ISBN 978-979-3145-63-1

Pengembangan Teknologi Produksi

berbasis pemberdayaan masyarakat
Editor: Sulistyo A. Siran; Maman Turjaman

PENGEMBANGAN TEKNOLOGI PRODUKSI GAHARU BERBASIS PEMBERDAYAAN MASYARAKAT SEKITAR HUTAN
Editor: Sulistyo A. Siran; Maman Turjaman ISBN: 978-979-3145-63-1 Penerbit: Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Kampus Balitbang Kehutanan Jl. Gunung Batu No. 5, Bogor 16110 Telp. (0251) 8633234, 7520067; Fax. (0251) 8638111 E-mail: p3hka_pp@yahoo.co.id

Petikan Undang-Undang Nomor 19 Tahun 2002 tentang Hak Cipta Ketentuan Pidana Pasal 72 (1) Barangsiapa dengan sengaja dan tanpa hak melakukan perbuatan sebagaimana dimaksud dalam Pasal 2 ayat (1) atau Pasal 49 ayat (1) dan ayat (2) dipidana dengan pidana penjara masing-masing paling singkat 1 (satu) bulan dan/atau denda paling sedikit Rp 1.000.000,00 (satu juta rupiah), atau pidana penjara paling lama 7 (tujuh) tahun dan/atau denda paling banyak Rp 5.000.000.000,00 (lima miliar rupiah). (2) Barangsiapa dengan sengaja menyiarkan, memamerkan, mengedarkan, atau menjual kepada umum suatu Ciptaan atau barang hasil pelanggaran Hak Cipta atau Hak Terkait sebagaimana dimaksud pada ayat (1) dipidana dengan pidana penjara paling lama 5 (lima) tahun dan/atau denda paling banyak Rp 500.000.000,00 (lima ratus juta rupiah).

ii

KATA PENGANTAR
Terdapat enam tantangan pembangunan kehutanan yang kita hadapi saat ini, yaitu: degradasi hutan, bencana alam dan lingkungan, pemanasan global, share sektor kehutanan terhadap pertumbuhan ekonomi nasional, desentralisasi sektor kehutanan, dan kontribusi kehutanan dalam hal food, water scarcity, energy, and medicine. Namun, kita masih melihat ada peluang yang merupakan sebuah anugerah bagi bangsa kita, yang bila dibudidayakan dan dikelola secara serius akan dapat menjawab paling tidak lima dari enam tantangan tadi. Anu-gerah yang juga merupakan peluang usaha sektor kehutanan dari jenis HHBK ini bernama “gaharu”. Ide dan gagasan membangun hutan tanaman gaharu juga menarik untuk kita kaji bersama. Kalau selama ini perusahaanperusahaan HTI telah eksis dengan komoditi-komoditi kayu seperti mangium, sengon, mahoni, dan jenis tumbuhan penghasil kayu lainnya, maka bukanlah hal yang mustahil untuk mengembangkan hutan tanaman penghasil gaharu apabila secara finansial menjajikan dan memungkinkan setelah dianalisis kelayakan usahanya. Pengembangan usaha budidaya tanaman HHBK unggulan akan berhasil dengan baik apabila didukung oleh semua stakeholder yang berkepentingan, baik Pemerintah Pusat dalam hal ini Departemen Kehutanan, Pemerintah Daerah, pengusaha, dan petani. Disampaikan terima kasih dan penghargaan yang setinggitingginya kepada semua pihak yang telah berkontribusi hingga terbitnya buku ini.
Jakarta, Nopember 2010

Kepala Badan Litbang Kehutanan

Dr. Ir. Tachrir Fathoni, MSc.

