid. 1-(2-furanyl).12 0.13 - 1.(CAS) Zingerone Ethanone.40 5 cm 0.45 - - - - - 0.28 - 2.61 0.02 - - - - - - - - 0.alpha.96 0.alpha.70 - 1.11 0.10 - 0.11 0.5-DIMETHYL-3(2H) FURANONE 2-ETHYL-4-HYDROXY-5METHYL-3(2H)FURANONE 2-HYDROXY-5-METHYL-2(5H)FURANONE 3-HYDROXY-5-METHYL-2(5H)FURANONE 0.48 0.12 0.21 - - 0.17 - 2.32 - - - - - - - - 0.(CAS) 2-Acetyfuran 2-ACETYL FURAN 2(3H)-Furanone (CAS) .14 0.23 - 0. 4-(4-hydroxy3-methoxyphenyl).(CAS) Veratryl alcohol 2-Butanone. . 3.(CAS) 6-HYDROXYCYCLO 2(5H)-FURANONE 2. 4-hydroxy-3methoxy.52 Me 5 cm 0.4-dimethoxy.06 - 0.36 - 1.Furanone 2(3H)-Furanone.(CAS) Homovanillic acid ISO-VELLERAL Benzenemethanol.

Kt = Kalimantan Tengah Tamiang Layang. (2008).6dimethoxyphenol 9H-Xanthen-9-one.86 18. Me = Mentawai.32 37.57 19.83 43. Rossi et al.05 3.34 43.06 Mu 5 cm 20 cm 1. Baker et al. 75 .70 25..52 3.62 0. Bunke & schatkowski (1997).31 17.. (2007).95 0. (2001). Koeduka et al. (2006).23 27.80 2.12 24.95 2. Mu = maluku FAO (2008). 2.10 52.01 44. Azah et al.71 21.18 0. (2007).93 22.65 46. Inc (2008).19 45.81 - 2.10 3. Abrishami et al.14 44.34 46. 1.87 - 1.. (2004).48 49. (2004). Valentines et al.30 45.23 0.33 50.Kajian Kimia Gaharu .33 0.56 Bo = Bahorok. Rho et al.. Zaika et al. ChemYQ (2008). (2005).37 25. Hua et al.23 - - - - 0. Castro et al. (2002). Pedroso et al.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm 5-HYDROXYMETHYLDIHYDRO-FURAN-2-ONE HYDROXY DIMETHYL FURANONE 2-(Acetyloxy)-1-[2-(acetyloxy02-(3-furanyl)ethyl]-5a[(acetyloxy)methyl]hexah 2-Methoxy-4-methylphenol Phenol. Sheikholeslam & Weeks (1987).6-dimethoxy-4-(2propenyl).(CAS) 4-allyl-2.33 26. Lynd-Shiveley (2004). International flavor and fragrance. (2008). (2002).06 - - - 18. (2008).13 0. Fotouhi et al.3-dihydroxy-6-methoxy-8methyl. Wikipedia encyclopedia Online (2008). The Good Scent Company (2008).02 20 cm 1.17 2.30 - Me 5 cm 1.06 2.(CAS) 6-O-METHYLXanthosine (CAS) Xanthine riboside Jumlah Rataan untuk kedua jarak suntik Total Rataan total untuk kedua jarak suntik Keterangan: Referensi: Bo 20 cm 1.65 5 cm - Kt 20 cm 1.29 26.

76 .

chip. Komoditas berbentuk minyak biasanya diperoleh dari penyulingan atau ekstraksi chip gaharu dari kelas yang bermutu rendah. dan minyak gaharu (Surata dan Widnyana. Gaharu telah diperdagangkan sejak ratusan tahun lalu. Maman Turjaman. Irnayuli R. kresna. Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu yang merupakan produk komersil bernilai ekonomis tinggi. Saat ini. Dalam perdagangan internasional. karas. oudh. mulai dari bongkahan.3 TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso. Bentuk perdagangan gaharu beragam. 77 . aloeswood. 2001). di mana China dilaporkan sebagai pembeli utama. Sitepu. Najmulah. Sugeng Santosa. komoditas ini dikenal dengan berbagai nama seperti agarwood. dan masih banyak lagi nama lainnya. meskipun penggunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. perdagangan produk ini di Indonesia pertama kali tercatat pada abad ke-5 Masehi. gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut sebagai ‘scent of God’. jinkoh. sebenarnya merupakan endapan resin yang terakumulasi pada jaringan kayu sebagai reaksi pohon terhadap pelukaan atau infeksi penyakit. serbuk. Ragil Setio Budi Irianto. Ahmad Yani. Menurut Suhartono dan Mardiastuti (2002).

terpicu oleh faktor biotik maupun abiotik. Proses pembentukan gaharu juga membutuhkan waktu yang lama. 2007) dan diketahui bermanfaat untuk mengatasi berbagai penyakit seperti sakit gigi. stimulan kerja saraf dan pencernaan (Heyne. Lain halnya jika pembentukan gaharu dipicu oleh faktor biotik seperti jamur atau jasad renik lainnya. Suhartono dan Mardiastuti. Namun pembentukan gaharu oleh faktor abiotik. diuretic. Terbentuknya gaharu pada tanaman penghasilnya.. Adelina.Aspek PRODUKSI Pada prinsipnya. sebagai pengharum ruangan. di mana selama proses tersebut berlangsung dihasilkan variasi mutu dan pada akhir proses dapat diperoleh gaharu dengan mutu paling tinggi (Sumadiwangsa dan Harbagung. 2000. tidak semua tanaman penghasilnya mengandung gaharu yang hanya terpicu pembentukannya jika terjadi kondisi cekaman. Sementara itu. diare. Penelitian-penelitian ini terutama didorong oleh berbagai hal seperti pasokan komersil untuk gaharu yang masih sangat tergantung dari produksi alam yang karena tingginya intensitas pemungutan produk ini telah menyebabkan tercantumnya genus utama tanaman penghasil gaharu. pelukaan mekanis pada batang. Selain itu. anti mikrobia. 2004. 1987. dan parfum (Barden et al.. mekanisme pembentukan dapat menyebar ke bagian lain pada pohon. oli. Penelitian mengenai berbagai aspek yang terkait dengan gaharu sudah dilakukan sejak lama dan semakin berkembang dewasa ini. 2000). pemanfaatan gaharu adalah untuk pengobatan. incense. Untuk menghasilkan gaharu secara artifisial. seperti yang telah disebutkan sebelumnya tidak menyebabkan terjadinya penyebaran mekanisme pembentukan ini ke bagian lain dari pohon yang tidak terkena efek langsung faktor abiotik tersebut. malaria. pengaruh bahan-bahan kimia seperti metal jasmonat. dan yang lainnya dapat memicu pembentukan gaharu. 2000). gula merah. obat kuat pada masa kehamilan dan bersalin. Barden et al. liver. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti imflamatory (Trupti et al. Gyrinops dan Aquilaria dalam Appendix II CITES. juga memiliki sifat anti racun. rematik.. asma. cacar. karena 78 . kanker. In-cense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagamaan. sembahyang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. ginjal. 2000).. 2002). tumor. hepatitis.

yang diinokulasi di Laboratorium Mikrobiologi Hutan. Kalimantan. microcarpa pada kegiatan ini bahan berupa pohon A. maka kualitas dan kuantitas produk gaharu yang dihasilkan akan lebih memuaskan. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Bogor...Teknologi Induksi Pohon . Bahan Bahan yang digunakan pada kegiatan ini adalah 21 isolat Fusarium spp. BAHAN DAN METODE A. Batang Aquilaria spp. Tabel 1. NTB dan Sulawesi (Tabel 1). Isolat fungi tersebut diperoleh dari batang Aquilaria spp. Isolat-isolat yang diamati No 1 2 3 4 5 6 7 8 9 10 11 Kode Ga 1 Ga 2 Ga 3 Ga 4 Ga 5 Ga 6 Ga 7 Ga 8 Ga 9 Ga 10 Ga 11 Asal lokasi Kalimantan Tengah Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Sumatera Barat Gorontalo No 12 13 14 15 16 17 18 19 20 21 Kode Ga 12 Ga 13 Ga 14 Ga 15 Ga 16 Ga 17 Ga 18 Ga 19 Ga 20 Ga 21 Asal lokasi Lampung Bengkulu Bogor Mentawai Kaltim LK Kalbar Yanlapa NTB Kalsel MIC Kalteng TL Media yang digunakan untuk menambahkan fungi. yaitu Potato Dekstrose Agar (PDA).(Erdy Santoso. Maluku. Dengan terjadinya penyebaran pembentukan gaharu ke jaringan lain pada batang pohon. Inokulasi jenis fungi Fusarium spp. yang telah menunjukkan adanya pembentukan gaharu secara alami. microcarpa 79 . pada A. diambil dari beberapa tanaman gaharu yang terdapat di Jawa. Sumatera... dkk) penyebab mekanisme ini adalah mahluk yang melakukan semua aktivitas yang diperlukan untuk kehidupannya.

C. diinkubasi dengan cara diletakkan pada ruang tertutup yang kelembabannya dijaga dengan cara memasukkan kapas yang telah dibasahi aquadesh steril. B. Rancangan acak lengkap dengan perlakuan daerah asal isolat (I). mata bor ukuran 3 mm. setelah itu koloni yang tumbuh pada gelas obyek diamati di bawah mikroskop setelah preparat diberi zat pewarna.Aspek PRODUKSI umur 13 tahun. Alat inokulasi. Jambi. Identifikasi juga mengamati ciri makrokonidia. semua peralatan yang digunakan disterilkan terlebih dahulu dengan alkohol 70% untuk menghindari adanya kontaminasi dari mikrobamikroba lain. baik secara horizontal maupun vertikal. yang diamati adalah bentuk dan miselium. Untuk pengamatan morfologi dilakukan melalui mikroskop parameter. yaitu Fusarium spp. Sediaan kultur dibuat dengan cara memindahkan potongan kecil isolat fungi menggunakan alat pelubang gabus berdiameter lima mm. Metode Untuk identifikasi masing-masing koloni ditumbuhkan pada media PDA dalam cawan petri. yang diamati adalah ukuran diameter koloni. Sebelum penginjeksian. Sediaan kultur diinkubasi selama tujuh hari. Teknik Inokulasi 1. Untuk fungi pembentuk gaharu asal Gorontalo. genset. dan Padang (Sumatera Barat). kemudian diinokulasi pada suhu kamar dan diletakkan di ruangan inokulasi selama tujuh hari. microcarpa di Hutan Penelitian Carita. Kalbar. Inokulasi Pohon contoh adalah A. terdiri dari bor listrik. Pengeboran dilakukan 80 . Masing-masing isolat diinokulasikan pada 3 ulangan. Jambi (13) dan Padang (14) serta campuran dari keempat isolat tersebut (15). isolat diletakkan pada gelas obyek yang kemudian ditutup dengan cover glass preparat. Kalimantan Barat (12). mikrokonidia serta bentuk konidiofor. diamati juga warna koloni dan keberadaan aerial miselium. dan lain-lain. asal Gorontalo (II). Inokulasi dilakukan pada semua pohon contoh.

cair selanjutnya diinjeksikan sebanyak 1 ml untuk setiap lubang bor di batang pohon.. Pengambilan data dilakukan secara acak pada beberapa titik injeksi inokulasi dan nilai panjang infeksi merupakan rata-rata dari panjang titiktitik infeksi tersebut dalam satu pohon. A Gambar 1. microcarpa. Lubang injeksi dibiarkan terbuka untuk memberi kondisi aerasi bagi mikroba yang diinokulasikan. Keragaman Isolat Fusarium spp. warna koloni dan diameter koloni isolat Fusarium spp.Teknologi Induksi Pohon . HASIL DAN PEMBAHASAN A. Pengeboran batang pohon contoh (A) dan injeksi isolat pada lubang bor (B) B 2. yang berasal dari berbagai daerah sangat 81 .(Erdy Santoso. 1. dkk) dengan kedalaman mencapai 1/3 diameter batang dengan tujuan inokulum cair nantinya mencapai kambium dan bagian floem kayu.. Inokulum Fusarium spp.. yang Berasal dari Berbagai Daerah Karakter morfologi aerial miselium.. Pengamatan dan Pengambilan Contoh Gaharu Pengamatan infeksi dilakukan pada umur inokulasi 2 bulan dan 6 bulan dengan mengukur panjang infeksi vertikal dan horizontal yang terjadi pada permukaaan batang A. Keragaman Morfologi Isolat Fusarium spp.

krem No.++ Warna Medium PDA Putih. ++ Cukup banyak. yang berasal dari berbagai daerah Kode isolat Karakter morfologi Asal lokasi Diameter koloni mm/7 hari Kalteng Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Padang Gorontalo Lampung Bangka Bogor Mentawai Kaltim LK Kalbar Yanlapa Mataram Kalsel MIC Kaltel TL 61 49 48 50 45 38 59 49 59 61 58 58 59 61 56 57 59 58 52 50 69 Aerial Miselium Ada.+ Ada. coklat muda Putih Putih kecoklatan Putih tulang. disebabkan oleh perbedaan asal isolat.+++ Ada.++ Ada. Keragaman morfologi Fusarium spp. Tabel 2. coklat muda Coklat muda Putih Putih Putih Putih krem Putih Putih krem. unggu Putih krem Putih.+++ Ada.+++ Ada.++ Ada. merah muda Putih Putih Coklet. +++ Banyak a.++ Ada. kuning muda Putih Putih. kuning muda Putih.+++ Ada. Keberadaan Aerial Miselium 82 .++ Ada. Keragaman karakter morfologi Fusarium spp.++ Ada. putih Putih.++ Ada. Koloni pada 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 Kelimpahan relatif aerial miselium: + Sedikit.+ Ada.+ Ada.+++ Ada.++ Ada.++ Tidak ada Ada. kuning muda Putih.Aspek PRODUKSI beragam (Tabel 2).+++ Ada.++ Ada.+++ Ada. Tabel 2. kuning.

putih krem (Ga-7. Isolat Ga-10 dan Ga11 memiliki warna koloni putih dan warna cokelat muda (peach). dan Ga-19 (Gambar 2. Isolat Ga-18. dan Ga-16 merupakan isolat dengan kelimpahan aerial miselium sedikit. Ga-11. 2004). dan Ga-21). b. Gambar 3. Ga-19. Selain warna putih. Ga-13. Ga-14. memiliki aerial miselium. Ga-17. Aerial miselium yang terbentuk dengan kelimpahan relatif banyak merupakan mekanisme fototropi terhadap kehadiran cahaya (Irawati. Ga-10. namun terdapat perbedaan antar isolat jika dilihat berdasarkan kerlimpahan relatif aerial miseliumnya. Walaupun sebagian besar isolat Fusarium spp. Ga-9. adalah warna koloni. sedangkan isolat Ga-3. karena pada penelitian semua isolat yang diuji mendapat perlakuan cahaya yang sama. maka perbedaan kelimpahan aerial miselium adalah disebabkan oleh karakter masing-masing isolat. 2006). Namun. keragaman morfologi isolat Fusarium spp. Ga8. Ga-6. dan Ga-20 memiliki warna koloni putih dan kuning muda. Ga-13. Fusarium solani merupakan spesies yang kosmopolit dengan ciri khas kelimpahan mikrokonidianya elips.. Hasil yang diperoleh menunjukkan bahwa warna koloni putih terdapat pada isolat Ga-4. cokelat muda (Ga-2). Ditemukan juga isolat yang memiliki warna koloni yang sangat berbeda dengan isolat lain. Isolat Ga-1. Isolat ga-17 dan Ga-21 memiliki kemiripan warna koloni dengan isolat Fusarium yang berasal dari Riau yang telah teridentifikasi dan merupakan spesies Fusarium solani (Luciasih et al. yaitu warna hifa miselium didominasi 83 . Ga-6. Isolat yang tidak memiliki aerial miselium dijumpai pada Ga-15 asal Mentawai. Ga-10. beberapa isolat memiliki warna putih dan warna kuning muda pada isolat Ga-1. Irawati (2004) melaporkan bahwa secara umum cendawan yang ditumbuhkan pada kondisi terang secara terus-menerus akan membentuk aerial miselium relatif lebih banyak. Ga-12. Warna Koloni Selain aerial miselium. dan Ga17 memiliki kelimpahan aerial miselium relatif banyak (Tabel 2). Ga-5. dan Gambar 4).Karakter aerial miselium terdapat hampir pada setiap isolat Fusarium spp.

Untuk mengetahui kemampuan virulensi. Ga-7. Gambar 2. memiliki keragaman pada karakter morfologi juga tampak adanya keragaman karakter mikrokonidia dan makrokonidia dari isolat yang diuji. Ga-14. Semua isolat yang diuji dapat diklasifikasikan menjadi tiga kelompok. Ga-11. c. Gambar 3. Cendawan yang tidak berpigmen umumnya berwarna hialin. Ga-9. Jumlah septa makrokonidia dominan berjumlah 2-3 yang dimiliki oleh isolat Ga-1. Ga-7. Namun. dan isolat dengan diameter lebih dari 50 mm (isolat Ga-1. Selain itu. Ga-16. Ga-12. misalnya terhadap inangnya. Ga-17. Ga-18. Ga10. berkisar antara 30-69 mm. dan kelimpahan mikrokonidia. Keragaman diameter koloni Fusarium spp. berhubungan dengan kecepatan tumbuh hifa. Fusarium spp. Keragaman yang terdapat pada warna koloni berhubungan dengan pigmen yang dikandung oleh dinding sel hifa. maka isolat perlu diuji. dari ke-10 isolat tersebut terdapat perbedaan pada 84 . Ga-3. Ga-20. Ga-6. Ga-18. Hasil pengamatan menunjukkan bahwa keragaman terlihat pada karakter jumlah septa makrokonidia. isolat dengan diameter antara 40-50 mm (isolat Ga-2. Pada beberapa isolat Fusarium. percabangan konidiofor. Ga-8. Ga-19. diperoleh adanya hubungan yang erat antara kecepatan tumbuh hifa dengan kehadiran aerial miselium. Ga-10. Ga-4. Keragaman Mikro dan Makrokonidia serta Konidiofor Isolat Fusarium spp. Ga-13. Ga-5. dan Ga-21) (Tabel 2. Ga-3. bentuk. 2. dan Ga-21. Ga-8. Kecepatan tumbuh yang tinggi dapat berhubungan juga dengan kemampuan virulensi. Diameter Koloni Diameter koloni Fusarium spp. yaitu diameter kurang dari 40 mm (isolat Ga-6). Ga-5. Ga-15. dan Ga-20).Aspek PRODUKSI oleh warna ungu namun memiliki warna koloni putih sedikit tipis pada aerial miselium yang terletak pada bagian tepi koloni (Gambar 3). dan Gambar 4). Diameter koloni merupakan veriebel yang berhubungan erat dengan kecepatan tumbuh. kecepatan tumbuh merupakan karakter yang khas pada setiap isolat.

Ga-11. Keragaman morfologi Fusarium spp. Ga-6. dan Ga16) umur tujuh hari pada medium PDA. Sedangkan isolat Ga-1. 85 . dan Ga-8) umur tujuh hari pada medium PDA Gambar 3. Isolat dengan konidiofor bercabang adalah Ga-18 dan Ga-21... Ga-8..Teknologi Induksi Pohon . Ga-15. Ga-6. Ga-10. (isolat Ga-1. Ga-7. Ga-3. Ga-3. Ga-14.. Ga-12. Ga-4. Ga-5. (isolat Ga-9. GA-7. Gambar 2. Keragaman morfologi Fusarium spp. Ga-5. dkk) percabangan konidifornya. dan Ga-10 memiliki konidiofor sederhana (Tabel 3).(Erdy Santoso. Ga-13. Ga-2.

Keragaman karakter makrokonidia Fusarium spp. sekat Elips Elips Elips Elips Elips Elips. Ga-3. yang berasal dari berbagai daerah Karakter histologi No Kode Makrokonidia Jumlah septa 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 3 4 3 4-7 2 3 2 2 5 3 4 5 4 7 4 7 5 3 4 2 3 Konidiofor Simpel Bercabang Simpel Simpel Simpel Simpel Simpel Simpel Simpel Simpel Bercabang Simpel Simpel Simpel Bercabang Simpel Bercabang Bercabang Simpel Bercabang Bercabang Mikrokonidia Kelimpahan Banyak Banyak Banyak Banyak Sedikit Sedikit Sedikit Sedikit Sedikit Banyak Banyak Banyak Sedikit Sedikit Banyak Sedikit Sedikit Banyak Banyak Sedikit Banyak Bentuk Elips Elips. namun dari ke-3 isolat tersebut dapat dibedakan berdasarkan 86 . Ga-20. sekat Elips. lonjong Elips. dan Ga-15 memiliki jumlah septa empat. Keragaman morfologi Fusarium spp. oval Elips Elips. oval Elips Isolat Ga-2. oval Elips. dan Ga-21) umur tujuh hari pada medium PDA Tabel 3. Ga-18. (isolat Ga-17. oval Elips Elips.Aspek PRODUKSI Gambar 4. Ga-19. oval Elips. sekat 3 Elips Elips Elips Elips.

Luciasih et al. Isolat Ga-14 berbeda dengan isolat Ga-16 karena pada isolat Ga-16 mikrokonidianya bersekat (Gambar 7). F. dkk) percabangan konidifor dan bentuk mikrokonidianya. bentuk mikrokonidianya elips dan oval. dan F. Ga-7. solani (isolat Ga-4. Genus Fusarium memiliki kemiripan dengan Cylindrocarpon pada karakter morfologi. solani dengan mikrokonidianya berbentuk elips. Di antara ketiga spesies tersebut F.. yaitu berbentuk bulan sabit (fusoid) sehingga memungkinkan dapat dengan mudah dibedakan dengan genus lain yang memiliki ciri mirip Fusarium. Fusarium solani berbeda dengan F. Mikrokonidia pada berbagai Fusarium memiliki bentuk yang khas. tricinctum (isolat Ga-2. Ga-6.. dan Ga-16 merupakan isolat yang memiliki jumlah septa makrokonidia relatif banyak. yaitu isolat Ga-12 dan Ga-14 memiliki kemiripan pada bentuk konidiofor dan bentuk mikrokonidia.(Erdy Santoso. solani keberadaannya paling dominan sehingga perlu mendapat perhatian khusus. namun kedua isolat tersebut berbeda pada tipe makrokonidianya. dan Ga9). Isolat Ga-12 memiliki ukuran relatif lebih besar pada makrokonidianya apabila dibandingkan dengan Ga-14 (Gambar 5 dan Gambar 6). sambunicum. (2006) melaporkan bahwa keragaman antar Fusarium spp.Teknologi Induksi Pohon . Ga-3. namun Booth (1971) membedakan Cylindrocarpon karena karakter pangkal konidianya yang relatif tumpul dan tidak memiliki hock/foot cell yang jelas seperti pada Fusarium spp. Spesies tersebut merupakan F. juga bentuk mikrokonidianya relatif lebih besar untuk F. Sedangkan F. dan Ga-5).. Cowan (1999) menerangkan bahwa tanaman memiliki kemampuan yang tidak terbatas dalam mensintesis substansi 87 . beberapa isolat telah teridentifikasi sampai pada tingkat spesies. sambunicum (isolat Ga-1). Isolat Ga-13 memiliki bentuk konidifor simpel dan Ga-15 bentuk konidifornya bercabang. yaitu berkisar 5-7 (Tabel 3). tricinctum berdasarkan karakter bentuk makrokonidianya... solani dibedakan dari F. dari 21 isolat Fusarium spp. Isolat Ga-12. Isolat Ga-2 memiliki konidifor bercabang. Dua dari tiga isolat tersebut. Ga-14. antara lain berdasarkan karakter kelimpahan dan bentuk mikrokonidianya. Ga-8.

Ga-17. Ga-9. Ga-20. Pada umumnya senyawa-senyawa tersebut merupakan metabolit sekunder yang seringkali berperan dalam mekanisme pertahanan tanaman terhadap serangan mikroorganisme. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. (isolat Ga-4. Ga. Ga12. Ga-11. (isolat Ga-1. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp.2. Ga-5. GA-10. Ga-15. dan Ga-18) dengan perbesaran 40x 88 . serangga ataupun herbivora. GA-7. dan Ga-21) dengan perbesaran 40x Gambar 6. Gambar 5.Aspek PRODUKSI aromatis yang kebanyakan merupakan senyawa fenol atau turunan oksigen-tersubstitusinya. Ga-14. Ga8.

dan Ga-19) dengan per-besaran 40x Gaharu merupakan senyawa fitoaleksin dari pohon gaharu sebagai mekanisme pertahanannya terhadap infeksi patogen. fitoaleksin sebagai agen anti mikrobial (sesqui-.. Ga-13. dkk) Gambar 7. atraktan serangga. Fitoantisipin adalah senyawa aktif anti mikrobial yang telah terdapat pada tanaman. Ga-6. 2000). Metabolit sekunder dalam sistem pertahanan tanaman. Terdapat jalur biosintesis yang terpicu pada level gen setelah pelukaan atau infeksi dan ada yang terjadi pada level senyawa. dan triterpena). 2004).Teknologi Induksi Pohon . di-. Berdasarkan berbagai fungsi tersebut. memainkan peranan penting (Verpoorte et al. 2000). Kayu beresin ini merupakan metabolit sekunder yang dibentuk tanaman sebagai respon pertahanan. 2004). dalam Isnaini.. kadangkala terpicu pengaktifannya saat pelukaan.. Metabolit sekunder tanaman yang diturunkan dari terpenoid memiliki berbagai fungsi dalam tanaman. Vidhyasekaran. Sebagai contoh. Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. di mana senyawa yang telah ada secara enzimatis dirubah menjadi senyawa aktif ketika pelukaan.(Erdy Santoso.. ekspresi dari jalur biosintesis yang terlibat akan berbeda. Ga-16. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. 2000. Fitoaleksin adalah senyawa aktif anti mikrobial yang diproduksi secara de novo setelah pelukaan atau infeksi. biosintesis sesquiterpena tertentu pada solanaceae terpicu oleh infeksi mikroba.. Biosintesis keduanya terpicu pada level gen (Verpoorte et al. Pohon penghasil gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini.. (isolat Ga-3. sedangkan pada tanaman lain biosintesis sesquiterpenoid 89 . baik fitoantisipin maupun fitoaleksin. di antaranya sebagai minyak esensial (monoterpenoid). rangsangan fisiologi maupun keadaan cekaman (Goodman et al.

2007). Senyawa kimia yang dimiliki pohon merupakan salah satu upaya pertahanan pohon terhadap mikroorganisme penyebab penyakit. Dalam hal pembentukan gaharu tentunya diharapkan penyakitlah yang akan menang. Daya tahan pohon akan menentukan pemenang antara pohon dengan penyakit yang disebabkan mikro-organisme tersebut. dan warna pada kayu. B. dan jaringan luka). Analisis Infeksi Batang Dalam kondisi menghadapi infeksi oleh jamur. karena analog dengan komponen vital tertentu dari sistem sinyal seluler atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Comission GIFNFC. Zat ekstratif yang terdiri dari bermacam-macam bahan ini memilki fungsi yang penting dalam daya tahan terhadap serangan jamur dan serangga. sehingga dihasilkan produk gaharu yang diinginkan. memberi bau. kayu teras. senyawa pertahanan tipe fitoaleksin. Zat ekstratif pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. Kerentanan pohon dalam menghadapi infeksi jamur akan berkaitan dengan 90 .Aspek PRODUKSI merupakan ekspresi pembentukan yang umum. Gaharu sendiri telah diidentifikasi sebagai sesquiterpenoid. antar spesies. misalnya pada Morinda citrifolia. dan antar musim. rasa. akar. pohon penghasil gaharu akan memberi respon untuk mempertahankan dan memulihkan dirinya. antar jaringan (konsentrasi tertinggi berada di kulit. pangkal percabangan. Metabolit sekunder tanaman efektif dalam melawan hama dan agen penyakit. anthraquinone biasa ditemukan di seluruh bagian tanaman (Verpoorte. antar pohon dalam spesies yang sama. 2000). 1987). Jenis-jenis tropis dan sub-tropis umumnya mengandung jumlah ekstratif yang lebih banyak dibanding jenis-jenis di daerah temperet (Forestry Comission GIFNFC. Rowell (1984) menyatakan bahwa di antara fungsi zat ekstratif adalah sebagai bagian dari mekanisme sistem pertahanan pohon terhadap serangan mikroorganisme. 2007). Metabolit sekunder pada kayu dapat disebut sebagai zat ekstratif. Konsentrasi metabolit sekunder bervariasi antar spesies.

193a inokulasi 2 bulan. dkk) gaharu yang terbentuk. Hasil uji lanjut Duncan memastikan bahwa pada dua bulan sejak inokulasi.05 dan campuran. Berbeda dengan kondisi pada Tabel 4.. Namun sama Padang 2. asal Gorontalo memperlihatkan nilai infeksi yang paling besar.(Erdy Santoso. diikuti oleh isolat campuran (Tabel 4). pada umur inokulasi 6 umur inokulasi bulan. Pada Gambar 8 terlihat panjang infeksi yang terjadi pada batang pohon A.857a lagi memberikan pengaruh nyata Jambi 2. terlihat bahwa asal isolat berpengaruh nyata terhadap panjang infeksi yang terjadi pada batang A..133a terlihat bahwa infeksi tertinggi masih Keterangan: Nilai yang diikuti oleh huruf yang disebabkan oleh isolat asal Gorontalo sama tidak berbeda nya-ta pada 0.13 cm diikuti oleh isolat campuran. microcarpa. Dari hasil analisis sidik ragam.Teknologi Induksi Pohon .223a terhadap infeksi yang terbentuk pada Kalimantan Barat batang A. Kalbar. isolat asal Gorontalo menyebabkan infeksi yang paling besar pada batang pohon penghasil gaharu. secara statistik asal isolat tidak 1.297a halnya dengan kondisi pada umur Campuran 3. Pada umur inokulasi 2 bulan isolat Fusarium spp.. dan yang terendah adalah infeksi yang terbentuk oleh isolat asal Jambi. dari Gambar 8 Gorontalo 4. yaitu 4. isolat campuran menyebabkan infeksi yang lebih tinggi dibandingkan Asal isolat Rataan isolat yang lain (Gambar 8). microcarpa. microcarpa pada umur inokulasi 2 bulan dan 6 bulan. Padang. Uji lanjut Duncan untuk infeksi 2 bulan umur 2 bulan.. Pada saat (Isolate origin) (Mean value) ini. 91 . dapat direfleksikan masing-masing oleh besar infeksi dan komponen kimianya.

Laju infeksi pada batang A. Namun begitu. tetapitidak mengalami perkembangan.186 pada 5%). secara statistik untuk bulan keenam inokulasi. microcarpa Gambar 8. Meskipun masih dua merupakan isolat yang menyebabkan infeksi terbesar. Panjang infeksi batang A. Meskipun terjadi 9 menunjukkan perubahan panjang infeksi yang terjadi sejak masihbulan inokulasi hingga bulan keenam. Gambar 9 menunjukkan perubahan panjang infeksi yang Gambar 9.bentuk pada batang A. tetapi infeksi bulan keenam oleh isolat asal Gorontalo terlihat infeksi merupakan isolat yang menyebabkan infeksi terbesar. dari Gambar 8 Aspek PRODUKSI terlihat bahwa infeksi tertinggi masih disebabkan oleh isolat asal Gorontalo dan campuran. asal daerah isolat tidak memberikan pengaruh nyata pada laju infeksi yang terjadi (nilai signifikansi 0. sedangkan infeksi oleh keempat asal isolat yang 71 | lain menunjukkan peningkatan yang beragam. microcarpa 92 . Namun sama halnya dengan kondisi pada umur inokulasi 2 bulan. huruf yang sama tidak berbeda nya- Gambar 8. microcarpa Gambar sejak dua bulan inokulasi hingga bulan keenam. mita pada 0. Gorontalo terlihat tidak mengalami bulan keenam oleh isolat asal sedangkan infeksi oleh keempat asal perkembangan.05 crocarpa. Panjang infeksi batang A.

Hasil inokulasi Fusarium spp. dkk) Perkembangan infeksi yang terjadi hingga 6 bulan setelah inokulasi menunjukkan asal daerah isolat tidak lagi memberikan pengaruh yang nyata. namun ada kemungkinan hal ini masih merupakan pengaruh dari isolat asal Gorontalo tersebut. Uji perbedaan kecepatan tumbuh menunjukkan bahwa isolat Ga9. namun terdapat warna koloni merah muda. pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masing sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. jadi sebaiknya isolat ini digunakan untuk inokulasi 93 . kuning. dan ungu. kekonsistenan perkembangan infeksi sebaiknya diteliti lebih lanjut dengan mengikuti perkembangan laju infeksi oleh isolat asal Gorontalo ini hingga kurun waktu tertentu. Meskipun tetap menyebabkan infeksi yang besar. memiliki karakter makrokonidia bersepta 3-4 dan makrokonidia didominasi oleh bentuk elips. Isolat Fusarium spp. dan Ga-17 merupakan isolat yang memiliki kecepatan tumbuh tinggi apabila dibandingkan dengan isolat Fusarium yang lain.Teknologi Induksi Pohon .. asal Gorontalo menyebabkan infeksi yang paling besar. yang berarti isolat ini menghasilkan kuantitas gaharu yang paling besar. Secara morfologi isolat Fusarium spp.. Meskipun isolat campuran menunjukkan panjang infeksi yang lebih tinggi saat 6 bulan setelah inokulasi.. Secara histologi isolat Fusarium spp. Dari perkembangan infeksi pada pohon A. Ga-11. KESIMPULAN 1. 4.(Erdy Santoso. meskipun yang terbesar masih disebabkan oleh isolat campuran dan isolat asal Gorontalo. 3. didominasi warna putih. Hal ini diduga ada kaitannya dengan pertahanan masing-masing pohon contoh.. 2. Hampir semua isolat memiliki aerial miselium. microcarpa ini dapat dikatakan bahwa isolat asal Gorontalo menyebabkan infeksi yang terbesar.

M. A. 2006. Wahyuno. DAFTAR PUSTAKA Adelina. The Genus Cylondrocarpon. microcarpa jika diinginkan hasil gaharu dalam jumlah besar. Booth. (England : Commonwealth Mycological Institute). Teresia. pp. and S. Berlin : SpringerVerlag. Washington : American Chemical Society. 2004. Jurnal Penelitian Hutan dan Konservasi Alam III(5):555-564. (1987). 2001. 1987. pp. Jakarta. pp. Badan Litbang Kehutanan. [14 Juli 2007]. A. Irawati. Heart of The Matter Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. D. Tumbuhan Berguna Indonesia. N. 120-127. E. Induksi Produksi Gubal Gaharu Melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik. W.uk/review/extraction. Seed Leaflet : Aquilaria malaccensis Lamk. csl. Plant Products as Antimicrobial Agents. [2 Februari 2007]. 1984. Hills. www. C. Forestry Commission GIFNFC. Bogor Luciasih. 94 . Program Pascasarjana Institut Pertanian Bogor. Santoso. Rm. Karakterisasi Mikoriza Rhizocstonia dari Perakaran Tanaman Vanili Sehat. Pusat Litbang Hutan dan Konservasi Alam.dk. Nooranie. Michael (2000). M. Applied Microbiology 32 : 278-281. dan E.cfm.Aspek PRODUKSI pada A. 2007. Bogor. Isnaini. Hua SST. Rowell. 2. Y. 1999. http: // treechemicals. 2004. 6-7.A. 267-269. K. Jilid III. Cowan. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. 2004. The Chemistry of Solid Wood.. Heartwood and Tree Exudates. gov. Disertasi)..kvl. Keanekaragaman Jenis Jamur yang Potensial dalam Pembentukan Gaharu dari Batang Aquilaria spp. Magelang. Forest and Landscape Denmark. Chemicals from Trees. pp. Tesis. Heyne. (1971). A. Clinical microbiology Review. Barden. TRAFFIC Network.12 (4) : 564-582.SL.

