Isi Buku Gaharu 5 Januari 2011 Full Size

ISBN 978-979-3145-63-1

Pengembangan Teknologi Produksi

berbasis pemberdayaan masyarakat
Editor: Sulistyo A. Siran; Maman Turjaman

PENGEMBANGAN TEKNOLOGI PRODUKSI GAHARU BERBASIS PEMBERDAYAAN MASYARAKAT SEKITAR HUTAN
Editor: Sulistyo A. Siran; Maman Turjaman ISBN: 978-979-3145-63-1 Penerbit: Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Kampus Balitbang Kehutanan Jl. Gunung Batu No. 5, Bogor 16110 Telp. (0251) 8633234, 7520067; Fax. (0251) 8638111 E-mail: p3hka_pp@yahoo.co.id

Petikan Undang-Undang Nomor 19 Tahun 2002 tentang Hak Cipta Ketentuan Pidana Pasal 72 (1) Barangsiapa dengan sengaja dan tanpa hak melakukan perbuatan sebagaimana dimaksud dalam Pasal 2 ayat (1) atau Pasal 49 ayat (1) dan ayat (2) dipidana dengan pidana penjara masing-masing paling singkat 1 (satu) bulan dan/atau denda paling sedikit Rp 1.000.000,00 (satu juta rupiah), atau pidana penjara paling lama 7 (tujuh) tahun dan/atau denda paling banyak Rp 5.000.000.000,00 (lima miliar rupiah). (2) Barangsiapa dengan sengaja menyiarkan, memamerkan, mengedarkan, atau menjual kepada umum suatu Ciptaan atau barang hasil pelanggaran Hak Cipta atau Hak Terkait sebagaimana dimaksud pada ayat (1) dipidana dengan pidana penjara paling lama 5 (lima) tahun dan/atau denda paling banyak Rp 500.000.000,00 (lima ratus juta rupiah).

ii

KATA PENGANTAR
Terdapat enam tantangan pembangunan kehutanan yang kita hadapi saat ini, yaitu: degradasi hutan, bencana alam dan lingkungan, pemanasan global, share sektor kehutanan terhadap pertumbuhan ekonomi nasional, desentralisasi sektor kehutanan, dan kontribusi kehutanan dalam hal food, water scarcity, energy, and medicine. Namun, kita masih melihat ada peluang yang merupakan sebuah anugerah bagi bangsa kita, yang bila dibudidayakan dan dikelola secara serius akan dapat menjawab paling tidak lima dari enam tantangan tadi. Anu-gerah yang juga merupakan peluang usaha sektor kehutanan dari jenis HHBK ini bernama “gaharu”. Ide dan gagasan membangun hutan tanaman gaharu juga menarik untuk kita kaji bersama. Kalau selama ini perusahaanperusahaan HTI telah eksis dengan komoditi-komoditi kayu seperti mangium, sengon, mahoni, dan jenis tumbuhan penghasil kayu lainnya, maka bukanlah hal yang mustahil untuk mengembangkan hutan tanaman penghasil gaharu apabila secara finansial menjajikan dan memungkinkan setelah dianalisis kelayakan usahanya. Pengembangan usaha budidaya tanaman HHBK unggulan akan berhasil dengan baik apabila didukung oleh semua stakeholder yang berkepentingan, baik Pemerintah Pusat dalam hal ini Departemen Kehutanan, Pemerintah Daerah, pengusaha, dan petani. Disampaikan terima kasih dan penghargaan yang setinggitingginya kepada semua pihak yang telah berkontribusi hingga terbitnya buku ini.
Jakarta, Nopember 2010

Kepala Badan Litbang Kehutanan

Dr. Ir. Tachrir Fathoni, MSc.

iii

iv

. Sitepu...................... APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp.....1 STATUS RISET GAHARU ...................................31 Aspek PRODUKSI ................... 139 v ...................... Yasuyuki Hashidoko..... Ahmad Yani............. KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp........................................53 3...... Irianto............. Ragil S........................... Sugeng Sentosa.......................... DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu ................................................... PENGEMBANGAN GAHARU DI SUMATERA Mucharromah........ DAN Fusarium sp...... Erdy Santoso .............................DAFTAR ISI KATA PENGANTAR.. UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto....................................................... Sitepu............................ Najmulah..... Sugeng Santosa.................................... Aryanto................................ Ragil Setio Budi Irianto.................... Siran ..................................................................... Maman Turjaman . 113 5............................ Sitepu.........................35 2....................................................................... Aryanto ..................................................B........ Irnayuli R................................ Maman Turjaman.. Maman Turjaman .................... PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman... 123 7.................................................. Ahmad Yani................. Irnayuli R...............................97 Aspek SILVIKULTUR ........... PADA Aquilaria microcarpa Eka Novriyanti ...77 4.................... TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso.33 1............................................... DI PERSEMAIAN Irnayuli R...................... Aryanto...... Najmulah...............iii DAFTAR ISI ................ Erdy Santoso.. 115 6........ EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp............... v PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A.........

.............................................................................. Irnayuli R..... Maman Turjaman..) DI PROVINSI LAMPUNG DAN BENGKULU.............................................................Daftar Isi 8....... HAMA PADA TANAMAN PENGHASIL GAHARU Ragil SB Irianto............................................................................................ KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi ............. 159 10... PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti ....... Sitepu . 181 11...................................................................................................................... 193 12................ POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk.................. 151 Aspek SOSIAL EKONOMI DAN KONSERVASI ........ 157 9............................ SUMATERA Titiek Setyawati......... 213 vi ............................................................ Erdy Santoso............... THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo ......................

Pepatah ini mengindikasikan bahwa sebenarnya komonditi gaharu sudah dipopulerkan oleh nenek moyang kita dan menjadi bukti sejarah bahwa keharuman gaharu telah dikenal sejak ratusan tahun yang lalu. maupun masyarakat 1 . baik oleh kalangan elit kerajaan. lantas kenapa komoditi yang telah populer tersebut sepertinya menghilang begitu lama dan saat ini muncul kembali. Dari sisi manfaat. Siran Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu sebuah nama komoditi hasil hutan non kayu yang saat ini menjadi perbincangan banyak kalangan. Gaharu sebenarnya sebuah produk yang berbentuk gumpalan padat berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar tanaman pohon inang (misalnya: Aquilaria sp. gaharu memang sangat unik. Pertanyaan yang muncul.) yang telah mengalami proses perubahan fisika dan kimia akibat terinfeksi oleh sejenis jamur. Oleh sebab itu tidak semua pohon penghasil gaharu mengandung gaharu. Jawaban yang sudah pasti adalah rumus umum.PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A. Dilihat dari wujud dan manfaatnya. gaharu sejak zaman dahulu kala sudah digunakan. Dalam kehidupan seharihari telah dikenal pepatah “sudah gaharu cendana pula”. yaitu karena pengambilan jauh lebih besar daripada produksinya.

disusul kualitas Tanggung dengan harga rata-rata per kilogram Rp 20.s/d Rp 4.000. bahan kosmetik dan obat-obatan sederhana. dan Nunukan. dan masuk dalam lampiran Convention on International Trade on Endangered Spcies of Flora and Fauana (Appendix II CITES). body lotion.-).000. harga jual yang tinggi. maka jenis-jenis tertentu misalnya Aquilaria dan Gyrinops saat ini sudah tergolong langka. Tarakan. Besarnya permintaan pasar.000. kualitas Kemedangan (Rp 1.000. Berdasarkan informasi.s/d Rp 50. bahan obatobatan yang memiliki khasiat sebagai anti asmatik. kualitas Teri (Rp 10.000.000. baik sebagai sumber pendapatan masyarakat maupun penerimaan daerah. Selama ini masyarakat hanya tinggal memanen gaharu yang dihasilkan oleh alam. dan stimulan kerja syaraf dan pencernaan.000.000. keberadaan pohon penghasil gaharu tersebut di Indonesia tidak terkecuali di Sumatera dan Kalimantan semakin langka. Gaharu dengan demikian mempunyai nilai sosial.000.-). sabun.-. dan ekonomi yang cukup tinggi.s/d Rp14.. Seringkali masyarakat tidak tahu pasti kapan pohon penghasil gaharu mulai membentuk gaharu dan bagaimana prosesnya.000. Bertahun-tahun masyarakat dan pemerintah daerah Kalimantan dan Sumatera menikmati berkah dari keberadaan gaharu. pengharum tubuh dan ruangan.000. Kalimantan Timur mencapai Rp 40. anti mikrobia. Kelangkaan terjadi karena pohon penghasil gaharu ditebang tanpa memperhatikan 2 . dan Suloan (Rp75.000. harga gaharu dengan kualitas Super di pasaran lokal Samarinda. Meningkatnya perdagangan gaharu sejak tiga dasawarsa terakhir ini telah menimbulkan kelangkaan produksi gubal gaharu dari alam. kualitas Kacangan dengan harga rata-rata Rp15. aroma terapi.000.-).000. Secara tradisional gaharu dimanfaatkan antara lain dalam bentuk dupa untuk acara ritual dan keagamaan. namun menurut kenyataan.. Walaupun sejak 1994 Indonesia berkewajiban melindungi pohon penghasil gaharu.-.per kilogram. budaya.000.000..suku pedalaman di Sumatera dan Kalimantan. Saat ini pemanfaatan gaharu telah berkembang demikian meluas antara lain untuk parfum. dan pola pemanenan yang berlebihan serta perdagangan yang masih mengandalkan pada alam tersebut..000.

Praktek semacam inilah yang mengakibatkan jumlah pohon pengahasil gaharu di alam semakin menurun dari tahun ke tahun. dan kalaupun ada usaha konservasi dan budidaya namun skalanya terbatas dan hanya dilakukan oleh lembaga penelitian. Indikasi menurunnya pupulasi pohon penghasil gaharu ditunjukkan oleh kecenderungan produksi gaharu dari Kalimantan dan Sumatera dari tahun ke tahun. di mana realisasi produksi gaharu pada dekade 80’an pernah mencapai ribuan ton dengan kualitas yang tinggi. Oleh karena itu dapat dibayangkan kalau pencari gaharu mendapatkan gaharu kira-kira 5 kilogram. Menurut hasil kajian. Kalaupun ada pohon yang mengandung gaharu. dari 20 pohon penghasil gaharu yang ditebang di hutan alam hanya ada satu atau sering sama sekali tidak ada yang mengandung gaharu. baik in-situ (dalam habitat) maupun ek-situ (di luar habitat) dan budidaya pohon penghasil gaharu. pengusaha 3 . mungkin puluhan atau bahkan ratusan pohon penghasil gaharu yang harus ditebang. (Sulistyo A. Namun upaya tersebut tidak mudah dilaksanakan.Perkembangan Pemanfaatan Gaharu . Guna menghindari agar tumbuhan jenis gaharu di alam tidak punah dan pemanfaatannya dapat lestari maka perlu diupayakan untuk konservasi.... Peningkatan produksi gaharu dimaksud (yang kegiatannya terdiri dari kegiatan di bagian hulu sampai hilir) selanjutnya akan berdampak pada peningkatan penerimaan oleh masyarakat petani. Prospek untuk mengembalikan gaharu menjadi komoditi andalan kembali terbuka dengan ditemukannya teknologi rekayasa produksi gaharu. Siran) ada atau tidak adanya gaharu pada pohon tersebut. Dengan teknologi inokulasi maka produksi gaharu dapat direncanakan dan dipercepat melalui induksi jamur pembentuk gaharu pada pohon penghasil gaharu. maka jumlah gaharu yang ada di pohon tersebut hanya beberapa gram saja. dan LSM konservasi. perguruan tinggi.. sedangkan saat ini produksi tersebut merosot drastis hanya kira-kira puluhan ton saja dengan kualitas yang bervariasi. Sementara masyarakat secara luas enggan untuk melakukan budidaya pohon penghasil gaharu karena memang tidak memberikan keuntungan apa-apa.

pemahaman mengenai pentingnya nilai gaharu. Pulau Sulawesi (2 jenis). perlunya budidaya. Kalimantan 4 . Pulau Jawa (2 jenis). Berdasarkan sebaran tempat tumbuh. konservasi. dan penerimaan pendapatan asli daerah serta devisa negara. Gaharu adalah gumpalan berbentuk padat.gaharu. yang dilaksanakan pada tahun 2000 ditemukan bahwa Aquilaria spp. Oleh sebab itu tidak semua tanaman penghasil gaharu menghasilkan gaharu. Pulau Papua (2 jenis). tumbuhan penghasil gaharu umumnya tumbuh di Pulau Kalimantan (12 jenis) dan Pulau Sumatera (10 jenis). Selain itu hutan hujan tropis Kalimantan juga sangat kaya dengan hasil hutan bukan kayu (HHBK). kemudian dalam jumlah terbatas tumbuh di Kepulauan Nusa Tenggara (3 jenis). di mana salah satu di antaranya adalah gaharu yang bernilai ekonomis tinggi. Dari pengamatan sebaran Aquilaria spp. dan Kepulauan Maluku (1 jenis). berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar dari jenis tumbuhan penghasil gaharu yang telah mengalami proses perubahan kimia dan fisika akibat terinfeksi oleh sejenis jamur. GAMBARAN UMUM TUMBUHAN PENGHASIL GAHARU Hutan hujan tropis di Indonesia semenjak tiga puluh tahun yang lalu dikenal sebagai salah satu penghasil utama kayu bulat (log) untuk bahan baku industri perkayuan. Kalimantan Barat. tumbuh tersebar secara luas di Kalimantan Timur. Tulisan ini dipaparkan dengan maksud untuk memberikan gambaran secara umum mengenai pemanfaatan gaharu. Di lndonesia hingga saat ini diperkirakan terdapat lebih kurang 25 jenis tumbuhan penghasil gaharu yang dikelompokkan ke dalam delapan marga dan tiga suku. dan rekayasa pembentukan gaharu yang dapat mengembalikan status komoditi dari kelangkaan menjadi produk andalan.

jinkohol II serta oxo-aga-rospirol. Lebih lanjut Susilo (2003) mengatakan bahwa terdapat 17 macam 5 . KANDUNGAN DAN MANFAAT GAHARU Terdapat beberapa zat penting yang terkandung dalam gubal gaharu yaitu (-agarofuran. (-agarofuran. Tingginya permintaan pasar dunia akan gaharu dan harga jual gaharu yang cukup tinggi telah menarik minat masyarakat.Perkembangan Pemanfaatan Gaharu . Aquilaria malaccensis. di pedalaman hutan Kalimantan Barat dan Kalimanatan Tengah serta menurunnya realisasi produksi gaharu dari tahun ke tahun. baik lokal maupun pendatang untuk melakukan eksploitasi gaharu secara besar-besaran. dihydrokaranone. Amerika Serikat pada tahun 1994. Bahkan sejak tahun 2004. jinkohol. Akibatnya. beberapa instansi pemerintah dan masyarakat telah melakukan inisiatif untuk mengadakan pelestarian tumbuhan penghasil gaharu dan sekaligus membudidayakan. kusunol. seluruh jenis Aquilaria telah dimasukkan dalam Appendix II CITES. (-)-10-epi-y-eudesmol. agarospirol. Walaupun realisasi produksi gaharu tidak menggambarkan besarnya potensi. populasi Aquilaria spp. baik untuk kepentingan konservasi maupun ekonomi.. antara lain dari pergerakan pencari gaharu yang telah mengarah pada bagian utara Kalimantan Timur. Menyadari semakin langkanya tumbuhan penghasil gaharu. Indikasi dari menurunnya populasi Aquilaria spp. Untuk mencegah dari kepunahan maka pada pertemuan CITES (The Convention on International Trade in Endangered Species of Wild Flora and Fauna) ke-IX di Florida. (Sulistyo A. jinkohon-eremol. Siran) Tengah. namun dengan semakin sulitnya mendapatkan gaharu dari waktu ke waktu menunjukkan populasi Aquilaria spp. di hutan alam semakin menurun dan bahkan pada suatu saat menjadi punah.... terus mengalami penurunan. dan Kalimantan Selatan. nor-ketoaaga-rofuran. salah satu tumbuhan penghasil gaharu terpenting yang banyak tumbuh di Kalimantan telah dimasukkan ke dalam Appendix II sebagai tumbuhan yang terancam punah sehingga dalam penebangan dan perdagangannya perlu dibatasi.

dan obatobatan. sedangkan air suling gaharu dimanfaatkan untuk kesehatan. kanker. antara lain: noroxoagarofuran. hio. gubal gaharu diperdagangkan sebagai komoditi elit untuk keperluan industri parfum. kanker. Limbah bekas gaharu yang telah disuling digunakan untuk dupa dan bahan untuk upacara agama. p-methoxybenzylaceton. Karena aromanya harum. kebugaran serta bahan minuman (kopi) oleh masyarakat di Kabupaten Berau. saat ini berbagai negara memanfaatkan gaharu selain sebagai bahan pengharum (parfum) dan kosmetik. kosmetika. dan stres. hepatitis. untuk pengobatan stres. asma.4 –dihydroxy-dihydro-agarufuran. juga telah berkembang industri pemanfaatan gaharu sebagai bahan baku industri obat herbal alami. dan tumor yang masih dalam proses uji klinis. tasbih. Gaharu dengan aromanya yang khas digunakan masyarakat di Timur Tengah sebagai bahan wewangian. kosmetik. membakar jenazah bagi umat hindu. liver. radang lambung dan ginjal. PEMUNGUTAN DAN PENGOLAHAN GAHARU A. agarospirol. Di Cina.senyawa yang terdapat pada gaharu. dan pengawet berbagai jenis asesori. Selain itu gaharu telah dipergunakan sebagai bahan baku industri parfum. asma. reumatik. Cara Pendugaan Kandungan Gaharu Karena tidak semua tumbuhan penghasil gaharu berisi gaharu. Di samping itu dengan perkembangan ilmu dan teknologi industri. gaharu dimanfaatkan sebagai obat sakit perut. dan aquillochin. malaria. tumor. gangguan ginjal. setanggi (dupa). maka pengetahuan cara pendugaan kandungan gaharu pada tumbuhan penghasil gaharu yang terinfeksi jamur pembentuk gaharu perlu diketahui terutama oleh para pemungut pemula 6 . Selanjutnya Oiler (tanpa tahun) dalam Suhartono dan Mardiastuti (2003) menyebutkan terdapat 31 unsur kimia yang terkandung di dalam gaharu dan bahan kimia penyusun utamanya adalah 2-(2-(4 methoxyphenyl)ethil)chromone (27%) dan 2-(2-phenylethyl)chromone (15%). bahan antibiotic. kecantikan. TBC. 3.

Potongan kayu berisi gaharu kemudian dikumpulkan dan secara perlahan bagian kayu dipisahkan dari gaharu dengan menggunakan pisau kecil atau pahat cekung. Setelah ditemukan ciri-ciri tersebut maka dilakukan uji pelukaan pada batang pohon dengan menggunakan kapak atau parang. Cara pemungutan gaharu semacam ini di Sumatera dan Kalimantan disebut servis. kulit kayu kering dan rapuh serta bila ditarik mudah putus.. Sistem Pemungutan Gaharu Pohon dari tumbuhan penghasil gaharu yang telah diyakini mengandung gaharu ditebang. Harga minyak gaharu di pasaran Jakarta Rp 750. Cara ini disebut tubuk. Pengolahan Gaharu Sampai saat ini produk gaharu yang berasal dari alam umumnya dipasarkan dalam bentuk bongkahan namun ada pula dalam bentuk minyak hasil sulingan... banyak terdapat benjolan dan lekukan sepanjang batang atau cabang pohon. tajuk pohon kecil dan tipis. cabang pohon banyak yang patah.. (Sulistyo A. C. 7 . Untuk lebih meyakinkan biasanya serpihan kayu tadi selanjutnya dibakar untuk mengetahui apakah mengeluarkan bau/ aroma wangi khas gaharu. Cara penyulingan minyak gaharu dapat dilakukan dengan dua sistem yaitu sistem kukus dan tekanan uap. puncut atau pahat. Adapun ciri dari tumbuhan penghasil gaharu berisi gaharu antara lain adalah: daun berwarna kuning dan rontok. Siran) sehingga tidak terjadi salah tebang pada pohon yang tidak berisi gaharu.Perkembangan Pemanfaatan Gaharu .000/tolak (1 tolak = 12 cc). Cara lain yang berlaku pada masyarakat Dayak Kenyah dan Punan di Kalimantan Timur adalah dengan mengiris dan memotong bagian kayu dari tumbuhan penghasil gaharu yang terkena infeksi penyakit hingga ke bagian tengah batang. kemudian dipotong-potong dan dibelah untuk diambil gaharunya. B. Bilamana terdapat alur coklat kehitaman pada batang menunjukkan adanya kandungan gaharu.

tanggung.1-1999) diharapkan standar mutu tersebut dapat segera menjadi bahan acuan para pengusaha gaharu. kacangan. Secara umum klasifikasi mutu gaharu dapat dikelompokkan menjadi enam kelas mutu yaitu super. dan cincangan dan setiap kelas mutu dibedakan lagi menjadi beberapa sub kelas mutu. kemedangan. TangKacangan isi Teri super gung isi Kacangan Teri laying Tangkosong gung kosong Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan. 4. dan pemungut gaharu di dalam menentukan kelas mutu gaharu. Lokasi Super Tanggung Kacangan Kacangan A Kacangan B Kacangan C Teri Teri A Teri B Teri C Teri kulit A Teri kulit B Kemedangan Kemedangan A Kemedangan B Kemedangan community Sudokan Serbuk Serbuk Cincangan Samarinda Super king Super A Super AB 2. 2007 8 . teri. pedagang pengumpul. 1. Klasifikasi mutu gaharu di Kota Samarinda dan daerah sekitarnya Klasifikasi mutu No. Tabel 1. Muara Kaman Kota Bangun Muara Wahau Super A Super B Super A Super B Kacangan isi Teri isi Kacangan Teri kulit kosong Kacangan A Kacangan B Teri A Teri B 3.KLASIFIKASI MUTU GAHARU Klasifikasi mutu gaharu di Kalimantan Timur khususnya di Kota Samarinda dan daerah sekitarnya hingga saat ini masih belum seragam (Tabel 1) dan penentuannya dilakukan secara visual. Keragaman dan ketidakjelasan di dalam penentuan mutu tersebut menyebabkan harga jual yang berbeda dengan kelas mutu yang sama. Pada Tabel 1 disajikan kriteria dan klasifikasi mutu gaharu. Dengan telah ditetapkannya standar nasional untuk mutu gaharu (SNI 01-5009.

..000. keras. bagian dalam kadang berlubang. Siran) Tabel 2.000.000. Kualitas gaharu yang paling 1.dilihat pada Gambar 3. Kriteria dan klasifikasi mutu gaharu No. berupa butiran-butiran sebesar biji kacang atau berdiameter sekitar 2 mm. 2. Gaharu berwarna hitam terkadang bercampur coklat.2.000. Kemedangan Cincangan Sumber : Balai Penelitian dan Pengembangan Kehutanan Kalimantan. 2006 Berdasarkan informasi pasar di Samarinda (Tabel 3) harga gaharu dengan kualitas super dapat Tabel 3.000 per kg. berupa butiran-butiran lebih kecil dari biji kacang dan lebih tipis atau berdiameter sekitar 1 mm.digunakan sebagai bahan baku 3. Teri C 500.000. berupa bongkahan atau butiran berukuran besar. Kelas mutu Harga (Rp/Kg) kg.000.000.25.. padat. Teri A 1. 1. Potongan kecil kayu dari pemisahan gaharu.- 6. Harga jual gaharu di mencapai Rp 30.penyulingan untuk menghasilkan Kacangan B 5.000.71/ 09/99. Gaharu berwarna hitam dan coklat.per No.500. bagian dalam tidak berlubang.000.000. Gaharu berwarna hitam terkadang bercampur coklat. 1386/BSN-I/HK. mengkilap dan sangat berbau. pasaran Samarinda. telah ditetapkan Standar Nasional mutu gaharu dengan judul dan nomor: Gaharu SNI 01-5009..500.rendah berharga sekitar Rp 25.000.100..beberapa sampel gaharu dapat Teri B 750. Kacangan 4.000. tidak ada campuran dengan serat kayu. Super King 30. Teri 5. keras.000. Teri Kulit A Teri Kulit B Kemedangan A Kemedangan B Kemedangan C Suloan 300.000. Klasifikasi Super Kriteria Gaharu berwarna hitam pekat.50. dan pada umumnya Super AB 15. disusul kualitas tanggung dengan Kalimantan Timur harga rata-rata Rp 10.Berdasarkan Keputusan Kepala Badan Standarisasi Nasional (BSN) No.75. kadang bercampur serat kayu dan berukuran tanggung. Dalam 5. 2006 9 . Secara visual Kacangan C 2.per kg.Perkembangan Pemanfaatan Gaharu . Tanggung 10.000.000. Kacangan A 7.000 Super 20.1-1999. bercampur kayu.000. Kayu yang mengandung getah gaharu. Tanggung 3.000.000. (Sulistyo A.000.250.000. bercampur kayu.000.4. Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan.000. 6.500.minyak gaharu. padat.000.

dan abu gaharu. Sampel gaharu (a) gaharu adalah kayu yang berasal kelas tanggung. memiliki kandungan damar wangi dengan aroma yang lemah. istilah. cara pemungutan. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia dapat dilihat pada Tabel 4. dan aroma ketika dibakar. spesifikasi. ditandai oleh warnanya yang hitam atau kehitaman berseling coklat. pengambilan contoh. lambang dan singkatan. berserat kasar dan kayunya yang lunak. (b) kacangan. 10 . kandungan damar wangi. klasifikasi. Klasifikasi mutu gaharu terdiri dari gubal gaharu. dengan aroma yang kuat. Kemudian yang dimaksud dengan kemedangan adalah kayu yang berasal dari pohon atau bagian pohon penghasil gaharu. bobot. cara uji. (c) teri dan dari pohon atau bagian pohon (d) kemedangan penghasil gaharu.standar ini diuraikan mengenai definisi gaharu. warna. serat. syarat mutu. Abu gaharu adalah serbuk kayu sisa pemisahan gaharu dari kayu. syarat lulus uji dan syarat penandaan. Menurut SNI 01-5009. kemedangan. ditandai oleh warnanya yang putih keabu-abuan sampai kecoklat-coklatan. Setiap kelas mutu selanjutnya dibedakan lagi menjadi beberapa sub kelas berdasarkan ukuran.1-1999 yang dimaksud dengan gubal Gambar 1.

4. 11 . Mutu V Kemedangan I Sedang Agak kuat 6... 2.. 1. 2. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia Kesetaraan dengan standar mutu di pasaran Kandungan damar wangi No Klasifikasi mutu Gubal Mutu Utama Mutu I Mutu II Kemedangan Mutu I Mutu II Mutu III Mutu IV Warna Bau/aroma (dibakar) A. 1. 3. 3. 2. 3. C. Super Super AB Sabah Super Hitam merata Hitam kecoklatan Hitam kecoklatan Tinggi Cukup Sedang Kuat Kuat Agak kuat Tanggung A Sabah I Tanggung AB Tanggung C Coklat kehitaman Coklat bergaris hitam Coklat bergaris putih tipis Kecoklatan bergaris putih tipis Kecoklatan bergaris putih lebar Putih keabuabuan garis hitam tipis Putih keabuabuan Tinggi Cukup Sedang Sedang Agak kuat Agak kuat Agak kuat Agak kuat 5. 1.. (Sulistyo A.Perkembangan Pemanfaatan Gaharu . Mutu VI Kemedangan II Kemedangan III Kurang Kurang kuat 7. Mutu VII Abu gaharu Mutu Utama Mutu I Mutu II Kurang Kurang kuat Cincangan Hitam Tinggi Sedang Kurang Kuat Sedang Kurang TATA NIAGA GAHARU Proses pemasaran gaharu di berbagai tempat di Indonesia dimulai dari pemungut gaharu yang menjual gaharu yang ditemukannya kepada pedagang pengumpul di desa atau di kecamatan dan selanjutnya oleh pedagang pengumpul dijual ke pedagang besar (eksportir) di Ibukota Propinsi. Siran) Tabel 4. B.

Salah satu contoh alur tata niaga gaharu di Kalimantan Timur dapat diuraikan seperti pada Gambar 2. Pembelian gaharu dilakukan sepanjang tahun melalui pedagang pengumpul atau pemungut bebas. pedagang pengumpul di kecamatan maupun langsung kepada pedagang besar (eksportir) di Kota Samarinda. Pemungut bebas adalah pemungut gaharu dengan modal kerja sendiri sehingga bebas di dalam menentukan waktu pencarian gaharu dan menjual hasil perolehannya. Pemungut terikat adalah pemungut gaharu yang dimodali sehingga waktu pencarian dan penjualan hasil perolehannya terikat pada pemberi modal yaitu pedagang pengumpul yang merupakan perpanjangan dari pedagang besar. Pedagang besar selain memiliki modal besar juga izin usaha yang dikeluarkan oleh instansi pemerintah. Hasil pembelian dari pedagang perantara ini kemudian dikumpulkan oleh pedagang pengumpul di kecamatan untuk selanjutnya dijual kepada pedagang besar karena adanya ikatan kontrak. Pembelian meningkat bilamana permintaan pasar terhadap gaharu tinggi. bahkan untuk mendapatkan jumlah yang diinginkan mereka menanamkan modal yang disalurkan melalui 12 . baik kepada pedagang pengumpul di desa. Pemungut gaharu terdiri dari pemungut bebas dan pemungut terikat. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 2. Contoh alur tata niaga gaharu di Kalimantan dan Sumatra Pedagang pengumpul terdiri dari pedagang perantara di desa yang langsung melakukan pembelian gaharu yang diperoleh para pemungut.

pengangkutan untuk peredaran dalam negeri dan pengangkutan untuk pemasaran luar negeri.. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 3. yaitu: gaharu dari Sumatera dan Kalimantan dengan jenis Aquilaria malaccensis dan A. baik di Indonesia maupun di luar negeri. yaitu: penentuan kuota. (Sulistyo A. gaharu menjadi komoditi primadona dan memiliki nilai komersial yang cukup tinggi sehingga banyak diburu oleh konsumen. gaharu dari Papua.. 13 . Sulawesi dan Maluku lebih dikenal dengan nama Aquilaria filaria. Pemasaran gaharu yang merupakan salah satu bentuk pemanfaatan tumbuhan dan satwa liar diatur berdasarkan Peraturan Pemerintah Nomor 8 Tahun 1999 dan Konvensi Perdagangan Internasional tentang jenis flora dan fauna liar yang terancam punah (CITES)..Perkembangan Pemanfaatan Gaharu . microcarpa. sedangkan jenis gaharu Gyrinops lebih banyak diproduksi dari Nusa Tenggara.. Oleh karena itu maka secara umum pemanfaatan gaharu harus mengikuti tahapan dan aturan-aturannya. Apabila diperhatikan maka perdagangan gaharu hasil alam di Indonesia dari dulu hingga saat ini lebih banyak bertumpu pada peyebaran secara ekologis jenis-jenis gaharu tersebut. Alur tata niaga Gaharu di daerah (Kalimantan) PEMASARAN GAHARU Dalam dunia perdagangan gaharu. Siran) pedagang pengumpul ataupun secara langsung kepada pemungut untuk modal kerja mencari gaharu. Gaharu yang diperdagangkan di Indonesia terdiri dari tiga jenis. pengambilan dari alam atau hasil budidaya (penangkaran).

Bahkan saat ini sudah dikembangkan daun jenis Aquilaria dan Gyrinops untuk bahan pembuatan minuman teh karena kandungan zat anti oksidan dalam daun yang cukup tinggi. Produk turunan gaharu: sabun transparan. lulur dan lotion 14 . hio. antara lain: minyak. Pemasaran Dalam Negeri Pemasaran dalam negeri dimulai dari aktivitas pengambilan. pengangkutan dan peredaran secara domestik produk sampai akhirnya ke konsumen. lotion. obat nyamuk. cream whitening. Karena perkembangan teknologi. Gambar 4. pemanfaatan untuk obat-obatan dan aroma terapi. tapi juga sudah mengarah ke produk turunannya.A. pembersih muka. lulur. sabun. Beberapa contoh produk dimaksud dapat dilihat pada gambar 3 dan 4 berikut. produk gaharu yang diperdagangkan dalam negeri saat ini tidak saja terbatas pada chip atau serpihan dengan bermacam-macam kelas. makmul.

Pemasaran gaharu dalam negeri terbentuk karena adanya hubungan antara daerah pemasok dengan kota/pusat penerima. Produk sirup dan teh untuk bahan minuman Dilihat dari pelaku usaha. maka terdapat kecenderungan untuk saling menekan harga. Secara tradisional daerah pemasok gaharu untuk kota Surabaya adalah Kalimantan. Papua. Karena jumlah pelaku usaha pemasaran. 15 . Oleh karena itu bentuk pemasaran gaharu di Indonesia lebih cocok dikatakan sebagai pasar “monopsoni”. baik dalam menentukan harga maupun kualitas gaharu. yaitu pasar yang dikuasai oleh pembeli.Sirup daun gaharu Gaharu leaf tea Gambar 5. kelompok masyarakat maupun lembaga. yaitu sumatera. NTB. ditambah dari daerah Indonesia bagian barat. banyak fihak yang terlibat dalam perdagangan gaharu. misalnya pencari gaharu dan pedagang pengumpul di bagian hulu (hutan atau desa sekitar hutan) lebih banyak dibandingkan dengan pedagang menengah dan besar yang berdomisili di ibukota kabupaten atau propinsi. Maluku. termasuk Riau. Daerahdaerah ini walaupun letaknya di Indonesia bagian timur. Di duga banyak gaharu yang di perdagangkan secara illegal dari sumatera lewat Riau ke Singapura dan Malaysia. Sulawesi. namun karena akses yang mudah memasok gaharu pula ke Jakarta. NTT. baik sebagai individu (perorangan).

A. produk gaharu sulit dibedakan berdasarkan asal jenis tumbuhan dan asal daerahnya. microcarpa. Demikian pula dari sisi warna dan aroma sangat sulit bagi orang awam atau pedagang pemula untuk dapat memilah-milahnya. . maka jenis Aquilaria yang ada. malaccensis. B. Pemasaran Luar Negeri Secara fisik.Secara garis besar. Lalu lintas perdagangan gaharu dalam negeri Beberapa permasalahan yang sering dijumpai di lapangan antara lain: sulitnya menentukan jenis gaharu. Kalimantan Sulawesi Papua Maluku Riau  Sumatera Sumatera Jakarta NTT NTB Surabaya Gambar 6. lalu lintas perdagangan gaharu di dalam negeri dapat dilihat pada gambar berikut. yaitu: A. A. filaria dan Gyrinops diatur perdagangannya oleh konvensi perdagangan internasional yaitu CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) melalui sistem quota. standar dan kualitas serta harga yang layak sehingga menguntungkan bagi kedua belah fihak. yaitu konsumen dan produsen. Oleh karena kekhawatiran salah satu species penghasil gaharu yang mungkin bisa cepat punah.

wewangian dan aroma terapi. Gaharu dalam bentuk gelondongan yang siap dikirim ke Taiwan. super A dan AB) umumnya dipasarkan ke negaranegara Timur Tengah untuk digunakan sebagai bahan acara ritual keagamaan. dapat dilihat beberapa gaharu yang masih dalam bentuk gelondongan yang siap untuk diekspor.Menurut ASGARIN. Gambar 7. produk gaharu yang diperdagangkan ke luar negeri mengikuti selera konsumen. makmul dan lain-lain. 17 . Dalam beberapa tahun terakhir terdapat kecenderungan pembeli dari Taiwan untuk mengimpor gaharu dari Indonesia dalam bentuk log. Nilai keseluruhan dari gaharu tersebut tidak kurang dari Rp 600 juta. Pada gambar 6 berikut. Untuk gaharu yang berkualitas menengah ke bawah. Kayu gaharu yang bentuknya masih gelondongan dan hanya sedikit mengandung gaharu tersebut digunakan sebagai hiasan yang dipasang di suatu ruangan dengan diberikan sedikit sentuan teknologi ukir sehingga terkesan mewah dan mempunyai nilai seni yang sangat tinggi. ekspor lebih banyak dilakukan ke negara-negara Asia Selatan untuk digunakan sebagai bahan baku pembuatan minyak wangi dan untuk acara-acara ritual dalam bentuk hio. Gaharu dengan kualitas super (superking.

filaria sebanyak tujuh kali lipat.250 (K) 74. Menurut ASGARIN. Pada tahun 2008. Taiwan dan Jepang. realisasi ekspor gaharu untuk ketiga jenis dapat terpenuhi 100% dari kuota yang ditetapkan.000(K) 326. Tabel 5.882(R) Gyrinops 24.000 (R) 25.000 (K) 65.000 (K) 25. Perkembangan kuota dan realisasi ekspor gaharu Indonesia Tahun 2007 2008 2009 A. sedangkan untuk A. Pada tahun 2009. Malaccensis 30. malaccensis sebanyak hampir enam kali lipat. malaccensis tidak dapat dipenuhi. Oleh Singapura gaharu yang masuk dilakukan penyortiran dan pengemasan dan kemudian di ekspor kembali ke India. filaria yang banyak terpendam di rawa-rawa di Papua.000 (R) 173.000 (K) 8. Dua negara ini pula yang menjadi daerah atau negara tujuan utama ekspor gaharu dari Indonesia. misalnya Vietnam dan Kamboja.000 (K) 76.000 (K) 23.000 (K) 30. Menurut sebuah sumber. 18 . filaria. hal ini terjadi karena ditemukannya potensi baru yang sebelumnya luput dari inventarisasi. filaria 76. misalnya untuk jenis A. dan bahkan untuk Gyrinops realisasi ekspornya hanya mencapai 30% dari kuota yang ditetapkan. sedangkan pada A. Sedangkan gaharu yang masuk ke Saudi Arabia di distribusikan lagi ke negara-negara lain di sekitarnya dan sebagian lagi di ekspor ke Inggris dan perancis.000 (R) 65.000 (K) - Tabel diatas memperlihatkan bahwa kuota ekspor gaharu pada tahun 2007 dari ketiga jenis yang dapat dipenuhi hanya dari jenis A.Selama 3 (tiga) tahun terakhir jumlah kuota dan realisasi gaharu yang diekspor sebagaimana dapat dilihat pada tabel berikut. dan sebagian lagi ke Timur Tengah. China. Singapura selain mendapat pasokan gaharu dari Indonesia juga dari negara Asia Tenggara. pusat perdagangan gaharu dunia yang sangat penting adalah Singapura dan Riyad (Saudi Arabia). Hongkong.890 (R) A. lonjakan kuota yang signifikan terjadi pada jenis A.000 (R) 455.709 (R) 30. seperti dapat dilihat pada gambar berikut.

(Sulistyo A.. pemeliharaan. Teknik budidaya dimaksud meliputi kegiatan perbanyakan bibit.. Rekayasa produksi gaharu diarahkan untuk pohon-pohon penghasil gaharu hasil budidaya. virus.. penanaman.Perkembangan Pemanfaatan Gaharu . yang dua-duanya berkaitan dengan proses patologis yang dirangsang oleh adanya luka pada batang patah cabang atau ranting. Luka tersebut menyebabkan pohon terinfeksi oleh penyakit (bakteri. jamur) yang diduga mengubah pentosan atau selulosa menjadi resin atau damar. 19 . Secara garis besar proses pembentukan gaharu terdiri dari dua. sedangkan pohon-pohon penghasil gaharu yang tumbuh secara alami perlu dikonservasi dan dipelihara dengan baik untuk dijadikan pohon induk penghasil anakan. pemberantasan hama dan penyakit hingga tumbuhan tersebut memiliki volume yang cukup memadai. Lalu lintas perdagangan gaharu luar negeri REKAYASA PEMBENTUKAN GAHARU Teknik budidaya perlu dikuasai dengan baik untuk dapat membudidayakan pohon penghasil gaharu. Siran) Hongkong Prancis UK India China Japan Malaysia Taiwan Kwait Oman Qatar Saudi Arabia UAE SINGAPORE Bahrain Middle East Riyadh Indonesia Iraq Iran Afrika Gambar 8.. yaitu secara alami dan buatan.

2. Proses pembentukan gaharu di hutan alam sulit dipantau dan diamati. kegiatan lapangan dan kombinasi keduanya.Semakin lama kinerja penyakit berlangsung. 3. Rekayasa pembentukan gaharu dengan inokulasi telah dilakukan oleh banyak fihak. kegiatan di laboratorium dan kegiatan uji lapangan yaitu: 1. koleksi dan isolasi jamur. 4. Identifikasi jamur secara molekuler Penyaringan (screening) Uji efektivitas Formulasi media Produksi inokulan (jamur) Pembangunan plot demonstrasi untuk ujicoba di lapangan Observasi dan evaluasi Alur kegiatan rekayasa produksi gaharu secara garis besar dapat dilihat sebagaimana gambar berikut: Gambar 9. dimulai dari kegiatan laboratorium. Alur kegiatan rekayasa produksi gaharu. Eksplorasi. Oleh karena itu untuk dapat mengamati secara langsung proses pembentukan gaharu dilakukan rekayasa dengan cara inokulasi (penyuntikan) jamur atau cendawan pada pohon penghasil gaharu. 5. 6. dengan teknik induksi yang bermacam-macam dan jenis jamur yang bervariasi. 20 . 7. Kegiatan yang “berskala laboratorium” dimulai dari kegiatan lapangan. kadar gaharu menjadi semakin tinggi. 8. Tahapan rekayasa produksi gaharu meliputi banyak kegiatan.

Diantara isolat tersebut empat isolat sudah diujicoba pada beberapa jenis pohon penghasil gaharu di beberapa daerah dan memberikan hasil yang cukup bagus. Launching tersebut juga dimaksudkan untuk memberikan akses kepada publik agar dapat memanfaatkan isolat tersebut untuk ujicoba produksi gaharu.Perkembangan Pemanfaatan Gaharu . Launching Inokulan Gaharu oleh Menteri Kehutanan Dengan adanya launching tersebut maka secara resmi inokulan prododuksi Puslitbang Hutan dan Konservasi Alam (P3HKA) telah dilepas di pasaran namun masih terbatas. maka secara resmi ke empat jenis isolat tersebut telah di “launching” Menteri Kehutanan (lihat gambar 8) pada Pameran Indo Green yang berlangsung di Jakarta Convention Center (JCC) pada tahun 1999. Berdasarkan pengamatan sementara... (Sulistyo A.. 21 . Sumatera Barat. Keterbatasan tersebut dimaksudkan hanya kepada masyarakat petani gaharu atau pelaku usaha gaharu yang telah mendapatkan pelatihan dari P3HKA saja yang boleh menggunakan inokulan tersebut. Gambar 10. Berdasarkan bukti-bukti keberhasilan tersebut. Gorontalo dan Papua. beberapa isolat lain yang juga cocok dan memberikan hasil yang cukup bagus adalah Jambi dan Kalimantan selatan. Siran) Sampai saat sudah berhasil dikoleksi 23 inokulan (isolat) dari sebagian besar propinsi di Indonesia.. Ke empat isolat tersebut adalah: isolat dari Kalimantan Barat.

untuk mengetahui perkembangan inokulasi. Bali. Bangka. Kalimantan Tengah. Carita (Banten). baik kegagalan maupun keberhasilanya. Sijunjung dan Padang Pariaman (Sumbar). Kalimantan Selatan.Untuk melihat efektivitas pembentukan gaharu. Bogor (Jabar). Penyebaran plot inokulasi dapat dilihat sebagaimana gamber berikut. Sumsel. Ujicoba tersebut dilaksanakan di lokasi dengan kondisi yang berbeda. Bioinduction : 15 locations Gambar 11. keterbukaan tajuk. 22 . Jambi. Beberapa faktor penting yang diamati adalah: kondisi kelembaban dan suhu udara. baik kondisi ekologis. Menado dan Seram. virulensi inokulan yang digunakan. Sukabumi. Kalimantan Barat. Lombok (NB). jarak titik lubang dan lain sebagainya. Penyebaran plot inokulasi pembentukan gaharu (gambar bintang warna kuning) Evaluasi dan pengamatan terus menerus dilakukan. jenis asal isolat dan jenis pohon penghasil gaharu yang diinokulasi. ujicoba ke enam isolat telah dilaksanakan di 15 (lima belas) lokasi yang tersebar di beberapa propinsi di Indonesia. yaitu: Bohorok (sumut).

Kualitas gaharu tersebut terus meningkat menjadi kacangan setelah 2 tahun inokulasi dan secara signifikan meningkat menjadi tanggung pada 3 tahun setelah inokulasi. Perkembangan hasil inokulasi menurut waktu Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun 2 tahun 3 tahun Kualitas Kemedangan Kemedangan B Kemedangan A teri kacangan tanggung Apabila di sejajarkan dengan kualitas gaharu hasil alam yang ada di pasaran dalam negeri... 23 . Pada saat ini pohon yang ditebang secara bertahap tersebut masih hidup dan masih tumbuh baik di lapangan. maka hasil gaharu yang dipanen setelah 3 bulan inokulasi memiliki kualitas kemedangan. dengan harapan bahwa gaharu yang akan dipanen tersebut akan mempunyai kualitas` yang lebih bagus lagi dari sebelumnya. Contoh gaharu hasil panen yang dilakukan secara bertahap adalah sebagai berikut. (Sulistyo A.. Menurut rencana pada tahun 2011 akan dilakukan pemanen lagi untuk melihat perkembangan kualitas gaharu. Tabel 6. dan terus meningkat menjadi kelas teri setelah 1 tahun.. Siran) Perkembangan hasil inokulasi yang dilaksanakan di salah satu lplot penelitian yaitu daerah Sukabumi dari waktu ke waktu dapat dilihat sebagaimana tabel berikut.Perkembangan Pemanfaatan Gaharu .

Gambar 12. dengan kualitas kemedangan C. Gaharu hasil panen 3 bulan setelah penyuntikan. Gambar 13. 24 . Gaharu hasil panen 9 bulan setelah penyuntikan (inokulasi) dengan kualitas kemedangan A.

(Sulistyo A... Gaharu hasil panen dua tahun setelah penyuntikan dengan kualitas kacangan 25 . Siran) Grade Kemedangan (US $ 100/kg) Gambar 14.Perkembangan Pemanfaatan Gaharu .. Gaharu hasil panen satu tahun setelah penyuntikan dengan kualitas teri Grade Gubah AB (US $ 200-250/kg) Gambar 15..

Harga gaharu yang cenderung meningkat dengan semakin tertundanya waktu panen. Gaharu hasil panen 3 (tiga) tahun setelah penyuntikan dengan kualitas tanggung Berdasarkan survey pasar.000 26 . Tabel 7.000 750.000 1.000 200. referensi harga gaharu hasil alam di pasaran dalam negeri dan penawaran dari pedagang gaharu dari Riyad (gambar sudut kanan atas). Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun Harga (Rp) 50. estimasi harga gaharu hasil panen dari plot penelitian P3HKA dapat dilihat sebagai mana tabel berikut.> US $ 800 Gambar 16.000.

.500. (Sulistyo A..000 US$ 800 atau 7. Kualitas Hasil rekayasa Super Tanggung Kacangan Teri Kemedangan Hasil alam 1 Hasil alam 2 Hasil alam 3 Hasil alam 4 1 2 3 4 Tahun 5 6 7 8 9 10 Gambar 17.000 ? Hubungan antara kualitas gaharu. Grafik hubungan antara terbentuknya gaharu dengan waktu penundaan panen. Siran) Umur Setelah Inokulasi 2 tahun 3 tahun 4 tahun Harga (Rp) 2.Perkembangan Pemanfaatan Gaharu ... waktu penundaan panen dan harga di pasaran sangan erat sekali. Berdasarkan pemeriksaan laboratorium. Semakin lama proses pembentukan gaharu di pohon maka akan semakin meningkat kualitas gaharu yang akan dihasilkan dan dengan sendirinya akan meningkatkan harga gaharu tersebut. gaharu hasil panen 9 bulan setelah penyuntikan mengandung zat aktif yang cukup 27 . Grafik hubungan antara terbentuknya gaharu dengan waktu dapat dilihat pada grafik sebagai berikut.500.

28 . penguat rasa/aroma pada roti &kue Komponen Kimia Ketoisophorone = wangi manis campuran kayu.konsituen utama dalam minyak melati Maltol = wangi caramel (manis). bahan kosemtik Isolongifolen = bahan odorant & parfum Indole = wangi bunga & parfum. setidaknya terdapat 12 (dua belas) komponen kimia sebagaimana dapat dilihat pada gambar berikut. Pemeriksaan kandungan kimia pada gaharu hasil alam menunjukkan hasil yang sama dengan gaharu hasil rekayasa jika dua-duanya diambil dari kualitas yang sama. komponen volatile dan kokoa Dumasin = wangi mint. anti inflamantory Ambrettolide = wangi musk. insektisida botani. teh dan daun tembakau Valerolactone = wangi herbal Ambrox = odorant tipe amber. Kandungan kimia yang terdapat pada gaharu hasil rekayasa. manis buah & bunga 1 2 3 4 5 Tahun Gambar 18. wangi & warna biru Benzylacetone = wangi manis bunga.banyak. Azulene = komponen minyak esensial tanaman. memiliki sifat pestisida Cadinene = konstituen minyak esensial berbagai tanaman Limonene = terpen aroma bunga & buah.

penanaman. dan pengamanan). (Sulistyo A.. penyediaan inokulan. pengangkutan. subsistem hilir (pemanenan. Siran) PENUTUP Dengan ditemukannya teknologi inokulasi pembentukan gaharu. peralatan inokulasi. maka produk gaharu akan menjadi produk andalan dimasa depan... subsistem pendukung (kebijakan pemerintah. Hanya dengan koordinasi dan integrasi yang baik di antara seluruh komponen masyarakat dan pemerintah. pemasaran). pengolahan.Perkembangan Pemanfaatan Gaharu . pemberantasan hama dan penyakit).. penyiapan bibit. 29 . tranportasi. Ketiga subsistem tersebut di atas memerlukan investasi yang cukup besar. riset dan pengembangan. infrastruktur. peluang penyerapan tenaga kerja yang besar dan penerimaan asli daerah yang cukup signifikan. Untuk dapat mewujudkan kondisi dan harapan tersebut. skema kredit dan asuransi). terbukalah peluang yang besar untuk kegiatan pengusahaan gaharu yang dimulai dari subsistem hulu (penyiapan lahan. subsistem tengah (penyuntikan. maka seluruh sektor harus memainkan peran sesuai dengan tugas pokok dan fungsinya masing-masing. pendidikan dan pelatihan. penyediaan pupuk.

30 .

STATUS RISET GAHARU 31 .

32 .

Aspek PRODUKSI 33 .

.