iii

iv

..............33 1...........................................31 Aspek PRODUKSI ..... Sitepu. Sitepu...................... TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso........................... Sugeng Sentosa.. PADA Aquilaria microcarpa Eka Novriyanti ..... Irnayuli R..... Ragil S........... APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp............... UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto......................................... 123 7............. Irianto.................................................. DAN Fusarium sp...................... DI PERSEMAIAN Irnayuli R..................... Siran . Aryanto .......................... Ahmad Yani............97 Aspek SILVIKULTUR ........ PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman............................................................................ Ahmad Yani. 113 5................................ Maman Turjaman..... Irnayuli R.................................................. Aryanto............ Sugeng Santosa...............................................................................77 4.......B............................... 139 v .......53 3. v PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A.. Maman Turjaman ........ Ragil Setio Budi Irianto....iii DAFTAR ISI .............................................. Aryanto................. KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp. EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp....... PENGEMBANGAN GAHARU DI SUMATERA Mucharromah................................................ 115 6..........35 2.. Maman Turjaman ....................................................... Erdy Santoso............................................DAFTAR ISI KATA PENGANTAR................................................. Yasuyuki Hashidoko............................ Najmulah.............................1 STATUS RISET GAHARU ........ Erdy Santoso ........ Najmulah....... DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu ........................ Sitepu..............................................

.................................................................................. Sitepu ............Daftar Isi 8...... KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi ...... Maman Turjaman................................... 181 11............................. PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti ...... 193 12.................... 151 Aspek SOSIAL EKONOMI DAN KONSERVASI .................................................................................................... 157 9.................... Irnayuli R......... SUMATERA Titiek Setyawati................. 159 10......... THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo ..... Erdy Santoso................................................. POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk........................... HAMA PADA TANAMAN PENGHASIL GAHARU Ragil SB Irianto...................) DI PROVINSI LAMPUNG DAN BENGKULU............................. 213 vi ...................................................................................

yaitu karena pengambilan jauh lebih besar daripada produksinya. Dilihat dari wujud dan manfaatnya. Oleh sebab itu tidak semua pohon penghasil gaharu mengandung gaharu. gaharu memang sangat unik. lantas kenapa komoditi yang telah populer tersebut sepertinya menghilang begitu lama dan saat ini muncul kembali.) yang telah mengalami proses perubahan fisika dan kimia akibat terinfeksi oleh sejenis jamur. Gaharu sebenarnya sebuah produk yang berbentuk gumpalan padat berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar tanaman pohon inang (misalnya: Aquilaria sp. Pepatah ini mengindikasikan bahwa sebenarnya komonditi gaharu sudah dipopulerkan oleh nenek moyang kita dan menjadi bukti sejarah bahwa keharuman gaharu telah dikenal sejak ratusan tahun yang lalu. maupun masyarakat 1 . Dalam kehidupan seharihari telah dikenal pepatah “sudah gaharu cendana pula”. Siran Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu sebuah nama komoditi hasil hutan non kayu yang saat ini menjadi perbincangan banyak kalangan.PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A. Pertanyaan yang muncul. gaharu sejak zaman dahulu kala sudah digunakan. Dari sisi manfaat. Jawaban yang sudah pasti adalah rumus umum. baik oleh kalangan elit kerajaan.