. Analgesik and AntiImflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. Mundhada. Surata. K.. Mardiastuti. S. P. Trupti.. Metabolic Engineering of Plant Secondary Metabolism. W. R van der Heijden. Kain. 2002. 2000. R.. W. Jakarta. and Alfermann. Pusat Penelitian Hasil Hutan. S. Aisuli 14.(Erdy Santoso. T. P. I K. (Editors). R. Y. Nandakumar. London. London. R. 95 .. 2000. Boca Raton. Dordrecht. Boston. K. I M. Teknik Budidaya Gaharu. A. P. 2000. A. Bogor. Verpoorte.. 2007. CRC Press Inc. J. Laju Pertumbuhan Tegakan Gaharu (Aquilaria malaccensis) di Riau yang Ditanam dengan Intensitas Budidaya Tinggi dan Manual. Memelink. and Alfermann. Vidhyasekaran.Teknologi Induksi Pohon . Boston. In Verpoorte. Pharmacology-online 1 : 288-298. A. C. R.. Physiology of Disease Resistant in Plant. Widnyana. Sumadiwangsa. 2001. p : 1-30. p : 31-50. Verpoorte. R. Miniyar. (Editors). Florida. General Strategies. CITES and Implementation in Indonesia. 2000. Somani. Balai Penelitian Kehutanan Kupang. Kluwer Academic Publisher. Kluwer Academic Publisher. dkk) Soehartono. Plant Secondary Metabolism. dan Harbagung. Bhutada.. Nagao Natural Environment Foundation. Gore. Info Hasil Hutan 6 (1) : 1-16. E. Dordrecht. Metabolic Engineering of Plant Secondary Metabolism. In : Verpoorte.

96 .

microcarpa) umur 97 .4 EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp. DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu Departemen Biologi. Selain itu. malaccensis. FMIPA. hingga saat ini masih terus diteliti. Proses pembentukan gubal pada pohon gaharu. asal gubal gaharu pada Gyrinops verstegii (sin. A. gubal gaharu diduga dapat terbentuk melalui infeksi cendawan. FMIPA. dan F. malaccensis mampu menginduksi gejala pembentukan gubal pada pohon gaharu (A. crassna. A. bulbigenium. Menurut Nobuchi dan Siripatanadilok (1991). oxyporum. Magnoliopsida. filaria) dan A. Institut Pertanian Bogor LATAR BALAKANG Gaharu merupakan salah satu komoditi hasil hutan bukan kayu (HHBK) yang dihasilkan oleh beberapa spesies pohon gaharu (Aquilaria sp. lateritium telah berhasil diisolasi oleh Santoso (1996). F. DAN Fusarium sp. Institut Pertanian Bogor Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Esti Wulandari Departemen Biologi. Thymelaeaceae).. Beberapa spesies Fusarium seperti F. A. Rahayu et al. (1999) menyatakan bahwa beberapa isolat Acremonium sp.

Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam). Acremonium sp. BAHAN DAN METODE A. (2007) dan Rahayu (2008) juga menyatakan bahwa Acremonium sp. Padang (koleksi Laboratorium Mikrobiologi Hutan. Banten. terhadap Fusarium sp. dan sebaliknya. Bahan Bahan dan alat yang digunakan adalah pohon A. (1995) juga menemukan proses SAR dari infeksi Pseudomonas lachrymans pada timun terhadap F. Infeksi ganda Fusarium sp. merangsang perubahan warna kayu dan pembentukan senyawa terpenoid.525 (koleksi IPBCC. Sebagai contoh. IPBCC 07. (1997). infeksi cendawan yang pertama dapat membangkitkan resistensi yang disebut Systemic Acquired Resistance (SAR) terhadap infeksi cendawan kedua. seringkali diperoleh dari satu gejala gubal.sp. 1962).Aspek PRODUKSI 2 tahun. Pada gubal gaharu. Liu et al. biakan Acremonium sp. Oleh sebab itu penelitian ini bertujuan untuk mengetahui efektivitas dan interaksi antara Acremonium sp. Caruso dan Kuc (1977) menyatakan bahwa infeksi F. yang berasal dari Aquilaria sp. dan Acremonium sp. dalam pembentukan gubal pada pohon gaharu (A. Mekanisme infeksi kedua cendawan ini pada satu lokasi infeksi belum dipelajari. terdeteksi senyawa oleoresin (Prema dan Bhattacharyya. melalui pemanfaatan kedua cendawan tersebut sebagai penginduksi ganda memerlukan informasi awal mengenai kemungkinan terbentuknya SAR yang dibangkitkan oleh Fusarium sp. microcarpa). terhadap Acremonium sp. Rahayu et al. hasil induksi cendawan. 98 . Oleh sebab itu. Padahal menurut Sticher et al. larutan gula 2%. Departemen Biologi FMIPA IPB). dan Fusarium sp. pada beberapa kasus infeksi cendawan pada tumbuhan. oxysporum. perubahan warna kayu dan adanya senyawa terpenoid dijadikan indikator efektivitas dan interaksi antara inokulan dalam pembentukan gubal. microcarpa umur 13 tahun di Hutan Penelitian Carita. dan Fusarium sp. oxysporum f. cucumerinum dapat membangkitkan SAR tanaman semangka terhadap infeksi Colletotrichum lagenarium.

Metode 1. dengan kedalaman lubang maksimal 1/3 diameter batang. mata bor berukuran 4 mm. ditumbuhkan pada 300 ml media cair. dan Fusarium sp. saja (FF)) digunakan sebagai pembanding. diremajakan pada media agaragar kentang dekstrosa (Difco) dan diinkubasi pada suhu ruang selama 7 hari. dan alat pencetaknya. Ke dalam lubang pada deretan kedua ini dimasukkan inokulan 2. saja (AA) atau Fusarium sp. Pasangan inokulan (FA atau AF) adalah set perlakuan. Pertama-tama. B. dan diinkubasi selama 3 minggu menggunakan inkubator bergoyang. Acremonium sp. 2. kemudian dibentuk berupa pelet dengan ukuran 4 mm x 40 mm. Batang yang tidak diberi perlakuan (K). Perubahan warna batang dan pembentukan wangi merupakan indikator pembentukan gubal. sederetan lubang dibuat di sekeliling batang utama (mulai ketinggian 0. bahan pelet. lubang diberi larutan gula 2% sebelum pemberian inokulan. Uji Efektivitas dan Interaksi Acremonium sp. Efektivitas dan interaksi diukur melalui perkembangan pembentukan gejala gubal di sekitar daerah induksi. Batang di sekitar lubang dikupas kulitnya. pohon dilubangi lagi pada jarak 15 cm secara vertikal dari deretan lubang yang pertama. Pembuatan Inokulan Acremonium sp.5-1 m di atas permukaan tanah) dengan mata bor berdiameter 4 mm. ditumbuhkan pada media serbuk gergaji selama 2 minggu. meteran. Seminggu kemudian. batang yang dilubangi dan diberi larutan gula (G). bor. Fusarium sp. Ke dalam deretan lubang ini dimasukkan inokulan 1 sampai lubang dipenuhi oleh inokulan. kemudian zona perubahan warna batang diukur secara horizontal 99 . yang dilubangi saja (B). Biakan ini akan digunakan sebagai sumber inokulum untuk pembuatan inokulan. Jarak antar set perlakuan dalam 1 pohon ± 30 cm.alkohol. Untuk inokulan berupa pelet. Pengamatan dilakukan setiap 1 bulan selama 4 bulan. aquades. serta batang dengan perlakuan tunggal (diberi Acremonium sp. dan Fusarium sp. Jarak antar lubang dalam deretan sekitar 5 cm.

kemudian disaring pada cawan petri steril dan diuapkan sampai kering (sampai terbentuk endapan berwarna kuning). sampelsampel dari kayu yang mengalami perubahan warna dipisahkan dari bagian yang sehat. ditambahkan 3 tetes asam asetat anhidrat dan 1 tetes H2SO4 pekat.4 g kayu yang berubah warna direndam dalam 5 ml etanol absolut panas. 2 = wangi). Wangi dinyatakan dalam tingkat wangi dan persentase titik induksi dengan kategori agak wangi dan sangat wangi. 1 = putih kecoklatan. 2 = coklat. 1987). Tingkat perubahan warna kayu ditetapkan berdasarkan sistem skor (0 = putih. 3 = coklat kehitaman). Perubahan warna diamati pada 10 titik untuk setiap pohon. Kayu di sekitar titik inokulasi dipahat. kemudian absorbansinya diukur dengan spektrofotometer pada λ 268 nm. 1987). Wangi ditetapkan berdasarkan sistem skor (0 = tidak wangi. Tingkat perubahan warna kayu dinyatakan dalam rataan dari hasil pengamatan 3 responden. 1 = agak wangi. Bila terdapat pengaruh nyata dari perlakuan yang diamati maka setiap taraf perlakuan 100 . Sebanyak 5 ml etanol absolut ditambahkan ke dalam larutan. dihomogenisasi lalu dipindahkan ke tabung reaksi steril. tingkat perubahan warna. 4. Tingkat wangi dinyatakan dalam rataan skor dari 3 responden. kemudian diamati wanginya secara organoleptik ketika kayu dibakar. lebar zona perubahan warna. Daerah yang menunjukkan perubahan warna kayu dari putih menjadi coklat-kehitaman diambil dengan dipahat dan dibawa ke laboratorium untuk pengamatan selanjutnya.1 menggunakan Rancangan Acak Lengkap (RAL) satu faktor dengan waktu dan uji F pada α = 5%. Sebanyak 0. Perubahan warna menjadi merah atau ungu menunjukkan adanya senyawa triterpenoid (Harbone. Setelah diamati tingkat wanginya. Deteksi Senyawa Terpenoid Senyawa terpenoid dideteksi dengan metode LiebermanBurchard (Harborne. Analisis Data Data hasil pengamatan (panjang. dan tingkat wangi) dianalisis dengan SAS versi 9.Aspek PRODUKSI dan vertikal. 3. Pada endapan ditambahkan 1 ml dietil eter pekat.

Berdasarkan persentase titik induksi pada kategori wangi.16 0.14a 3. Efektivitas inokulan tunggal maupun ganda Acremonium dan Fusarium relatif lebih tinggi dalam merangsang pembentukan gejala gubal gaharu dibandingkan dengan metode induksi lainnya.07 39..12 Titik induksi wangi (%) 1.30a Lebar (cm) 0.90b 1.83a Warna (skor) 1.Efektivitas dan Interaksi ..55 20. Gejala pembentukan gubal akibat inokulan ganda juga cenderung tidak berbeda nyata dari inokulan tunggalnya. HASIL A.59ab 101 .) dibandingkan dengan menggunakan uji lanjut Duncan pada taraf 5%.63ab 0. Efektivitas Inokulan dalam Menginduksi Gejala Pembentukan Gubal Gaharu Secara umum semua perlakuan menyebabkan perubahan warna kayu dan merangsang munculnya perubahan aroma kayu (Tabel 1).45c 1.75b 2. Pemberian gula menyebabkan gejala pembentukan gubal gaharu menjadi tertekan. Pembentukan gejala gubal gaharu hasil inokulasi cendawan tunggal dan ganda Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Inokulan tunggal Inokulan ganda AA FF AF FA 2.82a 0. inokulan ganda lebih efektif.94a 0. Sebagai inokulan tunggal A dan F memiliki efektivitas yang relatif sama..39 0.20a 3. AF lebih efektif dalam menginduksi pembentukan wangi daripada FA dan inokulan tunggal.37 31.18a Wangi (skor) Titik induksi agak wangi (%) 34.87a 0. Sedangkan pada parameter lainnya. Di antara inokulan ganda. dkk.(Gayu Rahayu.54ab 3.00 6.24 4..70a 0.62ab 0. AF justru lebih baik. Tabel 1.

Aspek PRODUKSI

Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Kontrol positif Kontrol negatif
*

Lebar (cm) 0,55b 0,73ab 0,00c

Warna (skor) 1,02d 1,16d 0,00e

Wangi (skor)

Titik induksi agak wangi (%) 10,41 11,11 0,00

Titik induksi wangi (%) 0,00 0,00 0,00

G B K

1,86b 2,87ab 0,00c

0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Kayu mengalami perubahan warna dari putih menjadi coklat atau coklat kehitaman (Gambar 1). Pemberian inokulan tidak berpengaruh pada panjang dan lebar zona perubahan warna. Namun panjang zona perubahan warna tertinggi terjadi berturut-turut pada kayu yang diberi perlakuan ganda FA dan AF. Sedangkan tingkat perubahan warna dipengaruhi oleh inokulan. Tingkat perubahan warna tertinggi pada FA dan berbeda nyata dari perlakuan lainnya.

Pemberian inokulan juga tidak berpengaruh nyata terhadap pembentukan wangi. Berbeda dengan perubahan warna kayu, tingkat wangi tertinggi terjadi pada kayu yang diberi inokulan ganda AF. Secara rataan nilai tingkat wangi yang terbentuk dari hasil perlakuan inokulan termasuk dalam kategori tidak wangi, Meskipun demikian, pemberian inokulan meningkatkan persentase titik induksi yang wangi. Bahkan inokulan tunggal AA dan inokulan ganda menghasilkan titik induksi pada kategori wangi (Tabel 1).

a

b

c

d

Gambar 1. Perubahan warna kayu dengan tingkat kegelapan yang berbeda dari (a) intensitas terendah sampai (d) intensitas tertinggi

102

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Periode induksi berpengaruh pada semua parameter pembentukan gubal kecuali panjang zona perubahan warna (Tabel 2). Secara umum, nilai parameter pembentukan gubal tertinggi terjadi pada bulan ke-2, kecuali tingkat perubahan warna. Pada bulan ke-2 induksi, intensitas warna cenderung naik, tapi intensitas warna kayu pada bulan ke-4 relatif sama dengan bulan ke-3.
Tabel 2. Pengaruh periode induksi pada gejala pembentukan gubal gaharu
Rataan* Perubahan warna kayu Bulan Panjang (cm) 1 2 3 4
*

Lebar (cm) 0,68a 0,71a 0,65b 0,65b

Tingkat (skor) 0,83c 1,24b 1,67a 1,65a

Wangi (skor)

Titik induksi agak wangi (%) 8,43 39,47 17,45 18,45

Titik induksi wangi (%) 0,00 0,00 0,00 6,74

2,46ab 2,58a 2,32ab 2,26b

0,32c 0,64a 0,51b 0,36c

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

B. Interaksi Inokulan 1 dan Inokulan 2
Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2 (Tabel 3). Inokulasi F sebelum inokulasi A tidak mempengaruhi pembentukan gejala gubal pada titik A termasuk pembentukan wangi. Kehadiran F justru cenderung meningkatkan respon perubahan warna kayu akibat inokulasi A. Demikian pula inokulasi A sebelum F tidak mempengaruhi pembentukan gejala gubal pada titik F, kecuali warna pada F menjadi lebih gelap dan persentase titik induksi yang wangi relatif lebih tinggi dibandingkan dengan inokulan tunggalnya. Inokulan ganda AF dan FA menghasilkan masing-masing 8,33% titik induksi pada kategori wangi. Infeksi sekunder juga tidak secara konsisten mempengaruhi infeksi primer (Tabel 4). Inokulasi F sebelum inokulasi A cenderung tidak mempengaruhi pembentukan gejala gubal termasuk tingkat

103

Aspek PRODUKSI

wangi, kecuali pada perubahan warna kayu. Intensitas warna pada titik induksi F lebih baik dibandingkan dengan perlakuan tunggalnya. Infeksi kedua oleh F juga cenderung tidak mempengaruhi gejala pembentukan gubal dan tingkat wangi. Infeksi sekunder oleh cendawan yang sama dengan cendawan tidak berpengaruh pada pembentukan gejala gubal (Tabel 5). Meskipun demikian, secara umum nilai parameter gejala gubal pada titik infeksi sekunder lebih rendah daripada pada titik infeksi primernya. Inokulan A dan F memiliki potensi yang relatif sama dalam merangsang pembentukan wangi.
Tabel 3. Pengaruh inokulan 1 terhadap inokulan 2 dalam gejala pembentukan gubal gaharu
Rataan* Perla-kuan Perubahan warna kayu Panjang (cm) FAa AAa AFf FFf GGg BBb KKk
*

Lebar (cm) 0,71bcd 0,66bcd 0,83abcd 0,75abcd 0,53d 0,65cd 0,00e

Warna (skor) 2,15ab 1,82bc 1,57cd 1,36de 1,02e 1,13e 0,00f

Wangi (skor) 0,60ab 0,63ab 0,70a 0,62ab 0,38c 0,47bc 0,00d

Titik induksi agak wangi (%) 26,37 36,11 40,27 27,78 0,00 0,00 0,00

Titik induksi wangi (%) 8,33 0,00 8,33 0,00 0,00 0,00 0,00

2,73abc 1,96bc 2,52abc 2,61abc 1,75c 2,40abc 0,00e

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 4. Pengaruh infeksi sekunder dengan cendawan yang berbeda dari cendawan penginfeksi primer
Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,68ab 3,87a Lebar (cm) 0,99ab 0,95abc Warna (skor) 1,53cd 2,22a Wangi (skor) Titik induksi agak wangi (%) 34,37 13,89 Titik induksi wangi (%) 0,00 0,00

FFF FAF

0,62ab 0,50bc

104

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,13abc 3,88a 1,98bc 3,35abc 0,00d Lebar (cm) 0,96abc 1,06a 0,56d 0,80abcd 0,00e Warna (skor) 1,98ab 1,93ab 1,01e 1,20de 0,00f Wangi (skor) Titik induksi agak wangi (%) 32,63 38,86 20,83 13,89 0,00 Titik induksi wangi (%) 2,78 4,15 0,00 0,00 0,00

AAA AFA GGG BBB KKK
*

0,63ab 0,70a 0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 5. Pengaruh infeksi sekunder cendawan yang sama dengan cendawan penginfeksi primernya
Rataan* Perlakuan Panjang (cm) 3,13abc 1,96bc 3,68ab 2,61abc Lebar (cm) 0,96abc 0,66bcd 0,99ab 0,75abcd Warna (skor) 1,98ab 1,82bc 1,53cd 1,36de Wangi (skor) 0,63ab 0,63ab 0,62ab 0,61ab Titik induksi agak wangi (%) 32,63 36,11 34,37 27,78 Titik induksi wangi (%) 2,78 0,00 0,00 0,00

AAA AAa FFF FFf
*

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

C. Pembentukan Senyawa Terpenoid
Senyawa terpenoid terdeteksi pada semua perlakuan. Pada perlakuan tunggal FF dan gandanya terbentuk warna merah, yang menunjukkan adanya senyawa triterpenoid. Warna merah pada minyak gaharu dijadikan sebagai pembanding kandungan triterpenoid perlakuan. Pada ekstrak kayu B, G, dan inokulan A terbentuk warna hijau. Warna hijau ini menunjukkan adanya senyawa sterol (Harborne, 1987). Sedangkan pada K tidak terbentuk

105

Pada 3 bsi.39* 0.12** 0.23** 0.23** 0.19** 0.14** 2 0 0. Begitu pula dengan nilai absorban inokulan 1 yang tidak dipengaruhi oleh inokulan 2. Tabel 6. Inokulan AF maupun FA juga tidak mempengaruhi kandungan terpenoid.06* 0.29* 0. Nilai absorbasi ekstrak kayu gaharu yang berubah warna Perlakuan K G B AF A AF F FA F FA A AA FF Bulan ke1 0 0. Hal ini menunjukkan bahwa pemberian inokulan 2 tidak mempengaruhi besarnya nilai absorban inokulan 1.12** 0.813) sebagai pembandingnya.Aspek PRODUKSI warna (bening).12* 0.11** 0.22* 0.14* 0.40* 0.21* 0.20** 0.06* 0.34* 0.15* 0.05* 0. secara umum nilai absorban perlakuan inokulan ganda hampir sama dengan inokulan tunggal (Tabel 6). Selain itu. ** Endapan berwarna merah-kecoklatan 106 . Secara umum. nilai absorbansi ekstrak terpenoid hasil perlakuan kurang dari nilai absorbansi minyak gaharu (0.25** 4 0 0.24* 0. Hal ini menunjukkan bahwa inokulan ganda tidak efektif dalam meningkatkan kandungan senyawa terpenoid.15* * Endapan berwarna hijau. perlakuan tunggal FF terbentuk endapan merah dan memiliki nilai absorbansi yang relatif tinggi.45* 0. Hal ini menunjukkan bahwa pada K tidak terdapat senyawa triterpenoid maupun sterol.25* 0.27* 0.20* 0.11* 0.06* 3 0 0.12** 0.20** 0.23* 0. Hal ini menunjukkan kandungan triterpenoid yang relatif tinggi pula (Tabel 6). Kandungan senyawa triterpenoid pada zona perubahan warna bervariasi pada setiap perlakuan selama 4 bsi (Tabel 6).

. inokulasi Acremonium sp. Pelukaan. Tajuk-tajuk pohon menjadi gundul. Pada akhirnya. Pohon semakin merana ketika diserang ulat. dan Fusarium sp. pada pohon kontrol daun-daun tidak mengalami klorosis sampai akhir pengamatan.. karena kemungkinan sumber karbon lebih diutamakan untuk pembentukan tunas baru. Sebelumnya. (1997) juga menyatakan bahwa perubahan warna kayu menjadi warna coklat (browning) dapat disebabkan oleh serangan patogen (cendawan) 107 . Efektivitas Induksi Pohon-pohon yang diberi perlakuan menurun kebugarannya mulai 1 bsi.Efektivitas dan Interaksi . Berkurangnya jumlah daun secara drastis dapat menghambat proses fotosintesis. Menurut Braithwaite (2007) Acremonium sp. Sedangkan pada pohon yang diberi inokulan ganda klorosis terjadi pada tiga cabang dekat lubang induksi. Pada 2 bsi. Berbeda dengan daun-daun pada pohon perlakuan.(Gayu Rahayu. dan Fusarium sp. menyebabkan perubahan warna kayu dari putih menjadi gelap.. berasosiasi dengan gejala perubahan warna kayu dan dicline pada Quercus sp. perkembangan gejala pembentukan gubal pun terganggu. Walker et al. Caruso and Kuc (1977) menyatakan bahwa Colletotrichum lagenarium menyebabkan klorosis pada daun tanaman semangka dan muskmelon. larutan gula. dkk. karena daun merupakan tempat utama berlangsungnya fotosintesis. Secara umum inokulan tunggal mengakibatkan klorosis pada daun-daun di dua cabang dekat lubang induksi. di New Zealand. Klorosis mungkin berhubungan dengan ketersediaan hara. jumlah daun yang mengalami klorosis tidak berbeda dengan 1 bsi. Perubahan warna kayu terjadi pada semua perlakuan. Selain itu..) PEMBAHASAN A. Fotosintat sebagai sumber karbon dalam pembentukan metabolit sekunder antimikrob pun terganggu. Ketersediaan hara terganggu karena jalur distribusinya ke daun terhambat akibat pengeboran. Penurunan kebugaran ditunjukkan oleh adanya daundaun yang mengalami klorosis pada cabang pertama dan kedua dari daerah lubang induksi dan kemudian daun-daun ini gugur. adanya inokulan juga menjadi penyebab klorosis. tetapi klorosis hampir memenuhi luasan helai daun.

Pada penelitian ini senyawa triterpenoid dan sterol juga terdeteksi. intensitas warna kayu lebih rendah dibandingkan 108 . Aroma wangi merupakan bagian dari senyawa gaharu (Rahayu et al. Aroma wangi mulai terdeteksi pada bulan ke-2 dan menurun pada bulan berikutnya. Sedangkan pada parameter lainnya. Periode inkubasi cenderung mempengaruhi semua parameter gejala gubal gaharu. Semakin lama periode induksi semakin gelap warna kayu. Kemungkinan besar fenomena ini berhubungan dengan kebugaran pohon yang menurun mulai bulan ke-2. Hal ini membuktikan bahwa wangi merupakan respon spesifik terhadap bentuk gangguan (Rahayu et al. 1995) mungkin tidak berhenti pada produk seskuiterpenoid tetapi dapat masuk dalam jalur metabolisme selanjutnya. Hal ini didukung oleh pernyataan Rahayu dan Situmorang (2006). Perubahan warna kayu pada gaharu mungkin dapat mengindikasi adanya senyawa gaharu. Pemberian larutan gula (G) menekan perkembangan gejala pembentukan gubal gaharu. Hal ini disebabkan karena gula tersebut segera dipergunakan pohon untuk proses penyembuhan daripada dimanfaatkan oleh cendawan. nilai tertinggi diperoleh pada bulan ke-2 induksi. Aroma wangi dan frekuensi wangi pada pemberian inokulan ganda AF relatif lebih tinggi dibandingkan dengan perlakuan lainnya.. Namun demikian metabolisme isopentenil pirofosfat sebagai pekursor pembentukan terpenoid (McGarvey and Croteau. 2007). Berdasarkan persentase titik induksi yang wangi. Namun. 2007).. Hal ini menunjukkan bahwa metabolisme terpenoid dapat berlangsung terus dan berakhir pada produk selain seskuiterpenoid ketika dipanen. inokulan ganda lebih baik dari inokulan tunggal maupun cara induksi lainnya.Aspek PRODUKSI dan kerusakan fisik. perubahan warna kayu menjadi coklat muncul setelah sel-sel kehilangan pati akibat pelukaan. bahwa perubahan warna dari putih menjadi coklat-kehitaman merupakan gejala awal terbentuknya senyawa gaharu. Senyawa wangi merupakan senyawa yang mudah menguap sehingga kemungkinan besar tergolong senyawa seskuiterpenoid. Menurut Nobuchi and Siripatanadilok (1991).

. Hal ini berbeda dari hasil penelitian Krokene et al. Triterpenoid terdeteksi pada pemberian inokulan tunggal FF dan inokulan ganda yang ditunjukkan dengan terbentuknya endapan berwarna merah pada pengujian Lieberman-Burchard. pada A. B. Kemungkinan lain adalah periode inokulasi antara inokulan 1 dan inokulan 2 yang hanya berselang 1 minggu..Efektivitas dan Interaksi . (1999) menyatakan bahwa pada Norway spruce (P. polonica. abies) terhadap C. Sesuai dengan pernyataan Rahayu et al. Acremonium dan Fusarium dikenal sebagai penyebab busuk batang atau kanker batang pada pohon berkayu. Sedangkan pada perlakuan B.. polonica terbentuk SAR setelah 3 minggu infeksi H. Heterobasidion mungkin merangsang pohon membentuk senyawa fitoaleksin yang bersifat anti C. dan Fusarium sp. crassna terbukti dapat merangsang pembentukan senyawa terpenoid. dkk. Selain itu penelitian sebelumnya. Heterobasidion juga menyebabkan busuk batang tetapi C. Hal ini menunjukkan bahwa aroma wangi yang dihasilkan tidak selalu sebanding dengan intensitas warna kayu. annosum. dalam bentuk inokulan tunggal atau inokulan ganda dapat merangsang pohon gaharu membentuk senyawa terpenoid. Pembentukan Senyawa Gaharu Acremonium sp. Krokene et al. Pada penelitian ini triterpenoid mulai terdeteksi pada 1 bsi. (1999) yang membuktikan bahwa inokulasi Heterobasidion annosum yang diikuti oleh Ceratocystis polonica menekan pembentukan gejala bluestain pada pohon Norway spruce (Picea abies). Kemungkinan besar hal ini disebabkan aktivitas patologis yang berbeda. G.(Gayu Rahayu. 109 . (1997) menyatakan bahwa serangan cendawan pada pohon Pinus akan merangsang pohon untuk membentuk senyawa terpenoid sebagai pertahanan pohon. Paine et al. Putri (2007) juga menyatakan bahwa pemberian Acremonium sp. (1999) bahwa terjadinya pembentukan wangi gaharu tidak selalu diikuti oleh perubahan warna kayu. polonica adalah penyebab bluestain saja dan tidak menyebabkan busuk batang.. Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2.) dengan pemberian inokulan ganda FA. dan inokulan tunggal AA terbentuk warna hijau.

P. Institut Teknologi Bandung. Berryman. 1987. V. BacterialMediated Induced Resistance in Cucumber: Beneficial Effect of the Endophytic Bacterium Serratia plymuthica on the Protection Against Infection by Pythium ultimum. Inokulan ganda terutama AF lebih efektif daripada inokulan tunggal dalam merangsang pembentukan wangi. Dick. 67: 1285-1289. Quéré. New Zealand Plant Protection 60:297-303 Caruso. Franceschi.A. Padmawinata K dan I Sudiro (penerjemah). 2007.. Kuc. Protection of Watermelon and Muskmelon Against Colletotrichum lagenarium by Colletotrichum lagenarium.M. Pay and C. Semua inokulan. Metode Fitokimia. Hill. J. 1977. Bandung Terjemahan dari: Phytochem Methods. Krokene. Soc.W. M. T. Beever. 1999. Solheim. Phytopathol. Harbone. L. E.A. Induced Resistance to Phatogenic Fungi in Norway Spruce. Christiansen. Phytopathol. Inglis.L. Dehbi.L. M. 121: 565-569. 2000..F. kecuali inokulan tunggal A merangsang pohon membentuk triterpenoid. Amer. C.R. SIMPULAN Semua pohon yag diinokulasi menurun kebugarannya sejak 1 bulan setelah inokulasi. S. Waipara. Ramsfield. N..B. Gagné. N.E.Aspek PRODUKSI Warna hijau ini mengindikasikan yang terbentuk adalah senyawa sterol. Plant Physiol. Braithwaite. DAFTAR PUSTAKA Benhamou. Harborne (1987) menyatakan bahwa sterol merupakan salah satu senyawa yang tergolong ke dalam senyawa terpenoid. D. 110 . F.. Investigation of Oak Tree Decline In Theauckland Region. H. Induksi dengan inokulan 1 yang hanya berselang 1 minggu dari pemberian inokulan 2 tidak membangkitkan resistensi pohon terhadap inokulan 2.D. R. J. A. 90(1): 45-56. J.

16-18 September 1999. Potensi Hifomiset dalam Menginduksi Pembentukan Gubal Gaharu.J.. T. L. Rahayu. Harrington. 1997. Increasing Fragrance and Terpenoid Production in Aquilaria crassna by Multi-Application of MethylJasmonate Comparing to Single Induction of Acremonium sp.. Siripatanadilok. 85:1064-1068. Sticher. Bull. Pembentukan Gaharu dengan Cara Inokulasi. and F. 42:179-206. Phytopathol.W. Umboh.C.. 1999. their Associated Fungi. hlm 573-581. 22-24 August 2007. Induction of Systemic Resistance in Cucumber by Plant Growth-Promoting Rhizobacteria: Duration of Protection and Effect of Host Resistance on Protection and Root Colonization. 2007.I. Switzerland. Acremonium and MethylJasmonate Induce Terpenoid Formation in Agarwood Tree (Aquilaria crassna).. 111 . Jakarta. 2008. Tuzun. K. 1996. Makalah dipresentasikan dalam 3rd Asian Conference on Crop Protection. T. Perhimpunan Fitopatologi Indonesia. G. 1997.. Institute de Biologie Végétale. S. J. Rahayu. Annu. Rahayu. M. 1995. Yogyakarta. dkk.. A.. L. J. McGarvey. Kyoto Univ. 11-12 Maret 1996. and Host Conifers.. Kloepper. 11-12 November 2008. Nobuchi. Makalah dipresentasikan dalam International Conference on Microbiology and Biotechnology.D. Terpenoid Metabolism. 1700 Fribourg. S. Pusat Litbang Hutan dan Konservasi Alam. Rev.P.. Métraux. Bogor. Hlm 1-3. Mauch-Mani. Entomol.F.) Liu. Systemic Acquired Resistance. B. 3 route A Gockel. Y. Putri dan Juliarni. Forest 63:226-235.Efektivitas dan Interaksi . Prosiding Kongres Nasional XV dan Seminar Perhimpunan Fitopatologi Indonesia. Raffa. D. Makalah Diskusi Hasil Penelitian dalam Menunjang Pemanfaatan Hutan yang Lestari.L.J. Santoso. E. 1995.. Paine. Isnaini. Purwokerto. T. Purwokerto. Université de Fribourg. Croteau. 1991. G. G. Interactions Among Scolytid Bark Beetles.(Gayu Rahayu. Preliminary Observation of Aquilaria crassna Wood Associated with the Formation of Aloeswood. Plant Cell 7:1015-1026.

112 .

Aspek SILVIKULTUR 113 .

114 .

bukan dari alam.. (Santoso et al. eksploitasi gaharu alam dilakukan tanpa mengindahkan kelestariannya. Erdy Santoso. dan Popullaria sp.5 UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto. Daijo and Oller. khususnya jamur Fusarium sp. 1987). Cylindrocarpon sp. Akibatnya populasi jenis-jenis gaharu menyusut tajam. Namun gaharu alam dapat mencapai kualitas tertinggi (kelas super) yang harganya bisa mencapai Rp 30 juta/kg. Dukungan iptek dimaksud 115 . Konsekuensinya. 2007. Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Pengembangan tanaman gaharu umumnya tidak bertujuan untuk menghasilkan kayu. sehingga jenis ini dimasukkan dalam Appendix II CITES (Santoso et al. 2001.. Budidaya gaharu memerlukan input iptek agar pertumbuhan dan produksi resin gaharu dapat optimal. 2007). dalam perdagangan resmi. gaharu harus dihasilkan dari pohon hasil budidaya. Karena potensi harga yang sangat tinggi. Pythium sp.. melainkan ditujukan untuk menghasilkan resin gaharu yang terbentuk dari respon tanaman atas infeksi mikroba. kurang dari 5% gaharu terbentuk dari populasi pohon dan bila terbentuk biasanya kurang dari 10% biomas kayu pada pohon yang terinfeksi.. 1996.. Di alam. Sidiyasa dan Suharti.. Phialophora sp.. Trichoderma sp.. Parman et al.

Pembahasan makalah ini difokuskan pada aspek pembibitan atau perbanyakan bibit pohon penghasil gaharu. 2. Biji pohon penghasil gaharu tergolong rekalsitran (Hou. 2.1oC dan 4. Perbanyakan Generatif Pengujian pada perbanyakan generatif dilakukan pada benih (biji) dan cabutan (anakan alam). dan 3 hari penyimpanan) serta kondisi penyapihan (dalam sungkup dan tanpa sungkup). malacensis asal Sukabumi. Namun informasi iptek mengenai teknik perbenihan dan teknik perbanyakan vegetatif gaharu masih sangat terbatas.4-26. 1980). 4. Makalah ini menyajikan hasil penelitian berkaitan dengan aspek perbenihan dan perbanyakan stek gaharu. baik secara generatif maupun vegetatif. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. 6.9-6.Aspek SILVIKULTUR berkaitan dengan aspek pembibitan dan penyuntikan stimulan gaharu. Bibit cabutan yang digunakan dalam uji waktu simpan cabutan adalah campuran Aquilaria microcarpa dan A. Perbanyakan bibit pohon penghasil gaharu dapat dilakukan. Perlakuan pada uji waktu simpan bibit cabutan adalah tiga waktu simpan (1. Benih pohon penghasil gaharu yang digunakan pada uji penyimpanan dan daya kecambah benih adalah campuran Aquilaria microcarpa dan A. baik pertumbuhan maupun produktivitas resin gaharunya. 116 .5oC). dan 8 minggu) dan temperatur penyimpanan (25. Penerapan perbanyakan vegetatif dan pemuliaan pohon berpotensi untuk menghasilkan bibit klon gaharu yang memiliki keunggulan. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. 1960). Biji rekalsitran umumnya cepat berkecambah dan tidak dapat disimpan dalam jangka panjang (Roberts and King. Perlakuan pada uji penyimpanan benih adalah waktu (0. malacensis. Proyek ITTO PD 425/06 berupaya untuk mengembangkan dan menerapkan iptek pada penanaman pohon penghasil gaharu agar pertumbuhan dan produktivitas resin gaharunya tinggi. METODE A.