Dari segi keberadaan material bibitnya lokasi sekitar hutan memiliki jumlah tegakan gaharu alam terbanyak. kecuali dengan campur tangan manusia. masyarakat di sekitar hutan merupakan sasaran ideal yang dapat melipatgandakan peran dan fungsi program tersebut. sekaligus untuk melindungi ragam pohon penghasil gaharu yang ada di Indonesia. sehingga tidak menyebar jauh. khususnya untuk menjaga kesinambungan produksi. mengingat buah pohon ini bersifat rekalsitran. sehingga pemahaman dan keterampilannya untuk mendukung pengembangan cluster industri gaharu telah sangat memadai. Pengembangan gaharu ini perlu dilakukan. pengembangan gaharu di sekitar hutan juga akan membantu pengamanan keragaman hayati dan kelestarian hutan.PENGEMBANGAN GAHARU DI SUMATERA Mucharromah Fakultas Pertanian Jurusan Perlindungan Tanaman Universitas Bengkulu PENDAHULUAN Gaharu merupakan produk kehutanan yang memiliki nilai ekonomi sangat tinggi dibanding produk kehutanan lainnya. Dari aspek keamanan lingkungan dan keragaman hayati. sehingga sangat potensial untuk dikembangkan. Dalam pengembangan gaharu. mengingat 35 . sebagian bahkan pernah menjadi pengumpul. Dari segi kesiapan masyarakat. pada umumnya masyarakat yang tinggal di sekitar hutan sudah mengenal gaharu.

berwarna hitam mengkilat dan berat hingga tenggelam dalam air. maka pengembangan gaharu sangat berpotensi mensejahterakan masyarakat. dan kekurangan oksigen. termasuk dari wilayah barat Indonesia atau Sumatera dan dihargai sangat mahal. Namun demikian. longsor. yaitu meningkatkan kapasitas absorbsi dan retensi air tanah. dengan tekstur yang sangat keras dan halus tidak berserat. produksi gaharu justru tidak akan terjadi bila pohonnya tumbuh sangat baik dan tidak terganggu sedikit pun. sehingga tidak mudah longsor serta menyerap CO2 dan menghasilkan O2 yang sangat penting dalam mendukung kehidupan. kekurangan air bersih. dan negara di samping menghindarkan dari bahaya bencana alam kekeringan. paningkatan temperatur udara. Sejauh ini produksi gaharu Indonesia masih banyak diambil dari alam sehingga disebut sebagai gaharu alam. Dengan demikian. khususnya yang berkaitan dengan pendanaan proses produksi yang memerlukan dana cukup besar. pengembangan gaharu tidak sama dengan pengembangan tanaman pertanian yang dapat langsung menghasilkan. di samping pemberdayaan dan pemakmuran masyarakat di sekitar wilayah hutan. bangsa. Gaharu alam telah dikenal sejak ribuan tahun lalu diperdagangkan ke Timur Tengah oleh para pedagang India dan Indo-China. pengembangan gaharu di wilayah sekitar hutan akan memperkuat fungsi hutan tersebut. khususnya yang memiliki kualitas super dan di atasnya.Aspek PRODUKSI masyarakat sudah dapat memperoleh penghasilan dari usaha pengembangan gaharu yang sangat prospektif secara ekonomi. Oleh karenanya. Sementara gaharu 36 . tetapi juga perlu didukung dengan pengembangan teknik produksi dan pengembangan sistem yang akan mendukung pengembangan produksi. Bentuk gaharu super sangat beragam. mengingat pohon penghasil gaharu memiliki morfologi yang sangat mendukung perannya sebagai ’penjaga lingkungan’. Selain itu. Gaharu kualitas super sudah mengeluarkan aroma harum meski tanpa dipanasi atau dibakar. polusi. menguatkan tanah. Pada pohon penghasil gaharu. pengembangan produksi gaharu tidak cukup hanya dilakukan dengan penanaman bibit pohon penghasilnya saja. Dengan nilai ekonomi gaharu yang sangat tinggi dan permintaan pasar dunia yang terus meningkat.

(Mucharromah) yang memiliki kualitas lebih rendah (kemedangan dan abuk) disuling untuk diambil resinnya dan ampasnya dibuat makmul atau hio untuk ritual keagamaan. Kesiapan Teknologi Produksi Berbeda dengan produk pepohonan lainnya yang selalu dihasilkan selama tanaman tumbuh sehat atau dengan kata lain 37 . pembersihan. Dengan upaya ini. namun banyak masyarakat umum yang tidak mengetahui apa yang disebut gaharu. hampir seperti seni memahat. maka volume perdagangan gaharu makin meningkat. sehingga lebih mampu menjaga keamanan lingkungan dan keragaman sumberdaya alam di sekitarnya. Dengan pengalaman mencari gaharu alam yang sudah cukup lama. Karenanya mereka merupakan kelompok sasaran yang sudah siap menjadi SDM untuk pengembangan gaharu. dan perdagangan gaharu.. maka produksi gaharu Indonesia akan tetap melimpah dan masyarakat yang memproduksinya juga makin makmur dan sejahtera. khususnya di area yang paling potensial yaitu wilayah sekitar hutan. kecuali masyarakat di sekitar wilayah hutan yang sudah pernah terlibat dalam pencarian. B. Kondisi ini tak akan dapat diatasi kecuali dengan melakukan pengembangan gaharu secara besar-besaran.. banyak masyarakat di sekitar hutan yang terampil membersihkan gaharu sehingga cukup siap untuk mendukung pengembangan gaharu di daerahnya. pembersihan gaharu dari sisa kayu putihnya. Kesiapan SDM Pendukung Proses Produksi Meskipun gaharu sudah sangat lama menjadi salah satu komoditi ekspor Indonesia.. Proses ini sangat lambat. khususnya pada proses pasca panen. Dengan makin meningkatnya permintaan pasar internasional. sehingga keberadaan pohon penghasil gaharu juga makin terancam akibat banyak yang ditebangi dan dicacah masyarakat untuk diambil gaharunya.Pengembangan Gaharu di .. KESIAPAN PENGEMBANGAN GAHARU A. sehingga membutuhkan banyak tenaga kerja terampil.

2008.d. Temuan tentang adanya jenis jasad renik yang dapat menginduksi terjadinya akumulasi resin wangi yang selanjutnya membentuk gaharu inilah yang mendasari adanya temuan tentang teknik induksi pembentukan gaharu yang dapat digunakan untuk mendukung proses produksi gaharu dalam skala industri. Faktor abiotik dapat berupa angin atau hujan angin dan petir. gaharu justru tidak akan didapat pada pohon yang tumbuh sehat tanpa ada gangguan apapun. baik secara alami oleh faktor abiotik maupun biotik ataupun telah diinduksi oleh manusia.Aspek PRODUKSI produksi merupakan fungsi dari pertumbuhan tanaman sehat. maka teknik produksi inokulan dan induksi pembentukan gaharu dengan inokulasi telah siap untuk dilatihkan kepada masyarakat guna mendukung pengembangan produksi gaharu melalui pemberdayaan masyarakat di sekitar wilayah hutan. 2009). 2006.. baik pelatihan teknik inokulasi maupun pelatihan teknik monitoring pembentukan gaharu. Kadir. Sementara pembentukan gaharu oleh faktor biotik dapat disebabkan oleh infeksi jasad renik terhadap tanaman. Selain itu juga perlu dilakukan teknik pelatihan produksi inokulan sehingga proses produksi dapat berlangsung lebih efisien.b. Namun kejadian pembentukan gaharu oleh faktor abiotik dari alam ini sulit ditiru sehingga tidak dapat dijadikan dasar pada proses produksi dalam bentuk industri. Kesiapan Kontrol Kualitas Produk Untuk keberhasilan dan kesinambungan suatu proses produksi umumnya selalu dilakukan monitoring kualitas produk. Untuk itu penyiapan SDM pendukung pengembangan gaharu juga perlu mempersiapkan personil yang mampu mengenali kualitas 38 ..c. Kebanyakan gaharu justru ditemukan pada pohon yang terganggu. maka untuk persiapan pelaksanaannya dalam proses produksi dibutuhkan pelatihanpelatihan. Santoso et al. Namun mengingat teknik yang diterapkan belum biasa dilakukan masyarakat. Beberapa kelompok peneliti telah mampu melakukan inokulasi yang merangsang pembentukan gaharu (Mucharromah et al. 2008a. C. Dengan dukungan operasional. selain akibat gesekan hewan dan perilaku manusia yang tidak direncanakan.

gaharu merupakan jaringan kayu dari pohon jenis tertentu (penghasil gaharu) dengan kandungan resin sesuiterpenoid volatil beraroma harum gaharu yang cukup tinggi. Pada gaharu alam gradasi kualitas ditentukan berdasarkan standar mutu yang telah ditetapkan secara nasional dalam SNI 015009. yaitu: a. yang terdiri dari: 1. Dari segi bentuknya. mutu TGB/TK2 c. yang selanjutnya membuat jaringan kayu tersebut memiliki warna. yaitu: a. mutu pertama 39 . mutu utama b. kemedangan. mutu utama = mutu super b. mutu kedua = mutu sabah super 2.dan mensortasi atau mengumpulkan gaharu yang dihasilkan berdasarkan gradasi kualitas dan kegunaannya. mutu pertama = mutu TGA/TK1 b. Gubal gaharu. mutu ketujuh = setara dengan M3 3. dan abu gaharu. Hal ini membuat gaharu menjadi makin mahal dan nilainya sangat ditentukan oleh kualitas kadar dan kemurnian resin yang dikandungnya. tekstur. Selain itu jaringan yang mengandung resin wangi gaharu juga hanya didapati pada bagian pohon yang mengalami proses tertentu. mutu TGC/TK3 d. aroma. Abu gaharu yang terbagi dalam 3 kelas mutu. mutu TGF/TK6 g. yaitu: a. Ketiga sortimen tersebut dibagi lagi dalam 13 kelas kualitas. Dalam standar ini kualitas gaharu dibedakan menjadi tiga sortimen.1-1999. Kemedangan. mutu TGE/TK5 f. dan tingkat kekerasan dan berat jenis berbeda. Adanya aroma harum yang khas dan tahan lama inilah yang membuat gaharu sangat disukai dan dihargai dengan nilai ekonomi yang sangat tinggi. yaitu gubal gaharu. mutu pertama = mutu AB c. dengan 3 tanda mutu. seperti pelukaan yang disertai infeksi patogen melalui inokulasi atau proses lainnya. mutu TGD/TK4 e. dengan 7 kelas mutu.

Untuk itu pelatihan SDM dalam teknik monitoring perkembangan pembentukan gaharu dan kontrol kualitasnya sangat penting dilakukan.Aspek PRODUKSI c. Hal ini menjadi modal utama yang membuat proses produksi gaharu menjadi jauh lebih 40 . yang biasanya baru dapat dicapai pada 12-18 bulan setelah inokulasi. standar kualitas gaharu dan harganya akan lebih terjamin. seperti yang telah dilakukan di Kota Bengkulu dan sekitarnya. Pada 6 bulan setelah inokulasi telah dicapai produk kualitas kemedangan TGB dan TGA. D. Namun dengan tingkat keahlian sortasi. Namun pengembangan gaharu di sekitar wilayah hutan kemungkinan akan jauh lebih efisien proses produksinya. tidak hanya di sekitar wilayah hutan tetapi bahkan hingga ke halaman rumah dan perkantoran serta sekolah. di mana pemilik barang merupakan penentu harga. Pada hasil uji lanjut teknik produksi gaharu yang dilakukan beberapa bulan lalu di Provinsi Bengkulu. mutu kedua.. Namun pembedaan kelas kualitas tersebut secara detil sangat sulit dilakukan sehingga pada prakteknya hingga saat ini konsumenlah yang menentukan tingkat mutu produk dan harga gaharu. Saat ini sudah cukup banyak pohon penghasil gaharu yang telah diinokulasi. proses pembentukan gaharu telah semakin cepat terjadi. di samping lebih besar manfaatnya bagi pengamanan lingkungan dan pemberdayaan serta pemakmuran masyarakat. Perkembangan keberhasilan teknik inokulasi ini sangat prospektif untuk mendukung pengembangan produksi gaharu yang pohon penghasilnya telah mulai banyak dibudidayakan di Sumatera dan wilayah lain di Indonesia. Dengan demikian pengembangan gaharu siap dilaksanakan. Teknik inokulasi untuk induksi pembentukan gaharu juga telah makin efisien dan murah. khususnya dari jenis Aquilaria dan Gyrinops. 2008). Hal ini merupakan anomali dari kondisi perdagangan komoditi lainnya. Kesiapan Modal dan Kelembagaan Indonesia merupakan negara yang sangat kaya dengan beragam jenis pohon penghasil gaharu. meskipun sebagian besar masih berada pada mutu TGC (Mucharromah et al.

Selain itu. pelatihan monitoring pembentukan gaharu serta upaya produksi gaharu hasil inokulasi. Berdasarkan hasil analisis tersebut maka pengembangan gaharu paling efisien bila dilakukan di area sekitar hutan yang masih kaya dengan tegakan gaharu berdiameter > 20 cm yang dapat diinokulasi untuk mempercepat produksi dan menambah modal awal untuk penanaman pada area yang lebih luas untuk kesinambungan usaha pengembangan gaharu. 2002). Selain itu juga diperlukan adanya kerjasama dan komitmen semua pihak untuk membantu mengawali usaha ini berdasarkan expertise dan bidang pekerjaannya. maka pengembangan gaharu hasil budidaya dan inokulasi dapat jauh lebih efisien dibandingkan produksi yang mengandalkan gaharu bentukan alam. Di alam tidak semua pohon penghasil gaharu membentuk gaharu atau hanya sedikit sekali menghasilkan gaharu. uji produksi.. (Mucharromah) mudah dan murah. Pada gaharu budidaya... pelatihan inokulasi. Hal ini membuat proses produksi gaharu alam menjadi kian mahal. Sejauh ini keberadaan pohon penghasil gaharu di lapangan telah banyak membantu pelaksanaan uji efektivitas inokulasi. Jumlah gaharu yang dihasilkan per pohon di hutan alam sangat bervariasi dari 0. Namun dari 41 . Dengan demikian.Pengembangan Gaharu di . sebagaimana disajikan pada analisis usaha inokulasi gaharu (Lampiran 1) dan analisis budidaya gaharu (Lampiran 2). Semakin lama maka semakin banyak resin wangi yang terakumulasi dan semakin tinggi kualitas gaharu yang dihasilkan. tidak semua pohon menghasilkan gaharu.. satu famili Leguminoceae.3 hingga 14 kg dan umumnya semakin banyak dengan makin besarnya diameter pohon (MacMahon. Namun demikian pengembangan gaharu tetap memerlukan dukungan dana yang relatif besar meskipun rasio keuntungannya terhadap modal juga cukup besar. 1998). proses produksi gaharu sangat ditentukan kuantitasnya oleh jumlah lubang atau luka yang diinokulasi dan kualitasnya tergantung dengan lamanya waktu sejak inokulasi hingga panen. Saat ini pembentukan gaharu di alam telah dilaporkan terjadi pada sedikitnya 16 jenis pohon dari beberapa genus famili Thymelaceae. 2008 dan Sumarna. dan satu famili Euphorbiaceae (Wiriadinata.

Sementara kehadiran jenis cendawan lainnya. Terbentuknya gaharu kualitas super atau yang sering disebut gubal super ini kemungkinan akan dapat dicapai seiring dengan pengembangan penelitian inokulan unggul yang terus dilakukan. double super. 2009). sehingga mampu menutupi pembiayaan untuk pengembangan selanjutnya. Mucharromah dan Surya. karena kualitas seperti gaharu alam tersebut bernilai sangat tinggi. yaitu USD 2. 42 . maka produksi gaharu selanjutnya tidak banyak memerlukan bantuan modal lagi. khususnya cendawan pelapuk kayu. Akibatnya jaringan kayu tersebut menjadi halus seperti dilapisi agar dan berwarna coklat kemerahan atau kehitaman. maka penggunaan inokulan unggul dan teknik inokulasi yang meminimalkan kontaminasi akan dapat meningkatkan kualitas gaharu yang dihasilkan dan mengefisienkan proses produksi hingga dapat dilaksanakan dengan modal lebih rendah. dan lebih tinggi.Aspek PRODUKSI segi kualitas.000 hingga 16.000 per kg di tingkat ’end-consumer’ di luar negeri. Dengan demikian. gaharu hasil inokulasi hingga kini belum dapat mencapai kualitas tertinggi gaharu alam. akumulasi resin wangi terjadi maksimal hingga luber dan menutupi sel-sel di sekitarnya. Saat ini kualitas gaharu hasil inokulasi sudah jauh lebih baik dan pada beberapa hasil penelitian sudah mendekati mutu gubal kualitas kemedangan B/C (Santoso. sebagaimana ditunjukkan oleh data mikroskopis perkembangan deposisi resin gaharu pada area jaringan sekitar lubang yang diinokulasi atau hanya dilukai (Mucharromah dan Marantika. 2008 . yaitu super. tergantung intensitas atau kadar resin gaharu yang dikandungnya. Secara teoritis keunggulan inokulan dalam menginduksi pembentukan gaharu berkaitan dengan jenis dan kemurnian mikroorganisme yang digunakan. Bila kualitas seperti ini dapat dihasilkan dari inokulasi pohon pada awal proses pengembangan. 2008.komunikasi pribadi. 2006) atau bahkan B (Surya. Pada gaharu kualitas gubal. justru mendegradasi kembali resin gaharu yang sudah dideposisi bahkan hingga menghancurkan selnya sehingga gaharu yang sudah mulai terbentuk menjadi hancur dan lapuk minimal sebagian dan kualitas gaharu yang dihasilkan akan menurun.

kemungkinan karena kemurnian resin yang dikandungnya.c.b. sehingga aroma gubal gaharu kualitas terbaik dari berbagai wilayah dapat berbeda (Mucharromah et al. 2008). 43 . A. hirta. 2002). 2008).Pengembangan Gaharu di . (Mucharromah) Mucharromah et al. 2006. 2009) menunjukkan bahwa pada jaringan yang terkontaminasi resin gaharu yang awalnya berwarna coklat bening kemerahan berubah menjadi berwarna kehitaman dan menghilang sebelum akhirnya selnya menjadi hancur. Santoso et al.... Jenisjenis pohon penghasil gaharu dari spesies Aquilaria malaccensis. dan A. beccariana. agallocha yang banyak dijumpai di Sumatera... A.. 2006. maka kualitas gubal super mungkin akan dapat dicapai. MODEL PENGEMBANGAN GAHARU DI SUMATERA Secara teoritis akumulasi resin wangi gaharu telah dilaporkan distimulasi oleh infeksi cendawan dari jenis tertentu (Mucharromah dan Surya. 2008a. Sumarna. Oleh karenanya pengembangan gaharu di wilayah sekitar hutan dengan cara memperbanyak pohon-pohon jenis Aquilaria yang ada di lokasi tersebut dan menginokulasi pohon yang sudah tua untuk membiayai peremajaannya akan dapat mengembalikan potensi produksi gaharu yang dahulu dimiliki Sumatera dan wilayah Indonesia lainnya. A. microcarpa. Oleh karena itu dalam proses produksi gaharu dengan inokulasi perlu diterapkan prinsip-prinsip aseptik yang akan membatasi peluang terjadinya kontaminasi (Mucharromah et al. Dengan teknik inokulasi dan jenis isolat yang lebih murni dan potensial serta waktu antara inokulasi dan panen yang lebih panjang.. 2007). dikenal menghasilkan gaharu yang disukai konsumen mancanegara sejak jaman dahulu. aroma resin gaharu juga sangat menentukan kualitas. Sejauh ini aroma gaharu alam lebih lembut dibanding hasil inokulasi.. Selain karena kandungan resinnya yang jauh lebih tinggi. Pada pengamatan mikroskopis (Mucharromah dan Marantika. Selain itu kekhasan aroma gaharu juga dipengaruhi oleh jenis pohon penghasilnya dan kemungkinan juga jenis mikro organisme inokulannya.

Mucharromah. Selain itu. Sejauh ini telah dilakukan pengembangan gaharu sebanyak > 10. ketepatan teknik inokulasi.Aspek PRODUKSI Kemampuan cendawan inokulan dalam menstimulir produksi resin juga sangat terkait dengan tingkat akumulasi resin yang merupakan hasil netto dari proses sintesis dikurangi dengan degradasinya serta jenis resin dan kemurniannya (Agrios. Selanjutnya pohon yang sudah cukup besar (diameter > 44 . pengembangan gaharu memerlukan modal yang cukup besar karena prosesnya cukup kompleks. Meskipun gaharu yang dipanen akan menghasilkan produk yang dapat dijual. dan keterampilan pekerja akan sangat mempengaruhi proses produksi dan kualitas produk. Kerjasama ini meliputi pemeliharaan dan penanaman kembali anakan alam yang ada di sekitar tegakan induk hingga mencapai populasi minimal 10-100 batang tanaman muda per pohon induk diinokulasi untuk produksi gaharu. 2004). namun untuk pelaksanaan proses panen dan pembersihan tersebut diperlukan modal yang cukup besar. 2005.000 batang yang ditanam di sekitar pohon induk yang diinokulasi. Pertama. setelah didapat inokulan efektif dan hasil inokulasi yang cukup menjanjikan. Oleh karenanya campur tangan pemerintah sangat diharapkan. Namun kerjasama ini masih membutuhkan cukup banyak modal untuk menjadi usaha pengembangan gaharu yang mandiri. maka kepada masyarakat pemilik tegakan gaharu yang diameternya telah mencapai > 20 cm ditawarkan kerjasama pengembangan gaharu dengan penanaman kembali dan inokulasi. Sebagaimana diuraikan sebelumnya. 2004. karena masih harus melakukan panen dan proses pembersihan gaharu yang bersifat padat karya. Langenhein. Oleh karenanya pengembangan gaharu tidak dapat dilakukan secara mandiri. Oleh karenanya di Bengkulu pengembangan gaharu diawali dengan pengujian efektivitas berbagai isolat cendawan yang berpotensi menginduksi pembentukan gaharu dan diikuti dengan pengembangan inokulan unggul yang masih terus dilakukan untuk peningkatan kualitas. Dengan demikian maka penggunaan jenis inokulan tertentu dan kemurniannya serta penerapan teknik aseptik dalam penyiapan dan aplikasi inokulan. anakan alam atau bibit harus ditanam dan dipelihara. khususnya pada masyarakat yang tidak memiliki modal dan hanya mengandalkan sumberdaya alam dan keterampilan.

Kelembagaan tersebut dapat sangat sederhana 45 . mengingat proses produksi gaharu jauh lebih rumit dibandingkan proses produksi komoditi hasil hutan dan perkebunan atau pertanian lainnya. Setelah dipanen secara total. Proses induksi pembentukan gaharu dilakukan dengan memberikan inokulan pada sejumlah besar lubang yang dibuat spiral dengan jarak 7-10 cm horisontal dan 12-20 cm vertikal dari pangkal batang hingga ujung pucuk yang masih bisa dipanjat. maka jumlah tenaga kerja yang dikaryakan juga akan semakin meningkat. maka perlu ada suatu kelembagaan yang bertugas untuk membantu penyiapan dan pelaksanaan proses produksinya hingga berhasil berkembang menjadi industri gaharu yang mandiri..Pengembangan Gaharu di . Selanjutnya pohon yang telah diinokulasi dimonitor hingga waktu panen. (Mucharromah) 20 cm) perlu diinduksi dengan inokulasi jasad renik atau perlakuan lainnya agar membentuk gaharu.. Oleh karenanya pengembangan gaharu harus dilakukan secara serius. Jumlah ini cukup besar dan akan mampu mempekerjakan masyarakat sekitar hutan sebanyak 280 hingga 340 orang/tahun dengan 200 hari kerja/tahun. Pada gaharu hasil inokulasi.000-68. Proses inokulasi ini selain memerlukan keterampilan. Proses ini dilakukan secara manual dengan melibatkan sejumlah besar tenaga kerja. pengembangan gaharu hasil budidaya dan inokulasi makin lama makin memberikan keuntungan melimpah dan makin ’sustainable’. Selain itu. Dari segi jumlah tenaga kerja yang menangani proses pembersihan produk ini kemungkinan tidak banyak berbeda antara produksi gaharu alam dengan gaharu budidaya. Dengan peningkatan permintaan dan kapasitas produksi. sehingga tidak berkelanjutan. tetapi dari segi keamanan pekerja dan lingkungan. juga keberanian dan ketersediaan personil dengan kondisi fisik yang mendukung pelaksanaan pekerjaan.000 orang/hari.. sehingga untuk menghasilkan gaharu sebanyak 270 ton sebagaimana jumlah yang diekspor pada tahun 2000-an akan mampu menyerap tenaga kerja sebanyak 56. sehingga upaya-upaya yang dilakukan akan memberi hasil yang berkelanjutan. untuk membersihkan 1 kg gaharu umumnya diperlukan 4-5 orang hari kerja.. dilakukan proses pembersihan untuk memisahkan gaharu dari jaringan kayu yang lebih sedikit kandungan resin wanginya. sementara gaharu alam akan makin habis.

swasta atau kelompok masyarakat. mengingat wilayah sekitar hutan yang menjadi area pengembangan gaharu umumnya cukup jauh dari lokasi institusi yang mensertifikasi produknya. tidak hanya dengan pihak yang dapat membantu pengembangannya. Hal ini mungkin perlu disederhanakan dalam upaya pengembangan gaharu yang dilakukan. Namun bila perdagangan gaharu masih diatur oleh kuota yang dalam proses perdagangannya melibatkan banyak pihak. baik halaman maupun kebun. baik oleh pihak swasta maupun perguruan tinggi dan kelompok masyarakat. justru akan dapat menghambat pengembangan gaharu yang dituju. Peran tersebut dapat dilakukan melalui kegiatan penelitian dan pengabdian pada masyarakat yang sudah secara 46 . maka proses pengembangan gaharu yang telah dilakukan sejauh ini berjalan aman. pengembangan inokulan unggul untuk peningkatan mutu serta pengembangan teknik pengawasan kualitas produk. dibuat secara sangat sederhana dengan kontrak kerjasama antara pemilik pohon/lahan dengan pelaksana yaitu perguruan tinggi.Aspek PRODUKSI bila pengembangan gaharu dapat diberlakukan seperti komoditi pertanian atau perkebunan hasil budidaya. maka pengembangan gaharu perlu dilakukan dengan melibatkan berbagai pihak yang terkait dengan perdagangannya. sehingga cukup menyulitkan meskipun prosesnya sederhana. Dalam hal pengembangan gaharu. Mengingat pohon yang diinokulasi atau bibit yang ditanam berada di lahan pribadi. penjualan gaharu hingga kini masih memerlukan adanya sertifikasi jumlah untuk memastikan bahwa batas kuota belum terlewati. Dalam pelaksanaannya. perguruan tinggi dapat memainkan peran yang dapat menguntungkan semua pihak. maka dengan adanya aturan kuota. Hal ini dikarenakan upaya pengembangan yang dilakukan masih belum mencapai tahap produksi gaharu yang siap diperdagangkan. Dalam hal ini peran perguruan tinggi yang mengembangkan penelitian gaharu dapat dilakukan dalam bentuk pembinaan kelompok produksi gaharu di sekitar wilayah hutan serta penelitian untuk pemutakhiran teknik produksi. Sejauh ini pengembangan gaharu yang dilakukan di Provinsi Bengkulu. pelibatan banyak pihak ini bila tidak dipayungi dengan deskripsi tugas yang mendetil dan tidak saling tumpang-tindih. Bila sudah mencapai tahap produksi.

tetapi juga karena upaya ini memerlukan investasi teknologi dan modal yang cukup besar bagi keberhasilannya. 1995. banjir. DAFTAR PUSTAKA Agrios.Pengembangan Gaharu di . tetapi juga untuk melindungi hutan dan keragaman hayati yang ada di sekitarnya serta meningkatkan kapasitas hutan dalam menanggulangi potensi bahaya bencana alam yang disebabkan oleh longsor. Anonim. Oleh karenanya pengembangan gaharu perlu dilaksanakan dengan perencanaan yang sangat matang dari setiap tahapan prosesnya sehingga dapat berjalan dan meningkatkan kemandirian masyarakat di wilayah sekitar hutan. dan beragam kerusakan lingkungan lainnya. polusi. Untuk lebih mengefisienkan proses produksi dan menekan pembiayaan maka program pengembangan gaharu perlu dilakukan dengan mengadopsi model yang paling efisien dan praktis. kekeringan. tidak hanya untuk menjamin peningkatan dan kesinambungan produksi gaharu. G. yang berpotensi sangat besar untuk pemberdayaan masyarakat di sekitar wilayah hutan. (Mucharromah) rutin dilakukan perguruan tinggi dengan dukungan pendanaan dari instansi pemerintah maupun swasta. New York. Makalah Dipresentasikan pada Temu Pertama Pakar Gaharu. sehingga keberhasilannya akan lebih terjamin. Hal ini sangat penting untuk diperhatikan mengingat proses pembentukan gaharu tidak berjalan secara otomatis pada tanaman yang tumbuh sehat. Academic Press. tidak hanya karena menghasilkan produk bernilai ekonomi yang sangat tinggi... PENUTUP 1. 47 . Jakarta. sebagaimana produk pertanian atau perkebunan dan kehutanan lainnya. 1988.. Analisa Penyebab Terjadinya Gubal dan Kemedangan pada Pohon Gaharu. Hal ini sangat penting dilakukan.. 2. 20 Oktober1995.N. Plant Pathology. Pengembangan gaharu merupakan suatu program yang sangat besar.

Rahayu dan E.. http://members. 14-16 Mei 2008. 12 Agustus 2008. 2001. 2006a. com/ratrani/ Agarwood. (unpublished).). Misnawaty. White Lotus Aromatics. Mucharromah. Asal Gaharu terhadap Alginate dan CaCl2.Aspek PRODUKSI Anonim. 2008. dalam Menginduksi Akumulasi Resin Wangi Gaharu pada Batang Aquilaria malaccensis (Lamk. Makalah Semirata Bidang MIPA. dan Hartal. Mucharromah. Updated April 16th. Universitas Bengkulu. 2006. pada Berbagai Waktu Setelah Pengeboran Batang Aquilaria malaccensis (Lamk.aol. Fenomena Pembentukan Gubal Gaharu pada Aquilaria malaccensis (Lamk. Indonesia. Bengkulu. 31 Oktober 2006. Prosiding Seminar Nasional Gaharu. 48 . Laporan Penelitian Fundamental. Hipotesa Mekanisme Pembentukan Gubal Gaharu. 18 November 2006. FAPERTA UNIB. Bogor. Hartal. Makalah Seminar Nasional Pengembangan Produksi Gaharu Provinsi Bengkulu untuk Mendukung Peningkatan Ekspor Gaharu Indonesia. BKS-PTN Wilayah Barat. Respon Acremonium sp. Teknologi Budidaya dan Produksi Gubal Gaharu di Provinsi Bengkulu. Santoso. Makalah Semirata Bidang MIPA. dan U. Universitas Mataram. Lombok. N. 1-2 Desember 2005. Hartal. DIKTI. C. Tingkat Akumulasi Resin Gaharu Akibat Inokulasi Fusarium sp. 2008. 2005.). 2008. BKS-PTN Wilayah Barat.) Merespon Pelukaan dan Infeksi Cendawan. Mucharromah. Studi Mekanisme Akumulasi Resin Wangi Aquilaria malaccensis (Lamk. Mucharromah. G. Nusa Tenggara Barat. Seameo-Biotrop.org/wiki /Agarwood”. ”http://en. Mucharromah. MacMahon. Fakultas Pertanian Universitas Mataram Bekerjasama dengan Balai Pengelolaan Daerah Aliran Sungai Dodokan Moyosari Nusa Tenggara Barat (BP DAS Dodokan Moyosari NTB). 14-16 Mei 2008. Makalah Seminar. 2008. Mucharromah. Potensi Tiga Isolat Fusarium sp. Agarwood.wikipedia. dan Surani.). Universitas Bengkulu. Accessed 16 April 2006. 1998. Maryani. Terakhir dimodifikasi 11:11. html. 2006. Santoso.

Texas.K. 2006. 11-13 September 2006. 49 . Mataram. Santoso. Studi Etiologi Gubal Gaharu pada Tanaman Ketimunan. Surabaya. Y. Teknologi Budidaya Tanaman Gaharu untuk Menuju Sistem Produksi Gubal Gaharu secara Berkelanjutan. Sumarna. Surabaya 12 September 2006. Ngatiman dan Armansyah. E. Parman. Chang and A..rain-tree. Inc.. 1-2 Desember 2005. 1996. 1-2 Desember 2005.. Y.. 2006. Teknik Inokulasi dan Produksi Gaharu. 2005.. Purba. Raintree. Ng.. Mulyaningsih. Prosiding Seminar Nasional Gaharu. 1997.T. M.. Uji Coba Pembentukan Gaharu dengan Cara Inokulasi. Austin.. Sites : hhtp//www. Surabaya 11-13 September 2006. L. 2006b.S. Kanwil Dephut Propinsi NTB. R. Raintree Nutrition. 11-12 April 1996. Surya. Rahman. Makalah Workshop Gaharu Tingkat Nasional. J. Strategi Budidaya dan Pengembangan Produksi Gaharu. Bogor.htm. Bogor. Sumarna. Kerjasama Dirjen PHKA dan ASGARIN. A Review on Agar (Gaharu) Producing Aquilaria Species.Pengembangan Gaharu di . T.com/ aquilaria. Parman dan T. Irianto. Turjaman. 2001. Seameo-Biotrop. SEAMEO BIOTROP. Kerjasama Dirjen PHKA dan ASGARIN. Makalah Workshop Gaharu Tingkat Nasional. Skripsi Fakultas Pertanian Universitas Bengkulu.N. 2005. Identifikasi Genus Cendawan yang Berasosiasi dengan Pohon Aquilaria malaccensis (Lamk. Date 3/3/06.S. Agustini.A.) dan Gubal Gaharu Hasil Inokulasi serta Potensinya untuk Menginfeksi Bibit Gaharu. (Mucharromah) Mucharromah dan J. Makalah disampaikan pada Workshop Gaharu Tingkat Nasional. dan Y. Azizil. Makalah Temu Pakar Gaharu. L. Y. 2007. Prosiding Seminar Nasional Gaharu “Peluang dan Tantangan Pengembangan Gaharu di Indonesia”. Journal of Tropical Forest Products 2 : 272-285. Database Entry For Aquilaria agallocha. Wahyuno. Biodiversitas dan Karakterisasi Jamur Potensial Penginduksi Resin Gaharu. Mulyaningsih.B. D.

30 kg/batang (Kemedangan) Total proyeksi hasil : 50 kg/batang Penjualan kelas BC per batang : 60 kg Penjualan powder : 100 kg/batang No A. Uraian Beban operasional Pembelian batang/tanah Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga ahli inokulasi Tenaga kerja Pemeliharaan/perawatan Operasi lainnya Total A.500 200 600 12 300 100 5.307 1 1 50 50 Btg Btg Kg Kg 50 50 25 2 50 50 1.000 90 1. Beban zakat/pajak Proyeksi keuntungan 5% % 60 100 Kg Kg 2.826 QTY Unit Harga/unit (Rp’000) Total cost (Rp’000) Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.250 100 1. Analisis usaha inokulasi gaharu Waktu inokulasi Jumlah tegakan gaharu Proyeksi hasil : 3 tahun : 1 batang : 20 kg/batang (Kelas BC). 2006 50 .450 1 1 1 1 1 1 3 1 Btg Btg Set Btg Btg Btg Thn Btg 100 5. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Pengurusan surat-surat Umum lainnya Total Total beban operasi B. Proyeksi penghasilan Penjualan kelas BC Penjualan powder Total proyeksi penghasilan C.168 50 50 50 1 50 Kg Kg Kg Btg Kg 5 10 5 6 0.000 5 120.Aspek PRODUKSI Lampiran 1.5 250 500 250 6 25 1.000 90 1. Beban panen dan pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total A.500 200 600 36 300 7.1.025 104.500 6.031 10.000 500 120. D.2.

5 5 24.500 1.000 1.000 A+B C C..000 10 5 10 1 20.000 25.Pengembangan Gaharu di .000 5. Analisis usaha budidaya gaharu Waktu budidaya Luas lahan Populasi tegakan Rasio jumlah suntikan Jumlah lubang Proyeksi hasil panen per batang Exchange rate IDR : 7 tahun : 1 ha : 1.000 10.000 4.000/ha : 80 lubang/kg : 160/batang : 160/80 = 2 kg : 9.1..000 1.000 1.000 2.000 1.000 10.000 24. Uraian Biaya akuisisi lahan Pembelian lahan Perizinan/sertifikat/notariat Total QTY Unit 1 1 ha Surat* B.000 No A.000 2.000 1 1.000 1.000 4. C. Beban inokulasi Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga kerja Pemelihaaan/perawatan Operasi lainnya 51 .000 1.000 Total cost (Rp’000) 15. (Mucharromah) Lampiran 2.000 1.000 1.000 1 ha Btg Btg Btg Btg ha 1.. Biaya pra operasi (start-up cost) Sarana & prasarana TBM Rumah jaga Sarana penerangan (PLN) Sarana komunikasi Sarana lainnya Total 1 1 1 1 Total biaya (direkapitulasi) Beban operasi Penanaman pohon baru Land clearing Pembelian bibit Pembuatan lubang Penanaman pohon gaharu Pemupukan Perawatan dan pengamanan Total 1 1.000 Total Btg Set Btg Btg Btg Btg 20 3.000 19.2.000 1..000 3.000 5 1 0.000 1.000 Harga/ unit (Rp’000) 15.000 6.000 2.000 1.000 Unit Unit Unit 2.000 49.000 500 5.000 1.000 5.000 1.000 36.

000 34. Uraian Beban panen & pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total QTY Unit Harga/ unit (Rp’000) 5 5 10 2 Total cost (Rp’000) 5.000 71.3.000 200.000 2.5 10.500 D Proyeksi penghasilan Penjualan kelas C 2.000 Total proyeksi penghasilan 5% Proyeksi keuntungan E F Beban zakat /pajak Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.500 Kg % 2.000.000 3.000 2.000 Kg Kg Kg Kg 5 10 20 0.000 4.000 4.000 40.000 1.000 190.000.609.000 4.4.000 2.000 20.000 1.000 Btg Btg Kg Kg C.000 5.Aspek PRODUKSI No C. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Umum lainnya Total Total beban operasi 2.000 2.000 2.000 20. 2006 52 .000 1.

meskipun pengunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. incense. yaitu 27 spesies dari 8 genus dan 3 famili yang tersebar di Sumatera. dan Irian (Sumarna. pemanfaatan gaharu adalah untuk pengobatan.Kajian Kimia Gaharu . 2000). Produk ini dihasilkan beberapa spesies penghasil gaharu dalam famili Thymeleaceae. sebagai pengharum ruangan sembayang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. Kalimantan.. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti 53 .(Eka Novriyanti) 2 KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp. 2005). Gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut memiliki scent of God’.. Maluku. Pada prinsipnya... dan parfum (Barden et al.. mulai dari 300 ribu rupiah hingga 25 juta rupiah untuk kualitas double super.. Incense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagaman. PADA Aquilaria microcarpa Eka Novriyanti Balai Penelitian Hutan Penghasil Serat Kuok PENDAHULUAN Gaharu adalah komoditas hasil hutan non-kayu yang bernilai ekonomi tinggi dengan harga pasar bervariasi tergantung kualitasnya. Sementara itu. 2000). Indonesia yang merupakan salah satu pemasok gaharu terbesar memiliki kekayaan jenis penghasil gaharu tertinggi di dunia.

hepatitis. pengembangan senyawa-senyawa dalam gaharu dengan bio-teknologi.. Metabolit sekunder pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. Barden et al. Suhartono dan Mardiastuti. 1987). informasi jalur biosintetis gaharu itu sendiri sehingga mungkin dapat dibuat sintetis senyawa. ginjal. hal ini 54 . dan jaringan luka). 2007). asma. 2007). pengembangan pemanfaatan lain dengan terbukanya kemungkinan diidentifikasinya senyawa-senyawa baru dengan manfaat yang baru pula. dan bermanfaat untuk mengatasi berbagai panyakit seperti sakit gigi. cacar. maupun keadaan cekaman (Goodman et al. atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Commission GIFNFC. rematik. antar pohon dalam spesies yang sama. 2004). kanker. Adelina. juga memiliki sifat anti racun. stimulan kerja saraf dan pencernaan. dan lain-lain pengembangan yang masih sangat luas untuk dilakukan. 2000. 1987. liver. dalam Isnaini. anti mikrobia. 2007). diuretic. Namun begitu. obat kuat pada masa kehamilan dan bersalin. dan antar musim (Forestry Commission GIFNFC. Pohon gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. tumor. pangkal percabangan. Konsentrasi metabolit sekunder ini bervariasi antar spesies. rangsangan fisiologi.. 2002). diare. Metabolit sekunder atau zat ekstraktif tanaman dapat efektif dalam melawan hama dan agen penyakit karena analog dengan komponen vital tertentu dari sistem sinyal seluler. (Hayne. anti serangga. kayu teras. antar jaringan (konsentrasi tertinggi berada di kulit. 2004. akar. Arah pemanfaatan informasi kimia gaharu di antaranya adalah penyusunan standar produk berdasarkan komposisi kimia yang dikandungnya sehingga lebih seragam dalam praktek penentuan kualitas produk. malaria. antar spesies. Informasi mengenai bahan-bahan kimia yang terkandung dalam gaharu penting untuk pemanfaatan produk ini. Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. Gaharu adalah senyawa fitoaleksin yang merupakan metabolit sekunder dari pohon gaharu sebagai mekanisme pertahanannya. 2004).Aspek PRODUKSI inflamatory (Trupti et al.

microcarpa. Meskipun di awal inokulasi masing-masing isolat memperlihatkan kecepatan pembentukan infeksi yang berbeda sesuai virulensinya. Helium digunakan sebagai gas pembawa (carrier) (0.25 mm.(Eka Novriyanti) masih memerlukan pemikiran dan terus melakukan penelitianpenelitian lanjutan yang akan membuka satu demi satu kebenaran yang saat ini masih belum terungkap. daerah asal isolat tidak berpengaruh nyata terhadap luasan infeksi yang terjadi pada batang pohon penghasil gaharu ini..Kajian Kimia Gaharu . Analisis komponen kimia dilakukan untuk gaharu rekayasa hasil inokulasi isolat Fusarium sp. suhu injeksi 2800C.25 μm). Kalimantan Tengah Tamiang Layang... namun setelah sekian waktu ternyata pengaruhnya terhadap luasan infeksi menjadi tidak signifikan lagi. dan ditahan pada suhu ini hingga menit ke-60.. kemudian increased mencapai 2800C hingga 30 menit. Identifikasi senyawa dilakukan berdasarkan waktu retensi dan analisis MS. namun secara statistik. Tidak signifikannya pengaruh asal isolat terhadap luas infeksi diduga disebabkan karena isolat yang diinokulasikan sama-sama Fusarium sp.. Injeksi dilakukan dalam mode split. dioperasikan dengan electron impact (EI) mode pada 70 eV dan suhu ion source 2000C. asal Bahorok. dan Maluku. sedangkan analisis kimia dilakukan untuk sampel berumur ± 1 tahun. ANALISIS KIMIA GAHARU HASIL INOKULASI ISOLAT DARI BEBERAPA DAERAH ASAL Dalam tulisan ini. Mentawai. Gambar 1 menyajikan luasan infeksi Fusarium sp. 55 . yaitu isothermal 500C selama 5 menit. analisis kimia gaharu dilakukan dengan analisis GCMS pirolisis menggunakan aparatus Shimadzu GCMSQP2010. Kondisi kromatografi adalah sebagai berikut: suhu oven kolom 500C. pada batang A. ketebalan film 0. Meskipun secara deskriptif isolat asal Bahorok sepertinya menyebabkan infeksi yang paling besar. Pengukuran luasan infeksi dilakukan pada umur inokulasi 6 bulan. dan perlu dicatat tidak satupun isolat yang origin dari lokasi di mana penelitian dilakukan yaitu asal Carita.8 ml/min) yang dilengkapi dengan kolom kapiler DB-5 MS (60 mm x 0.

2005. dengan tanpa membedakan jarak suntik menunjukkan bahwa akumulasi konsentrasi relatif tertinggi untuk konstituen terkonfirmasi (Yagura et al. 2005.. 56 . kelompok A: konstituen gaharu yang sudah diidentifikasi pada pekerjaan beberapa peneliti sebelumnya 2. 2002.. namun analisis komponen kimia dari gaharu hasil rekayasa ini menunjukkan adanya perbedaan. 2009. Kelompok A pada Lampiran 1. Pojanagaroon dan Kaewrak. Konishi. Lampiran 1 dibagi menjadi 3 kelompok. yaitu: 1. Nor Azhah et al. Burfield. Panjang infeksi pada umur inokulasi 6 bulan di batang A. Kelompok B: senyawa berkarakter odorant namun merupakan hasil pirolisis komponen kayu seperti selulosa dan lignin 3. 2003. 2006. microcarpa dengan pembeda daerah asal isolat Meskipun secara luasan infeksi tidak menunjukkan pengaruh yang nyata. Kelompok C: senyawa yang belum dikonfirmasi merupakan konstituen gaharu namun memiliki karakter odorant. Lampiran 1 menyajikan komponen kimia hasil analisis py-GCMS terhadap sampel gaharu inokulasi umur satu tahun. Sampel yang dianalisi adalah sampel masing-masing dari titik-titik inokulasi dengan jarak suntik 5 cm dan 20 cm.Aspek PRODUKSI Gambar 1. Tamuli... 2005. Alkhathlan et al. Bhuiyan et al.

27%). konsentrasi relatif tertinggi justru dihasilkan oleh isolat asal Maluku (12. Bahorok (10.89%.47%). Mentawai (24.40%). Kelompok B pada Lampiran 1 merupakan kelompok senyawa berkarakter odorant yang merupakan hasil pirolisis selulosa dan lignin.Kajian Kimia Gaharu .. dan Mentawai (11.37%). dan terakhir Kalimantan Tengah Tamiang Layang (18. akumulasi konsentrasi relatif tertinggi dihasilkan oleh isolat asal Maluku (26.61%).96%). Bahorok (22.47%).14%).. Maluku. Namun kontribusi komponen-komponen berkarakter odorant tersebut terhadap wangi gaharu masih memerlukan observasi yang lebih dalam lagi. Keberadaan senyawasenyawa odorant hasil pirolisis komponen kayu ini kemungkinan memiliki peran pada kesatuan wangi yang dihasilkan incense gaharu yang dibakar. Untuk Kelompok C. Perbedaan konsentrasi ini kemungkinan sangat dipengaruhi oleh konsentrasi selulosa dan lignin dari bagian batang yang dijadikan sampel.. Kalimantan Tengah Tamiang Layang (12. diikuti Mentawai. Dengan kata lain. dan Mentawai (8. Untuk kelompok odorant yang merupakan pirolisis komponen kayu ini.31%). Pengaruh kontribusi senyawa dalam kelompok ini pada wangi gaharu memerlukan investigasi lebih lanjut.23%)..71%). maka keberadaan senyawa dalam kelompok B tidak bisa dikesampingkan walaupun bukan merupakan konstituen resin gaharu yang sebenarnya. diikuti masing-masing Maluku (10. isolat asal Kalimantan Tengah Tamiang Layang memberikan hasil gaharu artifisial yang relatif terbaik yang ditunjukan oleh relatif lebih besarnya infeksi yang terjadi dan akumulasi senyawa gaharu terkonfirmasi tertinggi. Bahorok. karena digunakan sebagai incense yang mengumbar wangi saat dibakar. Secara kuantitas maupun kualitas (komponen kimia terkonfirmasi). 57 . Pola urutan konsentrasi yang sama juga terjadi untuk total konsentrasi relatif komponen berkarakter odorant. diikuti Bahorok (12.(Eka Novriyanti) 2008) terjadi pada isolat asal Kalimantan Tengah Tamiang Layang sebesar 12. Ditampilkannya fakta tersebut karena penggunaan gaharu pada umumnya sebagai incense yang menghasilkan wangi hanya jika kayu yang mengandung resinnya dibakar. dan Kalimantan Tengah Tamiang Layang.

produk ini dibuat sintetisnya dengan menggunakan indole (Wikipedia Online. microcarpa yang memiliki karakterisitik odorant penting Komponen Ambrettolide Ambrox Keterangan Senyawa ini memiliki karakter wangi musk. Inc. Tabel 1.11%. 2008). Angka-angka ini tidak jauh berbeda karena diduga konsentrasi komponen kayu yang relatif sama pada pohon-pohon sampel yang relatif berumur sama dan tumbuh pada kondisi yang relatif sama. Valerolactone Ketoisophorone Maltol Indole Isolongifolen 58 . Komponen ini menyajikan wangi caramel dan digunakan untuk menghasilkan wangi yang manis pada fragrance. Senyawa ini pada konsentrasi rendah menyajikan wangi bunga dan merupakan konstituen dalam berbagai wangi bunga dan parfum. teh..Aspek PRODUKSI Untuk komponen gaharu terkonfirmasi (Kelompok A).11% untuk jarak suntik 5 cm dan 20 cm.. daun tembakau (The Good Scent Company. Indole merupakan konstituen utama dalam minyak melati dan karena minyak melati ini berharga mahal. dan. Untuk kelompok B. Isolongifolene merupakan bahan yang sangat berguna sebagai odorant dan minyak parfum (Bunke dan Schatkowski. 2008) Ambrox memiliki karakter odorant tipe amber dan juga merupakan anti-inflamatory yang potensial untuk bidang pengobatan (Castro et al. kecuali untuk isolat asal Kalimantan Tengah Tamiang Layang yang justru lebih tinggi akumulasi konsentrasinya pada jarak suntik 20 cm (Tabel 1). 1997). jarak suntik 5 cm dan 20 cm menghasilkan akumulasi konsentrasi relatif masing-masing sebesar 11.25% dan 10. Komponen dalam gaharu hasil inokulasi berbagai daerah asal isolat Fusarium sp. dihasilkan akumulasi masing-masing sebesar 12. manis buah. biasanya dimanfaatkan sebagai penguat rasa dan aroma (flavor enhancer) pada roti dan kue (Wikipedia Online. 2008). pada A. Secara umum untuk kelompok A. 2002). 2008). Senyawa ini memiliki wangi herbal yang dimanfaatkan dalam industri parfum dan pewangi (Wikipedia Online. dan bunga (International Flavor and Fragrance. Ketoisophorone mengumbar wangi manis campuran kayu. 2008). secara umum jarak suntik 5 cm menghasilkan akumulasi konsentrasi yang lebih tinggi.17% dan 12.

23%).(Eka Novriyanti) Komponen Limonene Keterangan Limonene merupakan terpen yang memiliki aroma bunga dan buah.96% untuk jarak suntik 20 cm dan 5 cm. 2008). yang ditunjukan oleh infeksi yang lebih kecil. Kajian lebih dalam lagi diperlukan untuk mengetahui perkembangan atau perubahan yang terjadi dengan semakin lamanya waktu inokulasi.. selain sebagai bahan kosmetik dan flavouring karena memberi wangi sitrus.. Cadinene Dumasin Benzylacetone Azulene Akumulasi total untuk komponen berkarakter odorant menunjukkan bahwa jarak suntik 20 cm (52. 59 . juga merupakan komponen volatil pada kokoa (Wikipedia Online.59%) yang menghasilkan konsentrasi relatif lebih tinggi dibandingkan jarak suntik 5 cm (50. 2008. Namun.. 1994. 2008). dengan spasi injeksi yang lebih kecil di mana infeksi terjadi lebih cepat dan lebih besar. Benzylacetone memiliki wangi manis bunga yang merupakan komponen atraktan yang melimpah pada bunga. Di pihak lain. Blake. Dengan besarnya spasi injeksi akan menyebabkan proses pembentukan senyawa yang terjadi berlangsung relatif lebih lambat. 2004). Limonen merupakan monoterpeneoid yang digunakan sebagai insektisida botani.81% dan 20. Pola yang sama juga terlihat untuk akumulasi konsentrasi relatif pada kelompok senyawa C.. Dikenal juga sebagai cyclopentanone yang memiliki wangi mint.. Senyawa ini muncul sebagai konstituen minyak esensial berbagai tanaman (Wikipedia Online. Merupakan material wewangian dan untuk pengobatan serta memiliki sifat pestisida (ChemYQ.Kajian Kimia Gaharu . Geraniol dan limonen juga dimanfaatkan dalam pengobatan herbal dan konstituen dalam berbagai tanaman obat (Wikipedia Online. ada kemungkinan proses sintesis terjadi lebih cepat dibandingkan jarak injeksi yang lebih besar sehingga dihasilkan senyawa-senyawa baru yang lain yang berkarakter odorant namun akumulasinya belum cukup tinggi saat observasi dilakukan. 2008. masing-masing 24. Mann et al. proses yang lambat ini kemungkinan memberi waktu dan kesempatan bagi senyawa tertentu untuk disintesis atau diakumulasikan hingga diperoleh konsentrasi yang relatif lebih tinggi. 2004). 2008). Azulene sangat sering ditemukan sebagai komponen dalam minyak esensial tanaman dalam family Asteraceae dan memiliki wangi dan warna biru pada minyak dan ekstraknya (LyndShiveley. The Good Scent Company.

metileugenol. 2008). 2008). Koeduka et al. 1999). 1999).. Dalam Hua (2001) disebutkan bahwa konsentrasi asetosiringon meningkat 10 kali lipat ketika suatu jaringan aktif tanaman dilukai. Asetosiringon merupakan bioaktif dalam interaksi tanamanmikroba yang mempercepat pendeteksian kehadiran patogen oleh tanaman di mana konsentrasi senyawa ini meningkat dalam tanaman seiring dengan meningkatnya konsentrasi mikroba (Baker et al. PubChem Compound. dan guaiakol merupakan intermediet dalam pembuatan eugenol dan vanilin (Li dan Rosazza. isoeugenol. dan isometileugenol merupakan empat senyawa fenilpropanoid dari 12 senyawa volatil yang diketahui menyebabkan wangi yang manis pada Clarkia breweri (Rhodes. derivat cyclopentane (Wikipedia Onlie. eugenol (Cowan. 2000). 2002. Fotouhi et al. Sedangkan koniferil alkohol merupakan intermediet dalam biosintetis eugenol dan isoeugenol (Cowan. 2008).. benzoic acid (NBCI.. dan elimicin (Rossi et al. 2006). 2004).. dumasin (ChemYQ.. Eugenol serta isoeugenol digunakan dalam produksi vanilin yang merupakan bahan penting dalam industri wewangian (Cowan. Senyawa asetosiringon juga tercatat pada semua gaharu hasil inokulasi kelima daerah asal isolat dalam penelitian ini.. Beberapa di antara komponen ini bahkan juga memiliki karakter wangi yang diketahui merupakan konstituen minyak esensial dan digunakan secara komersil dalam industri parfum dan pengharum seperti vanillin. Rhodes. 1999. 2008). syringal-dehyde (Pedroso et al.. 1986). Eugenol. di mana senyawa ini merupakan fenolik yang dihasilkan tanaman sebagai respon alami terhadap pelukaan (Sheikholeslam dan Weeks. 2008). 2007. Rho et al. 2008). 2007). 2008. senyawa 4H-pyran-4-one dan derivatnya (Abrishami et a. 60 .Aspek PRODUKSI Hasil analisis py-GCMS juga menunjukkan adanya senyawasenyawa yang pada beberapa hasil penelitian lain disebutkan sebagai senyawa pertahananan.