dan stimulan kerja syaraf dan pencernaan.. budaya. Kalimantan Timur mencapai Rp 40. Tarakan. sabun.000.-).-). namun menurut kenyataan. Secara tradisional gaharu dimanfaatkan antara lain dalam bentuk dupa untuk acara ritual dan keagamaan.000.s/d Rp 50.-).000.-. harga gaharu dengan kualitas Super di pasaran lokal Samarinda. dan Nunukan.000. keberadaan pohon penghasil gaharu tersebut di Indonesia tidak terkecuali di Sumatera dan Kalimantan semakin langka. maka jenis-jenis tertentu misalnya Aquilaria dan Gyrinops saat ini sudah tergolong langka. Kelangkaan terjadi karena pohon penghasil gaharu ditebang tanpa memperhatikan 2 . baik sebagai sumber pendapatan masyarakat maupun penerimaan daerah. Berdasarkan informasi. dan Suloan (Rp75.s/d Rp 4.000. dan ekonomi yang cukup tinggi.000.000.000.000. disusul kualitas Tanggung dengan harga rata-rata per kilogram Rp 20.000. kualitas Kacangan dengan harga rata-rata Rp15.000.000.. Selama ini masyarakat hanya tinggal memanen gaharu yang dihasilkan oleh alam. Gaharu dengan demikian mempunyai nilai sosial. kualitas Kemedangan (Rp 1.000. dan masuk dalam lampiran Convention on International Trade on Endangered Spcies of Flora and Fauana (Appendix II CITES).s/d Rp14. anti mikrobia. Meningkatnya perdagangan gaharu sejak tiga dasawarsa terakhir ini telah menimbulkan kelangkaan produksi gubal gaharu dari alam. bahan kosmetik dan obat-obatan sederhana.000.000. Walaupun sejak 1994 Indonesia berkewajiban melindungi pohon penghasil gaharu. dan pola pemanenan yang berlebihan serta perdagangan yang masih mengandalkan pada alam tersebut. kualitas Teri (Rp 10. harga jual yang tinggi. Seringkali masyarakat tidak tahu pasti kapan pohon penghasil gaharu mulai membentuk gaharu dan bagaimana prosesnya.. Besarnya permintaan pasar. aroma terapi. body lotion. Saat ini pemanfaatan gaharu telah berkembang demikian meluas antara lain untuk parfum.per kilogram.000.000.-. Bertahun-tahun masyarakat dan pemerintah daerah Kalimantan dan Sumatera menikmati berkah dari keberadaan gaharu. pengharum tubuh dan ruangan. bahan obatobatan yang memiliki khasiat sebagai anti asmatik.suku pedalaman di Sumatera dan Kalimantan..

. Praktek semacam inilah yang mengakibatkan jumlah pohon pengahasil gaharu di alam semakin menurun dari tahun ke tahun. Dengan teknologi inokulasi maka produksi gaharu dapat direncanakan dan dipercepat melalui induksi jamur pembentuk gaharu pada pohon penghasil gaharu. Siran) ada atau tidak adanya gaharu pada pohon tersebut. mungkin puluhan atau bahkan ratusan pohon penghasil gaharu yang harus ditebang. maka jumlah gaharu yang ada di pohon tersebut hanya beberapa gram saja. baik in-situ (dalam habitat) maupun ek-situ (di luar habitat) dan budidaya pohon penghasil gaharu. dari 20 pohon penghasil gaharu yang ditebang di hutan alam hanya ada satu atau sering sama sekali tidak ada yang mengandung gaharu. pengusaha 3 . dan kalaupun ada usaha konservasi dan budidaya namun skalanya terbatas dan hanya dilakukan oleh lembaga penelitian. dan LSM konservasi. Peningkatan produksi gaharu dimaksud (yang kegiatannya terdiri dari kegiatan di bagian hulu sampai hilir) selanjutnya akan berdampak pada peningkatan penerimaan oleh masyarakat petani.. Menurut hasil kajian. Sementara masyarakat secara luas enggan untuk melakukan budidaya pohon penghasil gaharu karena memang tidak memberikan keuntungan apa-apa. Oleh karena itu dapat dibayangkan kalau pencari gaharu mendapatkan gaharu kira-kira 5 kilogram.. di mana realisasi produksi gaharu pada dekade 80’an pernah mencapai ribuan ton dengan kualitas yang tinggi. perguruan tinggi. Namun upaya tersebut tidak mudah dilaksanakan. Prospek untuk mengembalikan gaharu menjadi komoditi andalan kembali terbuka dengan ditemukannya teknologi rekayasa produksi gaharu. Indikasi menurunnya pupulasi pohon penghasil gaharu ditunjukkan oleh kecenderungan produksi gaharu dari Kalimantan dan Sumatera dari tahun ke tahun. Kalaupun ada pohon yang mengandung gaharu.. sedangkan saat ini produksi tersebut merosot drastis hanya kira-kira puluhan ton saja dengan kualitas yang bervariasi.Perkembangan Pemanfaatan Gaharu . (Sulistyo A. Guna menghindari agar tumbuhan jenis gaharu di alam tidak punah dan pemanfaatannya dapat lestari maka perlu diupayakan untuk konservasi.