Kondisi penyimpanan (kondisi ruang dan dalam re-frigerator) tidak secara nyata mempengaruhi perkecambahan benih (P Anova = 0. dkk..(Atok Subiakto. dan 3 kali pada bulan ketiga.. media tabur dapat menggunakan arang sekam Langsung 2 minggu 4 minggu 6 minggu 8 minggu 82 69 77 56 48 69 69 61 24 117 . Di Tabel 1. malacensis. Uji produksi bibit stek gaharu dilakukan dalam tiga tahap.. periode penyimpenyimpanan biji panan mempengaruhi persen Periode Kondisi Refrigerator kecam-bah benih (P Anova = < simpan ruang (%) (%) 0. HASIL DAN PEMBAHASAN A. Secara teknis pengecambahan biji gaharu mudah dilakukan. Persen kecambah dari hasil uji lain pihak.Uji Produksi Bibit .) B. yaitu media campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 2:1. Subiakto dan Sakai. Perbanyakan Generatif Biji gaharu tergolong rekalsitran. Perbanyakan Vegetatif Teknik perbanyakan vegetatif yang digunakan pada penelitian ini adalah teknik stek pucuk. 2 kali pada bulan kedua. Penyiraman 2 kali seminggu.. media menggunakan campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 1:1 dan intensitas penyiraman 1 kali pada bulan pertama. Uji penyimpanan benih dilakukan untuk mengetahui seberapa lama benih gaharu dapat disimpan. Perlakuan pada pengujian pertama menggunakan prosedur rutin.0001). 2007). 2007. Pada pengujian ketiga. Pada pengujian kedua perlakuan intensitas penyiraman dikurangi menjadi sekali seminggu dengan media arang sekam. Penelitian dilakukan pada rumah kaca yang menggunakan sistem pendingin kabut KOFFCO system (Sakai dan Subiakto.0993). Hasil uji pengecambahan biji dari dua kondisi penyimpanan disajikan pada Tabel 1 dan Tabel 2. sehingga harus secepatnya dikecambahkan. Bahan stek yang digunakan pada pengujian ini adalah A.

Penggunaan sungkup meningkatkan secara nyata persen tumbuh bibit cabutan (P Anova = < 0. 118 . Perbanyakan generatif Tabel 3. Penurun. penaburan biji dilakukan segera setelah buah yang masak dan jatuh. Persen jadi bibit (6 minggu setelah penaburan) dari hasil uji dimulai pada minggu kedua penyim-panan biji dan persen jadi bibit dihitung pada minggu keenam setelah Periode Kondisi Refrigerator penaburan. Oleh sebab itu untuk mendapatkan persen jadi bibit yang tinggi. Perkecambahan umumnya Tabel 2. Pada jenis-jenis biji rekalsitran seperti meranti. Hasil uji penanaman 3 76 38 cabutan disajikan pada Tabel 3. Pasimpan sungkup (%) sungkup (%) (hari) da pengujian penanaman 0 80 40 cabutan digunakan bibit 1 76 46 gaharu berukuran tinggi 2 87 24 7 cm. Pada jenis gaharu penyimpanan pada kondisi ruang selama 2 bulan masih dapat menghasilkan kecambah dengan tingkat keberhasilan 48%. Persen tumbuh bibit cabutan dari uji penyimpanan dan dapat pula dilakukan dengan kondisi tanam bibit menggunakan bibit yang diperoleh dari cabutan di Periode Dalam Tanpa bawah pohon induknya. kotiledonnya telah luruh.4 minggu 64 58 annya cenderung lebih besar 6 minggu 37 48 bila bibit disimpan dalam 8 minggu 29 9 jangka waktu yang lebih lama.0001). pengecambahan harus dilakukan segera setelah pengunduhan buah.Aspek SILVIKULTUR atau zeolit. Umumnya bibit cabutan yang masih memiliki kotiledon dapat langsung ditanam dalam kantong plastik tanpa penyungkupan. Pada Tabel 2 simpan ruang (%) (%) tampak ada penurunan antara Langsung 74 persen berkecambah dan 2 minggu 50 54 persen jadi bibit. Dalam pengujian ini media kecambah yang digunakan adalah arang sekam padi.

Mengingat persen jadi stek masih di bawah 70%.Uji Produksi Bibit . Pada pengujian tahap kedua.0083) terhadap persen jadi stek. penyiraman dikurangi menjadi satu kali seminggu. 2007). kelembaban.(Atok Subiakto. Perlakuannya adalah jenis dan wadah tanam (tabur) stek. B. maka dilakukan pengujian lebih lanjut. Penyimpanan bibit cabutan selama tiga hari masih memberikan hasil yang cukup baik (76%) bila penanamannya menggunakan sungkup. Media terbaik adalah zeolit. Perlakuan jenis tidak menunjukkan perbedaan nyata (P Anova = 0. dkk. adapun perlakuan yang diuji adalah tiga jenis media (arang sekam padi. Hasil pengujian ini membuktikan bahwa kelembaban tinggi di dalam sungkup mempengaruhi keberhasilan penanaman bibit cabutan. Pada tahap pertama digunakan prosedur baku pembuatan stek.6600) dalam persen jadi stek.. pasir. namun persen berakar masih di bawah 70%. Sungkup dapat dibuat dari plastik PVC transparan. Teknologi ini mengatur kondisi lingkungan. 2002). maka penanaman bibit cabutan harus melalui tahap penyungkupan. dan zeolit). Demikian pula perlakuan wadah tanam tidak menunjukkan perbedaan nyata (P Anova = 0.. dan media pada tingkat optimal bagi pertumbuhan (Sakai et al. Uji produksi stek dilakukan dalam tiga tahap penelitian.. Pembuatan stek dinilai dapat diusahakan secara ekonomis bila persen jadi mencapai 70% (Subiakto dan Sakai. 2007). yaitu cahaya. 2007. Hasil uji produksi stek gaharu disajikan pada Tabel 4. penyungkupan harus rapat agar kelembaban dalam sungkup dapat dijaga pada level di atas 95%. Perbanyakan Vegetatif Uji produksi stek gaharu dilakukan dengan menggunakan teknologi KOFFCO system yang dikembangkan oleh Badan Litbang Kehutanan dan Komatsu (Sakai dan Subiakto.. Subiakto dan Sakai.) Namun bila kotiledon telah luruh. Hasil pengujian menunjukkan media berpengaruh secara nyata (P Anova = 0.. temperatur. Ratarata persen jadi stek pada uji tahap pertama berkisar antara 4047%. Zeolit merupakan media dengan porositas yang baik dan tidak ditumbuhi oleh cendawan 119 .8276) dalam persen jadi stek.

siram 2 kali seminggu Media cocopeat : sekam = 1:1. termasuk cendawan pembusuk. crassna A. microcarpa Perlakuan Tanpa pot-tray. Tabel 4. media coco-peat : sekam = 2:1 Dengan pot-tray. crassna dan A. maka perlu dicoba media lain yang memiliki tingkat porositas relatif sama dengan zeolit. microcarpa Campuran A. Pada pengujian ketiga digunakan media campuran cocopeat dan sekam padi yang telah disteril. media coco-peat : sekam = 2:1 Tanpa pot-tray. crassna dan A. crassna dan A. siram 3 kali seminggu. siram 3 kali seminggu. Persen berakar stek dari rangkaian uji produksi stek Tahapan riset 1 1 1 1 2 2 2 3 3 3 Spesies A. microcarpa Campuran A. siram 1 kali seminggu Media cocopeat : sekam = 1:1. microcarpa Campuran A. media coco-peat : sekam = 2:1 Dengan pot-tray. dan 3 kali seminggu). Efek dari penyiraman adalah menyebabkan jenuhnya media dan meningkatkan pertumbuhan cendawan. siram 3 kali seminggu Persen berakar (%) 40 42 44 47 17 31 55 53 69 49 120 . siram 1 kali seminggu Media cocopeat : sekam = 1:1. siram 3 kali seminggu. media coco-peat : sekam = 2:1 Media sekam bakar. Perlakuan yang diuji adalah tingkat penyiraman (1 kali seminggu. crassna A. Penyiraman terbaik adalah dua kali seminggu dengan persen berakar 69%. microcarpa Campuran A. 2 kali seminggu. microcarpa Campuran A. microcarpa A. crassna dan A.0210). crassna dan A. crassna dan A. penyiraman berpengaruh secara nyata terhadap persen berakar stek (P Anova = 0. Karena zeolit adalah media yang berat dan relatif lebih mahal. siram 3 kali seminggu. microcarpa Campuran A. siram 1 kali seminggu Media zeolit. Hasil pengujian menunjukkan bahwa pada tingkat kepercayaan 5%. siram 1 kali seminggu Media pasir.Aspek SILVIKULTUR ataupun alga.

(Atok Subiakto. S. cukup disimpan pada suhu ruangan...G. H.. Pembuatan stek gaharu tersebut dilaksanakan pada rumah kaca dengan KOFFCO system.. 2007. p. Series I.. Studi Etiologi Gubal Gaharu Pada Tanaman Ketimunan. 1-15. Persen kecambah terbaik diperoleh dari benih yang langsung dikecambahkan setelah pengunduhan. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil Gaharu Aquilaria microcarpa. Penanaman bibit cabutan menggunakan sungkup menghasilkan persen tumbuh lebih baik dibandingkan bila tidak menggunakan sungkup. 2002. Komatsu. Pen. Subiakto. URL:http://store. T. A. dan Y. C. IV-5 : 499-509. Penyiraman terbaik dilakukan dua kali dalam seminggu.Uji Produksi Bibit . benih masih dapat disimpan selama dua bulan. Mass Propagation Method from The Cutting of Three Dipterocarps Species. Rahman. Sakai. Gunawan. C. Thymelaceae. Scent of Earth. com/scent-of-earth/alag. V. ed). J. Santoso. Media terbaik untuk penyetekan gaharu adalah campuran antara serbuk kulit kelapa (cocopeat) dan sekam padi dengan perbandingan 1:1. For. JICA. Mulyaningsih. Subiakto. E. dan N. Htn & KA.J.. Makalah Temu Pakar Gaharu di Kanwil Dephut Propinsi NTB.yahoo. 2001. Pedoman Pembuatan Stek Jenisjenis Dipterokarpa dengan KOFFCO System. DAFTAR PUSTAKA Daijo. Vol. J. Mataram. Bogor. Oller. Groningen. 2. Badan Litbang Kehutanan.) KESIMPULAN 1. A. Parman. Sakai. Nuroniah. 1960.G. dkk. and A. In : Flora Malesiana (Van Steenis. 1996.html (diakses : 5 Febuari 2001). D. Res. C. Turjaman. A. dan D. Hou... Walter-Noodhoff. W. Namun dengan mengantisipasi penurunan daya kecambah. 6. Kamata. Benih gaharu tidak perlu disimpan dalam refrigerator. 2007. The Netherland. 7:73-80. dan M. 121 .

Makalah Utama Diskusi Pemanfaatan Kayu Kurang Dikenal. Bogor.. Y.. Tamai. The Characteristic of Recalcitrant Seeds. BHD. Manajemen Persemaian KOFFCO System. Badan Litbang Kehutanan. and Roberts.Aspek SILVIKULTUR Sidiyasa. Cisarua. Arbuscular Mycorrhizal Fungi Increased Early Growth of Two Timber Forest Product Species Dyera polyphylla and Aquilaria filaria Under Greenhouse Conditions. 122 . Kuala Lumpur. Turjaman. Komatsu. M. E. 1980. Subiakto. H. Suharti. In : Recalcitran Crop Seeds (Chin. Santoso. F. Sakai. Jenis-Jenis Tumbuhan Penghasil Gaharu. E. 2007. Bogor. 2006. A. Malaysia. Tropical Press SDN. eds). H. Mycorrhiza 16 : 459-464. dan M. King. Roberts. H.. 1-5. 1987. and E. JICA. and M. K. dan C. W.

ditebang dan dipanen gaharunya. Sitepu Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Yasuyuki Hashidoko Lab. bahan aditif minyak wangi. Pohon penghasil gaharu yang ditemukan dengan ciri-ciri adanya lubang kecil yang disebut lubang semut. sehingga untuk mencegah punahnya pohon penghasil gaharu. budaya. sejak November 1994. Graduate School of Agriculture. Cara perburuan ini mengancam kelestarian gaharu di habitat alaminya. bahkan kegiatan sehari-hari. perburuan gaharu dilakukan secara agresif dan tidak bijaksana. Aquilaria 123 . of Ecological Chemistry. Division of Applied Bioscience. Hokkaido University Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu (dalam Bahasa Inggris dikenal dengan agarwood atau eaglewood) adalah kayu resin yang bernilai komersial tinggi karena digunakan sebagai dupa. DI PERSEMAIAN Irnayuli R. Di alam. dan minyak esensial untuk kegiatan keagaman.6 APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp.

Istilah RPPT digunakan untuk bakteri yang dapat membantu pertumbuhan tanaman melalui 124 . Upaya peningkatan mutu bibit di persemaian dapat dilakukan dengan pemupukan. Malaysia. Filipina. Thailand. Kedua genus ini ditemukan tumbuh alami di paling tidak 12 negara.49 (2004) mencatat ada 24 spesies yang termasuk genus Aquilaria dan tujuh spesies termasuk ke dalam genus Gyrinops.. 2004). Appendix II TRAFFIC-CITES-CoP13 Prop. Kamboja. termasuk Bangladesh. Indonesia. persiapan bibit kehutanan dilakukan mulai di persemaian. penggunaan biji yang bermutu baik dan inokulasi mikroba yang dapat memacu pertumbuhan. Gaharu hasil budidaya diharapkan akan dapat memenuhi kebutuhan pasokan gaharu untuk ekspor ke negara-negara pemakai. Lao PRD. dan Papua New Guinea (Barden et al. yaitu Aetoxylon. Keberadaan gaharu semakin menipis di alam. Kegiatan budidaya pohon penghasil gaharu tidak terlepas dari penyediaan bibit yang berkualitas tinggi. Butan. dalam Gunn et al. Agar ketersediaan produk gaharu dan pohon penghasil gaharu tidak punah dan untuk menjaga kesinambungan produksi gaharu yang lestari. Gonystylus. Myanmar. dua genus pohon penghasil gaharu terpenting yang termasuk ke dalam famili Thymelaeaceae (Ordo: Myrtales dan Kelas: Magnoliopsida) telah masuk ke dalam daftar CITES (the Convention on the International Trade in Endangered Species of Wild Flora and Fauna). produk unik ini juga dapat terjadi pada beberapa genus tanaman lainnya. seperti bakteri penghuni perakaran yang disebut rhizobakteri pemacu pertumbuhan tanaman (RPPT atau plant growth promoting rhizobacteria).Aspek SILVIKULTUR dan Gyrinops. Wikstroemia. Selain ditemukan pada kedua genus di atas. Vietnam. Gaharu terjadi melalui proses patogenisitas di mana jenis patogen fungi tertentu menginfeksi jenis pohon tertentu dan sebagai respon terhadap serangan patogen. Lain halnya dengan komoditas pertanian yang langsung ditanam di lapangan. Phaleria. Enkleia. perlu upaya budidaya pohon penghasil gaharu. pohon menghasilkan metabolit sekunder atau senyawa resin yang menyebabkan bau wangi ketika dibakar. Budidaya merupakan kunci utama dalam meningkatkan produksi gaharu yang semakin menipis.

di persemaian. dan pencegahan terjadinya serangan patogen tular tanah (Garbaye. dan diduga adalah produksi fitohormon oleh bakteri penambat nitrogen tersebut.Aplikasi Rhizobakteri Penghasil . dkk) mekanisme yang beragam. Sitepu. Mikroorganisme yang menghuni rhizosfir berbagai macam tanaman umumnya memproduksi auksin sebagai metabolit sekunder sebagai respon terhadap suplai eksudat akar yang berlimpah di zona perakaran. Azospirillum sp. 2006). maka dilakukan penelitian uji aplikasi bakteri penghasil AIA/auksin dalam memacu pertumbuhan bibit penghasil gaharu Aquilaria sp.. Glick.. 2006). membantu proses terbentuknya mikoriza.. 1994. yaitu asam indol asetat (AIA/auksin). Dikatakan bahwa bakteri penghasil hormon pertumbuhan diduga memegang peranan penting dalam memacu pertumbuhan tanaman. Mekanisme ini meliputi produksi fitohormon. Di antara mekanisme ini. Namun. sampai saat ini informasi penelitian tentang pemanfaatan bakteri fitohormon untuk tanaman kehutanan di daerah tropis masih terbatas. yang dikenal sebagai bakteri penambat nitrogen. (2005) melaporkan bahwa Azospirilum brazilance meningkatkan jumlah dan panjang akar lateral. Barbieri et al.. Untuk menguji hipotesa ini. Lucy et al.(Irna R. Dalam penelitian ini. baik secara langsung maupun tidak langsung (Glick. 1995. fitohormon mendapatkan perhatian penelitian karena aplikasi bakteri penghasil fitohormon dilaporkan meningkatkan produksi tanaman inang secara berkesinambungan (Narula et al. Kokalis-Burelle et al.. dan sitokinin (berbagai sumber dalam Narula et al. 1995. giberelin (AG). dan kinetin. solubilisasi atau mineralisasi fosfat. 2006). Narula et al. misalnya dapat memproduksi tiga jenis fitohormon. penambatan nitrogen.. kandungan nitrogen pada tanaman yang diinokulasi tidak meningkat secara myata. (2006) mengatakan bahwa dalam studi pemanfaatan bakteri penambat nitrogen untuk meningkatkan produksi tanaman. sequestration besi oleh siderofor.. AG. 2004). Sedangkan Azospirillum chroococcum diketahui dapat memproduksi AIA. sehingga respon peningkatan pertumbuhan tanaman disebabkan oleh mekanisme lain dan bukan nitrogen. (1986) dalam Ahmad et al. Sedangkan Pseudomonas putida GR12-2 pada bibit canola meningkatkan panjang akar sampai tiga kali lipat. bakteri terlebih dahulu diseleksi secara in vitro untuk 125 ..

USA) dengan empat pilihan primer. 2002). 4.. Homologi sekuens ditelusuri dengan menggunakan BLASTN online DNA database in National Center for Bio-technology Information (NCBI). Segera setelah agar diinokulasi rhizobakteri. 518R (5 GTATTACCGCGGCTGCTGG 3). Seleksi awal rhizobakteri secara in vitro dilakukan untuk mengetahui kemampuannya dalam memproduksi fitohormon (asam indol asetat-AIA) melalui karakterisasi kualitatif dan kuantitatif. dan diinkubasi dalam gelap pada suhu 28°C. diameter 47 mm. (1991).. membran dipindahkan dan ditumpuk pada kertas saring berdiameter 55 mm No. 126 .2 yang mengandung 1% sukrosa sebagai sumber karbon dan 0. Toyo Roshi Kaisha Ltd. dan/atau 1080RM (5 ACGAGCTGACGACA 3). media ditumpuk dengan membran nitrocellulose berukuran pori 0. BAHAN DAN METODE A. 1112F (5 GTCCCGCAACGAGCGCAAC 3). Rhizobakteri ini kemudian diidentifikasi secara molekuler mengikuti metode Weisburg et al. 3. Karakterisasi in vitro dan Persiapan Inokulum Rhizobakteri diisolasi dari rhizosfir dan rhizoplan bibit atau sapling menggunakan media campuran mineral Winogradsky’s bebas N dengan pH 5. Katakterisasi kualitatif menggunakan metode colorimetric Brick et al. Analisa sekuens DNA menggunakan BigDye Terminator v3.3% gellan gum sebagai bahan pemadat (Hashidoko et al.45mm. Foste City.6-6. (1991) yang dimodifikasi sebagai berikut: Rhizobakteri ditumbuhkan dalam media agar Winogradsky’s yang dimodifikasi (AWM) yang diberi 100 mg/L L-tryptophan (C 11H 12N 2O 2). Setelah inkubasi selama 3 hari. 926F (5 AAACTCAAAGGAATTGACGG 3).Aspek SILVIKULTUR mengetahui kapasitasnya sebagai bakteri penghasil fitohormon AIA/auksin. Bakteri Penghasil Fitohormon: Identifikasi. 2.1 cycle (Applied Biosystems. yaitu: 1. 2 (Advantec.

Rhizobakteri yang mampu memproduksi AIA akan membentuk cincin halo warna merah di sekitar koloni. dan merah tua. digunakan juga satu isolat bakteri pemacu asosiasi mikoriza. radiata tidak menunjukkan adanya korelasi yang positif antara intensitas kepekatan warna merah dengan laju pertumbuhan tanaman (tinggi dan total panjang akar).. Selain itu. Tidak adanya korelasi yang spesifik ini mengindikasikan bahwa kepekatan warna merah bukan merupakan indikasi tingginya kuantitas IAA yang dihasilkan. pembentukan warna dibaca pada A665nm. melainkan diduga merupakan indikasi perbedaan/variasi derifat dari senyawa indol yang dikonversi dari L-triptophan. Perubahan warna diamati setelah 30 menit kemudian.. Rhizobakteri yang membentuk cincin halo berwarna merah muda sampai merah pekat digunakan untuk uji kuantitatif AIA. maka dipilih sembilan bakteri (Tabel 1). yaitu Chromobacterium sp.. Intensitas warna yang terbentuk. Sitepu. dkk) Tokyo. Japan) yang telah direndam sebelumnya dalam larutan Salkowski. Sedangkan karakterisasi AIA secara kuantitatif dilakukan mengikuti metode Narula (2004). Rhizobakteri dikulturkan pada media MW cair yang ditambah dengan 100mg/L L-tryptophan dan diinkubasikan pada suhu 28°C dalam kondisi statis di dalam gelap selama 7 hari. Setelah 0. kemudian dikelompokkan menjadi merah muda. Dari ketiga uji pendahuluan untuk mendapatkan bakteri penghasil AIA.5 jam.. Glickmann dan Dessaux (1995) menyatakan bahwa larutan Salkowsky memberikan respon positif tidak hanya terhadap auksin (IAA) melainkan juga terhadap asam indolpirufat dan indoleacetamide. untuk mengetahui kemampuan bakteri dalam membantu terbentuknya asosiasi mikoriza pada bibit Aquilaria sp. Kemudian larutan Salkowski ditambahkan pada supernatant kultur rhizobakteri. Namun demikian.Aplikasi Rhizobakteri Penghasil . 127 . merah. uji lanjutan pada V. CK8 karena Aquilaria sp. Strain rhizobakteri yang bereaksi positif dengan larutan Salkowski kemudian diuji untuk mengetahui kemampuannya dalam memacu pertumbuhan akar Vigna radiata sebagai tanaman uji.(Irna R. diketahui berasosiasi dengan fungi mikoriza arbuskula.

Sel bakteri yang ditumbuhkan pada media cair MW + 100 mg/L L-tryptophan diinkubasi dengan menggoyang selama 3 hari pada suhu 28ºC. Pada saat penanaman. Inokulasi dilakukan pada bibit yang berumur 4 minggu dengan cara merendam bibit dalam larutan bakteri selama 30 menit. Informasi bakteri PGPR penghasil fitohormon yang digunakan sebagai inokulum Strain bakteri Stenotrophomonas sp. Rizoplan Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Hopea sp. 1 ml larutan bakteri juga disebarkan di daerah perakaran. UP: Universitas Palangkaraya. teysmanniana S. CK26 Sub kelas Proteobacteria Bacilli Proteobacteria Hasil analisa colorimetric AIA Merah Inang Substrat Sta-dium Asal lokasi Dipterocarpus sp. Bibit ditumbuhkan di rumah kaca dan disiram setiap hari dengan air keran. CK59 bacteria (DQ195914) Dipterocarpus sp. diameter. H: Hopea.5% gellan gum selama 30 menit. CK8 (DQ195926) Proteobacteria * Catatan: S: Shorea. parviflora Rizoplan Rizoplan Sapling ~1 bln Sapling ~1.5 th NI CK 61 Chromobacterium sp. CK67 NI CK53 NI CK54 Proteobacteria S. CK41 Azospirillum sp. CK34 Bacillus sp. NI: bakteri yang belum teridentifikasi. * isolat mycorrhization helper bacteria. CK28 bacteria (DQ195889) Burkholderia Proteosp. S. Rizoplan S. Pengamatan dilakukan terhadap tinggi. balangeran S.Aspek SILVIKULTUR B. AIA: asam indol asetat 128 . teysmanniana Rizoplan Rizoplan Rizoplan Merah muda Merah muda Merah muda pupus Merah muda pupus Merah muda pupus Merah tua Merah tua Merah muda Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Burkholderia Proteosp. teysmanniana Rizoplan Sapling ~1th Bibit~ 6 bln Nyaru Menteng Nyaru Menteng Pembi-bitan UP Nyaru Menteng Serratia sp. dan bobot kering biomassa. kemudian ditanam dalam polybag yang berisi 500 g media tanah yang tidak steril. setelah itu kultur bakteri agak dikentalkan dengan menambahkan 0. Inokulasi Bakteri Fitohormon pada Bibit Aquilaria sp. Tabel 1.

Warna merah yang terbentuk di sekitar koloni setelah direaksikan dengan reagen Salkowski (a): Pembentukan warna pada membrane nitroselulose 3 hari setelah inkubasi. Parameter yang diukur untuk mengetahui respon bibit terhadap inokulasi.. (b): Pembentukan warna pada media cair. USA). dan persentase peningkatan pertumbuhan. Data dianalisa secara statistik dengan analisa sidik ragam menggunakan program SPSS®version 10. Rancangan Percobaan dan Analisa Data Penelitian menggunakan rancangan acak lengkap dengan faktor tunggal..0 (SPSS Inc. yaitu tinggi. berat kering total. Sitepu. dkk) a b Gambar 1. indeks mutu bibit. yang masing-masing diulang sebanyak 10 bibit per perlakuan. yaitu 10 isolat bakteri. Analisa persentase peningkatan pertumbuhan dilakukan sebagai berikut: %Peningkatan = Bibit yang diinokulasi bibit kontrol Bibit kontrol x 100% 129 .(Irna R. Data yang berbeda nyata diuji lanjut dengan Least Significant Difference untuk mengelompokkan perlakuan yang tidak berbeda nyata. Chicago. diameter.Aplikasi Rhizobakteri Penghasil ... Bakteri NICK53 yang membentuk warna merah tua dibanding dengan kontrol media tanpa bakteri C..

Semua bibit yang diinokulasi secara signifikan memiliki pertumbuhan tinggi yang lebih baik daripada tanaman kontrol melalui analisa Least Significant Difference (LSD). Respon tanaman diamati melalui pertumbuhan tinggi dan diameter setiap bulannya. β Proteobacteria) merupakan isolat yang paling konsisten dalam memberikan pengaruh paling efektif dalam meningkatkan pertumbuhan tinggi selama lima bulan setelah inokulasi (Gambar 2). Bakteri fitohormon memberikan pengaruh nyata terhadap tinggi tanaman mulai 1-5 bulan setelah inokulasi (P < 0. 130 .05). CK8 (DQ195926.2-38. β Proteobacteria) dan Chromobacterium sp. bibit yang tumbuh di lantai hutan perlu memiliki kemampuan untuk segera tumbuh tinggi bersaing dengan bibit di sekitarnya untuk mendapatkan cahaya agar dapat tumbuh baik.7% dibandingkan dengan bibit yang tidak diinokulasi pada lima bulan setelah inokulasi. Kedua bakteri ini berasal dari rhizoplan S. netral atau negatif terhadap pertumbuhan tanaman jika dibandingkan dengan tanaman yang tidak diinokulasi (kontrol negatif ). menunjukkan respon beragam terhadap inokulasi bakteri fitohormon (Gambar 2).5 tahun dari arboretum Nyaru Menteng. (2007) bahwa respon diameter bibit Shorea selanica terhadap inokulasi RPPT tidak konsisten. Bakteri fitohormon memberikan pengaruh positif. Respon yang serupa juga telah dilaporkan oleh Sitepu et al. tinggi merupakan parameter yang reliable untuk mengamati respon bibit terhadap inokulasi mikroba pemacu pertumbuhan. Kalimantan Tengah. Pada habitat hutan yang rimbun dengan kanopi yang bertingkat. teysmanniana umur kurang lebih 1 tahun dan S.Aspek SILVIKULTUR HASIL DAN PEMBAHASAN Bibit Aquilaria sp. Dua isolat bakteri. CK28 (DQ195889. berkisar antara 12. parviflora umur kurang lebih 1. Pertumbuhan diameter tidak menunjukkan respon yang konsisten terhadap inokulasi (Tabel 2). Dijelaskan bahwa tanaman hutan pertumbuhannya jauh lebih lambat dari tanaman pertanian sehingga untuk pertumbuhan stadium awal di persemaian. Peningkatan pertumbuhan tinggi bibit Aquilaria sp. yaitu Burkholderia sp.

yaitu Shorea leprosula. Angka di atas notasi adalah peningkatan pertumbuhan dibanding kontrol Inokulasi tidak memberikan pengaruh nyata terhadap pertumbuhan tinggi.. Diduga tidak adanya respon bibit yang nyata pada bulan keenam dan selanjutnya disebabkan karena bibit telah terinfeksi oleh fungi mikoriza secara alami yang dapat berasal dari tanah maupun air yang dipakai untuk menyiram tanaman walaupun analisa infeksi mikoriza alami tidak dilakukan. Inokulasi juga tidak berpengaruh terhadap pertumbuhan setelah bibit dipindah ke lapangan. tidak disterilisasi pada saat inokulasi bakteri sehingga mikroba alami yang terdapat dalam tanah. enam bulan setelah inokulasi. juga terhadap berat kering total. 2005). 1990. enam bulan setelah inokulasi. ditumbuhkan di bawah tegakan meranti di Hutan Penelitian Dramaga.. Hopea odorata. Tidak responnya bibit terhadap bakteri. 131 . Pengaruh bakteri PGPR terhadap pertumbuhan tinggi bibit Aquilaria sp. dapat dijelaskan sebagai berikut: Tanah sebagai media tumbuh dan bibit Aquilaria sp. Yazid et al. 1994.. Sitepu. rasio pucuk terhadap akar.. Bibit Aquilaria sp. dan Shorea pinanga (Lee..Aplikasi Rhizobakteri Penghasil .(Irna R. bibit cenderung tumbuh lambat (Tabel 2). Fungi mikoriza dilaporkan baru berperan efektif tujuh bulan setelah inokulasi pada tanaman dipterokarpa. dkk) Gambar 2. Turjaman et al.. dan indeks mutu bibit (Gambar 3 dan Gambar 4). Shorea acuminata. sampai 5 bulan setelah inokulasi. kemudian bebas untuk berinteraksi dengan bakteri yang diinokulasikan.

05 *: nyata pada taraf 0. Analisa sidik ragam pada parameter pertumbuhan yang diukur Parameter Diameter (mm) Tinggi (cm) Berat Kering Pucuk (g) Berat Kering akar (g) Berat Kering Total (g) Rasio P/A Indeks Mutu Bibit tn * tn * Analisa sidik ragam * * tn tn tn tn tn * * tn * tn tn Catatan: tn: tidak nyata pada taraf 0.05. Berat kering total bibit Aquilaria sp.Aspek SILVIKULTUR Tabel 2. Tabel 1. yang diinokulasi bakteri 132 . P/A: Pucuk/akar Gambar 3.

Salah satu dari kedua inokulan yang paling efektif. CK8 adalah bakteri yang telah diuji secara in vitro dapat membantu pertumbuhan miselia fungi ektomikoriza Laccaria sp.. (2001) menyatakan bahwa bakteri Paenibacillus sp... monteilii meningkatkan biomassa fungi di dalam tanah (Founoune et al. dan Rhodococcus sp. (1998) pada bibit loblolly dan slash pine melaporkan bahwa inokulasi RPPT meningkatkan biomassa tegakan.Aplikasi Rhizobakteri Penghasil . Indeks mutu bibit Aquilaria sp. yaitu Chromobacterium sp. Penelitian yang dilakukan oleh Enebak et al.. 2002). MHB) juga telah dilaporkan.. Brule et al. dkk) Gambar 4. Pengaruh tidak langsung dari inokulasi RPPT berupa pembentukan asosiasi mikoriza (disebut sebagai mycorrhizal helper bacteria. Sitepu. Penelitian yang dilakukan oleh Poole et al. dalam penelitian ini. 1994. pengaruh mikoriza dimulai lebih awal. Gambar 4... Bakteri tertentu dapat berperan dalam merangsang terbentuknya asosiasi mikoriza antara fungi mikoriza dan tanaman inangnya. 2001). Burkholderia sp. Sedangkan Paenibacillus monteilii dan Paenibacillus resinovorans memacu simbiosis antara Pisolithus alba dengan Acacia holosericea di mana P. 133 . Pseudomonas fluorescense BBc6R8 memacu simbiosis antara Laccaria bicolor S238N-Douglas fir (Pseudotsuga menziesii) dan efek dari bakteri MHB ini paling efektif pada saat fungi mikoriza tumbuh berada pada kondisi yang tidak optimal (Garbaye. merangsang infeksi ektomikoriza pada tahapan pembentukan akar lateral antara Laccaria rufus dan Pinus sylvestris. yang diinokulasi bakteri Pada bibit Aquiliaria sp.. yaitu pada enam bulan setelah inokulasi.(Irna R.

maka perlu uji lebih lanjut untuk mengetahui pengaruh inokulasi ganda antara bakteri dan fungi mikoriza arbuskula dalam memacu pertumbuhan bibit. dan apakah hipotesa di atas benar. 134 . Dalam hal ini bibit bermikroba dapat meningkatkan ketahanan tumbuh tanaman pada kondisi ekstrim. segera setelah inokulasi berturut-turut selama lima bulan. CK28 yang menghasilkan warna pink muda pada uji colorimetric. baik di persemaian maupun di lapangan. terhadap inokulasi menghasilkan satu bakteri penghasil indol yang efektif. Peningkatan pertumbuhan tinggi bervariasi dari 12. Uji lanjutan inokulasi ganda dengan fungi mikoriza arbuskula perlu dilakukan untuk mengetahui mikroba yang berperan dalam memacu pertumbuhan bibit pada stadia lanjut di persemaian sebelum dipindah ke lapangan. Penelitian yang dilakukan oleh Kashyap et al. menunjukkan respon beragam terhadap inokulasi bakteri penghasil fitohormon. Uji in vitro merupakan metode yang praktis. terutama dalam menyeleksi isolat dalam jumlah besar sebelum dilakukan uji selanjutnya. KESIMPULAN Bibit Aquilaria sp. yaitu Burkholderia sp. Dalam penelitian ini. Dua isolat Burkholderia sp. Dari hasil in vitro didapat sembilan bakteri penghasil indol yang kemudian diuji lanjut pada bibit Aquilaria sp.Aspek SILVIKULTUR Untuk mengetahui apakah fenomena MHB ini juga berlaku untuk Aquilaria sp.7% dibandingkan dengan bibit yang tidak diinokulasi. CK28 dan Chromobacterium sp. pendekatan yang dilakukan adalah menyeleksi bakteri secara in vitro terlebih dahulu sebelum dilakukan uji pada tanaman target di persemaian. Respon pertumbuhan bibit Aquilaria sp. (2004) menunjukkan bahwa inokulasi ganda fungi mikoriza arbuskula dan bakteri Azotobacter dengan tambahan asam indol butirat secara nyata meningkatkan survival rate sapling Morus alba (Moraceae) yang ditanam pada kondisi yang bergaram tinggi dari 25-50%.2-38. CK8 adalah dua bakteri yang secara konsisten memacu pertumbuhan tinggi. Inokulasi bakteri penghasil fitohormon dapat meningkatkan tinggi bibit Aquilaria sp.