Senyawa ini digunakan untuk menghasilkan isoeugenol yang diperlukan untuk membuat vanilin yang juga merupakan bahan yang penting dalam obat-obatan dan industri parfum dan pengharum. yang juga digunakan sebagai antiseptik dan parasitisida (Li dan Rosazza. sedatif. 61 . ekspektoran. Adalah fenol terhidroksilasi yang bersifat toksik pada mikroorganisme. Eugenol dan isoeugenol diturunkan dari prekursor lignin. Merupakan dimetil eter dari pirokatekol. dan obat-obatan. Konstituen resveratrol yang diturunkan dari asam p-hidroksisinamat dan 3 unit malonat. Hasil inokulasi Fusarium sp. 1983. pada A. 1999). Kedua senyawa ini dan turunannya digunakan sebagai antiseptik.Kajian Kimia Gaharu .. Merupakan intermediet dalam pembuatan eugenol dan vanilin.. dan parasitisida (Wikipedia.. microcarpa ditemukan beberapa komponen senyawa yang sudah diidentifikasi merupakan konstituen gaharu dan beberapa senyawa lain yang memiliki karakter odorant dan secara komersil digunakan dalam industri perfumery dan flavoring. contohnya adalah yang terdapat pada Linum usitiltissimum (Sengbusch. pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masinng sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. 2008). Koniferil alkohol Guaiakol Katekol dan pirogalol Veratrol KESIMPULAN 1. 2. 2000). Eugenol digunakan dalam pembuatan parfum. 2008). Senyawa-senyawa yang berdasarkan beberapa referensi diketahui merupakan pertahanan pada tanaman tertentu dan terdeteksi pada gaharu hasil inokulasi Senyawa Eugenol Keterangan Bersifat bakteriostatik terhadap jamur dan bakteri (Cowan. 2008a). yaitu asam ferulat ataupun koniferil alkohol (Rhodes. 1999). Pada gaharu rekayasa hasil inokulasi Fusarium sp. minyak esensial. di mana daya racun akan semakin meningkat dengan semakin tingginya hidroksilasi (Cowan. p:144). Merupakan senyawa pertahanan tipe fitoaleksin yang termasuk dalam grup fenilpropanoid.(Eka Novriyanti) Tabel 2. Letak dan jumlah grup hidroksil pada grup fenol diduga berkaitan dengan daya racun relative-nya terhadap mikroorganisme. deodoran. memiliki sifat antimikrobial (Torssel..

Sustainable Agarwood Production in Aquilaria Trees. namun isolat asal Maluku menunjukkan konsentrasi yang relatif lebih tinggi untuk total senyawa dengan karakter odoran. gov/research/publications/publications. J. com/MedicinalPlantConstituents. Bunke. [21 Juni 2008]. R. A. 2002. R. N. F. Chang.pdf. Schatkowski. 2004. M. S. Heart of the Matter: Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. Secara umum. K. 2008. Husni. S. A. N. The Malaysian Journal of Analytical Sciences 12 (2): 338-340. Robert. Y. M.ars. inokulasi Fusarium sp. J. United State Patent. Barden.traffic. A. www. [2 Februari 2007]. Rice. daerah asal isolat menunjukkan perbedaan dalam konsentrasi senyawa-senyawa gaharu yang terbentuk. A. Azah. P. D.net. S. Majid. A. Comparison of Chemical Profiles of Selected Gaharu Oils from Peninsular Malayia. Mulliken. Shahrisa. Whitaker.. A. Said.. Mailina.3. http://www. Isolongifolanol Derivates. E. N. 2000. Stimulatory Effect of Acetosyringone on Plant/Pathogen Recognition. www. N. http://www. htm. T. A. Anak. L. Blanchette. J. A. J. Bayat. A. Averyanov. Y. 2004 Medicinal Plant Constituents. S. [22 Mei 2007]. asal Kalimantan Tengah menunjukkan konsentrasi senyawa konstituen gaharu terkonfirmasi yang lebih tinggi. D. Blake. 2006. M. their Production and their Use.org.therainforestproject. Y. B. D. Mock. C. Teimuri-Mofrad. Hasnida. C. N.com [31 Desember 2008]. naturalhealthwizards. Synthesis of Some Aldoxime Derivatives of 4H-Pyran-4-ones. Deahl. DAFTAR PUSTAKA Abrishami. Molecules 7: 239–244. [20 Juni 2008].usda. Yasmin. freepatentsonline. .. http://www. 1997. Baker. H. Meskipun secara statistik tidak memperlihatkan perbedaan yang signifikan terhadap luasan infeksi yang terbentuk setelah 6 bulan inokulasi. A. Song.

nsf/0/45BD7B214C6F661E8025699000 5D79C2 [31 Desember 2008]. http://www. CITES. 1987.. [14 Juli 2007]. Terjemahan dari: Nuttige Planten Van Indonesie. 2004. M. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. Thymelaceae.cites. Convention on International Trade in endangered Species of Wild Fauna and flora: Amendments to Appendices I and II of CITES.org.com/ En/xz/xz11 [3 April 2008]. J. hlm: 1467-1469. Salido. 1987. csl. Hayne. http://www.uk/review/extraction. Tetrahedron 58 (29): 5941-5949. 3: 721-726. 2002.iff. Ishihara. A. W. Tumbuhan Berguna Indonesia Jilid III. A. Three Sesquiterpenes from Agarwood. Uneyama.. Synthesis of Ambrox® from Labdanolic Acid. Chemicals from Trees. Berlin: SpringerVerlag. [2 Februari 2007]. International Flavor and Fragrance. www. Badan Litbang Kehutanan Jakarta. Cowan. Inc. Forestry Commission GIFNFC. M. Altarejos. Tsuneya. 2001. Food safety and Quality: Flavoruing Index. ChemYQ. K.org/ ag/agn/jecfa-flav/index. Fatehi. Sánchez. Clinical Microbiology Review 12 (4): 564-582.com/ Ingredients. 2008. 1991. Yayasan Sarana Wana Jaya.cropwatch. J. M.pdf.31 pm]. S. 2008. Succinaldehyde. M. T. Nogueras. Heartwood and Tree Exudates. Investigation of Electrooxidation Reaction of Some Tetrahydrobenzo[b]pyran Derivatives. Castro. M. Heravi. Sci. E. T. Plant Products as Antimicrobial Agents. http://www.cfm. S. Electrochem. 2005a. Hua. 1999. and K. M.gov. FAO. Dumasin. Int.chemyq.Burfield. Applied Microbiology 32: 278-281. J. Shiga. Agarwood Chemistry. 2007. Hills. 63 .html?showSynonyms=1 [ 1 November 2008: 2. Fotouhi. M. S. L. Phytochemistry 30 (2): 563566..fao. T. http://www. 2008.org/common/cop/13/raw / props/ID-Aguilaria-Gyrinops. http: // treechemicals.

Baiga. Korean Chem. Chang. Campos. 2007. Deschamps. Proc. T. S...actahort. S. Microbial Transformation of Terpenes.Aspek PRODUKSI Isnaini. E. A. Y. Applied and Environmental Microbiology 66 (2): 684-687. N. F. B. Lee. J. R. G. www.. Biocatalytic Synthesis of Vanillin. D. Kish. Barison. P. B. T. G. and P. W. C. Baek. Natl. 2000. Pojanagaroon. Aromaticplant project. H. Konoshima. H. 2004. Rosazza. Six New 2-(2-Phenylethyl)chromones from Agarwood.ncbi. Bogor. Koeduka. E. Rho. C. USA. Azulene and Chamomile. www. Acad. 50 (3): 419-422. Dudareva. NCBI PubChem. Steil. 2004. You. Chem. [22 Mei 2007]. S. Y. Jackson. New 5-Hydroxy-2-(hydroxymethyl)-4H-pyran-4one Derivative has Both Tyrosinase Inhibitory and Antioxidant Properties. Lab. Bull. A. Prema. Kiyosawa. 64 . Mechanical Methods to Stimulate Aloes Wood Formation in Aquiliria crassna Pierre ex H Lec (Kritsana) Trees. J. S. and I. S. Y. P. P. [1 Desember 2008]. M. W. K. Spassova. S.cgi?cid=243. Induksi Produksi Gubal Gaharu melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik (Disertasi). Lewis. Program Pascasarjana Institut Pertanian Bogor. F. ISHS Acta Hort 676. M. 2008. Konishi. Pichersky. D. E. A. 2006. of Pharmacognosy 18(1): 63-69. T.org. T. are Biosynthesized via Reduction of a Coniferyl Alcohol Ester. Shimada.. 2002. R. 2006. Lynd-Shiveley. M. gov/summary/ summary. Bull.nih. Sci. Eugenol and Isoeugenol. 28 (3): 471-473. Kaewrak. Noel. Kim. Pedroso. Santos. D. H. Orlova. C. Benzoic acid.nlm. N. Nat. S... 2008. Isolation of Syringaldehyde from Mikania laevigata Medicinal: Extract and its Influence on the Fatty Acid Profile of Mice. Pharm. Fridman. Brazilian Jour. D. [20 Juni 2008]. Gang. Vassão. T. M. http://pubchem. Biavatti. J. J. N. Bhattacharrya. India. I. Characteristic Aromatic Constituents of Spices.com. Li. S. Soc. Chem. Kim. J. 1962. L. A.

Kajian Kimia Gaharu .....(Eka Novriyanti)

Rhodes, D. 2008. Secondary Products Derived from Aromatic Amino Acids: Eugenol and Isoeugenol. www.hort.purdue.edu. [20 Juni 2008]. Rossi, P. G., L. Bao, A. Luciani, P. Panighi, J. M. Desjobert, J. Costa, J. Casanova, J. M. Bolla, and L. Berti. 2007. (E)-Methy-lisoeugenol and Elemicin: Antibacterial Components of Daucus carota L. Essential Oil Against Campylobacter jejuni. J. Agric. Food Chem. 55 (18): 7332-7336. Sengbusch, P. V. 2008. Phenolic Compounds. http://www.biologie. unihamburg. de/b-online/e20/20d.htm. [10 April 2008]. Sheikholeslam, S. N., D. P. Weeks. 1987. Acetosyringone Promotes High Efficiency Transformation of Arabidopsis thaliana Explants by Agrobacterium tumafacien. Plant Molecular Biology 8: 291198. Sumarna, Y. 2005. Budidaya Gaharu. Seri Agribusines. Penebar Swadaya. Jakarta. The Good Scent Company. 2008. Limonene; Ketoisophorone; Syringaldehyde, Tiglaldehyde. http://www.thegoodscents company.com/gca/gc1014951.html [20 Juni 2008]. Torssell, K. B. G. 1983. Natural Product Chemistry. John Wiley & Son Limited. Chichester, New Tork, brisbane, Toronto, Singapore. Trupti, C., P. Bhutada, K. Nandakumar, R. Somani, P. Miniyar, Y. Mundhada, S. Gore, K. Kain. 2007. Analgesik and Antiimflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. Pharmacologyonline 1: 288-298. Vidhyasekaran, P. 2000. Physiology of Disease Resistant in Plant. CRC Press Inc. Boca Raton, Florida. Verpoorte, R., R. van der Heijden, J. Memelink. 2000. General Strategies. In Verpoorte, R. and A. W. Alfermann (eds). Metabolic Engineering of Plant Secondary Metabolism. Kluwer Academic Publisher. Dordrecht, Boston, London. p: 31-50. Wikipedia Online. 2008. Pyrrolidine; Propargyl Alcohol; Ptalic Acid; Mesityl Oxide; Maltol; Indole; Glutanic Acid, Furanone; Elemicin; DABCO; Crotonic Acid; Cadinene; Butyric Acid; Benzylacetone; Caprylic Acid. http://en.wikipedia.org/wiki/. [1 juni 2008].

65

Aspek PRODUKSI

Yagura, T., N. Shibayama, M. Ito, F. Kiuchi, G. Honda. 2005. Three Novel Diepoxy Tetrahydrochromones from Agarwood Artificially Produced by Intentional Wounding. Tetrahedron Letters 46: 4395-4398. Yagura, T., M. Ito, F. Kiuchi, G. Honda, Y. Shimada. 2003. Four New 2-(2-Phenylethyl) Chromone Derivatives from Withered Wood of Aquilaria sinensis. Chem. Pharm. Bull. 51:560-564. Zaika, E. I., R. A. Perlow, E. Matz, S. Broyde, R. Gilboa. 2004. Sub-strate Discrimination by Formamidopyrimidine-DNA Glycosylase. The Jour. of Biol. Chem. 279 (6) issue 6: 4849-4861.

66

Kajian Kimia Gaharu .....(Eka Novriyanti)

Lampiran 1. Komponen dalam gaharu hasil inokulasi Fusarium sp. pada A. microcarpa
Konsentrasi Relatif (%) Nama senyawa 5 cm Bo 20 cm 5 cm Kt 20 cm Me 5 cm 20 cm Mu 5 cm 20 cm

A. Komponen aromatis yang sudah diidentifikasi sebagai konstituen gaharu 4-(2’-Methyl-3’-butenyl) azulene 2,5-DIMETHOXY-4ETHYLBENZALDEHYDE 2-Hydroxy-4methylbenzaldehyde 4-Ethoxy-3methoxybenzaldehyde 4-METHYL-2,5DIMETHOXYBENZALDEHYDE Benzaldehyde, 2,4-dihydroxy Benzaldehyde, 2,4-dimethoxy- (CAS) 2,4-Dimethoxybenzaldehyde Benzaldehyde, 3,4-dihydroxy- (CAS) 3,4-Dihydroxybenzaldehyde Benzaldehyde, 3-hydroxy- (CAS) m-Hydroxybenzaldehyde Benzaldehyde, 4,6-dimethoxy2,3-dimethyl- (CAS) 2,4-Dimethoxy-5,6-dimethyl Benzaldehyde, 4-[[4-(acetyloxy)-3,5dimethoxyphenyl]methoxy]3-methoxy Benzaldehyde, 4-hydroxy(CAS) p-Hydroxybenzaldehyde 1,2-benzenedicarboxylic acid, diisooctyl ester (CAS) Isooctyl phthalate 2-Butanone, 4-phenyl- (CAS) Benzylacetone 2-Butanone, 3,3-dimethyl(CAS) 3,3-Dimethyl-2butanone 0,09 0,09 4,35 0,42 0,06 0,08 0,08 2,37 0,30 0,49 3,66 0,08 0,06 0,21 1,52 0,22 0,07 4,65 0,10 1,45 0,09 4,42 0,11 4,60 0,25 -

-

-

0,32

0,29

0,26

-

0,24

0,28

-

0,37

-

-

0,39

-

-

0,29

-

-

0,36

-

-

-

-

-

-

-

0,37

-

-

0,54

0,48

-

-

0,07

-

0,12

0,43 -

0,23 -

0,44 -

-

0,24 -

0,04

-

0,41 0,04

-

0,53 -

0,05

-

67

Aspek PRODUKSI

Konsentrasi Relatif (%) Nama senyawa 5 cm 2-Butanone, 3-phenyl- (CAS) 4H-1-Benzopyran-4-one, 2-(3,4-dihydroxyphenyl)-7-(. beta.-D-glucopyranosyl) 4H-1-Benzopyran-4one, 2-methyl- (CAS) 2-Methylchromone 4H-1-Benzopyran-4-one, 5,7-dihydroxy-2-methyl- (CAS) 2-Methyl-5,7-dihydroxy 4H-1-Benzopyran-4-one, 6-dihydroxy-2-methyl- (CAS) 6-Hydroxy-2-methylchromone 2-Coumaranone .gamma.-Eudesmol Hexadecanoic acid, 2-(octadecyloxy)-, tetradecyl ester (CAS) TETRADECYL Hexadecanoic acid, methyl ester (CAS) Methyl palmitate 2,4-Hexadienedioic acid, 3,4-diethyl-, dimethyl ester, (Z,Z)- (CAS) CIS.CIS.D 2,4-Hexadienedioic acid, 3-methyl-4-propyl-, dimethyl ester, (Z,E)- (CAS) .alpha.-humulene 1-Naphthalenol, 1,2,3,4-tetrahydro- (CAS) 1-Tetralol 1-Ethynyl-3,4-dihydro-2naphthalenecarbadehyde Phenol, 2,6-dimethoxy- (CAS) 2,6-Dimethoxyphenol Phenol, 3,4-dimethoxy- (CAS) 3,4-dimethoxyphenol Benzenepropanoic acid, methyl ester (CAS) Methyl hydrocinnamate Bo 20 cm 5 cm Kt 20 cm 0,05 Me 5 cm 20 cm Mu 5 cm 0,15 20 cm -

-

-

-

0,18

-

-

-

-

-

0,06

-

0,36

-

-

0,34

-

-

-

-

0,46

-

-

-

-

-

0,04 -

-

-

-

-

0,28 -

0,03

-

-

-

-

0,69

-

0,05 0,85

-

-

0,12

-

0,16

-

0,09

0,17

-

-

-

-

-

-

0,11 0,07

-

-

2,94 0,25 -

0,08 3,37 0,33 -

2,74 0,33 -

3,67 0,40 0,25

3,11 0,24 -

3,05 0,42 -

4,22 0,40 -

2,83 0,22 -

68

20 0.2.56 0.2-Benzenediol (CAS) Pyrocathecol 1.14 0.87 0.59 8.65 - - 0.4.61 0.17 0. 1-hydroxy.19 0.04 3..25 0.58 13.67 6.31 - 1.60 4.89 9. anhydride (CAS) Propionic anhydride Propanoic acid.86 1.14 0.27 0.4. ethenyl ester (CAS) vinyl propionate CYCLOPENTANEPROPANOIC ACID. Komponen aromatis yang merupakan pyrolisis dari bagian kayu 4H-Pyran-4-one.(CAS) Acetovanillone 1.38 0.66 0.3.4A.95 6.5. 1-(4-hydroxy-3.62 10.96 B.2-benzenediol.84 0.(CAS) 5-hydroxy-2methyl-4H-pyran-4-one 2-Propanone. METHYL Benzenepropanoic acid (CAS) Phenylpropionic acid 3.99 0. 1-(acetyloxy)(CAS) Acetol acetate 2-Propanone.17 5.55 0.15 4.83 0.29 0.74 16.6.12 - 0.20 9.79 0. 3-methyl(CAS) 3-methylpyrocathecol 0.17 0.94 0.17 0.95 10.28 8.18 0.22 0.49 - 0.Kajian Kimia Gaharu .15 3.5dimethoxyphenyl).(CAS) Maltol 4H-Pyran-4-one.2DIMETHYL-.21 0.. 1-ACETYL-2.26 0.5.(CAS) Acetol Ethanone.66 2.19 0.12 0.58 0.28 5 cm Kt 20 cm 0.66 0. 5-Hydroxy2-methyl. ethyl ester (CAS) ETHYL 3-PROPARGYL Propanoic acid.8A-OCTAHYDRONAPHTHALENE Jumlah Rataan untuk kedua jarak suntik Bo 20 cm 0. 3-Hydroxy-2methyl.03 - - 0.28 69 .7.49 6.24 Me 5 cm 20 cm Mu 5 cm 20 cm 0.30 8.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm Propanoic acid.8-HEXAHYDRO-2HCHROMENE 1.49 2.27 0.20 0.44 - - 12.17 0.. 1-(4-hydroxy3-methoxyphenyl).20 1.66 0.30 12.02 - 0.57 0.46 1. 3-(2-propynyloxy)-.6.58 3.12 5.50 4.74 0.(CAS) Acetosyringone ACETOVANILLONE Ethanone..

06 0.43 1.13 0.71 1.35 11. methyl ester (CAS) METHYL 4-VINYLBENZOATE 2.(CAS) 6-ETHYL-.(CAS) Guaiacol Phenol. Komponen berkarakter odorant lainnya yang belum disebutkan sebagai konstituen gaharu Ascaridole 2H-Pyran-2-one.37 0.36 13. 6-ethyltetrahydro.07 - - - - - - 70 . 3-methoxy.14 - 0. 4-methyl.13 0.37 Bo 20 cm 1.VALEROLACTONE Oxacycloheptadec-8-en-2-one (CAS) Ambrettolide Oxacycloheptadecan-2-one (CAS) Dihydroambrettolide Benzoic acid.82 0.89 10. methyl ester (CAS) 3.07 14.82 0.18 0.36 0.57 2. 4-ethenyl-.69 0.28 Kt 20 cm 2.19 0.(CAS) m-Cresol Phenol.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 3-Methoxy-pyrocathecol 4-METHYL CATHECOL Phenol.24 0.54 12.90 0. 2-methyl.47 C. 2-methoxy.(CAS) p -Cresol Phenol.11 0.24 - 0.47 Mu 5 cm 1.57 0.4.18 12.34 11.63 20 cm 1. 4-ethyl-2-methoxy(CAS) p-Ethylguaiacol Phenol (CAS) Izal Jumlah Rataan untuk kedua jarak suntik 1.03 - 0.31 0.5-trimethoxy-.87 11. 2-methoxy-4-propyl(CAS) 5-PROPYL-GUAIACOL Phenol.35 1.11 1.40 5 cm 1.39 0.06 - - 0.14 0.18 0. 3. 4-(methylamino)Benzoic acid.05 0.(CAS) m-Guaiacol Phenol.40 20 cm 1.31 11.30 1.52 0. 3-methyl.23 Me 5 cm 1.12 0.18 1.23 0.50 0.64 - 0.16 - - 0.52 11.45 2.01 0.15 0.08 0.35 0.92 0.14 0.82 0.19 0.43 12.4.46 0.5-Trimethoxybenzoic Benzoic acid.(CAS) o-Cresol Phenol.39 13.64 - 0.DELTA.40 0.22 0.27 1.70 0.

5-dihydroxyphenyl)(CAS) Quinacetophenone Phenol.42 4.09 Me 5 cm 1.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm .30 0.(CAS) (E)isoeugenol Phenol.67 0.33 - - 0. dihydro-.23 20 cm 0. cisCholestane-3.99 - 4.71 0.beta.24 - 0.95 0.61 - 4.38 0.07 0.61 - - - - - - - 0..55 Mu 5 cm 1.04 - 0.33 - 6.Kajian Kimia Gaharu .22 - - 1.66 20 cm 2.).65 0.03 0.20 71 .(CAS) Eugenol 5-BUTYL-2-VALERYLFURAN 2(3H)-Furanone..beta.14 1..alpha.6..beta.7.(CAS) 2.98 Kt 20 cm 0.5-furandione. 3-acetyldihydro.32 1..45 1..-Cyclocitral Cyclopentanone.85 - - - - - 0.(CAS) 2-acetylbutyrolactone 0.66 5 cm 0.51 0.31 - 0.-bisabolene 2-Butanone (CAS) Mehtyl ethyl ketone Butyric acid.84 - 0.5.76 0.53 0. 1-(2.22 - 0.38 - 4.beta. 3-methyl(CAS) Citraconic anhydride Citronellyl acetate . (3.93 - 0.. 2-methoxy-4-(1propenyl).26 0.78 Bo 20 cm 0. dimethylhydrazone (CAS) Cyclopentanone dimethylhydrazone Cyclopropyl carbinol Cyclopentanone (CAS) Dumasin 1-Eicosanol (CAS) n-Eicosanol TRANS-ISOELEMICIN Ethanone.93 0.45 0. 2-methoxy-4-(1propenyl)-.98 1.(CAS) Isoeugenol Phenol. beta.93 - 3.17 1.7-triol. 2-methoxy-4-(2propenyl).12 - 0. m-nitrophenyl ester (CAS) m-Nitrophenyl butyrate Carveol. (E).70 0.20 - 4.25 1.28 1.6.

55 0.09 - - - - - - - 0.(CAS) 3-Methyl-2-heptanone Hexanoic acid.40 0.13 0.39 0.28 0.59 0. delta. 1-methylethyl ester (CAS) Isopropyl hexanoate 3-Hexenoic acid 1H-Indole (CAS) Indole 1H-Indole.71 0. acetate (CAS) 2-HEPTYL ACETATE 2-Heptanone.09 - 0.HEXALACTONE 3.36 0.5-Dihydrodecanoic acid.77 0. 5-hexyldihydro.60 0.93 - - 0. 2-methyl.54 0.66 - 0.31 0.21 0.65 0.65 - 0.(CAS) 2-methylindole 6-Nitro-5-hydroxy-1. 5-methyl(identity?) (CAS) 2-Penten-4olide 2(3H)-Furanone.02 - 72 .GAMMA.56 0.54 - 0.25 - - 0.31 - 0. tetrahydro(CAS) Tetrahydrofurfuryl alcohol 2-Heptanol.64 0.18 0.54 - 0.21 0.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 2(5H)-Furanone.70 - 0.14 0.5-dimethyl(CAS) 4.4-Dimethylbut-2enolide 2(5H)-Furanone.74 1.23 0.2dimethylindole Indolizine (CAS) Indolizin Ionol 2 3-pentanone CAS) Diethyl ketone 1-Penten-3-one (CAS) Ethyl vinyl ketone .09 Mu 5 cm 20 cm - - - - - - 0. 3-methyl.26 - 0.69 - 0.03 0.09 - 0.04 0. 5.18 Kt 20 cm Me 5 cm 20 cm 0.63 - 0.-lactone Muskolactone Bo 20 cm 5 cm 0.48 0.06 0.03 - 0.75 1.56 0.03 0.76 - 0.51 0.30 0.(CAS) 4-decanolide 2-Furancarboxaldehyde (CAS) Furfural 2-Furanmethanol (CAS) Furfuryl alcohol 2-Furanmethanol.35 - 0.11 - 0.98 0.38 0.

6.13 0.5-DIMETHOXY-PHENYL)PROPIONIC ACID 3-PHENYL-PROPIONIC ACID ISOPROPYL ESTER 2-PROPYNOIC ACID 9H-Purine. 4-hydroxy3.89 2. 4-ethyl.50 5..6-TRIDEUTERIO-OMENTHONE Benzene.04 0.(CAS) N-Acetyl-L-isoleucine 5.65 3.5-Norbornanediol (CAS) 2.21 Mu 5 cm 0.04 5 cm 0. 6-methyl-9(trimethylsilyl).01 0.3.58 73 .5-DIHYDROXYNORBORNANE Piperidine. N-acetyl.15 0.43 0.29 - 0.Kajian Kimia Gaharu .50 0.3-d3 (CAS) 2.(CAS) 4-methyl-4-nonanol 2.50 - 0.21 0.21 0.40 0.58 0.04 0. 4-methyl.17 - 0. 1-nitroso.52 0. 9-TRIMETHYLSILYL 1.13 0.3-Benzenediol.52 0..5-dimethoxy.48 2.86 - 0. 1-methoxy-4-methyl(CAS) p-methylanisole NEROLIDOL ISOMER 4-Nonanol.11 0.3-Benzenediol.(CAS) 4-Ethylresorcinol 1.19 Kt 20 cm 0.19 0.47 0.42 0. 1-(1-METHYLPENTYL)3-(2.34 - 0.93 - 0.20 0.15 - 0.57 3.70 0.7-dimethoxy-2-methylindan1-one Lineolone METHYL MALONIC ACID p-Menthane-2-one-1.(CAS) 6-METHYLPURINE.20 Me 5 cm 20 cm 0.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm L-isoleucine.57 0.(CAS) Syringaldehyde Bo 20 cm 0.(CAS) NITROSOPIPERIDINE PIPERIDINE.13 20 cm 0.45 3.22 0...56 - 0.89 0. 5-methyl(CAS) Orcinol Benzaldehyde.

(CAS) Zingerone Ethanone.52 Mu 5 cm 0.17 - 2.72 0.(CAS) 2-methoxymandelic acid Benzeneacetic acid.(CAS) Vanillin Benzeneacetic acid.32 - - - - - - - - 0.28 - 2.14 0.96 0.77 0.36 - 1.13 0.04 0.4-dimethoxy.12 0.55 0. 3.01 20 cm 0.5-DIMETHYL-3(2H) FURANONE 2-ETHYL-4-HYDROXY-5METHYL-3(2H)FURANONE 2-HYDROXY-5-METHYL-2(5H)FURANONE 3-HYDROXY-5-METHYL-2(5H)FURANONE 0.52 Me 5 cm 0.59 20 cm 0.11 0.alpha. 4-hydroxy-3-methoxy.40 5 cm 0.45 0.10 - 0.38 Bo 20 cm 0.13 - 1.61 0.50 Kt 20 cm 0.14 - 1.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm (E)-2-hydroxy-4’phenylstilbene 1-TRICOSENE Benzaldehyde.26 74 .3DIHYDROFURAN 2(3H)-Furanone.97 0.11 0.09 0.15 - 0. 4-(4-hydroxy3-methoxyphenyl). 4-hydroxy-3methoxy.12 0.(CAS) 6-HYDROXYCYCLO 2(5H)-FURANONE 2. 1-(2-furanyl).23 - - 0.06 - 0.70 - 1. .alpha.63 - - - - - 0.23 - 0. hexahydro3-methylene.(CAS) Homovanillic acid ISO-VELLERAL Benzenemethanol.20 0.4-dimethoxy(CAS) Vanillin methyl ether Benzaldehyde. 5-methyl(CAS) 5-Methyl-2-oxo-2.(CAS) Veratryl alcohol 2-Butanone.hydroxy-2-methoxy.02 - - - - - - - - 0.27 0.21 - - 0.45 - - - - - 0.Furanone 2(3H)-Furanone. 3.39 1.48 0.(CAS) 2-Acetyfuran 2-ACETYL FURAN 2(3H)-Furanone (CAS) .

.34 43.57 19.71 21.10 52. 1.83 43.33 50.32 37..01 44. Pedroso et al.65 46. Koeduka et al.33 0. Baker et al. Me = Mentawai.48 49.70 25. Lynd-Shiveley (2004).23 0. Abrishami et al. Kt = Kalimantan Tengah Tamiang Layang.6dimethoxyphenol 9H-Xanthen-9-one. Rho et al.06 Mu 5 cm 20 cm 1. (2004).Kajian Kimia Gaharu .6-dimethoxy-4-(2propenyl).30 - Me 5 cm 1.19 45.81 - 2. Zaika et al.93 22.56 Bo = Bahorok.05 3.29 26. (2008).95 2.65 5 cm - Kt 20 cm 1. Castro et al. ChemYQ (2008). 75 .18 0. (2005). (2007). (2008).(CAS) 6-O-METHYLXanthosine (CAS) Xanthine riboside Jumlah Rataan untuk kedua jarak suntik Total Rataan total untuk kedua jarak suntik Keterangan: Referensi: Bo 20 cm 1.37 25.33 26.13 0.3-dihydroxy-6-methoxy-8methyl. Hua et al. (2008). 2.30 45. Bunke & schatkowski (1997). Sheikholeslam & Weeks (1987).23 27. (2002).17 2.10 3. Mu = maluku FAO (2008).80 2.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm 5-HYDROXYMETHYLDIHYDRO-FURAN-2-ONE HYDROXY DIMETHYL FURANONE 2-(Acetyloxy)-1-[2-(acetyloxy02-(3-furanyl)ethyl]-5a[(acetyloxy)methyl]hexah 2-Methoxy-4-methylphenol Phenol. (2006).86 18. The Good Scent Company (2008).06 - - - 18. Wikipedia encyclopedia Online (2008).12 24. (2007).95 0. International flavor and fragrance.(CAS) 4-allyl-2.02 20 cm 1.. (2002). Valentines et al. (2001).62 0. Fotouhi et al.14 44.34 46.87 - 1. Inc (2008).06 2. (2004).. Azah et al.31 17.23 - - - - 0. Rossi et al.52 3.

76 .

Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu yang merupakan produk komersil bernilai ekonomis tinggi. kresna. karas. oudh. Dalam perdagangan internasional. jinkoh. perdagangan produk ini di Indonesia pertama kali tercatat pada abad ke-5 Masehi. aloeswood. dan masih banyak lagi nama lainnya. chip. serbuk. Sitepu. gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut sebagai ‘scent of God’. 77 . Saat ini. Maman Turjaman. dan minyak gaharu (Surata dan Widnyana. Bentuk perdagangan gaharu beragam. Sugeng Santosa. Irnayuli R. sebenarnya merupakan endapan resin yang terakumulasi pada jaringan kayu sebagai reaksi pohon terhadap pelukaan atau infeksi penyakit.3 TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso. di mana China dilaporkan sebagai pembeli utama. Najmulah. Gaharu telah diperdagangkan sejak ratusan tahun lalu. meskipun penggunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. 2001). Komoditas berbentuk minyak biasanya diperoleh dari penyulingan atau ekstraksi chip gaharu dari kelas yang bermutu rendah. Ragil Setio Budi Irianto. Ahmad Yani. komoditas ini dikenal dengan berbagai nama seperti agarwood. mulai dari bongkahan. Menurut Suhartono dan Mardiastuti (2002).

kanker. Penelitian-penelitian ini terutama didorong oleh berbagai hal seperti pasokan komersil untuk gaharu yang masih sangat tergantung dari produksi alam yang karena tingginya intensitas pemungutan produk ini telah menyebabkan tercantumnya genus utama tanaman penghasil gaharu. 2007) dan diketahui bermanfaat untuk mengatasi berbagai penyakit seperti sakit gigi. dan parfum (Barden et al. Untuk menghasilkan gaharu secara artifisial.Aspek PRODUKSI Pada prinsipnya. juga memiliki sifat anti racun. Proses pembentukan gaharu juga membutuhkan waktu yang lama. Selain itu. gula merah. 2002). 1987. pemanfaatan gaharu adalah untuk pengobatan. diare. dan yang lainnya dapat memicu pembentukan gaharu. 2004. Barden et al. ginjal. tidak semua tanaman penghasilnya mengandung gaharu yang hanya terpicu pembentukannya jika terjadi kondisi cekaman. liver. Adelina. 2000). asma. pelukaan mekanis pada batang. Lain halnya jika pembentukan gaharu dipicu oleh faktor biotik seperti jamur atau jasad renik lainnya. malaria. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti imflamatory (Trupti et al. pengaruh bahan-bahan kimia seperti metal jasmonat. Gyrinops dan Aquilaria dalam Appendix II CITES. Sementara itu. hepatitis. 2000). seperti yang telah disebutkan sebelumnya tidak menyebabkan terjadinya penyebaran mekanisme pembentukan ini ke bagian lain dari pohon yang tidak terkena efek langsung faktor abiotik tersebut. incense.. Terbentuknya gaharu pada tanaman penghasilnya. tumor. Suhartono dan Mardiastuti. stimulan kerja saraf dan pencernaan (Heyne. cacar.. anti mikrobia. 2000. mekanisme pembentukan dapat menyebar ke bagian lain pada pohon. di mana selama proses tersebut berlangsung dihasilkan variasi mutu dan pada akhir proses dapat diperoleh gaharu dengan mutu paling tinggi (Sumadiwangsa dan Harbagung. In-cense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagamaan. oli.. obat kuat pada masa kehamilan dan bersalin. karena 78 . sebagai pengharum ruangan. sembahyang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. Namun pembentukan gaharu oleh faktor abiotik.. diuretic. terpicu oleh faktor biotik maupun abiotik. rematik. Penelitian mengenai berbagai aspek yang terkait dengan gaharu sudah dilakukan sejak lama dan semakin berkembang dewasa ini. 2000).

microcarpa 79 .Teknologi Induksi Pohon . maka kualitas dan kuantitas produk gaharu yang dihasilkan akan lebih memuaskan. Kalimantan.. BAHAN DAN METODE A. NTB dan Sulawesi (Tabel 1). yaitu Potato Dekstrose Agar (PDA).. pada A. Isolat-isolat yang diamati No 1 2 3 4 5 6 7 8 9 10 11 Kode Ga 1 Ga 2 Ga 3 Ga 4 Ga 5 Ga 6 Ga 7 Ga 8 Ga 9 Ga 10 Ga 11 Asal lokasi Kalimantan Tengah Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Sumatera Barat Gorontalo No 12 13 14 15 16 17 18 19 20 21 Kode Ga 12 Ga 13 Ga 14 Ga 15 Ga 16 Ga 17 Ga 18 Ga 19 Ga 20 Ga 21 Asal lokasi Lampung Bengkulu Bogor Mentawai Kaltim LK Kalbar Yanlapa NTB Kalsel MIC Kalteng TL Media yang digunakan untuk menambahkan fungi. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Bogor.. Sumatera.(Erdy Santoso. dkk) penyebab mekanisme ini adalah mahluk yang melakukan semua aktivitas yang diperlukan untuk kehidupannya.. Bahan Bahan yang digunakan pada kegiatan ini adalah 21 isolat Fusarium spp. Dengan terjadinya penyebaran pembentukan gaharu ke jaringan lain pada batang pohon. Tabel 1. microcarpa pada kegiatan ini bahan berupa pohon A. diambil dari beberapa tanaman gaharu yang terdapat di Jawa. Isolat fungi tersebut diperoleh dari batang Aquilaria spp. Maluku. yang diinokulasi di Laboratorium Mikrobiologi Hutan. Batang Aquilaria spp. yang telah menunjukkan adanya pembentukan gaharu secara alami. Inokulasi jenis fungi Fusarium spp.

yang diamati adalah ukuran diameter koloni. Sediaan kultur diinkubasi selama tujuh hari. Pengeboran dilakukan 80 . dan lain-lain. semua peralatan yang digunakan disterilkan terlebih dahulu dengan alkohol 70% untuk menghindari adanya kontaminasi dari mikrobamikroba lain. Kalimantan Barat (12). diinkubasi dengan cara diletakkan pada ruang tertutup yang kelembabannya dijaga dengan cara memasukkan kapas yang telah dibasahi aquadesh steril. Identifikasi juga mengamati ciri makrokonidia. Masing-masing isolat diinokulasikan pada 3 ulangan. genset. microcarpa di Hutan Penelitian Carita. Untuk pengamatan morfologi dilakukan melalui mikroskop parameter. Jambi (13) dan Padang (14) serta campuran dari keempat isolat tersebut (15). C. mikrokonidia serta bentuk konidiofor. terdiri dari bor listrik. yaitu Fusarium spp. setelah itu koloni yang tumbuh pada gelas obyek diamati di bawah mikroskop setelah preparat diberi zat pewarna. Inokulasi Pohon contoh adalah A. Untuk fungi pembentuk gaharu asal Gorontalo. mata bor ukuran 3 mm. yang diamati adalah bentuk dan miselium.Aspek PRODUKSI umur 13 tahun. isolat diletakkan pada gelas obyek yang kemudian ditutup dengan cover glass preparat. Teknik Inokulasi 1. dan Padang (Sumatera Barat). Sebelum penginjeksian. Sediaan kultur dibuat dengan cara memindahkan potongan kecil isolat fungi menggunakan alat pelubang gabus berdiameter lima mm. Inokulasi dilakukan pada semua pohon contoh. kemudian diinokulasi pada suhu kamar dan diletakkan di ruangan inokulasi selama tujuh hari. diamati juga warna koloni dan keberadaan aerial miselium. Metode Untuk identifikasi masing-masing koloni ditumbuhkan pada media PDA dalam cawan petri. Jambi. Alat inokulasi. baik secara horizontal maupun vertikal. Kalbar. asal Gorontalo (II). Rancangan acak lengkap dengan perlakuan daerah asal isolat (I). B.

Lubang injeksi dibiarkan terbuka untuk memberi kondisi aerasi bagi mikroba yang diinokulasikan. HASIL DAN PEMBAHASAN A.. Pengamatan dan Pengambilan Contoh Gaharu Pengamatan infeksi dilakukan pada umur inokulasi 2 bulan dan 6 bulan dengan mengukur panjang infeksi vertikal dan horizontal yang terjadi pada permukaaan batang A.(Erdy Santoso. A Gambar 1. yang berasal dari berbagai daerah sangat 81 . yang Berasal dari Berbagai Daerah Karakter morfologi aerial miselium.. Keragaman Isolat Fusarium spp. Pengambilan data dilakukan secara acak pada beberapa titik injeksi inokulasi dan nilai panjang infeksi merupakan rata-rata dari panjang titiktitik infeksi tersebut dalam satu pohon. Pengeboran batang pohon contoh (A) dan injeksi isolat pada lubang bor (B) B 2.. warna koloni dan diameter koloni isolat Fusarium spp. dkk) dengan kedalaman mencapai 1/3 diameter batang dengan tujuan inokulum cair nantinya mencapai kambium dan bagian floem kayu. cair selanjutnya diinjeksikan sebanyak 1 ml untuk setiap lubang bor di batang pohon.. Inokulum Fusarium spp. 1. Keragaman Morfologi Isolat Fusarium spp. microcarpa.Teknologi Induksi Pohon .

coklat muda Putih Putih kecoklatan Putih tulang. Tabel 2.++ Ada.++ Ada.++ Ada.++ Warna Medium PDA Putih. kuning muda Putih. Keberadaan Aerial Miselium 82 .++ Tidak ada Ada. coklat muda Coklat muda Putih Putih Putih Putih krem Putih Putih krem.++ Ada. Keragaman morfologi Fusarium spp.++ Ada.+++ Ada.+++ Ada.++ Ada. putih Putih.+++ Ada.+++ Ada. kuning muda Putih. Keragaman karakter morfologi Fusarium spp. disebabkan oleh perbedaan asal isolat. merah muda Putih Putih Coklet. kuning. yang berasal dari berbagai daerah Kode isolat Karakter morfologi Asal lokasi Diameter koloni mm/7 hari Kalteng Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Padang Gorontalo Lampung Bangka Bogor Mentawai Kaltim LK Kalbar Yanlapa Mataram Kalsel MIC Kaltel TL 61 49 48 50 45 38 59 49 59 61 58 58 59 61 56 57 59 58 52 50 69 Aerial Miselium Ada. Koloni pada 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 Kelimpahan relatif aerial miselium: + Sedikit.+ Ada.+++ Ada. ++ Cukup banyak. Tabel 2.+ Ada. unggu Putih krem Putih.+ Ada.Aspek PRODUKSI beragam (Tabel 2). krem No. kuning muda Putih Putih.+++ Ada.++ Ada.+++ Ada. +++ Banyak a.++ Ada.

Ga-10. 2006). Ga-11. Ga-5. maka perbedaan kelimpahan aerial miselium adalah disebabkan oleh karakter masing-masing isolat. dan Ga17 memiliki kelimpahan aerial miselium relatif banyak (Tabel 2). putih krem (Ga-7. Ga8. Namun. b. Gambar 3. Ga-10. Ditemukan juga isolat yang memiliki warna koloni yang sangat berbeda dengan isolat lain. memiliki aerial miselium. Aerial miselium yang terbentuk dengan kelimpahan relatif banyak merupakan mekanisme fototropi terhadap kehadiran cahaya (Irawati. Ga-6. yaitu warna hifa miselium didominasi 83 . cokelat muda (Ga-2).. Isolat Ga-1. Hasil yang diperoleh menunjukkan bahwa warna koloni putih terdapat pada isolat Ga-4. Ga-9. 2004). Ga-14. Warna Koloni Selain aerial miselium.Karakter aerial miselium terdapat hampir pada setiap isolat Fusarium spp. karena pada penelitian semua isolat yang diuji mendapat perlakuan cahaya yang sama. Isolat Ga-10 dan Ga11 memiliki warna koloni putih dan warna cokelat muda (peach). sedangkan isolat Ga-3. namun terdapat perbedaan antar isolat jika dilihat berdasarkan kerlimpahan relatif aerial miseliumnya. beberapa isolat memiliki warna putih dan warna kuning muda pada isolat Ga-1. Selain warna putih. adalah warna koloni. dan Ga-19 (Gambar 2. Ga-6. dan Ga-20 memiliki warna koloni putih dan kuning muda. Ga-17. dan Ga-16 merupakan isolat dengan kelimpahan aerial miselium sedikit. Ga-13. Isolat yang tidak memiliki aerial miselium dijumpai pada Ga-15 asal Mentawai. Ga-19. Ga-13. Walaupun sebagian besar isolat Fusarium spp. dan Gambar 4). Ga-12. Isolat ga-17 dan Ga-21 memiliki kemiripan warna koloni dengan isolat Fusarium yang berasal dari Riau yang telah teridentifikasi dan merupakan spesies Fusarium solani (Luciasih et al. dan Ga-21). Irawati (2004) melaporkan bahwa secara umum cendawan yang ditumbuhkan pada kondisi terang secara terus-menerus akan membentuk aerial miselium relatif lebih banyak. Fusarium solani merupakan spesies yang kosmopolit dengan ciri khas kelimpahan mikrokonidianya elips. keragaman morfologi isolat Fusarium spp. Isolat Ga-18.

Diameter koloni merupakan veriebel yang berhubungan erat dengan kecepatan tumbuh. Ga-10. dan Ga-20). Cendawan yang tidak berpigmen umumnya berwarna hialin. Gambar 3. Ga-13. percabangan konidiofor. berkisar antara 30-69 mm. Gambar 2. 2. dan Ga-21.Aspek PRODUKSI oleh warna ungu namun memiliki warna koloni putih sedikit tipis pada aerial miselium yang terletak pada bagian tepi koloni (Gambar 3). Ga-19. berhubungan dengan kecepatan tumbuh hifa. bentuk. Ga-17. Ga-5. Ga-20. Untuk mengetahui kemampuan virulensi. Namun. Keragaman Mikro dan Makrokonidia serta Konidiofor Isolat Fusarium spp. Ga-5. c. dan isolat dengan diameter lebih dari 50 mm (isolat Ga-1. Semua isolat yang diuji dapat diklasifikasikan menjadi tiga kelompok. isolat dengan diameter antara 40-50 mm (isolat Ga-2. Jumlah septa makrokonidia dominan berjumlah 2-3 yang dimiliki oleh isolat Ga-1. Ga-18. Ga-14. Ga-9. Ga-4. Ga-18. Ga-6. Ga-11. Keragaman yang terdapat pada warna koloni berhubungan dengan pigmen yang dikandung oleh dinding sel hifa. Ga-3. yaitu diameter kurang dari 40 mm (isolat Ga-6). Selain itu. Ga-15. Ga-8. diperoleh adanya hubungan yang erat antara kecepatan tumbuh hifa dengan kehadiran aerial miselium. dan Ga-21) (Tabel 2. Diameter Koloni Diameter koloni Fusarium spp. Ga-7. Ga-3. Ga-16. Pada beberapa isolat Fusarium. Keragaman diameter koloni Fusarium spp. Kecepatan tumbuh yang tinggi dapat berhubungan juga dengan kemampuan virulensi. Ga-12. misalnya terhadap inangnya. maka isolat perlu diuji. kecepatan tumbuh merupakan karakter yang khas pada setiap isolat. Ga-7. Fusarium spp. memiliki keragaman pada karakter morfologi juga tampak adanya keragaman karakter mikrokonidia dan makrokonidia dari isolat yang diuji. Ga-8. dan Gambar 4). dan kelimpahan mikrokonidia. Ga10. Hasil pengamatan menunjukkan bahwa keragaman terlihat pada karakter jumlah septa makrokonidia. dari ke-10 isolat tersebut terdapat perbedaan pada 84 .

Ga-10.. 85 . Ga-4. Isolat dengan konidiofor bercabang adalah Ga-18 dan Ga-21. dan Ga16) umur tujuh hari pada medium PDA. Ga-15. Ga-8. Ga-5. Ga-6. dkk) percabangan konidifornya. Ga-12. dan Ga-8) umur tujuh hari pada medium PDA Gambar 3. Ga-7. Keragaman morfologi Fusarium spp.Teknologi Induksi Pohon ..(Erdy Santoso. Sedangkan isolat Ga-1. Gambar 2. (isolat Ga-1. Ga-14. dan Ga-10 memiliki konidiofor sederhana (Tabel 3). Ga-13.. Ga-3. Ga-5. (isolat Ga-9. Ga-2. Ga-11. GA-7. Keragaman morfologi Fusarium spp.. Ga-3. Ga-6.

oval Elips Elips. oval Elips Elips. Keragaman morfologi Fusarium spp. sekat Elips. Ga-3. Ga-18. dan Ga-21) umur tujuh hari pada medium PDA Tabel 3. lonjong Elips. sekat 3 Elips Elips Elips Elips. oval Elips. Ga-20.Aspek PRODUKSI Gambar 4. dan Ga-15 memiliki jumlah septa empat. namun dari ke-3 isolat tersebut dapat dibedakan berdasarkan 86 . sekat Elips Elips Elips Elips Elips Elips. Ga-19. oval Elips. oval Elips Isolat Ga-2. Keragaman karakter makrokonidia Fusarium spp. (isolat Ga-17. yang berasal dari berbagai daerah Karakter histologi No Kode Makrokonidia Jumlah septa 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 3 4 3 4-7 2 3 2 2 5 3 4 5 4 7 4 7 5 3 4 2 3 Konidiofor Simpel Bercabang Simpel Simpel Simpel Simpel Simpel Simpel Simpel Simpel Bercabang Simpel Simpel Simpel Bercabang Simpel Bercabang Bercabang Simpel Bercabang Bercabang Mikrokonidia Kelimpahan Banyak Banyak Banyak Banyak Sedikit Sedikit Sedikit Sedikit Sedikit Banyak Banyak Banyak Sedikit Sedikit Banyak Sedikit Sedikit Banyak Banyak Sedikit Banyak Bentuk Elips Elips.