Oleh sebab itu tidak semua tanaman penghasil gaharu menghasilkan gaharu. dan penerimaan pendapatan asli daerah serta devisa negara. dan rekayasa pembentukan gaharu yang dapat mengembalikan status komoditi dari kelangkaan menjadi produk andalan. di mana salah satu di antaranya adalah gaharu yang bernilai ekonomis tinggi. Kalimantan Barat. GAMBARAN UMUM TUMBUHAN PENGHASIL GAHARU Hutan hujan tropis di Indonesia semenjak tiga puluh tahun yang lalu dikenal sebagai salah satu penghasil utama kayu bulat (log) untuk bahan baku industri perkayuan. Pulau Sulawesi (2 jenis). tumbuh tersebar secara luas di Kalimantan Timur. Pulau Papua (2 jenis). perlunya budidaya. berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar dari jenis tumbuhan penghasil gaharu yang telah mengalami proses perubahan kimia dan fisika akibat terinfeksi oleh sejenis jamur.gaharu. Dari pengamatan sebaran Aquilaria spp. Berdasarkan sebaran tempat tumbuh. konservasi. kemudian dalam jumlah terbatas tumbuh di Kepulauan Nusa Tenggara (3 jenis). yang dilaksanakan pada tahun 2000 ditemukan bahwa Aquilaria spp. Gaharu adalah gumpalan berbentuk padat. Selain itu hutan hujan tropis Kalimantan juga sangat kaya dengan hasil hutan bukan kayu (HHBK). Di lndonesia hingga saat ini diperkirakan terdapat lebih kurang 25 jenis tumbuhan penghasil gaharu yang dikelompokkan ke dalam delapan marga dan tiga suku. Pulau Jawa (2 jenis). Tulisan ini dipaparkan dengan maksud untuk memberikan gambaran secara umum mengenai pemanfaatan gaharu. Kalimantan 4 . pemahaman mengenai pentingnya nilai gaharu. dan Kepulauan Maluku (1 jenis). tumbuhan penghasil gaharu umumnya tumbuh di Pulau Kalimantan (12 jenis) dan Pulau Sumatera (10 jenis).

Indikasi dari menurunnya populasi Aquilaria spp. salah satu tumbuhan penghasil gaharu terpenting yang banyak tumbuh di Kalimantan telah dimasukkan ke dalam Appendix II sebagai tumbuhan yang terancam punah sehingga dalam penebangan dan perdagangannya perlu dibatasi. (-)-10-epi-y-eudesmol. di hutan alam semakin menurun dan bahkan pada suatu saat menjadi punah. Bahkan sejak tahun 2004. Walaupun realisasi produksi gaharu tidak menggambarkan besarnya potensi. dihydrokaranone. (Sulistyo A.Perkembangan Pemanfaatan Gaharu . di pedalaman hutan Kalimantan Barat dan Kalimanatan Tengah serta menurunnya realisasi produksi gaharu dari tahun ke tahun. Tingginya permintaan pasar dunia akan gaharu dan harga jual gaharu yang cukup tinggi telah menarik minat masyarakat. KANDUNGAN DAN MANFAAT GAHARU Terdapat beberapa zat penting yang terkandung dalam gubal gaharu yaitu (-agarofuran. nor-ketoaaga-rofuran. Akibatnya.. jinkohol.. jinkohol II serta oxo-aga-rospirol. beberapa instansi pemerintah dan masyarakat telah melakukan inisiatif untuk mengadakan pelestarian tumbuhan penghasil gaharu dan sekaligus membudidayakan. Lebih lanjut Susilo (2003) mengatakan bahwa terdapat 17 macam 5 . Aquilaria malaccensis. populasi Aquilaria spp.. Siran) Tengah. Menyadari semakin langkanya tumbuhan penghasil gaharu. (-agarofuran. baik untuk kepentingan konservasi maupun ekonomi. dan Kalimantan Selatan. namun dengan semakin sulitnya mendapatkan gaharu dari waktu ke waktu menunjukkan populasi Aquilaria spp. Untuk mencegah dari kepunahan maka pada pertemuan CITES (The Convention on International Trade in Endangered Species of Wild Flora and Fauna) ke-IX di Florida. antara lain dari pergerakan pencari gaharu yang telah mengarah pada bagian utara Kalimantan Timur.. seluruh jenis Aquilaria telah dimasukkan dalam Appendix II CITES. terus mengalami penurunan. jinkohon-eremol. baik lokal maupun pendatang untuk melakukan eksploitasi gaharu secara besar-besaran. Amerika Serikat pada tahun 1994. agarospirol. kusunol.