J. Rapid in situ assay for indoleacetic acid production by bacteria immobilized on a nitrocellulose membrane.L. Canadian Journal of Microbiology 41: 109-117. New Phytologist 153: 81-89. Sall. I.E. 1991.C.. Ba. dkk) Ucapan Terimakasih Para penulis mengucapkan terimakasih kepada Bapak Ahmad Yani dan Bapak Zaenal yang telah membantu pengukuran dan perawatan tanaman di Hutan Penelitian Dramaga. and S. 1994. Effect of plant growthpromoting rhizobacteria on loblolly and slash pine seedlings.A. F. Silverstone. J. G.M. Chotte.S. J. Glick. New Phytologist 128: 197-210. 2002. H... M. Sitepu..M.. J. J. Forest Science 44: 139-144. Bostock. Ahmad. DAFTAR PUSTAKA Ahmad. S. dan M. 1995. and J.M. Applied and Environmental Microbiology 57: 535-538. 135 . P.. 2001. Brick. and J. Enebak. Brulé. Branget. G. Garbaye. 1995.Aplikasi Rhizobakteri Penghasil . Mycorrhiza Helper Bacteria stimulate ectomycorrhizal symbiosis of Acacia holosericea with Pisolithus alba. A critical examination of the specificity of the Salkowski reagent for indolic compounds produced by phytopathogenic bacteria. Gerard. Courrier. Turkish Journal of Biology 29: 29-34. S.L.W.. Frey-Klett. R. Rousselet. Founoune. R. B. F. Helper bacteria: a new dimension to the mycorrhizal symbiosis. C.(Irna R.. Duponnois. Garbaye. A. S. Soil Biology and Bio-chemistry 33: 1683-1694. E. Survival in the soil of the ectomycorrhizal fungus Laccaria bicolor and the effects of mycorrhiza helper Pseudomonas fluorescens. I. Dessaux. 2005. and J. Lemoine. Indole acetic acid production by the indigenous isolates of Azotobacter and fluorescent Pseudomonas in the presence and absence of tryptophan.C. Glickmann. Wei. Applied Environmental Microbiology 61: 793-796. Khan.. Pierrat.R. Neyra. Sommer. The enhancement of plant growth by free-living bacteria. Lorquin. M. 1998. Kloepper. and Y.

2002. B. Limin.D. Narula. 2006. free-living nitrogen-fixing bacteria inhabiting the rhizoplane of plants. Narula. CCS Haryana Agricultural University. Singadan. Tahara. 1990. P. N. Eaglewood in Papua New Guinea. PhD Dissertation. J. Applications of free living plant growth-promoting rhizobacteria. W. and M. Chatterton. 2004. E. M. L..67.W. N. Cha. and investigations of their functions on seedling growth. Paranodules and colonization of wheat roots by phytohormone producing bacteria in soil. Biofertilizer technology-A manual.S. I. Plant Soil Environment 52:119-129. A. E. G. Lee.S.51. Department of Microbiology. M. J.V. Hokkaido University.. 2005.M.. Sitepu. Y. S. India. Bacteria associated with Pinus sylvestris-Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro. Tawaraya.J. and D. R. Hashidoko. The mycorrhizal association of the Dipterocarpaceae in the tropical rain forests of Malaysia. 2004. J. Segah. Osaki. Screening of plant-growth promoting rhizobacteria from Dipterocarpaceae plants growing in Indonesian tropical rain forests. Kloepper. Bending.Aspek SILVIKULTUR Gunn. Soft gel medium solidified with gellan gum for preliminary screening for rootassociating. M. pp. Behl. Y. Reed.. Inoculation with the ectomycorrhizal fungi 136 . Gans. 2007. and W. Applied Soil Ecology 31: 91-100. and B.. Canberra. N. 18 pp. Poole.Y. and P. and S. Plant growth-promoting rhizobacteria as transplants amendments and their effects on indigenous rhizo-sphere microorganisms. Turjaman. 91 pp. 2004. Antonie van Leeuwenhoek 86: 1-25. New Phytologist 151: 743-751. Sunari. Osaki. 2006. Tamai. AMBIO 19: 383-385. H. Kokalis-Burelle.K. Hisar. Read. Whipps. Bio-science Biotechnology Biochemistry 66: 2259–2263...R. M. Lucy. S. Deubel.H. The Australian National University. M. Reddy. and K. Stevens. Glick.J. Tada. Resource Management in Asia-Pacific Working Paper No. 2001. M. Merbach.R.

Forest Ecology Management 67: 339-343. and F.M.Aplikasi Rhizobakteri Penghasil .(Irna R. D.. dkk) Pisolithus arhizus and Scleroderma sp. S. S. Lee. Journal of Bacteriology 173: 697-707.S. Growth stimulition of Hopea spp. and D. Barns.. W.. 16S ribosomal DNA amplification for phylogenic study. 137 . Weisburg. G.A.. (Dipterocarpaceae) seedlings following ectomycorrhizal inoculation with an exotic strain of Pisolithus tinctorius. 1994. Lane. 1991. Pelletier. Lapeyrie. S. New Forest 30: 67-73. improves early growth of Shorea pinanga nursery seedlings...M.J. Sitepu. Yazid.

138 .

Karena disebabkan tingginya nilai produk gaharu. Enkleia. dan Aquilaria yang memproduksi gaharu (Ding Hou. 1960). Oyen dan Dung. maka jenisjenis ini mengalami kelebihan pemanenan di seluruh kawasan Asia selama 20 tahun terakhir (Paoli et al. Gyrinops. India. Bhutan. Irnayuli R. Jenis-jenis ini merupakan sumber utama dari kayu gaharu (semacam kayu yang 139 . Myanmar. Pada saat ini Aquilaria. Aryanto.. Ragil S. Jenis-jenis Aquilaria pada umumnya banyak dijumpai pada hutan-hutan primer dan sekunder dataran rendah di Indonesia. Thailand. 1998. Sitepu.B. Bangladesh.. Cambodia. Wikstroemia. Malaysia. Vietnam. Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Salah satu famili pohon tropika yang sekarang menjadi perhatian dunia internasional adalah Thymelaeaceae. Gyrinops. Irianto. Najmulah. Papua Nugini. Famili pohon ini sangat penting karena menghasilkan produk gaharu dan kayu mewah untuk masyarakat di sekitar kawasan hutan di kawasan Asia (Lemmens et al. Gonystylus. dan Filipina. 1999). dan Gonystylus dimasukkan ke dalam CITES (Convention on the International Trade in Endangered Species) Appendix II (CITES 2005). China. Ahmad Yani. Sugeng Sentosa. 2001).7 PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman. Phaleria. Thymeleaceae terdiri dari 50 genera dengan Aetoxylon.

Namun demikian. belum dilaporkan adanya uji inokulasi fungi mikoriza arbuskula pada jenis-jenis Aquilaria.. Fungi mikoriza arbuskula (FMA) telah diuji dengan hasil yang signifikan pertumbuhannya pada jenis Leucaena leucocephala (Michelsen dan Rosendahl. 11 jenis Eucalyptus (Adjoud et al. 1998). baik di tingkat persemaian maupun di lapangan. obat tradisional. Tectona grandis (Rajan et al. Parkia biglobosa. 2005).. Telah banyak dilaporkan dalam beberapa jurnal internasional pentingnya pemanfaatan fungi mikoriza arbuskula dari beberapa jenis tanaman hutan yang berbeda untuk membantu kegiatan reforestasi. Dari hasil studi literatur. Produk gaharu biasanya digunakan sebagai bahan dasar parfum. Sesbania aegyptiaca dan S. Ketersediaan nutrisi tanah merupakan salah satu faktor pembatas untuk pertumbuhan awal dalam kegiatan penanaman bibit-bibit tanaman hutan pada kondisi lahan hutan yang terdegradasi (Santiago et al. Pada kenyataannya ketersediaan bibit biasanya cenderung dibuat dengan kualitas rendah dan mengalami defisiensi unsur hara dan pada akhirnya mengalami kematian yang tinggi pada saat telah ditanam di tingkat lapang. 1990). Penggunaan bibit tanaman hutan yang vigor sangat diperlukan dalam kegiatan reforestasi. 2000). 1996). 2002). 2004)..Aspek SILVIKULTUR mempunyai resin wangi) yang termasuk dalam urutan teratas dari kelompok hasil hutan bukan kayu bernilai sangat tinggi yang berasal dari hutan tropika. Zizyphus mauritiana (Guissou et al. grandiflora (Giri and Mukerji. Tujuan dari penelitian ini adalah menentukan tingkat pengaruh fungi mikoriza arbuskula pada jenis-jenis Aquilaria. incence. sulit sekali untuk melakukan pengaturan perlindungan genus ini dan termasuk juga dalam pengaturan kelestarian produksi gaharu alami. Pada saat ini kegiatan reforestasi memproduksi ratusan juta bibit tanaman hutan setiap tahunnya. dan produk komersial lainnya (Eurling dan Gravendeel. 140 . Pada tahap awal pertumbuhan jenis Aquilaria sering mengalami pertumbuhan yang lambat. jenis Aquilaria berkurang populasinya di alam. Tamarindus indica. sebab pada umumnya kondisi lahan hutan tropika di Indonesia kahat unsur hara terutama N dan P.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

BAHAN DAN METODE
A. Perbenihan dan Perkecambahan
Benih Aquilaria crassna diperoleh dari Dramaga (Bogor), A. malaccensis dikoleksi dari Desa Gudang (Pulau Bangka), A. microcarpa dari Desa Mianas (Kalimantan Barat), A. beccariana berasal dari Sanggau (Kalimantan Barat). Semua benih Aquilaria spp. direndam selama dua jam, kemudian disterilisasi dengan sodium hypochlorit (5%) selama lima menit. Setelah disterilisasi, benih tersebut dicuci beberapa kali dengan air sampai bersih. Benih Aquilaria spp. dikecambahkan pada bak plastik yang berisi media zeolite. Benih Aquilaria spp. mulai berkecambah 21 hari setelah ditaburkan.

B. Media Semai
Jenis tanah ultisol diambil dari Hutan Penelitian Haurbentes, Jasinga dan kemudian disimpan di rumah kaca. Media semai tersebut disaring dengan diameter saringan lima mm. pH media adalah 4,7; P tersedia (Bray-1) adalah 0,17 mg kg-1, dan N total (Kjeldahl) was 1.7 mg kg-1. Kemudian media semai disterilisasi pada temperatur 121oC selama 30 menit.

C. Inokulum Mikoriza Arbuskula
Fungi mikoriza arbuskula, G. decipiens, G. clarum, Glomus sp. ZEA, dan Glomus sp. ACA diisolasi dari Desa Kalampangan, Palangkaraya, Kalimantan Tengah melalui teknik pot kultur. Teknik pot kultur dimulai dengan cara spora tunggal. Inang yang digunakan untuk mempropagasi FMA adalah Pueraria javanica. Pot plastik diisi dengan zeolite steril dan ditambahkan 5 g dari masingmasing jenis FMA. Kemudian ditanam benih P. javanica yang telah berumur enam hari pada pot plastik tersebut. Pot-pot disusun pada rak-rak besi di rumah kaca dan dipelihara selama 90 hari. Spora, hifa eksternal, dan akar yang terkolonisasi dari masing-masing jenis FMA diamati di bawah mikroskop.

141

Aspek SILVIKULTUR

D. Inokulasi FMA
Polybag (ukuran 15 cm x 10 cm) diisi tanah steril 500 g. Inokulasi FMA diberikan 5 g untuk setiap pot dan diletakkan dekat akar semai Aquilaria spp. Semai empat jenis Aquilaria yang tidak diinokulasi sebagai kontrol. Dari hasil penelitian pendahuluan, penggunaan inokulum steril tidak memberikan pengaruh pertumbuhan pada Aquilaria spp. Semai dipelihara dan disiram setiap hari pada kondisi rumah kaca dan diamati selama 6 bulan. Temperatur di rumah kacar berkisar antara 26-35oC dan kelembaban udara 8090%. Gulma dan hama yang mengganggu semai dimonitor setiap hari.

E. Parameter Pertumbuhan
Percobaan inokulasi pada jenis-jenis Aquilaria terdiri atas (a) kontrol (tanpa inokulum); (b) Entrophospora sp.; (c) G. decipiens; (d) G. clarum; (e) Glomus sp. ZEA; dan (f) Glomus sp. ACA. Desain penelitian dilakukan dengan rancangan acak lengkap (RAL) dengan 30 ulangan. Parameter yang diukur adalah tinggi, diameter, dan daya hidup semai. Setelah berumur enam bulan, dilakukan pemanenan pucuk dan akar semai Aquilaria. Semua sampel di-oven pada suhu 70oC selama tiga hari. Analisis N dan P jaringan semai dilakukan dengan metode semi-micro Kjeldahl dan vanadomolybdate-yellow assay (Olsen and Sommers, 1982). Pada tingkat lapang, percobaan yang dilakukan hanya pada jenis A. beccariana dengan desain RAL yang sama. Percobaan dilakukan di Kawasan Hutan Dengan Tujuan Khusus (KHDTK) Dramaga di bawah naungan tegakan Gmelina arborea. Paramater yang diamati pada tingkat lapang ini adalah tinggi dan diameter A. beccariana yang telah dilakukan selama dua tahun.

F. Kolonisasi Mikoriza Arbuskula
Akar dari masing-masing jenis Aquilaria dicuci untuk membersihkan partikel-partikel tanah yang masih menempel. Akar dibersihkan dalam 100 g l-1 KOH selama satu jam, diasamkan dalam larutan HCl dan diberi warna dengan 500 mg l -1 tryphan blue dalam lactoglycerol (Brundrett et al., 1996). Kemudian akar

142

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

dicuci dalam 50% glycerol dan 100 potong akar berukuran satu cm diamati di bawah mikroskop compound dengan perbesaran 200x. Penghitungan kolonisasi mikoriza dilakukan dengan sistem skoring keberadaan dan tidak adanya struktur FMA (McGonigle et al., 1990).

G. Analisis Statistik
Analisis statistik menggunakan ANOVA dengan software StatView 5.0 (Abacus Concepts). Sedangkan analisis statistik lanjutan menggunakan uji beda nyata terkecil (LSD) apabila nilai F signifikan.

HASIL DAN PEMBAHASAN
Lima jenis fungi mikoriza arbuskula (FMA) sangat efektif mengkolonisasi sistem perakaran dari A. crassna, A. malaccensis, A. Microcarpa, dan A. beccariana setelah enam bulan diinokulasi pada kondisi rumah kaca. Dari hasil penelitian sebelumnya Santoso et al. (2008), kolonisasi FMA yang terjadi pada akar bibit A. microcarpa dimulai sebelum minggu ke-7 setelah inokulasi. Tidak ada perbedaan nyata antara lima jenis FMA dalam mengkolonisasi perakaran empat jenis Aquilaria. Kolonisasi FMA dapat meningkatkan parameter pertumbuhan tinggi, diameter batang, berat kering, berat basah, dan daya hidup semai Aquilaria di persemaian (Tabel 1). Pada jenis A. crassna, A. Malaccensis, dan A. microcarpa, penggunaan FMA Entrophospora sp. lebih efektif meningkatkan parameter pertumbuhan dibandingkan jenis FMA lainnya. Khusus FMA G. clarum sangat efektif meningkatkan parameter pertumbuhan pada jenis A. beccariana. Semai yang tidak diinokulasi terkolonisasi oleh FMA yang tidak teridentifikasi (110%), tetapi tidak dapat mempengaruhi pertumbuhan empat jenis Aquilaria. Kolonisasi FMA mampu meningkatkan serapan N dan P pada jaringan empat jenis Aquilaria dibandingkan semai yang tidak diinokulasi (Tabel 2). Peningkatan serapan N dan P ini memberikan pengaruh pada peningkatan dari parameter pertumbuhan empat jenis Aquilaria. Pada tingkat lapang, dilakukan kegiatan penanaman hanya pada jenis A. beccariana dua tahun setelah diinokulasi oleh FMA. Hasil penelitian pada tingkat lapang menunjukkan bahwa

143

Aspek SILVIKULTUR

jenis G. clarum lebih efektif dalam meningkatkan pertumbuhan A. beccariana dibandingkan dengan kontrol dan jenis FMA lain yang telah diujicobakan. Dari hasil penelitian ini memberikan informasi yang sangat penting dalam memanfaatkan inokulum FMA pada jenis-jenis Aquilaria spp. Regenerasi jenis-jenis Aquilaria yang berkelanjutan dapat dibantu dengan adanya pemanfaatan teknologi FMA dimulai pada saat di persemaian. Penggunaan FMA yang efektif dapat meningkatkan pertumbuhan Aquilaria yang sangat signifikan, sehingga biomassa pohon penghasil gaharu yang akan dipanen akan meningkat, artinya produk gaharu hasil induksi yang akan dipanen lebih meningkat produksinya. Penelitian ini sejalan dengan penelitian yang terdahulu, yaitu tentang pemanfaatan FMA pada 11 jenis Eucalyptus spp. (Adjoud et al., 1996), 17 jenis tanaman legume (Duponnois et al., 2001), Sesbania aegyptiaca dan S. grandiflora (Giri dan Mukerji, 2004). Penelitian pemanfaatan FMA pada jenis-jenis pohon tropika (Muthukumar et al., 2001) dan khususnya jenis-jenis Aquilaria menunjukkan bahwa ada kemungkinan inokulum FMA dapat menurunkan penggunaan pupuk kimia di persemaian. Meskipun perhitungan tentang keuntungan dan biaya penggunaan FMA belum diuji dalam penelitian ini, hasilnya tidak diragukan lagi menunjukkan FMA dapat menurunkan penggunaan pupuk kimia dalam penyediaan semai tanaman penghasil gaharu. Selanjutnya mekanisme penggunaan FMA sebagai pemacu pertumbuhan jenisjenis Aquilaria pada tanah masam dan pada tanah yang populasi FMA sangat rendah harus menjadi perhatian dan pertimbangan untuk mengetahui keberadaan FMA alami. Pola penanaman jenis-jenis Aquilaria dengan pola agroforestry sangat membantu mempercepat ketersediaan pohon-pohon penghasil gaharu di Indonesia. Pada prinsipnya, pencampuran dilakukan untuk melindungi pertumbuhan semai Aquilaria pada tahun pertama dan kedua dari sengatan sinar matahari. Jenis-jenis Aquilaria yang telah dikolonisasi oleh FMA akan dapat mempunyai hubungan antara sistem perakaran pohon jenis-jenis lain, sehingga kebutuhan nutrisi untuk pertumbuhan gaharu dapat terpenuhi.

144

melinjo. G. Gambar 1. clarum untuk memacu pertumbuhan tanaman dan serapan nutrisinya. crassna. 2. kelapa.Aca = Glomus sp.. ZEA. Ketersediaan inokulum FMA di tingkat 145 ..Penggunaan Fungsi Mikoriza . ACA. dkk. K = Kontrol. decipiens. dan A. Jenis FMA Entrophospora sp. Gc = G. Direkomendasikan untuk menggunakan jenis FMA efektif untuk mempercepat pertumbuhan jenis-jenis Aquilaria mulai di tingkat persemaian. beccariana lebih memilih jenis FMA G..) Jenis-jenis pohon yang direkomendasikan sebagai pohon pencampur dengan pohon penghasil gaharu adalah pohon karet. gmelina.ZEA = Glomus sp. Ent = Entrophospora sp. jengkol. microcarpa. G.(Maman Turjaman. Pertumbuhan tinggi dan diameter pohon penghasil gaharu Aquilaria beccariana setelah dua tahun ditanam di tingkat lapang. malaccensis. Penggunaan FMA pada jenis-jenis Aquilaria sangat signifikan dalam memacu pertumbuhan awal di persemaian dan lapangan. KESIMPULAN DAN REKOMENDASI 1..clarum. sengon. Khusus jenis pohon penghasil gaharu A. A. dan beberapa jenis lain pohon buah-buahan. kelapa sawit.. Gg = G. sangat efektif dalam memacu pertumbuhan tanaman dan serapan nurtisi pada jenis A. baik di tingkat semaian maupun lapangan.

Mycorrhiza 14 : 307-312. Mycorrhiza 6 : 129-135. agar penggunaan FMA menjadi efektif dan efisien. Lapeyrie. UNEP. Gravendeel. C. B. J-M. Giri. and B. C. H.M. 2005. Ding Hou.) Benth. Convention on International Trade in Endangered Species of Wild Fauna and Flora. Wolters-Noordhoff. II and III of CITES. 1996. Brundrett. 1-15. 6. Tamarindus indica L. Grove and N. Pontanier (2005). Thymelaeaceae.Aspek SILVIKULTUR pengguna dan sosialisasi penggunaanya perlu dilakukan. Bâ. 1996. 1960. Duponnois.M. Bougher. Groningen. The Netherlands. 2005. Appendices I. Mukerji. T. M. Halli-Hargas and F. T. In : Van Steenis. Forest Ecology and Management 207 : 351-362. to Arbuscular Mycorrhizal Fungi in a Phosphorus-Deficient Sandy Soil. p. Malajczuk. DAFTAR PUSTAKA Adjoud. Founoune. 48 pp. Duponnois. and Zizyphus mauritiana Lam. Masse and R.. M.G.. Response of 11 Eucalyptus Species to Inoculation with Three Arbuscular Mycorrhizal Fungi. Guinko and R.C. Dell. Biology and Fertility Soils 26 : 194-198. R. Plant Systematics and Evolution 254 : 1-12. Guisso. Canberra. 1998.J. 2004. Plenchette. CITES. (ed) Flora Malesiana. ACIAR Monograph 32... D. N. Vol.G. and K. Series I.Ouadba. A. Responses of Parkia biglobosa (Jacq.G. TrnL-TrnF Sequence Data Imply Paraphyly of Aquilaria and Gyrinops (Thymelaeaceae) and Provide New Perspectives for Agarwood Identification. Inoculation of Acacia holosericea with Ectomycorrhizal Fungi in a Semiarid Site in Senegal : Growth Response and Influences on The Mycorrhizal Soil Infectivity After 2 Years Plantation. R. B. S. Working with Mycorrhizas in Forestry and Agriculture. Mycorrhizal Inoculant Alleviates Salt Stress in Sesbania aegyptiaca and Sesbania grandiflora Under Field Conditions : Evidence for Reduced Sodium and Improved Magnesium Uptake. D. Eurlings. 146 .

Gunawan dan M..L.X. 1998. Reddy and D. Turjaman. In : Page AL (ed. E.. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil 147 . Phosphorus. L. Effect of Post-Planting Inoculation with Bradyrhizobium sp.A. A New Method Which Gives an Objective Measure of Colonization of Roots by Vesicular-Arbuscular Mycorrhizal Fungi. Santiago.). Wong (Eds. R. Biology and Fertility Soils 34 : 417-426 Olsen. 2002. 1999. West Kalimantan.D.P..M. in Two Tropical Soils. Leighton and I. Michelsen.. Samsoedin.R. An Ecological and Economic Assessment of The Nontimber Forest Product Gaharu Wood in Gunung Palung National Park. Essential-Oil Plants. S. Bogor. Q. Phosphate-Solubilizing and Asymbiotic Nitrogen-Fixing Bacteria Under Tropical Nursery Conditions. B.M. Dalbergia nigra Allem. and N.. G.. T.).. New Phytologist 115 : 495-501. McGonigle. Prosea. M. D.Penggunaan Fungsi Mikoriza . Soerianegara and W.R.. Timber Trees : Minor Commercial Timbers.. M. The Effect of VA Mycorrhizal Fungi. Evans. p 403-430. Santoso. 19. and S.P. 2000. Paoli.A.E... Oyen. Madison. Prosea. Phosphorus and Drought Stress on The Growth of Acacia nilotica and Leucaena leucocephala Seedlings. K. Peart. G. A. Indonesia. dkk. I.W. Udaiyan and V. 2001. S.H. Bagyaraj. Rajan.R.) Methods of Soil Analysis Part 2 Chemical and Micro-biological Properties. Garcia and M. Miller. Swan. Ex Benth. 2001. Rajeshkannan. Forest Ecology and Management 126: 91-95.J. Indonesia. Response of Neem (Azadirachta indica A. 2008.) Lemmens. Plant and Soil 124 : 7-13.J. Bogor. Indonesia. American Society of Agronomy. Screening of Arbuscular Mycorrhizal Fungi for Their Symbiotic Efficiency with Tectona grandis. 1990. and Mycorrhizal Fungi on The Growth Brazilian Rosewood. 5 (2). G. Sommers. A. Conservation Biology 15 : 1721-1732. Muthukumar.(Maman Turjaman. New Forests 24 : 15-25. Rosendhal.K. Fairchild and J. Dung (Eds.. Plant Resources of South-East Asia No. T. and L. Scotti.G.D. 1990. 1982. Juss) to Indigenous Arbuscular Mycorrhizal Fungi.H. Plant Resources of South-East Asia No.J.C. D.

Jurnal Penelitian Hutan dan Konservasi Alam IV (5): 499-509. 148 .Aspek SILVIKULTUR Gaharu. Bogor. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

Lampiran 1. Kolonisasi mikoriza arbuskula dan pertumbuhan pada jenisjenis Aquilaria setelah enam bulan pada kondisi di rumah kaca
Kolonisasi AM Tinggi (cm) Diameter (mm) Berat basah Pucuk (g) Akar (g) Berat kering Pucuk (g) Akar (g) Daya hidup (%)

Perlakuan

A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA 10a 85b 71b 79b 61b 84b 15,40a 19,20b 32,18d 45,30e 32,03d 26,24c 1,90a 2,37b 3,94c 5,02d 3,75c 3,53c 0,30a 5,46e 4,74d 6,74f 3,14b 3,84c 0,10a 2,54c 1,64b 2,82d 1,38c 1,20b 0,09a 1,76c 1,59c 2,30d 0,97b 1,19b 0,02a 0,78c 0,41b 0,91d 0,36b 0,28b 73 100 100 100 100 100 2a 97b 88b 83b 85b 87b 13,39a 24,74d 21,99c 20,28c 17,24b 18,09b 2,23a 3,89c 3,67c 3,58c 2,84b 2,98b 0,75a 4,32c 3,87c 3,46c 2,24b 2,70b 0,34a 2,29c 3,41d 1,55b 1,08b 1,23b 0,23a 1,31c 1,44c 0,95b 0,64b 0,76b 0,09a 0,37b 0,57c 0,30b 0,24b 0,28b 67 100 97 93 87 90 1a 97b 88b 83b 84b 86b 16,43a 25,97c 21,91b 19,96b 22,33b 21,30b 2,28a 3,88c 3,02b 2,94b 3,26b 3,12b 1,46a 4,68c 2,92b 2,90b 2,62b 2,74b 0,52a 2,24c 1,20b 1,28b 1,38b 1,22b 0,41a 1,44c 0,88b 1,95c 0,79b 0,89b 0,18a 0,48c 0,27b 0,78c 0,27b 0,26b 73 100 100 97 90 93 4a* 73b 63b 78b 78b 59b 20,90 a 46,14 c 29,58 b 32,43 b 38,94 c 24,60 a 2,9 a 5,4 c 4,1 b 4,4 b 4,7 b 3,7 a 0,68a 1,06a 0,33a 3,82b 3,26b 0,86a 2,99b 4,19b 0,13a 1,35b 1,56b 0,27a 1,01b 1,52b 70 100 100 100 87 100

12,58b 5,72b 11,64b 7,36b 8,82b 9,92b 4,3b 4,54b

13,46b 6,94b

149

Aspek SILVIKULTUR

Lampiran 2. Kandungan N dan P pada jenis-jenis Aquilaria setelah enam bulan diinokulasi oleh beberapa jenis fungi mikoriza arbuskula (FMA)
N Concentrations (mg/g) N Content (mg/plant) P Concentrations (mg/g) P Content (mg/plant)

Perlakuan A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA

7,9 ± 0,1a* 9,8 ± 0,1c 8,2 ± 0,2a 8,7 ± 0,2b 8,7 ± 0,1b 10,8 ± 0,2d

2,6 ± 0,6a 37,7 ± 4,3d 26,7 ± 4,1c 7,4 ± 1,0b 25,8 ± 3,6c 45,9 ± 9,6d

0,78 ± 0,02a 1,42 ± 0,03e 0,85 ± 0,02b 0,95 ± 0,02c 0,96 ± 0,03c 1,22 ± 0,02d

0,26 ± 0,06a 5,4 ± 0,6d 2,8 ± 0,5c 0,82 ± 0,14b 2,85 ± 0,41c 5,14 ± 1,0d

8,6 ± 0,2a 12,1 ± 0,1d 10,7 ± 0,1c 10,4 ± 0,1b 11,1 ± 0,2c 10,9 ± 0,2c

3,49 ± 0,5a 17,28 ± 2,0c 9,02 ± 0,7b 20,5 ± 3,3c 8,8 ± 0,9b 9,7 ± 1,8b

0,65 ± 0,02a 0,73 ± 0,01b 0,85 ± 0,01c 0,72 ± 0,02b 0,77 ± 0,03b 1,04 ± 0,03d

0,26 ± 0,04a 1,06 ± 0,15d 0,75 ± 0,07c 1,60 ± 0,20e 0,6 ± 0,07b 0,92 ± 0,17c

7,8 ± 0,1a 9,6 ± 0,2c 9,6 ± 0,1c 9,3 ± 0,1c 9,4 ± 0,1c 8,9 ± 0,2b

1,02 ± 0,07a 16,9 ± 1,5d 11,7 ± 0,9c 8,3 ± 0,4b 9,17 ± 1,35b 8,28 ± 0,40b

0,65 ± 0,02a 1,12 ± 0,03d 0,86 ± 0,01c 0,78 ± 0,02b 0,77 ± 0,03b 0,77 ± 0,02b

0,08 ± 0,01a 1,97 ± 0,18d 1,20 ± 0,18c 0,70 ± 0,03b 0,75 ± 0,12b 0,9 ± 0,1b

6,0 ± 0,1a 9,9 ± 0,2c 10,6 ± 0,1c 11,3 ± 0,d 9,4 ± 0,1b 8,8 ± 0,2b

5,02 ± 0,07a 10,2 ± 1,0c 11,8 ± 0,8c 12,5 ± 0,4d 9,17 ± 1,35b 9,28 ± 0,40b

0,40 ± 0,02a 0,98 ± 0,02d 0,89 ± 0,03c 1,11 ± 0,02e 0,77 ± 0,03b 0,97 ± 0,02d

0,10 ± 0,01a 0,87 ± 0,20d 1,25 ± 0,21c 1,95 ± 0,03e 0,75 ± 0,12b 1,04 ± 0,1c

*Nilai-nilai dengan huruf yang sama adalah tidak berbeda nyata (P<0.05).

150

8
HAMA PADA TANAMAN PENGHASIL GAHARU
Ragil SB Irianto, Erdy Santoso, Maman Turjaman, Irnayuli R. Sitepu
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Tanaman penghasil gaharu yang ada di Indonesia sekitar 27 jenis, beberapa di antaranya yang cukup potensial menghasilkan gaharu yaitu Aquilaria spp., Aetoxylontallum spp., Gyrinops spp., dan Gonystylus spp. Pemanfaatan gaharu di Indonesia oleh masyarakat terutama di pedalaman Pulau Sumatera dan Kalimantan telah berlangsung ratusan tahun yang lalu. Secara tradisional gaharu dimanfaatkan, antara lain dalam bentuk dupa untuk upacara keagamaan, pengharum tubuh dan ruangan, bahan kosmetik dan obat-obatan sederhana. Produk gaharu saat ini sangat dicari oleh para pencari gaharu, karena harganya yang cukup mahal, dimana harga gaharu super dapat mencapai sekitar Rp 40 juta/kg. Akibat dari harga yang cukup tinggi tersebut, maka para pencari gaharu semakin intensif untuk mendapatkannya, saat ini para pencari gaharu mulai memfokuskan mencari gaharu di Pulau Papua yang potensi alamnya (gaharu) masih cukup tinggi dibandingkan dengan di Pulau Kalimantan atau Sumatera.

151

Aspek SILVIKULTUR

Dengan semakin langkanya tanaman penghasil gaharu di lapang dan harganya yang cukup tinggi tersebut, maka para peneliti kehutanan, rimbawan, dan masyarakat awam mulai mendomestikasi atau menanam tanaman penghasil gaharu di luar habitat aslinya. Saat ini banyak sekali para petani maupun orang kota yang mulai menanam tanaman penghasil gaharu dalam skala kecil dari beberapa pohon sampai dengan ribuan pohon. Penanaman tanaman penghasil gaharu yang monokultur dan di luar habitat aslinya pada umumnya akan rentan terhadap serangan hama dan penyakit. Dimulai dua tahun yang lalu banyak sekali sentra penanaman tanaman penghasil gaharu yang terserang hama daun Heortia vitessoides Moore. Sentra penanaman tanaman penghasil gaharu yang terserang hama dan telah dilaporkan terdapat di KHDTK Carita (2008), Sanggau (2007), Mataram (2009), dan lain-lain.

HAMA Heortio vitessoides
A. Gejala Serangan
Gejala serangan tingkat awal adalah permukaan daun yang muda dimakan oleh larva instar pertama dan daun tersebut hanya meninggalkan tulang-tulang daunnya. Pada stadia lebih lanjut ulatulat tersebut mulai menyerang daun-daun pada bagian cabang lebih atasnya dan menyebabkan tanaman menjadi gundul. Ngengat meletakkan telurnya pada bagian bawah permukaan daun yang muda pada cabang tanaman yang dekat dengan permukaan tanah.

B. Siklus Hidup
1. Telur
Ngengat meletakkan telurnya yang berwarna putih kekuningkuningan yang akan segera berubah menjadi kuning kehijauhijauan dalam bentuk kluster pada bagian bawah permukaan daun

152

Ulat akan membungkus dirinya dengan butiran-butiran tanah atau serpihan-serpihan serasah yang ada di permukaan dengan bantuan benang-benang suteranya.. dkk.. Stadium pupa berkisar 8 hari. Telur akan menetas sekitar 10 hari.. Larva/Ulat Ulat H. jumlah telur yang dihasilkan per imago betina berkisar antara 350-500. 4. 3.(Ragil SB Irianto. Ngengat betina dapat meletakkan telur sebanyak 350-500. Ngengat (4 Hari) Kepompong (8 Hari) Telur (10 Hari) Larva (23 Hari) Gambar 1. Stadium ngengat berkisar sekitar 4 hari. Larva instar terakhir pada saat akan berkepompong mulai berhenti makan dan ulat turun ke permukaan tanah untuk berkepompong. Siklus hidup hama daun tanaman penghasil gaharu H. vitessoides pada instar pertama berwarna kuning pucat dan pada instar selanjutnya menjadi hijau kekuning-kuningan. Pupa Larva instar terakhir sebelum berkepompong akan berhenti makan dan turun ke permukaan tanah dengan bantuan benang sutera yang dihasilkannya.) yang muda pada cabang tanaman yang dekat dengan permukaan tanah. vitessoides 153 .Hama pada Tanaman . 2.. Ngengat Serangga dewasa berbentuk ngengat yang aktif pada waktu malam. ulat ini terdiri dari 5 instar dan berlangsung selama 23 hari.

dan lain-lain untuk merangsang tumbuhnya tunas-tunas baru. Mekanis Pengendalian mekanis merupakan pengendalian yang sangat sederhana.Aspek SILVIKULTUR STRATEGI PENGENDALIAN A. dan lain-lain. 2. rambutan. yaitu dengan cara mengambil ulat atau telur yang ada di tanaman tersebut. Pengendalian dengan cara ini mudah diaplikasikan terutama pada pesemaian atau bibit yang baru dua tahun. Kimiawi Pengendalian kimiawi dapat dilakukan dengan insektisida kontak. Jangka Pendek 1. B. melinjo. seperti Beauveria bassiana atau Bacillus thuringiensis. Karena hama ini memakan daun dan pada serangan berat umumnya tanaman gundul. Jangka Menengah 1. dimana tanaman masih bisa dijangkau oleh orang dengan berdiri tanpa bantuan alat. Pencarian sarang semut rangrang yang memiliki ratu merupakan salah satu faktor 154 . sistemik atau dengan insektisida yang berbahan aktif mikroorganisme. growmore. Nabati Pengendalian nabati merupakan pengendalian yang cukup sederhana dan dapat dilakukan oleh petani sendiri dengan mengambil bahan-bahan yang ada di sekitar lokasi penanaman tanaman gaharu. seperti tanaman nangka. sudah populer di tingkat petani. durian. Predator Rangrang Semut rangrang (Oecophylla smaradigna) merupakan serangga yang mudah ditemukan di kampung-kampung pada tanamantanaman yang banyak mengeluarkan nektar. 3. maka disarankan pada saat penyemprotan dikombinasikan dengan pemupukan lewat daun dengan pupuk daun seperti gandasil.