. Di antara ketiga spesies tersebut F. bentuk mikrokonidianya elips dan oval. Isolat Ga-12 memiliki ukuran relatif lebih besar pada makrokonidianya apabila dibandingkan dengan Ga-14 (Gambar 5 dan Gambar 6). tricinctum berdasarkan karakter bentuk makrokonidianya. Isolat Ga-14 berbeda dengan isolat Ga-16 karena pada isolat Ga-16 mikrokonidianya bersekat (Gambar 7). Isolat Ga-2 memiliki konidifor bercabang. dkk) percabangan konidifor dan bentuk mikrokonidianya. yaitu isolat Ga-12 dan Ga-14 memiliki kemiripan pada bentuk konidiofor dan bentuk mikrokonidia.. Isolat Ga-12.. Ga-3. Fusarium solani berbeda dengan F. dan Ga-5). namun Booth (1971) membedakan Cylindrocarpon karena karakter pangkal konidianya yang relatif tumpul dan tidak memiliki hock/foot cell yang jelas seperti pada Fusarium spp. Ga-6. (2006) melaporkan bahwa keragaman antar Fusarium spp.. F. Ga-7. sambunicum (isolat Ga-1). solani dibedakan dari F. dan Ga-16 merupakan isolat yang memiliki jumlah septa makrokonidia relatif banyak. Luciasih et al.Teknologi Induksi Pohon . solani dengan mikrokonidianya berbentuk elips. juga bentuk mikrokonidianya relatif lebih besar untuk F.. Sedangkan F. Genus Fusarium memiliki kemiripan dengan Cylindrocarpon pada karakter morfologi. Ga-14. yaitu berbentuk bulan sabit (fusoid) sehingga memungkinkan dapat dengan mudah dibedakan dengan genus lain yang memiliki ciri mirip Fusarium. dan F. Mikrokonidia pada berbagai Fusarium memiliki bentuk yang khas. Spesies tersebut merupakan F. Ga-8. Isolat Ga-13 memiliki bentuk konidifor simpel dan Ga-15 bentuk konidifornya bercabang. solani keberadaannya paling dominan sehingga perlu mendapat perhatian khusus. namun kedua isolat tersebut berbeda pada tipe makrokonidianya. beberapa isolat telah teridentifikasi sampai pada tingkat spesies. yaitu berkisar 5-7 (Tabel 3). tricinctum (isolat Ga-2. antara lain berdasarkan karakter kelimpahan dan bentuk mikrokonidianya. dari 21 isolat Fusarium spp. dan Ga9).(Erdy Santoso. Dua dari tiga isolat tersebut. solani (isolat Ga-4. sambunicum. Cowan (1999) menerangkan bahwa tanaman memiliki kemampuan yang tidak terbatas dalam mensintesis substansi 87 .

dan Ga-18) dengan perbesaran 40x 88 .Aspek PRODUKSI aromatis yang kebanyakan merupakan senyawa fenol atau turunan oksigen-tersubstitusinya. Ga-14. Ga-5. Ga-15. Ga-20. (isolat Ga-1. GA-10. serangga ataupun herbivora. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. Gambar 5. (isolat Ga-4. Ga8. Ga-11. Ga-17.2. Pada umumnya senyawa-senyawa tersebut merupakan metabolit sekunder yang seringkali berperan dalam mekanisme pertahanan tanaman terhadap serangan mikroorganisme. Ga-9. Ga12. Ga. dan Ga-21) dengan perbesaran 40x Gambar 6. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. GA-7.

fitoaleksin sebagai agen anti mikrobial (sesqui-. 2000).. Berdasarkan berbagai fungsi tersebut. kadangkala terpicu pengaktifannya saat pelukaan. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. di mana senyawa yang telah ada secara enzimatis dirubah menjadi senyawa aktif ketika pelukaan. dalam Isnaini. Pohon penghasil gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini.Teknologi Induksi Pohon . Ga-16. dkk) Gambar 7. ekspresi dari jalur biosintesis yang terlibat akan berbeda.. biosintesis sesquiterpena tertentu pada solanaceae terpicu oleh infeksi mikroba. sedangkan pada tanaman lain biosintesis sesquiterpenoid 89 . baik fitoantisipin maupun fitoaleksin. rangsangan fisiologi maupun keadaan cekaman (Goodman et al. Terdapat jalur biosintesis yang terpicu pada level gen setelah pelukaan atau infeksi dan ada yang terjadi pada level senyawa. Sebagai contoh.. Metabolit sekunder tanaman yang diturunkan dari terpenoid memiliki berbagai fungsi dalam tanaman. Ga-6. Ga-13. memainkan peranan penting (Verpoorte et al. 2004). Fitoantisipin adalah senyawa aktif anti mikrobial yang telah terdapat pada tanaman. 2000.. di-. Biosintesis keduanya terpicu pada level gen (Verpoorte et al. di antaranya sebagai minyak esensial (monoterpenoid). 2000)... Metabolit sekunder dalam sistem pertahanan tanaman. Fitoaleksin adalah senyawa aktif anti mikrobial yang diproduksi secara de novo setelah pelukaan atau infeksi. atraktan serangga. dan triterpena). Kayu beresin ini merupakan metabolit sekunder yang dibentuk tanaman sebagai respon pertahanan. (isolat Ga-3. Vidhyasekaran. 2004). Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. dan Ga-19) dengan per-besaran 40x Gaharu merupakan senyawa fitoaleksin dari pohon gaharu sebagai mekanisme pertahanannya terhadap infeksi patogen.(Erdy Santoso.

pangkal percabangan. memberi bau. Rowell (1984) menyatakan bahwa di antara fungsi zat ekstratif adalah sebagai bagian dari mekanisme sistem pertahanan pohon terhadap serangan mikroorganisme. 2007). Metabolit sekunder pada kayu dapat disebut sebagai zat ekstratif. dan jaringan luka). karena analog dengan komponen vital tertentu dari sistem sinyal seluler atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Comission GIFNFC. 1987). B. sehingga dihasilkan produk gaharu yang diinginkan. Konsentrasi metabolit sekunder bervariasi antar spesies. Gaharu sendiri telah diidentifikasi sebagai sesquiterpenoid. Jenis-jenis tropis dan sub-tropis umumnya mengandung jumlah ekstratif yang lebih banyak dibanding jenis-jenis di daerah temperet (Forestry Comission GIFNFC. anthraquinone biasa ditemukan di seluruh bagian tanaman (Verpoorte. antar jaringan (konsentrasi tertinggi berada di kulit. Daya tahan pohon akan menentukan pemenang antara pohon dengan penyakit yang disebabkan mikro-organisme tersebut. pohon penghasil gaharu akan memberi respon untuk mempertahankan dan memulihkan dirinya. misalnya pada Morinda citrifolia. Dalam hal pembentukan gaharu tentunya diharapkan penyakitlah yang akan menang. antar spesies. senyawa pertahanan tipe fitoaleksin. Zat ekstratif pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. Kerentanan pohon dalam menghadapi infeksi jamur akan berkaitan dengan 90 . akar. Metabolit sekunder tanaman efektif dalam melawan hama dan agen penyakit. kayu teras.Aspek PRODUKSI merupakan ekspresi pembentukan yang umum. antar pohon dalam spesies yang sama. 2007). dan antar musim. Senyawa kimia yang dimiliki pohon merupakan salah satu upaya pertahanan pohon terhadap mikroorganisme penyebab penyakit. 2000). Zat ekstratif yang terdiri dari bermacam-macam bahan ini memilki fungsi yang penting dalam daya tahan terhadap serangan jamur dan serangga. rasa. Analisis Infeksi Batang Dalam kondisi menghadapi infeksi oleh jamur. dan warna pada kayu.

dapat direfleksikan masing-masing oleh besar infeksi dan komponen kimianya. diikuti oleh isolat campuran (Tabel 4). dkk) gaharu yang terbentuk. Kalbar.133a terlihat bahwa infeksi tertinggi masih Keterangan: Nilai yang diikuti oleh huruf yang disebabkan oleh isolat asal Gorontalo sama tidak berbeda nya-ta pada 0.193a inokulasi 2 bulan.. isolat campuran menyebabkan infeksi yang lebih tinggi dibandingkan Asal isolat Rataan isolat yang lain (Gambar 8). Dari hasil analisis sidik ragam. secara statistik asal isolat tidak 1. microcarpa. pada umur inokulasi 6 umur inokulasi bulan. Padang. Namun sama Padang 2.223a terhadap infeksi yang terbentuk pada Kalimantan Barat batang A. Pada Gambar 8 terlihat panjang infeksi yang terjadi pada batang pohon A. Hasil uji lanjut Duncan memastikan bahwa pada dua bulan sejak inokulasi. 91 .(Erdy Santoso. Pada saat (Isolate origin) (Mean value) ini.13 cm diikuti oleh isolat campuran.Teknologi Induksi Pohon . Pada umur inokulasi 2 bulan isolat Fusarium spp. asal Gorontalo memperlihatkan nilai infeksi yang paling besar. isolat asal Gorontalo menyebabkan infeksi yang paling besar pada batang pohon penghasil gaharu. Berbeda dengan kondisi pada Tabel 4. Uji lanjut Duncan untuk infeksi 2 bulan umur 2 bulan. dan yang terendah adalah infeksi yang terbentuk oleh isolat asal Jambi.857a lagi memberikan pengaruh nyata Jambi 2.. terlihat bahwa asal isolat berpengaruh nyata terhadap panjang infeksi yang terjadi pada batang A. microcarpa pada umur inokulasi 2 bulan dan 6 bulan.05 dan campuran. microcarpa.297a halnya dengan kondisi pada umur Campuran 3. dari Gambar 8 Gorontalo 4. yaitu 4...

asal daerah isolat tidak memberikan pengaruh nyata pada laju infeksi yang terjadi (nilai signifikansi 0.186 pada 5%). dari Gambar 8 Aspek PRODUKSI terlihat bahwa infeksi tertinggi masih disebabkan oleh isolat asal Gorontalo dan campuran. sedangkan infeksi oleh keempat asal isolat yang 71 | lain menunjukkan peningkatan yang beragam. tetapitidak mengalami perkembangan. Gambar 9 menunjukkan perubahan panjang infeksi yang Gambar 9. microcarpa 92 . microcarpa Gambar sejak dua bulan inokulasi hingga bulan keenam. Panjang infeksi batang A. tetapi infeksi bulan keenam oleh isolat asal Gorontalo terlihat infeksi merupakan isolat yang menyebabkan infeksi terbesar. Gorontalo terlihat tidak mengalami bulan keenam oleh isolat asal sedangkan infeksi oleh keempat asal perkembangan. mita pada 0. Namun begitu. Meskipun terjadi 9 menunjukkan perubahan panjang infeksi yang terjadi sejak masihbulan inokulasi hingga bulan keenam. Panjang infeksi batang A. secara statistik untuk bulan keenam inokulasi.05 crocarpa. Namun sama halnya dengan kondisi pada umur inokulasi 2 bulan. Laju infeksi pada batang A. Meskipun masih dua merupakan isolat yang menyebabkan infeksi terbesar. microcarpa Gambar 8.bentuk pada batang A. huruf yang sama tidak berbeda nya- Gambar 8.

Hampir semua isolat memiliki aerial miselium. dkk) Perkembangan infeksi yang terjadi hingga 6 bulan setelah inokulasi menunjukkan asal daerah isolat tidak lagi memberikan pengaruh yang nyata. KESIMPULAN 1. Meskipun tetap menyebabkan infeksi yang besar. Meskipun isolat campuran menunjukkan panjang infeksi yang lebih tinggi saat 6 bulan setelah inokulasi. jadi sebaiknya isolat ini digunakan untuk inokulasi 93 . pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masing sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. namun terdapat warna koloni merah muda. 3. 4. Hal ini diduga ada kaitannya dengan pertahanan masing-masing pohon contoh.(Erdy Santoso. kuning. memiliki karakter makrokonidia bersepta 3-4 dan makrokonidia didominasi oleh bentuk elips. Secara morfologi isolat Fusarium spp. Ga-11. namun ada kemungkinan hal ini masih merupakan pengaruh dari isolat asal Gorontalo tersebut.. meskipun yang terbesar masih disebabkan oleh isolat campuran dan isolat asal Gorontalo.. Dari perkembangan infeksi pada pohon A. Isolat Fusarium spp.Teknologi Induksi Pohon ... kekonsistenan perkembangan infeksi sebaiknya diteliti lebih lanjut dengan mengikuti perkembangan laju infeksi oleh isolat asal Gorontalo ini hingga kurun waktu tertentu. didominasi warna putih. asal Gorontalo menyebabkan infeksi yang paling besar. Hasil inokulasi Fusarium spp. 2. dan ungu. microcarpa ini dapat dikatakan bahwa isolat asal Gorontalo menyebabkan infeksi yang terbesar. dan Ga-17 merupakan isolat yang memiliki kecepatan tumbuh tinggi apabila dibandingkan dengan isolat Fusarium yang lain. Uji perbedaan kecepatan tumbuh menunjukkan bahwa isolat Ga9. Secara histologi isolat Fusarium spp. yang berarti isolat ini menghasilkan kuantitas gaharu yang paling besar.

C. Wahyuno. Isnaini. M. (England : Commonwealth Mycological Institute). The Chemistry of Solid Wood. Forest and Landscape Denmark. A. pp. Rowell. Washington : American Chemical Society.cfm.A.12 (4) : 564-582. pp. [14 Juli 2007]. M. Disertasi). Clinical microbiology Review. dan E. 2006. [2 Februari 2007]. 2004. Plant Products as Antimicrobial Agents. E. D. Cowan. A. Hua SST. Berlin : SpringerVerlag.uk/review/extraction. 2001. (1987).kvl.. gov. Applied Microbiology 32 : 278-281. Tumbuhan Berguna Indonesia. pp. microcarpa jika diinginkan hasil gaharu dalam jumlah besar. Rm. www.SL. Magelang. Tesis. Badan Litbang Kehutanan. Jakarta. pp. 2. and S. Forestry Commission GIFNFC. 94 . Chemicals from Trees. Bogor. Barden. Jurnal Penelitian Hutan dan Konservasi Alam III(5):555-564. 1984. csl. http: // treechemicals. Program Pascasarjana Institut Pertanian Bogor. Karakterisasi Mikoriza Rhizocstonia dari Perakaran Tanaman Vanili Sehat. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. Irawati. 2004. Jilid III. Bogor Luciasih. TRAFFIC Network. Induksi Produksi Gubal Gaharu Melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik. N. Hills. W. Pusat Litbang Hutan dan Konservasi Alam. Michael (2000). 1999. A. K. DAFTAR PUSTAKA Adelina. Keanekaragaman Jenis Jamur yang Potensial dalam Pembentukan Gaharu dari Batang Aquilaria spp. Seed Leaflet : Aquilaria malaccensis Lamk. Heartwood and Tree Exudates. 2004. Y. Booth. (1971). Heart of The Matter Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. Heyne.. Nooranie. The Genus Cylondrocarpon.Aspek PRODUKSI pada A. Teresia. Santoso. 1987. 120-127. 2007. 267-269. 6-7.dk.

2000... dkk) Soehartono. 2000. p : 1-30. General Strategies. Somani. R. Balai Penelitian Kehutanan Kupang. Info Hasil Hutan 6 (1) : 1-16. Verpoorte. Florida. T. Surata. Kluwer Academic Publisher. A. and Alfermann. Nagao Natural Environment Foundation. K. p : 31-50. 2001.. R. In : Verpoorte. In Verpoorte. Miniyar.(Erdy Santoso.. Dordrecht.. Nandakumar. P. Bhutada. Pusat Penelitian Hasil Hutan. Physiology of Disease Resistant in Plant. J. London. CRC Press Inc. Boca Raton. Boston. Teknik Budidaya Gaharu. R. Gore. E. Verpoorte. Metabolic Engineering of Plant Secondary Metabolism. Memelink. Plant Secondary Metabolism. Widnyana. Mardiastuti. Vidhyasekaran. (Editors). S. Kluwer Academic Publisher. Analgesik and AntiImflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. W. Boston. Laju Pertumbuhan Tegakan Gaharu (Aquilaria malaccensis) di Riau yang Ditanam dengan Intensitas Budidaya Tinggi dan Manual. P. P. A. Trupti. Mundhada. 2007. K. Bogor. London.. S. C. 2002. Kain. Aisuli 14. Dordrecht. 2000. CITES and Implementation in Indonesia. I K.Teknologi Induksi Pohon . dan Harbagung. Y. I M. 2000. Metabolic Engineering of Plant Secondary Metabolism.. Sumadiwangsa. (Editors). R. and Alfermann. Pharmacology-online 1 : 288-298. 95 . A.. R van der Heijden. Jakarta. W. R.

96 .

gubal gaharu diduga dapat terbentuk melalui infeksi cendawan. A. dan F. Selain itu. filaria) dan A. malaccensis mampu menginduksi gejala pembentukan gubal pada pohon gaharu (A. microcarpa) umur 97 . A. Menurut Nobuchi dan Siripatanadilok (1991). Beberapa spesies Fusarium seperti F. DAN Fusarium sp. F. A. DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu Departemen Biologi. crassna. asal gubal gaharu pada Gyrinops verstegii (sin. Magnoliopsida. hingga saat ini masih terus diteliti. malaccensis.4 EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp. FMIPA. FMIPA. Rahayu et al. Institut Pertanian Bogor Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Esti Wulandari Departemen Biologi. Thymelaeaceae). oxyporum.. Institut Pertanian Bogor LATAR BALAKANG Gaharu merupakan salah satu komoditi hasil hutan bukan kayu (HHBK) yang dihasilkan oleh beberapa spesies pohon gaharu (Aquilaria sp. bulbigenium. (1999) menyatakan bahwa beberapa isolat Acremonium sp. Proses pembentukan gubal pada pohon gaharu. lateritium telah berhasil diisolasi oleh Santoso (1996).

98 . Mekanisme infeksi kedua cendawan ini pada satu lokasi infeksi belum dipelajari. Oleh sebab itu penelitian ini bertujuan untuk mengetahui efektivitas dan interaksi antara Acremonium sp.525 (koleksi IPBCC. (2007) dan Rahayu (2008) juga menyatakan bahwa Acremonium sp. oxysporum. infeksi cendawan yang pertama dapat membangkitkan resistensi yang disebut Systemic Acquired Resistance (SAR) terhadap infeksi cendawan kedua. dan sebaliknya. (1997). Departemen Biologi FMIPA IPB). cucumerinum dapat membangkitkan SAR tanaman semangka terhadap infeksi Colletotrichum lagenarium. Pada gubal gaharu. IPBCC 07. perubahan warna kayu dan adanya senyawa terpenoid dijadikan indikator efektivitas dan interaksi antara inokulan dalam pembentukan gubal. Oleh sebab itu. oxysporum f. Padahal menurut Sticher et al. terhadap Acremonium sp. microcarpa umur 13 tahun di Hutan Penelitian Carita. dalam pembentukan gubal pada pohon gaharu (A. Banten. BAHAN DAN METODE A. merangsang perubahan warna kayu dan pembentukan senyawa terpenoid. Infeksi ganda Fusarium sp. 1962). Liu et al. Bahan Bahan dan alat yang digunakan adalah pohon A. terdeteksi senyawa oleoresin (Prema dan Bhattacharyya. Rahayu et al. melalui pemanfaatan kedua cendawan tersebut sebagai penginduksi ganda memerlukan informasi awal mengenai kemungkinan terbentuknya SAR yang dibangkitkan oleh Fusarium sp. dan Acremonium sp. Padang (koleksi Laboratorium Mikrobiologi Hutan. hasil induksi cendawan. larutan gula 2%.sp. microcarpa). dan Fusarium sp. Acremonium sp. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam). terhadap Fusarium sp.Aspek PRODUKSI 2 tahun. yang berasal dari Aquilaria sp. (1995) juga menemukan proses SAR dari infeksi Pseudomonas lachrymans pada timun terhadap F. Sebagai contoh. biakan Acremonium sp. dan Fusarium sp. Caruso dan Kuc (1977) menyatakan bahwa infeksi F. pada beberapa kasus infeksi cendawan pada tumbuhan. seringkali diperoleh dari satu gejala gubal.

5-1 m di atas permukaan tanah) dengan mata bor berdiameter 4 mm. saja (AA) atau Fusarium sp. meteran. dan Fusarium sp. bahan pelet. Biakan ini akan digunakan sebagai sumber inokulum untuk pembuatan inokulan. Pembuatan Inokulan Acremonium sp.alkohol. diremajakan pada media agaragar kentang dekstrosa (Difco) dan diinkubasi pada suhu ruang selama 7 hari. Pertama-tama. Metode 1. dan alat pencetaknya. Jarak antar lubang dalam deretan sekitar 5 cm. Seminggu kemudian. kemudian zona perubahan warna batang diukur secara horizontal 99 . serta batang dengan perlakuan tunggal (diberi Acremonium sp. dan diinkubasi selama 3 minggu menggunakan inkubator bergoyang. Untuk inokulan berupa pelet. aquades. sederetan lubang dibuat di sekeliling batang utama (mulai ketinggian 0. Ke dalam lubang pada deretan kedua ini dimasukkan inokulan 2. B. Efektivitas dan interaksi diukur melalui perkembangan pembentukan gejala gubal di sekitar daerah induksi. Fusarium sp. Batang di sekitar lubang dikupas kulitnya. pohon dilubangi lagi pada jarak 15 cm secara vertikal dari deretan lubang yang pertama. 2. ditumbuhkan pada media serbuk gergaji selama 2 minggu. yang dilubangi saja (B). Jarak antar set perlakuan dalam 1 pohon ± 30 cm. dengan kedalaman lubang maksimal 1/3 diameter batang. ditumbuhkan pada 300 ml media cair. kemudian dibentuk berupa pelet dengan ukuran 4 mm x 40 mm. mata bor berukuran 4 mm. dan Fusarium sp. saja (FF)) digunakan sebagai pembanding. Batang yang tidak diberi perlakuan (K). Perubahan warna batang dan pembentukan wangi merupakan indikator pembentukan gubal. Acremonium sp. Pasangan inokulan (FA atau AF) adalah set perlakuan. Pengamatan dilakukan setiap 1 bulan selama 4 bulan. Uji Efektivitas dan Interaksi Acremonium sp. batang yang dilubangi dan diberi larutan gula (G). lubang diberi larutan gula 2% sebelum pemberian inokulan. Ke dalam deretan lubang ini dimasukkan inokulan 1 sampai lubang dipenuhi oleh inokulan. bor.

Wangi ditetapkan berdasarkan sistem skor (0 = tidak wangi. kemudian diamati wanginya secara organoleptik ketika kayu dibakar. kemudian disaring pada cawan petri steril dan diuapkan sampai kering (sampai terbentuk endapan berwarna kuning). dan tingkat wangi) dianalisis dengan SAS versi 9. dihomogenisasi lalu dipindahkan ke tabung reaksi steril. 3. 3 = coklat kehitaman). Perubahan warna diamati pada 10 titik untuk setiap pohon. kemudian absorbansinya diukur dengan spektrofotometer pada λ 268 nm. Deteksi Senyawa Terpenoid Senyawa terpenoid dideteksi dengan metode LiebermanBurchard (Harborne. Tingkat perubahan warna kayu dinyatakan dalam rataan dari hasil pengamatan 3 responden. Analisis Data Data hasil pengamatan (panjang. Daerah yang menunjukkan perubahan warna kayu dari putih menjadi coklat-kehitaman diambil dengan dipahat dan dibawa ke laboratorium untuk pengamatan selanjutnya.1 menggunakan Rancangan Acak Lengkap (RAL) satu faktor dengan waktu dan uji F pada α = 5%. 2 = wangi). Sebanyak 0. Sebanyak 5 ml etanol absolut ditambahkan ke dalam larutan. Tingkat wangi dinyatakan dalam rataan skor dari 3 responden. Setelah diamati tingkat wanginya. Tingkat perubahan warna kayu ditetapkan berdasarkan sistem skor (0 = putih. ditambahkan 3 tetes asam asetat anhidrat dan 1 tetes H2SO4 pekat. Bila terdapat pengaruh nyata dari perlakuan yang diamati maka setiap taraf perlakuan 100 . 1987). tingkat perubahan warna. Pada endapan ditambahkan 1 ml dietil eter pekat. 1 = agak wangi. 4. 1 = putih kecoklatan. 2 = coklat. Perubahan warna menjadi merah atau ungu menunjukkan adanya senyawa triterpenoid (Harbone. sampelsampel dari kayu yang mengalami perubahan warna dipisahkan dari bagian yang sehat.Aspek PRODUKSI dan vertikal. Kayu di sekitar titik inokulasi dipahat.4 g kayu yang berubah warna direndam dalam 5 ml etanol absolut panas. Wangi dinyatakan dalam tingkat wangi dan persentase titik induksi dengan kategori agak wangi dan sangat wangi. lebar zona perubahan warna. 1987).

12 Titik induksi wangi (%) 1. Sedangkan pada parameter lainnya.37 31.87a 0.14a 3.94a 0..82a 0.45c 1.30a Lebar (cm) 0. Pemberian gula menyebabkan gejala pembentukan gubal gaharu menjadi tertekan.62ab 0. AF lebih efektif dalam menginduksi pembentukan wangi daripada FA dan inokulan tunggal.54ab 3.Efektivitas dan Interaksi .00 6.(Gayu Rahayu. inokulan ganda lebih efektif.63ab 0..90b 1.55 20.07 39. HASIL A. Berdasarkan persentase titik induksi pada kategori wangi. Pembentukan gejala gubal gaharu hasil inokulasi cendawan tunggal dan ganda Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Inokulan tunggal Inokulan ganda AA FF AF FA 2.) dibandingkan dengan menggunakan uji lanjut Duncan pada taraf 5%. Sebagai inokulan tunggal A dan F memiliki efektivitas yang relatif sama.83a Warna (skor) 1..39 0. Gejala pembentukan gubal akibat inokulan ganda juga cenderung tidak berbeda nyata dari inokulan tunggalnya.70a 0.20a 3..24 4.75b 2.18a Wangi (skor) Titik induksi agak wangi (%) 34. Di antara inokulan ganda. Efektivitas Inokulan dalam Menginduksi Gejala Pembentukan Gubal Gaharu Secara umum semua perlakuan menyebabkan perubahan warna kayu dan merangsang munculnya perubahan aroma kayu (Tabel 1).16 0. AF justru lebih baik.59ab 101 . Tabel 1. Efektivitas inokulan tunggal maupun ganda Acremonium dan Fusarium relatif lebih tinggi dalam merangsang pembentukan gejala gubal gaharu dibandingkan dengan metode induksi lainnya. dkk.

Aspek PRODUKSI

Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Kontrol positif Kontrol negatif
*

Lebar (cm) 0,55b 0,73ab 0,00c

Warna (skor) 1,02d 1,16d 0,00e

Wangi (skor)

Titik induksi agak wangi (%) 10,41 11,11 0,00

Titik induksi wangi (%) 0,00 0,00 0,00

G B K

1,86b 2,87ab 0,00c

0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Kayu mengalami perubahan warna dari putih menjadi coklat atau coklat kehitaman (Gambar 1). Pemberian inokulan tidak berpengaruh pada panjang dan lebar zona perubahan warna. Namun panjang zona perubahan warna tertinggi terjadi berturut-turut pada kayu yang diberi perlakuan ganda FA dan AF. Sedangkan tingkat perubahan warna dipengaruhi oleh inokulan. Tingkat perubahan warna tertinggi pada FA dan berbeda nyata dari perlakuan lainnya.

Pemberian inokulan juga tidak berpengaruh nyata terhadap pembentukan wangi. Berbeda dengan perubahan warna kayu, tingkat wangi tertinggi terjadi pada kayu yang diberi inokulan ganda AF. Secara rataan nilai tingkat wangi yang terbentuk dari hasil perlakuan inokulan termasuk dalam kategori tidak wangi, Meskipun demikian, pemberian inokulan meningkatkan persentase titik induksi yang wangi. Bahkan inokulan tunggal AA dan inokulan ganda menghasilkan titik induksi pada kategori wangi (Tabel 1).

a

b

c

d

Gambar 1. Perubahan warna kayu dengan tingkat kegelapan yang berbeda dari (a) intensitas terendah sampai (d) intensitas tertinggi

102

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Periode induksi berpengaruh pada semua parameter pembentukan gubal kecuali panjang zona perubahan warna (Tabel 2). Secara umum, nilai parameter pembentukan gubal tertinggi terjadi pada bulan ke-2, kecuali tingkat perubahan warna. Pada bulan ke-2 induksi, intensitas warna cenderung naik, tapi intensitas warna kayu pada bulan ke-4 relatif sama dengan bulan ke-3.
Tabel 2. Pengaruh periode induksi pada gejala pembentukan gubal gaharu
Rataan* Perubahan warna kayu Bulan Panjang (cm) 1 2 3 4
*

Lebar (cm) 0,68a 0,71a 0,65b 0,65b

Tingkat (skor) 0,83c 1,24b 1,67a 1,65a

Wangi (skor)

Titik induksi agak wangi (%) 8,43 39,47 17,45 18,45

Titik induksi wangi (%) 0,00 0,00 0,00 6,74

2,46ab 2,58a 2,32ab 2,26b

0,32c 0,64a 0,51b 0,36c

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

B. Interaksi Inokulan 1 dan Inokulan 2
Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2 (Tabel 3). Inokulasi F sebelum inokulasi A tidak mempengaruhi pembentukan gejala gubal pada titik A termasuk pembentukan wangi. Kehadiran F justru cenderung meningkatkan respon perubahan warna kayu akibat inokulasi A. Demikian pula inokulasi A sebelum F tidak mempengaruhi pembentukan gejala gubal pada titik F, kecuali warna pada F menjadi lebih gelap dan persentase titik induksi yang wangi relatif lebih tinggi dibandingkan dengan inokulan tunggalnya. Inokulan ganda AF dan FA menghasilkan masing-masing 8,33% titik induksi pada kategori wangi. Infeksi sekunder juga tidak secara konsisten mempengaruhi infeksi primer (Tabel 4). Inokulasi F sebelum inokulasi A cenderung tidak mempengaruhi pembentukan gejala gubal termasuk tingkat

103

Aspek PRODUKSI

wangi, kecuali pada perubahan warna kayu. Intensitas warna pada titik induksi F lebih baik dibandingkan dengan perlakuan tunggalnya. Infeksi kedua oleh F juga cenderung tidak mempengaruhi gejala pembentukan gubal dan tingkat wangi. Infeksi sekunder oleh cendawan yang sama dengan cendawan tidak berpengaruh pada pembentukan gejala gubal (Tabel 5). Meskipun demikian, secara umum nilai parameter gejala gubal pada titik infeksi sekunder lebih rendah daripada pada titik infeksi primernya. Inokulan A dan F memiliki potensi yang relatif sama dalam merangsang pembentukan wangi.
Tabel 3. Pengaruh inokulan 1 terhadap inokulan 2 dalam gejala pembentukan gubal gaharu
Rataan* Perla-kuan Perubahan warna kayu Panjang (cm) FAa AAa AFf FFf GGg BBb KKk
*

Lebar (cm) 0,71bcd 0,66bcd 0,83abcd 0,75abcd 0,53d 0,65cd 0,00e

Warna (skor) 2,15ab 1,82bc 1,57cd 1,36de 1,02e 1,13e 0,00f

Wangi (skor) 0,60ab 0,63ab 0,70a 0,62ab 0,38c 0,47bc 0,00d

Titik induksi agak wangi (%) 26,37 36,11 40,27 27,78 0,00 0,00 0,00

Titik induksi wangi (%) 8,33 0,00 8,33 0,00 0,00 0,00 0,00

2,73abc 1,96bc 2,52abc 2,61abc 1,75c 2,40abc 0,00e

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 4. Pengaruh infeksi sekunder dengan cendawan yang berbeda dari cendawan penginfeksi primer
Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,68ab 3,87a Lebar (cm) 0,99ab 0,95abc Warna (skor) 1,53cd 2,22a Wangi (skor) Titik induksi agak wangi (%) 34,37 13,89 Titik induksi wangi (%) 0,00 0,00

FFF FAF

0,62ab 0,50bc

104

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,13abc 3,88a 1,98bc 3,35abc 0,00d Lebar (cm) 0,96abc 1,06a 0,56d 0,80abcd 0,00e Warna (skor) 1,98ab 1,93ab 1,01e 1,20de 0,00f Wangi (skor) Titik induksi agak wangi (%) 32,63 38,86 20,83 13,89 0,00 Titik induksi wangi (%) 2,78 4,15 0,00 0,00 0,00

AAA AFA GGG BBB KKK
*

0,63ab 0,70a 0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 5. Pengaruh infeksi sekunder cendawan yang sama dengan cendawan penginfeksi primernya
Rataan* Perlakuan Panjang (cm) 3,13abc 1,96bc 3,68ab 2,61abc Lebar (cm) 0,96abc 0,66bcd 0,99ab 0,75abcd Warna (skor) 1,98ab 1,82bc 1,53cd 1,36de Wangi (skor) 0,63ab 0,63ab 0,62ab 0,61ab Titik induksi agak wangi (%) 32,63 36,11 34,37 27,78 Titik induksi wangi (%) 2,78 0,00 0,00 0,00

AAA AAa FFF FFf
*

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

C. Pembentukan Senyawa Terpenoid
Senyawa terpenoid terdeteksi pada semua perlakuan. Pada perlakuan tunggal FF dan gandanya terbentuk warna merah, yang menunjukkan adanya senyawa triterpenoid. Warna merah pada minyak gaharu dijadikan sebagai pembanding kandungan triterpenoid perlakuan. Pada ekstrak kayu B, G, dan inokulan A terbentuk warna hijau. Warna hijau ini menunjukkan adanya senyawa sterol (Harborne, 1987). Sedangkan pada K tidak terbentuk

105

25** 4 0 0.14* 0. ** Endapan berwarna merah-kecoklatan 106 .15* * Endapan berwarna hijau.12* 0.40* 0. nilai absorbansi ekstrak terpenoid hasil perlakuan kurang dari nilai absorbansi minyak gaharu (0.45* 0. Pada 3 bsi.25* 0.813) sebagai pembandingnya.12** 0.15* 0. Selain itu.11* 0.12** 0.23** 0.19** 0.11** 0.21* 0.06* 3 0 0. Inokulan AF maupun FA juga tidak mempengaruhi kandungan terpenoid.Aspek PRODUKSI warna (bening). Secara umum. Kandungan senyawa triterpenoid pada zona perubahan warna bervariasi pada setiap perlakuan selama 4 bsi (Tabel 6).20** 0.39* 0.29* 0.23* 0. perlakuan tunggal FF terbentuk endapan merah dan memiliki nilai absorbansi yang relatif tinggi. secara umum nilai absorban perlakuan inokulan ganda hampir sama dengan inokulan tunggal (Tabel 6). Hal ini menunjukkan bahwa pemberian inokulan 2 tidak mempengaruhi besarnya nilai absorban inokulan 1.34* 0. Tabel 6. Hal ini menunjukkan kandungan triterpenoid yang relatif tinggi pula (Tabel 6).27* 0.24* 0.22* 0.20** 0.14** 2 0 0. Hal ini menunjukkan bahwa pada K tidak terdapat senyawa triterpenoid maupun sterol. Hal ini menunjukkan bahwa inokulan ganda tidak efektif dalam meningkatkan kandungan senyawa terpenoid. Begitu pula dengan nilai absorban inokulan 1 yang tidak dipengaruhi oleh inokulan 2.20* 0.06* 0.23** 0.06* 0. Nilai absorbasi ekstrak kayu gaharu yang berubah warna Perlakuan K G B AF A AF F FA F FA A AA FF Bulan ke1 0 0.05* 0.12** 0.

dan Fusarium sp. karena kemungkinan sumber karbon lebih diutamakan untuk pembentukan tunas baru. Efektivitas Induksi Pohon-pohon yang diberi perlakuan menurun kebugarannya mulai 1 bsi. perkembangan gejala pembentukan gubal pun terganggu. Caruso and Kuc (1977) menyatakan bahwa Colletotrichum lagenarium menyebabkan klorosis pada daun tanaman semangka dan muskmelon.. Pelukaan. Sedangkan pada pohon yang diberi inokulan ganda klorosis terjadi pada tiga cabang dekat lubang induksi. Menurut Braithwaite (2007) Acremonium sp. Walker et al. Secara umum inokulan tunggal mengakibatkan klorosis pada daun-daun di dua cabang dekat lubang induksi. inokulasi Acremonium sp. karena daun merupakan tempat utama berlangsungnya fotosintesis. (1997) juga menyatakan bahwa perubahan warna kayu menjadi warna coklat (browning) dapat disebabkan oleh serangan patogen (cendawan) 107 . Ketersediaan hara terganggu karena jalur distribusinya ke daun terhambat akibat pengeboran.. Sebelumnya. Pada akhirnya. Berkurangnya jumlah daun secara drastis dapat menghambat proses fotosintesis. Penurunan kebugaran ditunjukkan oleh adanya daundaun yang mengalami klorosis pada cabang pertama dan kedua dari daerah lubang induksi dan kemudian daun-daun ini gugur. Pada 2 bsi.. Selain itu. pada pohon kontrol daun-daun tidak mengalami klorosis sampai akhir pengamatan. dkk. adanya inokulan juga menjadi penyebab klorosis. berasosiasi dengan gejala perubahan warna kayu dan dicline pada Quercus sp. larutan gula.) PEMBAHASAN A. Tajuk-tajuk pohon menjadi gundul.(Gayu Rahayu. Fotosintat sebagai sumber karbon dalam pembentukan metabolit sekunder antimikrob pun terganggu. Berbeda dengan daun-daun pada pohon perlakuan. menyebabkan perubahan warna kayu dari putih menjadi gelap. jumlah daun yang mengalami klorosis tidak berbeda dengan 1 bsi. dan Fusarium sp.. Klorosis mungkin berhubungan dengan ketersediaan hara. tetapi klorosis hampir memenuhi luasan helai daun. di New Zealand.Efektivitas dan Interaksi . Pohon semakin merana ketika diserang ulat. Perubahan warna kayu terjadi pada semua perlakuan.

Kemungkinan besar fenomena ini berhubungan dengan kebugaran pohon yang menurun mulai bulan ke-2. Berdasarkan persentase titik induksi yang wangi. Namun demikian metabolisme isopentenil pirofosfat sebagai pekursor pembentukan terpenoid (McGarvey and Croteau. intensitas warna kayu lebih rendah dibandingkan 108 . Perubahan warna kayu pada gaharu mungkin dapat mengindikasi adanya senyawa gaharu. inokulan ganda lebih baik dari inokulan tunggal maupun cara induksi lainnya. Pemberian larutan gula (G) menekan perkembangan gejala pembentukan gubal gaharu. Semakin lama periode induksi semakin gelap warna kayu. Hal ini disebabkan karena gula tersebut segera dipergunakan pohon untuk proses penyembuhan daripada dimanfaatkan oleh cendawan. Aroma wangi mulai terdeteksi pada bulan ke-2 dan menurun pada bulan berikutnya. Periode inkubasi cenderung mempengaruhi semua parameter gejala gubal gaharu. Aroma wangi dan frekuensi wangi pada pemberian inokulan ganda AF relatif lebih tinggi dibandingkan dengan perlakuan lainnya. Sedangkan pada parameter lainnya. 2007). 1995) mungkin tidak berhenti pada produk seskuiterpenoid tetapi dapat masuk dalam jalur metabolisme selanjutnya.. 2007). perubahan warna kayu menjadi coklat muncul setelah sel-sel kehilangan pati akibat pelukaan.Aspek PRODUKSI dan kerusakan fisik. Hal ini menunjukkan bahwa metabolisme terpenoid dapat berlangsung terus dan berakhir pada produk selain seskuiterpenoid ketika dipanen. Namun. Aroma wangi merupakan bagian dari senyawa gaharu (Rahayu et al. Pada penelitian ini senyawa triterpenoid dan sterol juga terdeteksi. Hal ini didukung oleh pernyataan Rahayu dan Situmorang (2006). bahwa perubahan warna dari putih menjadi coklat-kehitaman merupakan gejala awal terbentuknya senyawa gaharu. Menurut Nobuchi and Siripatanadilok (1991). nilai tertinggi diperoleh pada bulan ke-2 induksi. Senyawa wangi merupakan senyawa yang mudah menguap sehingga kemungkinan besar tergolong senyawa seskuiterpenoid. Hal ini membuktikan bahwa wangi merupakan respon spesifik terhadap bentuk gangguan (Rahayu et al..

G. Acremonium dan Fusarium dikenal sebagai penyebab busuk batang atau kanker batang pada pohon berkayu. (1999) yang membuktikan bahwa inokulasi Heterobasidion annosum yang diikuti oleh Ceratocystis polonica menekan pembentukan gejala bluestain pada pohon Norway spruce (Picea abies). Sesuai dengan pernyataan Rahayu et al. Pembentukan Senyawa Gaharu Acremonium sp. pada A. Hal ini menunjukkan bahwa aroma wangi yang dihasilkan tidak selalu sebanding dengan intensitas warna kayu. (1997) menyatakan bahwa serangan cendawan pada pohon Pinus akan merangsang pohon untuk membentuk senyawa terpenoid sebagai pertahanan pohon.) dengan pemberian inokulan ganda FA. polonica terbentuk SAR setelah 3 minggu infeksi H.Efektivitas dan Interaksi . Triterpenoid terdeteksi pada pemberian inokulan tunggal FF dan inokulan ganda yang ditunjukkan dengan terbentuknya endapan berwarna merah pada pengujian Lieberman-Burchard. Putri (2007) juga menyatakan bahwa pemberian Acremonium sp.. (1999) menyatakan bahwa pada Norway spruce (P. crassna terbukti dapat merangsang pembentukan senyawa terpenoid. Pada penelitian ini triterpenoid mulai terdeteksi pada 1 bsi.. B.(Gayu Rahayu. polonica adalah penyebab bluestain saja dan tidak menyebabkan busuk batang. dkk. (1999) bahwa terjadinya pembentukan wangi gaharu tidak selalu diikuti oleh perubahan warna kayu. Paine et al.. Kemungkinan lain adalah periode inokulasi antara inokulan 1 dan inokulan 2 yang hanya berselang 1 minggu. dan Fusarium sp. Heterobasidion juga menyebabkan busuk batang tetapi C. Heterobasidion mungkin merangsang pohon membentuk senyawa fitoaleksin yang bersifat anti C. Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2.. dalam bentuk inokulan tunggal atau inokulan ganda dapat merangsang pohon gaharu membentuk senyawa terpenoid. 109 . Selain itu penelitian sebelumnya. abies) terhadap C. Krokene et al. polonica. annosum. dan inokulan tunggal AA terbentuk warna hijau. Kemungkinan besar hal ini disebabkan aktivitas patologis yang berbeda. Hal ini berbeda dari hasil penelitian Krokene et al. Sedangkan pada perlakuan B.

Inglis. 90(1): 45-56. L. 110 . Induced Resistance to Phatogenic Fungi in Norway Spruce.M. Hill. N. Beever. Harbone. Dehbi.Aspek PRODUKSI Warna hijau ini mengindikasikan yang terbentuk adalah senyawa sterol. Induksi dengan inokulan 1 yang hanya berselang 1 minggu dari pemberian inokulan 2 tidak membangkitkan resistensi pohon terhadap inokulan 2. Phytopathol. 2007. M. 1999.W. Padmawinata K dan I Sudiro (penerjemah).R. H.L. Soc. Solheim.. Pay and C. Dick. Amer. R. Waipara. S. A. New Zealand Plant Protection 60:297-303 Caruso.E. kecuali inokulan tunggal A merangsang pohon membentuk triterpenoid. Semua inokulan. Investigation of Oak Tree Decline In Theauckland Region. D. Franceschi. F. Metode Fitokimia.A. Gagné. Christiansen. 1977. Phytopathol. 121: 565-569. Ramsfield.F. Harborne (1987) menyatakan bahwa sterol merupakan salah satu senyawa yang tergolong ke dalam senyawa terpenoid.D.. P.L. Bandung Terjemahan dari: Phytochem Methods. 67: 1285-1289. Inokulan ganda terutama AF lebih efektif daripada inokulan tunggal dalam merangsang pembentukan wangi. Kuc. Krokene. Institut Teknologi Bandung. M.. V. Protection of Watermelon and Muskmelon Against Colletotrichum lagenarium by Colletotrichum lagenarium. E. J. J. T. 2000. Berryman. C. BacterialMediated Induced Resistance in Cucumber: Beneficial Effect of the Endophytic Bacterium Serratia plymuthica on the Protection Against Infection by Pythium ultimum. Braithwaite.. Quéré.A. Plant Physiol. SIMPULAN Semua pohon yag diinokulasi menurun kebugarannya sejak 1 bulan setelah inokulasi. DAFTAR PUSTAKA Benhamou. J.B. 1987. N.

G. and F. 1991. Hlm 1-3. G. Jakarta. Makalah dipresentasikan dalam 3rd Asian Conference on Crop Protection.C. Prosiding Kongres Nasional XV dan Seminar Perhimpunan Fitopatologi Indonesia.. Paine..J. Preliminary Observation of Aquilaria crassna Wood Associated with the Formation of Aloeswood. 1997. Makalah Diskusi Hasil Penelitian dalam Menunjang Pemanfaatan Hutan yang Lestari. Isnaini. T. Institute de Biologie Végétale. Increasing Fragrance and Terpenoid Production in Aquilaria crassna by Multi-Application of MethylJasmonate Comparing to Single Induction of Acremonium sp. 85:1064-1068. Makalah dipresentasikan dalam International Conference on Microbiology and Biotechnology.Efektivitas dan Interaksi . A. Phytopathol. Umboh. Perhimpunan Fitopatologi Indonesia. Y.. Rahayu. Systemic Acquired Resistance. 1996.) Liu.I. Annu.. Métraux. Putri dan Juliarni. 1999. S. T. J. Acremonium and MethylJasmonate Induce Terpenoid Formation in Agarwood Tree (Aquilaria crassna).P. Pembentukan Gaharu dengan Cara Inokulasi. Entomol.D.. Potensi Hifomiset dalam Menginduksi Pembentukan Gubal Gaharu. Purwokerto. L. Yogyakarta. Rahayu. their Associated Fungi.. 1995. 3 route A Gockel. M. 1700 Fribourg.W. Kloepper. Terpenoid Metabolism. Pusat Litbang Hutan dan Konservasi Alam. Bull. and Host Conifers. 1997. McGarvey. Bogor.F. Kyoto Univ. Purwokerto. J.J. G. D.. 2007. Plant Cell 7:1015-1026. 2008. Siripatanadilok.L. Interactions Among Scolytid Bark Beetles. 11-12 Maret 1996. 111 .. Harrington.. 11-12 November 2008. Rahayu. E. Santoso. B. L. Rev. Sticher. 42:179-206. Induction of Systemic Resistance in Cucumber by Plant Growth-Promoting Rhizobacteria: Duration of Protection and Effect of Host Resistance on Protection and Root Colonization. S. Raffa. Université de Fribourg. hlm 573-581. 1995. dkk. T. Switzerland. K. Mauch-Mani. Forest 63:226-235. Nobuchi.(Gayu Rahayu. Croteau. 16-18 September 1999. Tuzun. 22-24 August 2007..

112 .

Aspek SILVIKULTUR 113 .

114 .

Di alam.. dan Popullaria sp. Budidaya gaharu memerlukan input iptek agar pertumbuhan dan produksi resin gaharu dapat optimal. eksploitasi gaharu alam dilakukan tanpa mengindahkan kelestariannya. Dukungan iptek dimaksud 115 .. khususnya jamur Fusarium sp.. 2001.. Akibatnya populasi jenis-jenis gaharu menyusut tajam. Erdy Santoso. Namun gaharu alam dapat mencapai kualitas tertinggi (kelas super) yang harganya bisa mencapai Rp 30 juta/kg.. Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Pengembangan tanaman gaharu umumnya tidak bertujuan untuk menghasilkan kayu. Pythium sp. Trichoderma sp. Daijo and Oller.5 UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto. Parman et al. 2007. Karena potensi harga yang sangat tinggi.. Phialophora sp. Sidiyasa dan Suharti. bukan dari alam. (Santoso et al. dalam perdagangan resmi.. 2007). 1987). Konsekuensinya. 1996. gaharu harus dihasilkan dari pohon hasil budidaya. kurang dari 5% gaharu terbentuk dari populasi pohon dan bila terbentuk biasanya kurang dari 10% biomas kayu pada pohon yang terinfeksi.. melainkan ditujukan untuk menghasilkan resin gaharu yang terbentuk dari respon tanaman atas infeksi mikroba. Cylindrocarpon sp. sehingga jenis ini dimasukkan dalam Appendix II CITES (Santoso et al.

baik pertumbuhan maupun produktivitas resin gaharunya.5oC). Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. 1960).9-6. Biji rekalsitran umumnya cepat berkecambah dan tidak dapat disimpan dalam jangka panjang (Roberts and King. Bibit cabutan yang digunakan dalam uji waktu simpan cabutan adalah campuran Aquilaria microcarpa dan A. Perlakuan pada uji penyimpanan benih adalah waktu (0. Makalah ini menyajikan hasil penelitian berkaitan dengan aspek perbenihan dan perbanyakan stek gaharu. Penerapan perbanyakan vegetatif dan pemuliaan pohon berpotensi untuk menghasilkan bibit klon gaharu yang memiliki keunggulan. Perbanyakan bibit pohon penghasil gaharu dapat dilakukan. Proyek ITTO PD 425/06 berupaya untuk mengembangkan dan menerapkan iptek pada penanaman pohon penghasil gaharu agar pertumbuhan dan produktivitas resin gaharunya tinggi. malacensis.4-26. Pembahasan makalah ini difokuskan pada aspek pembibitan atau perbanyakan bibit pohon penghasil gaharu. Biji pohon penghasil gaharu tergolong rekalsitran (Hou. 116 . 6. Namun informasi iptek mengenai teknik perbenihan dan teknik perbanyakan vegetatif gaharu masih sangat terbatas. Benih pohon penghasil gaharu yang digunakan pada uji penyimpanan dan daya kecambah benih adalah campuran Aquilaria microcarpa dan A. 1980).1oC dan 4.Aspek SILVIKULTUR berkaitan dengan aspek pembibitan dan penyuntikan stimulan gaharu. Perlakuan pada uji waktu simpan bibit cabutan adalah tiga waktu simpan (1. Perbanyakan Generatif Pengujian pada perbanyakan generatif dilakukan pada benih (biji) dan cabutan (anakan alam). 2. 4. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. baik secara generatif maupun vegetatif. METODE A. malacensis asal Sukabumi. 2. dan 3 hari penyimpanan) serta kondisi penyapihan (dalam sungkup dan tanpa sungkup). dan 8 minggu) dan temperatur penyimpanan (25.

0993). dkk. Persen kecambah dari hasil uji lain pihak. Uji produksi bibit stek gaharu dilakukan dalam tiga tahap.. dan 3 kali pada bulan ketiga.) B. 2007). Perbanyakan Vegetatif Teknik perbanyakan vegetatif yang digunakan pada penelitian ini adalah teknik stek pucuk. media tabur dapat menggunakan arang sekam Langsung 2 minggu 4 minggu 6 minggu 8 minggu 82 69 77 56 48 69 69 61 24 117 . Kondisi penyimpanan (kondisi ruang dan dalam re-frigerator) tidak secara nyata mempengaruhi perkecambahan benih (P Anova = 0. yaitu media campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 2:1. Pada pengujian ketiga. Subiakto dan Sakai..0001). Perbanyakan Generatif Biji gaharu tergolong rekalsitran. periode penyimpenyimpanan biji panan mempengaruhi persen Periode Kondisi Refrigerator kecam-bah benih (P Anova = < simpan ruang (%) (%) 0. Perlakuan pada pengujian pertama menggunakan prosedur rutin. HASIL DAN PEMBAHASAN A.. Di Tabel 1. Pada pengujian kedua perlakuan intensitas penyiraman dikurangi menjadi sekali seminggu dengan media arang sekam. media menggunakan campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 1:1 dan intensitas penyiraman 1 kali pada bulan pertama.. malacensis. sehingga harus secepatnya dikecambahkan. 2007. Hasil uji pengecambahan biji dari dua kondisi penyimpanan disajikan pada Tabel 1 dan Tabel 2. Bahan stek yang digunakan pada pengujian ini adalah A. Penelitian dilakukan pada rumah kaca yang menggunakan sistem pendingin kabut KOFFCO system (Sakai dan Subiakto. Penyiraman 2 kali seminggu.Uji Produksi Bibit . Uji penyimpanan benih dilakukan untuk mengetahui seberapa lama benih gaharu dapat disimpan.(Atok Subiakto. 2 kali pada bulan kedua. Secara teknis pengecambahan biji gaharu mudah dilakukan.

Oleh sebab itu untuk mendapatkan persen jadi bibit yang tinggi. Pasimpan sungkup (%) sungkup (%) (hari) da pengujian penanaman 0 80 40 cabutan digunakan bibit 1 76 46 gaharu berukuran tinggi 2 87 24 7 cm. penaburan biji dilakukan segera setelah buah yang masak dan jatuh. Penggunaan sungkup meningkatkan secara nyata persen tumbuh bibit cabutan (P Anova = < 0.4 minggu 64 58 annya cenderung lebih besar 6 minggu 37 48 bila bibit disimpan dalam 8 minggu 29 9 jangka waktu yang lebih lama. Dalam pengujian ini media kecambah yang digunakan adalah arang sekam padi. Perbanyakan generatif Tabel 3. Pada Tabel 2 simpan ruang (%) (%) tampak ada penurunan antara Langsung 74 persen berkecambah dan 2 minggu 50 54 persen jadi bibit. Persen tumbuh bibit cabutan dari uji penyimpanan dan dapat pula dilakukan dengan kondisi tanam bibit menggunakan bibit yang diperoleh dari cabutan di Periode Dalam Tanpa bawah pohon induknya. 118 . Penurun.Aspek SILVIKULTUR atau zeolit. Perkecambahan umumnya Tabel 2. pengecambahan harus dilakukan segera setelah pengunduhan buah. Persen jadi bibit (6 minggu setelah penaburan) dari hasil uji dimulai pada minggu kedua penyim-panan biji dan persen jadi bibit dihitung pada minggu keenam setelah Periode Kondisi Refrigerator penaburan. Pada jenis-jenis biji rekalsitran seperti meranti. Pada jenis gaharu penyimpanan pada kondisi ruang selama 2 bulan masih dapat menghasilkan kecambah dengan tingkat keberhasilan 48%. kotiledonnya telah luruh.0001). Umumnya bibit cabutan yang masih memiliki kotiledon dapat langsung ditanam dalam kantong plastik tanpa penyungkupan. Hasil uji penanaman 3 76 38 cabutan disajikan pada Tabel 3.