Limbah bekas gaharu yang telah disuling digunakan untuk dupa dan bahan untuk upacara agama.4 –dihydroxy-dihydro-agarufuran. agarospirol.senyawa yang terdapat pada gaharu. kanker. hio. untuk pengobatan stres. malaria. Di Cina. Cara Pendugaan Kandungan Gaharu Karena tidak semua tumbuhan penghasil gaharu berisi gaharu. TBC. PEMUNGUTAN DAN PENGOLAHAN GAHARU A. membakar jenazah bagi umat hindu. dan pengawet berbagai jenis asesori. Selain itu gaharu telah dipergunakan sebagai bahan baku industri parfum. dan tumor yang masih dalam proses uji klinis. kebugaran serta bahan minuman (kopi) oleh masyarakat di Kabupaten Berau. juga telah berkembang industri pemanfaatan gaharu sebagai bahan baku industri obat herbal alami. p-methoxybenzylaceton. Karena aromanya harum. saat ini berbagai negara memanfaatkan gaharu selain sebagai bahan pengharum (parfum) dan kosmetik. liver. radang lambung dan ginjal. asma. maka pengetahuan cara pendugaan kandungan gaharu pada tumbuhan penghasil gaharu yang terinfeksi jamur pembentuk gaharu perlu diketahui terutama oleh para pemungut pemula 6 . reumatik. antara lain: noroxoagarofuran. kecantikan. Di samping itu dengan perkembangan ilmu dan teknologi industri. asma. setanggi (dupa). gangguan ginjal. sedangkan air suling gaharu dimanfaatkan untuk kesehatan. hepatitis. kosmetik. kanker. kosmetika. tumor. 3. gubal gaharu diperdagangkan sebagai komoditi elit untuk keperluan industri parfum. tasbih. Selanjutnya Oiler (tanpa tahun) dalam Suhartono dan Mardiastuti (2003) menyebutkan terdapat 31 unsur kimia yang terkandung di dalam gaharu dan bahan kimia penyusun utamanya adalah 2-(2-(4 methoxyphenyl)ethil)chromone (27%) dan 2-(2-phenylethyl)chromone (15%). gaharu dimanfaatkan sebagai obat sakit perut. bahan antibiotic. dan aquillochin. dan obatobatan. Gaharu dengan aromanya yang khas digunakan masyarakat di Timur Tengah sebagai bahan wewangian. dan stres.