Cuc. C. 155 . R. dkk. 2004.(Ragil SB Irianto. V. and S.Hama pada Tanaman .. Geobios 29: 13-16. P. 59 p.) keberhasilan dalam perkembangan populasi serangga tersebut dalam jangka panjang. C. Heortia vitessoides Moore A Serious Pest of Agarwod Plant (Aquilaria malaccensis Lamk). T. A Historical Review of Research on The Weaver Ant Oecophylla in Biological Control. ICRAF. Musuh Alami Musuh alami. V. 2008. Nath. T. dan N. Bhattacharyya. DAFTAR PUSTAKA Kalita. J. Jangka Panjang 1.. 2002. Mele. Teknik Silvikultur Pengendalian dengan cara teknik silvikultur merupakan salah satu cara pengendalian yang sudah menyatu dengan penanaman suatu tanaman dan termasuk pengendalian yang sudah cukup dikenal oleh petani. Agricultural and Forest Entomology 10: 13-22. vitessoides merupakan suatu cara pengendalian yang sangat diharapkan dalam jangka panjang. Mele. Semut Sahabat Petani: Meningkatkan Hasil Buah-Buahan dan Menjaga Kelestarian Lingkungan Bersama Semut Rangrang. 2.. P. baik parasit maupun predator dari serangga perusak daun tanaman penghasil gaharu H... P.

156 .

Aspek SOSIAL EKONOMI DAN KONSERVASI 157 .

158 .

Jika tanaman ini terluka. Sejenis resin beraroma ini berasal dari tanaman jenis Aquilaria. pau d’aquila (Portugis). rusak atau terinfeksi. chenxiang (China). bois d’aigle (Perancis). 2008). gaharu (Indonesia). Gyrinops. baik disebabkan penyakit atau serangan serangga. dan adlerholz (Jerman). aloeswood. Beberapa nama diberikan pada gaharu seperti agarwood. Resin ini sebetulnya dapat melindungi tanaman dari infeksi yang lebih besar sehingga dapat dianggap sebagai sistim imun yang dihasilkan (Squidoo. ood. akan menghasilkan resin/substansi aromatik berupa gumpalan atau padatan berwarna coklat muda sampai coklat kehitaman yang terbentuk pada lapisan dalam dari jenis kayu tertentu sebagai reaksi dari infeksi/ luka tersebut. Aquilaria yang merupakan tanaman penghasil gaharu saat ini menjadi jenis yang dilindungi 159 . dan Gonystylus. oodh (Arab). oudh. Tanaman penghasil gaharu secara alami tumbuh di wilayah Asia Selatan dan Asia Tenggara.9 PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti Pusat Litbang Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu tanaman hutan yang mempunyai nilai ekonomi tinggi karena kayunya mengandung resin yang harum.

Sebagai akibatnya pada beberapa tahun terakhir ada kecenderungan besar-besaran untuk mambudidayakan gaharu terutama di wilayah Asia Tenggara (Squidoo. Pengembangan budidaya gaharu dengan pola PHBM (sistem bagi hasil) merupakan salah satu alternatif bentuk usahatani produktif yang selain bertujuan untuk mengembangkan budidaya gaharu secara luas juga sekaligus dapat meningkatkan pendapatan masyarakat serta mengurangi tekanan masyarakat terhadap hutan yang tingkat ketergantungannya terhadap hutan tinggi.Aspek SOSIAL EKONOMI DAN KONSERVASI di banyak negara dan eksploitasi gaharu dari hutan alam dianggap sebagai kegiatan ilegal. Namun karena pengusahaan gaharu memerlukan modal yang tidak sedikit. dan Kalimantan Selatan. 2008). Kesepakatan internasional seperti CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) yang disepakati oleh 169 negara ditetapkan untuk menjamin bahwa perdagangan gaharu tidak mengganggu survival dari Aquilaria. perlu dikembangkan suatu skema kerjasama antara pemilik modal dengan masyarakat. Meskipun demikian. maka masyarakat yang mampu membudidayakan gaharu adalah kelompok yang memiliki permodalan yang kuat. Salah satu bentuk kemitraan yang dapat dikembangkan adalah pola PHBM (Pengelolaan Hutan Berbasis Masyarakat). Di Indonesia. Upaya pembudidayaan tersebut makin berkembang karena ditunjang oleh kemajuan hasil penelitian yang menunjukkan bahwa budidaya gaharu memberikan keuntungan yang layak bagi pelakunya. eksploitasi gaharu secara ilegal ternyata tetap berlangsung dan konsumen yang kurang memahami hal ini secara tidak sadar justru menciptakan permintaan yang tinggi yang dapat membahayakan keberadaan tanaman Aquilaria (Blanchette. permintaan akan gaharu jauh melebihi supply yang ada. PHBM diharapkan menjadi suatu cara yang efektif karena melibatkan masyarakat sekitar hutan dan parapihak pemangku 160 . tingginya harga gaharu dan makin langkanya tanaman gaharu di hutan alam juga mendorong masyarakat di berbagai daerah untuk melakukan budidaya gaharu seperti yang terjadi di Riau. Sumatera Utara. 2006). Untuk mengembangkan budidaya gaharu secara lebih luas. Jambi. Sampai saat ini.

dan saling mendukung...... laporan hasil penelitian........ hak dan kewajiban) dengan prinsip saling menguntungkan......(Sri Suharti) kepentingan lainnya untuk bekerjasama dan berbagi (ruang. waktu..... tingkat diskonto atau potongan (=bunga bank yang berlaku). serta berbagai terbitan lainnya.... METODOLOGI Tulisan ini merupakan hasil desk study dari berbagai pustaka. Suatu kegiatan usaha dinyatakan layak secara finansial bila nilai NPV > 0. CITES. Asosiasi Gaharu Indonesia (Asgarin).. Departemen Kehutanan. saling memperkuat... dan Benefit Cost Ratio (B/C ).... biaya pada tahun t.. benefit atau penerimaan pada tahun t..... NPV atau nilai kini bersih dirumuskan sebagai berikut: n Bt − Ct NPV = ∑ t =0 (1 + i)t . BPS. Data dan informasi yang berhasil dihimpun.. Khusus untuk perhitungan analisis finansial usahatani gaharu digunakan kriteria kelayakan Net Present Value (NPV)........ dan data statistik yang tersedia.Prospek Pengusahaan Gaharu ............... diolah dan Dianalisis secara deskriptif. Internal Rate of Return (IRR).. umur ekonomi proyek (cakrawala waktu). Data dan informasi serta literatur tersebut dihimpun dari berbagai sumber antara lain.............. (1) dimana: NPV Bt Ct i n = = = = = Net Present Value (Nilai Kini Bersih)............ Tulisan ini bertujuan untuk memberikan gambaran tentang prospek pengusahaan gaharu oleh masyarakat melalui pola pengelolaan hutan berbasis masyarakat (PHBM).... IRR atau tingkat pengembalian internal dirumuskan sebagai berut: 161 .

............. nilai B/C dirumuskan sebagai beikut: n Bt ∑ t =0 (1 + i)t B/C = n Ct ∑ t =0 (1 + i)t ............ NPV2 = nilai NPV negatif mendekati nol.Aspek SOSIAL EKONOMI DAN KONSERVASI IRR = i1 + NPV1 NPV1 − NPV2 (i2 − i1) .............................. PROSPEK PENGUSAHAAN GAHARU A.... nilai NPV mendekati nol positif.......... Suatu bisnis dinyatakan layak secara finansial bilai nilai IRR lebih besar dari tingkat suku pinjaman di bank yang berlaku saat ini. biaya pada tahun t................... tingkat diskonto. benefit atau penerimaan pada tahun t... (2) dimana: IRR = i1 = NPV1 = i2 = Internal Rate of Raturn (tingkat keuntungan internal)............ Kegiatan usaha dikatakan layak apabila B/C > 1. tingkat diskonto untuk menghasilkan NPV1 mendekati nol...................... umur ekonomis proyek........... (3) dimana: B/C Bt Ct i n = = = = = Benefit Cost Ratio ( Rasio penerimaan-biaya). tingkat diskonto untuk menghasilkan NVP2 negatif mendekati nol.. Selanjutnya.... Prospek Pasar Gaharu Indonesia adalah produsen gaharu terbesar di dunia dan menjadi tempat tumbuh endemik beberapa spesies gaharu komersial dari 162 ...........

penghasil gaharu terbaik ke dalam daftar Ap-pendix II dan sejak saat itu ekspor gaharu dibatasi oleh kuota yaitu hanya 250 ton/tahun (Anonim. hirta. dan Gyrinops spp. Selanjutnya. Permintaan terhadap gaharu terus meningkat karena banyaknya manfaat gaharu. tidak hanya dengan cara memungut dari pohon gaharu yang mati alami melainkan juga dengan menebang pohon hidup. beberapa agama di dunia mensyaratkan wangi gaharu yang dibakar sebagai sarana peribadatan (untuk keperluan kegiatan religi). filarial. A. Seiring dengan kemajuan ilmu pengetahuan dan teknologi industri. tetapi juga digunakan sebagai bahan baku obat-obatan. total ekspor gaharu dari Indonesia terus menurun hingga jauh di bawah ambang kuota CITES. karena sulitnya memperoleh bahan 163 .. A.Prospek Pengusahaan Gaharu . dan pengawet berbagai jenis asesoris. karena adanya kekhawatiran akan punahnya spesies gaharu di Indonesia. gaharu tidak hanya digunakan sebagai bahan wangi-wangian (industri parfum). A.(Sri Suharti) marga Aquilaria seperti A. maka sejak tahun 2005 Departemen Kehutanan kembali menurunkan kuota ekspor menjadi hanya 125 ton/tahun (Anonim. Selain itu.487 ton. Semakin sulitnya mendapatkan gaharu di hutan alam telah mengakibatkan semua pohon gaharu (Aquilaria spp.. tingginya permintaan gaharu belum dapat dipenuhi karena kekurangan bahan baku bermutu tinggi untuk ekspor. malaccensis. dupa.400 kg tahun 2006. 2004).. Ekspor untuk pasar Timur Tengah sebagai contoh menurun dari 67. namun eksploitasi hutan alam tropis dan perburuan gaharu yang tidak terkendali telah mengakibatkan spesies-spesies gaharu menjadi langka. Bahkan sejak tahun 2000. jumlah ekspor gaharu Indonesia mencapai sekitar 1. A.) dimasukkan dalam Apendix II pada konvensi CITES tanggal 2-14 Oktober 2004 di Bangkok (Gun et al. Tingginya harga jual gaharu mendorong masyarakat untuk memburu gaharu. 2005). dan lain-lain..245 kg pada tahun 2005 menjadi 39. malaccensis. Hal ini banyak dikeluhkan oleh beberapa eksportir gaharu Indonesia. 2005). microcarpa. Oleh karena itu pada tahun 1995 CITES memasukkan A. beccariana. Pada tahun 1985. Namun dari sisi negara pengekspor.. kosmetika. Perkembangan yang terjadi selanjutnya ternyata kurang begitu bagus.

filarial 180.000 180.000-50. Keluhan kekurangan bahan baku gaharu untuk ekspor juga dialami oleh pemasok pasar Singapura.523 (termasuk A. Pada awalnya kenaikan harga gaharu relatif lambat.000 Aktual ekspor berdasar CITES Indonesia*) n/a≠)) 299.000 300.000/ kg untuk kualitas rendah dan Rp 80. Sebagai gambaran.000 225.000 50.150 219.238 81.000/kg pada tahun 1993. baik di pasar dunia maupun di tingkat pengumpul.000 70. filarial dan jenis lain 287.245 n/a Tahun 1995 1996 1997 1998 1999 2000 2001 2002 2003 *): CITES Management Authority of Indonesia.000 300.2003 Kuota hasil panen resmi*) n/a 300.593 287.377 74.000 225.002 (termasuk A.000 68.401 81.000 75. Penurunan kemampuan ekspor Indonesia tersebut sudah diprediksi oleh berbagai pihak karena eksploitasi hutan dan perburuan gaharu yang tidak terkendali.826 n/a n/a Total ekspor gaharu (semua spesies)*) n/a≠ 299.000 150. dari Indonesia tahun 1995 . Pada tahun 1980. CV Ama Ina Rua. pada Tabel 1 disajikan data hasil kajian tentang perdagangan gaharu di Indonesia yang diterbitkan CITES pada tahun 2003. **): CITES Annual Report Data Compiled by UNEP-WCMC. Tabel 1.000 150.000/kg untuk kualitas super.546 n/a Net ekspor laporan CITES **) 323. Sebagai contoh.Aspek SOSIAL EKONOMI DAN KONSERVASI baku gubal super yang diminta.000 75.826 70.002 n/a ≠) 313.212 76.483 147.772 175. harga gaharu di tingkat pengumpul berkisar antara Rp 30.593 305.079 81. Penurunan kemampuan ekspor Indonesia tersebut sangat berpengaruh terhadap perkembangan harga gaharu.577 293. eksportir di Jakarta yang pada tahun 2005 bisa mengekspor 5-6 ton/bulan.377 74.000 50. 2009).000 120.649 245. pada tahun 2006 hanya mampu mengekspor 2-3 ton/bulan (Adijaya.000 kg) 148. ≠): the reason for the unavailability of data for 1995 1nd 1998 is not known 164 . Kenaikan pesat terjadi pada saat krisis ekonomi melanda Indonesia tahun 1997. yaitu hanya naik menjadi Rp100.000 Kuota hasil aktual*) n/a 160. Hasil pemanenan dan ekspor gaharu jenis Aquilqria spp.

Hutan Produksi Terbatas 22. Pakistan. A.8 juta ha. tersebar di daerah tropis Asia mulai dari India. 2006). 165 .. Pada saat ini luas kawasan hutan dan perairan Indonesia berdasarkan Keputusan Menteri Kehutanan tentang Penunjukkan Kawasan Hutan dan Perairan serta Tata Guna Hutan Kesepakatan (TGHK) tercatat seluas 137. Marga Aquilaria terdiri dari 15 spesies. terdiri dari Kawasan Suaka Alam dan Pelestarian Alam 23. Hutan Lindung 31. Myanmar. microcarpa. beccariana. 2009. dan Taman Buru 0. Hutan Produksi Tetap 36. Hutan Produksi yang Dapat Dikonversi 22. Wiguna. Thailand. Indonesia memiliki potensi yang sangat besar untuk menghasilkan gaharu. China Selatan. dihasilkan gaharu sebagai salah satu hasil hutan bukan kayu yang bernilai ekonomi tinggi.09 juta ha. Kenaikan harga gaharu terus berlanjut dan makin tajam hingga mencapai Rp10 juta/ kg pada tahun 2000 dan meningkat lagi hingga mencapai Rp 15 juta/ kg pada tahun 2009 (Adijaya.. Malaysia. Gyrinops.(Sri Suharti) di mana harga gaharu mencapai Rp 3-5 juta/kg.23 juta ha (Departemen Kehutanan. Philipina.. Dari kawasan hutan tersebut khususnya dari kawasan hutan produksi alam. Potensi dan Peluang Usaha Sebagaimana diuraikan sebelumnya.65 juta ha. Lao PDR. Kondisi tersebut menggambarkan bahwa gaharu sangat prospektif untuk dikembangkan. malaccensis. Gaharu dihasilkan oleh pohon-pohon terinfeksi yang tumbuh di daerah tropika dan memiliki marga Aquilaria.6 juta ha.31 juta ha. sehingga produksi gaharu Indonesia terus menurun. 2007). hirta. A. Enam di antaranya ditemukan di Indonesia (A. Kamboja.. A.5 juta ha.Prospek Pengusahaan Gaharu . namun potensi yang tersedia tersebut sampai saat ini belum dimanfaatkan secara optimal dan produksi gaharu lebih banyak berasal dari proses alami. cumingiana. dan Indonesia. khususnya bagi Indonesia yang memiliki potensi biologis yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. A. dan Gonystilus yang keseluruhannya termasuk dalam famili Thymelaeaceae. B.

Marga Gyrinops memiliki tujuh spesies. HTI. Setelah tanaman penghasil gaharu berumur 5 tahun dengan diameter 15 cm. Marga Gonystilus memiliki 20 spesies. kelapa. kemedangan. Hasil rekayasa tersebut dapat dipanen satu atau dua tahun kemudian. tersebar di Asia Tenggara mulai dari Malaysia. rekayasa produksi untuk menghasilkan gaharu sudah dapat mulai dilakukan dengan cara teknik induksi/inokulasi penyakit pembentuk gaharu yang sesuai dengan jenis pohon. dan abu/ bubuk (Sumarna. dan lain-lain). Philipina. Keenam jenis tersebut terdapat hampir di seluruh kepulauan Indonesia. 2002). 2007). tetapi idealnya dipanen setelah pohon mati dengan variasi mutu produksi akan terdiri dari kelas gubal. 2009) atau di bawah tegakan pohon hutan seperti meranti. durian (Rizlani dan Aswandi. filarial). dan Irian Jaya. Hutan Rakyat juga dapat ditanam pada areal tanaman perkebunan (karet. Jika ditanam secara monokultur dan tanpa naungan resiko kegagalan penanaman (tanaman muda) lebih tinggi. Indonesia. sawit. Maluku. penanaman pohon gaharu sebaiknya dilakukan secara tumpangsari atau berada di bawah naungan tegakan lain seperti karet. Bali. Pemanenan dapat dilakukan pada kondisi pohon belum mati. Keberhasilan berbagai hasil penelitian 166 . Sembilan spesies di antaranya terdapat di Indonesia yaitu di Sumatera. Papua New Guinea. mahoni. Peninsula. Persyaratan tumbuh serta pemeliharaan tanaman penghasil gaharu relatif tidak terlalu rumit. Serawak. sawit. pulai seperti yang dikembangkan di KHDTK Carita. dan kepulauan Solomon serta kepulauan Nicobar. Bali. Pembudidayaan tanaman penghasil gaharu dapat dilakukan secara monokultur maupun tumpangsari dengan tanaman lainnya. Beberapa alternatif pengembangan budidaya pohon penghasil gaharu selain pada hutan produksi (LOA). Berbagai hasil penelitian tentang tanaman gaharu memberikan hasil yang sangat menggembirakan karena berbagai jenis tanaman gaharu dari hutan alam ternyata dapat dibudidayakan dan produksi gaharu dapat direkayasa. kecuali Jawa. dan Nusa Tenggara.Aspek SOSIAL EKONOMI DAN KONSERVASI dan A. Sabah. Karena sifat permudaan gaharu yang toleran terhadap cahaya (butuh naungan). Enam di antaranya tersebar di Indonesia bagian timur serta satu spesies terdapat di Srilanka (Anonim. Kalimantan.

Selain itu Dinas Kehutanan Riau juga menanam jenis yang sama seluas 10 hektar di Taman Hutan Raya Syarif Hasyim. Kecamatan Tabir Ulu. Sebagai contoh usaha yang dilakukan oleh para petani di Desa Pulau Aro.. 2. Kelayakan Pengusahaan Gaharu Untuk memperoleh gambaran bagaimana kelayakan pengusahaan gaharu melalui budidaya dan rekayasa produksi gaharu. berikut ini dilakukan contoh analisis finansial budidaya gaharu dengan asumsi tingkat keberhasilan mencapai 60%. kelas kemedangan II sebesar 40%. Analisis finansial tersebut menggunakan beberapa batasan dan asumsi sebagai berikut: 1. Selain itu. malacensis dan A. microcarpa. malaccensis seluas lebih dari 10 hektar. sampai akhir tahun 2002 terdapat sekitar 116 petani yang tergabung dalam Kelompok Tani Penghijauan Indah Jaya yang telah mengembangkan lebih dari seratus ribu bibit gaharu (Anonim. Jambi. PT Budidaya Perkasa di Riau dengan menanam A. Selanjutnya pada tahun 2001-2002 beberapa individu atau kelompok tani juga mulai tertarik untuk membudidayakan jenis pohon penghasil gaharu. 167 . Tanaman yang bertahan hidup dan menghasilkan gaharu diasumsikan 60% dengan tingkat produksi 2 kg per pohon.. BP DAS Batanghari bekerjasama dengan Badan Litbang Kehutanan pada 2004/2005 membuat demplot budidaya gaharu di antara tegakan tanaman karet rakyat seluas 50 ha (Sumarna. 2008). yang menanam gaharu dari jenis A. sehingga total produksi 480 kg/ha dengan 3 kualitas masingmasing kelas kemedangan I sebesar 10%. 2007). dan kelas kemedangan III sebesar 50%.(Sri Suharti) tersebut makin mendorong dan menggugah pemburu gaharu untuk melakukan budidaya tanaman gaharu. Upaya pembudidayaan gaharu sudah mulai dirintis sejak tahun 1994/1995 oleh sebuah perusahaan pengekspor gaharu. Pengusahaan gaharu dilakukan pada luasan satu ha dengan jarak tanam 5 m x 5 m.. Kabupaten Merangin. Di desa tersebut. C. sehingga kerapatan 400 pohon per hektar.Prospek Pengusahaan Gaharu ..

53%. kelas kemedangan II = Rp 2 juta/ kg. sehingga total biaya inokulan Rp 20 juta/ha. 4. dan kelas kemedangan III = Rp 500 ribu/kg. Harga jual produksi gaharu hasil inokulasi untuk kelas kemedangan I = Rp 5 juta/kg. dan adanya pencurian pohon di kebun gaharu (Duryatmo. dan biaya tenaga kerja Rp 74.350 juta.50 juta. dan tenaga kerja untuk pemungutan hasil (panen) yang besarnya mencapai Rp 77 juta atau sekitar 54. Berdasarkan asumsi dan batasan tersebut ternyata untuk pengusahaan satu hektar gaharu dibutuhkan biaya sebesar Rp 141. Hasil analisis finansial menunjukkan bahwa pengusahaan gaharu tersebut layak untuk dilaksanakan karena dapat menghasilkan keuntungan bersih nilai kini (NPV) sebesar Rp 147. 5. 6. sedangkan upah tenaga kerja untuk inokulasi Rp 30.000/pohon. PROSPEK PENGUSAHAAN GAHARU DENGAN POLA PHBM A. 2009). dan B/C = 3. Peluang Pengembangan Gaharu dengan Pola PHBM Pembudidayaan tanaman penghasil gaharu akhir-akhir ini makin marak karena sebagian masyarakat sudah dapat menikmati hasilnya.74 juta/ ha. beban biaya yang relatif besar adalah untuk pembelian bahan inokulan.000/HK. Biaya tersebut meliputi biaya pra-investasi dan persiapan lahan serta penanaman sebesar Rp 26.350 juta. Analisis finansial menggunakan tingkat diskonto sebesar 15%. 168 .Aspek SOSIAL EKONOMI DAN KONSERVASI 3. baik tenaga kerja keluarga maupun luar keluarga diasumsikan sebesar Rp 50. Kalau diperhatikan lebih seksama.32 (Lampiran 1). Upah tenaga kerja. IRR sebesar 48. kegagalan dalam melakukan inokulasi. Harga inokulan diasumsikan Rp 50. Namun di sisi lain juga dijumpai beberapa kasus ketidakberhasilan pengusahaan gaharu yang disebabkan antara lain oleh kegagalan dalam pemeliharaan. biaya bahan dan peralatan Rp 40.000/pohon. tenaga kerja untuk inokulasi.50 juta.47% dari total biaya.

Salah satu bentuk kemitraan yang dapat dikembangkan adalah melalui pola pengelolaan hutan berbasis masyarakat (PHBM). Masyarakat dengan keterbatasan sumberdaya yang dimiliki (lahan. perlu dikembangkan suatu pola kemitraan dalam budidaya tanaman penghasil gaharu. maka parapihak yang terlibat dalam kegiatan ini dapat memperoleh bagian/ sharing manfaat sesuai kontribusi masing-masing. masyarakat) dapat berbagi peran dan tanggung jawab untuk mengembangkan tanaman gaharu. Pengembangan gaharu dengan pola PHBM dapat dilakukan. akses pasar. sarana prasarana. dan pengelolaan hutan (Hayat. 2007). dan lain-lain) dapat ikut berperan dalam pengusahaan tanaman gaharu. Pada areal hutan milik. pengusaha/investor. Pengembangan gaharu melalui pola PHBM merupakan salah satu alternatif peningkatan produksi gaharu melalui pelibatan masyarakat dalam budidaya gaharu. baik dalam areal hutan milik (hutan rakyat) maupun dalam kawasan hutan Negara. parapihak yang tertarik (pemerintah. meningkatkan peluang keberhasilan serta mengurangi resiko kerugian yang diderita. Perubahan paradigma ke arah PHBM menjadi momentum penting bagi masyarakat desa hutan. keterampilan. PHBM merupakan salah satu jawaban dari pergeseran paradigma dalam pengelolaan sumberdaya hutan dari yang berbasis negara (state based) ke arah yang berbasis komunitas/masyarakat (community based) (Indradi. masyarakat diharapkan melakukan penanaman gaharu pada lahannya sendiri terutama pada lahan kosong (tidak produktif ) secara swadaya. dan di sisi lain. Di satu sisi masyarakat dapat mendayagunakan potensi-potensi kehutanan untuk kesejahteraan mereka.Prospek Pengusahaan Gaharu . 169 .. Dengan pola ini diharapkan areal tanam dan juga kualitas dan kuantitas produksi gaharu akan dapat ditingkatkan. Melalui pola PHBM. kelompok usaha bersama/koperasi..(Sri Suharti) Untuk lebih membudayakan penanaman gaharu secara luas. pemeliharan. masyarakat di dalam dan di sekitar kawasan hutan dapat menjadi aset bagi usaha-usaha penjagaan.. baik di lahan milik di luar kawasan hutan maupun di kawasan hutan. Karena bentuk kerjasamanya adalah kemitraan.. 2009). input produksi.

baik dalam bentuk bantuan/hibah maupun melalui sistim kredit yang akan dibayar jika tanaman gaharu telah menghasilkan nantinya. Pengadaan bibit dan inokulasi dapat difasilitasi oleh mitra kerjasama yang disalurkan kepada petani. proporsi tanaman gaharu yang ditanam disesuaikan dengan luasan dan kondisi areal hutan milik yang ada. Dampak positif yang terjadi selanjutnya adalah sumberdaya hutan akan lebih terjaga dan terpelihara. produktivitas meningkat serta kesejahteraan masyarakat akan meningkat pula. Oleh karena kawasan hutan umumnya sudah ditumbuhi dengan berbagai jenis tumbuhan. baik berupa pengadaan bibit. Oleh karena lahan milik rakyat umumnya tidak begitu luas dan sudah ditumbuhi berbagai jenis tanaman. baik secara ekonomi. Hal ini sesuai dengan paradigma pembangunan kehutanan yang lebih menitikberatkan pada peningkatan partisipasi masyarakat dalam pengelolaan hutan dan menempatkan masyarakat desa hutan sebagai patner/mitra menuju pengelolaan hutan lestari.Aspek SOSIAL EKONOMI DAN KONSERVASI Agar masyarakat bersedia menanam gaharu. Adanya peningkatan kesejahteraan dari budidaya gaharu selanjutnya akan mengurangi tekanan masyarakat terhadap sumberdaya hutan dalam bentuk illegal logging dan perambahan lahan bahkan masyarakat secara sadar akan mempertahankan 170 . Berbagai hasil penelitian menunjukkan bahwa pola kerjasama kemitraan pengelolaan hutan dengan masyarakat desa hutan memberikan dampak positif. Dalam prakteknya pengembangan hutan rakyat gaharu umumnya dikombinasikan dengan tanaman semusim atau tahunan lainnya yang sudah ada (tanaman sisipan). maka perlu diberikan berbagai bentuk insentif. maka pola tanam yang dikembangkan adalah pola tumpangsari (sisipan atau tanaman sela di antara tegakan yang sudah ada). Keterlibatan masyarakat dalam pengelolaan hutan meningkatkan posisi tawar serta rasa memiliki masyarakat terhadap sumberdaya hutan yang ada. sosial maupun ekologi. biaya inokulasi tanaman maupun informasi tentang peluang dan teknik pengembangan gaharu. Pengembangan tanaman gaharu dalam kawasan hutan dapat dilakukan melalui pelibatan masyarakat sekitar hutan dalam pengelolaan hutan. biaya tanam.

(Sri Suharti) setiap jengkal hutan dari kerusakan.. apapun penyebabnya (Aswandi. Adanya pengaturan kerjasama yang saling menguntungkan dan adil sesuai dengan kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan bersama. Pengembangan kerjasama memang layak secara ekonomi dalam jangka panjang (sesuai jangka waktu kontrak perjanjian kerjasama). pemeliharaannya relatif mudah dan bernilai ekonomi tinggi. 3.. Dari sisi masyarakat. Sistim Bagi Hasil dalam PHBM Pengembangan gaharu dengan pola PHBM merupakan salah satu alternatif usaha yang dapat mengakomodasikan kepentingan ekologi di satu sisi dan pertimbangan ekonomi di sisi lain. Beberapa skenario sebagai alternatif bentuk kemitraan yang dapat dikembangkan antara lain sebagaimana disajikan dalam Tabel 2. pengembangan gaharu dengan pola PHBM memberikan peluang kepada masyarakat untuk memperoleh manfaat ganda yaitu dari hasil tanaman gaharu jika telah menghasilkan nantinya serta kesempatan untuk memanfaatkan lahan di antara tanaman untuk usahatani tanaman semusim.Prospek Pengusahaan Gaharu . Menempatkan masyarakat sebagai mitra dalam pengelolaan hutan secara tidak langsung juga telah memposisikan masyarakat sebagai garda terdepan dalam pengamanan sumberdaya hutan. 4. 2. Adanya kesepahaman tentang resiko dan konsekuensi dari adanya perjanjian kerjasama tersebut. Tanaman gaharu dipilih karena tanaman ini dapat tumbuh di dalam areal hutan yang sudah banyak ditumbuhi tegakan pohon dengan intensitas cahaya < 70%. 2009).. Adanya tujuan bersama yang ingin dicapai. 171 . B. Beberapa prinsip utama yang dipegang dalam pengembangan gaharu dengan pola PHBM adalah: 1..

budidaya gaharu oleh masyarakat umumnya dilakukan dalam skala kecil dengan pola campuran. tergantung luas lahan garapan dan kepadatan tanaman yang ada. diharapkan masyarakat yang memiliki banyak keterbatasan. 3. Alternatif bentuk kemitraan yang dapat dikembangkan Jenis input Skenario I 1 Lahan Saprodi Tenaga kerja Bahan inokulan Biaya inokulasi Pengolahan hasil Pemasaran √ √ √ √ √ √ √ 2 3 Skenario II 1 √ √ √ √ √ √ √ 2 3 Skenario III 1 √ √ √ √ √ √ √ √ √ √ √ √ 2 3 Skenario IV 1 2 3 √ √ Keterangan: 1.Aspek SOSIAL EKONOMI DAN KONSERVASI Tabel 2. teknologi serta akses terhadap pasar dapat ikut berpartisipasi dalam budidaya tanaman gaharu. Sebagaimana sifat usahatani skala kecil oleh masyarakat yang ketergantungannya terhadap lahan usahatani yang dimiliki/digarap sangat tinggi. Petani. maka gaharu bukan merupakan komoditi utama yang diusahakan. Gaharu diusahakan sebagai investasi jangka panjang. Pemda/Pihak lain Sebagaimana diuraikan sebelumnya. Besarnya bagi hasil yang diperoleh oleh masingmasing pihak yang terlibat dalam PHBM disesuaikan dengan kontribusi masing-masing pihak dan merupakan hasil kesepakatan bersama. Berbeda dengan pengusahaan gaharu skala besar yang dilakukan oleh para investor. Konsekuensinya. 2. populasi tanaman gaharu dalam setiap garapan petani berjumlah relatif sedikit serta tidak seragam. baik dari segi permodalan. Investor/Pengusaha. Dengan pola PHBM. pengembangan gaharu dengan pola PHBM dapat dilakukan di areal hutan milik maupun di dalam kawasan hutan sepanjang persyaratan tumbuhnya terpenuhi. sepanjang modal yang dimiliki mencukupi untuk biaya budidaya tanaman berikut biaya inokulasinya yang cukup besar. Dengan demikian meskipun investor/penyandang dana 172 .

Prospek Pengusahaan Gaharu .. dan Cilaban sebanyak 49 orang (anggota Kelompok Tani Hutan Giri Wisata Lestari yang dipimpin Ustad Jafar sebanyak 40 orang dan Kelompok Tani Hutan Carita Lestari pimpinan Pak Rembang sebanyak 19 orang). Apalagi jika pengembangan kemitraan dengan pola PHBM bertujuan untuk meningkatkan kelestarian sumberdaya hutan (dalam hal ini tanaman gaharu yang sudah langka) dan meningkatkan kesejahteraan masyarakat desa hutan dan bukan semata-mata untuk tujuan komersial (mendapat profit terbesar). belum tentu bagian hasil/sharing yang diperolehnya akan paling besar pula. cengkeh. dan nangka. Cangkara. Kegiatan dilaksanakan dengan melibatkan masyarakat yang telah berusahatani di areal tersebut untuk ikut mengembangkan tanaman penghasil gaharu di lahan garapan mereka. Banten.. Gaharu ditanam dengan jarak ± 5 m x 5 m. C. Dengan demikian jumlah 173 .(Sri Suharti) memberikan kontribusi input dengan porsi terbesar. Kegiatan dilaksanakan pada sebagian Petak 21 di areal KHDTK Carita dengan luas ± 40 hektar. jengkol. Uji coba ini merupakan kerjasama antara Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam dengan masyarakat sekitar areal KHDTK Carita. durian. Oleh karena areal kerjasama sudah ditumbuhi berbagi jenis tumbuhan.. petai. Selain tanaman JPSG milik masyarakat. dan hawuan. Selama ini masyarakat ikut menggarap lahan di Petak 21 dengan budidaya berbagai tanaman jenis pohon serbaguna (JPSG) dan buah-buahan seperti melinjo. Uji Coba Pengembangan Gaharu dengan Pola PHBM di KHDTK Carita Di areal KHDTK Carita. khaya. pulai.. di areal tersebut juga terdapat berbagi pohon hutan seperti meranti. Kelompok masyarakat yang terlibat dalam kegiatan penelitian ini berasal dari Desa Sindang Laut dan Desa Suka Jadi tepatnya dari Kampung Longok. mahoni. maka pola tanam yang diterapkan adalah pola tumpangsari (sisipan di antara tanaman yang ada). Banten pada tahun 2008 telah dikembangkan uji coba skema kemitraan budidaya tanaman penghasil gaharu dengan pola PHBM.