. 2002).8276) dalam persen jadi stek. Perbanyakan Vegetatif Uji produksi stek gaharu dilakukan dengan menggunakan teknologi KOFFCO system yang dikembangkan oleh Badan Litbang Kehutanan dan Komatsu (Sakai dan Subiakto. Pada pengujian tahap kedua.Uji Produksi Bibit . 2007.0083) terhadap persen jadi stek. Subiakto dan Sakai. adapun perlakuan yang diuji adalah tiga jenis media (arang sekam padi. penyungkupan harus rapat agar kelembaban dalam sungkup dapat dijaga pada level di atas 95%.. yaitu cahaya. dkk. Pembuatan stek dinilai dapat diusahakan secara ekonomis bila persen jadi mencapai 70% (Subiakto dan Sakai. Hasil pengujian menunjukkan media berpengaruh secara nyata (P Anova = 0. Teknologi ini mengatur kondisi lingkungan. Media terbaik adalah zeolit. Hasil pengujian ini membuktikan bahwa kelembaban tinggi di dalam sungkup mempengaruhi keberhasilan penanaman bibit cabutan.) Namun bila kotiledon telah luruh. Sungkup dapat dibuat dari plastik PVC transparan. penyiraman dikurangi menjadi satu kali seminggu. Hasil uji produksi stek gaharu disajikan pada Tabel 4. Zeolit merupakan media dengan porositas yang baik dan tidak ditumbuhi oleh cendawan 119 .6600) dalam persen jadi stek. maka dilakukan pengujian lebih lanjut. Mengingat persen jadi stek masih di bawah 70%. Demikian pula perlakuan wadah tanam tidak menunjukkan perbedaan nyata (P Anova = 0.(Atok Subiakto. Perlakuannya adalah jenis dan wadah tanam (tabur) stek. 2007).. dan zeolit). Uji produksi stek dilakukan dalam tiga tahap penelitian. namun persen berakar masih di bawah 70%. temperatur.. dan media pada tingkat optimal bagi pertumbuhan (Sakai et al. Ratarata persen jadi stek pada uji tahap pertama berkisar antara 4047%. Perlakuan jenis tidak menunjukkan perbedaan nyata (P Anova = 0. Penyimpanan bibit cabutan selama tiga hari masih memberikan hasil yang cukup baik (76%) bila penanamannya menggunakan sungkup.. pasir. 2007). B. kelembaban. Pada tahap pertama digunakan prosedur baku pembuatan stek. maka penanaman bibit cabutan harus melalui tahap penyungkupan.

microcarpa Perlakuan Tanpa pot-tray. media coco-peat : sekam = 2:1 Dengan pot-tray. media coco-peat : sekam = 2:1 Dengan pot-tray.0210). Tabel 4. siram 1 kali seminggu Media cocopeat : sekam = 1:1. microcarpa Campuran A. media coco-peat : sekam = 2:1 Media sekam bakar. penyiraman berpengaruh secara nyata terhadap persen berakar stek (P Anova = 0. crassna A. Hasil pengujian menunjukkan bahwa pada tingkat kepercayaan 5%. siram 3 kali seminggu. siram 3 kali seminggu. crassna dan A. microcarpa A. Penyiraman terbaik adalah dua kali seminggu dengan persen berakar 69%. siram 2 kali seminggu Media cocopeat : sekam = 1:1. Perlakuan yang diuji adalah tingkat penyiraman (1 kali seminggu. siram 1 kali seminggu Media cocopeat : sekam = 1:1.Aspek SILVIKULTUR ataupun alga. 2 kali seminggu. maka perlu dicoba media lain yang memiliki tingkat porositas relatif sama dengan zeolit. microcarpa Campuran A. microcarpa Campuran A. media coco-peat : sekam = 2:1 Tanpa pot-tray. siram 3 kali seminggu. crassna dan A. siram 1 kali seminggu Media zeolit. termasuk cendawan pembusuk. Pada pengujian ketiga digunakan media campuran cocopeat dan sekam padi yang telah disteril. crassna dan A. Persen berakar stek dari rangkaian uji produksi stek Tahapan riset 1 1 1 1 2 2 2 3 3 3 Spesies A. siram 3 kali seminggu Persen berakar (%) 40 42 44 47 17 31 55 53 69 49 120 . siram 3 kali seminggu. Karena zeolit adalah media yang berat dan relatif lebih mahal. microcarpa Campuran A. crassna A. crassna dan A. siram 1 kali seminggu Media pasir. Efek dari penyiraman adalah menyebabkan jenuhnya media dan meningkatkan pertumbuhan cendawan. dan 3 kali seminggu). microcarpa Campuran A. crassna dan A. microcarpa Campuran A. crassna dan A.

Penyiraman terbaik dilakukan dua kali dalam seminggu. dan D. Santoso. J. Badan Litbang Kehutanan. Makalah Temu Pakar Gaharu di Kanwil Dephut Propinsi NTB. In : Flora Malesiana (Van Steenis. Bogor. Rahman. Pedoman Pembuatan Stek Jenisjenis Dipterokarpa dengan KOFFCO System. C.G.Uji Produksi Bibit . Scent of Earth. dan M. C. Studi Etiologi Gubal Gaharu Pada Tanaman Ketimunan. Nuroniah. E. Series I. DAFTAR PUSTAKA Daijo. Hou.) KESIMPULAN 1. Walter-Noodhoff. IV-5 : 499-509. Benih gaharu tidak perlu disimpan dalam refrigerator. Res. Namun dengan mengantisipasi penurunan daya kecambah.G. com/scent-of-earth/alag. Subiakto. A. J. Groningen. Turjaman. Thymelaceae. Sakai.. Parman. ed). T. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil Gaharu Aquilaria microcarpa. C. D.. dan Y. W. Media terbaik untuk penyetekan gaharu adalah campuran antara serbuk kulit kelapa (cocopeat) dan sekam padi dengan perbandingan 1:1. URL:http://store.yahoo. Komatsu. Gunawan. For.. and A. Pembuatan stek gaharu tersebut dilaksanakan pada rumah kaca dengan KOFFCO system. Mataram. benih masih dapat disimpan selama dua bulan. 2..(Atok Subiakto. 2007. V.. 2007. Mulyaningsih. A. The Netherland. Vol. S. 6. 1996. dkk. H. Htn & KA. 1960. Oller. Mass Propagation Method from The Cutting of Three Dipterocarps Species.J. Persen kecambah terbaik diperoleh dari benih yang langsung dikecambahkan setelah pengunduhan. cukup disimpan pada suhu ruangan. Penanaman bibit cabutan menggunakan sungkup menghasilkan persen tumbuh lebih baik dibandingkan bila tidak menggunakan sungkup. 1-15. A. Sakai. p. Subiakto. 121 . Kamata. dan N. Pen. 2001....html (diakses : 5 Febuari 2001). 2002. 7:73-80. JICA.

In : Recalcitran Crop Seeds (Chin. JICA. Badan Litbang Kehutanan.. E. Turjaman. H.Aspek SILVIKULTUR Sidiyasa. 1980.. Tamai. 2006. Roberts. Jenis-Jenis Tumbuhan Penghasil Gaharu. Mycorrhiza 16 : 459-464. Bogor. K. H. King. Bogor. Kuala Lumpur. Malaysia. and M. Arbuscular Mycorrhizal Fungi Increased Early Growth of Two Timber Forest Product Species Dyera polyphylla and Aquilaria filaria Under Greenhouse Conditions. A. and E. F. 2007. Manajemen Persemaian KOFFCO System. dan C. 122 . 1987. 1-5. Makalah Utama Diskusi Pemanfaatan Kayu Kurang Dikenal. Cisarua. E. dan M.. Y. Santoso. BHD. eds). Sakai. H. Komatsu. M. W. Suharti. and Roberts. Tropical Press SDN. The Characteristic of Recalcitrant Seeds. Subiakto.

Graduate School of Agriculture. Di alam. sehingga untuk mencegah punahnya pohon penghasil gaharu. perburuan gaharu dilakukan secara agresif dan tidak bijaksana. dan minyak esensial untuk kegiatan keagaman.6 APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp. budaya. bahkan kegiatan sehari-hari. Division of Applied Bioscience. Aquilaria 123 . Hokkaido University Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu (dalam Bahasa Inggris dikenal dengan agarwood atau eaglewood) adalah kayu resin yang bernilai komersial tinggi karena digunakan sebagai dupa. of Ecological Chemistry. Cara perburuan ini mengancam kelestarian gaharu di habitat alaminya. Pohon penghasil gaharu yang ditemukan dengan ciri-ciri adanya lubang kecil yang disebut lubang semut. ditebang dan dipanen gaharunya. sejak November 1994. DI PERSEMAIAN Irnayuli R. Sitepu Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Yasuyuki Hashidoko Lab. bahan aditif minyak wangi.

seperti bakteri penghuni perakaran yang disebut rhizobakteri pemacu pertumbuhan tanaman (RPPT atau plant growth promoting rhizobacteria). Istilah RPPT digunakan untuk bakteri yang dapat membantu pertumbuhan tanaman melalui 124 . Agar ketersediaan produk gaharu dan pohon penghasil gaharu tidak punah dan untuk menjaga kesinambungan produksi gaharu yang lestari. Gaharu terjadi melalui proses patogenisitas di mana jenis patogen fungi tertentu menginfeksi jenis pohon tertentu dan sebagai respon terhadap serangan patogen. Malaysia. Filipina. Gaharu hasil budidaya diharapkan akan dapat memenuhi kebutuhan pasokan gaharu untuk ekspor ke negara-negara pemakai. produk unik ini juga dapat terjadi pada beberapa genus tanaman lainnya. pohon menghasilkan metabolit sekunder atau senyawa resin yang menyebabkan bau wangi ketika dibakar. Phaleria.49 (2004) mencatat ada 24 spesies yang termasuk genus Aquilaria dan tujuh spesies termasuk ke dalam genus Gyrinops. yaitu Aetoxylon.Aspek SILVIKULTUR dan Gyrinops. Selain ditemukan pada kedua genus di atas. Thailand. Kegiatan budidaya pohon penghasil gaharu tidak terlepas dari penyediaan bibit yang berkualitas tinggi. Kedua genus ini ditemukan tumbuh alami di paling tidak 12 negara. Enkleia.. dua genus pohon penghasil gaharu terpenting yang termasuk ke dalam famili Thymelaeaceae (Ordo: Myrtales dan Kelas: Magnoliopsida) telah masuk ke dalam daftar CITES (the Convention on the International Trade in Endangered Species of Wild Flora and Fauna). Vietnam. dan Papua New Guinea (Barden et al. Lao PRD. Wikstroemia. Myanmar. Kamboja. 2004). Gonystylus. Lain halnya dengan komoditas pertanian yang langsung ditanam di lapangan. termasuk Bangladesh. Butan. Budidaya merupakan kunci utama dalam meningkatkan produksi gaharu yang semakin menipis. Appendix II TRAFFIC-CITES-CoP13 Prop. penggunaan biji yang bermutu baik dan inokulasi mikroba yang dapat memacu pertumbuhan. perlu upaya budidaya pohon penghasil gaharu. Keberadaan gaharu semakin menipis di alam. persiapan bibit kehutanan dilakukan mulai di persemaian. Upaya peningkatan mutu bibit di persemaian dapat dilakukan dengan pemupukan. Indonesia. dalam Gunn et al.

. Namun. 1995. Mekanisme ini meliputi produksi fitohormon. membantu proses terbentuknya mikoriza. dan diduga adalah produksi fitohormon oleh bakteri penambat nitrogen tersebut. baik secara langsung maupun tidak langsung (Glick. Narula et al... misalnya dapat memproduksi tiga jenis fitohormon. 2006). dan kinetin. Di antara mekanisme ini. dan sitokinin (berbagai sumber dalam Narula et al. bakteri terlebih dahulu diseleksi secara in vitro untuk 125 . Barbieri et al. giberelin (AG). Sedangkan Azospirillum chroococcum diketahui dapat memproduksi AIA. maka dilakukan penelitian uji aplikasi bakteri penghasil AIA/auksin dalam memacu pertumbuhan bibit penghasil gaharu Aquilaria sp.. penambatan nitrogen. Sitepu. 2006). AG. sehingga respon peningkatan pertumbuhan tanaman disebabkan oleh mekanisme lain dan bukan nitrogen.(Irna R. 1994. sequestration besi oleh siderofor. 2006). di persemaian. (2005) melaporkan bahwa Azospirilum brazilance meningkatkan jumlah dan panjang akar lateral. (2006) mengatakan bahwa dalam studi pemanfaatan bakteri penambat nitrogen untuk meningkatkan produksi tanaman. Kokalis-Burelle et al. Lucy et al. dkk) mekanisme yang beragam. sampai saat ini informasi penelitian tentang pemanfaatan bakteri fitohormon untuk tanaman kehutanan di daerah tropis masih terbatas. yaitu asam indol asetat (AIA/auksin). kandungan nitrogen pada tanaman yang diinokulasi tidak meningkat secara myata. 2004).. (1986) dalam Ahmad et al. Mikroorganisme yang menghuni rhizosfir berbagai macam tanaman umumnya memproduksi auksin sebagai metabolit sekunder sebagai respon terhadap suplai eksudat akar yang berlimpah di zona perakaran. yang dikenal sebagai bakteri penambat nitrogen. Dikatakan bahwa bakteri penghasil hormon pertumbuhan diduga memegang peranan penting dalam memacu pertumbuhan tanaman.. Glick. 1995. dan pencegahan terjadinya serangan patogen tular tanah (Garbaye.. Azospirillum sp.. Sedangkan Pseudomonas putida GR12-2 pada bibit canola meningkatkan panjang akar sampai tiga kali lipat.Aplikasi Rhizobakteri Penghasil . Untuk menguji hipotesa ini. Dalam penelitian ini. solubilisasi atau mineralisasi fosfat. fitohormon mendapatkan perhatian penelitian karena aplikasi bakteri penghasil fitohormon dilaporkan meningkatkan produksi tanaman inang secara berkesinambungan (Narula et al.

media ditumpuk dengan membran nitrocellulose berukuran pori 0. 2002)..Aspek SILVIKULTUR mengetahui kapasitasnya sebagai bakteri penghasil fitohormon AIA/auksin. 126 . membran dipindahkan dan ditumpuk pada kertas saring berdiameter 55 mm No. 2. Seleksi awal rhizobakteri secara in vitro dilakukan untuk mengetahui kemampuannya dalam memproduksi fitohormon (asam indol asetat-AIA) melalui karakterisasi kualitatif dan kuantitatif. 1112F (5 GTCCCGCAACGAGCGCAAC 3). diameter 47 mm. Analisa sekuens DNA menggunakan BigDye Terminator v3.1 cycle (Applied Biosystems.. yaitu: 1. dan/atau 1080RM (5 ACGAGCTGACGACA 3). USA) dengan empat pilihan primer. 926F (5 AAACTCAAAGGAATTGACGG 3). Katakterisasi kualitatif menggunakan metode colorimetric Brick et al. (1991). 518R (5 GTATTACCGCGGCTGCTGG 3). Setelah inkubasi selama 3 hari.45mm. Bakteri Penghasil Fitohormon: Identifikasi. (1991) yang dimodifikasi sebagai berikut: Rhizobakteri ditumbuhkan dalam media agar Winogradsky’s yang dimodifikasi (AWM) yang diberi 100 mg/L L-tryptophan (C 11H 12N 2O 2).2 yang mengandung 1% sukrosa sebagai sumber karbon dan 0. Segera setelah agar diinokulasi rhizobakteri. Homologi sekuens ditelusuri dengan menggunakan BLASTN online DNA database in National Center for Bio-technology Information (NCBI). Foste City. Toyo Roshi Kaisha Ltd.3% gellan gum sebagai bahan pemadat (Hashidoko et al. dan diinkubasi dalam gelap pada suhu 28°C.6-6. 4. 2 (Advantec. Rhizobakteri ini kemudian diidentifikasi secara molekuler mengikuti metode Weisburg et al. Karakterisasi in vitro dan Persiapan Inokulum Rhizobakteri diisolasi dari rhizosfir dan rhizoplan bibit atau sapling menggunakan media campuran mineral Winogradsky’s bebas N dengan pH 5. BAHAN DAN METODE A. 3.

Rhizobakteri yang membentuk cincin halo berwarna merah muda sampai merah pekat digunakan untuk uji kuantitatif AIA. uji lanjutan pada V. radiata tidak menunjukkan adanya korelasi yang positif antara intensitas kepekatan warna merah dengan laju pertumbuhan tanaman (tinggi dan total panjang akar). Perubahan warna diamati setelah 30 menit kemudian. Dari ketiga uji pendahuluan untuk mendapatkan bakteri penghasil AIA. digunakan juga satu isolat bakteri pemacu asosiasi mikoriza. Namun demikian. Selain itu. Setelah 0. dan merah tua. Rhizobakteri dikulturkan pada media MW cair yang ditambah dengan 100mg/L L-tryptophan dan diinkubasikan pada suhu 28°C dalam kondisi statis di dalam gelap selama 7 hari... diketahui berasosiasi dengan fungi mikoriza arbuskula. dkk) Tokyo. Glickmann dan Dessaux (1995) menyatakan bahwa larutan Salkowsky memberikan respon positif tidak hanya terhadap auksin (IAA) melainkan juga terhadap asam indolpirufat dan indoleacetamide. 127 . Sedangkan karakterisasi AIA secara kuantitatif dilakukan mengikuti metode Narula (2004). Rhizobakteri yang mampu memproduksi AIA akan membentuk cincin halo warna merah di sekitar koloni.5 jam.Aplikasi Rhizobakteri Penghasil .. Tidak adanya korelasi yang spesifik ini mengindikasikan bahwa kepekatan warna merah bukan merupakan indikasi tingginya kuantitas IAA yang dihasilkan. melainkan diduga merupakan indikasi perbedaan/variasi derifat dari senyawa indol yang dikonversi dari L-triptophan. maka dipilih sembilan bakteri (Tabel 1). yaitu Chromobacterium sp. Sitepu. Intensitas warna yang terbentuk. pembentukan warna dibaca pada A665nm. untuk mengetahui kemampuan bakteri dalam membantu terbentuknya asosiasi mikoriza pada bibit Aquilaria sp. kemudian dikelompokkan menjadi merah muda.(Irna R. merah.. CK8 karena Aquilaria sp. Strain rhizobakteri yang bereaksi positif dengan larutan Salkowski kemudian diuji untuk mengetahui kemampuannya dalam memacu pertumbuhan akar Vigna radiata sebagai tanaman uji. Japan) yang telah direndam sebelumnya dalam larutan Salkowski. Kemudian larutan Salkowski ditambahkan pada supernatant kultur rhizobakteri.

Aspek SILVIKULTUR B. diameter. Inokulasi dilakukan pada bibit yang berumur 4 minggu dengan cara merendam bibit dalam larutan bakteri selama 30 menit. CK34 Bacillus sp. Rizoplan S. setelah itu kultur bakteri agak dikentalkan dengan menambahkan 0. Tabel 1. Rizoplan Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Hopea sp. CK67 NI CK53 NI CK54 Proteobacteria S. dan bobot kering biomassa. teysmanniana Rizoplan Sapling ~1th Bibit~ 6 bln Nyaru Menteng Nyaru Menteng Pembi-bitan UP Nyaru Menteng Serratia sp. Pada saat penanaman. teysmanniana Rizoplan Rizoplan Rizoplan Merah muda Merah muda Merah muda pupus Merah muda pupus Merah muda pupus Merah tua Merah tua Merah muda Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Burkholderia Proteosp. CK26 Sub kelas Proteobacteria Bacilli Proteobacteria Hasil analisa colorimetric AIA Merah Inang Substrat Sta-dium Asal lokasi Dipterocarpus sp. NI: bakteri yang belum teridentifikasi. CK8 (DQ195926) Proteobacteria * Catatan: S: Shorea. * isolat mycorrhization helper bacteria. teysmanniana S. kemudian ditanam dalam polybag yang berisi 500 g media tanah yang tidak steril. 1 ml larutan bakteri juga disebarkan di daerah perakaran. H: Hopea. CK59 bacteria (DQ195914) Dipterocarpus sp.5% gellan gum selama 30 menit. Sel bakteri yang ditumbuhkan pada media cair MW + 100 mg/L L-tryptophan diinkubasi dengan menggoyang selama 3 hari pada suhu 28ºC. balangeran S. S. CK41 Azospirillum sp. Informasi bakteri PGPR penghasil fitohormon yang digunakan sebagai inokulum Strain bakteri Stenotrophomonas sp. AIA: asam indol asetat 128 . Inokulasi Bakteri Fitohormon pada Bibit Aquilaria sp. CK28 bacteria (DQ195889) Burkholderia Proteosp.5 th NI CK 61 Chromobacterium sp. Bibit ditumbuhkan di rumah kaca dan disiram setiap hari dengan air keran. Pengamatan dilakukan terhadap tinggi. parviflora Rizoplan Rizoplan Sapling ~1 bln Sapling ~1. UP: Universitas Palangkaraya.

Sitepu. Data yang berbeda nyata diuji lanjut dengan Least Significant Difference untuk mengelompokkan perlakuan yang tidak berbeda nyata. diameter.. dkk) a b Gambar 1. indeks mutu bibit.(Irna R.0 (SPSS Inc...Aplikasi Rhizobakteri Penghasil .. dan persentase peningkatan pertumbuhan. yaitu 10 isolat bakteri. Rancangan Percobaan dan Analisa Data Penelitian menggunakan rancangan acak lengkap dengan faktor tunggal. Warna merah yang terbentuk di sekitar koloni setelah direaksikan dengan reagen Salkowski (a): Pembentukan warna pada membrane nitroselulose 3 hari setelah inkubasi. yang masing-masing diulang sebanyak 10 bibit per perlakuan. Parameter yang diukur untuk mengetahui respon bibit terhadap inokulasi. Analisa persentase peningkatan pertumbuhan dilakukan sebagai berikut: %Peningkatan = Bibit yang diinokulasi bibit kontrol Bibit kontrol x 100% 129 .. yaitu tinggi. USA). berat kering total. (b): Pembentukan warna pada media cair. Data dianalisa secara statistik dengan analisa sidik ragam menggunakan program SPSS®version 10. Bakteri NICK53 yang membentuk warna merah tua dibanding dengan kontrol media tanpa bakteri C. Chicago.

yaitu Burkholderia sp. Kalimantan Tengah.05).2-38. Dijelaskan bahwa tanaman hutan pertumbuhannya jauh lebih lambat dari tanaman pertanian sehingga untuk pertumbuhan stadium awal di persemaian. Pada habitat hutan yang rimbun dengan kanopi yang bertingkat. parviflora umur kurang lebih 1. Peningkatan pertumbuhan tinggi bibit Aquilaria sp. Pertumbuhan diameter tidak menunjukkan respon yang konsisten terhadap inokulasi (Tabel 2). berkisar antara 12. netral atau negatif terhadap pertumbuhan tanaman jika dibandingkan dengan tanaman yang tidak diinokulasi (kontrol negatif ). CK8 (DQ195926. Semua bibit yang diinokulasi secara signifikan memiliki pertumbuhan tinggi yang lebih baik daripada tanaman kontrol melalui analisa Least Significant Difference (LSD). CK28 (DQ195889.5 tahun dari arboretum Nyaru Menteng.Aspek SILVIKULTUR HASIL DAN PEMBAHASAN Bibit Aquilaria sp. Respon tanaman diamati melalui pertumbuhan tinggi dan diameter setiap bulannya. Bakteri fitohormon memberikan pengaruh nyata terhadap tinggi tanaman mulai 1-5 bulan setelah inokulasi (P < 0. bibit yang tumbuh di lantai hutan perlu memiliki kemampuan untuk segera tumbuh tinggi bersaing dengan bibit di sekitarnya untuk mendapatkan cahaya agar dapat tumbuh baik. β Proteobacteria) merupakan isolat yang paling konsisten dalam memberikan pengaruh paling efektif dalam meningkatkan pertumbuhan tinggi selama lima bulan setelah inokulasi (Gambar 2). β Proteobacteria) dan Chromobacterium sp. menunjukkan respon beragam terhadap inokulasi bakteri fitohormon (Gambar 2). tinggi merupakan parameter yang reliable untuk mengamati respon bibit terhadap inokulasi mikroba pemacu pertumbuhan. Dua isolat bakteri. 130 . Kedua bakteri ini berasal dari rhizoplan S. Respon yang serupa juga telah dilaporkan oleh Sitepu et al. (2007) bahwa respon diameter bibit Shorea selanica terhadap inokulasi RPPT tidak konsisten.7% dibandingkan dengan bibit yang tidak diinokulasi pada lima bulan setelah inokulasi. Bakteri fitohormon memberikan pengaruh positif. teysmanniana umur kurang lebih 1 tahun dan S.

enam bulan setelah inokulasi.. Pengaruh bakteri PGPR terhadap pertumbuhan tinggi bibit Aquilaria sp.Aplikasi Rhizobakteri Penghasil . Diduga tidak adanya respon bibit yang nyata pada bulan keenam dan selanjutnya disebabkan karena bibit telah terinfeksi oleh fungi mikoriza secara alami yang dapat berasal dari tanah maupun air yang dipakai untuk menyiram tanaman walaupun analisa infeksi mikoriza alami tidak dilakukan. kemudian bebas untuk berinteraksi dengan bakteri yang diinokulasikan. Tidak responnya bibit terhadap bakteri. Sitepu. 1990. Yazid et al. tidak disterilisasi pada saat inokulasi bakteri sehingga mikroba alami yang terdapat dalam tanah. yaitu Shorea leprosula. ditumbuhkan di bawah tegakan meranti di Hutan Penelitian Dramaga. sampai 5 bulan setelah inokulasi. Fungi mikoriza dilaporkan baru berperan efektif tujuh bulan setelah inokulasi pada tanaman dipterokarpa. Shorea acuminata... Inokulasi juga tidak berpengaruh terhadap pertumbuhan setelah bibit dipindah ke lapangan. rasio pucuk terhadap akar.. Bibit Aquilaria sp. dapat dijelaskan sebagai berikut: Tanah sebagai media tumbuh dan bibit Aquilaria sp.. Hopea odorata. 1994. bibit cenderung tumbuh lambat (Tabel 2). dkk) Gambar 2.. dan indeks mutu bibit (Gambar 3 dan Gambar 4). juga terhadap berat kering total. enam bulan setelah inokulasi. 2005). Turjaman et al. 131 .(Irna R. dan Shorea pinanga (Lee. Angka di atas notasi adalah peningkatan pertumbuhan dibanding kontrol Inokulasi tidak memberikan pengaruh nyata terhadap pertumbuhan tinggi.

Tabel 1. Berat kering total bibit Aquilaria sp. yang diinokulasi bakteri 132 . Analisa sidik ragam pada parameter pertumbuhan yang diukur Parameter Diameter (mm) Tinggi (cm) Berat Kering Pucuk (g) Berat Kering akar (g) Berat Kering Total (g) Rasio P/A Indeks Mutu Bibit tn * tn * Analisa sidik ragam * * tn tn tn tn tn * * tn * tn tn Catatan: tn: tidak nyata pada taraf 0.05 *: nyata pada taraf 0.Aspek SILVIKULTUR Tabel 2.05. P/A: Pucuk/akar Gambar 3.

Pengaruh tidak langsung dari inokulasi RPPT berupa pembentukan asosiasi mikoriza (disebut sebagai mycorrhizal helper bacteria. Brule et al. yaitu Chromobacterium sp.. 133 . CK8 adalah bakteri yang telah diuji secara in vitro dapat membantu pertumbuhan miselia fungi ektomikoriza Laccaria sp.Aplikasi Rhizobakteri Penghasil . pengaruh mikoriza dimulai lebih awal. Bakteri tertentu dapat berperan dalam merangsang terbentuknya asosiasi mikoriza antara fungi mikoriza dan tanaman inangnya. Pseudomonas fluorescense BBc6R8 memacu simbiosis antara Laccaria bicolor S238N-Douglas fir (Pseudotsuga menziesii) dan efek dari bakteri MHB ini paling efektif pada saat fungi mikoriza tumbuh berada pada kondisi yang tidak optimal (Garbaye. Salah satu dari kedua inokulan yang paling efektif. 2001). Sitepu. dkk) Gambar 4.. Penelitian yang dilakukan oleh Poole et al.. monteilii meningkatkan biomassa fungi di dalam tanah (Founoune et al. MHB) juga telah dilaporkan. 1994. yaitu pada enam bulan setelah inokulasi. Gambar 4. Burkholderia sp.. 2002). (2001) menyatakan bahwa bakteri Paenibacillus sp.(Irna R. merangsang infeksi ektomikoriza pada tahapan pembentukan akar lateral antara Laccaria rufus dan Pinus sylvestris. dalam penelitian ini. Penelitian yang dilakukan oleh Enebak et al... dan Rhodococcus sp. Sedangkan Paenibacillus monteilii dan Paenibacillus resinovorans memacu simbiosis antara Pisolithus alba dengan Acacia holosericea di mana P. (1998) pada bibit loblolly dan slash pine melaporkan bahwa inokulasi RPPT meningkatkan biomassa tegakan.. yang diinokulasi bakteri Pada bibit Aquiliaria sp.. Indeks mutu bibit Aquilaria sp.

(2004) menunjukkan bahwa inokulasi ganda fungi mikoriza arbuskula dan bakteri Azotobacter dengan tambahan asam indol butirat secara nyata meningkatkan survival rate sapling Morus alba (Moraceae) yang ditanam pada kondisi yang bergaram tinggi dari 25-50%. pendekatan yang dilakukan adalah menyeleksi bakteri secara in vitro terlebih dahulu sebelum dilakukan uji pada tanaman target di persemaian. maka perlu uji lebih lanjut untuk mengetahui pengaruh inokulasi ganda antara bakteri dan fungi mikoriza arbuskula dalam memacu pertumbuhan bibit. dan apakah hipotesa di atas benar. baik di persemaian maupun di lapangan. segera setelah inokulasi berturut-turut selama lima bulan. Respon pertumbuhan bibit Aquilaria sp. menunjukkan respon beragam terhadap inokulasi bakteri penghasil fitohormon.Aspek SILVIKULTUR Untuk mengetahui apakah fenomena MHB ini juga berlaku untuk Aquilaria sp. KESIMPULAN Bibit Aquilaria sp. Penelitian yang dilakukan oleh Kashyap et al. Dalam hal ini bibit bermikroba dapat meningkatkan ketahanan tumbuh tanaman pada kondisi ekstrim. terutama dalam menyeleksi isolat dalam jumlah besar sebelum dilakukan uji selanjutnya.7% dibandingkan dengan bibit yang tidak diinokulasi. Dalam penelitian ini. Inokulasi bakteri penghasil fitohormon dapat meningkatkan tinggi bibit Aquilaria sp. Uji in vitro merupakan metode yang praktis. CK28 dan Chromobacterium sp. 134 . Uji lanjutan inokulasi ganda dengan fungi mikoriza arbuskula perlu dilakukan untuk mengetahui mikroba yang berperan dalam memacu pertumbuhan bibit pada stadia lanjut di persemaian sebelum dipindah ke lapangan. Dari hasil in vitro didapat sembilan bakteri penghasil indol yang kemudian diuji lanjut pada bibit Aquilaria sp. Dua isolat Burkholderia sp. CK8 adalah dua bakteri yang secara konsisten memacu pertumbuhan tinggi. terhadap inokulasi menghasilkan satu bakteri penghasil indol yang efektif. CK28 yang menghasilkan warna pink muda pada uji colorimetric. Peningkatan pertumbuhan tinggi bervariasi dari 12.2-38. yaitu Burkholderia sp.

. Frey-Klett. Gerard. G. Neyra.S.. Lemoine. Lorquin..(Irna R.... E. M. J.A.M.W. dkk) Ucapan Terimakasih Para penulis mengucapkan terimakasih kepada Bapak Ahmad Yani dan Bapak Zaenal yang telah membantu pengukuran dan perawatan tanaman di Hutan Penelitian Dramaga. Effect of plant growthpromoting rhizobacteria on loblolly and slash pine seedlings. C. Bostock. Khan. Forest Science 44: 139-144. J. and S. A critical examination of the specificity of the Salkowski reagent for indolic compounds produced by phytopathogenic bacteria. Soil Biology and Bio-chemistry 33: 1683-1694. A. 2005. Helper bacteria: a new dimension to the mycorrhizal symbiosis. Courrier. Enebak. 1991. F. Applied and Environmental Microbiology 57: 535-538. I.. Dessaux. 135 . 1995. and J. Glickmann. Ba. New Phytologist 128: 197-210. Branget. M.M. J.. Rapid in situ assay for indoleacetic acid production by bacteria immobilized on a nitrocellulose membrane.L. I. Canadian Journal of Microbiology 41: 109-117.L. Sall. Chotte. Pierrat. S. G. and J.. H. The enhancement of plant growth by free-living bacteria. Garbaye. R.M. P. R. 1995. Ahmad. Brulé. Wei.R. 2002. Glick. Silverstone. DAFTAR PUSTAKA Ahmad. S. Garbaye. 2001. and J. 1994. Duponnois. Indole acetic acid production by the indigenous isolates of Azotobacter and fluorescent Pseudomonas in the presence and absence of tryptophan. J. F. J. Sommer. Brick. Survival in the soil of the ectomycorrhizal fungus Laccaria bicolor and the effects of mycorrhiza helper Pseudomonas fluorescens. Mycorrhiza Helper Bacteria stimulate ectomycorrhizal symbiosis of Acacia holosericea with Pisolithus alba. Kloepper.C. 1998. and Y.E. Rousselet. Sitepu. B.C. Applied Environmental Microbiology 61: 793-796. dan M.Aplikasi Rhizobakteri Penghasil . S. New Phytologist 153: 81-89. Founoune. Turkish Journal of Biology 29: 29-34.

J. free-living nitrogen-fixing bacteria inhabiting the rhizoplane of plants. S. I. Applications of free living plant growth-promoting rhizobacteria. J. Plant Soil Environment 52:119-129.M. Paranodules and colonization of wheat roots by phytohormone producing bacteria in soil. Osaki. Turjaman. Kloepper. Screening of plant-growth promoting rhizobacteria from Dipterocarpaceae plants growing in Indonesian tropical rain forests. W. Whipps.. Reddy. The mycorrhizal association of the Dipterocarpaceae in the tropical rain forests of Malaysia. Tawaraya. Poole. P. Hokkaido University. and M. Biofertilizer technology-A manual. Hisar..R. Merbach. Tamai.Aspek SILVIKULTUR Gunn. Antonie van Leeuwenhoek 86: 1-25. Hashidoko. Reed. Narula. Canberra. Resource Management in Asia-Pacific Working Paper No. N. India. 2006. PhD Dissertation. Kokalis-Burelle.J. Lucy. Limin. 2004.K.S. Y. The Australian National University. 1990. 2006. Y. and B. 2005. E. Applied Soil Ecology 31: 91-100.Y. Bending.H. 2004. Soft gel medium solidified with gellan gum for preliminary screening for rootassociating. Glick. Department of Microbiology. G. N. and investigations of their functions on seedling growth. Sunari. AMBIO 19: 383-385. Cha. Bacteria associated with Pinus sylvestris-Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro. New Phytologist 151: 743-751.67. R. pp.S. 2002. M. Tada. Plant growth-promoting rhizobacteria as transplants amendments and their effects on indigenous rhizo-sphere microorganisms.. M. S. Singadan. Lee. and S. Tahara. Read. 2004. L. J.W. and D. Segah. B. Eaglewood in Papua New Guinea. J. and P. M. Stevens. Gans.. M. 18 pp. M. Behl. E. Narula. Inoculation with the ectomycorrhizal fungi 136 . M.51. and W. 2007. Sitepu. Deubel.. H. Osaki. N. CCS Haryana Agricultural University. A. Chatterton..R. 2001.V. 91 pp.. Bio-science Biotechnology Biochemistry 66: 2259–2263. and K.D.

16S ribosomal DNA amplification for phylogenic study. Barns.M. 137 . S. W. Lapeyrie. Forest Ecology Management 67: 339-343. Yazid. S. 1994.S..J.. Growth stimulition of Hopea spp. S.. Lee. Sitepu.M. Journal of Bacteriology 173: 697-707. and F.. Weisburg. Lane. and D. New Forest 30: 67-73.A. G. dkk) Pisolithus arhizus and Scleroderma sp. D. Pelletier.. (Dipterocarpaceae) seedlings following ectomycorrhizal inoculation with an exotic strain of Pisolithus tinctorius.(Irna R.Aplikasi Rhizobakteri Penghasil . improves early growth of Shorea pinanga nursery seedlings. 1991..

138 .

Najmulah. Enkleia. Irianto. Thailand. Sitepu. Karena disebabkan tingginya nilai produk gaharu. Cambodia. Gonystylus. China.. Vietnam. Jenis-jenis Aquilaria pada umumnya banyak dijumpai pada hutan-hutan primer dan sekunder dataran rendah di Indonesia. Sugeng Sentosa. Bhutan. Myanmar. Gyrinops. Bangladesh. Wikstroemia.. Jenis-jenis ini merupakan sumber utama dari kayu gaharu (semacam kayu yang 139 . Phaleria. Gyrinops. dan Aquilaria yang memproduksi gaharu (Ding Hou. Ragil S. Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Salah satu famili pohon tropika yang sekarang menjadi perhatian dunia internasional adalah Thymelaeaceae. 1960). maka jenisjenis ini mengalami kelebihan pemanenan di seluruh kawasan Asia selama 20 tahun terakhir (Paoli et al. Thymeleaceae terdiri dari 50 genera dengan Aetoxylon. Oyen dan Dung. 1999). Papua Nugini. Aryanto. Malaysia.B. 2001). Irnayuli R. India.7 PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman. Pada saat ini Aquilaria. 1998. dan Filipina. Famili pohon ini sangat penting karena menghasilkan produk gaharu dan kayu mewah untuk masyarakat di sekitar kawasan hutan di kawasan Asia (Lemmens et al. dan Gonystylus dimasukkan ke dalam CITES (Convention on the International Trade in Endangered Species) Appendix II (CITES 2005). Ahmad Yani.

Pada saat ini kegiatan reforestasi memproduksi ratusan juta bibit tanaman hutan setiap tahunnya. Produk gaharu biasanya digunakan sebagai bahan dasar parfum. sulit sekali untuk melakukan pengaturan perlindungan genus ini dan termasuk juga dalam pengaturan kelestarian produksi gaharu alami. Tectona grandis (Rajan et al. dan produk komersial lainnya (Eurling dan Gravendeel. Penggunaan bibit tanaman hutan yang vigor sangat diperlukan dalam kegiatan reforestasi. sebab pada umumnya kondisi lahan hutan tropika di Indonesia kahat unsur hara terutama N dan P. 11 jenis Eucalyptus (Adjoud et al. Zizyphus mauritiana (Guissou et al.. baik di tingkat persemaian maupun di lapangan. obat tradisional. Tujuan dari penelitian ini adalah menentukan tingkat pengaruh fungi mikoriza arbuskula pada jenis-jenis Aquilaria. 2004). jenis Aquilaria berkurang populasinya di alam. 2000). incence. Sesbania aegyptiaca dan S.. Telah banyak dilaporkan dalam beberapa jurnal internasional pentingnya pemanfaatan fungi mikoriza arbuskula dari beberapa jenis tanaman hutan yang berbeda untuk membantu kegiatan reforestasi. 140 . Namun demikian. 1998). Parkia biglobosa. Dari hasil studi literatur. Ketersediaan nutrisi tanah merupakan salah satu faktor pembatas untuk pertumbuhan awal dalam kegiatan penanaman bibit-bibit tanaman hutan pada kondisi lahan hutan yang terdegradasi (Santiago et al. Tamarindus indica. Fungi mikoriza arbuskula (FMA) telah diuji dengan hasil yang signifikan pertumbuhannya pada jenis Leucaena leucocephala (Michelsen dan Rosendahl. 2005). 2002). Pada kenyataannya ketersediaan bibit biasanya cenderung dibuat dengan kualitas rendah dan mengalami defisiensi unsur hara dan pada akhirnya mengalami kematian yang tinggi pada saat telah ditanam di tingkat lapang. grandiflora (Giri and Mukerji..Aspek SILVIKULTUR mempunyai resin wangi) yang termasuk dalam urutan teratas dari kelompok hasil hutan bukan kayu bernilai sangat tinggi yang berasal dari hutan tropika. 1990). belum dilaporkan adanya uji inokulasi fungi mikoriza arbuskula pada jenis-jenis Aquilaria. Pada tahap awal pertumbuhan jenis Aquilaria sering mengalami pertumbuhan yang lambat. 1996).

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

BAHAN DAN METODE
A. Perbenihan dan Perkecambahan
Benih Aquilaria crassna diperoleh dari Dramaga (Bogor), A. malaccensis dikoleksi dari Desa Gudang (Pulau Bangka), A. microcarpa dari Desa Mianas (Kalimantan Barat), A. beccariana berasal dari Sanggau (Kalimantan Barat). Semua benih Aquilaria spp. direndam selama dua jam, kemudian disterilisasi dengan sodium hypochlorit (5%) selama lima menit. Setelah disterilisasi, benih tersebut dicuci beberapa kali dengan air sampai bersih. Benih Aquilaria spp. dikecambahkan pada bak plastik yang berisi media zeolite. Benih Aquilaria spp. mulai berkecambah 21 hari setelah ditaburkan.

B. Media Semai
Jenis tanah ultisol diambil dari Hutan Penelitian Haurbentes, Jasinga dan kemudian disimpan di rumah kaca. Media semai tersebut disaring dengan diameter saringan lima mm. pH media adalah 4,7; P tersedia (Bray-1) adalah 0,17 mg kg-1, dan N total (Kjeldahl) was 1.7 mg kg-1. Kemudian media semai disterilisasi pada temperatur 121oC selama 30 menit.

C. Inokulum Mikoriza Arbuskula
Fungi mikoriza arbuskula, G. decipiens, G. clarum, Glomus sp. ZEA, dan Glomus sp. ACA diisolasi dari Desa Kalampangan, Palangkaraya, Kalimantan Tengah melalui teknik pot kultur. Teknik pot kultur dimulai dengan cara spora tunggal. Inang yang digunakan untuk mempropagasi FMA adalah Pueraria javanica. Pot plastik diisi dengan zeolite steril dan ditambahkan 5 g dari masingmasing jenis FMA. Kemudian ditanam benih P. javanica yang telah berumur enam hari pada pot plastik tersebut. Pot-pot disusun pada rak-rak besi di rumah kaca dan dipelihara selama 90 hari. Spora, hifa eksternal, dan akar yang terkolonisasi dari masing-masing jenis FMA diamati di bawah mikroskop.

141

Aspek SILVIKULTUR

D. Inokulasi FMA
Polybag (ukuran 15 cm x 10 cm) diisi tanah steril 500 g. Inokulasi FMA diberikan 5 g untuk setiap pot dan diletakkan dekat akar semai Aquilaria spp. Semai empat jenis Aquilaria yang tidak diinokulasi sebagai kontrol. Dari hasil penelitian pendahuluan, penggunaan inokulum steril tidak memberikan pengaruh pertumbuhan pada Aquilaria spp. Semai dipelihara dan disiram setiap hari pada kondisi rumah kaca dan diamati selama 6 bulan. Temperatur di rumah kacar berkisar antara 26-35oC dan kelembaban udara 8090%. Gulma dan hama yang mengganggu semai dimonitor setiap hari.

E. Parameter Pertumbuhan
Percobaan inokulasi pada jenis-jenis Aquilaria terdiri atas (a) kontrol (tanpa inokulum); (b) Entrophospora sp.; (c) G. decipiens; (d) G. clarum; (e) Glomus sp. ZEA; dan (f) Glomus sp. ACA. Desain penelitian dilakukan dengan rancangan acak lengkap (RAL) dengan 30 ulangan. Parameter yang diukur adalah tinggi, diameter, dan daya hidup semai. Setelah berumur enam bulan, dilakukan pemanenan pucuk dan akar semai Aquilaria. Semua sampel di-oven pada suhu 70oC selama tiga hari. Analisis N dan P jaringan semai dilakukan dengan metode semi-micro Kjeldahl dan vanadomolybdate-yellow assay (Olsen and Sommers, 1982). Pada tingkat lapang, percobaan yang dilakukan hanya pada jenis A. beccariana dengan desain RAL yang sama. Percobaan dilakukan di Kawasan Hutan Dengan Tujuan Khusus (KHDTK) Dramaga di bawah naungan tegakan Gmelina arborea. Paramater yang diamati pada tingkat lapang ini adalah tinggi dan diameter A. beccariana yang telah dilakukan selama dua tahun.

F. Kolonisasi Mikoriza Arbuskula
Akar dari masing-masing jenis Aquilaria dicuci untuk membersihkan partikel-partikel tanah yang masih menempel. Akar dibersihkan dalam 100 g l-1 KOH selama satu jam, diasamkan dalam larutan HCl dan diberi warna dengan 500 mg l -1 tryphan blue dalam lactoglycerol (Brundrett et al., 1996). Kemudian akar

142

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

dicuci dalam 50% glycerol dan 100 potong akar berukuran satu cm diamati di bawah mikroskop compound dengan perbesaran 200x. Penghitungan kolonisasi mikoriza dilakukan dengan sistem skoring keberadaan dan tidak adanya struktur FMA (McGonigle et al., 1990).

G. Analisis Statistik
Analisis statistik menggunakan ANOVA dengan software StatView 5.0 (Abacus Concepts). Sedangkan analisis statistik lanjutan menggunakan uji beda nyata terkecil (LSD) apabila nilai F signifikan.

HASIL DAN PEMBAHASAN
Lima jenis fungi mikoriza arbuskula (FMA) sangat efektif mengkolonisasi sistem perakaran dari A. crassna, A. malaccensis, A. Microcarpa, dan A. beccariana setelah enam bulan diinokulasi pada kondisi rumah kaca. Dari hasil penelitian sebelumnya Santoso et al. (2008), kolonisasi FMA yang terjadi pada akar bibit A. microcarpa dimulai sebelum minggu ke-7 setelah inokulasi. Tidak ada perbedaan nyata antara lima jenis FMA dalam mengkolonisasi perakaran empat jenis Aquilaria. Kolonisasi FMA dapat meningkatkan parameter pertumbuhan tinggi, diameter batang, berat kering, berat basah, dan daya hidup semai Aquilaria di persemaian (Tabel 1). Pada jenis A. crassna, A. Malaccensis, dan A. microcarpa, penggunaan FMA Entrophospora sp. lebih efektif meningkatkan parameter pertumbuhan dibandingkan jenis FMA lainnya. Khusus FMA G. clarum sangat efektif meningkatkan parameter pertumbuhan pada jenis A. beccariana. Semai yang tidak diinokulasi terkolonisasi oleh FMA yang tidak teridentifikasi (110%), tetapi tidak dapat mempengaruhi pertumbuhan empat jenis Aquilaria. Kolonisasi FMA mampu meningkatkan serapan N dan P pada jaringan empat jenis Aquilaria dibandingkan semai yang tidak diinokulasi (Tabel 2). Peningkatan serapan N dan P ini memberikan pengaruh pada peningkatan dari parameter pertumbuhan empat jenis Aquilaria. Pada tingkat lapang, dilakukan kegiatan penanaman hanya pada jenis A. beccariana dua tahun setelah diinokulasi oleh FMA. Hasil penelitian pada tingkat lapang menunjukkan bahwa

143

Aspek SILVIKULTUR

jenis G. clarum lebih efektif dalam meningkatkan pertumbuhan A. beccariana dibandingkan dengan kontrol dan jenis FMA lain yang telah diujicobakan. Dari hasil penelitian ini memberikan informasi yang sangat penting dalam memanfaatkan inokulum FMA pada jenis-jenis Aquilaria spp. Regenerasi jenis-jenis Aquilaria yang berkelanjutan dapat dibantu dengan adanya pemanfaatan teknologi FMA dimulai pada saat di persemaian. Penggunaan FMA yang efektif dapat meningkatkan pertumbuhan Aquilaria yang sangat signifikan, sehingga biomassa pohon penghasil gaharu yang akan dipanen akan meningkat, artinya produk gaharu hasil induksi yang akan dipanen lebih meningkat produksinya. Penelitian ini sejalan dengan penelitian yang terdahulu, yaitu tentang pemanfaatan FMA pada 11 jenis Eucalyptus spp. (Adjoud et al., 1996), 17 jenis tanaman legume (Duponnois et al., 2001), Sesbania aegyptiaca dan S. grandiflora (Giri dan Mukerji, 2004). Penelitian pemanfaatan FMA pada jenis-jenis pohon tropika (Muthukumar et al., 2001) dan khususnya jenis-jenis Aquilaria menunjukkan bahwa ada kemungkinan inokulum FMA dapat menurunkan penggunaan pupuk kimia di persemaian. Meskipun perhitungan tentang keuntungan dan biaya penggunaan FMA belum diuji dalam penelitian ini, hasilnya tidak diragukan lagi menunjukkan FMA dapat menurunkan penggunaan pupuk kimia dalam penyediaan semai tanaman penghasil gaharu. Selanjutnya mekanisme penggunaan FMA sebagai pemacu pertumbuhan jenisjenis Aquilaria pada tanah masam dan pada tanah yang populasi FMA sangat rendah harus menjadi perhatian dan pertimbangan untuk mengetahui keberadaan FMA alami. Pola penanaman jenis-jenis Aquilaria dengan pola agroforestry sangat membantu mempercepat ketersediaan pohon-pohon penghasil gaharu di Indonesia. Pada prinsipnya, pencampuran dilakukan untuk melindungi pertumbuhan semai Aquilaria pada tahun pertama dan kedua dari sengatan sinar matahari. Jenis-jenis Aquilaria yang telah dikolonisasi oleh FMA akan dapat mempunyai hubungan antara sistem perakaran pohon jenis-jenis lain, sehingga kebutuhan nutrisi untuk pertumbuhan gaharu dapat terpenuhi.

144

Ketersediaan inokulum FMA di tingkat 145 ... Pertumbuhan tinggi dan diameter pohon penghasil gaharu Aquilaria beccariana setelah dua tahun ditanam di tingkat lapang.) Jenis-jenis pohon yang direkomendasikan sebagai pohon pencampur dengan pohon penghasil gaharu adalah pohon karet. kelapa. ACA. dkk.. Khusus jenis pohon penghasil gaharu A.Aca = Glomus sp. jengkol. Gg = G.(Maman Turjaman. beccariana lebih memilih jenis FMA G. malaccensis. crassna. Jenis FMA Entrophospora sp.ZEA = Glomus sp.clarum. Direkomendasikan untuk menggunakan jenis FMA efektif untuk mempercepat pertumbuhan jenis-jenis Aquilaria mulai di tingkat persemaian. dan beberapa jenis lain pohon buah-buahan. decipiens. kelapa sawit. dan A. G. clarum untuk memacu pertumbuhan tanaman dan serapan nutrisinya. KESIMPULAN DAN REKOMENDASI 1. Ent = Entrophospora sp. baik di tingkat semaian maupun lapangan. Gambar 1. ZEA. melinjo.. G.Penggunaan Fungsi Mikoriza . K = Kontrol.. gmelina. 2. Penggunaan FMA pada jenis-jenis Aquilaria sangat signifikan dalam memacu pertumbuhan awal di persemaian dan lapangan. A. sangat efektif dalam memacu pertumbuhan tanaman dan serapan nurtisi pada jenis A. sengon. microcarpa. Gc = G.

agar penggunaan FMA menjadi efektif dan efisien. T. Pontanier (2005). Response of 11 Eucalyptus Species to Inoculation with Three Arbuscular Mycorrhizal Fungi. Inoculation of Acacia holosericea with Ectomycorrhizal Fungi in a Semiarid Site in Senegal : Growth Response and Influences on The Mycorrhizal Soil Infectivity After 2 Years Plantation. B. and Zizyphus mauritiana Lam. Canberra. H. p. Grove and N. II and III of CITES. Plenchette. R. In : Van Steenis. 1960. Plant Systematics and Evolution 254 : 1-12. Mycorrhiza 14 : 307-312. 48 pp. Appendices I. UNEP. Giri. Guisso. Thymelaeaceae.M. 146 . A. Ding Hou..G.G. TrnL-TrnF Sequence Data Imply Paraphyly of Aquilaria and Gyrinops (Thymelaeaceae) and Provide New Perspectives for Agarwood Identification. and K. Eurlings. B. Guinko and R. T.) Benth. The Netherlands. Series I.. Duponnois.G. Masse and R.J. N. M. DAFTAR PUSTAKA Adjoud. Mycorrhiza 6 : 129-135.. Halli-Hargas and F. Biology and Fertility Soils 26 : 194-198. Tamarindus indica L. Founoune. 1996. Wolters-Noordhoff. ACIAR Monograph 32. 1996. C. CITES. 2004. Lapeyrie. 6.C. Bougher. Brundrett. S. Duponnois. (ed) Flora Malesiana. D. Mukerji. Groningen. 1998. to Arbuscular Mycorrhizal Fungi in a Phosphorus-Deficient Sandy Soil. Convention on International Trade in Endangered Species of Wild Fauna and Flora.Aspek SILVIKULTUR pengguna dan sosialisasi penggunaanya perlu dilakukan. Responses of Parkia biglobosa (Jacq. Vol. C. Dell. Bâ. and B. R. Forest Ecology and Management 207 : 351-362..Ouadba. 1-15. J-M. Working with Mycorrhizas in Forestry and Agriculture. 2005. Mycorrhizal Inoculant Alleviates Salt Stress in Sesbania aegyptiaca and Sesbania grandiflora Under Field Conditions : Evidence for Reduced Sodium and Improved Magnesium Uptake. Malajczuk. D. M.M. Gravendeel. 2005.