7 . tajuk pohon kecil dan tipis. puncut atau pahat. Cara pemungutan gaharu semacam ini di Sumatera dan Kalimantan disebut servis. C. kulit kayu kering dan rapuh serta bila ditarik mudah putus. cabang pohon banyak yang patah.. Cara penyulingan minyak gaharu dapat dilakukan dengan dua sistem yaitu sistem kukus dan tekanan uap. Setelah ditemukan ciri-ciri tersebut maka dilakukan uji pelukaan pada batang pohon dengan menggunakan kapak atau parang.. Untuk lebih meyakinkan biasanya serpihan kayu tadi selanjutnya dibakar untuk mengetahui apakah mengeluarkan bau/ aroma wangi khas gaharu. Sistem Pemungutan Gaharu Pohon dari tumbuhan penghasil gaharu yang telah diyakini mengandung gaharu ditebang. Harga minyak gaharu di pasaran Jakarta Rp 750. Adapun ciri dari tumbuhan penghasil gaharu berisi gaharu antara lain adalah: daun berwarna kuning dan rontok. Cara ini disebut tubuk. Cara lain yang berlaku pada masyarakat Dayak Kenyah dan Punan di Kalimantan Timur adalah dengan mengiris dan memotong bagian kayu dari tumbuhan penghasil gaharu yang terkena infeksi penyakit hingga ke bagian tengah batang. Siran) sehingga tidak terjadi salah tebang pada pohon yang tidak berisi gaharu.Perkembangan Pemanfaatan Gaharu . B. Bilamana terdapat alur coklat kehitaman pada batang menunjukkan adanya kandungan gaharu.. (Sulistyo A.. banyak terdapat benjolan dan lekukan sepanjang batang atau cabang pohon.000/tolak (1 tolak = 12 cc). Potongan kayu berisi gaharu kemudian dikumpulkan dan secara perlahan bagian kayu dipisahkan dari gaharu dengan menggunakan pisau kecil atau pahat cekung. Pengolahan Gaharu Sampai saat ini produk gaharu yang berasal dari alam umumnya dipasarkan dalam bentuk bongkahan namun ada pula dalam bentuk minyak hasil sulingan. kemudian dipotong-potong dan dibelah untuk diambil gaharunya.

Tabel 1. 1. Lokasi Super Tanggung Kacangan Kacangan A Kacangan B Kacangan C Teri Teri A Teri B Teri C Teri kulit A Teri kulit B Kemedangan Kemedangan A Kemedangan B Kemedangan community Sudokan Serbuk Serbuk Cincangan Samarinda Super king Super A Super AB 2. Keragaman dan ketidakjelasan di dalam penentuan mutu tersebut menyebabkan harga jual yang berbeda dengan kelas mutu yang sama.KLASIFIKASI MUTU GAHARU Klasifikasi mutu gaharu di Kalimantan Timur khususnya di Kota Samarinda dan daerah sekitarnya hingga saat ini masih belum seragam (Tabel 1) dan penentuannya dilakukan secara visual. pedagang pengumpul. Klasifikasi mutu gaharu di Kota Samarinda dan daerah sekitarnya Klasifikasi mutu No. dan cincangan dan setiap kelas mutu dibedakan lagi menjadi beberapa sub kelas mutu. Pada Tabel 1 disajikan kriteria dan klasifikasi mutu gaharu. kacangan. teri. Dengan telah ditetapkannya standar nasional untuk mutu gaharu (SNI 01-5009. Muara Kaman Kota Bangun Muara Wahau Super A Super B Super A Super B Kacangan isi Teri isi Kacangan Teri kulit kosong Kacangan A Kacangan B Teri A Teri B 3. TangKacangan isi Teri super gung isi Kacangan Teri laying Tangkosong gung kosong Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan. tanggung. kemedangan.1-1999) diharapkan standar mutu tersebut dapat segera menjadi bahan acuan para pengusaha gaharu. Secara umum klasifikasi mutu gaharu dapat dikelompokkan menjadi enam kelas mutu yaitu super. 4. dan pemungut gaharu di dalam menentukan kelas mutu gaharu. 2007 8 .