3. Setelah diperoleh gambaran prospek partisipasi masyarakat dalam pembangunan demplot uji coba ini dilanjutkan dengan penyusunan rancangan teknis kerjasama penelitian dan penyusunan draft perjanjian kerjasama. Beberapa prinsip utama yang disepakati antara pihak pertama (Puslitbang Hutan dan Konservasi Alam) dengan pihak kedua (kelompok masyarakat peserta uji coba) dalam pola kemitraan di areal KHDTK carita adalah: 1. Pihak pertama memberikan pembinaan teknis budidaya tanaman gaharu secara rutin kepada pihak kedua.Aspek SOSIAL EKONOMI DAN KONSERVASI tanaman gaharu yang ditanam di areal kerjasama sebanyak 15. Pihak pertama menyediakan biaya bagi pihak kedua untuk melakukan kegiatan budidaya penanaman pohon gaharu yang meliputi biaya upah dan bibit tanaman. Pihak pertama menyediakan jamur pembentuk gaharu untuk kegiatan inokulasi sebanyak 25% dari jumlah tanaman gaharu pada masing-masing penggarap setelah tanaman gaharu berumur ≥ 5 tahun. dan masyarakat calon peserta untuk mempelajari prospek partisipasi masyarakat dalam kegiatan dan pemeliharaan tanaman. Pemda. 174 . Pihak pertama akan membantu mencarikan investor untuk bekerjasama menyediakan produksi jamur pembentuk gaharu untuk kegiatan inokulasi untuk 75% tanaman gaharu lainnya. Dengan pendekatan yang lebih intensif ini diharapkan masyarakat akan lebih memahami tujuan kerjasama penelitian serta dapat lebih aktif berpartisipasi dalam budidaya tanaman plot uji coba. Pihak pertama akan memberikan pelatihan budidaya gaharu serta pemanenan gaharu (paket training gaharu) kepada pihak kedua.000 pohon (± 400 pohon/ha). kegiatan pembangunan demplot uji coba tanaman penghasil gaharu di KHDTK Carita diawali dengan pendekatan yang lebih intensif kepada berbagai pihak yang terkait pengembangan gaharu di areal tersebut seperti Perhutani. Sebelum penanaman. 5. 4. 2.

5%. sebagian hasil tanaman gaharu akan diberikan pada Desa Sindang Laut sebesar 2. Pihak kedua berkewajiban mengikuti aturan teknis dan kaidah konservasi yang berlaku di dalam areal KHDTK Carita.5% dan LMDH (kelompok) 2. 8. pihak pertama dan pihak kedua memperoleh hasil tanaman gaharu yang ditanam dan dipelihara di lokasi kerjasama dengan proporsi masing-masing 35% untuk pihak pertama dan 60% untuk pihak kedua. Selain pihak pertama dan pihak kedua. Jika sudah menghasilkan. 9.. Pihak kedua berkewajiban memelihara dan menjaga keamanan tanaman gaharu dan tanaman hutan lainnya. 175 ..Prospek Pengusahaan Gaharu . kebakaran atau bencana lain yang mengakibatkan kerusakan sumberdaya hutan. Pihak kedua berkewajiban melaporkan setiap kejadian seperti serangan hama/penyakit tanaman. 7. baik pada tanaman gaharu atau tanaman lainnya di areal kerjasama.. 10.(Sri Suharti) 6. maka resiko akan ditanggung bersama sehingga perhitungan bagi hasil pada saat panen ditentukan dengan rumus sebagai berikut: = P akhir ∑ tan total − ∑ tan mati x P awal ∑ tan total Keterangan: Pakhir = Proporsi bagi hasil tanaman gaharu yang diterima masingmasing pihak jika ada tanaman yang mati/hilang/tidak/ belum menghasilkan = Proporsi bagi hasil tanaman gaharu sesuai kesepakatan yang tertuang dalam perjanjian kerjasama ini Pawal Butir-butir kesepakatan tersebut tertuang dalam naskah perjanjian kerjasama yang disusun berdasarkan hasil kesepakatan/ negosiasi antara pihak pertama dan pihak kedua.. Jika pada saat pemanenan tanaman gaharu ternyata ada tanaman yang mati/hilang/tidak/belum menghasilkan.

Diakses 20 Januari 2009. dan ekologi. Kerjasama kemitraan pengembangan tanaman penghasil gaharu dengan pola PHBM merupakan salah satu alternatif solusi untuk menjaga kelestarian hutan. IRR sebesar 48. Info Pusat Standardisasi dan Lingkungan Departemen Kehutanan. GAHARU: HHBK yang Menjadi Primadona. D. 4.co. 2002. http:// www. Trubus online. khususnya bagi Indonesia yang memiliki potensi biologi yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. DAFTAR PUSTAKA Adijaya.htm.id/mod. dan B/C = 3. Skema kemitraan dengan pola PHBM memberikan kesempatan kepada para-pihak yang berminat mengembangkan tanaman gaharu untuk bekerjasama sesuai dengan input/sumberdaya yang dimiliki dan memperoleh bagian hasil/sharing sesuai dengan kontribusi serta kesepakatan parapihak yang terlibat. 2009. Gaharu: Harta di Kebun. http:// www. 3.php?mod=publisher&op =viewarticle&cid=8 &artid=290.trubus.74 juta/ha.go. meningkatkan produktivitas lahan serta meningkatkan pendapatan masyarakat sekitar hutan. Anonim. 5.32.dephut. Diakses 16 Februari 2009.id/ Halaman/STANDARDISASI_& _LINGUNGAN_ KEHUTANAN/INFO_V02/VI_V02. 176 .53%. 2.Aspek SOSIAL EKONOMI DAN KONSERVASI KESIMPULAN DAN SARAN 1. Budidaya gaharu layak untuk dilaksanakan karena secara finansial akan memberikan keuntungan bersih nilai kini (NPV) sebesar Rp 147. ekonomi. Gaharu sangat prospektif untuk dikembangkan. Prinsip utama yang dipegang dalam pengembangan kerjasama kemitraan dengan pola PHBM adalah prinsip kelestarian dan kelayakan secara ekonomi dalam jangka panjang sesuai jangka waktu kontrak serta saling menguntungkan berdasarkan nilai kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan sosial.online.

html. 2008. A.php?mod=publisher &op=viewarticle&cid=1& artid=1618. 3 2008. Diakses. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). BIOTROP Training and Information Centre. Anonim. 2006. Anonim. Access November. 2009. 2005. http://forestpathology.ffi. 2003. com/gaharu. C.id. Blanchette. Indradi. Diakses 16 Februari 2009.com/2008/01 /perkembangangaharu-dan-prospeknya-di. Mencari Solusi PHBM di Geumpang. B.org/eng /com/PC/14/EPC14-09-02-02-A2.id/id/news /1/tahun/2007/bulan/11/tanggal/17/id/ 60/. http://bpk-aeknauli. htm. Working paper No. http://laksmananursery. 177 . Diakses 16 Februari 2009. Steven.blogspot. 2009. Di akses 4 Maret 2009. Gun. 2009. BUDIDAYA GAHARU : Alternatif Pemberdayaan Masyarakat Desa Hutan.. dan Aswandi.bticnet.. 2007. S.co. Diakses 16 Februari 2009.or.edu/ agarwood. Rizlani. Y. Chatteron.htm. Aswandi.pdf. or. Perkembangan Gaharu dan Prospeknya di Indonesia.. 2009. Statistik Kehutanan Indonesia 2006.umn.cites. 2009. R. Hayat. Jakarta. http://www. Departemen Kehutanan.. Diakses 16 Februari 2009. Sungadan. Trubus online. (2004). Tropical Rain Fo rest Project. 12 Februari. http:// forestry-senu57.php ?option=com_content&task= view&id= 74&Itemid=1.id/mod. Diakses 4 Maret 2009. Z. Depatemen Kehutanan. Tersandung Wangi Gaharu. Perjalanan Panjang Pengelolaan Hutan Berbasis Masyarakat di Indonesia..html. http:// www. Sumari and P. http:// www.cfans. Vietnam.. Duryatmo.. M. Prospek Budidaya Gaharu Secara Ringkas. http://www. 51.blogspot.Prospek Pengusahaan Gaharu . Pelatihan Nasional: BUDIDAYA DAN PENGOLAHAN GAHARU.trubus-online. Review of Significant Trade Aquilaria malaccensis. Eaglewood in Papua New Guinea. L.(Sri Suharti) Anonim. http://fwi. Sustainable Agarwood Production in Aquilaria Trees. 2009.com/2009/01/ prospek-budidaya-gaharu-secara ringkas. P. 2007. Diakses 13 Januari.org/index.

Sumarna. Wiguna. Jakarta. squidoo. http://www. Production and marketing of cultivated agarwood. . Y.id/mod.trubus. LLC and respective copyright owners.3 2008. Temu Pakar Pengembangan Gaharu. Access November. Diakses 16 Februari 2009.com/agarwood Copyright © 2008. Squidoo. Budidaya dan Rekayasa Produksi Gaharu.online. Trubus online. 2008. http://www. Squidoo. Direktorat Jenderal RLPS.co. 2006.php?mod =publisher&op=viewarticle& cid=8 &artid=290. 2007. I. Tinggi Permintaan Terganjal Pasokan.

Cash inflow (Rp 1000) a. Persiapan lahan & tanam 3.3176 2500 1000 0 3500 16425 -16425 -21675 2500 1000 0 3500 7075 -7075 -28750 2000 500 0 2500 6850 -6850 -35600 1500 500 0 2000 6600 -6600 -42200 1500 500 12000 14000 39125 -39125 -81325 1500 500 0 2000 7125 -7125 -88450 1500 500 0 2000 6650 -6650 -95100 20000 25000 0 45000 46250 697750 602650 33000 29500 12000 74500 141350 602650 179 Catatan: Produksi gaharu 480 kg/ha dengan harga rata-rata Rp 1. Output (kg) b. Pupuk TSP/SP-36 4. dan pupuk kandang Rp 150/kg Harga inokulan Rp 50. Analisis NPV. Harga bibit Rp 15. Lampiran 1. Bahan inokulan Biaya bahan & peralatan c. IV. Tenaga kerja keluarga 2.Lampiran 1. Keterangan I. Pupuk KCl 5. TSP Rp 7000/kg. Tenaga kerja inokulasi Biaya tenaga kerja Total biaya Cash flow Cash flow komulatif a. Nilai output Gaharu kemedangan I (10%) Gaharu kemedangan II (40%) Gaharu kemedangan III (50%) Cash outflow (Rp 1000) a.742 48. Biaya bahan & peralatan 1. Harga pupuk urea Rp 2500/kg. NPV (DF 15%) b. Lain-lain Biaya pra investasi b. KCl Rp 6000/kg.53% 3.550. 500 3000 1250 250 5000 0 0 0 0 0 250 0 250 6750 125 350 300 150 0 0 7675 0 125 350 300 300 0 0 1075 0 250 700 600 300 0 0 1850 0 250 700 600 300 250 0 2100 0 375 1050 900 300 0 20000 22625 0 2500 2500 250 5250 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 500 5500 20000 500 26500 6750 1750 4900 4200 1950 800 20000 40350 III.000/kg Harga gaharu K1= Rp 5 juta/kg. Pupuk Urea 3. IRR (%) c. dan B/C dari Pengusahaan tanaman gaharu per hektar 0 0 0 0 0 0 0 0 0 480 744000 240000 384000 120000 0 0 1250 0 1250 0 375 1050 900 300 0 0 2625 0 250 700 600 300 300 0 2150 0 0 0 0 0 0 0 0 1 2 3 4 5 Tahun ke6 7 8 Total No.000/phn. Peralatan pertanian 7. Pupuk kandang 6.000/tanaman . K2= Rp 2 juta/kg dan K3=Rp 500.000/kg. IRR. Biaya tenaga kerja 1. Pra-investasi 2. Bibit tanaman gaharu 2. B/C 0 0 0 0 5250 -5250 -5250 147. Tenaga kerja upahan 3. jumlah tanaman 400 phn/ha dibutuhkan 450 phn dg sulaman. Sewa lahan 4. Pra investasi 1. 744000 II.

Aspek SOSIAL EKONOMI DAN KONSERVASI 180 .

This is because. There is a lack of information on factors influencing the success of gaharu formation. namely. the gaharu export market remains open. 181 . climate. Most of the gaharu formation usually relays on natural infection. Only small group of farmers using introduced inoculants.10 THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo Lambung Mangkurat University. Therefore there is a big opportunity for the Indonesian farmers to establish eaglewood plantation. soil properties and plant species). the gaharu production may be considered low. South Kalimantan INTRODUCTION Eaglewood (gaharu) may play an important role in gaining foreign exchange and as a source of income for people living in out.and in-side the forest in Indonesia. The success of gaharu formation may not be only due to inoculants but may also be influenced by environmental characteristics (climate. In South Kalimantan. soil properties and plant diversity surrounding the newly grown and existing gaharu stands in South Kalimantan Province. The present work focused on characterizing the environment.

The climatic data for all sites were represented by Kandangan weather station. HST) Kalaka (HST) Kandangan (HSS) Madang (HSS) 115.8 km 115. The sites located in Banjar. Climatic Characters The climate parameters collected were rainfall.4 3. 182 .1 115. The data obtained were for the last 9 years observation. Hulu Sungai Selatan (HSS) and Hulu Sungai Tengah (HST).8 3.3 North 115.2 3.4 oE 115. The data were supplied by the Weather Bureau in Banjarbaru.6 2.0 2. air temperature and relative humidity. Site Distribution of selected sites for the project can be seen in Figure 1. The selected study sites B. South Kalimantan. 115.6 22.6 Figure 1. HST) Aluan (3) (HST) Bawan (HST) Gading (HST) Batung (HST) Layuh (HKK) (HST) Rasau (HST) Kambat (2.0 oS 3.5 Layuh (2.Aspek SOSIAL EKONOMI DAN KONSERVASI METHODS A. The selected site were used for growing eagle wood and inoculation.7 Wawai (HST) 115. 14 sites would be used for newly planted eaglewood trees and 9 sites for inoculation trial. Location-wise.2 Belanti (3) (HSS) Rejo (Banjar) 115.4 2.

electric conductivity (EC). cation exchange capacity (CEC). plant species grown under gaharu tree were collected plant within area of 6x6 m2. soil pH. The rainy season commenced in October and ended in July each year.. total nitrogen (N). In each site. D. air temperature and relative humidity for the last 9 years are shown in Figure 2.. Plant Diversity The diversity of plant species was determined to show its association with the success of inoculation. 183 . the content of total carbon (C). (1982). RESULTS A. A significant low rainfall occurred in the period of July-September.(Erry Purnomo) C.72 mm.The Environmental Characteristics . Climatic Characters The average rainfall. The pattern of air temperature and relative humidity are shown in Figure 2b and 2c.. Method used for particle fraction analysis was described in Klute (1986) and the methods for other soil properties were described in Page et al. total potassium (K) and total phosphorus (P). The rainfall distribution can be observed in Figure 2a. The average annual rainfall in the study area was 2361.. Soil Properties Soil properties measured were particle fraction analysis. and CO2 evolution. respectively.

the content of total carbon (C). level of status of each soil property will be made available as categorized by Djaenuddin et al. air temperature [b] and relative humidity [c] for the last 9 years. and CO2 evolution. The particle fraction analysis (Figure 3) shows that all soil samples dominated by slit fraction.Aspek SOSIAL EKONOMI DAN KONSERVASI 500 [a] 400 30 [b] 29 Air temperature (oC) 30 [b] 29 Rainfall (mm) 300 200 100 28 27 26 25 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month Air temperature (oC) 28 27 26 25 0 l t r r r r ary ary rch pri May June July gus mbe tobe mbe mbe nu ru Ma A Au pte Oc ove ece Ja Feb N D Se Month Figure 2. The rainfall [a]. electric conductivity (EC). Soil properties measures were particle fraction analysis. cation exchange capacity (CEC). (1994). soil pH. followed by clay and sand fractions. 184 . Soil Properties The soil properties of each site are presented in Figures 3-11. total potassium (K) and total phosphorus (P). If applicable. Total nitrogen (N). Bars indicate the standard error mean 9 years observation B.

The low level of C and N content confirms the low level of organic matter content of the soil.The Environmental Characteristics . only 5 sites had low C. The total C of soil for each site 185 ...(Erry Purnomo) The category range of total C total content was very low to low (Figure 4). namely. Mandala and Madang Low had K content of moderate level. 100 80 60 Sand Silt Clay % 40 20 0 n Bela 5 ti 1 t ) ) i s 3 g h 3 w .0 0. Two sites.16 angsa andala awai dingin awa au (10 Kate g Hig adin (2 & 3 lanti 1 ng Lo gkinkin W as M W Man uh an aur G bat da Han Be TL R Lay Mad H Ma Kam Site Figure 3.0 Low 1.5 Total C content (%) 1. Most of the soil classified as very low to low level of K concentration.5 Moderate 2. The N content of the soils (Figure 5) was generally low. It was found that Wawai and Belanti 13 sites had very low and moderate levels of N content. Most of the selected sites contained very low C.5 0.16 gsa da i H i 15 T Lan Man Waw and Waasauyuh K ang ur Gaat (2Belandang angk M R La Mad Ha mb H Ma Ka Site Figure 4. Particle fraction analysis of each soil 2.0 Very low Be ti lan t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin . respectively... The K and P contents of the soils from all sites are demonstrated in Figures 6.

Most of total P content of the soils was categorized as very low to low. Number of Plant Species It was observed that the number of plant species was varied from site to site (Figure 12). The CEC of the soils were commonly low (Figure 10).Aspek SOSIAL EKONOMI DAN KONSERVASI 0. The CO2 evolution as an indication microbial activity was similar site-wise (Figure 11). The low EC readings indicate the absence of salinity problem. Except. Only one site (Belanti 13) had a slightly acidic value (Figure 8). C. it was observed that the microbial was lower than the other sites. Only one site (Rasau 10) was categorized as very high (Figure 7).05 0. 186 . Almost all the soil pH of the selected soils was categorized into very acidic to acidic category.15 0. There were 3 sites and 2 sites had CEC of moderate and high. there were 3-5 plant species. at Madang Low.00 Very low la n Be 16 ngsat dalawai 3 inginawai (10) ates High ding & 3) ti 13 Low inkin n a d W sau h K ng r Ga t (2 elan ang ngk 5ti 1 T La Ma W Man B ad Ha Ra Layu ada Hau mba M M Ka Site Figure 5.10 0. The total N of soil for each site One site (Rasau 10) had a very high K level. except for Hangkinkin site. For EC reading. The low CEC indicates a low storage cation capacity and results in prone to cation leaching. At 5 sites.20 Total N content (%) Low 0. respectively. all soils had EC below 1 mS cm-1 (Figure 9).25 Moderate 0. The low EC readings may be associated with the far distance from the shore.

1200 1000 Total K content (%) 800 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s i .16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 7.. Total P content of soil for each site 187 .. Total K content of soil for each site 2600 2400 Total P content (%) 2200 2000 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s .16 gsa dalawai 3inginawa u (10 ate High ding & 3nti 13 Lowinkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2Belaadangangk M H L M d Ha am b a M K Site Figure 6.(Erry Purnomo) The other 8 sites had 5-14 plant species and one site had 22 plant species..The Environmental Characteristics ..

16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 9.1 angs anda awanding aw au (uh Katng Hr Gadi (2 & lantiang Lngkink WRas y W Ma M BeMad Ha n ti 1 T L L a Ma d a H a u m b a t a Bela K Site 0 Figure 8.Aspek SOSIAL EKONOMI DAN KONSERVASI 7 Neutral Slightly acidic 6 Soil pH H2O 5 Acidic 4 Very acidic la i 3 6 in in ai 10) 3) 13 ow at es igh ng 5 .16 gsa dal ai ngi wa (10 ate Hig din & 3 ti 1 Low nki 15 T Lan Man Waw andi Wa asau yuh K ang ur Gaat (2Belan dang angki R La n ti a M H ad Ha m b a M M Bel Ka Site 0 Gambar 10. Cation exchange capacity of soil for each site 188 . Soil pH for each site 130 Electric conductivity (mScm-1) 120 110 100 2 1 0 nt Bela ) ) t s . Electrical conductivity readings for soil each site Cation exchnage capacity (cmol[+]kg-1) 40 30 High 20 Moderate 10 Low Very low ) ) t s i g a 3 3 h n n .

The highest rainfall occurred in the period of November-April ranging 215-358 mm. The lowest rainfall was observed in the period of July-September ranging 54-84 mm.. In May.16 gsa da H i i 15 T Lan Man W aw and W a asau yuh Kdang ur Ga at (2 Belan dang angk M nti R La Ma H Ha amb Ma ela B K 0 Sites Gambar 12.The Environmental Characteristics . 25 Number of plant species each site 20 15 10 5 t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin .. CO2 evolution from soil from each site DISCUSSION The rainfall pattern was typical the study area. The schedule of inoculation may have to consider the climatic condition throughout the year. The number of plant species found in each site 189 ..16 gsa dal wai 3 inginawa u (10 ate High din & 3nti 1 g Low inkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2BelaadanHangk M L M d Ha am b a M K Site Gambar 11.(Erry Purnomo) 2000 1600 1200 CO2 evolution (mg C kg-1) 800 400 0 an t Bel ) ) t s i g a 3 .. June and October the rainfall ranged 132-151 mm.

190 . It seems that there was a shading affect on the gaharu trees growth. improving the fertility status may results in healthier eaglewood trees. ACKNOWLEDGEMENT I would like to thank ITTO for funding the work. (1994) leads the need to amend to improve the soil fertility status. The number plant species were varied from site to site. I also acknowledge the anonymous reviewer who critically commented on the manuscript. Mrs. Plants grown under the gaharu was quite divers from site to site. Banjar. CONCLUSION The selected sites were distributed in regencies. Hulu Sungai Selatan and Hulu Sungai Tengah. In general. It is too early to gain any conclusion on the effect of environmental characters on gaharu production. Maman Turjaman for the invitation to be involved in the project. From field observation. Dr. This may result in the failure of gaharu formation. The healthy trees may immune to the infection. Therefore. further study is still needed to investigate the relationship between soil properties or plant diversity on eaglewood growth or the success of inoculants application. namely. M Yani. Presto Janu Saputra and Storus for supporting the field work. The annual total rainfall in the area under study was 2361 mm. the soil in each site was considered very poor.Aspek SOSIAL EKONOMI DAN KONSERVASI The low fertility status according to Djaenuddin et al. However. it was found that there was gaharu trees growth variation under different plan species grown surrounding the gaharu trees. The rainy season began in October and ease in June.

Pp.. Subagjo. and Keeney. V. Center for Soil and Agroclimate Research. Dai.. Land Suitability for Agricultural and Silviculture Plants. Sukardi. Bachri. A. Ismangun. ASA. Madison..0.. (1986) Methods of soil Analysis. 191 . SSSA. J. L.L.. Marsudi. S. April 1994. Klute.. 2nd Edition.REFERENCE Djaenuddin. Suharta. Chemical and microbiological properties.. Hardjowigeno.R.H.. D. Basuni. Miller. Hakim. ASA. 7. Pp 1159. and Jordens. SSSA. M. R. N. Part 1 Physical and mineralogy methods. Suwandi. Widagdo.. A. Bogor. S. 2nd Edition. E.. Madison. (In Indonesian). (1982) Methods of soil Analysis. D. Ds. Laporan Teknis No.1188 Page.R.. H. Versi 1.

Aspek SOSIAL EKONOMI DAN KONSERVASI 192 .

. maka keberadaan jenis ini perlu dipertahankan. Gaharu merupakan salah satu kayu aromatik penting. Ada beberapa jenis tumbuhan yang dapat menghasilkan gaharu.Karakteristik Lahan Habitat . yaitu A. karena secara ekonomis jenis ini dapat meningkatkan devisa negara dan sumber penghasilan bagi masyarakat yang hidup di dalam maupun sekitar hutan. Enkleia spp.. Dalam kegiatan penelitian ini difokuskan pada jenis-jenis pohon dari genus Aquilaria.. Gonystylus spp. (Chakrabarty et al.. Sidiyasa et al. Genus ini termasuk dalam famili Thymelaeaceae. 1986)...(Pratiwi) 11 KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu hasil hutan non kayu yang mempunyai nilai penting. Karena jenis pohon ini mempunyai nilai ekonomi tinggi. Awalnya gaharu berasal dari pohon tropika yang terinfeksi jamur. sehingga hasil hutan non kayu ini menjadi subjek pemanenan yang cukup tinggi. Oleh karena itu beberapa 193 ... malaccensis dan A.. dan Gyrinops spp... Wikstromeae spp. 1994. seperti Aquilaria spp. microcarpa. Aetoxylon spp. Salah satu upaya yang dapat dilakukan adalah dengan mengembangkan tanaman gaharu dalam hutan tanaman di beberapa area.

Aspek SOSIAL EKONOMI DAN KONSERVASI informasi sehubungan dengan habitat pohon penghasil gaharu perlu diinventarisasi. topografi. Secara administrasi pemerintahan. Provinsi Banten sedangkan 194 . sehingga keberadaan jenis ini dapat dilestarikan. di samping air. Sifat-sifat tanah yang spesifik mempengaruhi komposisi vegetasi yang ada di atasnya (Pratiwi. dan Sukabumi. udara. jenis tanah. Pratiwi dan Mulyanto (2000) serta Jenny (1941) menyebutkan bahwa tanah merupakan hasil proses pelapukan batuan yang dipengaruhi oleh faktor-faktor iklim. METODOLOGI A. agar kemampuan lahannya dapat diketahui. Sepanjang komponen tanah bervariasi. maka penelitian ini bertujuan untuk mendapatkan informasi tentang sifat-sifat habitat pohon penghasil gaharu di hutan tanaman gaharu di daerah Carita. Carita terletak di Kabupaten Pandeglang. dan energi matahari. dan Sukabumi. Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah dan topografi serta vegetasi. termasuk sifat-sifat tanahnya dan komposisi vegetasi tumbuhan bawah yang ada di sekitarnya. Tanah sebagai bagian dari suatu ekosistem merupakan salah satu komponen penyangga kehidupan. Selanjutnya Pratiwi dan Mulyanto (2000) menyatakan bahwa penyebaran tumbuhan. 1991). dan iklim (termasuk iklim mikro) harus dipertimbangkan sebagai bagian dari ekosistem yang terintegrasi. Diharapkan informasi ini dapat mendukung pengembangan hutan tanaman pohon penghasil gaharu. Dramaga. Tanah yang berbeda dengan sistem lingkungan yang bervariasi akan menentukan vegetasi yang ada di atasnya. sebagaimana juga diharapkan dapat meningkatkan pendapatan dan kesejahteraan masyarakat. Lokasi dan Waktu Penelitian Penelitian dilakukan pada bulan September 2008 di Carita. Dramaga. dan waktu. Sehubungan dengan hal tersebut di atas. maka tanah dan karakteristiknya akan berbeda-beda dari satu tempat ke tempat lain. organisme.

Dramaga. Pengamatan terhadap sifat-sifat tanah dan topografi dilakukan di dalam plot yang sama dengan pengamatan vegetasi. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC.. Metode Penelitian Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah. 1951) dan curah hujan tahunan sekitar 3. cangkul. B. 1951) dan curah hujan sekitar 3. dan meteran. topografi. Bahan dan Alat Penelitian Sebagai bahan penelitian adalah contoh tanah yang diambil dalam plot penelitian di Carita. C.000 (Lembaga Penelitian 195 ...600 mm per tahun.. 1951) dan curah hujan sekitar 3. Temperatur udara bervariasi antara 24ºC sampai 30ºC. alat-alat survei lapangan seperti bor tanah.Karakteristik Lahan Habitat . Jawa Barat serta Sukabumi di Provinsi Jawa Barat. Jumlah contoh tanah yang diambil di masing-masing lokasi adalah sebanyak 6 buah. Kelembaban udara rata-rata berkisar antara 80% sampai 90%. dan Sukabumi. Munsell Color Chart. 1.959 mm. dan vegetasi. Pengambilan Contoh Tanah Plot dibuat di area yang telah dipilih berdasarkan peta tanah Jawa dan Madura pada skala 1:500. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. 2005).000 mm per tahun.(Pratiwi) Dramaga terletak di Kabupaten Bogor. Kelembaban udara ratarata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. Sedangkan alat yang dipakai dalam penelitian lapangan adalah alat-alat tulis. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. Bahan lain adalah berupa data hasil analisis vegetasi untuk tingkat semai (termasuk tumbuhan bawah).

1962). Ca. Contoh tanah komposit diambil pada kedalaman 0-30 cm. Pada setiap kedalaman tanah.3 m) antara 2 cm sampai < 10 cm dan semai merupakan permudaan dari kecambah sampai tinggi < 1. Contoh tanah diambil dari setiap horizon yang telah diidentifikasi untuk dianalisis di laboratorium. Pengamatan Vegetasi Pengamatan vegetasi dilakukan terhadap seluruh vegetasi yang ada dalam plot. berat jenis.. Seluruh jenis pohon dan belta dihitung dan diukur diameternya. Sifat-sifat tanah yang dianalisis. Sedangkan belta merupakan tumbuhan dengan diameter setinggi dada (1. Al. Ntotal. dan semai. 1981). yaitu pada tingkat pohon. Sedangkan untuk pengamatan belta dilakukan dengan membuat petak berukuran 10 m x 10 m di sepanjang jalur tersebut dengan interval 10 m. Kemudian contoh tanah dicampur sesuai kedalamannya. Total tanah komposit yang dikumpulkan dari masing-masing lokasi adalah enam contoh (tiga untuk analisis sifat fisik tanah dan tiga untuk analisis sifat kimia tanah). dan > 60 cm di setiap lokasi penelitian.. 30-60 cm. belta. porositas.3 m)>10 cm. KB. KTK. Kriteria pohon adalah tumbuhan dengan diameter setinggi dada (1. contoh tanah diambil pada 20 titik yang tersebar di masing-masing horizon. Kriteria 196 . Mg.5 m (Kartawinata et al.Aspek SOSIAL EKONOMI DAN KONSERVASI Tanah. permeabilitas. Na. Sedangkan tingkat semai dan tumbuhan bawah diamati dengan cara membuat petak 1 m x 1 m di dalam jalur pengamatan pohon dan belta. K. Pengamatan vegetasi dilakukan terhadap semai dan tumbuhan bawah yang ada di bawah tegakan/pohon penghasil gaharu. meliputi: a) sifat fisik yaitu tekstur. dan sifat kimia yaitu pH H2O. dan H+ (sifat kimia) (Blackmore et al. Plot-plot contoh berukuran 20 m x 20 m dibuat untuk pengamatan pohon dengan interval 20 m pada jalur sepanjang satu km. Seluruh semai dan tumbuhan bawah yang ada dicatat dan dihitung jumlahnya. Corg. 1976). Dua macam contoh tanah yang diambil adalah contoh tanah terganggu untuk analisis sifat-sifat fisik dan kimia tanah serta contoh tanah tidak terganggu untuk pengamatan sifat fisik tanah (porositas dan berat jenis tanah). 2. Dengan demikian ada 18 contoh tanah yang dikumpulkan. ketersediaan P.

Karakteristik Lahan Habitat .. data yang diperoleh ditentukan spesies dominannya dengan menghitung nilai penting sesuai dengan rumus yang dikemukakan oleh Kartawinata et al. Jenis yang diperoleh kemudian dibuat spesimen herbariumnya untuk diidentifikasi di laboratorium Botani dan Ekologi Hutan. Seluruh semai dan tumbuhan bawah yang ada dalam plot dicatat nama daerahnya. yaitu: SI = Dimana : 2w a+b SI = Similarity Index w = Jumlah dari nilai penting terkecil untuk jenis yang sama yang ditemukan pada dua komunitas yang dibandingkan (A dan B) a = Jumlah nilai penting dari semua jenis yang ada di komunitas A b = Jumlah nilai penting dari semua jenis yang ada di komunitas B 197 . D. (1976).. 1976). Indeks kesamaan jenis dihitung dengan menggunakan rumus Sorensen (Mueller-Dum-bois and Ellenberg. P3HKA. dan dihitung jumlahnya serta diukur luas penutupan tajuknya. Bogor. Untuk vegetasi.. Pada masingmasing lokasi.(Pratiwi) semai adalah permudaan jenis tumbuhan berkayu dari kecambah sampai tinggi < 1. jalur dibuat sebanyak tiga buah masing-masing sepanjang 100 m. Plot-plot berukuran 1 m x 1 m diletakkan di jalur pengamatan vegetasi di dalam tegakan/pohon penghasil gaharu. 1974). Spesies dominan merupakan spesies yang mempunyai nilai penting tertinggi di dalam tipe vegetasi yang bersangkutan. Analisis Data Sifat-sifat fisik dan kimia tanah dihitung sesuai dengan formula pada standar prosedur dari setiap karakteristik tanah kemudian ditabulasi untuk setiap horizon...5 m (Kartawinata et al.

Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. khususnya sifat fisik dan kimia. Kelembaban udara rata-rata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. Dramaga.959 mm. Karakteristik Tanah di Daerah Penelitian Karakteristik tanah sangat dipengaruhi oleh faktor-faktor pembentukan tanah dan sifat-sifat tanah. dan Sukabumi. Ini berarti bahan induk daerah ini kaya akan mineral-mineral ferro-magnesium dan beberapa mineral sebagai sumber elemen basa. 2005). 198 . 1951) dan curah hujan sekitar 3. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. Kelembaban udara rata-rata berkisar antara 80% sampai 90%.Aspek SOSIAL EKONOMI DAN KONSERVASI HASIL DAN PEMBAHASAN A. 1951) dan curah hujan tahunan sekitar 3. yaitu Carita. 1. Lokasi penelitian Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson.000 mm per tahun. Temperatur udara bervariasi antara 24ºC sampai 30ºC.600 mm per tahun. Bahan induk tanah Carita adalah dari Gunung Danau sedangkan Dramaga dan Sukabumi masing-masing dari Gunung Salak dan Gede Pangrango. Vulkanik material dari lokasi-lokasi ini memiliki sifat andesitik. Topograpfi di daerah Carita bergelombang sampai bergunung sedangkan di Dramaga datar sampai bergelombang dan di Sukabumi bergelombang sampai berbukit. 1951) dan curah hujan sekitar 3. Faktor-Faktor yang Mempengaruhi Pembentukan Tanah di Lokasi Penelitian Penelitian dilakukan di tiga lokasi. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. Tipe mineral-mineral ini sangat dipengaruhi oleh sifat-sifat tanah.

melinjo (Gnetum gnemon). Data analisis tekstur tanah menunjukkan bahwa tanah di semua lokasi penelitian memiliki kelas tekstur liat. Sifat Fisik Tanah Sifat fisik tanah.Karakteristik Lahan Habitat . 199 . gaharu ditanam secara monokultur dan ditanam masing-masing tahun 1993 dan 1999. Tabel 2. Sedangkan tanah di lokasi penelitian Sukabumi memiliki KB lebih dari 50% sehingga diklasifikan sebagai alfisol. Pada tabel tersebut terlihat bahwa ketiga lokasi penelitian memiliki sifat-sifat fisik tanah yang relatif sama. Tabel 5. durian (Durio zibethinus) dan sebagainya. Sifat-Sifat Tanah a.. nangka (Artocarpus integra). Oleh karena itu tanah ini diklasifikasikan sebagai ultisol. microcarpa di Sukabumi. Hasil penelitian sifat-sifat fisik tanah disajikan pada Tabel 1. Hal ini mengindikasikan bahwa partikel tanah yang dominan adalah fraksi liat. Hal ini menunjukkan bahwa tanah di lokasi penelitian berkembang dari material vulkanik tuff. dan permeabilitas. Ketinggian daerah ini sekitar 100 meter di atas permukaan laut. Spesies yang ditanam adalah Aquilaria crassna dan A. dengan areal sekitar 5 ha dan dibangun pada tahun 1998 dengan total 346 pohon. Pohon penghasil gaharu ditanam bersama dengan tanaman lain. Berat jenis (BD) tanah di semua lokasi penelitian kurang dari 1 tetapi lebih dari 0.. porositas. Di Carita. berat jenis. jenis yang ditanam adalah Aquilaria microcarpa.8.. dan Tabel 6). Implikasi dari kelas tekstur ini adalah retensi air dan hara pada tanah ini relatif bagus. Tanah yang memiliki horizon argilik dapat diklasifikasikan sebagai alfisol atau ultisol tergantung kejenuhan basanya (KB). Sedangkan di Dramaga dan Sukabumi. microcarpa di Darmaga dan A.. Dari data tekstur tanah dapat dilihat juga bahwa tanah di dalam profil menunjukkan adanya akumulasi liat. dan Tabel 3. antara lain berkaitan dengan tekstur. Tanah di Carita dan Dramaga memiliki KB kurang dari 50% (Tabel 4. umumnya pohon serbaguna seperti pete (Parkia speciosa).(Pratiwi) Penggunaan lahan di ketiga lokasi penelitian adalah hutan tanaman pohon penghasil gaharu. Ini berarti seluruh tanah di lokasi penelitian memiliki sub horizon argilik. 2.