). Bogor.K. D.H. Oyen.C.D.). American Society of Agronomy. Prosea.(Maman Turjaman.W. Response of Neem (Azadirachta indica A. 1990. Leighton and I. 2000. Paoli. 1982. 5 (2).. 2001.H. Bogor.X. Rosendhal. Reddy and D. McGonigle. 19.M. M. Phosphorus. I. Q. An Ecological and Economic Assessment of The Nontimber Forest Product Gaharu Wood in Gunung Palung National Park. Santoso. Michelsen. Ex Benth. and N. and Mycorrhizal Fungi on The Growth Brazilian Rosewood.. Muthukumar. Rajeshkannan. 2008. Evans.L. A New Method Which Gives an Objective Measure of Colonization of Roots by Vesicular-Arbuscular Mycorrhizal Fungi.G. R. 2002. G. B. and L.) Lemmens. T. Indonesia. Indonesia. Wong (Eds. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil 147 . Madison. Miller.A. in Two Tropical Soils.P. A. Dung (Eds. A. Juss) to Indigenous Arbuscular Mycorrhizal Fungi. 1998. Soerianegara and W. Samsoedin. Prosea.. Udaiyan and V.R. Essential-Oil Plants. The Effect of VA Mycorrhizal Fungi. and S. Turjaman.. D. p 403-430. In : Page AL (ed.A. New Phytologist 115 : 495-501. dkk.M.P. Gunawan dan M.. Effect of Post-Planting Inoculation with Bradyrhizobium sp.. G. S. 1990.. Garcia and M.) Methods of Soil Analysis Part 2 Chemical and Micro-biological Properties. Indonesia... Conservation Biology 15 : 1721-1732. T. Santiago.Penggunaan Fungsi Mikoriza . Bagyaraj.J. Dalbergia nigra Allem. K.E. Plant and Soil 124 : 7-13. S. Rajan. Scotti.J. Timber Trees : Minor Commercial Timbers. 2001. M. 1999. Plant Resources of South-East Asia No. Phosphorus and Drought Stress on The Growth of Acacia nilotica and Leucaena leucocephala Seedlings. E. Forest Ecology and Management 126: 91-95. Phosphate-Solubilizing and Asymbiotic Nitrogen-Fixing Bacteria Under Tropical Nursery Conditions. L. New Forests 24 : 15-25. Screening of Arbuscular Mycorrhizal Fungi for Their Symbiotic Efficiency with Tectona grandis. West Kalimantan.J. Biology and Fertility Soils 34 : 417-426 Olsen.. Sommers. G. Plant Resources of South-East Asia No.D..R. Swan. Fairchild and J.. Peart.R.

Jurnal Penelitian Hutan dan Konservasi Alam IV (5): 499-509. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam. 148 .Aspek SILVIKULTUR Gaharu. Bogor.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

Lampiran 1. Kolonisasi mikoriza arbuskula dan pertumbuhan pada jenisjenis Aquilaria setelah enam bulan pada kondisi di rumah kaca
Kolonisasi AM Tinggi (cm) Diameter (mm) Berat basah Pucuk (g) Akar (g) Berat kering Pucuk (g) Akar (g) Daya hidup (%)

Perlakuan

A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA 10a 85b 71b 79b 61b 84b 15,40a 19,20b 32,18d 45,30e 32,03d 26,24c 1,90a 2,37b 3,94c 5,02d 3,75c 3,53c 0,30a 5,46e 4,74d 6,74f 3,14b 3,84c 0,10a 2,54c 1,64b 2,82d 1,38c 1,20b 0,09a 1,76c 1,59c 2,30d 0,97b 1,19b 0,02a 0,78c 0,41b 0,91d 0,36b 0,28b 73 100 100 100 100 100 2a 97b 88b 83b 85b 87b 13,39a 24,74d 21,99c 20,28c 17,24b 18,09b 2,23a 3,89c 3,67c 3,58c 2,84b 2,98b 0,75a 4,32c 3,87c 3,46c 2,24b 2,70b 0,34a 2,29c 3,41d 1,55b 1,08b 1,23b 0,23a 1,31c 1,44c 0,95b 0,64b 0,76b 0,09a 0,37b 0,57c 0,30b 0,24b 0,28b 67 100 97 93 87 90 1a 97b 88b 83b 84b 86b 16,43a 25,97c 21,91b 19,96b 22,33b 21,30b 2,28a 3,88c 3,02b 2,94b 3,26b 3,12b 1,46a 4,68c 2,92b 2,90b 2,62b 2,74b 0,52a 2,24c 1,20b 1,28b 1,38b 1,22b 0,41a 1,44c 0,88b 1,95c 0,79b 0,89b 0,18a 0,48c 0,27b 0,78c 0,27b 0,26b 73 100 100 97 90 93 4a* 73b 63b 78b 78b 59b 20,90 a 46,14 c 29,58 b 32,43 b 38,94 c 24,60 a 2,9 a 5,4 c 4,1 b 4,4 b 4,7 b 3,7 a 0,68a 1,06a 0,33a 3,82b 3,26b 0,86a 2,99b 4,19b 0,13a 1,35b 1,56b 0,27a 1,01b 1,52b 70 100 100 100 87 100

12,58b 5,72b 11,64b 7,36b 8,82b 9,92b 4,3b 4,54b

13,46b 6,94b

149

Aspek SILVIKULTUR

Lampiran 2. Kandungan N dan P pada jenis-jenis Aquilaria setelah enam bulan diinokulasi oleh beberapa jenis fungi mikoriza arbuskula (FMA)
N Concentrations (mg/g) N Content (mg/plant) P Concentrations (mg/g) P Content (mg/plant)

Perlakuan A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA

7,9 ± 0,1a* 9,8 ± 0,1c 8,2 ± 0,2a 8,7 ± 0,2b 8,7 ± 0,1b 10,8 ± 0,2d

2,6 ± 0,6a 37,7 ± 4,3d 26,7 ± 4,1c 7,4 ± 1,0b 25,8 ± 3,6c 45,9 ± 9,6d

0,78 ± 0,02a 1,42 ± 0,03e 0,85 ± 0,02b 0,95 ± 0,02c 0,96 ± 0,03c 1,22 ± 0,02d

0,26 ± 0,06a 5,4 ± 0,6d 2,8 ± 0,5c 0,82 ± 0,14b 2,85 ± 0,41c 5,14 ± 1,0d

8,6 ± 0,2a 12,1 ± 0,1d 10,7 ± 0,1c 10,4 ± 0,1b 11,1 ± 0,2c 10,9 ± 0,2c

3,49 ± 0,5a 17,28 ± 2,0c 9,02 ± 0,7b 20,5 ± 3,3c 8,8 ± 0,9b 9,7 ± 1,8b

0,65 ± 0,02a 0,73 ± 0,01b 0,85 ± 0,01c 0,72 ± 0,02b 0,77 ± 0,03b 1,04 ± 0,03d

0,26 ± 0,04a 1,06 ± 0,15d 0,75 ± 0,07c 1,60 ± 0,20e 0,6 ± 0,07b 0,92 ± 0,17c

7,8 ± 0,1a 9,6 ± 0,2c 9,6 ± 0,1c 9,3 ± 0,1c 9,4 ± 0,1c 8,9 ± 0,2b

1,02 ± 0,07a 16,9 ± 1,5d 11,7 ± 0,9c 8,3 ± 0,4b 9,17 ± 1,35b 8,28 ± 0,40b

0,65 ± 0,02a 1,12 ± 0,03d 0,86 ± 0,01c 0,78 ± 0,02b 0,77 ± 0,03b 0,77 ± 0,02b

0,08 ± 0,01a 1,97 ± 0,18d 1,20 ± 0,18c 0,70 ± 0,03b 0,75 ± 0,12b 0,9 ± 0,1b

6,0 ± 0,1a 9,9 ± 0,2c 10,6 ± 0,1c 11,3 ± 0,d 9,4 ± 0,1b 8,8 ± 0,2b

5,02 ± 0,07a 10,2 ± 1,0c 11,8 ± 0,8c 12,5 ± 0,4d 9,17 ± 1,35b 9,28 ± 0,40b

0,40 ± 0,02a 0,98 ± 0,02d 0,89 ± 0,03c 1,11 ± 0,02e 0,77 ± 0,03b 0,97 ± 0,02d

0,10 ± 0,01a 0,87 ± 0,20d 1,25 ± 0,21c 1,95 ± 0,03e 0,75 ± 0,12b 1,04 ± 0,1c

*Nilai-nilai dengan huruf yang sama adalah tidak berbeda nyata (P<0.05).

150

8
HAMA PADA TANAMAN PENGHASIL GAHARU
Ragil SB Irianto, Erdy Santoso, Maman Turjaman, Irnayuli R. Sitepu
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Tanaman penghasil gaharu yang ada di Indonesia sekitar 27 jenis, beberapa di antaranya yang cukup potensial menghasilkan gaharu yaitu Aquilaria spp., Aetoxylontallum spp., Gyrinops spp., dan Gonystylus spp. Pemanfaatan gaharu di Indonesia oleh masyarakat terutama di pedalaman Pulau Sumatera dan Kalimantan telah berlangsung ratusan tahun yang lalu. Secara tradisional gaharu dimanfaatkan, antara lain dalam bentuk dupa untuk upacara keagamaan, pengharum tubuh dan ruangan, bahan kosmetik dan obat-obatan sederhana. Produk gaharu saat ini sangat dicari oleh para pencari gaharu, karena harganya yang cukup mahal, dimana harga gaharu super dapat mencapai sekitar Rp 40 juta/kg. Akibat dari harga yang cukup tinggi tersebut, maka para pencari gaharu semakin intensif untuk mendapatkannya, saat ini para pencari gaharu mulai memfokuskan mencari gaharu di Pulau Papua yang potensi alamnya (gaharu) masih cukup tinggi dibandingkan dengan di Pulau Kalimantan atau Sumatera.

151

Aspek SILVIKULTUR

Dengan semakin langkanya tanaman penghasil gaharu di lapang dan harganya yang cukup tinggi tersebut, maka para peneliti kehutanan, rimbawan, dan masyarakat awam mulai mendomestikasi atau menanam tanaman penghasil gaharu di luar habitat aslinya. Saat ini banyak sekali para petani maupun orang kota yang mulai menanam tanaman penghasil gaharu dalam skala kecil dari beberapa pohon sampai dengan ribuan pohon. Penanaman tanaman penghasil gaharu yang monokultur dan di luar habitat aslinya pada umumnya akan rentan terhadap serangan hama dan penyakit. Dimulai dua tahun yang lalu banyak sekali sentra penanaman tanaman penghasil gaharu yang terserang hama daun Heortia vitessoides Moore. Sentra penanaman tanaman penghasil gaharu yang terserang hama dan telah dilaporkan terdapat di KHDTK Carita (2008), Sanggau (2007), Mataram (2009), dan lain-lain.

HAMA Heortio vitessoides
A. Gejala Serangan
Gejala serangan tingkat awal adalah permukaan daun yang muda dimakan oleh larva instar pertama dan daun tersebut hanya meninggalkan tulang-tulang daunnya. Pada stadia lebih lanjut ulatulat tersebut mulai menyerang daun-daun pada bagian cabang lebih atasnya dan menyebabkan tanaman menjadi gundul. Ngengat meletakkan telurnya pada bagian bawah permukaan daun yang muda pada cabang tanaman yang dekat dengan permukaan tanah.

B. Siklus Hidup
1. Telur
Ngengat meletakkan telurnya yang berwarna putih kekuningkuningan yang akan segera berubah menjadi kuning kehijauhijauan dalam bentuk kluster pada bagian bawah permukaan daun

152

Siklus hidup hama daun tanaman penghasil gaharu H. Stadium pupa berkisar 8 hari. dkk. Stadium ngengat berkisar sekitar 4 hari.) yang muda pada cabang tanaman yang dekat dengan permukaan tanah..Hama pada Tanaman . jumlah telur yang dihasilkan per imago betina berkisar antara 350-500. 3.. Larva/Ulat Ulat H. vitessoides 153 . Pupa Larva instar terakhir sebelum berkepompong akan berhenti makan dan turun ke permukaan tanah dengan bantuan benang sutera yang dihasilkannya. ulat ini terdiri dari 5 instar dan berlangsung selama 23 hari. Larva instar terakhir pada saat akan berkepompong mulai berhenti makan dan ulat turun ke permukaan tanah untuk berkepompong..(Ragil SB Irianto. Ngengat (4 Hari) Kepompong (8 Hari) Telur (10 Hari) Larva (23 Hari) Gambar 1. Ngengat betina dapat meletakkan telur sebanyak 350-500. 4. Telur akan menetas sekitar 10 hari. 2. Ngengat Serangga dewasa berbentuk ngengat yang aktif pada waktu malam.. vitessoides pada instar pertama berwarna kuning pucat dan pada instar selanjutnya menjadi hijau kekuning-kuningan. Ulat akan membungkus dirinya dengan butiran-butiran tanah atau serpihan-serpihan serasah yang ada di permukaan dengan bantuan benang-benang suteranya.

dan lain-lain untuk merangsang tumbuhnya tunas-tunas baru.Aspek SILVIKULTUR STRATEGI PENGENDALIAN A. B. Pengendalian dengan cara ini mudah diaplikasikan terutama pada pesemaian atau bibit yang baru dua tahun. Karena hama ini memakan daun dan pada serangan berat umumnya tanaman gundul. sudah populer di tingkat petani. sistemik atau dengan insektisida yang berbahan aktif mikroorganisme. yaitu dengan cara mengambil ulat atau telur yang ada di tanaman tersebut. rambutan. 2. durian. dan lain-lain. Jangka Pendek 1. maka disarankan pada saat penyemprotan dikombinasikan dengan pemupukan lewat daun dengan pupuk daun seperti gandasil. Pencarian sarang semut rangrang yang memiliki ratu merupakan salah satu faktor 154 . Mekanis Pengendalian mekanis merupakan pengendalian yang sangat sederhana. Kimiawi Pengendalian kimiawi dapat dilakukan dengan insektisida kontak. 3. Jangka Menengah 1. seperti Beauveria bassiana atau Bacillus thuringiensis. melinjo. seperti tanaman nangka. Predator Rangrang Semut rangrang (Oecophylla smaradigna) merupakan serangga yang mudah ditemukan di kampung-kampung pada tanamantanaman yang banyak mengeluarkan nektar. dimana tanaman masih bisa dijangkau oleh orang dengan berdiri tanpa bantuan alat. growmore. Nabati Pengendalian nabati merupakan pengendalian yang cukup sederhana dan dapat dilakukan oleh petani sendiri dengan mengambil bahan-bahan yang ada di sekitar lokasi penanaman tanaman gaharu.

Jangka Panjang 1. ICRAF.. vitessoides merupakan suatu cara pengendalian yang sangat diharapkan dalam jangka panjang. C.(Ragil SB Irianto.. Bhattacharyya. Teknik Silvikultur Pengendalian dengan cara teknik silvikultur merupakan salah satu cara pengendalian yang sudah menyatu dengan penanaman suatu tanaman dan termasuk pengendalian yang sudah cukup dikenal oleh petani.Hama pada Tanaman . P. Geobios 29: 13-16. DAFTAR PUSTAKA Kalita. 155 . 2004. T. Cuc. 2002.. Mele. J. V. Nath. and S. C. Mele. T. Semut Sahabat Petani: Meningkatkan Hasil Buah-Buahan dan Menjaga Kelestarian Lingkungan Bersama Semut Rangrang. Heortia vitessoides Moore A Serious Pest of Agarwod Plant (Aquilaria malaccensis Lamk). dan N. Agricultural and Forest Entomology 10: 13-22.. Musuh Alami Musuh alami. P. 2008.. V. 2. A Historical Review of Research on The Weaver Ant Oecophylla in Biological Control. 59 p. R. P.) keberhasilan dalam perkembangan populasi serangga tersebut dalam jangka panjang. dkk. baik parasit maupun predator dari serangga perusak daun tanaman penghasil gaharu H.

156 .

Aspek SOSIAL EKONOMI DAN KONSERVASI 157 .

158 .

dan adlerholz (Jerman). Resin ini sebetulnya dapat melindungi tanaman dari infeksi yang lebih besar sehingga dapat dianggap sebagai sistim imun yang dihasilkan (Squidoo. Jika tanaman ini terluka. akan menghasilkan resin/substansi aromatik berupa gumpalan atau padatan berwarna coklat muda sampai coklat kehitaman yang terbentuk pada lapisan dalam dari jenis kayu tertentu sebagai reaksi dari infeksi/ luka tersebut. 2008). chenxiang (China). dan Gonystylus. oudh. aloeswood. rusak atau terinfeksi. pau d’aquila (Portugis). Gyrinops. baik disebabkan penyakit atau serangan serangga. gaharu (Indonesia). ood. Beberapa nama diberikan pada gaharu seperti agarwood. Tanaman penghasil gaharu secara alami tumbuh di wilayah Asia Selatan dan Asia Tenggara. bois d’aigle (Perancis). Aquilaria yang merupakan tanaman penghasil gaharu saat ini menjadi jenis yang dilindungi 159 . oodh (Arab).9 PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti Pusat Litbang Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu tanaman hutan yang mempunyai nilai ekonomi tinggi karena kayunya mengandung resin yang harum. Sejenis resin beraroma ini berasal dari tanaman jenis Aquilaria.

Sumatera Utara. 2008). Jambi. maka masyarakat yang mampu membudidayakan gaharu adalah kelompok yang memiliki permodalan yang kuat. Upaya pembudidayaan tersebut makin berkembang karena ditunjang oleh kemajuan hasil penelitian yang menunjukkan bahwa budidaya gaharu memberikan keuntungan yang layak bagi pelakunya. Sampai saat ini. tingginya harga gaharu dan makin langkanya tanaman gaharu di hutan alam juga mendorong masyarakat di berbagai daerah untuk melakukan budidaya gaharu seperti yang terjadi di Riau. Di Indonesia. Untuk mengembangkan budidaya gaharu secara lebih luas. Pengembangan budidaya gaharu dengan pola PHBM (sistem bagi hasil) merupakan salah satu alternatif bentuk usahatani produktif yang selain bertujuan untuk mengembangkan budidaya gaharu secara luas juga sekaligus dapat meningkatkan pendapatan masyarakat serta mengurangi tekanan masyarakat terhadap hutan yang tingkat ketergantungannya terhadap hutan tinggi.Aspek SOSIAL EKONOMI DAN KONSERVASI di banyak negara dan eksploitasi gaharu dari hutan alam dianggap sebagai kegiatan ilegal. PHBM diharapkan menjadi suatu cara yang efektif karena melibatkan masyarakat sekitar hutan dan parapihak pemangku 160 . dan Kalimantan Selatan. 2006). Kesepakatan internasional seperti CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) yang disepakati oleh 169 negara ditetapkan untuk menjamin bahwa perdagangan gaharu tidak mengganggu survival dari Aquilaria. Salah satu bentuk kemitraan yang dapat dikembangkan adalah pola PHBM (Pengelolaan Hutan Berbasis Masyarakat). perlu dikembangkan suatu skema kerjasama antara pemilik modal dengan masyarakat. Sebagai akibatnya pada beberapa tahun terakhir ada kecenderungan besar-besaran untuk mambudidayakan gaharu terutama di wilayah Asia Tenggara (Squidoo. eksploitasi gaharu secara ilegal ternyata tetap berlangsung dan konsumen yang kurang memahami hal ini secara tidak sadar justru menciptakan permintaan yang tinggi yang dapat membahayakan keberadaan tanaman Aquilaria (Blanchette. permintaan akan gaharu jauh melebihi supply yang ada. Namun karena pengusahaan gaharu memerlukan modal yang tidak sedikit. Meskipun demikian.

.. Asosiasi Gaharu Indonesia (Asgarin). dan data statistik yang tersedia...... waktu. saling memperkuat. hak dan kewajiban) dengan prinsip saling menguntungkan... laporan hasil penelitian.... Internal Rate of Return (IRR). benefit atau penerimaan pada tahun t...... Khusus untuk perhitungan analisis finansial usahatani gaharu digunakan kriteria kelayakan Net Present Value (NPV)... serta berbagai terbitan lainnya..... BPS.. dan saling mendukung..... METODOLOGI Tulisan ini merupakan hasil desk study dari berbagai pustaka...... tingkat diskonto atau potongan (=bunga bank yang berlaku)..(Sri Suharti) kepentingan lainnya untuk bekerjasama dan berbagi (ruang....... NPV atau nilai kini bersih dirumuskan sebagai berikut: n Bt − Ct NPV = ∑ t =0 (1 + i)t ... Departemen Kehutanan... (1) dimana: NPV Bt Ct i n = = = = = Net Present Value (Nilai Kini Bersih).....Prospek Pengusahaan Gaharu ........ Data dan informasi yang berhasil dihimpun. umur ekonomi proyek (cakrawala waktu).. biaya pada tahun t..... Suatu kegiatan usaha dinyatakan layak secara finansial bila nilai NPV > 0...... CITES.. Tulisan ini bertujuan untuk memberikan gambaran tentang prospek pengusahaan gaharu oleh masyarakat melalui pola pengelolaan hutan berbasis masyarakat (PHBM).... Data dan informasi serta literatur tersebut dihimpun dari berbagai sumber antara lain........ diolah dan Dianalisis secara deskriptif........ IRR atau tingkat pengembalian internal dirumuskan sebagai berut: 161 .. dan Benefit Cost Ratio (B/C )..

................. biaya pada tahun t. tingkat diskonto untuk menghasilkan NPV1 mendekati nol.. umur ekonomis proyek....... tingkat diskonto....... NPV2 = nilai NPV negatif mendekati nol.... Suatu bisnis dinyatakan layak secara finansial bilai nilai IRR lebih besar dari tingkat suku pinjaman di bank yang berlaku saat ini............. nilai B/C dirumuskan sebagai beikut: n Bt ∑ t =0 (1 + i)t B/C = n Ct ∑ t =0 (1 + i)t ... nilai NPV mendekati nol positif.......... Prospek Pasar Gaharu Indonesia adalah produsen gaharu terbesar di dunia dan menjadi tempat tumbuh endemik beberapa spesies gaharu komersial dari 162 ............... benefit atau penerimaan pada tahun t.. Kegiatan usaha dikatakan layak apabila B/C > 1............ PROSPEK PENGUSAHAAN GAHARU A..Aspek SOSIAL EKONOMI DAN KONSERVASI IRR = i1 + NPV1 NPV1 − NPV2 (i2 − i1) ................... (3) dimana: B/C Bt Ct i n = = = = = Benefit Cost Ratio ( Rasio penerimaan-biaya)............. (2) dimana: IRR = i1 = NPV1 = i2 = Internal Rate of Raturn (tingkat keuntungan internal)....................... tingkat diskonto untuk menghasilkan NVP2 negatif mendekati nol... Selanjutnya.....

2004). microcarpa. malaccensis. tingginya permintaan gaharu belum dapat dipenuhi karena kekurangan bahan baku bermutu tinggi untuk ekspor. Selain itu.245 kg pada tahun 2005 menjadi 39. filarial. A. penghasil gaharu terbaik ke dalam daftar Ap-pendix II dan sejak saat itu ekspor gaharu dibatasi oleh kuota yaitu hanya 250 ton/tahun (Anonim. Tingginya harga jual gaharu mendorong masyarakat untuk memburu gaharu. Selanjutnya.. Semakin sulitnya mendapatkan gaharu di hutan alam telah mengakibatkan semua pohon gaharu (Aquilaria spp. total ekspor gaharu dari Indonesia terus menurun hingga jauh di bawah ambang kuota CITES. beccariana. malaccensis. karena adanya kekhawatiran akan punahnya spesies gaharu di Indonesia.. Oleh karena itu pada tahun 1995 CITES memasukkan A. maka sejak tahun 2005 Departemen Kehutanan kembali menurunkan kuota ekspor menjadi hanya 125 ton/tahun (Anonim. Permintaan terhadap gaharu terus meningkat karena banyaknya manfaat gaharu. Namun dari sisi negara pengekspor. tetapi juga digunakan sebagai bahan baku obat-obatan. Hal ini banyak dikeluhkan oleh beberapa eksportir gaharu Indonesia. Pada tahun 1985.. dan Gyrinops spp.487 ton. karena sulitnya memperoleh bahan 163 .. A.Prospek Pengusahaan Gaharu . Bahkan sejak tahun 2000. dupa. 2005). dan lain-lain. tidak hanya dengan cara memungut dari pohon gaharu yang mati alami melainkan juga dengan menebang pohon hidup. namun eksploitasi hutan alam tropis dan perburuan gaharu yang tidak terkendali telah mengakibatkan spesies-spesies gaharu menjadi langka.(Sri Suharti) marga Aquilaria seperti A. kosmetika. beberapa agama di dunia mensyaratkan wangi gaharu yang dibakar sebagai sarana peribadatan (untuk keperluan kegiatan religi). hirta.) dimasukkan dalam Apendix II pada konvensi CITES tanggal 2-14 Oktober 2004 di Bangkok (Gun et al. Perkembangan yang terjadi selanjutnya ternyata kurang begitu bagus.400 kg tahun 2006. jumlah ekspor gaharu Indonesia mencapai sekitar 1. Seiring dengan kemajuan ilmu pengetahuan dan teknologi industri. 2005).. gaharu tidak hanya digunakan sebagai bahan wangi-wangian (industri parfum). Ekspor untuk pasar Timur Tengah sebagai contoh menurun dari 67. A. A. dan pengawet berbagai jenis asesoris.

Keluhan kekurangan bahan baku gaharu untuk ekspor juga dialami oleh pemasok pasar Singapura.523 (termasuk A.000/kg pada tahun 1993.filarial 180.401 81.000 kg) 148. eksportir di Jakarta yang pada tahun 2005 bisa mengekspor 5-6 ton/bulan.000 75. **): CITES Annual Report Data Compiled by UNEP-WCMC.483 147.577 293. harga gaharu di tingkat pengumpul berkisar antara Rp 30.212 76.000 225.000 68. Kenaikan pesat terjadi pada saat krisis ekonomi melanda Indonesia tahun 1997. Pada tahun 1980.000 Kuota hasil aktual*) n/a 160. baik di pasar dunia maupun di tingkat pengumpul. 2009).Aspek SOSIAL EKONOMI DAN KONSERVASI baku gubal super yang diminta. Penurunan kemampuan ekspor Indonesia tersebut sangat berpengaruh terhadap perkembangan harga gaharu.000 70.593 287. yaitu hanya naik menjadi Rp100.000 180. CV Ama Ina Rua.772 175.002 (termasuk A. Sebagai gambaran. Hasil pemanenan dan ekspor gaharu jenis Aquilqria spp.000 50. Penurunan kemampuan ekspor Indonesia tersebut sudah diprediksi oleh berbagai pihak karena eksploitasi hutan dan perburuan gaharu yang tidak terkendali.079 81.000 Aktual ekspor berdasar CITES Indonesia*) n/a≠)) 299. Pada awalnya kenaikan harga gaharu relatif lambat.000 225.245 n/a Tahun 1995 1996 1997 1998 1999 2000 2001 2002 2003 *): CITES Management Authority of Indonesia.000 150.377 74.000/ kg untuk kualitas rendah dan Rp 80.150 219.593 305.000 300.377 74. ≠): the reason for the unavailability of data for 1995 1nd 1998 is not known 164 .649 245.000 75. Tabel 1.000 120.546 n/a Net ekspor laporan CITES **) 323.000/kg untuk kualitas super.826 70.000 300. filarial dan jenis lain 287.000 50.238 81.2003 Kuota hasil panen resmi*) n/a 300.000 150.000-50.002 n/a ≠) 313. dari Indonesia tahun 1995 . pada tahun 2006 hanya mampu mengekspor 2-3 ton/bulan (Adijaya.826 n/a n/a Total ekspor gaharu (semua spesies)*) n/a≠ 299. Sebagai contoh. pada Tabel 1 disajikan data hasil kajian tentang perdagangan gaharu di Indonesia yang diterbitkan CITES pada tahun 2003.

Philipina. Gaharu dihasilkan oleh pohon-pohon terinfeksi yang tumbuh di daerah tropika dan memiliki marga Aquilaria.Prospek Pengusahaan Gaharu .. 2006). Thailand. Lao PDR.8 juta ha. Dari kawasan hutan tersebut khususnya dari kawasan hutan produksi alam. Malaysia. Myanmar. tersebar di daerah tropis Asia mulai dari India.(Sri Suharti) di mana harga gaharu mencapai Rp 3-5 juta/kg. dan Taman Buru 0. Kenaikan harga gaharu terus berlanjut dan makin tajam hingga mencapai Rp10 juta/ kg pada tahun 2000 dan meningkat lagi hingga mencapai Rp 15 juta/ kg pada tahun 2009 (Adijaya. terdiri dari Kawasan Suaka Alam dan Pelestarian Alam 23. B. Gyrinops. beccariana. cumingiana. 2007). hirta. A..23 juta ha (Departemen Kehutanan.65 juta ha.09 juta ha.6 juta ha.. Wiguna. khususnya bagi Indonesia yang memiliki potensi biologis yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. Potensi dan Peluang Usaha Sebagaimana diuraikan sebelumnya.31 juta ha. Marga Aquilaria terdiri dari 15 spesies. Pada saat ini luas kawasan hutan dan perairan Indonesia berdasarkan Keputusan Menteri Kehutanan tentang Penunjukkan Kawasan Hutan dan Perairan serta Tata Guna Hutan Kesepakatan (TGHK) tercatat seluas 137. Hutan Lindung 31.5 juta ha. Kamboja. A. malaccensis.. Kondisi tersebut menggambarkan bahwa gaharu sangat prospektif untuk dikembangkan. dan Indonesia. Hutan Produksi Terbatas 22. 165 . microcarpa. dan Gonystilus yang keseluruhannya termasuk dalam famili Thymelaeaceae. Pakistan. sehingga produksi gaharu Indonesia terus menurun. A. Indonesia memiliki potensi yang sangat besar untuk menghasilkan gaharu. 2009. namun potensi yang tersedia tersebut sampai saat ini belum dimanfaatkan secara optimal dan produksi gaharu lebih banyak berasal dari proses alami. China Selatan. Hutan Produksi yang Dapat Dikonversi 22. A. dihasilkan gaharu sebagai salah satu hasil hutan bukan kayu yang bernilai ekonomi tinggi. Hutan Produksi Tetap 36. Enam di antaranya ditemukan di Indonesia (A.

kecuali Jawa. mahoni. Kalimantan. durian (Rizlani dan Aswandi. Keenam jenis tersebut terdapat hampir di seluruh kepulauan Indonesia. 2002). Hasil rekayasa tersebut dapat dipanen satu atau dua tahun kemudian. kelapa. 2007). Persyaratan tumbuh serta pemeliharaan tanaman penghasil gaharu relatif tidak terlalu rumit. Peninsula. Sabah. Maluku. dan Irian Jaya. Philipina. filarial). Karena sifat permudaan gaharu yang toleran terhadap cahaya (butuh naungan). dan abu/ bubuk (Sumarna. pulai seperti yang dikembangkan di KHDTK Carita. sawit. Indonesia. Setelah tanaman penghasil gaharu berumur 5 tahun dengan diameter 15 cm. sawit. 2009) atau di bawah tegakan pohon hutan seperti meranti. Jika ditanam secara monokultur dan tanpa naungan resiko kegagalan penanaman (tanaman muda) lebih tinggi. dan lain-lain). dan kepulauan Solomon serta kepulauan Nicobar. kemedangan. Enam di antaranya tersebar di Indonesia bagian timur serta satu spesies terdapat di Srilanka (Anonim. Berbagai hasil penelitian tentang tanaman gaharu memberikan hasil yang sangat menggembirakan karena berbagai jenis tanaman gaharu dari hutan alam ternyata dapat dibudidayakan dan produksi gaharu dapat direkayasa. penanaman pohon gaharu sebaiknya dilakukan secara tumpangsari atau berada di bawah naungan tegakan lain seperti karet. tetapi idealnya dipanen setelah pohon mati dengan variasi mutu produksi akan terdiri dari kelas gubal. Sembilan spesies di antaranya terdapat di Indonesia yaitu di Sumatera. Serawak. tersebar di Asia Tenggara mulai dari Malaysia. Hutan Rakyat juga dapat ditanam pada areal tanaman perkebunan (karet. Marga Gyrinops memiliki tujuh spesies. Marga Gonystilus memiliki 20 spesies. Pembudidayaan tanaman penghasil gaharu dapat dilakukan secara monokultur maupun tumpangsari dengan tanaman lainnya. Beberapa alternatif pengembangan budidaya pohon penghasil gaharu selain pada hutan produksi (LOA). Keberhasilan berbagai hasil penelitian 166 . dan Nusa Tenggara.Aspek SOSIAL EKONOMI DAN KONSERVASI dan A. Bali. Papua New Guinea. HTI. Pemanenan dapat dilakukan pada kondisi pohon belum mati. Bali. rekayasa produksi untuk menghasilkan gaharu sudah dapat mulai dilakukan dengan cara teknik induksi/inokulasi penyakit pembentuk gaharu yang sesuai dengan jenis pohon.

Di desa tersebut. sampai akhir tahun 2002 terdapat sekitar 116 petani yang tergabung dalam Kelompok Tani Penghijauan Indah Jaya yang telah mengembangkan lebih dari seratus ribu bibit gaharu (Anonim. Kelayakan Pengusahaan Gaharu Untuk memperoleh gambaran bagaimana kelayakan pengusahaan gaharu melalui budidaya dan rekayasa produksi gaharu. dan kelas kemedangan III sebesar 50%.. Tanaman yang bertahan hidup dan menghasilkan gaharu diasumsikan 60% dengan tingkat produksi 2 kg per pohon. Selain itu Dinas Kehutanan Riau juga menanam jenis yang sama seluas 10 hektar di Taman Hutan Raya Syarif Hasyim.. Jambi. Sebagai contoh usaha yang dilakukan oleh para petani di Desa Pulau Aro. berikut ini dilakukan contoh analisis finansial budidaya gaharu dengan asumsi tingkat keberhasilan mencapai 60%. Selain itu. Upaya pembudidayaan gaharu sudah mulai dirintis sejak tahun 1994/1995 oleh sebuah perusahaan pengekspor gaharu.(Sri Suharti) tersebut makin mendorong dan menggugah pemburu gaharu untuk melakukan budidaya tanaman gaharu. sehingga total produksi 480 kg/ha dengan 3 kualitas masingmasing kelas kemedangan I sebesar 10%. microcarpa. malacensis dan A. Kecamatan Tabir Ulu. Pengusahaan gaharu dilakukan pada luasan satu ha dengan jarak tanam 5 m x 5 m. BP DAS Batanghari bekerjasama dengan Badan Litbang Kehutanan pada 2004/2005 membuat demplot budidaya gaharu di antara tegakan tanaman karet rakyat seluas 50 ha (Sumarna. Kabupaten Merangin. C. Selanjutnya pada tahun 2001-2002 beberapa individu atau kelompok tani juga mulai tertarik untuk membudidayakan jenis pohon penghasil gaharu. sehingga kerapatan 400 pohon per hektar. kelas kemedangan II sebesar 40%.. Analisis finansial tersebut menggunakan beberapa batasan dan asumsi sebagai berikut: 1. malaccensis seluas lebih dari 10 hektar. 2007). PT Budidaya Perkasa di Riau dengan menanam A.Prospek Pengusahaan Gaharu . 2008). 167 . yang menanam gaharu dari jenis A.. 2.

IRR sebesar 48. baik tenaga kerja keluarga maupun luar keluarga diasumsikan sebesar Rp 50.000/pohon.000/pohon. Harga inokulan diasumsikan Rp 50. Harga jual produksi gaharu hasil inokulasi untuk kelas kemedangan I = Rp 5 juta/kg.47% dari total biaya. sehingga total biaya inokulan Rp 20 juta/ha. Hasil analisis finansial menunjukkan bahwa pengusahaan gaharu tersebut layak untuk dilaksanakan karena dapat menghasilkan keuntungan bersih nilai kini (NPV) sebesar Rp 147. tenaga kerja untuk inokulasi. beban biaya yang relatif besar adalah untuk pembelian bahan inokulan. 2009).50 juta.32 (Lampiran 1).350 juta. Peluang Pengembangan Gaharu dengan Pola PHBM Pembudidayaan tanaman penghasil gaharu akhir-akhir ini makin marak karena sebagian masyarakat sudah dapat menikmati hasilnya. Kalau diperhatikan lebih seksama. Analisis finansial menggunakan tingkat diskonto sebesar 15%. dan adanya pencurian pohon di kebun gaharu (Duryatmo. 5. Biaya tersebut meliputi biaya pra-investasi dan persiapan lahan serta penanaman sebesar Rp 26.50 juta. 4. kegagalan dalam melakukan inokulasi.350 juta. PROSPEK PENGUSAHAAN GAHARU DENGAN POLA PHBM A. 6.53%. kelas kemedangan II = Rp 2 juta/ kg.000/HK.Aspek SOSIAL EKONOMI DAN KONSERVASI 3.74 juta/ ha. dan B/C = 3. dan tenaga kerja untuk pemungutan hasil (panen) yang besarnya mencapai Rp 77 juta atau sekitar 54. dan biaya tenaga kerja Rp 74. biaya bahan dan peralatan Rp 40. Upah tenaga kerja. dan kelas kemedangan III = Rp 500 ribu/kg. 168 . Berdasarkan asumsi dan batasan tersebut ternyata untuk pengusahaan satu hektar gaharu dibutuhkan biaya sebesar Rp 141. Namun di sisi lain juga dijumpai beberapa kasus ketidakberhasilan pengusahaan gaharu yang disebabkan antara lain oleh kegagalan dalam pemeliharaan. sedangkan upah tenaga kerja untuk inokulasi Rp 30.

sarana prasarana. Di satu sisi masyarakat dapat mendayagunakan potensi-potensi kehutanan untuk kesejahteraan mereka. Karena bentuk kerjasamanya adalah kemitraan. Pada areal hutan milik. Dengan pola ini diharapkan areal tanam dan juga kualitas dan kuantitas produksi gaharu akan dapat ditingkatkan. kelompok usaha bersama/koperasi... baik di lahan milik di luar kawasan hutan maupun di kawasan hutan. PHBM merupakan salah satu jawaban dari pergeseran paradigma dalam pengelolaan sumberdaya hutan dari yang berbasis negara (state based) ke arah yang berbasis komunitas/masyarakat (community based) (Indradi. perlu dikembangkan suatu pola kemitraan dalam budidaya tanaman penghasil gaharu.(Sri Suharti) Untuk lebih membudayakan penanaman gaharu secara luas. Masyarakat dengan keterbatasan sumberdaya yang dimiliki (lahan. dan pengelolaan hutan (Hayat. pemeliharan.. dan lain-lain) dapat ikut berperan dalam pengusahaan tanaman gaharu. Pengembangan gaharu dengan pola PHBM dapat dilakukan. pengusaha/investor. parapihak yang tertarik (pemerintah. Perubahan paradigma ke arah PHBM menjadi momentum penting bagi masyarakat desa hutan. keterampilan. akses pasar. 2007). baik dalam areal hutan milik (hutan rakyat) maupun dalam kawasan hutan Negara. Salah satu bentuk kemitraan yang dapat dikembangkan adalah melalui pola pengelolaan hutan berbasis masyarakat (PHBM). Melalui pola PHBM. 2009). Pengembangan gaharu melalui pola PHBM merupakan salah satu alternatif peningkatan produksi gaharu melalui pelibatan masyarakat dalam budidaya gaharu. meningkatkan peluang keberhasilan serta mengurangi resiko kerugian yang diderita. 169 .Prospek Pengusahaan Gaharu . maka parapihak yang terlibat dalam kegiatan ini dapat memperoleh bagian/ sharing manfaat sesuai kontribusi masing-masing. masyarakat diharapkan melakukan penanaman gaharu pada lahannya sendiri terutama pada lahan kosong (tidak produktif ) secara swadaya.. masyarakat di dalam dan di sekitar kawasan hutan dapat menjadi aset bagi usaha-usaha penjagaan. masyarakat) dapat berbagi peran dan tanggung jawab untuk mengembangkan tanaman gaharu. dan di sisi lain. input produksi.

Aspek SOSIAL EKONOMI DAN KONSERVASI Agar masyarakat bersedia menanam gaharu. maka perlu diberikan berbagai bentuk insentif. Keterlibatan masyarakat dalam pengelolaan hutan meningkatkan posisi tawar serta rasa memiliki masyarakat terhadap sumberdaya hutan yang ada. Hal ini sesuai dengan paradigma pembangunan kehutanan yang lebih menitikberatkan pada peningkatan partisipasi masyarakat dalam pengelolaan hutan dan menempatkan masyarakat desa hutan sebagai patner/mitra menuju pengelolaan hutan lestari. Oleh karena kawasan hutan umumnya sudah ditumbuhi dengan berbagai jenis tumbuhan. Berbagai hasil penelitian menunjukkan bahwa pola kerjasama kemitraan pengelolaan hutan dengan masyarakat desa hutan memberikan dampak positif. Oleh karena lahan milik rakyat umumnya tidak begitu luas dan sudah ditumbuhi berbagai jenis tanaman. proporsi tanaman gaharu yang ditanam disesuaikan dengan luasan dan kondisi areal hutan milik yang ada. baik secara ekonomi. baik dalam bentuk bantuan/hibah maupun melalui sistim kredit yang akan dibayar jika tanaman gaharu telah menghasilkan nantinya. biaya tanam. Pengembangan tanaman gaharu dalam kawasan hutan dapat dilakukan melalui pelibatan masyarakat sekitar hutan dalam pengelolaan hutan. Pengadaan bibit dan inokulasi dapat difasilitasi oleh mitra kerjasama yang disalurkan kepada petani. maka pola tanam yang dikembangkan adalah pola tumpangsari (sisipan atau tanaman sela di antara tegakan yang sudah ada). Adanya peningkatan kesejahteraan dari budidaya gaharu selanjutnya akan mengurangi tekanan masyarakat terhadap sumberdaya hutan dalam bentuk illegal logging dan perambahan lahan bahkan masyarakat secara sadar akan mempertahankan 170 . biaya inokulasi tanaman maupun informasi tentang peluang dan teknik pengembangan gaharu. baik berupa pengadaan bibit. Dampak positif yang terjadi selanjutnya adalah sumberdaya hutan akan lebih terjaga dan terpelihara. Dalam prakteknya pengembangan hutan rakyat gaharu umumnya dikombinasikan dengan tanaman semusim atau tahunan lainnya yang sudah ada (tanaman sisipan). sosial maupun ekologi. produktivitas meningkat serta kesejahteraan masyarakat akan meningkat pula.

pemeliharaannya relatif mudah dan bernilai ekonomi tinggi. 2.. Dari sisi masyarakat.. apapun penyebabnya (Aswandi. Tanaman gaharu dipilih karena tanaman ini dapat tumbuh di dalam areal hutan yang sudah banyak ditumbuhi tegakan pohon dengan intensitas cahaya < 70%.Prospek Pengusahaan Gaharu . 4. 3. Sistim Bagi Hasil dalam PHBM Pengembangan gaharu dengan pola PHBM merupakan salah satu alternatif usaha yang dapat mengakomodasikan kepentingan ekologi di satu sisi dan pertimbangan ekonomi di sisi lain. 2009). Beberapa skenario sebagai alternatif bentuk kemitraan yang dapat dikembangkan antara lain sebagaimana disajikan dalam Tabel 2.(Sri Suharti) setiap jengkal hutan dari kerusakan. Adanya pengaturan kerjasama yang saling menguntungkan dan adil sesuai dengan kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan bersama. Menempatkan masyarakat sebagai mitra dalam pengelolaan hutan secara tidak langsung juga telah memposisikan masyarakat sebagai garda terdepan dalam pengamanan sumberdaya hutan. 171 . Adanya tujuan bersama yang ingin dicapai. Adanya kesepahaman tentang resiko dan konsekuensi dari adanya perjanjian kerjasama tersebut. Beberapa prinsip utama yang dipegang dalam pengembangan gaharu dengan pola PHBM adalah: 1. B. pengembangan gaharu dengan pola PHBM memberikan peluang kepada masyarakat untuk memperoleh manfaat ganda yaitu dari hasil tanaman gaharu jika telah menghasilkan nantinya serta kesempatan untuk memanfaatkan lahan di antara tanaman untuk usahatani tanaman semusim. Pengembangan kerjasama memang layak secara ekonomi dalam jangka panjang (sesuai jangka waktu kontrak perjanjian kerjasama)...

Sebagaimana sifat usahatani skala kecil oleh masyarakat yang ketergantungannya terhadap lahan usahatani yang dimiliki/digarap sangat tinggi. maka gaharu bukan merupakan komoditi utama yang diusahakan. Berbeda dengan pengusahaan gaharu skala besar yang dilakukan oleh para investor. populasi tanaman gaharu dalam setiap garapan petani berjumlah relatif sedikit serta tidak seragam. pengembangan gaharu dengan pola PHBM dapat dilakukan di areal hutan milik maupun di dalam kawasan hutan sepanjang persyaratan tumbuhnya terpenuhi. Dengan demikian meskipun investor/penyandang dana 172 . Gaharu diusahakan sebagai investasi jangka panjang. sepanjang modal yang dimiliki mencukupi untuk biaya budidaya tanaman berikut biaya inokulasinya yang cukup besar. Petani. Konsekuensinya. budidaya gaharu oleh masyarakat umumnya dilakukan dalam skala kecil dengan pola campuran.Aspek SOSIAL EKONOMI DAN KONSERVASI Tabel 2. Investor/Pengusaha. tergantung luas lahan garapan dan kepadatan tanaman yang ada. Besarnya bagi hasil yang diperoleh oleh masingmasing pihak yang terlibat dalam PHBM disesuaikan dengan kontribusi masing-masing pihak dan merupakan hasil kesepakatan bersama. 3. Dengan pola PHBM. diharapkan masyarakat yang memiliki banyak keterbatasan. Pemda/Pihak lain Sebagaimana diuraikan sebelumnya. teknologi serta akses terhadap pasar dapat ikut berpartisipasi dalam budidaya tanaman gaharu. 2. Alternatif bentuk kemitraan yang dapat dikembangkan Jenis input Skenario I 1 Lahan Saprodi Tenaga kerja Bahan inokulan Biaya inokulasi Pengolahan hasil Pemasaran √ √ √ √ √ √ √ 2 3 Skenario II 1 √ √ √ √ √ √ √ 2 3 Skenario III 1 √ √ √ √ √ √ √ √ √ √ √ √ 2 3 Skenario IV 1 2 3 √ √ Keterangan: 1. baik dari segi permodalan.

Kegiatan dilaksanakan pada sebagian Petak 21 di areal KHDTK Carita dengan luas ± 40 hektar. cengkeh. mahoni.. Oleh karena areal kerjasama sudah ditumbuhi berbagi jenis tumbuhan. di areal tersebut juga terdapat berbagi pohon hutan seperti meranti.(Sri Suharti) memberikan kontribusi input dengan porsi terbesar. Selama ini masyarakat ikut menggarap lahan di Petak 21 dengan budidaya berbagai tanaman jenis pohon serbaguna (JPSG) dan buah-buahan seperti melinjo. durian. khaya. petai. Apalagi jika pengembangan kemitraan dengan pola PHBM bertujuan untuk meningkatkan kelestarian sumberdaya hutan (dalam hal ini tanaman gaharu yang sudah langka) dan meningkatkan kesejahteraan masyarakat desa hutan dan bukan semata-mata untuk tujuan komersial (mendapat profit terbesar). jengkol.. Cangkara. Kelompok masyarakat yang terlibat dalam kegiatan penelitian ini berasal dari Desa Sindang Laut dan Desa Suka Jadi tepatnya dari Kampung Longok. C.Prospek Pengusahaan Gaharu . Banten. Uji coba ini merupakan kerjasama antara Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam dengan masyarakat sekitar areal KHDTK Carita. dan Cilaban sebanyak 49 orang (anggota Kelompok Tani Hutan Giri Wisata Lestari yang dipimpin Ustad Jafar sebanyak 40 orang dan Kelompok Tani Hutan Carita Lestari pimpinan Pak Rembang sebanyak 19 orang). pulai. Banten pada tahun 2008 telah dikembangkan uji coba skema kemitraan budidaya tanaman penghasil gaharu dengan pola PHBM. maka pola tanam yang diterapkan adalah pola tumpangsari (sisipan di antara tanaman yang ada). dan nangka.. Gaharu ditanam dengan jarak ± 5 m x 5 m. Dengan demikian jumlah 173 . Kegiatan dilaksanakan dengan melibatkan masyarakat yang telah berusahatani di areal tersebut untuk ikut mengembangkan tanaman penghasil gaharu di lahan garapan mereka. dan hawuan. Uji Coba Pengembangan Gaharu dengan Pola PHBM di KHDTK Carita Di areal KHDTK Carita. belum tentu bagian hasil/sharing yang diperolehnya akan paling besar pula. Selain tanaman JPSG milik masyarakat..

000 pohon (± 400 pohon/ha). Dengan pendekatan yang lebih intensif ini diharapkan masyarakat akan lebih memahami tujuan kerjasama penelitian serta dapat lebih aktif berpartisipasi dalam budidaya tanaman plot uji coba. Pihak pertama akan membantu mencarikan investor untuk bekerjasama menyediakan produksi jamur pembentuk gaharu untuk kegiatan inokulasi untuk 75% tanaman gaharu lainnya. Pihak pertama memberikan pembinaan teknis budidaya tanaman gaharu secara rutin kepada pihak kedua. Pemda. 2.Aspek SOSIAL EKONOMI DAN KONSERVASI tanaman gaharu yang ditanam di areal kerjasama sebanyak 15. Sebelum penanaman. dan masyarakat calon peserta untuk mempelajari prospek partisipasi masyarakat dalam kegiatan dan pemeliharaan tanaman. Pihak pertama akan memberikan pelatihan budidaya gaharu serta pemanenan gaharu (paket training gaharu) kepada pihak kedua. 3. 174 . Pihak pertama menyediakan biaya bagi pihak kedua untuk melakukan kegiatan budidaya penanaman pohon gaharu yang meliputi biaya upah dan bibit tanaman. 4. 5. kegiatan pembangunan demplot uji coba tanaman penghasil gaharu di KHDTK Carita diawali dengan pendekatan yang lebih intensif kepada berbagai pihak yang terkait pengembangan gaharu di areal tersebut seperti Perhutani. Beberapa prinsip utama yang disepakati antara pihak pertama (Puslitbang Hutan dan Konservasi Alam) dengan pihak kedua (kelompok masyarakat peserta uji coba) dalam pola kemitraan di areal KHDTK carita adalah: 1. Setelah diperoleh gambaran prospek partisipasi masyarakat dalam pembangunan demplot uji coba ini dilanjutkan dengan penyusunan rancangan teknis kerjasama penelitian dan penyusunan draft perjanjian kerjasama. Pihak pertama menyediakan jamur pembentuk gaharu untuk kegiatan inokulasi sebanyak 25% dari jumlah tanaman gaharu pada masing-masing penggarap setelah tanaman gaharu berumur ≥ 5 tahun.