000. tidak ada campuran dengan serat kayu.beberapa sampel gaharu dapat Teri B 750. Tanggung 3.000. 1.000. bercampur kayu. Gaharu berwarna hitam terkadang bercampur coklat. Kualitas gaharu yang paling 1.000 per kg. Secara visual Kacangan C 2. kadang bercampur serat kayu dan berukuran tanggung. Kelas mutu Harga (Rp/Kg) kg.per No.000. berupa butiran-butiran sebesar biji kacang atau berdiameter sekitar 2 mm..Perkembangan Pemanfaatan Gaharu .Berdasarkan Keputusan Kepala Badan Standarisasi Nasional (BSN) No.000. Harga jual gaharu di mencapai Rp 30.penyulingan untuk menghasilkan Kacangan B 5. Kacangan A 7.. Kriteria dan klasifikasi mutu gaharu No. Gaharu berwarna hitam dan coklat.000.. padat.000. berupa butiran-butiran lebih kecil dari biji kacang dan lebih tipis atau berdiameter sekitar 1 mm. Super King 30. pasaran Samarinda.000.000. (Sulistyo A. Dalam 5.per kg. Kemedangan Cincangan Sumber : Balai Penelitian dan Pengembangan Kehutanan Kalimantan.000.1-1999. Teri A 1.dilihat pada Gambar 3.25. Teri Kulit A Teri Kulit B Kemedangan A Kemedangan B Kemedangan C Suloan 300. 2.500. bercampur kayu. Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan.50. mengkilap dan sangat berbau.000. bagian dalam tidak berlubang.. padat. bagian dalam kadang berlubang. 6.000.000.000. Potongan kecil kayu dari pemisahan gaharu.000. disusul kualitas tanggung dengan Kalimantan Timur harga rata-rata Rp 10. telah ditetapkan Standar Nasional mutu gaharu dengan judul dan nomor: Gaharu SNI 01-5009.500.500.75.4.000. Kacangan 4.2.000.000.000.000. dan pada umumnya Super AB 15.000.000 Super 20.rendah berharga sekitar Rp 25. Klasifikasi Super Kriteria Gaharu berwarna hitam pekat.minyak gaharu. Gaharu berwarna hitam terkadang bercampur coklat.000. berupa bongkahan atau butiran berukuran besar. Teri C 500. Kayu yang mengandung getah gaharu.250. keras.000. 1386/BSN-I/HK. Teri 5.100. keras. 2006 Berdasarkan informasi pasar di Samarinda (Tabel 3) harga gaharu dengan kualitas super dapat Tabel 3. Tanggung 10.- 6. Siran) Tabel 2.000. 2006 9 ..digunakan sebagai bahan baku 3.71/ 09/99.

cara uji. bobot. (b) kacangan. Sampel gaharu (a) gaharu adalah kayu yang berasal kelas tanggung.standar ini diuraikan mengenai definisi gaharu. Klasifikasi mutu gaharu terdiri dari gubal gaharu. berserat kasar dan kayunya yang lunak. istilah. dan abu gaharu. klasifikasi. Kemudian yang dimaksud dengan kemedangan adalah kayu yang berasal dari pohon atau bagian pohon penghasil gaharu. pengambilan contoh. (c) teri dan dari pohon atau bagian pohon (d) kemedangan penghasil gaharu. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia dapat dilihat pada Tabel 4. spesifikasi. Abu gaharu adalah serbuk kayu sisa pemisahan gaharu dari kayu. cara pemungutan. dengan aroma yang kuat. 10 . dan aroma ketika dibakar. lambang dan singkatan. memiliki kandungan damar wangi dengan aroma yang lemah. syarat lulus uji dan syarat penandaan. ditandai oleh warnanya yang putih keabu-abuan sampai kecoklat-coklatan. kandungan damar wangi. ditandai oleh warnanya yang hitam atau kehitaman berseling coklat. kemedangan. Menurut SNI 01-5009. serat. Setiap kelas mutu selanjutnya dibedakan lagi menjadi beberapa sub kelas berdasarkan ukuran.1-1999 yang dimaksud dengan gubal Gambar 1. warna. syarat mutu.