10 22.99 63. Sifat-sifat fisik tanah di lokasi penelitian Dramaga Sifat fisik Kedalaman (cm) Pasir (%) 0-30 30-60 > 60 0 30 60 8. Informasi ini menunjukkan bahwa terjadi fenomena pemadatan tanah (soil compaction) karena adanya injakan (trampling) dan mungkin adanya jatuhan butir-butir hujan dari batang pohon (stem fall).93 0.09 Liat (%) 79.Aspek SOSIAL EKONOMI DAN KONSERVASI Data porositas tanah menunjukkan bahwa di semua lokasi penelitian.33 5.90 64. porositas tanah di horizon permukaan lebih rendah daripada di bagian bawahnya. Hal ini menunjukkan bahwa tanah ini mempunyai sifat andik.51 Liat (%) 66. Sedangkan berat jenis tanah di tiga kedalaman kurang dari satu.69 85.87 0.86 66.57 69. sehingga tanah di lokasi penelitian termasuk dalam ordo andisol dalam sistem taksonomi tanah (Soil Survey Staff.01 Tekstur Debu (%) 25. 1994).21 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 200 .33 8.59 11.96 65. Tabel 1.78 Kelas tekstur Liat Liat Liat 0.10 36.33 6.99 68.13 Debu (%) 12.84 0.85 Berat Jenis Porositas (%) Tabel 2.98 9.08 81.55 6. Sifat-sifat fisik tanah di lokasi penelitian Carita Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 8.48 Kelas tekstur Liat Liat Liat 0.90 0.45 66.35 57.

Keterangan yang lebih lengkap dapat dilihat pada Tabel 4. Hal ini terlihat pada lokasi penelitian.. N. Al. umumnya diikuti dengan penurunan persentase ruang pori atau porositas dan juga penurunan nilai permeabilitas tanah. Pratiwi dan Garsetiasih (2003) menyatakan bahwa pemadatan tanah dapat diakibatkan oleh karena injakan manusia. P tersedia.37 Liat (%) 68. Nilai permeabilitas tanah menunjukkan laju pergerakan air.75 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 Sedangkan porositas di lokasi penelitian menunjukkan bahwa semakin ke bawah porositasnya semakin kecil. kejenuhan basa (KB).09 Kelas tekstur Liat Liat Liat 0. Sifat Kimia Tanah Sifat-sifat kimia tanah.59 68. di mana lokasi-lokasi ini merupakan hutan tanaman. Namun demikian tanah-tanah di lokasi 201 . b. Mg. Peningkatan berat jenis tanah. Na.43 67.95 11.83 63.78 9. K. C. Fe.49 84.. Namun demikian Bullock et al. dan Tabel 6. dan Mn.Karakteristik Lahan Habitat . Hal ini terjadi juga di ketiga lokasi penelitian. kapasitas tukar kation (KTK). Hal ini menunjukkan semakin ke dalam jumlah pori-pori semakin kecil yang diakibatkan antara lain oleh adanya pemadatan tanah. pH H 2O di semua lokasi penelitian umumnya kurang dari lima. Tabel 5.97 0. meliputi pH H2O.86 0. (1985) menyatakan bahwa nilai ini tergantung bukan saja oleh jumlah pori tetapi juga tingkat kontinuitas pori. Adanya pori-pori yang menurun jumlahnya.15 62. Sifat-sifat fisik tanah di lokasi penelitian Sukabumi Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 12. Cu.54 Debu (%) 18. kecuali Sukabumi. Zn. maka akan mengakibatkan kapasitas tanah menampung air dan udara menurun...90 26.(Pratiwi) Tabel 3. Ca.73 5.

dan S) dan unsur hara mikro (Fe. K tergolong medium sedangkan di Carita dan Sukabumi masing-masing tergolong rendah dan tinggi dan Al+3 dan H+ rendah sampai sangat rendah di semua lokasi. N. Menurut Sutanto (1988). Walaupun tanah-tanah di lokasi penelitian berkembang dari bahan vulkanik andesitik yang kaya akan material-material basa. 202 . dan Co). maka reaksinya asam dan kejenuhan basanya kurang dari 100%. Rendahnya carbon organik dan nitrogen total berhubungan dengan rendahnya bahan organik. Oleh karena itu di ketiga lokasi penelitian tidak ada bahaya keracunan Al. Al+3. Pratiwi (2004 dan 2005) menyatakan bahwa unsur ini khususnya di lapisan atas mempunyai fungsi yang sangat penting dalam perkecambahan biji. Di samping pH.Aspek SOSIAL EKONOMI DAN KONSERVASI penelitian masih dikategorikan asam. ketersediaan dari unsur-unsur esensial ditentukan oleh bahan organik dan proses-proses dinamis yang ada di dalam profil tanah. carbon organik lebih tinggi daripada Sukabumi dan Dramaga. Tanah dengan kandungan Al yang tinggi memiliki sifat toksik. 2004 dan 2005). Zn. Ca. P. Hal ini dapat dimengerti karena di lokasi penelitian Carita. tetapi di Carita. namun karena adanya proses pelapukan yang intensif dan juga adanya pencucian (leaching). H. Unsur-unsur ini dikategorikan sebagai unsur hara makro (C. Unsur hara esensial merupakan unsur yang diperlukan oleh tanaman dan fungsinya tidak dapat digantikan oleh unsur lain (Pratiwi. Mo. Di areal penelitian Dramaga. Hal ini menunjukkan bahwa dekomposisi bahan organik tidak terlalu kuat. Reaksi ini mempengaruhi ketersediaan unsur hara esensial. Perbandingan C/N di semua horizon tergolong tinggi. K. B. Elemen penting lainnya adalah K. Mn. khususnya di horizon bagian atas. Cl. dan H+. dijumpai banyak tumbuhan bawah jika dibandingkan dengan lokasi penelitian Sukabumi dan Dramaga. Tumbuhan bawah merupakan sumber bahan organik. Cu. bahan organik juga menyebabkan meningkatnya KTK dengan meningkatnya muatan negatif. Carbon organik dan nitrogen total di lokasi penelitian menurun semakin ke bawah. Mg. Jumlah carbon organik relatif rendah di semua horizon. O. Kandungan P di semua lokasi penelitian tergolong sangat rendah (< 2).

Ada kecenderungan bahwa daerah dengan pH yang tinggi memiliki kejenuhan basa yang tinggi pula.(Pratiwi) Unsur hara mikro juga mempengaruhi pertumbuhan tanaman.07) sedangkan di Dramaga medium (16.77). Tabel 4.75) dan yang terendah adalah di Carita (13.Karakteristik Lahan Habitat .11(Rendah) 203 . KTK tanah dianalisis dengan larutan buffer NH4Oact pH 7 dan KTK sum of cation..35-41.70 (Rendah) 1. KTK tinggi berarti areal tersebut cukup subur. Kapasitas tukar kation (KTK) menunjukkan tingkat kesuburan tanah.50 (Rendah) 1. dan Mn.12 (Rendah) Horizon 3 (>60 cm) 4.03 (Rendah) 0.0515.43 (Rendah) 0.60 (Rendah) 1.. di mana pH daerah Sukabumi lebih tinggi daripada Carita dan Dramaga. Hal ini disebabkan karena Sukabumi memiliki pH H 2O tertinggi. Zn. Di semua horizon dari tiga lokasi penelitian ini. dan Tabel 6 mengindikasikan bahwa tanah di Sukabumi memiliki KB tinggi (39.03 (Rendah) 0. Dari Tabel 4. dan Tabel 6 menunjukkan secara jelas bahwa KTK NH4Oact pH 7 dari seluruh profil sangat tinggi daripada KTK sum of cation. Unsur-unsur tersebut adalah Fe. Jumlah kation tertinggi di areal penelitian terdapat di Sukabumi dan yang terendah di Carita. kation basa didominasi oleh calcium dan magnesium. dan Zn relatif rendah sementara kandungan Mn sedang sampai relatif cukup. Tabel 5. Kandungan kation basa di Sukabumi termasuk tinggi sedangkan di Dramaga medium dan Carita termasuk rendah. Cu. Tanah dengan KTK tinggi dapat menyerap unsur hara. Cu. Unsur-unsur Fe. Tabel 4. tetapi diperlukan dalam jumlah sangat sedikit..01-17.. Kondisi ini relatif sesuai untuk pertumbuhan tanaman. Kecenderungan ini terjadi di areal penelitian.15 (Rendah) Horizon 2 (30-60 cm) 4. Tabel 5. Tanah dengan pH lebih tinggi umumnya memiliki KTK yang lebih tinggi. Sifat-sifat kimia tanah di lokasi penelitian Dramaga Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) Horizon 1 (0-30 cm) 4. sehingga ketersediaan hara akan lebih bagus pada areal dengan KTK rendah.

16 (Sangat rendah) 0.16 (Rendah) 1.30 (Rendah) 17.14 (Rendah) 1.99 (Medium) 46.80 2.7 (Sangat rendah) 5.60 (Rendah) 0.14 (Rendah) 1.52 (Rendah) 0.72 (Sangat rendah) 0.41 2.20 (Sangat rendah) Horizon 3 (>60 cm) 4.48 2.75 (Medium) 40.26 (Rendah) 16.44 5.88 88.01 (Sangat rendah) 0.49 (Sangat rendah) 0.29 (Medium) 1.44 (Medium) 0.60 1.70 (Sangat rendah) Horizon 2 (30-60 cm) 4.26 (Medium) 3.68 (Medium) 4.36 4.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): Al H 0.20 (Sangat rendah) 204 .17 (Rendah) 1.31 (Medium) 0.08 (Sangat rendah) 1.04 3.32 ( Medium) 1.28 79.71 (Sangat rendah) 0.7 (Sangat rendah) Horizon 2 (30-60 cm) 1.24 85.20 Tabel 5.51 (Rendah) 0.40 5.33 4.00 (Sangat rendah) 0.70(Medium) 0.3 (Sangat rendah) Horizon 3 (>60 cm) 1.64 4.26 (Rendah) 16.58 (Tinggi) 0.60 (Rendah) 2.88 (Medium) 5.50 (Rendah) 1.19 ( Medium) 0.61 (Medium) 35.13 (Rendah) Horizon 1 (0-30 cm) 4.90 (Sangat rendah) 0.44 (Medium) 0.17 (Rendah) 1.53 (Rendah) 0. Sifat-sifat kimia tanah di lokasi penelitian Carita Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K 1.01 1.09 (Medium) 0.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 1.75 (Rendah) 0.

11 (Rendah) 3.04 1.27 (Sangat rendah) 5.21 (Rendah) 13.64 3.77 (Rendah) 16.72 1.00 1. Sifat-sifat kimia tanah di lokasi penelitian Sukabumi Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): 16.99 (Tinggi) 10.49 7.49 (Sangat rendah) Horizon 2 (30-60 cm) 0..98 (Tinggi) 10.07 (Sangat tinggi) 69.40 (Medium) 0..43 (Medium) 36.01 (Rendah) 0.22 (Rendah) 13.56 (Tinggi) 16.(Pratiwi) Sifat-sifat kimia Na KTK KB (%) KCl (me/100 gr): Al H 0.15 (Rendah) 3.10 (Rendah) 2.Karakteristik Lahan Habitat .52 2.20 (Rendah) 15.00 28.80 16.94 (Sangat tinggi) 0.68 2.64 (Tinggi) 10.60 (Rendah) 1.40 (Sangat rendah) 205 .84 (Rendah) 0.86 (Tinggi) Horizon 1 (0-30 cm) 5.48 (Tinggi) 78.40 (Rendah) 0.03 (Rendah) 14.22 (Rendah) 39..05 (Sangat tinggi) 0.71 (Tinggi) 0.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 0.35 (Tinggi) 63.53 6.07 (Medium) 0.60 17.36 (Rendah) 0..11 (Rendah) 14.70 (Sangat rendah) Horizon 3 (>60 cm) 4.40 Tabel 6.49 (Sangat rendah) Horizon 3 (>60 cm) 0.22 (Rendah) 0.48 1.90 (Sangat rendah) Horizon 2 (30-60 cm) 5.52 (Sangat tinggi) 0.08 1.18 (Rendah) 3.60 (Rendah) 0.45 1.10 (Rendah) 1.84 (Sangat tinggi) 14.36 (Medium) 41.

Umum Analisis vegetasi dilakukan terhadap vegetasi/tumbuhan bawah di Carita.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia Al H 0.40 (Rendah) 0. Dengan demikian untuk tingkat pohon.40 17. dan Sukabumi. Komposisi Vegetasi dan Spesies Dominan 1.25 Horizon 2 (30-60 cm) 2.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 2. Oleh karena itu analisis vegetasi ditekankan pada tumbuhan bawah.12 0.36 1. mendukung beberapa anakan muncul dari jenis-jenis lain selain jenis tanaman penghasil gaharu. 206 . Tabel 7. Dramaga.36 B. Sistem penanaman di Carita yang multikultur. sapling serta tiang didominasi oleh gaharu.32 (Sangat rendah) 0.44 1. Komposisi Tumbuhan Bawah Hasil pengamatan menunjukkan bahwa komposisi jenis tumbuhan bawah di Carita lebih tinggi dibandingkan di Sukabumi dan Dramaga (Tabel 7).76 (Sangat rendah) 0.12 1. Areal ini merupakan hutan tanaman pohon penghasil gaharu.30 Horizon 3 (>60 cm) 6. Di Carita pohon Sukabumi 6 3 penghasil gaharu ditanam dengan sistem campuran dengan jenis tanaman serba guna sedangkan di Sukabumi dan Dramaga ditanam dengan sistem monokultur.42 0.56 26.00 0.52 1.20 1.56 22.32 1. 2. Jumlah jenis tumbuhan bawah dan familinya di lokasi penelitian Lokasi penelitian Jumlah jenis Jumlah famili Ko n d i s i i n i a g a k nya k a r e n a Carita 30 18 perbedaan sistem penanaman dalam Dramaga 8 16 hutan tanaman tersebut.

Karakteristik Lahan Habitat . 207 . dan Lampiran 3). Indeks Kesamaan Jenis Tumbuhan Bawah Berdasarkan indeks kesamaan jenis menurut Sorensen (MuellerDumbois and Ellenberg. Jenis Tumbuhan Bawah Dominan Secara ekologis. Hal ini diindikomuni-tas tumbuhan di lokasi penelitian kasikan dengan nilai indeks similaritas yang rendah (<50%) Lokasi Carita Dramaga Sukabumi (Tabel 8).. nilai vegetasi ditentukan oleh peran dari jenis dominan.. Jenis dominan merupakan jenis yang mempunyai nilai penting tertinggi di dalam komunitas yang bersangkutan. Nilai ini merupakan hasil dari interaksi di antara jenis dengan kondisikondisi lingkungan... yaitu material volkanik yang bersifat andesitik.(Pratiwi) 3. Hasil pengamatan menunjukkan bahwa jenis dominan dan kodominan masing-masing areal penelitian berbeda. dan karakteristik tanah. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor lingkungan seperti iklim. topografi. Lampiran 2. Di Carita jenis dominan dan kodominan dari tumbuhan bawah yang ditemui adalah jampang (Panicum disachyum) dan selaginela (Selaginella plana) sedangkan di Dramaga adalah pakis (Dictyopteris iregularis) dan seuseureuhan (Piper aduncum) serta di Sukabumi adalah jampang (Panicum disachyum) dan rumput pait (Panicum barbatum) (Lampiran 1. 1974) komposisi jenis tumbuhan bawah di tiap lokasi penelitian berbeda satu Tabel 8. Data ini mengindikasikan bahwa habitat dari masing-masing lokasi penelitian secara ekologis memiliki karakteristik yang berbeda-beda. Tanah di tiga lokasi penelitian memiliki bahan induk yang relatif sama. Indeks similaritas (%) dari dengan lainnya. Carita - 9 - 35 9 - Darmaga Sukabumi - KESIMPULAN 1. 4.

LPT. serta di Sukabumi masing-masing jampang (Panicum disachyum) dan rumput pait (Panicum barbatum). H. Factors of Soil Formation. Lembaga Penelitian Tanah. WWF-Traffic India. In C.). 4. dan sifat-sifat tanah. L. 6. Jenny. Jenis dominan dan kodominan di masing-masing areal penelitian berbeda. 5. Peta Tanah Tinjau Jawa dan Madura. Kumar and V. Tingkat kesuburan ini berhubungan dengan tingkat dari proses pelapukan. Komposisi jenis tumbuhan bawah juga berbeda di tiap lokasi penelitian sebagaimana diindikasikan dengan nilai SI < 50%. Sifat-sifat fisik dan kimia tanah di areal penelitian mendukung pertumbuhan pohon penghasil gaharu. A. Perbedaan sifat-sifat fisik dan kimia tanah di lokasi penelitian disebabkan perbedaan tingkat proses pelapukan yang berhubungan dengan kondisi lingkungan dari proses pelapukan tersebut. tanah Carita kurang subur dibandingkan dengan Dramaga dan Sukabumi. McGrawhill. Di Carita tumbuhan bawah yang dominan adalah jampang (Panicum disachyum) dan jenis kodominan adalah selaginela (Selaginella plana).A. K. DAFTAR PUSTAKA Allison. Bogor. 280 p. Menon. Black (ed. 1994.Aspek SOSIAL EKONOMI DAN KONSERVASI 2.. Soil Analyses. Part II. New York. 1965. Organic Matter by Walkey and Black methods. 3. Chakrabarty. Trade in Agarwood.E. 208 . 1962. Sedangkan di Dramaga jenis dominan dan kodominan masing-masing adalah pakis (Dictyopteris irregularis) dan seuseureuhan (Piper aduncum). Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor-faktor lingkungan seperti iklim. topografi. Sehubungan dengan tingkat pelapukan. 1941.

Soil Characteristics and Vegetation Composition Along a Topotransect in The Gunung Gede Pangrango National Park.. 1991. PhD Thesis. 209 . Buletin Penelitian Hutan 644: 63-76. Report No. Pusat Litbang Hutan dan Konservasi Alam. New York. Pratiwi. United Stated Department of Agriculture. Ferguson. Hubungan Antara Sifat-Sifat Tanah dan Komposisi Vegetasi di Daerah Tabalar. Kementrian Perhubungan. Belgium. Pratiwi.A. Ellenberg. International Training Center For Post Graduate Soil Scientists. Hutan Penelitian Carita. Kalimantan Timur. 306 p. John Willey and Son. and J. F..Karakteristik Lahan Habitat . The Relationship Between Soil Characteristics with Vegetation Diversity in Tanjung Redep.. 2004. 68 p. and H. MSc. R.) di Beberapa Hutan Tanaman di Pulau Jawa. Eksplorasi dan Studi Permudaan Jenis-Jenis Penghasil Gaharu di Wilayah Hutan Kintap. Sutomo. Six Edition. Kalimantan Selatan. 1984. 2000. Charge Properties and Classification of Soils on Volcanic Materials and Limestone in Central Java. 1974. Schmidt. 21 p. Minerlogy. Indonesia. D. Pratiwi and B. Aims and Methods of Vegetation Ecology. Verhand. S. Revised ed. Bogor. Procedure for Collecting Samples and Methods of Analyses for Soil Survey.Agric.H. K. Forestry and Estate Crops Research Journal 1(1): 27-33. Pratiwi.U. Universiteit Gent.. Soil Conservation Service. 2005. Kabupaten Berau. 233 p. dan R. Gakuryoku XI(2):127-131. 1951.. S. I.. Indonesia. A. Dept. 1988. Pusat Litbang Hutan dan Konservasi Alam. 1986. 1994. Mulyanto. Gent. Prawira. Buletin Penelitian Hutan 474: 59-66. Thesis. Sutanto.(Pratiwi) Mueller-Dumbois. Djawatan Meteorologi dan Geofisika. Soil Survey Staff. ITC-RUG. Sidiyasa. 2005. West Java. Key to Soil Taxonomy. Ciri dan Sifat Lahan Habitat Mahoni (Swietenia macrophylla King. East Kalimantan. Rainfall Based on Wet and Dry Period Ratios for Indonesia with Western New Guinea.S. Jakarta.H. Soil Conservation Service. 42.

00 300. Stachystarpheta jamaisensis Vahl.10 0.73 3.43 1.43 1. Amaryllidiaceae Elaeocarpus glaber Blume Elaeocarpaceae Seuseureuhan Piper aduncum L. Selaginellaceae Melastomataceae Meraispermaceae Cyperaceae Solanaceae Polypodiaceae Moraceae Schizophyllaceae Polypodiaceae Dilleniaceae Melastomaceae Rubiaceae Meliaceae Rubiaceae Graminae Verbenaceae Zingiberaceae Piperaceae Rubiaceae Polypodiaceae Thymelaeaceae Leguminosae Euphorbiaceae Rubiaceae Panicum barbatum Lamk. Compositae 100.49 1. Coniograma intermedia Hieron.43 1.00 5.25 0.93 1.02 4. Bridelia monoica L. Swietenia macrophylla King Morinda bracteosa Hort.28 57.00 14.25 0.62 0.98 0.43 1. Aquilaria malaccensis Lamk.18 2.93 1.43 1.91 2.25 0.23 0. Lygodium circinatum Sw.50 0.Sch.62 0.43 25.05 2.48 0.43 1. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Nama daerah Jampang Selaginella Harendong merah Cingcau Rumput pait Ilat Parasi Terongan Hatta Peletok Paku anam Pakis Sasahan Harendong Kokopian Mahoni Cacabean Alang-alang Hawuan Kakacangan Pacing Nama botani Famili Kr (%) Fr (%) Dr (%) NP (%) 47.00 100.71 0.83 9.99 3. Dictyopteris irregularis Presl. Gagajahan Ki koneng Babadotan Pakis anjing Gaharu Pete Kanyere Cingcanan Plectronia sp.81 10.18 6.43 1. Cecropia peltata L.80 1.43 1.37 0. Graminae Ageratum conizoides Linn.97 6. Parkia speciosa Hassk.43 1. Nilai penting jenis tumbuhan bawah di Carita No.11 0.25 0.09 3.29 1.37 0.25 0.12 0.25 21.43 1. Total Panicum montanum Roxb. Clidenia hirta Don.72 4.45 0. Solanum jamaicence Mill.85 4. Graminae Curculigo latifolia Dryand.25 0.75 0. Morinda bracteosa Hort. Tetracera indica L.69 2.85 1.36 6.66 8.43 2.50 0.Chr.25 0. Ixora sp.82 3.39 3.80 Panicum disachyum Linn.70 16. Gramínea Selaginella plana Hiern.62 1. Tapeinochilus teysmannianus K.43 2.99 10.00 Keterangan: Kr Fr Dr NP : Kerapatan relatif : Frekuensi relatif : Dominansi relatif : Nilai penting 210 .71 5.71 4.75 1.05 1.58 10.12 0. Imperata cylindrica Linn.43 1. Melastoma malabathricum L.25 0.70 32.12 81.86 1.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 1.25 0.28 22. Cyperus difformis Linn.43 1.80 1.17 7.76 7.57 4.30 2.43 1.00 5.23 0.98 0.23 0.88 7.43 2.09 2.25 0.25 8. Dryopteris dentata C.05 2.12 0.39 9.62 0.85 2.43 2.57 4.29 5.50 0.25 0.52 5.71 1.00 100.47 2. Cyclea barbata Miers.25 0.25 0.09 1.75 0.00 9.93 1.25 0.25 0.17 2.30 2.49 0.

42 1. Compositae Tapeinochilus teysmannianus K.72 11.89 100.89 17.19 22.00 Fr (%) 16.41 11.25 20.76 5.06 19..04 43. Ageratum conizoides Linn.72 16. Micania scandens Willd.71 5.03 16.55 3.76 5. Famili Polypodaceae Piperaceae Araceae Graminae Gramínea Compositae Kr (%) 29. Total Zingiberaceae Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 211 ..00 Dr (%) 28.72 11.00 Rumput pait Panicum barbatum Lamk.14 100.53 100.89 11.03 5.16 37.56 300.Sch.76 5.00 16. Rumput padi Areu Babadotan Pacine Oryza grandulata Nees. 1 2 3 4 5 6 7 8 Nama daerah Pakis Seuseureuhan Tales Nama botani Dictyopteris irregularis Presl..14 1.(Pratiwi) Lampiran 2. Alocasia sp.64 11.Karakteristik Lahan Habitat . Nilai penting jenis tumbuhan bawah di Dramaga No.72 16.08 34..71 5.52 5.21 57.00 NP (%) 74.78 30. Piper aduncum Linn.

71 14.38 4.56 24.33 16.57 100.57 3. Harendong Babadotan Kirinyuh Clidenia hirta Don.62 16.35 22. Famili Gramínea Graminae Melastomaceae Compositae Kr (%) 56.76 7.00 NP (%) 139. Total Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 212 .00 Rumput pait Panicum barbatum Lamk.24 4.00 Fr (%) 33.14 30.74 2.94 32.00 17. Nilai penting jenis tumbuhan bawah di Sukabumi No.67 8. Compositae Graminae Alang-alang Imperata cilíndrica Linn.06 300.34 16. Euphatorium pallascens DC.87 10.9 58. Ageratum conizoides Linn.67 16.28 3.67 8.16 100. 1 2 3 4 5 6 Nama daerah Jampang Nama botani Panicum distachyum Linn.00 Dr (%) 50.Lampiran 3.33 100.

beccariana. 2000). bahan obat serta juga kulitnya dapat dibuat untuk bahan tali atau kain (Puri. selama ini banyak dikenal sebagai bahan untuk membuat wangi-wangian. Heyne. microcarpa. Bagi Suku Dayak Punan di Kalimantan Timur. 1987. A. A. filaria. hirta. 2002). Indonesia juga merupakan habitat endemik beberapa jenis gaharu komersial dari marga Aquilaria. A. karena merupakan sumber pendapatan terbesar yang memiliki nilai pasar tinggi (Kaskija. negara penghasil gaharu terbesar di dunia.) DI PROVINSI LAMPUNG DAN BENGKULU.2 milyar rupiah ke kas negara pada tahun 1995. dan lain-lain. 2001. Gaharu merupakan komoditi hasil hutan bukan kayu yang banyak diminati oleh pasar luar negeri (Soehartono dan Newton. SUMATERA Titiek Setyawati Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu. Jenis pohon penghasil gaharu menghasilkan resin yang memiliki aroma wangi dan jenis-jenis yang menghasilkan gaharu dengan 213 .12 POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk. Zuhud 1994). seperti A. dengan nama perdagangan “agarwood/aloe-wood/ eaglewood”. Indonesia merupakan salah satu eksportir terbesar produk gaharu dan sudah menyumbangkan sekitar 6. Gaharu banyak diproduksi di Indonesia. A. gaharu merupakan komoditi hasil hutan non-kayu penting. malaccensis Lamk..

Hampir sebagian besar jenis dapat ditemukan di Kalimantan. kemedangan. Dalam proses selanjutnya.87 pohon/ha (Sumatera). Sumatera. dan 4. Enkleia (1 jenis). yaitu gubal gaharu. dan Gyrinops 214 . keberadaan serta potensi pohon penghasil gaharu yang ada di Indonesia sampai saat ini masih belum terkoleksi dengan baik. kedelapan jenis tersebut masuk dalam marga Aetoxylon (1 jenis). 2007). karena eksploitasi yang berlebihan (Zich dan Compton.37 pohon/ha (Kalimantan). gaharu ternyata dihasilkan tidak dari satu jenis pohon saja melainkan dari berbagai macam jenis. Satu pohon biasanya dapat menghasilkan 0. Gaharu dihasilkan dari proses pembusukan atau infeksi.untuk kualitas super. Menurut Sidiyasa (1986) dalam Mai dan Suripatty (1996).000. Nusa Tenggara Timur. 2001) dan bahkan semua jenis penghasil gaharu (Aquilaria spp. baik batang maupun akar pohon secara kimiawi oleh beberapa jenis jamur. Berdasarkan hasil pengamatan di lapangan. Jenis yang saat ini banyak dipanen di Irian Jaya sudah sangat terancam keberadaannya. dan abu gaharu. 3. sejak tahun 1994 gaharu masuk dalam Appendix II daftar CITES (Soehartono dan Newton.33 pohon/ha (Irian Jaya) (Anonim. 2001) yang tumbuh tersebar di Indonesia. dan Wikstroemia (2 jenis). Dari beberapa pustaka yang ada. Potensi yang diperkirakan ada saat ini yaitu 1. Karena eksploitasi yang intensif sehingga mengancam keberadaanya di alam. 2001). Usaha budidaya jenis pohon penghasil gaharu juga belum banyak mengalami perkembangan yang nyata dan produk gaharu masih lebih banyak dipanen dari hutan alam.Aspek SOSIAL EKONOMI DAN KONSERVASI kualitas tinggi banyak diperdagangkan ke luar negeri. Nusa Tenggara Barat. Resin yang dihasilkan memiliki aroma wangi yang merupakan ciri khas dalam menentukan kualitas gaharu. Pada umumnya gaharu diperdagangkan dalam tiga kelompok sortimen. Meskipun jumlah ekspor gaharu saat ini mengalami penurunan pesat dibandingkan dengan tahun-tahun sebelumnya. Bahkan beberapa jenis sudah menjadi langka akibat perburuan jenis-jenis tertentu yang tidak terkendali.5 sampai 4 kg gaharu dengan harga di tingkat pencari Rp 700. masingmasing sortimen akan dibedakan lagi berdasarkan kelas mutunya. Gonystylus (2 jenis). informasi mengenai jenis. serta Irian Jaya. Aquilaria (2 jenis). jenis pohon penghasil gaharu dari marga Aquilaria dan Wiekstroemia memiliki lebih dari 2 jenis (Sellato.

malaccencis Lamk. baik dari sisi potensi dan persebarannya. Harga gaharu saat ini sangat bervariasi tergantung dari kualitasnya. maka diperlukan upaya serius dari berbagai macam pihak yang berkepentingan agar keberadaan jenis-jenis tersebut di Indonesia dapat dipantau. baik ek-situ maupun in-situ. maka diharapkan tersedia bukti yang kuat menyangkut status jenis-jenis pohon penghasil gaharu di Indonesia. diperlukan upaya eksplorasi dan konservasi. Sumatera. diharapkan jenis ini dapat keluar dari daftar CITES sebagai jenis yang harus dilindungi. maka tidaklah heran jika gaharu sangat dicari oleh para pedagang sedangkan pemanenan masih mengandalkan gaharu yang tumbuh di alam dan pencarian dilakukan oleh masyarakat lokal yang memiliki akses masuk ke dalam hutan. Makalah ini bertujuan untuk memberikan informasi menyangkut aspek potensi dan persebaran gaharu (A. 1997 dalam Soehartono dan Newton. 2009). Mengingat keberadaan jenis-jenis pohon penghasil gaharu yang mulai langka dan terancam punah. Harga gaharu saat ini bervariasi mulai dari 5 juta hingga 20 juta rupiah per kilogramnya.(Titiek Setyawati) spp. 2000) dan sudah memberikan sumbangan kepada pemasukan negara sejumlah 6. Untuk jenis gaharu yang terbaik di kelasnya harganya bisa melebihi 20 juta rupiah per kilogram tergantung kualitasnya (Anonim.. Mengingat harga gaharu yang demikian tinggi. Selama beberapa dekade ini. Indonesia dikenal sebagai negara penghasil gaharu terbesar (Direktorat Jenderal PHPA.) masuk dalam Appendix II CITES sejak tahun 2004. Masyarakat di lokasi hutan di Sumatera pada umumnya mengumpulkan gaharu dalam kelompok yang masing-masing terdiri dari 3 sampai 5 orang.2 milyar rupiah di tahun 1995... Dengan tersedianya informasi yang memadai. Dengan usia tanam dari 6 hingga 8 tahun gaharu mampu menghasilkan getah sekitar dua kilogram.Potensi dan Kondisi . Mengingat semakin terancamnya keberdaan jenis pohon penghasil gaharu yang ada di habitat alaminya.) di Provinsi Lampung dan Bengkulu. karena berbagai macam alasan yang menyangkut status konservasinya. Kelompok tersebut biasanya akan tinggal di hutan selama lebih kurang seminggu untuk mencari 215 ..

Areal penelitian masuk dalam Seksi Konservasi Wilayah II Krui dengan luas kawasan ± 96. tepatnya di Kabupaten Lampung Tengah. Kabupaten Lampung Barat. Kabupaten Lampung Tengah. yaitu di Hutan Bukit Rupi dan Hutan Gunung Sugih. Pada saat ini. Lampung Survei jenis-jenis pohon penghasil gaharu di Provinsi Lampung dilakukan di satu lokasi yang ada di dalam kawasan Taman Nasional Bukit Barisan Selatan (Hutan Biha) dan dua lokasi di luar kawasan TNBBS. Seksi Krui.884 ha dengan cakupan wilayah meliputi Resort Merpas. Kecamatan Pesisir Selatan. Resort Biha.Aspek SOSIAL EKONOMI DAN KONSERVASI gaharu di pedalaman hutan. Kecamatan Pubian. Lokasi survei berada di Desa Sumur Jaya. METODE PENELITIAN A. Namun demikian masih ada beberapa lokasi hutan alam. Kondisi topografi di hutan alam ini sedikit berbukit dengan beberapa lokasi memiliki kelerengan hingga 35 derajat. Kondisi hutan sebagian sudah dialihfungsikan menjadi lahan perkebunan dan ladang masyarakat. Jika gaharu ditemukan. Kawasan Hutan Bukit Rupi berada di luar kawasan TNBBS namun demikian merupakan kawasan hutan lindung yang dikelola oleh Dinas Kehutanan Provinsi Lampung Tengah. Seringkali terjadi bahwa kualitas gaharu tidak seperti yang mereka inginkan dan pada akhirnya pohon yang sudah terlanjur ditebang ditinggalkan begitu saja di hutan. dimana ditemukan tegakan gaharu yang masih utuh. sehingga orang harus tinggal lebih dari 2 minggu atau bahkan sebulan hanya untuk mendapatkan gaharu. maka mereka akan menebang pohonnya secara manual menggunakan kampak. Pugung 216 . Kawasan Hutan Biha masuk dalam Blok Hutan Podomoro. pencarian gaharu makin sulit akibat potensinya yang mulai menurun. Kawasan Hutan Bukit Rupi berada di Desa Segala Midar. Lokasi Penelitian 1.