9. pihak pertama dan pihak kedua memperoleh hasil tanaman gaharu yang ditanam dan dipelihara di lokasi kerjasama dengan proporsi masing-masing 35% untuk pihak pertama dan 60% untuk pihak kedua. baik pada tanaman gaharu atau tanaman lainnya di areal kerjasama. Pihak kedua berkewajiban mengikuti aturan teknis dan kaidah konservasi yang berlaku di dalam areal KHDTK Carita. Pihak kedua berkewajiban melaporkan setiap kejadian seperti serangan hama/penyakit tanaman.. 175 . Selain pihak pertama dan pihak kedua.5% dan LMDH (kelompok) 2. Jika sudah menghasilkan.(Sri Suharti) 6. 10. maka resiko akan ditanggung bersama sehingga perhitungan bagi hasil pada saat panen ditentukan dengan rumus sebagai berikut: = P akhir ∑ tan total − ∑ tan mati x P awal ∑ tan total Keterangan: Pakhir = Proporsi bagi hasil tanaman gaharu yang diterima masingmasing pihak jika ada tanaman yang mati/hilang/tidak/ belum menghasilkan = Proporsi bagi hasil tanaman gaharu sesuai kesepakatan yang tertuang dalam perjanjian kerjasama ini Pawal Butir-butir kesepakatan tersebut tertuang dalam naskah perjanjian kerjasama yang disusun berdasarkan hasil kesepakatan/ negosiasi antara pihak pertama dan pihak kedua... Jika pada saat pemanenan tanaman gaharu ternyata ada tanaman yang mati/hilang/tidak/belum menghasilkan. Pihak kedua berkewajiban memelihara dan menjaga keamanan tanaman gaharu dan tanaman hutan lainnya. 7. 8.5%.. kebakaran atau bencana lain yang mengakibatkan kerusakan sumberdaya hutan.Prospek Pengusahaan Gaharu . sebagian hasil tanaman gaharu akan diberikan pada Desa Sindang Laut sebesar 2.

http:// www.id/ Halaman/STANDARDISASI_& _LINGUNGAN_ KEHUTANAN/INFO_V02/VI_V02.co. 2. Prinsip utama yang dipegang dalam pengembangan kerjasama kemitraan dengan pola PHBM adalah prinsip kelestarian dan kelayakan secara ekonomi dalam jangka panjang sesuai jangka waktu kontrak serta saling menguntungkan berdasarkan nilai kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan sosial. Skema kemitraan dengan pola PHBM memberikan kesempatan kepada para-pihak yang berminat mengembangkan tanaman gaharu untuk bekerjasama sesuai dengan input/sumberdaya yang dimiliki dan memperoleh bagian hasil/sharing sesuai dengan kontribusi serta kesepakatan parapihak yang terlibat. 176 . Trubus online. khususnya bagi Indonesia yang memiliki potensi biologi yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. 5. ekonomi. dan ekologi.go. Kerjasama kemitraan pengembangan tanaman penghasil gaharu dengan pola PHBM merupakan salah satu alternatif solusi untuk menjaga kelestarian hutan. GAHARU: HHBK yang Menjadi Primadona. Diakses 16 Februari 2009. dan B/C = 3.53%.32.dephut. D.trubus.74 juta/ha. Anonim. Info Pusat Standardisasi dan Lingkungan Departemen Kehutanan. Gaharu: Harta di Kebun.id/mod. 2002. DAFTAR PUSTAKA Adijaya. 3.htm. http:// www. Diakses 20 Januari 2009. IRR sebesar 48.Aspek SOSIAL EKONOMI DAN KONSERVASI KESIMPULAN DAN SARAN 1. Gaharu sangat prospektif untuk dikembangkan. 4.online. meningkatkan produktivitas lahan serta meningkatkan pendapatan masyarakat sekitar hutan. Budidaya gaharu layak untuk dilaksanakan karena secara finansial akan memberikan keuntungan bersih nilai kini (NPV) sebesar Rp 147. 2009.php?mod=publisher&op =viewarticle&cid=8 &artid=290.

Mencari Solusi PHBM di Geumpang.. Trubus online. Pelatihan Nasional: BUDIDAYA DAN PENGOLAHAN GAHARU. Anonim.com/2009/01/ prospek-budidaya-gaharu-secara ringkas. R. M. or. Diakses 16 Februari 2009. B. Gun. Diakses 13 Januari.html. 2009.or. Hayat. Anonim. Diakses 16 Februari 2009. Departemen Kehutanan. http://forestpathology..org/index. Rizlani.htm. Eaglewood in Papua New Guinea. http:// www. A. Working paper No. Di akses 4 Maret 2009.pdf.id/id/news /1/tahun/2007/bulan/11/tanggal/17/id/ 60/. 2003. Indradi.(Sri Suharti) Anonim. Z. Diakses 16 Februari 2009. Sungadan.com/2008/01 /perkembangangaharu-dan-prospeknya-di.umn. http://laksmananursery. 3 2008. htm. http:// forestry-senu57. P.bticnet.cites.co. Diakses. L.org/eng /com/PC/14/EPC14-09-02-02-A2. Blanchette.trubus-online. 2005. Prospek Budidaya Gaharu Secara Ringkas.. http://www.Prospek Pengusahaan Gaharu . Chatteron.. http:// www. Tropical Rain Fo rest Project.php ?option=com_content&task= view&id= 74&Itemid=1.cfans. Duryatmo. 2007. http://fwi. 2009. 177 .html. Review of Significant Trade Aquilaria malaccensis. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES).. Diakses 4 Maret 2009.blogspot. 2009. Vietnam.. 2009.blogspot.id/mod. http://bpk-aeknauli. (2004). Depatemen Kehutanan. 51. Sumari and P. BUDIDAYA GAHARU : Alternatif Pemberdayaan Masyarakat Desa Hutan. 2006. 2007. 2009. Statistik Kehutanan Indonesia 2006. Steven. Access November. C. 2008. Perjalanan Panjang Pengelolaan Hutan Berbasis Masyarakat di Indonesia.ffi. 12 Februari. Sustainable Agarwood Production in Aquilaria Trees.php?mod=publisher &op=viewarticle&cid=1& artid=1618.edu/ agarwood. dan Aswandi. com/gaharu. Aswandi. Diakses 16 Februari 2009. BIOTROP Training and Information Centre. 2009. Jakarta. http://www.. Y.id. S. Tersandung Wangi Gaharu. Perkembangan Gaharu dan Prospeknya di Indonesia.

http://www.id/mod. Temu Pakar Pengembangan Gaharu.com/agarwood Copyright © 2008. Squidoo.Sumarna. 2006. Diakses 16 Februari 2009.online. I. Jakarta. Y. Access November. Wiguna.php?mod =publisher&op=viewarticle& cid=8 &artid=290. Trubus online. Budidaya dan Rekayasa Produksi Gaharu. 2007. Direktorat Jenderal RLPS. squidoo. Tinggi Permintaan Terganjal Pasokan.co. . 2008. Squidoo. LLC and respective copyright owners.trubus. http://www. Production and marketing of cultivated agarwood.3 2008.

000/tanaman . Analisis NPV.550. Pupuk TSP/SP-36 4. 500 3000 1250 250 5000 0 0 0 0 0 250 0 250 6750 125 350 300 150 0 0 7675 0 125 350 300 300 0 0 1075 0 250 700 600 300 0 0 1850 0 250 700 600 300 250 0 2100 0 375 1050 900 300 0 20000 22625 0 2500 2500 250 5250 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 500 5500 20000 500 26500 6750 1750 4900 4200 1950 800 20000 40350 III. Biaya tenaga kerja 1. Lain-lain Biaya pra investasi b. Harga pupuk urea Rp 2500/kg. Output (kg) b. Harga bibit Rp 15. Tenaga kerja keluarga 2.000/kg Harga gaharu K1= Rp 5 juta/kg. K2= Rp 2 juta/kg dan K3=Rp 500. Pra-investasi 2. IRR. Persiapan lahan & tanam 3.742 48.000/phn. B/C 0 0 0 0 5250 -5250 -5250 147.53% 3. Bibit tanaman gaharu 2. Biaya bahan & peralatan 1. TSP Rp 7000/kg. Pra investasi 1. Peralatan pertanian 7. Lampiran 1. Sewa lahan 4.3176 2500 1000 0 3500 16425 -16425 -21675 2500 1000 0 3500 7075 -7075 -28750 2000 500 0 2500 6850 -6850 -35600 1500 500 0 2000 6600 -6600 -42200 1500 500 12000 14000 39125 -39125 -81325 1500 500 0 2000 7125 -7125 -88450 1500 500 0 2000 6650 -6650 -95100 20000 25000 0 45000 46250 697750 602650 33000 29500 12000 74500 141350 602650 179 Catatan: Produksi gaharu 480 kg/ha dengan harga rata-rata Rp 1.000/kg. Tenaga kerja upahan 3. Keterangan I. Tenaga kerja inokulasi Biaya tenaga kerja Total biaya Cash flow Cash flow komulatif a. KCl Rp 6000/kg. Pupuk Urea 3.Lampiran 1. IV. 744000 II. Pupuk kandang 6. IRR (%) c. dan B/C dari Pengusahaan tanaman gaharu per hektar 0 0 0 0 0 0 0 0 0 480 744000 240000 384000 120000 0 0 1250 0 1250 0 375 1050 900 300 0 0 2625 0 250 700 600 300 300 0 2150 0 0 0 0 0 0 0 0 1 2 3 4 5 Tahun ke6 7 8 Total No. Bahan inokulan Biaya bahan & peralatan c. Nilai output Gaharu kemedangan I (10%) Gaharu kemedangan II (40%) Gaharu kemedangan III (50%) Cash outflow (Rp 1000) a. Pupuk KCl 5. NPV (DF 15%) b. Cash inflow (Rp 1000) a. dan pupuk kandang Rp 150/kg Harga inokulan Rp 50. jumlah tanaman 400 phn/ha dibutuhkan 450 phn dg sulaman.

Aspek SOSIAL EKONOMI DAN KONSERVASI 180 .

Therefore there is a big opportunity for the Indonesian farmers to establish eaglewood plantation. 181 . This is because. the gaharu production may be considered low. soil properties and plant diversity surrounding the newly grown and existing gaharu stands in South Kalimantan Province. the gaharu export market remains open. namely. There is a lack of information on factors influencing the success of gaharu formation. South Kalimantan INTRODUCTION Eaglewood (gaharu) may play an important role in gaining foreign exchange and as a source of income for people living in out. Most of the gaharu formation usually relays on natural infection.and in-side the forest in Indonesia. In South Kalimantan. The present work focused on characterizing the environment. soil properties and plant species). climate. The success of gaharu formation may not be only due to inoculants but may also be influenced by environmental characteristics (climate. Only small group of farmers using introduced inoculants.10 THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo Lambung Mangkurat University.

182 .0 2. HST) Aluan (3) (HST) Bawan (HST) Gading (HST) Batung (HST) Layuh (HKK) (HST) Rasau (HST) Kambat (2. Hulu Sungai Selatan (HSS) and Hulu Sungai Tengah (HST).2 Belanti (3) (HSS) Rejo (Banjar) 115. The data were supplied by the Weather Bureau in Banjarbaru.6 2.4 oE 115. Site Distribution of selected sites for the project can be seen in Figure 1. The selected site were used for growing eagle wood and inoculation. Climatic Characters The climate parameters collected were rainfall. The data obtained were for the last 9 years observation.4 3. HST) Kalaka (HST) Kandangan (HSS) Madang (HSS) 115.6 22. South Kalimantan.3 North 115.8 km 115.0 oS 3. 115.4 2. 14 sites would be used for newly planted eaglewood trees and 9 sites for inoculation trial.2 3.7 Wawai (HST) 115.6 Figure 1.8 3.5 Layuh (2.Aspek SOSIAL EKONOMI DAN KONSERVASI METHODS A. The climatic data for all sites were represented by Kandangan weather station. air temperature and relative humidity. The sites located in Banjar. The selected study sites B. Location-wise.1 115.

Method used for particle fraction analysis was described in Klute (1986) and the methods for other soil properties were described in Page et al.. and CO2 evolution.. total nitrogen (N). Soil Properties Soil properties measured were particle fraction analysis. Plant Diversity The diversity of plant species was determined to show its association with the success of inoculation.. total potassium (K) and total phosphorus (P). D. The rainy season commenced in October and ended in July each year. the content of total carbon (C).The Environmental Characteristics . The average annual rainfall in the study area was 2361.(Erry Purnomo) C. (1982). respectively. electric conductivity (EC). Climatic Characters The average rainfall. plant species grown under gaharu tree were collected plant within area of 6x6 m2. air temperature and relative humidity for the last 9 years are shown in Figure 2. A significant low rainfall occurred in the period of July-September. The rainfall distribution can be observed in Figure 2a. RESULTS A. 183 . The pattern of air temperature and relative humidity are shown in Figure 2b and 2c..72 mm. In each site. soil pH. cation exchange capacity (CEC).

The particle fraction analysis (Figure 3) shows that all soil samples dominated by slit fraction. and CO2 evolution. (1994). the content of total carbon (C).Aspek SOSIAL EKONOMI DAN KONSERVASI 500 [a] 400 30 [b] 29 Air temperature (oC) 30 [b] 29 Rainfall (mm) 300 200 100 28 27 26 25 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month Air temperature (oC) 28 27 26 25 0 l t r r r r ary ary rch pri May June July gus mbe tobe mbe mbe nu ru Ma A Au pte Oc ove ece Ja Feb N D Se Month Figure 2. electric conductivity (EC). air temperature [b] and relative humidity [c] for the last 9 years. The rainfall [a]. Soil properties measures were particle fraction analysis. If applicable. cation exchange capacity (CEC). Bars indicate the standard error mean 9 years observation B. total potassium (K) and total phosphorus (P). followed by clay and sand fractions. 184 . Soil Properties The soil properties of each site are presented in Figures 3-11. soil pH. level of status of each soil property will be made available as categorized by Djaenuddin et al. Total nitrogen (N).

0 0. Particle fraction analysis of each soil 2.. The total C of soil for each site 185 . Two sites.The Environmental Characteristics . Most of the selected sites contained very low C. The N content of the soils (Figure 5) was generally low.16 angsa andala awai dingin awa au (10 Kate g Hig adin (2 & 3 lanti 1 ng Lo gkinkin W as M W Man uh an aur G bat da Han Be TL R Lay Mad H Ma Kam Site Figure 3.(Erry Purnomo) The category range of total C total content was very low to low (Figure 4). Mandala and Madang Low had K content of moderate level. The low level of C and N content confirms the low level of organic matter content of the soil. only 5 sites had low C. 100 80 60 Sand Silt Clay % 40 20 0 n Bela 5 ti 1 t ) ) i s 3 g h 3 w .5 Moderate 2.. It was found that Wawai and Belanti 13 sites had very low and moderate levels of N content.. The K and P contents of the soils from all sites are demonstrated in Figures 6.0 Low 1.0 Very low Be ti lan t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin . respectively.5 0. Most of the soil classified as very low to low level of K concentration.16 gsa da i H i 15 T Lan Man Waw and Waasauyuh K ang ur Gaat (2Belandang angk M R La Mad Ha mb H Ma Ka Site Figure 4.. namely.5 Total C content (%) 1.

Most of total P content of the soils was categorized as very low to low. At 5 sites.10 0. The total N of soil for each site One site (Rasau 10) had a very high K level. it was observed that the microbial was lower than the other sites.20 Total N content (%) Low 0. C. The low EC readings indicate the absence of salinity problem. Only one site (Rasau 10) was categorized as very high (Figure 7). 186 . Almost all the soil pH of the selected soils was categorized into very acidic to acidic category. except for Hangkinkin site. The CEC of the soils were commonly low (Figure 10).15 0. The CO2 evolution as an indication microbial activity was similar site-wise (Figure 11). at Madang Low. respectively.25 Moderate 0. Only one site (Belanti 13) had a slightly acidic value (Figure 8). There were 3 sites and 2 sites had CEC of moderate and high. Except.05 0. For EC reading. The low EC readings may be associated with the far distance from the shore. all soils had EC below 1 mS cm-1 (Figure 9).00 Very low la n Be 16 ngsat dalawai 3 inginawai (10) ates High ding & 3) ti 13 Low inkin n a d W sau h K ng r Ga t (2 elan ang ngk 5ti 1 T La Ma W Man B ad Ha Ra Layu ada Hau mba M M Ka Site Figure 5. The low CEC indicates a low storage cation capacity and results in prone to cation leaching.Aspek SOSIAL EKONOMI DAN KONSERVASI 0. Number of Plant Species It was observed that the number of plant species was varied from site to site (Figure 12). there were 3-5 plant species.

.16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 7.The Environmental Characteristics ...(Erry Purnomo) The other 8 sites had 5-14 plant species and one site had 22 plant species.. Total K content of soil for each site 2600 2400 Total P content (%) 2200 2000 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s .16 gsa dalawai 3inginawa u (10 ate High ding & 3nti 13 Lowinkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2Belaadangangk M H L M d Ha am b a M K Site Figure 6. 1200 1000 Total K content (%) 800 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s i . Total P content of soil for each site 187 .

Electrical conductivity readings for soil each site Cation exchnage capacity (cmol[+]kg-1) 40 30 High 20 Moderate 10 Low Very low ) ) t s i g a 3 3 h n n .16 gsa dal ai ngi wa (10 ate Hig din & 3 ti 1 Low nki 15 T Lan Man Waw andi Wa asau yuh K ang ur Gaat (2Belan dang angki R La n ti a M H ad Ha m b a M M Bel Ka Site 0 Gambar 10.Aspek SOSIAL EKONOMI DAN KONSERVASI 7 Neutral Slightly acidic 6 Soil pH H2O 5 Acidic 4 Very acidic la i 3 6 in in ai 10) 3) 13 ow at es igh ng 5 . Soil pH for each site 130 Electric conductivity (mScm-1) 120 110 100 2 1 0 nt Bela ) ) t s .16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 9.1 angs anda awanding aw au (uh Katng Hr Gadi (2 & lantiang Lngkink WRas y W Ma M BeMad Ha n ti 1 T L L a Ma d a H a u m b a t a Bela K Site 0 Figure 8. Cation exchange capacity of soil for each site 188 .

CO2 evolution from soil from each site DISCUSSION The rainfall pattern was typical the study area.(Erry Purnomo) 2000 1600 1200 CO2 evolution (mg C kg-1) 800 400 0 an t Bel ) ) t s i g a 3 . The schedule of inoculation may have to consider the climatic condition throughout the year.The Environmental Characteristics . The lowest rainfall was observed in the period of July-September ranging 54-84 mm.. The number of plant species found in each site 189 .. June and October the rainfall ranged 132-151 mm.16 gsa dal wai 3 inginawa u (10 ate High din & 3nti 1 g Low inkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2BelaadanHangk M L M d Ha am b a M K Site Gambar 11.16 gsa da H i i 15 T Lan Man W aw and W a asau yuh Kdang ur Ga at (2 Belan dang angk M nti R La Ma H Ha amb Ma ela B K 0 Sites Gambar 12.. 25 Number of plant species each site 20 15 10 5 t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin . The highest rainfall occurred in the period of November-April ranging 215-358 mm. In May..

This may result in the failure of gaharu formation. Dr. it was found that there was gaharu trees growth variation under different plan species grown surrounding the gaharu trees. I also acknowledge the anonymous reviewer who critically commented on the manuscript. The number plant species were varied from site to site. Mrs. Banjar. Presto Janu Saputra and Storus for supporting the field work. The rainy season began in October and ease in June. (1994) leads the need to amend to improve the soil fertility status. 190 . Plants grown under the gaharu was quite divers from site to site. namely. It seems that there was a shading affect on the gaharu trees growth. CONCLUSION The selected sites were distributed in regencies.Aspek SOSIAL EKONOMI DAN KONSERVASI The low fertility status according to Djaenuddin et al. Therefore. The annual total rainfall in the area under study was 2361 mm. the soil in each site was considered very poor. However. In general. ACKNOWLEDGEMENT I would like to thank ITTO for funding the work. improving the fertility status may results in healthier eaglewood trees. Maman Turjaman for the invitation to be involved in the project. From field observation. The healthy trees may immune to the infection. M Yani. further study is still needed to investigate the relationship between soil properties or plant diversity on eaglewood growth or the success of inoculants application. It is too early to gain any conclusion on the effect of environmental characters on gaharu production. Hulu Sungai Selatan and Hulu Sungai Tengah.

.R.L. Center for Soil and Agroclimate Research. N. Subagjo. V. Bachri.. Suharta.. Dai. April 1994. Suwandi. L. SSSA.. Miller. Widagdo. Versi 1. Hakim.. and Jordens.. H. (In Indonesian). A. Chemical and microbiological properties. 7.. ASA. Ismangun. 2nd Edition. R.0. ASA. Bogor.. Land Suitability for Agricultural and Silviculture Plants. (1986) Methods of soil Analysis. Madison.. (1982) Methods of soil Analysis. J. A. D. Laporan Teknis No. Basuni. Klute.H. Sukardi. SSSA. and Keeney. 2nd Edition. S. E. Part 1 Physical and mineralogy methods.R.REFERENCE Djaenuddin. Madison. Ds.1188 Page.. 191 . Marsudi.. Pp. D. S. Hardjowigeno. M. Pp 1159.

Aspek SOSIAL EKONOMI DAN KONSERVASI 192 .

Ada beberapa jenis tumbuhan yang dapat menghasilkan gaharu.. 1994.. Salah satu upaya yang dapat dilakukan adalah dengan mengembangkan tanaman gaharu dalam hutan tanaman di beberapa area. seperti Aquilaria spp. Gaharu merupakan salah satu kayu aromatik penting. Gonystylus spp.. Awalnya gaharu berasal dari pohon tropika yang terinfeksi jamur. Wikstromeae spp.. maka keberadaan jenis ini perlu dipertahankan.. karena secara ekonomis jenis ini dapat meningkatkan devisa negara dan sumber penghasilan bagi masyarakat yang hidup di dalam maupun sekitar hutan. 1986).. Aetoxylon spp. (Chakrabarty et al. dan Gyrinops spp. microcarpa. sehingga hasil hutan non kayu ini menjadi subjek pemanenan yang cukup tinggi. Genus ini termasuk dalam famili Thymelaeaceae.. Sidiyasa et al.. yaitu A. Karena jenis pohon ini mempunyai nilai ekonomi tinggi..(Pratiwi) 11 KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu hasil hutan non kayu yang mempunyai nilai penting. malaccensis dan A. Enkleia spp. Dalam kegiatan penelitian ini difokuskan pada jenis-jenis pohon dari genus Aquilaria.Karakteristik Lahan Habitat .. Oleh karena itu beberapa 193 ..

Provinsi Banten sedangkan 194 . Carita terletak di Kabupaten Pandeglang. dan Sukabumi. sehingga keberadaan jenis ini dapat dilestarikan. sebagaimana juga diharapkan dapat meningkatkan pendapatan dan kesejahteraan masyarakat. Secara administrasi pemerintahan. termasuk sifat-sifat tanahnya dan komposisi vegetasi tumbuhan bawah yang ada di sekitarnya. Dramaga. maka tanah dan karakteristiknya akan berbeda-beda dari satu tempat ke tempat lain. Sepanjang komponen tanah bervariasi. METODOLOGI A. Diharapkan informasi ini dapat mendukung pengembangan hutan tanaman pohon penghasil gaharu. Pratiwi dan Mulyanto (2000) serta Jenny (1941) menyebutkan bahwa tanah merupakan hasil proses pelapukan batuan yang dipengaruhi oleh faktor-faktor iklim. dan energi matahari. Lokasi dan Waktu Penelitian Penelitian dilakukan pada bulan September 2008 di Carita. dan waktu. Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah dan topografi serta vegetasi. Selanjutnya Pratiwi dan Mulyanto (2000) menyatakan bahwa penyebaran tumbuhan.Aspek SOSIAL EKONOMI DAN KONSERVASI informasi sehubungan dengan habitat pohon penghasil gaharu perlu diinventarisasi. dan iklim (termasuk iklim mikro) harus dipertimbangkan sebagai bagian dari ekosistem yang terintegrasi. Sifat-sifat tanah yang spesifik mempengaruhi komposisi vegetasi yang ada di atasnya (Pratiwi. di samping air. maka penelitian ini bertujuan untuk mendapatkan informasi tentang sifat-sifat habitat pohon penghasil gaharu di hutan tanaman gaharu di daerah Carita. 1991). topografi. Tanah sebagai bagian dari suatu ekosistem merupakan salah satu komponen penyangga kehidupan. organisme. agar kemampuan lahannya dapat diketahui. Sehubungan dengan hal tersebut di atas. Tanah yang berbeda dengan sistem lingkungan yang bervariasi akan menentukan vegetasi yang ada di atasnya. jenis tanah. Dramaga. dan Sukabumi. udara.

000 mm per tahun.. dan vegetasi.. Sedangkan alat yang dipakai dalam penelitian lapangan adalah alat-alat tulis. Kelembaban udara rata-rata berkisar antara 80% sampai 90%.959 mm. Kelembaban udara ratarata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. cangkul. alat-alat survei lapangan seperti bor tanah. Jumlah contoh tanah yang diambil di masing-masing lokasi adalah sebanyak 6 buah. dan Sukabumi. Metode Penelitian Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah. Pengambilan Contoh Tanah Plot dibuat di area yang telah dipilih berdasarkan peta tanah Jawa dan Madura pada skala 1:500. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. dan meteran. Bahan lain adalah berupa data hasil analisis vegetasi untuk tingkat semai (termasuk tumbuhan bawah). 1951) dan curah hujan sekitar 3. topografi.. Temperatur udara bervariasi antara 24ºC sampai 30ºC. Jawa Barat serta Sukabumi di Provinsi Jawa Barat. Pengamatan terhadap sifat-sifat tanah dan topografi dilakukan di dalam plot yang sama dengan pengamatan vegetasi.600 mm per tahun. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. 1. Bahan dan Alat Penelitian Sebagai bahan penelitian adalah contoh tanah yang diambil dalam plot penelitian di Carita. 1951) dan curah hujan sekitar 3.Karakteristik Lahan Habitat . 2005). 1951) dan curah hujan tahunan sekitar 3.(Pratiwi) Dramaga terletak di Kabupaten Bogor.000 (Lembaga Penelitian 195 . Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. C. Munsell Color Chart. B.. Dramaga.

Dua macam contoh tanah yang diambil adalah contoh tanah terganggu untuk analisis sifat-sifat fisik dan kimia tanah serta contoh tanah tidak terganggu untuk pengamatan sifat fisik tanah (porositas dan berat jenis tanah). Mg. Sifat-sifat tanah yang dianalisis. permeabilitas. Sedangkan belta merupakan tumbuhan dengan diameter setinggi dada (1. meliputi: a) sifat fisik yaitu tekstur. Kemudian contoh tanah dicampur sesuai kedalamannya. K. KTK. Pengamatan Vegetasi Pengamatan vegetasi dilakukan terhadap seluruh vegetasi yang ada dalam plot. porositas. Sedangkan tingkat semai dan tumbuhan bawah diamati dengan cara membuat petak 1 m x 1 m di dalam jalur pengamatan pohon dan belta.Aspek SOSIAL EKONOMI DAN KONSERVASI Tanah.3 m)>10 cm. Kriteria 196 . Plot-plot contoh berukuran 20 m x 20 m dibuat untuk pengamatan pohon dengan interval 20 m pada jalur sepanjang satu km. Corg. Total tanah komposit yang dikumpulkan dari masing-masing lokasi adalah enam contoh (tiga untuk analisis sifat fisik tanah dan tiga untuk analisis sifat kimia tanah). Al. ketersediaan P. dan H+ (sifat kimia) (Blackmore et al. Contoh tanah komposit diambil pada kedalaman 0-30 cm. Sedangkan untuk pengamatan belta dilakukan dengan membuat petak berukuran 10 m x 10 m di sepanjang jalur tersebut dengan interval 10 m. 1976). KB.. Seluruh jenis pohon dan belta dihitung dan diukur diameternya. Ntotal. 1962). belta. Ca. Pada setiap kedalaman tanah.3 m) antara 2 cm sampai < 10 cm dan semai merupakan permudaan dari kecambah sampai tinggi < 1. Seluruh semai dan tumbuhan bawah yang ada dicatat dan dihitung jumlahnya.. dan sifat kimia yaitu pH H2O. contoh tanah diambil pada 20 titik yang tersebar di masing-masing horizon. yaitu pada tingkat pohon. Dengan demikian ada 18 contoh tanah yang dikumpulkan. 1981). 2. 30-60 cm. dan semai. Contoh tanah diambil dari setiap horizon yang telah diidentifikasi untuk dianalisis di laboratorium. dan > 60 cm di setiap lokasi penelitian. Kriteria pohon adalah tumbuhan dengan diameter setinggi dada (1. Na. berat jenis. Pengamatan vegetasi dilakukan terhadap semai dan tumbuhan bawah yang ada di bawah tegakan/pohon penghasil gaharu.5 m (Kartawinata et al.

Jenis yang diperoleh kemudian dibuat spesimen herbariumnya untuk diidentifikasi di laboratorium Botani dan Ekologi Hutan. (1976)..5 m (Kartawinata et al. Untuk vegetasi. Analisis Data Sifat-sifat fisik dan kimia tanah dihitung sesuai dengan formula pada standar prosedur dari setiap karakteristik tanah kemudian ditabulasi untuk setiap horizon. P3HKA.. 1976). D. 1974). data yang diperoleh ditentukan spesies dominannya dengan menghitung nilai penting sesuai dengan rumus yang dikemukakan oleh Kartawinata et al. Seluruh semai dan tumbuhan bawah yang ada dalam plot dicatat nama daerahnya.. Indeks kesamaan jenis dihitung dengan menggunakan rumus Sorensen (Mueller-Dum-bois and Ellenberg. Spesies dominan merupakan spesies yang mempunyai nilai penting tertinggi di dalam tipe vegetasi yang bersangkutan.Karakteristik Lahan Habitat . jalur dibuat sebanyak tiga buah masing-masing sepanjang 100 m. dan dihitung jumlahnya serta diukur luas penutupan tajuknya...(Pratiwi) semai adalah permudaan jenis tumbuhan berkayu dari kecambah sampai tinggi < 1. Pada masingmasing lokasi. yaitu: SI = Dimana : 2w a+b SI = Similarity Index w = Jumlah dari nilai penting terkecil untuk jenis yang sama yang ditemukan pada dua komunitas yang dibandingkan (A dan B) a = Jumlah nilai penting dari semua jenis yang ada di komunitas A b = Jumlah nilai penting dari semua jenis yang ada di komunitas B 197 . Bogor. Plot-plot berukuran 1 m x 1 m diletakkan di jalur pengamatan vegetasi di dalam tegakan/pohon penghasil gaharu.

Temperatur udara bervariasi antara 24ºC sampai 30ºC. Karakteristik Tanah di Daerah Penelitian Karakteristik tanah sangat dipengaruhi oleh faktor-faktor pembentukan tanah dan sifat-sifat tanah.600 mm per tahun.959 mm. Dramaga. dan Sukabumi. Kelembaban udara rata-rata berkisar antara 80% sampai 90%. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. 1. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. 198 . 1951) dan curah hujan sekitar 3.000 mm per tahun. Lokasi penelitian Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Bahan induk tanah Carita adalah dari Gunung Danau sedangkan Dramaga dan Sukabumi masing-masing dari Gunung Salak dan Gede Pangrango. Topograpfi di daerah Carita bergelombang sampai bergunung sedangkan di Dramaga datar sampai bergelombang dan di Sukabumi bergelombang sampai berbukit. khususnya sifat fisik dan kimia. Vulkanik material dari lokasi-lokasi ini memiliki sifat andesitik. 1951) dan curah hujan sekitar 3.Aspek SOSIAL EKONOMI DAN KONSERVASI HASIL DAN PEMBAHASAN A. Tipe mineral-mineral ini sangat dipengaruhi oleh sifat-sifat tanah. 2005). yaitu Carita. Kelembaban udara rata-rata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. 1951) dan curah hujan tahunan sekitar 3. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. Faktor-Faktor yang Mempengaruhi Pembentukan Tanah di Lokasi Penelitian Penelitian dilakukan di tiga lokasi. Ini berarti bahan induk daerah ini kaya akan mineral-mineral ferro-magnesium dan beberapa mineral sebagai sumber elemen basa.

gaharu ditanam secara monokultur dan ditanam masing-masing tahun 1993 dan 1999. 199 . Spesies yang ditanam adalah Aquilaria crassna dan A. dan permeabilitas. Pada tabel tersebut terlihat bahwa ketiga lokasi penelitian memiliki sifat-sifat fisik tanah yang relatif sama. 2. Hasil penelitian sifat-sifat fisik tanah disajikan pada Tabel 1. Hal ini menunjukkan bahwa tanah di lokasi penelitian berkembang dari material vulkanik tuff.. Ketinggian daerah ini sekitar 100 meter di atas permukaan laut. dan Tabel 3. Oleh karena itu tanah ini diklasifikasikan sebagai ultisol. durian (Durio zibethinus) dan sebagainya.. Sifat-Sifat Tanah a. Di Carita. porositas. Sedangkan tanah di lokasi penelitian Sukabumi memiliki KB lebih dari 50% sehingga diklasifikan sebagai alfisol. Hal ini mengindikasikan bahwa partikel tanah yang dominan adalah fraksi liat. antara lain berkaitan dengan tekstur. Sifat Fisik Tanah Sifat fisik tanah. dengan areal sekitar 5 ha dan dibangun pada tahun 1998 dengan total 346 pohon. Tabel 5. Data analisis tekstur tanah menunjukkan bahwa tanah di semua lokasi penelitian memiliki kelas tekstur liat. umumnya pohon serbaguna seperti pete (Parkia speciosa).8. Dari data tekstur tanah dapat dilihat juga bahwa tanah di dalam profil menunjukkan adanya akumulasi liat. melinjo (Gnetum gnemon). Sedangkan di Dramaga dan Sukabumi. Tabel 2. microcarpa di Darmaga dan A. Pohon penghasil gaharu ditanam bersama dengan tanaman lain. microcarpa di Sukabumi. Tanah yang memiliki horizon argilik dapat diklasifikasikan sebagai alfisol atau ultisol tergantung kejenuhan basanya (KB).. Berat jenis (BD) tanah di semua lokasi penelitian kurang dari 1 tetapi lebih dari 0.Karakteristik Lahan Habitat . berat jenis. Ini berarti seluruh tanah di lokasi penelitian memiliki sub horizon argilik. Implikasi dari kelas tekstur ini adalah retensi air dan hara pada tanah ini relatif bagus.(Pratiwi) Penggunaan lahan di ketiga lokasi penelitian adalah hutan tanaman pohon penghasil gaharu. Tanah di Carita dan Dramaga memiliki KB kurang dari 50% (Tabel 4.. jenis yang ditanam adalah Aquilaria microcarpa. nangka (Artocarpus integra). dan Tabel 6).

33 8.08 81.55 6.01 Tekstur Debu (%) 25.96 65. Sifat-sifat fisik tanah di lokasi penelitian Dramaga Sifat fisik Kedalaman (cm) Pasir (%) 0-30 30-60 > 60 0 30 60 8.10 22.90 0.45 66.87 0. sehingga tanah di lokasi penelitian termasuk dalam ordo andisol dalam sistem taksonomi tanah (Soil Survey Staff.69 85.93 0.59 11. Hal ini menunjukkan bahwa tanah ini mempunyai sifat andik.84 0.98 9.48 Kelas tekstur Liat Liat Liat 0.86 66.35 57.33 6.99 63.10 36. Informasi ini menunjukkan bahwa terjadi fenomena pemadatan tanah (soil compaction) karena adanya injakan (trampling) dan mungkin adanya jatuhan butir-butir hujan dari batang pohon (stem fall).Aspek SOSIAL EKONOMI DAN KONSERVASI Data porositas tanah menunjukkan bahwa di semua lokasi penelitian. porositas tanah di horizon permukaan lebih rendah daripada di bagian bawahnya.90 64. Tabel 1. Sifat-sifat fisik tanah di lokasi penelitian Carita Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 8.57 69.51 Liat (%) 66.99 68.78 Kelas tekstur Liat Liat Liat 0. Sedangkan berat jenis tanah di tiga kedalaman kurang dari satu.09 Liat (%) 79.13 Debu (%) 12.85 Berat Jenis Porositas (%) Tabel 2.33 5.21 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 200 . 1994).

C.86 0.95 11. Adanya pori-pori yang menurun jumlahnya. Sifat Kimia Tanah Sifat-sifat kimia tanah.(Pratiwi) Tabel 3.75 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 Sedangkan porositas di lokasi penelitian menunjukkan bahwa semakin ke bawah porositasnya semakin kecil. Na.. pH H 2O di semua lokasi penelitian umumnya kurang dari lima..43 67. Al. Namun demikian Bullock et al.37 Liat (%) 68. Fe. Tabel 5. Mg.. Hal ini terlihat pada lokasi penelitian.83 63. kapasitas tukar kation (KTK). P tersedia.Karakteristik Lahan Habitat . N.90 26. Ca. kejenuhan basa (KB). Zn. kecuali Sukabumi. Hal ini terjadi juga di ketiga lokasi penelitian.59 68. Hal ini menunjukkan semakin ke dalam jumlah pori-pori semakin kecil yang diakibatkan antara lain oleh adanya pemadatan tanah. umumnya diikuti dengan penurunan persentase ruang pori atau porositas dan juga penurunan nilai permeabilitas tanah.09 Kelas tekstur Liat Liat Liat 0. Pratiwi dan Garsetiasih (2003) menyatakan bahwa pemadatan tanah dapat diakibatkan oleh karena injakan manusia. di mana lokasi-lokasi ini merupakan hutan tanaman. maka akan mengakibatkan kapasitas tanah menampung air dan udara menurun. Peningkatan berat jenis tanah.78 9. Nilai permeabilitas tanah menunjukkan laju pergerakan air. K. (1985) menyatakan bahwa nilai ini tergantung bukan saja oleh jumlah pori tetapi juga tingkat kontinuitas pori. Keterangan yang lebih lengkap dapat dilihat pada Tabel 4. Sifat-sifat fisik tanah di lokasi penelitian Sukabumi Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 12.54 Debu (%) 18. dan Tabel 6. b..73 5.15 62.97 0.49 84. dan Mn. meliputi pH H2O. Namun demikian tanah-tanah di lokasi 201 . Cu.

dijumpai banyak tumbuhan bawah jika dibandingkan dengan lokasi penelitian Sukabumi dan Dramaga. Ca. 2004 dan 2005). carbon organik lebih tinggi daripada Sukabumi dan Dramaga. dan S) dan unsur hara mikro (Fe. Di areal penelitian Dramaga. K tergolong medium sedangkan di Carita dan Sukabumi masing-masing tergolong rendah dan tinggi dan Al+3 dan H+ rendah sampai sangat rendah di semua lokasi. Walaupun tanah-tanah di lokasi penelitian berkembang dari bahan vulkanik andesitik yang kaya akan material-material basa. Mg. tetapi di Carita. Tumbuhan bawah merupakan sumber bahan organik. Jumlah carbon organik relatif rendah di semua horizon. Zn. 202 . Tanah dengan kandungan Al yang tinggi memiliki sifat toksik. Menurut Sutanto (1988). Reaksi ini mempengaruhi ketersediaan unsur hara esensial. Cu.Aspek SOSIAL EKONOMI DAN KONSERVASI penelitian masih dikategorikan asam. Perbandingan C/N di semua horizon tergolong tinggi. N. Di samping pH. dan H+. Kandungan P di semua lokasi penelitian tergolong sangat rendah (< 2). khususnya di horizon bagian atas. Cl. Mo. Hal ini dapat dimengerti karena di lokasi penelitian Carita. O. Elemen penting lainnya adalah K. bahan organik juga menyebabkan meningkatnya KTK dengan meningkatnya muatan negatif. maka reaksinya asam dan kejenuhan basanya kurang dari 100%. K. Unsur hara esensial merupakan unsur yang diperlukan oleh tanaman dan fungsinya tidak dapat digantikan oleh unsur lain (Pratiwi. Hal ini menunjukkan bahwa dekomposisi bahan organik tidak terlalu kuat. Carbon organik dan nitrogen total di lokasi penelitian menurun semakin ke bawah. H. Al+3. Oleh karena itu di ketiga lokasi penelitian tidak ada bahaya keracunan Al. ketersediaan dari unsur-unsur esensial ditentukan oleh bahan organik dan proses-proses dinamis yang ada di dalam profil tanah. Mn. P. B. Rendahnya carbon organik dan nitrogen total berhubungan dengan rendahnya bahan organik. namun karena adanya proses pelapukan yang intensif dan juga adanya pencucian (leaching). Unsur-unsur ini dikategorikan sebagai unsur hara makro (C. Pratiwi (2004 dan 2005) menyatakan bahwa unsur ini khususnya di lapisan atas mempunyai fungsi yang sangat penting dalam perkecambahan biji. dan Co).

Tabel 4. Zn.12 (Rendah) Horizon 3 (>60 cm) 4. tetapi diperlukan dalam jumlah sangat sedikit. Sifat-sifat kimia tanah di lokasi penelitian Dramaga Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) Horizon 1 (0-30 cm) 4. Unsur-unsur tersebut adalah Fe. Hal ini disebabkan karena Sukabumi memiliki pH H 2O tertinggi. Ada kecenderungan bahwa daerah dengan pH yang tinggi memiliki kejenuhan basa yang tinggi pula.11(Rendah) 203 .(Pratiwi) Unsur hara mikro juga mempengaruhi pertumbuhan tanaman. dan Tabel 6 menunjukkan secara jelas bahwa KTK NH4Oact pH 7 dari seluruh profil sangat tinggi daripada KTK sum of cation. Tanah dengan KTK tinggi dapat menyerap unsur hara.07) sedangkan di Dramaga medium (16.0515. di mana pH daerah Sukabumi lebih tinggi daripada Carita dan Dramaga. Kecenderungan ini terjadi di areal penelitian. Jumlah kation tertinggi di areal penelitian terdapat di Sukabumi dan yang terendah di Carita.60 (Rendah) 1.Karakteristik Lahan Habitat . Unsur-unsur Fe. Kondisi ini relatif sesuai untuk pertumbuhan tanaman. dan Mn.. Tabel 4.75) dan yang terendah adalah di Carita (13.. Dari Tabel 4. Di semua horizon dari tiga lokasi penelitian ini.. Tanah dengan pH lebih tinggi umumnya memiliki KTK yang lebih tinggi.35-41. Kapasitas tukar kation (KTK) menunjukkan tingkat kesuburan tanah.03 (Rendah) 0. Kandungan kation basa di Sukabumi termasuk tinggi sedangkan di Dramaga medium dan Carita termasuk rendah.50 (Rendah) 1.03 (Rendah) 0.. Tabel 5.70 (Rendah) 1.43 (Rendah) 0. Cu.01-17. sehingga ketersediaan hara akan lebih bagus pada areal dengan KTK rendah.15 (Rendah) Horizon 2 (30-60 cm) 4. KTK tinggi berarti areal tersebut cukup subur.77). kation basa didominasi oleh calcium dan magnesium. Tabel 5. dan Tabel 6 mengindikasikan bahwa tanah di Sukabumi memiliki KB tinggi (39. KTK tanah dianalisis dengan larutan buffer NH4Oact pH 7 dan KTK sum of cation. dan Zn relatif rendah sementara kandungan Mn sedang sampai relatif cukup. Cu.

16 (Rendah) 1.7 (Sangat rendah) 5.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): Al H 0.14 (Rendah) 1. Sifat-sifat kimia tanah di lokasi penelitian Carita Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K 1.09 (Medium) 0.70(Medium) 0.3 (Sangat rendah) Horizon 3 (>60 cm) 1.61 (Medium) 35.40 5.44 5.64 4.90 (Sangat rendah) 0.88 (Medium) 5.20 Tabel 5.60 1.7 (Sangat rendah) Horizon 2 (30-60 cm) 1.44 (Medium) 0.60 (Rendah) 2.17 (Rendah) 1.20 (Sangat rendah) 204 .19 ( Medium) 0.53 (Rendah) 0.26 (Medium) 3.33 4.17 (Rendah) 1.28 79.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 1.20 (Sangat rendah) Horizon 3 (>60 cm) 4.01 1.30 (Rendah) 17.88 88.49 (Sangat rendah) 0.29 (Medium) 1.75 (Medium) 40.58 (Tinggi) 0.08 (Sangat rendah) 1.04 3.68 (Medium) 4.80 2.50 (Rendah) 1.44 (Medium) 0.16 (Sangat rendah) 0.26 (Rendah) 16.52 (Rendah) 0.01 (Sangat rendah) 0.60 (Rendah) 0.41 2.13 (Rendah) Horizon 1 (0-30 cm) 4.14 (Rendah) 1.48 2.51 (Rendah) 0.36 4.31 (Medium) 0.26 (Rendah) 16.00 (Sangat rendah) 0.72 (Sangat rendah) 0.75 (Rendah) 0.32 ( Medium) 1.71 (Sangat rendah) 0.99 (Medium) 46.70 (Sangat rendah) Horizon 2 (30-60 cm) 4.24 85.

49 (Sangat rendah) Horizon 2 (30-60 cm) 0.36 (Rendah) 0.11 (Rendah) 3.(Pratiwi) Sifat-sifat kimia Na KTK KB (%) KCl (me/100 gr): Al H 0.40 (Medium) 0.52 2.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 0.22 (Rendah) 0.Karakteristik Lahan Habitat .22 (Rendah) 39.40 Tabel 6.45 1..35 (Tinggi) 63.40 (Rendah) 0..04 1.07 (Sangat tinggi) 69.27 (Sangat rendah) 5.70 (Sangat rendah) Horizon 3 (>60 cm) 4.01 (Rendah) 0.22 (Rendah) 13.60 (Rendah) 1.68 2.80 16.99 (Tinggi) 10.36 (Medium) 41.60 (Rendah) 0.20 (Rendah) 15.48 1.94 (Sangat tinggi) 0.05 (Sangat tinggi) 0.18 (Rendah) 3.84 (Rendah) 0.64 (Tinggi) 10.08 1.. Sifat-sifat kimia tanah di lokasi penelitian Sukabumi Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): 16..56 (Tinggi) 16.52 (Sangat tinggi) 0.10 (Rendah) 1.10 (Rendah) 2.72 1.84 (Sangat tinggi) 14.49 7.07 (Medium) 0.15 (Rendah) 3.00 28.53 6.00 1.48 (Tinggi) 78.43 (Medium) 36.77 (Rendah) 16.21 (Rendah) 13.03 (Rendah) 14.71 (Tinggi) 0.60 17.98 (Tinggi) 10.86 (Tinggi) Horizon 1 (0-30 cm) 5.40 (Sangat rendah) 205 .49 (Sangat rendah) Horizon 3 (>60 cm) 0.64 3.90 (Sangat rendah) Horizon 2 (30-60 cm) 5.11 (Rendah) 14.

00 0. Oleh karena itu analisis vegetasi ditekankan pada tumbuhan bawah.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 2.56 26.32 1. Dramaga.12 0.25 Horizon 2 (30-60 cm) 2. Komposisi Tumbuhan Bawah Hasil pengamatan menunjukkan bahwa komposisi jenis tumbuhan bawah di Carita lebih tinggi dibandingkan di Sukabumi dan Dramaga (Tabel 7).20 1.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia Al H 0. sapling serta tiang didominasi oleh gaharu.44 1. 206 . dan Sukabumi. Umum Analisis vegetasi dilakukan terhadap vegetasi/tumbuhan bawah di Carita.76 (Sangat rendah) 0. mendukung beberapa anakan muncul dari jenis-jenis lain selain jenis tanaman penghasil gaharu.36 1.52 1.30 Horizon 3 (>60 cm) 6.32 (Sangat rendah) 0. Tabel 7. Areal ini merupakan hutan tanaman pohon penghasil gaharu.36 B.56 22.40 (Rendah) 0. Komposisi Vegetasi dan Spesies Dominan 1. 2.42 0.12 1. Di Carita pohon Sukabumi 6 3 penghasil gaharu ditanam dengan sistem campuran dengan jenis tanaman serba guna sedangkan di Sukabumi dan Dramaga ditanam dengan sistem monokultur. Sistem penanaman di Carita yang multikultur. Jumlah jenis tumbuhan bawah dan familinya di lokasi penelitian Lokasi penelitian Jumlah jenis Jumlah famili Ko n d i s i i n i a g a k nya k a r e n a Carita 30 18 perbedaan sistem penanaman dalam Dramaga 8 16 hutan tanaman tersebut. Dengan demikian untuk tingkat pohon.40 17.

. topografi. Tanah di tiga lokasi penelitian memiliki bahan induk yang relatif sama. Indeks Kesamaan Jenis Tumbuhan Bawah Berdasarkan indeks kesamaan jenis menurut Sorensen (MuellerDumbois and Ellenberg. dan karakteristik tanah. nilai vegetasi ditentukan oleh peran dari jenis dominan. dan Lampiran 3). 207 . Lampiran 2. Carita - 9 - 35 9 - Darmaga Sukabumi - KESIMPULAN 1. 4. Hasil pengamatan menunjukkan bahwa jenis dominan dan kodominan masing-masing areal penelitian berbeda.. Hal ini diindikomuni-tas tumbuhan di lokasi penelitian kasikan dengan nilai indeks similaritas yang rendah (<50%) Lokasi Carita Dramaga Sukabumi (Tabel 8). Nilai ini merupakan hasil dari interaksi di antara jenis dengan kondisikondisi lingkungan. Indeks similaritas (%) dari dengan lainnya. Jenis dominan merupakan jenis yang mempunyai nilai penting tertinggi di dalam komunitas yang bersangkutan. Di Carita jenis dominan dan kodominan dari tumbuhan bawah yang ditemui adalah jampang (Panicum disachyum) dan selaginela (Selaginella plana) sedangkan di Dramaga adalah pakis (Dictyopteris iregularis) dan seuseureuhan (Piper aduncum) serta di Sukabumi adalah jampang (Panicum disachyum) dan rumput pait (Panicum barbatum) (Lampiran 1.. 1974) komposisi jenis tumbuhan bawah di tiap lokasi penelitian berbeda satu Tabel 8.(Pratiwi) 3. Jenis Tumbuhan Bawah Dominan Secara ekologis. Data ini mengindikasikan bahwa habitat dari masing-masing lokasi penelitian secara ekologis memiliki karakteristik yang berbeda-beda. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor lingkungan seperti iklim.. yaitu material volkanik yang bersifat andesitik.Karakteristik Lahan Habitat .

1962. Bogor. Di Carita tumbuhan bawah yang dominan adalah jampang (Panicum disachyum) dan jenis kodominan adalah selaginela (Selaginella plana).Aspek SOSIAL EKONOMI DAN KONSERVASI 2. Black (ed. tanah Carita kurang subur dibandingkan dengan Dramaga dan Sukabumi. LPT. Soil Analyses. 5. Sifat-sifat fisik dan kimia tanah di areal penelitian mendukung pertumbuhan pohon penghasil gaharu. Menon.).. Chakrabarty. topografi. 4. 6. New York. Trade in Agarwood. Jenny. 1965. Sedangkan di Dramaga jenis dominan dan kodominan masing-masing adalah pakis (Dictyopteris irregularis) dan seuseureuhan (Piper aduncum). 1941. Factors of Soil Formation. Part II. A. K. L. Jenis dominan dan kodominan di masing-masing areal penelitian berbeda. Organic Matter by Walkey and Black methods. H. 280 p.E. Lembaga Penelitian Tanah. In C. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor-faktor lingkungan seperti iklim. DAFTAR PUSTAKA Allison. 1994. Perbedaan sifat-sifat fisik dan kimia tanah di lokasi penelitian disebabkan perbedaan tingkat proses pelapukan yang berhubungan dengan kondisi lingkungan dari proses pelapukan tersebut. Komposisi jenis tumbuhan bawah juga berbeda di tiap lokasi penelitian sebagaimana diindikasikan dengan nilai SI < 50%. dan sifat-sifat tanah. Kumar and V. 3. Tingkat kesuburan ini berhubungan dengan tingkat dari proses pelapukan. Sehubungan dengan tingkat pelapukan.A. serta di Sukabumi masing-masing jampang (Panicum disachyum) dan rumput pait (Panicum barbatum). 208 . McGrawhill. Peta Tanah Tinjau Jawa dan Madura. WWF-Traffic India.