Lokasi penelitian secara detil tertera pada Gambar 1. Curah hujan ratarata di bagian barat adalah 3. Peta lokasi survei dan pengamatan 2. Topografi kawasan ini bergelombang dan berbukit-bukit dengan ketinggian berkisar antara 0-1... Bengkulu Lokasi kedua kawasan hutan sangat berdekatan dengan Tahura Rojolelo yang terletak di antara 03 42’-03 44’LS sampai 102 21’BT dan berada di ketinggian 10-30 m dpl.500-3.. dan Seksi di Provinsi Lampung Konservasi Wilayah III Sukaraja. 217 . dan Biha.964 m dpl.000-3. Gambar 1.(Titiek Setyawati) Tampak. Kawasan hutan TNBBS ini terletak di ujung selatan dari rangkaian pegunungan Bukit Barisan dan secara geografis berada pada 4031’5057’ LS dan 103024’1 0 4 0 BT s e d a n g k a n secara administratif p e n ge l o l a a n te r b a g i d a l a m t i g a w i l aya h pengelolaan. yaitu Seksi Konservasi Wilayah I Liwa. S e k s i Ko n s e r va s i jenis-jenis pohon penghasil gaharu Wilayah Krui.Potensi dan Kondisi .500 mm/th sedangkan di bagian timur 2. Waktu tempuh dari pusat kota Bengkulu sekitar 30 menit dengan jarak sekitar 20 km (Gambar 2).. Krui.000 mm/ th.

kamera digital. kertas plak herbarium. BAHAN DAN ALAT A.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 2. fenologi. GPS Garmin 12 satelit. karet. antara lain alkohol 96%. Lokasi penelitian di Kawasan Hutan Binjai Temula (Kec. dan potensi sebaran jenis pohon penghasil gaharu ini adalah semua jenis pohon yang diduga menghasilkan gaharu yang terdapat di kawasan hutan lindung. alat plak herbarium. Bahan dan Alat Bahan yang dijadikan sebagai obyek kegiatan ekologi. kertas koran. dan tali rafia. jeruk. baik primer dan sekunder. pisang. Prosedur Kerja Kajian lapangan di Kabupaten Lampung Tengah dan Lampung Barat dilakukan pada bulan Oktober dan Desember 2007 sedangan 218 . B. Bengkulu Utara Kawasan hutan dekat Desa Tanjung Terdana sebagian besar sudah dikonversi menjadi areal persawahan dan perkebunan masyarakat. Talang Empat) dan Pungguk Gambo (Kec. tambang nilon. karung plastik. kantung plastik. Pondok Kelapa). Alat yang digunakan untuk pengambilan data di lapangan. pena/alat gambar. tinta gambar spesial. kertas gambar spesial. Tanaman yang umum ditanam antara lain padi. kelapa sawit. kompas. dan tanaman palawija lainnya. larutan sub-limat. jati.

200-500 m. baik secara langsung melalui wawancara dengan masyarakat yang tinggal di dekat dan sekitar hutan maupun tidak langsung dengan cara melakukan kajian pustaka. Di samping itu dibuat juga blangko isian tersendiri yang digunakan untuk bahan wawancara dengan penduduk yang berisi pertanyaan-pertanyaan menyangkut berbagai macam informasi tentang karakter jenis-jenis pohon penghasil gaharu yang dikenal oleh penduduk setempat. Pengamatan pertama di Bengkulu dilaksanakan di Hutan Lindung Kelompok Hutan Binjai Temula. 3. antara lain: 2. Desa Tanjung Terdana.. Untuk itu digunakan blanko isian mencakup data pohon. yaitu pada bulan Oktober dan Desember 2008. Kecamatan Pondok Kelapa. data kondisi lingkungan tempat tumbuh. Eksplorasi dilakukan di berbagai kondisi hutan. 219 . Beberapa contoh pohon akan diambil untuk keperluan identifikasi dan koleksi herbarium. yakni topografi datar (kemiringan lereng kurang dari 10%) dan bergelombang berat (kemiringan 25% atau lebih). Pengamatan dan analisis gaharu meliputi beberapa macam kegiatan. Kegiatan pengamatan dan pengukuran di lapangan dikerjakan oleh seorang peneliti. Panjang tiap jalur eksplorasi yaitu 1 km dengan jarak antar jalur 500 m... Waktu pengamatan lapangan masing-masing selama 8 dan 10 hari. Kecamatan Talang Empat dan yang kedua di Hutan Lindung Kelompok Hutan Pungguk Gambo. 1. Pengumpulan data lapangan. dan data penggunaan tradisional penduduk setempat. baik di lahan kering maupun lahan basah. yaitu antara 0-200 m.Potensi dan Kondisi . dan 5 orang tenaga teknis lapangan.(Titiek Setyawati) Kabupaten Bengkulu Utara. Ketinggian tempat di lahan kering ada 3 macam. Kuesioner dipersiapkan sebelum kegiatan lapangan dilakukan. dan lebih dari 500 m dpl dengan topografi yang berbeda. Koleksi data primer di lapangan mencakup keanekaragaman jenis pohon penghasil gaharu dan kondisi lingkungan tempat tumbuhnya dengan menggunakan metode eksplorasi dalam jalur-jalur yang sistematik. Provinsi Bengkulu dilaksanakan dua kali. 3 orang teknisi. Desa Dusun Baru..

tingkat pancang (tinggi lebih dari 150 cm dengan diameter kurang dari 10 cm) dan tingkat tiang (diameter 10-20 cm) di sekitar titik pusat kuadran. diameter batang. Mengadakan pendugaan potensi dan sebarannya dengan menggunakan metode titik pusat kuadran (quadrant center point method) sepanjang jalur eksplorasi dengan jarak antara titik pertama dan titik berikutnya 50 m. Jika anakan yang pertama ditemukan berada jauh dari pohon induk. Estimasi regenerasi jenis-jenis pohon penghasil gaharu yang terdapat di kawasan hutan dengan cara menghitung permudaan tingkat semai (tinggi kurang dari 150 cm). Pengidentifikasian jenis-jenis pohon penghasil gaharu dan proses koleksi herbarium dari kegiatan eksplorasi. Penduduk yang tinggal di dekat kawasan diminta untuk mengisi blanko kosong yang harus diisi dengan informasi kapan masa 220 . Individu pohon tersebut yang dirisalah dibatasi jarak terjauh 25 m dari titik pusat kuadran dan diameter batangnya 20 cm atau lebih. 11. 8. maka dibuat risalah anakan menggunakan metoda jalur transek sepanjang 1 km dari titik anakan pertama ditemukan.Aspek SOSIAL EKONOMI DAN KONSERVASI 4. Jarak anakan pertama dengan pohon induk diukur. Pada tiap titik pusat kuadran dilakukan perisalahan 4 individu pohon penghasil gaharu atau pohon lainnya yang terdekat dengan titik pusat atau 1 individu pohon pada tiap kuadran. Pengolahan data hasil wawancara dengan masyarakat lokal. Selanjutnya dibuat petak 10 m x 10 m di setiap selang 200 m dari jalur transek. Pendataan pohon meliputi nama jenis. Penulisan deskripsi jenis-jenis pohon penghasil gaharu yang disertai gambar lukisan spesimen herbarium. 9. Penggambaran lukisan spesimen herbarium jenis pohon penghasil gaharu. 6. 10. 5. Pembuatan tally sheet untuk mengisi data tentang masa berbunga dan berbuah jenis-jenis pohon penghasil gaharu. Pengolahan data potensi keberadaan jenis pohon penghasil gaharu dan wilayah sebarannya yang terdapat di dalam kawasan hutan alam. dan tinggi pohon. 7.

.. dan Frekuensi Relatif (FR) dari jenis tertentu. panas. Krebs. Kepadatan: jumlah individu per plot (100 m2). Luas Bidang Dasar (LBD): luasan bagian melintang dari batang >20 cm sebatas dada (diameter of breast height (dbh)). dan sebagainya) dan mengisi data curah hujan. malaccensis Lamk. 3. 1992). 4. jumlah pohon yang berbuah dan berbunga. Kelimpahan Relatif (KR). antara lain: 2. Beberapa definisi dan kalkulasi yang digunakan dalam analisis vegetasi. di mana jenis ditemukan. kondisi iklim atau cuaca pada saat berbunga atau berbuah (hujan. HASIL DAN PEMBAHASAN A.(Titiek Setyawati) berbunga. Luas bidang dasar untuk tiap plot dijumlah untuk memperoleh LBD tiap pohon dengan menggunakan rumus: LBD (m2) = pi x d (diameter dalam m)2/4 (Kent dan Coker. Hasil Pengamatan di Lampung Hasil pengamatan yang diperoleh dalam rangka melakukan kajian potensi sebaran jenis A.Potensi dan Kondisi . KR merupakan rasio jumlah individu dari suatu jenis terhadap jumlah total jenis di dalam plot dan FR merupakan rasio frekuensi dari suatu jenis terhadap total frekuensi seluruh jenis di dalam plot (Kent dan Coker. jumlah buah dan bunga (persentase).. Analisis Data 1. 1992. 1994). C. DR merupakan rasio total luas bidang dasar dari suatu jenis terhadap jumlah total luas bidang dasar dari seluruh jenis yang ada. Nilai NP ini diperoleh dengan cara menjumlahkan Dominansi Relatif (DoR). Nilai Penting (NP): perkiraan secara keseluruhan pentingnya suatu jenis pohon di dalam komunitas lokalnya. 1999. 5. kering. Frekuensi: jumlah unit contoh (10 m x 10 m). di Provinsi Lampung ini menunjukkan bahwa di beberapa lokasi di dalam kawasan Taman Nasional Bukit Barisan Selatan ini masih terdapat 221 ..

Lampung Tengah menunjukkan 222 . jumlah tegakan pohon. mereka tidak merasa menanam pohon penghasil gaharu dan menemukan pohon tersebut tumbuh di halaman kebun mereka.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan alam pohon gaharu meskipun jumlah dan potensi regenerasi alamnya tampak mengalami penurunan seperti yang ada di Kawasan Hutan Biha. dan anakan yang ditemukan pada enam plot sampel tampak cukup banyak. Tampak pada Gambar 3 kecambah gaharu yang tumbuh melimpah menyerupai permadani di bawah tegakan induknya yang ditemukan di Kawasan Hutan Bukit Rupi. belum ada laporan bahwa pohon tersebut pernah menghasilkan gaharu atau terinfeksi oleh patogen. sapling. Lampung Tengah 4). Gunung Sugih. Tampaknya tidak banyak gangguan seperti pengambilan gubal gaharu di kawasan ini. Di beberapa tempat juga tampak tandatanda bekas perambahan hutan yang tentunya sebagian besar untuk mengambil kayu gaharu. Jumlah pohon gaharu yang dapat ditemukan di Bukit Rupi. Di lokasi ini juga dijumpai tegakan pohon penghasil gaharu alami yang tumbuh Gambar 3. Tegakan dapat dikatakan alami. Lampung Tengah. Kemungkinan hal ini disebabkan akses ke dalam kawasan hutan yang relatif sulit dibandingkan dengan Kawasan Hutan Biha. Khusus di Bukit Rupi. karena berdasarkan wawancara dengan pemilik kebun. Lampung Tengah tertera pada Tabel 1. Anakan gaharu yang ditemukan tumbuh secara besar di wilayah perkebunan alami di Kawasan Hutan Bukit milik masyarakat (Gambar Rupi. Nampak bahwa kondisi batang tegakan pohon sangat halus dan tidak ditemukan cacat pohon. Hasil pengamatan regenerasi alam jenis gaharu di Kawasan Hutan Way Waya. Namun demikian. Kemungkinan besar biji gaharu terbang dan menemukan media yang baik untuk tumbuh besar di kebun milik penduduk tersebut.

(Titiek Setyawati) perkembangan yang sedikit berbeda dengan yang ada di Bukit Rupi. Lampung Tengah 223 . Tegakan pohon A. meskipun lokasinya sama-sama di satu kabupaten. menemukan jenis gaharu tersebut. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Biha tertera pada Tabel 3. namun bukan sama sekali tidak ditemukan seperti di Kawasan Hutan Gunung Sugi. Nampak pula bahwa sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu. Gambar 4. Tampak bahwa tidak satu pun jenis penghasil gaharu ditemukan di petak sampel (Tabel 2) di antara 13 jenis pohon hutan yang berhasil diidentifikasi di laboratorium Botani Hutan. sehingga pemungut kayu gaharu setiap saat dapat secara kebetulan maupun ada juga yang dengan niat keras. yang ditemukan tumbuh secara alami di perkebunan milik masyarakat yang lokasinya berbatasan dengan Kawasan Hutan Bukit Rupi. Lampung Tengah.....Potensi dan Kondisi . Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Hutan Biha sangat sedikit. sehingga kemungkinan sejak dahulu sudah banyak masyarakat yang memanfaatkan gaharu yang tumbuh alami namun hal ini tidak dibarengi dengan upaya budidayanya. Kurangnya jumlah pohon ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung. malaccensis Lamk.

5. Lampung Tengah No. malaccensis Lamk. dan anakan A. 6. Lampung Tengah Tabel 1. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Rupi. plot 1.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 5. malaccensis Lamk. 2. 4. 3. Gunung Sugih. anakan dan semai beberapa jenis pohon alami yang ada dalam 50 plots penelitian di Kawasan Hutan Way Waya.) di kebun miliknya di Kawasan Hutan Gunung Sugih. Jumlah pohon (> 10 cm) 26 9 8 14 16 8 Jumlah pancang 34 15 21 16 19 17 Jumlah anakan 14 21 30 14 11 9 Tabel 2. pancang. Penduduk setempat yang sudah melakukan upaya bu-didaya penanaman pohon gaharu (A. Jumlah pohon. Jumlah pohon. Lampung Tengah Pohon No 1 2 3 Nama jenis Artocarpus elasticus Ganophyllum falcatum Bombax valetonii Plot 15 5 4 Batang 45 10 5 Tiang Plot 2 0 0 Batang 6 0 0 Pancang Plot 0 4 2 Batang 0 15 4 Semai Plot 0 0 0 Batang 0 0 0 224 . pancang.

plot 1. pancang. Alstonia angustifolia Pometia pinnata Cananga odorata Litsea sp. oleh karena itu pembuatan plot dilakukan di hutan belukar tersebut.. 3. Lampung Barat No.(Titiek Setyawati) Pohon No 4 5 6 7 8 9 10 11 12 13 Nama jenis Pterospermum diversifolium Laportea stimulans Vitex sp.. malaccensis Lamk.. Ficus sp.. Desa Sendang Baru. Namun demikian masih terdapat beberapa pohon penghasil gaharu alami yang tersisa di daerah hutan belukar. Kecamatan Sendang Agung. 4. Hibiscus macrophyllus Plot 4 0 3 3 2 4 2 3 2 1 Batang 5 0 7 5 3 5 3 5 3 1 Tiang Plot 4 1 5 4 1 2 5 5 4 4 Batang 8 4 12 8 2 5 8 6 5 5 Pancang Plot 6 5 0 2 0 3 0 2 0 2 Batang 18 17 0 7 0 10 0 7 0 3 Semai Plot 4 12 11 10 0 6 12 5 13 0 Batang 8 20 23 15 0 12 23 12 20 0 Tabel 3. 2. Artocarpus sp. Kabupaten 225 . yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Biha. Pohon gaharu yang masih ada di Kawasan Hutan Register 22 Way Waya. Jumlah pohon. dan anakan A.Potensi dan Kondisi . Jumlah pohon (> 10 cm) 2 Jumlah pancang 1 2 4 Jumlah anakan 3 8 5 12 Berdasarkan informasi penduduk yang tinggal di Kawasan Hutan Lindung Bukit Sugih (Register 22 Way Waya) bahwa jenis pohon gaharu sudah sulit dijumpai karena adanya pembalakan hutan maupun adanya pencari gaharu di masa lampau.

Lampung Barat 226 . malaccensis Lamk. itu pun terbagi tempatnya menjadi tiga titik dengan jarak tempuh yang berbeda. sedangkan tingkat tiang tidak dijumpai. 25 cm. masing-masing satu batang pohon yang berdiameter 20 cm. (kiri) dan anakan yang tumbuh di bawahnya (kanan) di lokasi Kawasan Hutan Biha. 30 cm. Lampung Tengah. 28 cm. (Thymelaeaceae). Tegakan pohon A.Aspek SOSIAL EKONOMI DAN KONSERVASI Gunung Sugih. hanya tinggal sekitar 5 pohon. tingkat pancang hanya satu batang. dan 102 batang. 85. dan 34 cm. malaccensis Lamk. dan tingkat anakan terdapat 3 plot dengan jumlah masing-masing 30. Titik yang terdekat berjarak sekitar 5 km dengan jarak tempuh sekitar 1 jam berjalan kaki. Adapun jenis pohon penghasil gaharu yang ditemui hanya satu jenis yaitu A. Dari 50 plot yang dibuat terdapat 5 plot yang dijumpai pohon penghasil gaharu. Gambar 6.

Desa Dusun Baru. Hal ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung dan kemungkinan besar juga adalah tingkat reproduksi tegakan yang mulai berkurang. memiliki indeks nilai penting yang cukup tinggi pada tingkat pohon. pada Kawasan Lindung Kelompok Hutan 227 . Kecamatan Pondok Kelapa. Desa Tanjung Terdana. sehingga sejak dahulu sudah banyak memanfaatkan gaharu yang tumbuh alami.20%). Berdasarkan angka nilai pentingnya.. yaitu di Kelompok Hutan Binjai Temula. Tampak bahwa jumlah pohon sangat sedikit dan menurut informasi yang diperoleh dari masyarakat sekitar. Kecamatan Talang Empat dan Kelompok Hutan Pungguk Gambo. Jumlah pohon penghasil gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Binjai Temula tertera pada Tabel 4. Berdasarkan hasil analisis vegetasi di Kelompok Hutan Binjai Temula.86% (urutan kedua setelah Cinnamomum porectum (Roxb. Hasil Pengamatan di Kawasan Hutan di Provinsi Bengkulu Hasil menunjukkan bahwa A.(Titiek Setyawati) B. (57. Kedua lokasi berada di Provinsi Bengkulu dan kedua kawasan juga masuk dalam kawasan hutan lindung. sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu. A.. Tegakan gaharu pada tingkat tiang dan pancang tidak ditemukan pada plot sampel namun mendominasi pada tiangkat seedling (38..72%). yaitu Binjai Temula.) Kostm. malaccensis Lamk. Hal ini terjadi terutama di Kawasan Lindung Kelompok Hutan Pungguk Gambo. Kondisi regenerasi di kawasan ini hampir sama dengan kawasan yang sebelumnya. Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Kawasan Binjai Temula ini sangat sedikit. yaitu 39.. malaccensis Lamk. Sampai saat ini masih terdapat perburuan gaharu di hutan alam dan bahkan masyarakat atau penduduk lokal mengumpulkan anakan pohon gaharu (semai dan pancang) dari hutan alam untuk diperdagangkan.Potensi dan Kondisi . merupakan jenis yang ditemukan di kedua lokasi penelitian di Bengkulu Utara. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Pungguk Gambo tertera pada Tabel 5.

(67. 6. Jumlah pohon (> 10 cm) 1 1 0 1 1 0 Jumlah pancang 0 0 0 0 0 0 Jumlah anakan 0 3 1 2 3 2 228 . 3. 5. C. dan anakan A. Kecambah atau biji yang mulai tumbuh (kiri) dan beberapa anakan mulai tinggi (kanan) di areal Kelompok Hutan Pungguk Gambo Tabel 4. Tegakan tidak ditemukan di tingkat tiang dan hanya memiliki nilai penting 3. (90. banyak ditemukan kecambah atau biji-biji yang mulai berkecambah di bawah pohon induknya serta beberapa anakan dengan pertumbuhan yang cukup sehat (Gambar 7). Gambar 7.59% pada tingkat pancang dan berada di urutan keempat (19. pohon penghasil gaharu (>20 cm) menduduki urutan keempat (43. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Binjai Temula.55%). plot 1.Aspek SOSIAL EKONOMI DAN KONSERVASI Pungguk Gambo.82%). Bengkulu Utara No. Jumlah pohon. 4. Pada plot sampel di lokasi Pungguk Gambo. porectum (Roxb. 2. malaccensis Lamk.20%) setelah Vitex pubescens Vahl.48%) untuk tingkat seedling atau semai.30%). pancang. dan Garcinia diocia Blume (56.) Kostm.

Masa 229 .. Tegakan pada tingkat pohon terlihat sangat rapat (Gambar 8) dan pada sebagian petak sampel terdapat pohon dengan ukuran diameter yang cukup besar namun belum menampakkan tandatanda terjadinya pembusukan yang mengakibatkan terbentuknya gaharu (Gambar 9). malaccensis Lamk.Potensi dan Kondisi . Jumlah pohon. karena akan dipungut oleh penduduk untuk diperdagangkan.(Titiek Setyawati) No.5 kg pada musim yang baik. plot 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 0 1 Jumlah pancang 0 0 0 0 Jumlah anakan 2 1 3 3 Tabel 5. Namun demikian semai/seedling berukuran tinggi di atas 10 cm saja dihitung dalam petak pengamatan (2 m x 2 m) untuk memperoleh angka nilai penting... 3. pancang dan anakan A.. 4. 5 6 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 1 0 1 0 0 0 0 0 Jumlah pancang 0 0 2 0 0 0 0 0 0 0 Jumlah anakan 0 0 0 0 0 3 0 4 0 0 Biji yang mulai berkecambah tersebut tumbuh sangat rapat dan pada umumnya hanya bertahan beberapa hari saja. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Pungguk Gambo No. plot 1. Pada umumnya pohon mulai berbunga dan berbuah pada umur 5 sampai 6 tahun bahkan pohon berukuran sedang bisa menghasilkan biji kurang lebih 1. 2.

Di Sumatera. Sumarna et al. Penyakit seperti ini tidak ditemukan di lokasi penelitian di Bengkulu Utara. Petani menggunakan pestisida jika perlu untuk membasmi serangga ini. 2001). Masalah utama di lapangan adalah penyakit pada anakan yang disebabkan oleh serangga kecil yang hinggap di ujung daun anakan. Buah yang matang berwarna coklat kehitamhitaman. Pohon gaharu dengan diameter ≥ 50 cm Pohon berbunga pada bulan Juli dan Agustus dan menghasilkan buah matang pada bulan November-Desember. Buah ini harus langsung dipanen dari pohonnya. masa berbunga dan berbuah 2 kali dalam setahun. 230 . Gambar 8. 2004). 2000. Pembungaan pada bulan Maret-April akan menghasilkan buah di bulan Juli-Agustus (Adelina. menghisap cairan daun dan menyebabkan helai pucuk daun bergulung dan mengakibatkan anakan menjadi kerdil.Aspek SOSIAL EKONOMI DAN KONSERVASI berbunga dan berbuah biasanya terjadi pada bulan-bulan kering. Perkecambahan biji dan anakan yang muda sangat rentan terhadap penyakit damping off yang disebabkan oleh jamur (Kundu dan Ka-chari. Tegakan gaharu yang rapat Gambar 9. Meskipun ada..

Estimasi potensi stock kayu gaharu di Indonesia yaitu 1. Meskipun tampak bahwa di kawasan Bengkulu Utara di sebagian tempat tampak rapat namun keberadaan pohon penghasil gaharu sendiri tidak menjamin adanya resin gaharu. Sebagai akibatnya populasinya di alam makin lama makin berkurang. Soehartono dan Newton. sudah mengalami penurunan populasi. Saat ini gaharu sudah masuk dalam Appendix II CITES. Hasil pengamatan di dua lokasi contoh di Kabupaten Bengkulu Utara. 2001).(Titiek Setyawati) dilaporkan hanya sedikit di beberapa tempat saja. Kesimpulan 1. Beberapa peneliti menduga bahwa hanya 10% dari pohon Aquilaria yang mengandung gaharu. Demikian pula dengan potensi regenerasinya yang ditunjukkan dengan sedikitnya jumlah semai maupun anakan yang ada di bawah tegakan alam. 3. 2007.. Indonesia merupakan eksportir utama produk gaharu dan dengan tingginya permintaan pasar akhir-akhir ini serta tingginya harga yang ditawarkan di pasar dunia. tampak bahwa potensi tegakan alam A. masih banyak namun demikian kondisinya saat ini menghadapi ancaman penurunan populasi di berbagai tingkatan umur 231 ... 2.37 pohon/ha di Kalimantan. Namun hal ini tidak mengurangi kerusakan dan berkurangnya populasi gaharu di alam (Anonim..Potensi dan Kondisi . Bisanya petani akan membuang anakan yang sakit. Tampak bahwa stock di kawasan hutan di Sumatera lebih rendah dibandingkan dengan kawasan hutan yang ada di Kalimantan dan Papua.87 pohon/ha di Sumatera. dan 4. maka banyak kolektor yang tidak berpengalaman pada akhirnya ikut mengeksploitasi gaharu di alam.33 pohon/ha di Papua. KESIMPULAN DAN SARAN A. malaccensis Lamk. tampak bahwa potensi tegakan alam A. malaccensis Lamk. Berdasarkan hasil pengamatan lapangan dan estimasi potensi regenerasi alam jenis-jenis pohon penghasil gaharu yang tumbuh di hutan alam di beberapa lokasi contoh di Kabupaten Lampung Tengah dan Lampung Barat.

3. Akibatnya bagi proses regenerasi alaminya terjadi kekosongan tegakan pada tingkat tiang. B. malaccensis Lamk. Berlainan dengan temuan yang ada di Provinsi Lampung. Sedikit lebih baik dari kondisi gaharu di Provinsi Lampung. sehingga potensi regenerasi alami akan mengalami hambatan karena ketidakseimbangan pertumbuhan di setiap tingkatan terutama tidak terjadinya pertumbuhan mencapai tingkat tiang. Saran Provinsi Lampung. terutama di tingkat seedling dan sapling. akibat pemanenan gaharu yang kurang memperhatikan aspek kelestarian. Meskipun demikian jenis pohon ini mengalami ancaman serius akibat perburuan. di Bengkulu ditemukan adanya laporan serangan serangga yang menyebabkan pertumbuhan tegakan gaharu menjadi kerdil. khususnya Kabupaten Lampung Tengah dan Lampung Barat memiliki potensi tegakan alam gaharu yang cukup merata meskipun di beberapa lokasi jumlah sampelnya tidak memadai. Meskipun ada beberapa lokasi sampel dengan kondisi tegakan pohon dewasa yang sangat kurang. mengingat potensi jenis gaharu yang masih tampak baik. Tampak pula terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. sehingga diperlukan penyuluhan bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan Taman Nasional Bukit Barisan Selatan dan kawasan hutan lindung. Sebagian besar penduduk memperjualbelikan anakan alami untuk 232 . tidak hanya pohonnya namun juga anakan alaminya. Kawasan hutan di Provinsi Lampung dan Bengkulu memiliki potensi yang cukup baik untuk dijadikan areal sumberdaya genetik untuk jenis A. Untuk data masa pembungaan dan berbuah sampai saat penelitian belum dapat diperoleh mengingat masa pengamatan tidak bertepatan dengan masa berbunga dan berbuah. khususnya Kabupaten Bengkulu Utara memiliki potensi tegakan alam gaharu yang juga cukup baik dilihat dari sisi populasi tegakan alaminya. kawasan hutan di Provinsi Bengkulu.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan.

233 . Krebs. Kachari. Anonim. Kent. Desiccation Sensitivity and Recalcitrant Behaviour of Seeds of Aquilaria agallocha Roxb. Claiming the Forest.. CIFOR.depan. Downloaded: 24 Januari 2007. Ko m p a s o n l i n e : h t t p : / / r e g i o n a l . dan P. Kundu. 1987. Ecological Methodology..tanam. Behalven Press. maka diperlukan penyuluhan atau pendidikan konservasi bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan hutan lindung yang merupakan habitat alami jenis pohon penghasil gaharu ini. Aquilaria malaccensis Lamk. Ecology : The Experimental Analysis of Distribution and Abundance. terutama gangguan terhadap proses regenerasi alaminya. Vol. L. Mengingat masih terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. 2002.php?fuseactian=whatwedo. N.c o m / r e a d / xml/2009/07/24/1300220/siapkan. J. Vegetation Description and Analysis : A Practical Approach.masa. Tumbuhan Berguna Indonesia. 103. Ayo Tanam Gaharu. Harper Collins College Publishers. I. Siapkan Masa Depan. DAFTAR PUSTAKA Adelina. 2000. 2007. Jakarta. 2004. M. dan IV. k o m p a s . K.id/index. Badan Penelitian dan Pengembangan Kehutanan. East Kalimantan. Forest & Landscape Denmark. Seed Science and Technology.(Titiek Setyawati) dikembangkan lebih lanjut atau ditanam di kebun masyarakat ataupun dijual ke luar daerah Bengkulu. gaharu Anonim.Potensi dan Kondisi . M. Indonesia.. Krebs. II. 1992. C. 2009. CRC Press. wwf. Media on line : http// www.species_gaharu. 1999.. Seed Leaflet No. III. J. Kaskija. Jim Green. 1994.or. dan J.ayo. Coker. C. Gaharu (Aquilaria). December 2004. Punan Local Histories and Recent Developments in Bulungan. Heyne. Yayasan Sarana Wana Jaya.

An information Document Prepared by TRAFFIC Oceania for the Eleventh Meeting of the CITES Plants Committee. A. 2001. Balai Penelitian Kehutanan Manokwari. Mindawati. E. The Impact of Gaharu Harvesting in Indonesia. 234 . Latin. CIFOR. R. Y. 1996. 1994. Resources and People in Bulungan. dan B.C. Agarwood (Gaharu) Harvest and Trade in Papua New Guinea : A Preliminary Assessment.C. 1880-2000. Pengaruh Wadah Penyimpanan dan Kelas Diameter Terhadap Pertumbuhan Stump Wikstroemia polyantha. Sumarna. with reference to CITES Decisions 11.R. Soehartono. T. dan N. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria I. dan A. Puri. Biological Conservation No 97. Canberra. CSIRO Plant Industry. Sellato.. Syaffari. East West Center-Prosea. B.CIFOR. Australia. 96. Elements for a History of Settlement. Newton. 2001. Pembibitan Jenis Pohon Penghasil Gaharu (Aquilaria malaccensis Lamk). Suripatty. Irian Jaya. Bogor. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria II. dan A.K. Buletin Penelitian Kehutanan 1(1). Centre for Plant Biodiversity Research. Trade and Social Dynamics in Borneo. Bogor.Aspek SOSIAL EKONOMI DAN KONSERVASI Mai. F. Forest. 2001. Indonesia.A. T. Zuhud.112 and 11. 2001.A. Status and Use in Indonesia. Bulungan Ethnobiology Handbook. Biological Conservation No. dan J. Compton.M. CIFOR.113 Regarding Aquilaria spp. Soehartono. Pelestarian dan Pemanfaatan Keanekaragaman Tumbuhan Obat Hutan Tropika Indonesia. Zich. 2001. Indonesia. 2000. R. Newton.

Schima wallichii Korth. Daftar jenis pohon yang di survei dalam plot pengamatan gaharu di Bukit Rupi. Dillenia sumatrana Miq.) Kosterm. Ficus variegata Bl. Evodia aromatica Blume Alstonia angustiloba Miq. Cratoxylum formosum Dyer. Cinnamomum iners Blume Peltophorum grande prain Eurya acuminata APDC.. Carallia brachiata Merr Tetracera indica L. Selaginella plana Hiern. Lampung Tengah No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Nama lokal Kayu alim Leban Kelat Kelepu Putat Lahu Ketaran Kilada Simpur Terap Sepat Rempelas Lingkem Ranggung Ancau Cempaka Pulai Lupang Medang Kedukduk Gio Kemutul Seru Asam Kandis Nerung Petai Sebasah Beruas Tepa Sago Sidi Nyari Sungkai Nama botanis Aqualaria malaccensis Lamk. Antidesma tetandrum Blume Peronema canescens Jack Famili Thymelaeaceae Verbenaceae Myrtaceae Rubiacea Lecythidiaceae Moraceae Moraceae Lauraceae Dilleniaceae Moraceae Rhizophoraceae Dilleniaceae Selaginelaceae Dilleniaceae Rutaceae Rutaceae Apocynaceae Sterculiaceae Lauraceae Melastomataceae Melastomataceae Hypericaceae Theaceae Guttiferae Ulmaceae Mimosaceae Olacaceae Guttiferae Lauraceae Celasteraceae Theaceae Euphorbiaceae Verbenaceae 235 . Vitex pubescens Vahl. Dillenia excelsa Gieg. Eugenia grandis Wight Neonauclea calycina Merr Barringtonia sp..(Titiek Setyawati) Lampiran 1. Artocarpus elasticus Reinw. Artocarpus anisophyllus Reinw. Parkia speciosa Hassk.. Garcinia dioica Bl.. Comersonia bartamia Merr Dehaasia caesia Blume Clidenia hirta don Kibessia azurea DC. Clausena excavata Burm. Parasponia parvifolia Miq.Potensi dan Kondisi . Strombosia javanica Blume Garcinia celebica L. Cinnanmomum porectum (Roxb.

Kecamatan Talang Empat. Clausena exavata Actinodaphne glabra Blume Orophea sp Pleomele elliptica H.Gambir Ketepung K.Br Bridelia monoica Merr Symplocos cochinchinense Lour Horsfieldia glabularis Warb Garcinia dioica Blume Aporusa sp. Bengkulu Utara No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Nama lokal Karas Gadis Leban Marapuyan Petai Berawas Sipo Terap Jering Tetak Tunjuk Semipis Kademe Semuting Seubo-ubo Kemutun K.Beras Salung Gajah Salung Urat Use Nyaran Ingitdare Nama botanis Aquilaria malaccensis Lamk Cinnamomum porectum (Roxb. Daftar jenis pohon yang ada di dalam Kelompok Hutan Binjai Temula.f Eugenia glomerata K et V Timonius sericanthus Boerl Tarenna sp.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 2. Aporusa aurita Miq Cratoxylum sumatranum (Jack) Blume Elaeocarpus stipularis Blume Ixonanthes petiolaris Blume Litsea firma Hook. Desa Dusun Baru.) Kostrm Vitex pubescens Vahl Rhodamnia cinerea Jack Parkia speciosa Hassk Litsea odorifera T et B Dillenia exelsa Gilg Artocarpus elasticus Reinw Archidendron jiringa (Jack) Nielsen Canarium dichotonum Miq Baccaurea racemosa Muell Arg Croton argyratus Blume Neonauclea calycina Merr Glochidion zeylanicum Juss Cratoxylum formosum (jack) Dyer Styrax benzoind Dryand Vernonia arborea Ham. Ganophyllum falcatum Blume Lucuma maingayi Dub Carallia brachiata Merr Famili Thymelaceae Lauraceae Verbenaceae Myrtaceae Leguminosae Lauraceae Dilleniaceae Moraceae Leguminosae Burseraceae Euphorbiaceae Euphorbiaceae Rubiaceae Euphorbiaceae Hyperiaceae Styraxaceae Compositae Rutaceae Lauraceae Annonaceae Liliaceae Euphorbiaceae Symplocaceae Myristicaceae Guttiferae Euphorbiaceae Euphorbiaceae Hyperiaceae Elaeocarpaceae Linnaceae Lauraceae Myrtaceae Rubiaceae Rubiaceae Rubiaceae Sapotaceae Sapotaceae Rhizophoraceae 236 .Angit Jungjung bukit Sugi Sipunan Kenidai Kendung Naran Kandis Kbg Saka/ Seketut Pelangas Lulus Gamat Marabikang Kemalau Gelam Abang K. Tarenna confusa K et V.

Sign up to vote on this title
UsefulNot useful