Pusat Litbang Hutan dan Konservasi Alam.H. Pratiwi. 306 p. Indonesia. Hubungan Antara Sifat-Sifat Tanah dan Komposisi Vegetasi di Daerah Tabalar. Thesis. 1988. Ciri dan Sifat Lahan Habitat Mahoni (Swietenia macrophylla King. Jakarta. International Training Center For Post Graduate Soil Scientists. 1991... Soil Conservation Service. Buletin Penelitian Hutan 474: 59-66. Kementrian Perhubungan. Gent.) di Beberapa Hutan Tanaman di Pulau Jawa. 68 p. Pusat Litbang Hutan dan Konservasi Alam. R. Hutan Penelitian Carita. Pratiwi. 1994. Bogor. Kabupaten Berau. Verhand. 1984. Schmidt. S.A. Eksplorasi dan Studi Permudaan Jenis-Jenis Penghasil Gaharu di Wilayah Hutan Kintap.(Pratiwi) Mueller-Dumbois. John Willey and Son. Mulyanto. 1986. Revised ed. Ellenberg.. United Stated Department of Agriculture. and J. dan R. Pratiwi and B. Prawira. 209 . Soil Characteristics and Vegetation Composition Along a Topotransect in The Gunung Gede Pangrango National Park.U. New York.Karakteristik Lahan Habitat . Rainfall Based on Wet and Dry Period Ratios for Indonesia with Western New Guinea.. Buletin Penelitian Hutan 644: 63-76. Universiteit Gent. F. 1951. Key to Soil Taxonomy. Ferguson. D. 2004. MSc. ITC-RUG. 233 p.. S. Belgium. 42. 21 p. West Java. Soil Conservation Service. Dept. East Kalimantan. 2005. Aims and Methods of Vegetation Ecology. The Relationship Between Soil Characteristics with Vegetation Diversity in Tanjung Redep.. Kalimantan Selatan. Gakuryoku XI(2):127-131. Minerlogy. Sidiyasa. Pratiwi.Agric. 2005. 2000.S. 1974. A. PhD Thesis. Djawatan Meteorologi dan Geofisika. Forestry and Estate Crops Research Journal 1(1): 27-33. I. Sutomo. Indonesia. Soil Survey Staff. Six Edition. K. and H. Charge Properties and Classification of Soils on Volcanic Materials and Limestone in Central Java. Procedure for Collecting Samples and Methods of Analyses for Soil Survey. Sutanto. Kalimantan Timur. Report No.H.

29 1.62 0.25 0.49 0.Sch.43 1.25 0.57 4.12 0.25 0.76 7.12 0.52 5.00 Keterangan: Kr Fr Dr NP : Kerapatan relatif : Frekuensi relatif : Dominansi relatif : Nilai penting 210 .05 2.43 1.43 2.43 1. Aquilaria malaccensis Lamk.97 6.00 9.81 10.99 3. Imperata cylindrica Linn.18 2.50 0.02 4. Amaryllidiaceae Elaeocarpus glaber Blume Elaeocarpaceae Seuseureuhan Piper aduncum L.09 3.82 3.05 2.05 1.43 1. Coniograma intermedia Hieron. Dictyopteris irregularis Presl.86 1.25 0.25 0. Tetracera indica L.25 0.25 0.10 0.43 1. Selaginellaceae Melastomataceae Meraispermaceae Cyperaceae Solanaceae Polypodiaceae Moraceae Schizophyllaceae Polypodiaceae Dilleniaceae Melastomaceae Rubiaceae Meliaceae Rubiaceae Graminae Verbenaceae Zingiberaceae Piperaceae Rubiaceae Polypodiaceae Thymelaeaceae Leguminosae Euphorbiaceae Rubiaceae Panicum barbatum Lamk.99 10.50 0. Total Panicum montanum Roxb.12 0. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Nama daerah Jampang Selaginella Harendong merah Cingcau Rumput pait Ilat Parasi Terongan Hatta Peletok Paku anam Pakis Sasahan Harendong Kokopian Mahoni Cacabean Alang-alang Hawuan Kakacangan Pacing Nama botani Famili Kr (%) Fr (%) Dr (%) NP (%) 47.70 16.62 1.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 1.71 0.28 22.47 2.85 2.Chr.00 14.43 1.43 25.25 0.12 81.39 3. Melastoma malabathricum L.93 1.17 7. Dryopteris dentata C. Ixora sp.43 1.80 1.80 1.25 0.37 0.80 Panicum disachyum Linn.66 8. Gramínea Selaginella plana Hiern.25 0.29 5.00 100.00 5.09 2.72 4.43 1.23 0.85 1. Tapeinochilus teysmannianus K.43 1.25 0.43 2.58 10.43 2.70 32.25 0. Nilai penting jenis tumbuhan bawah di Carita No.18 6.09 1. Cyperus difformis Linn.43 1. Graminae Curculigo latifolia Dryand.45 0.98 0.43 1.71 4.36 6.25 8.98 0.23 0. Graminae Ageratum conizoides Linn. Compositae 100.43 1.00 5.17 2.71 5.75 0.62 0. Cyclea barbata Miers.28 57.50 0.25 0.93 1.43 1.85 4.00 300.91 2.57 4.43 2.25 21.30 2. Lygodium circinatum Sw.23 0.62 0. Bridelia monoica L.11 0.00 100.48 0. Swietenia macrophylla King Morinda bracteosa Hort.73 3. Parkia speciosa Hassk.69 2. Clidenia hirta Don.75 0.25 0.25 0.93 1.71 1.83 9. Cecropia peltata L.88 7.49 1. Solanum jamaicence Mill. Gagajahan Ki koneng Babadotan Pakis anjing Gaharu Pete Kanyere Cingcanan Plectronia sp.30 2. Stachystarpheta jamaisensis Vahl.75 1. Morinda bracteosa Hort.39 9.37 0.

00 NP (%) 74.76 5.04 43.00 16.Karakteristik Lahan Habitat .55 3. Alocasia sp.14 100..03 16.42 1..41 11.08 34.52 5.16 37.89 11.89 17.78 30. Total Zingiberaceae Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 211 .19 22.72 16.06 19.14 1.00 Dr (%) 28.89 100.21 57.Sch.(Pratiwi) Lampiran 2. Micania scandens Willd.03 5.72 11.76 5.64 11.71 5. 1 2 3 4 5 6 7 8 Nama daerah Pakis Seuseureuhan Tales Nama botani Dictyopteris irregularis Presl.00 Fr (%) 16. Rumput padi Areu Babadotan Pacine Oryza grandulata Nees.25 20..76 5. Ageratum conizoides Linn.56 300.71 5. Nilai penting jenis tumbuhan bawah di Dramaga No.53 100.72 16.72 11..00 Rumput pait Panicum barbatum Lamk. Famili Polypodaceae Piperaceae Araceae Graminae Gramínea Compositae Kr (%) 29. Piper aduncum Linn. Compositae Tapeinochilus teysmannianus K.

34 16.00 17.28 3.57 100.71 14.14 30.67 16.67 8.Lampiran 3.33 100. Euphatorium pallascens DC. Ageratum conizoides Linn.9 58.56 24.74 2.38 4.94 32.00 Rumput pait Panicum barbatum Lamk. Nilai penting jenis tumbuhan bawah di Sukabumi No. 1 2 3 4 5 6 Nama daerah Jampang Nama botani Panicum distachyum Linn.67 8.00 Dr (%) 50.24 4. Famili Gramínea Graminae Melastomaceae Compositae Kr (%) 56.62 16.76 7. Total Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 212 .16 100. Compositae Graminae Alang-alang Imperata cilíndrica Linn.35 22.00 Fr (%) 33.00 NP (%) 139.06 300.57 3.33 16.87 10. Harendong Babadotan Kirinyuh Clidenia hirta Don.

selama ini banyak dikenal sebagai bahan untuk membuat wangi-wangian. beccariana. SUMATERA Titiek Setyawati Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu. Indonesia juga merupakan habitat endemik beberapa jenis gaharu komersial dari marga Aquilaria. A. Heyne. dengan nama perdagangan “agarwood/aloe-wood/ eaglewood”.12 POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk. Jenis pohon penghasil gaharu menghasilkan resin yang memiliki aroma wangi dan jenis-jenis yang menghasilkan gaharu dengan 213 . gaharu merupakan komoditi hasil hutan non-kayu penting. seperti A. negara penghasil gaharu terbesar di dunia. filaria. hirta. A. Indonesia merupakan salah satu eksportir terbesar produk gaharu dan sudah menyumbangkan sekitar 6. bahan obat serta juga kulitnya dapat dibuat untuk bahan tali atau kain (Puri.2 milyar rupiah ke kas negara pada tahun 1995. Zuhud 1994). A. dan lain-lain.) DI PROVINSI LAMPUNG DAN BENGKULU. Gaharu banyak diproduksi di Indonesia. malaccensis Lamk. 2002). 2000).. A. 2001. Bagi Suku Dayak Punan di Kalimantan Timur. Gaharu merupakan komoditi hasil hutan bukan kayu yang banyak diminati oleh pasar luar negeri (Soehartono dan Newton. microcarpa. 1987. karena merupakan sumber pendapatan terbesar yang memiliki nilai pasar tinggi (Kaskija.

Resin yang dihasilkan memiliki aroma wangi yang merupakan ciri khas dalam menentukan kualitas gaharu.Aspek SOSIAL EKONOMI DAN KONSERVASI kualitas tinggi banyak diperdagangkan ke luar negeri. Enkleia (1 jenis). sejak tahun 1994 gaharu masuk dalam Appendix II daftar CITES (Soehartono dan Newton. Sumatera. kedelapan jenis tersebut masuk dalam marga Aetoxylon (1 jenis). Satu pohon biasanya dapat menghasilkan 0. gaharu ternyata dihasilkan tidak dari satu jenis pohon saja melainkan dari berbagai macam jenis. Pada umumnya gaharu diperdagangkan dalam tiga kelompok sortimen. 2007). Gaharu dihasilkan dari proses pembusukan atau infeksi. Bahkan beberapa jenis sudah menjadi langka akibat perburuan jenis-jenis tertentu yang tidak terkendali.37 pohon/ha (Kalimantan). Karena eksploitasi yang intensif sehingga mengancam keberadaanya di alam. 2001). Hampir sebagian besar jenis dapat ditemukan di Kalimantan. serta Irian Jaya. dan 4. jenis pohon penghasil gaharu dari marga Aquilaria dan Wiekstroemia memiliki lebih dari 2 jenis (Sellato. Menurut Sidiyasa (1986) dalam Mai dan Suripatty (1996). Dari beberapa pustaka yang ada. Jenis yang saat ini banyak dipanen di Irian Jaya sudah sangat terancam keberadaannya.000. 2001) yang tumbuh tersebar di Indonesia. Potensi yang diperkirakan ada saat ini yaitu 1. Dalam proses selanjutnya. keberadaan serta potensi pohon penghasil gaharu yang ada di Indonesia sampai saat ini masih belum terkoleksi dengan baik. Nusa Tenggara Barat. karena eksploitasi yang berlebihan (Zich dan Compton. Usaha budidaya jenis pohon penghasil gaharu juga belum banyak mengalami perkembangan yang nyata dan produk gaharu masih lebih banyak dipanen dari hutan alam. Nusa Tenggara Timur. Meskipun jumlah ekspor gaharu saat ini mengalami penurunan pesat dibandingkan dengan tahun-tahun sebelumnya. 3.33 pohon/ha (Irian Jaya) (Anonim.87 pohon/ha (Sumatera). kemedangan. Aquilaria (2 jenis). yaitu gubal gaharu. baik batang maupun akar pohon secara kimiawi oleh beberapa jenis jamur. dan Gyrinops 214 .untuk kualitas super. Gonystylus (2 jenis). 2001) dan bahkan semua jenis penghasil gaharu (Aquilaria spp. dan abu gaharu.5 sampai 4 kg gaharu dengan harga di tingkat pencari Rp 700. dan Wikstroemia (2 jenis). masingmasing sortimen akan dibedakan lagi berdasarkan kelas mutunya. Berdasarkan hasil pengamatan di lapangan. informasi mengenai jenis.

diharapkan jenis ini dapat keluar dari daftar CITES sebagai jenis yang harus dilindungi.(Titiek Setyawati) spp. 2009). maka diharapkan tersedia bukti yang kuat menyangkut status jenis-jenis pohon penghasil gaharu di Indonesia. Selama beberapa dekade ini...) masuk dalam Appendix II CITES sejak tahun 2004. Mengingat semakin terancamnya keberdaan jenis pohon penghasil gaharu yang ada di habitat alaminya. Mengingat harga gaharu yang demikian tinggi. Makalah ini bertujuan untuk memberikan informasi menyangkut aspek potensi dan persebaran gaharu (A. diperlukan upaya eksplorasi dan konservasi. Mengingat keberadaan jenis-jenis pohon penghasil gaharu yang mulai langka dan terancam punah. 2000) dan sudah memberikan sumbangan kepada pemasukan negara sejumlah 6. Dengan usia tanam dari 6 hingga 8 tahun gaharu mampu menghasilkan getah sekitar dua kilogram. maka tidaklah heran jika gaharu sangat dicari oleh para pedagang sedangkan pemanenan masih mengandalkan gaharu yang tumbuh di alam dan pencarian dilakukan oleh masyarakat lokal yang memiliki akses masuk ke dalam hutan. maka diperlukan upaya serius dari berbagai macam pihak yang berkepentingan agar keberadaan jenis-jenis tersebut di Indonesia dapat dipantau. 1997 dalam Soehartono dan Newton. Untuk jenis gaharu yang terbaik di kelasnya harganya bisa melebihi 20 juta rupiah per kilogram tergantung kualitasnya (Anonim. Sumatera. Harga gaharu saat ini sangat bervariasi tergantung dari kualitasnya. Harga gaharu saat ini bervariasi mulai dari 5 juta hingga 20 juta rupiah per kilogramnya. karena berbagai macam alasan yang menyangkut status konservasinya.Potensi dan Kondisi . Masyarakat di lokasi hutan di Sumatera pada umumnya mengumpulkan gaharu dalam kelompok yang masing-masing terdiri dari 3 sampai 5 orang. baik dari sisi potensi dan persebarannya.2 milyar rupiah di tahun 1995. malaccencis Lamk.. Kelompok tersebut biasanya akan tinggal di hutan selama lebih kurang seminggu untuk mencari 215 .) di Provinsi Lampung dan Bengkulu. Dengan tersedianya informasi yang memadai.. baik ek-situ maupun in-situ. Indonesia dikenal sebagai negara penghasil gaharu terbesar (Direktorat Jenderal PHPA.

Aspek SOSIAL EKONOMI DAN KONSERVASI gaharu di pedalaman hutan. Kawasan Hutan Bukit Rupi berada di Desa Segala Midar. pencarian gaharu makin sulit akibat potensinya yang mulai menurun. Kondisi topografi di hutan alam ini sedikit berbukit dengan beberapa lokasi memiliki kelerengan hingga 35 derajat. yaitu di Hutan Bukit Rupi dan Hutan Gunung Sugih. Lampung Survei jenis-jenis pohon penghasil gaharu di Provinsi Lampung dilakukan di satu lokasi yang ada di dalam kawasan Taman Nasional Bukit Barisan Selatan (Hutan Biha) dan dua lokasi di luar kawasan TNBBS. Areal penelitian masuk dalam Seksi Konservasi Wilayah II Krui dengan luas kawasan ± 96. METODE PENELITIAN A.884 ha dengan cakupan wilayah meliputi Resort Merpas. Seringkali terjadi bahwa kualitas gaharu tidak seperti yang mereka inginkan dan pada akhirnya pohon yang sudah terlanjur ditebang ditinggalkan begitu saja di hutan. Kabupaten Lampung Tengah. dimana ditemukan tegakan gaharu yang masih utuh. Kawasan Hutan Biha masuk dalam Blok Hutan Podomoro. Kecamatan Pubian. tepatnya di Kabupaten Lampung Tengah. sehingga orang harus tinggal lebih dari 2 minggu atau bahkan sebulan hanya untuk mendapatkan gaharu. Lokasi survei berada di Desa Sumur Jaya. Kondisi hutan sebagian sudah dialihfungsikan menjadi lahan perkebunan dan ladang masyarakat. Kecamatan Pesisir Selatan. Jika gaharu ditemukan. maka mereka akan menebang pohonnya secara manual menggunakan kampak. Resort Biha. Pada saat ini. Kawasan Hutan Bukit Rupi berada di luar kawasan TNBBS namun demikian merupakan kawasan hutan lindung yang dikelola oleh Dinas Kehutanan Provinsi Lampung Tengah. Pugung 216 . Namun demikian masih ada beberapa lokasi hutan alam. Lokasi Penelitian 1. Seksi Krui. Kabupaten Lampung Barat.

Waktu tempuh dari pusat kota Bengkulu sekitar 30 menit dengan jarak sekitar 20 km (Gambar 2). Kawasan hutan TNBBS ini terletak di ujung selatan dari rangkaian pegunungan Bukit Barisan dan secara geografis berada pada 4031’5057’ LS dan 103024’1 0 4 0 BT s e d a n g k a n secara administratif p e n ge l o l a a n te r b a g i d a l a m t i g a w i l aya h pengelolaan.. dan Biha..964 m dpl. Gambar 1. Peta lokasi survei dan pengamatan 2. Lokasi penelitian secara detil tertera pada Gambar 1. Krui. 217 .(Titiek Setyawati) Tampak.000-3. Bengkulu Lokasi kedua kawasan hutan sangat berdekatan dengan Tahura Rojolelo yang terletak di antara 03 42’-03 44’LS sampai 102 21’BT dan berada di ketinggian 10-30 m dpl..500-3.Potensi dan Kondisi . yaitu Seksi Konservasi Wilayah I Liwa. Curah hujan ratarata di bagian barat adalah 3. dan Seksi di Provinsi Lampung Konservasi Wilayah III Sukaraja. S e k s i Ko n s e r va s i jenis-jenis pohon penghasil gaharu Wilayah Krui. Topografi kawasan ini bergelombang dan berbukit-bukit dengan ketinggian berkisar antara 0-1..000 mm/ th.500 mm/th sedangkan di bagian timur 2.

GPS Garmin 12 satelit. fenologi. BAHAN DAN ALAT A. kertas koran. jeruk. karet.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 2. antara lain alkohol 96%. karung plastik. alat plak herbarium. baik primer dan sekunder. kompas. jati. tinta gambar spesial. kertas plak herbarium. Bahan dan Alat Bahan yang dijadikan sebagai obyek kegiatan ekologi. dan tali rafia. kelapa sawit. kamera digital. Bengkulu Utara Kawasan hutan dekat Desa Tanjung Terdana sebagian besar sudah dikonversi menjadi areal persawahan dan perkebunan masyarakat. tambang nilon. Tanaman yang umum ditanam antara lain padi. Prosedur Kerja Kajian lapangan di Kabupaten Lampung Tengah dan Lampung Barat dilakukan pada bulan Oktober dan Desember 2007 sedangan 218 . pisang. larutan sub-limat. kertas gambar spesial. Alat yang digunakan untuk pengambilan data di lapangan. Lokasi penelitian di Kawasan Hutan Binjai Temula (Kec. Pondok Kelapa). dan tanaman palawija lainnya. Talang Empat) dan Pungguk Gambo (Kec. pena/alat gambar. B. dan potensi sebaran jenis pohon penghasil gaharu ini adalah semua jenis pohon yang diduga menghasilkan gaharu yang terdapat di kawasan hutan lindung. kantung plastik.

Di samping itu dibuat juga blangko isian tersendiri yang digunakan untuk bahan wawancara dengan penduduk yang berisi pertanyaan-pertanyaan menyangkut berbagai macam informasi tentang karakter jenis-jenis pohon penghasil gaharu yang dikenal oleh penduduk setempat. 219 . Beberapa contoh pohon akan diambil untuk keperluan identifikasi dan koleksi herbarium. Koleksi data primer di lapangan mencakup keanekaragaman jenis pohon penghasil gaharu dan kondisi lingkungan tempat tumbuhnya dengan menggunakan metode eksplorasi dalam jalur-jalur yang sistematik. dan lebih dari 500 m dpl dengan topografi yang berbeda.. dan data penggunaan tradisional penduduk setempat. Desa Dusun Baru. data kondisi lingkungan tempat tumbuh. Eksplorasi dilakukan di berbagai kondisi hutan. Waktu pengamatan lapangan masing-masing selama 8 dan 10 hari. antara lain: 2. Kecamatan Talang Empat dan yang kedua di Hutan Lindung Kelompok Hutan Pungguk Gambo. Ketinggian tempat di lahan kering ada 3 macam. baik di lahan kering maupun lahan basah. 3. Kuesioner dipersiapkan sebelum kegiatan lapangan dilakukan. 3 orang teknisi. 200-500 m. Kecamatan Pondok Kelapa. dan 5 orang tenaga teknis lapangan. Desa Tanjung Terdana. Kegiatan pengamatan dan pengukuran di lapangan dikerjakan oleh seorang peneliti.. Pengamatan pertama di Bengkulu dilaksanakan di Hutan Lindung Kelompok Hutan Binjai Temula. Untuk itu digunakan blanko isian mencakup data pohon.. Pengumpulan data lapangan.Potensi dan Kondisi . Panjang tiap jalur eksplorasi yaitu 1 km dengan jarak antar jalur 500 m. yaitu pada bulan Oktober dan Desember 2008.. yakni topografi datar (kemiringan lereng kurang dari 10%) dan bergelombang berat (kemiringan 25% atau lebih). Provinsi Bengkulu dilaksanakan dua kali. yaitu antara 0-200 m. Pengamatan dan analisis gaharu meliputi beberapa macam kegiatan. baik secara langsung melalui wawancara dengan masyarakat yang tinggal di dekat dan sekitar hutan maupun tidak langsung dengan cara melakukan kajian pustaka. 1.(Titiek Setyawati) Kabupaten Bengkulu Utara.

Aspek SOSIAL EKONOMI DAN KONSERVASI 4. 8. Mengadakan pendugaan potensi dan sebarannya dengan menggunakan metode titik pusat kuadran (quadrant center point method) sepanjang jalur eksplorasi dengan jarak antara titik pertama dan titik berikutnya 50 m. 10. Pendataan pohon meliputi nama jenis. 9. Jarak anakan pertama dengan pohon induk diukur. Jika anakan yang pertama ditemukan berada jauh dari pohon induk. maka dibuat risalah anakan menggunakan metoda jalur transek sepanjang 1 km dari titik anakan pertama ditemukan. 5. Pada tiap titik pusat kuadran dilakukan perisalahan 4 individu pohon penghasil gaharu atau pohon lainnya yang terdekat dengan titik pusat atau 1 individu pohon pada tiap kuadran. Selanjutnya dibuat petak 10 m x 10 m di setiap selang 200 m dari jalur transek. Individu pohon tersebut yang dirisalah dibatasi jarak terjauh 25 m dari titik pusat kuadran dan diameter batangnya 20 cm atau lebih. 7. Penggambaran lukisan spesimen herbarium jenis pohon penghasil gaharu. Estimasi regenerasi jenis-jenis pohon penghasil gaharu yang terdapat di kawasan hutan dengan cara menghitung permudaan tingkat semai (tinggi kurang dari 150 cm). Penduduk yang tinggal di dekat kawasan diminta untuk mengisi blanko kosong yang harus diisi dengan informasi kapan masa 220 . Pengolahan data potensi keberadaan jenis pohon penghasil gaharu dan wilayah sebarannya yang terdapat di dalam kawasan hutan alam. Pengolahan data hasil wawancara dengan masyarakat lokal. dan tinggi pohon. 11. Pengidentifikasian jenis-jenis pohon penghasil gaharu dan proses koleksi herbarium dari kegiatan eksplorasi. 6. Pembuatan tally sheet untuk mengisi data tentang masa berbunga dan berbuah jenis-jenis pohon penghasil gaharu. diameter batang. Penulisan deskripsi jenis-jenis pohon penghasil gaharu yang disertai gambar lukisan spesimen herbarium. tingkat pancang (tinggi lebih dari 150 cm dengan diameter kurang dari 10 cm) dan tingkat tiang (diameter 10-20 cm) di sekitar titik pusat kuadran.

Luas bidang dasar untuk tiap plot dijumlah untuk memperoleh LBD tiap pohon dengan menggunakan rumus: LBD (m2) = pi x d (diameter dalam m)2/4 (Kent dan Coker.. 5. C. HASIL DAN PEMBAHASAN A. Frekuensi: jumlah unit contoh (10 m x 10 m). Nilai Penting (NP): perkiraan secara keseluruhan pentingnya suatu jenis pohon di dalam komunitas lokalnya. jumlah pohon yang berbuah dan berbunga. Kepadatan: jumlah individu per plot (100 m2). 1992). 3. jumlah buah dan bunga (persentase). Analisis Data 1. di mana jenis ditemukan.. dan sebagainya) dan mengisi data curah hujan. 1994). 1999. Luas Bidang Dasar (LBD): luasan bagian melintang dari batang >20 cm sebatas dada (diameter of breast height (dbh)). Nilai NP ini diperoleh dengan cara menjumlahkan Dominansi Relatif (DoR). Hasil Pengamatan di Lampung Hasil pengamatan yang diperoleh dalam rangka melakukan kajian potensi sebaran jenis A. panas. di Provinsi Lampung ini menunjukkan bahwa di beberapa lokasi di dalam kawasan Taman Nasional Bukit Barisan Selatan ini masih terdapat 221 . Beberapa definisi dan kalkulasi yang digunakan dalam analisis vegetasi. kering. 4. Krebs. KR merupakan rasio jumlah individu dari suatu jenis terhadap jumlah total jenis di dalam plot dan FR merupakan rasio frekuensi dari suatu jenis terhadap total frekuensi seluruh jenis di dalam plot (Kent dan Coker.Potensi dan Kondisi . DR merupakan rasio total luas bidang dasar dari suatu jenis terhadap jumlah total luas bidang dasar dari seluruh jenis yang ada. kondisi iklim atau cuaca pada saat berbunga atau berbuah (hujan. malaccensis Lamk. Kelimpahan Relatif (KR).(Titiek Setyawati) berbunga. antara lain: 2. 1992. dan Frekuensi Relatif (FR) dari jenis tertentu...

Kemungkinan hal ini disebabkan akses ke dalam kawasan hutan yang relatif sulit dibandingkan dengan Kawasan Hutan Biha. Lampung Tengah tertera pada Tabel 1. Khusus di Bukit Rupi. Anakan gaharu yang ditemukan tumbuh secara besar di wilayah perkebunan alami di Kawasan Hutan Bukit milik masyarakat (Gambar Rupi. Nampak bahwa kondisi batang tegakan pohon sangat halus dan tidak ditemukan cacat pohon. Tampaknya tidak banyak gangguan seperti pengambilan gubal gaharu di kawasan ini. Lampung Tengah 4). Tampak pada Gambar 3 kecambah gaharu yang tumbuh melimpah menyerupai permadani di bawah tegakan induknya yang ditemukan di Kawasan Hutan Bukit Rupi. karena berdasarkan wawancara dengan pemilik kebun. Gunung Sugih. sapling. Lampung Tengah. Di beberapa tempat juga tampak tandatanda bekas perambahan hutan yang tentunya sebagian besar untuk mengambil kayu gaharu. Di lokasi ini juga dijumpai tegakan pohon penghasil gaharu alami yang tumbuh Gambar 3. Lampung Tengah menunjukkan 222 . mereka tidak merasa menanam pohon penghasil gaharu dan menemukan pohon tersebut tumbuh di halaman kebun mereka. Kemungkinan besar biji gaharu terbang dan menemukan media yang baik untuk tumbuh besar di kebun milik penduduk tersebut. jumlah tegakan pohon. dan anakan yang ditemukan pada enam plot sampel tampak cukup banyak.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan alam pohon gaharu meskipun jumlah dan potensi regenerasi alamnya tampak mengalami penurunan seperti yang ada di Kawasan Hutan Biha. belum ada laporan bahwa pohon tersebut pernah menghasilkan gaharu atau terinfeksi oleh patogen. Namun demikian. Hasil pengamatan regenerasi alam jenis gaharu di Kawasan Hutan Way Waya. Tegakan dapat dikatakan alami. Jumlah pohon gaharu yang dapat ditemukan di Bukit Rupi.

Gambar 4.. namun bukan sama sekali tidak ditemukan seperti di Kawasan Hutan Gunung Sugi. Lampung Tengah.(Titiek Setyawati) perkembangan yang sedikit berbeda dengan yang ada di Bukit Rupi. sehingga kemungkinan sejak dahulu sudah banyak masyarakat yang memanfaatkan gaharu yang tumbuh alami namun hal ini tidak dibarengi dengan upaya budidayanya. Kurangnya jumlah pohon ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung.Potensi dan Kondisi . Lampung Tengah 223 . menemukan jenis gaharu tersebut... Tampak bahwa tidak satu pun jenis penghasil gaharu ditemukan di petak sampel (Tabel 2) di antara 13 jenis pohon hutan yang berhasil diidentifikasi di laboratorium Botani Hutan. meskipun lokasinya sama-sama di satu kabupaten. Nampak pula bahwa sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Biha tertera pada Tabel 3. malaccensis Lamk. sehingga pemungut kayu gaharu setiap saat dapat secara kebetulan maupun ada juga yang dengan niat keras.. Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Hutan Biha sangat sedikit. Tegakan pohon A. yang ditemukan tumbuh secara alami di perkebunan milik masyarakat yang lokasinya berbatasan dengan Kawasan Hutan Bukit Rupi.

Lampung Tengah No. Penduduk setempat yang sudah melakukan upaya bu-didaya penanaman pohon gaharu (A. Jumlah pohon.) di kebun miliknya di Kawasan Hutan Gunung Sugih. malaccensis Lamk. Jumlah pohon. Gunung Sugih. dan anakan A. 4. Jumlah pohon (> 10 cm) 26 9 8 14 16 8 Jumlah pancang 34 15 21 16 19 17 Jumlah anakan 14 21 30 14 11 9 Tabel 2. 2. Lampung Tengah Tabel 1. Lampung Tengah Pohon No 1 2 3 Nama jenis Artocarpus elasticus Ganophyllum falcatum Bombax valetonii Plot 15 5 4 Batang 45 10 5 Tiang Plot 2 0 0 Batang 6 0 0 Pancang Plot 0 4 2 Batang 0 15 4 Semai Plot 0 0 0 Batang 0 0 0 224 . pancang. plot 1. 5. 6. 3. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Rupi.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 5. malaccensis Lamk. pancang. anakan dan semai beberapa jenis pohon alami yang ada dalam 50 plots penelitian di Kawasan Hutan Way Waya.

Pohon gaharu yang masih ada di Kawasan Hutan Register 22 Way Waya. Artocarpus sp. Ficus sp. malaccensis Lamk... Jumlah pohon. Jumlah pohon (> 10 cm) 2 Jumlah pancang 1 2 4 Jumlah anakan 3 8 5 12 Berdasarkan informasi penduduk yang tinggal di Kawasan Hutan Lindung Bukit Sugih (Register 22 Way Waya) bahwa jenis pohon gaharu sudah sulit dijumpai karena adanya pembalakan hutan maupun adanya pencari gaharu di masa lampau. Kecamatan Sendang Agung. 3. Lampung Barat No. dan anakan A. Alstonia angustifolia Pometia pinnata Cananga odorata Litsea sp. Namun demikian masih terdapat beberapa pohon penghasil gaharu alami yang tersisa di daerah hutan belukar.Potensi dan Kondisi . Kabupaten 225 .(Titiek Setyawati) Pohon No 4 5 6 7 8 9 10 11 12 13 Nama jenis Pterospermum diversifolium Laportea stimulans Vitex sp. pancang.. plot 1. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Biha. Desa Sendang Baru. 2.. Hibiscus macrophyllus Plot 4 0 3 3 2 4 2 3 2 1 Batang 5 0 7 5 3 5 3 5 3 1 Tiang Plot 4 1 5 4 1 2 5 5 4 4 Batang 8 4 12 8 2 5 8 6 5 5 Pancang Plot 6 5 0 2 0 3 0 2 0 2 Batang 18 17 0 7 0 10 0 7 0 3 Semai Plot 4 12 11 10 0 6 12 5 13 0 Batang 8 20 23 15 0 12 23 12 20 0 Tabel 3. oleh karena itu pembuatan plot dilakukan di hutan belukar tersebut. 4.

(kiri) dan anakan yang tumbuh di bawahnya (kanan) di lokasi Kawasan Hutan Biha. Dari 50 plot yang dibuat terdapat 5 plot yang dijumpai pohon penghasil gaharu. dan tingkat anakan terdapat 3 plot dengan jumlah masing-masing 30. Tegakan pohon A. tingkat pancang hanya satu batang. 30 cm. malaccensis Lamk. sedangkan tingkat tiang tidak dijumpai. dan 34 cm. Lampung Tengah. 28 cm. Lampung Barat 226 . (Thymelaeaceae). masing-masing satu batang pohon yang berdiameter 20 cm. malaccensis Lamk. Gambar 6. hanya tinggal sekitar 5 pohon.Aspek SOSIAL EKONOMI DAN KONSERVASI Gunung Sugih. 85. itu pun terbagi tempatnya menjadi tiga titik dengan jarak tempuh yang berbeda. dan 102 batang. 25 cm. Adapun jenis pohon penghasil gaharu yang ditemui hanya satu jenis yaitu A. Titik yang terdekat berjarak sekitar 5 km dengan jarak tempuh sekitar 1 jam berjalan kaki.

Tampak bahwa jumlah pohon sangat sedikit dan menurut informasi yang diperoleh dari masyarakat sekitar.. memiliki indeks nilai penting yang cukup tinggi pada tingkat pohon.) Kostm.Potensi dan Kondisi . (57.20%). Hal ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung dan kemungkinan besar juga adalah tingkat reproduksi tegakan yang mulai berkurang. yaitu di Kelompok Hutan Binjai Temula. sehingga sejak dahulu sudah banyak memanfaatkan gaharu yang tumbuh alami. Jumlah pohon penghasil gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Binjai Temula tertera pada Tabel 4. Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Kawasan Binjai Temula ini sangat sedikit.. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Pungguk Gambo tertera pada Tabel 5. Desa Tanjung Terdana. Hasil Pengamatan di Kawasan Hutan di Provinsi Bengkulu Hasil menunjukkan bahwa A. sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu.. malaccensis Lamk. yaitu 39. Kecamatan Talang Empat dan Kelompok Hutan Pungguk Gambo. merupakan jenis yang ditemukan di kedua lokasi penelitian di Bengkulu Utara. A.(Titiek Setyawati) B. Kecamatan Pondok Kelapa.72%).. Sampai saat ini masih terdapat perburuan gaharu di hutan alam dan bahkan masyarakat atau penduduk lokal mengumpulkan anakan pohon gaharu (semai dan pancang) dari hutan alam untuk diperdagangkan. Berdasarkan hasil analisis vegetasi di Kelompok Hutan Binjai Temula. Kondisi regenerasi di kawasan ini hampir sama dengan kawasan yang sebelumnya. Kedua lokasi berada di Provinsi Bengkulu dan kedua kawasan juga masuk dalam kawasan hutan lindung.86% (urutan kedua setelah Cinnamomum porectum (Roxb. pada Kawasan Lindung Kelompok Hutan 227 . yaitu Binjai Temula. Hal ini terjadi terutama di Kawasan Lindung Kelompok Hutan Pungguk Gambo. Tegakan gaharu pada tingkat tiang dan pancang tidak ditemukan pada plot sampel namun mendominasi pada tiangkat seedling (38. Desa Dusun Baru. malaccensis Lamk. Berdasarkan angka nilai pentingnya.

Jumlah pohon (> 10 cm) 1 1 0 1 1 0 Jumlah pancang 0 0 0 0 0 0 Jumlah anakan 0 3 1 2 3 2 228 .Aspek SOSIAL EKONOMI DAN KONSERVASI Pungguk Gambo. 6.20%) setelah Vitex pubescens Vahl. Jumlah pohon. Bengkulu Utara No.) Kostm. (90. 2. 3. plot 1. banyak ditemukan kecambah atau biji-biji yang mulai berkecambah di bawah pohon induknya serta beberapa anakan dengan pertumbuhan yang cukup sehat (Gambar 7). Pada plot sampel di lokasi Pungguk Gambo. dan Garcinia diocia Blume (56. pancang.82%). (67. pohon penghasil gaharu (>20 cm) menduduki urutan keempat (43. Tegakan tidak ditemukan di tingkat tiang dan hanya memiliki nilai penting 3. C. Kecambah atau biji yang mulai tumbuh (kiri) dan beberapa anakan mulai tinggi (kanan) di areal Kelompok Hutan Pungguk Gambo Tabel 4.30%). dan anakan A. Gambar 7. 5.48%) untuk tingkat seedling atau semai.55%).59% pada tingkat pancang dan berada di urutan keempat (19. malaccensis Lamk. 4. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Binjai Temula. porectum (Roxb.

Pada umumnya pohon mulai berbunga dan berbuah pada umur 5 sampai 6 tahun bahkan pohon berukuran sedang bisa menghasilkan biji kurang lebih 1. Jumlah pohon. Masa 229 . malaccensis Lamk.. karena akan dipungut oleh penduduk untuk diperdagangkan. 4.. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Pungguk Gambo No. pancang dan anakan A. plot 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 0 1 Jumlah pancang 0 0 0 0 Jumlah anakan 2 1 3 3 Tabel 5..(Titiek Setyawati) No. plot 1. Namun demikian semai/seedling berukuran tinggi di atas 10 cm saja dihitung dalam petak pengamatan (2 m x 2 m) untuk memperoleh angka nilai penting. Tegakan pada tingkat pohon terlihat sangat rapat (Gambar 8) dan pada sebagian petak sampel terdapat pohon dengan ukuran diameter yang cukup besar namun belum menampakkan tandatanda terjadinya pembusukan yang mengakibatkan terbentuknya gaharu (Gambar 9). 3.5 kg pada musim yang baik. 2.Potensi dan Kondisi .. 5 6 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 1 0 1 0 0 0 0 0 Jumlah pancang 0 0 2 0 0 0 0 0 0 0 Jumlah anakan 0 0 0 0 0 3 0 4 0 0 Biji yang mulai berkecambah tersebut tumbuh sangat rapat dan pada umumnya hanya bertahan beberapa hari saja.

menghisap cairan daun dan menyebabkan helai pucuk daun bergulung dan mengakibatkan anakan menjadi kerdil. masa berbunga dan berbuah 2 kali dalam setahun. Perkecambahan biji dan anakan yang muda sangat rentan terhadap penyakit damping off yang disebabkan oleh jamur (Kundu dan Ka-chari. Petani menggunakan pestisida jika perlu untuk membasmi serangga ini. 2001). Buah ini harus langsung dipanen dari pohonnya. Gambar 8. 2000. Meskipun ada. Penyakit seperti ini tidak ditemukan di lokasi penelitian di Bengkulu Utara.. Pembungaan pada bulan Maret-April akan menghasilkan buah di bulan Juli-Agustus (Adelina. Pohon gaharu dengan diameter ≥ 50 cm Pohon berbunga pada bulan Juli dan Agustus dan menghasilkan buah matang pada bulan November-Desember.Aspek SOSIAL EKONOMI DAN KONSERVASI berbunga dan berbuah biasanya terjadi pada bulan-bulan kering. 230 . Tegakan gaharu yang rapat Gambar 9. Sumarna et al. 2004). Buah yang matang berwarna coklat kehitamhitaman. Masalah utama di lapangan adalah penyakit pada anakan yang disebabkan oleh serangga kecil yang hinggap di ujung daun anakan. Di Sumatera.

dan 4. KESIMPULAN DAN SARAN A.Potensi dan Kondisi .37 pohon/ha di Kalimantan. Berdasarkan hasil pengamatan lapangan dan estimasi potensi regenerasi alam jenis-jenis pohon penghasil gaharu yang tumbuh di hutan alam di beberapa lokasi contoh di Kabupaten Lampung Tengah dan Lampung Barat. Saat ini gaharu sudah masuk dalam Appendix II CITES. 2. Meskipun tampak bahwa di kawasan Bengkulu Utara di sebagian tempat tampak rapat namun keberadaan pohon penghasil gaharu sendiri tidak menjamin adanya resin gaharu.(Titiek Setyawati) dilaporkan hanya sedikit di beberapa tempat saja.. malaccensis Lamk. masih banyak namun demikian kondisinya saat ini menghadapi ancaman penurunan populasi di berbagai tingkatan umur 231 . Sebagai akibatnya populasinya di alam makin lama makin berkurang. maka banyak kolektor yang tidak berpengalaman pada akhirnya ikut mengeksploitasi gaharu di alam.. Indonesia merupakan eksportir utama produk gaharu dan dengan tingginya permintaan pasar akhir-akhir ini serta tingginya harga yang ditawarkan di pasar dunia. sudah mengalami penurunan populasi.33 pohon/ha di Papua. Namun hal ini tidak mengurangi kerusakan dan berkurangnya populasi gaharu di alam (Anonim. tampak bahwa potensi tegakan alam A. Estimasi potensi stock kayu gaharu di Indonesia yaitu 1. Hasil pengamatan di dua lokasi contoh di Kabupaten Bengkulu Utara. Kesimpulan 1.87 pohon/ha di Sumatera. Bisanya petani akan membuang anakan yang sakit. Tampak bahwa stock di kawasan hutan di Sumatera lebih rendah dibandingkan dengan kawasan hutan yang ada di Kalimantan dan Papua.. Beberapa peneliti menduga bahwa hanya 10% dari pohon Aquilaria yang mengandung gaharu. Demikian pula dengan potensi regenerasinya yang ditunjukkan dengan sedikitnya jumlah semai maupun anakan yang ada di bawah tegakan alam. 3.. Soehartono dan Newton. 2001). malaccensis Lamk. 2007. tampak bahwa potensi tegakan alam A.

B.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan. khususnya Kabupaten Bengkulu Utara memiliki potensi tegakan alam gaharu yang juga cukup baik dilihat dari sisi populasi tegakan alaminya. tidak hanya pohonnya namun juga anakan alaminya. Tampak pula terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. Sedikit lebih baik dari kondisi gaharu di Provinsi Lampung. Saran Provinsi Lampung. khususnya Kabupaten Lampung Tengah dan Lampung Barat memiliki potensi tegakan alam gaharu yang cukup merata meskipun di beberapa lokasi jumlah sampelnya tidak memadai. Untuk data masa pembungaan dan berbuah sampai saat penelitian belum dapat diperoleh mengingat masa pengamatan tidak bertepatan dengan masa berbunga dan berbuah. sehingga potensi regenerasi alami akan mengalami hambatan karena ketidakseimbangan pertumbuhan di setiap tingkatan terutama tidak terjadinya pertumbuhan mencapai tingkat tiang. akibat pemanenan gaharu yang kurang memperhatikan aspek kelestarian. Meskipun ada beberapa lokasi sampel dengan kondisi tegakan pohon dewasa yang sangat kurang. Akibatnya bagi proses regenerasi alaminya terjadi kekosongan tegakan pada tingkat tiang. sehingga diperlukan penyuluhan bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan Taman Nasional Bukit Barisan Selatan dan kawasan hutan lindung. Meskipun demikian jenis pohon ini mengalami ancaman serius akibat perburuan. di Bengkulu ditemukan adanya laporan serangan serangga yang menyebabkan pertumbuhan tegakan gaharu menjadi kerdil. terutama di tingkat seedling dan sapling. mengingat potensi jenis gaharu yang masih tampak baik. Sebagian besar penduduk memperjualbelikan anakan alami untuk 232 . malaccensis Lamk. 3. Kawasan hutan di Provinsi Lampung dan Bengkulu memiliki potensi yang cukup baik untuk dijadikan areal sumberdaya genetik untuk jenis A. Berlainan dengan temuan yang ada di Provinsi Lampung. kawasan hutan di Provinsi Bengkulu.

Punan Local Histories and Recent Developments in Bulungan. Kachari.ayo. II.. December 2004. 103. DAFTAR PUSTAKA Adelina. Seed Science and Technology. k o m p a s . Jakarta. 2009. 1987. Forest & Landscape Denmark.tanam. Gaharu (Aquilaria). Ayo Tanam Gaharu.. III. Indonesia.php?fuseactian=whatwedo. Heyne. Badan Penelitian dan Pengembangan Kehutanan. Seed Leaflet No.masa.Potensi dan Kondisi . dan J. 2000.. Krebs. L. J. Behalven Press. Media on line : http// www. Ko m p a s o n l i n e : h t t p : / / r e g i o n a l . C. Ecological Methodology. Siapkan Masa Depan. C. maka diperlukan penyuluhan atau pendidikan konservasi bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan hutan lindung yang merupakan habitat alami jenis pohon penghasil gaharu ini. 1994..(Titiek Setyawati) dikembangkan lebih lanjut atau ditanam di kebun masyarakat ataupun dijual ke luar daerah Bengkulu. I. Vegetation Description and Analysis : A Practical Approach. CRC Press. wwf. J. Kent. Kaskija.id/index. Ecology : The Experimental Analysis of Distribution and Abundance. 1992. Harper Collins College Publishers. Kundu. Claiming the Forest. terutama gangguan terhadap proses regenerasi alaminya. dan IV. East Kalimantan. 2007. Krebs. 2004. N. 233 . Coker. Aquilaria malaccensis Lamk.species_gaharu. Vol.or.depan. CIFOR. Jim Green. K. Yayasan Sarana Wana Jaya. 1999. gaharu Anonim.c o m / r e a d / xml/2009/07/24/1300220/siapkan. Mengingat masih terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. 2002. dan P. Anonim. Tumbuhan Berguna Indonesia. M. Desiccation Sensitivity and Recalcitrant Behaviour of Seeds of Aquilaria agallocha Roxb. M. Downloaded: 24 Januari 2007.

R. 96. 234 . Biological Conservation No.112 and 11. East West Center-Prosea. dan J.113 Regarding Aquilaria spp.K. Canberra.A. Sellato. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria II. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria I. T. Status and Use in Indonesia. Mindawati. Centre for Plant Biodiversity Research. Pembibitan Jenis Pohon Penghasil Gaharu (Aquilaria malaccensis Lamk).C.M. B. Latin.Aspek SOSIAL EKONOMI DAN KONSERVASI Mai. CIFOR. Zuhud. The Impact of Gaharu Harvesting in Indonesia. Pengaruh Wadah Penyimpanan dan Kelas Diameter Terhadap Pertumbuhan Stump Wikstroemia polyantha. Pelestarian dan Pemanfaatan Keanekaragaman Tumbuhan Obat Hutan Tropika Indonesia. An information Document Prepared by TRAFFIC Oceania for the Eleventh Meeting of the CITES Plants Committee. 1994. 2001. 1996. Zich. Syaffari. with reference to CITES Decisions 11. Sumarna. Biological Conservation No 97. Compton. 2001. Indonesia. Newton. E. A. CIFOR. Y.C. 2000. dan N.A. Buletin Penelitian Kehutanan 1(1). Resources and People in Bulungan. 2001. Soehartono. Forest. Agarwood (Gaharu) Harvest and Trade in Papua New Guinea : A Preliminary Assessment. T. dan A. CSIRO Plant Industry. dan A. 2001. Australia. R. Newton. F. 1880-2000. Bogor. Balai Penelitian Kehutanan Manokwari.CIFOR. Elements for a History of Settlement. Indonesia.. Bogor. Trade and Social Dynamics in Borneo. Bulungan Ethnobiology Handbook. Irian Jaya. 2001.R. Suripatty. dan B. Soehartono. Puri.

Parkia speciosa Hassk.. Comersonia bartamia Merr Dehaasia caesia Blume Clidenia hirta don Kibessia azurea DC.. Evodia aromatica Blume Alstonia angustiloba Miq. Daftar jenis pohon yang di survei dalam plot pengamatan gaharu di Bukit Rupi. Cinnanmomum porectum (Roxb. Lampung Tengah No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Nama lokal Kayu alim Leban Kelat Kelepu Putat Lahu Ketaran Kilada Simpur Terap Sepat Rempelas Lingkem Ranggung Ancau Cempaka Pulai Lupang Medang Kedukduk Gio Kemutul Seru Asam Kandis Nerung Petai Sebasah Beruas Tepa Sago Sidi Nyari Sungkai Nama botanis Aqualaria malaccensis Lamk. Parasponia parvifolia Miq. Cratoxylum formosum Dyer. Clausena excavata Burm. Artocarpus anisophyllus Reinw. Ficus variegata Bl.. Garcinia dioica Bl.) Kosterm. Cinnamomum iners Blume Peltophorum grande prain Eurya acuminata APDC. Eugenia grandis Wight Neonauclea calycina Merr Barringtonia sp. Vitex pubescens Vahl. Strombosia javanica Blume Garcinia celebica L. Artocarpus elasticus Reinw. Selaginella plana Hiern. Antidesma tetandrum Blume Peronema canescens Jack Famili Thymelaeaceae Verbenaceae Myrtaceae Rubiacea Lecythidiaceae Moraceae Moraceae Lauraceae Dilleniaceae Moraceae Rhizophoraceae Dilleniaceae Selaginelaceae Dilleniaceae Rutaceae Rutaceae Apocynaceae Sterculiaceae Lauraceae Melastomataceae Melastomataceae Hypericaceae Theaceae Guttiferae Ulmaceae Mimosaceae Olacaceae Guttiferae Lauraceae Celasteraceae Theaceae Euphorbiaceae Verbenaceae 235 . Schima wallichii Korth. Dillenia sumatrana Miq.(Titiek Setyawati) Lampiran 1.Potensi dan Kondisi .. Dillenia excelsa Gieg. Carallia brachiata Merr Tetracera indica L.

Clausena exavata Actinodaphne glabra Blume Orophea sp Pleomele elliptica H. Daftar jenis pohon yang ada di dalam Kelompok Hutan Binjai Temula.Br Bridelia monoica Merr Symplocos cochinchinense Lour Horsfieldia glabularis Warb Garcinia dioica Blume Aporusa sp.Gambir Ketepung K.Angit Jungjung bukit Sugi Sipunan Kenidai Kendung Naran Kandis Kbg Saka/ Seketut Pelangas Lulus Gamat Marabikang Kemalau Gelam Abang K. Ganophyllum falcatum Blume Lucuma maingayi Dub Carallia brachiata Merr Famili Thymelaceae Lauraceae Verbenaceae Myrtaceae Leguminosae Lauraceae Dilleniaceae Moraceae Leguminosae Burseraceae Euphorbiaceae Euphorbiaceae Rubiaceae Euphorbiaceae Hyperiaceae Styraxaceae Compositae Rutaceae Lauraceae Annonaceae Liliaceae Euphorbiaceae Symplocaceae Myristicaceae Guttiferae Euphorbiaceae Euphorbiaceae Hyperiaceae Elaeocarpaceae Linnaceae Lauraceae Myrtaceae Rubiaceae Rubiaceae Rubiaceae Sapotaceae Sapotaceae Rhizophoraceae 236 . Tarenna confusa K et V.Beras Salung Gajah Salung Urat Use Nyaran Ingitdare Nama botanis Aquilaria malaccensis Lamk Cinnamomum porectum (Roxb. Kecamatan Talang Empat.f Eugenia glomerata K et V Timonius sericanthus Boerl Tarenna sp. Aporusa aurita Miq Cratoxylum sumatranum (Jack) Blume Elaeocarpus stipularis Blume Ixonanthes petiolaris Blume Litsea firma Hook. Desa Dusun Baru.) Kostrm Vitex pubescens Vahl Rhodamnia cinerea Jack Parkia speciosa Hassk Litsea odorifera T et B Dillenia exelsa Gilg Artocarpus elasticus Reinw Archidendron jiringa (Jack) Nielsen Canarium dichotonum Miq Baccaurea racemosa Muell Arg Croton argyratus Blume Neonauclea calycina Merr Glochidion zeylanicum Juss Cratoxylum formosum (jack) Dyer Styrax benzoind Dryand Vernonia arborea Ham.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 2. Bengkulu Utara No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Nama lokal Karas Gadis Leban Marapuyan Petai Berawas Sipo Terap Jering Tetak Tunjuk Semipis Kademe Semuting Seubo-ubo Kemutun K.

Sign up to vote on this title
UsefulNot useful