. C. 4. Siran) Tabel 4. Mutu VI Kemedangan II Kemedangan III Kurang Kurang kuat 7. 2. Mutu V Kemedangan I Sedang Agak kuat 6. 3. 1. 2. 1..Perkembangan Pemanfaatan Gaharu . B. Super Super AB Sabah Super Hitam merata Hitam kecoklatan Hitam kecoklatan Tinggi Cukup Sedang Kuat Kuat Agak kuat Tanggung A Sabah I Tanggung AB Tanggung C Coklat kehitaman Coklat bergaris hitam Coklat bergaris putih tipis Kecoklatan bergaris putih tipis Kecoklatan bergaris putih lebar Putih keabuabuan garis hitam tipis Putih keabuabuan Tinggi Cukup Sedang Sedang Agak kuat Agak kuat Agak kuat Agak kuat 5. 3. Mutu VII Abu gaharu Mutu Utama Mutu I Mutu II Kurang Kurang kuat Cincangan Hitam Tinggi Sedang Kurang Kuat Sedang Kurang TATA NIAGA GAHARU Proses pemasaran gaharu di berbagai tempat di Indonesia dimulai dari pemungut gaharu yang menjual gaharu yang ditemukannya kepada pedagang pengumpul di desa atau di kecamatan dan selanjutnya oleh pedagang pengumpul dijual ke pedagang besar (eksportir) di Ibukota Propinsi. 1. 11 . (Sulistyo A. 3... Klasifikasi mutu gaharu menurut Standar Nasional Indonesia Kesetaraan dengan standar mutu di pasaran Kandungan damar wangi No Klasifikasi mutu Gubal Mutu Utama Mutu I Mutu II Kemedangan Mutu I Mutu II Mutu III Mutu IV Warna Bau/aroma (dibakar) A. 2.

pedagang pengumpul di kecamatan maupun langsung kepada pedagang besar (eksportir) di Kota Samarinda. Pedagang besar selain memiliki modal besar juga izin usaha yang dikeluarkan oleh instansi pemerintah. Pembelian gaharu dilakukan sepanjang tahun melalui pedagang pengumpul atau pemungut bebas. Hasil pembelian dari pedagang perantara ini kemudian dikumpulkan oleh pedagang pengumpul di kecamatan untuk selanjutnya dijual kepada pedagang besar karena adanya ikatan kontrak. baik kepada pedagang pengumpul di desa.Salah satu contoh alur tata niaga gaharu di Kalimantan Timur dapat diuraikan seperti pada Gambar 2. Pemungut gaharu terdiri dari pemungut bebas dan pemungut terikat. Pemungut bebas adalah pemungut gaharu dengan modal kerja sendiri sehingga bebas di dalam menentukan waktu pencarian gaharu dan menjual hasil perolehannya. Pembelian meningkat bilamana permintaan pasar terhadap gaharu tinggi. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 2. bahkan untuk mendapatkan jumlah yang diinginkan mereka menanamkan modal yang disalurkan melalui 12 . Contoh alur tata niaga gaharu di Kalimantan dan Sumatra Pedagang pengumpul terdiri dari pedagang perantara di desa yang langsung melakukan pembelian gaharu yang diperoleh para pemungut. Pemungut terikat adalah pemungut gaharu yang dimodali sehingga waktu pencarian dan penjualan hasil perolehannya terikat pada pemberi modal yaitu pedagang pengumpul yang merupakan perpanjangan dari pedagang besar.

. Apabila diperhatikan maka perdagangan gaharu hasil alam di Indonesia dari dulu hingga saat ini lebih banyak bertumpu pada peyebaran secara ekologis jenis-jenis gaharu tersebut. Siran) pedagang pengumpul ataupun secara langsung kepada pemungut untuk modal kerja mencari gaharu. Oleh karena itu maka secara umum pemanfaatan gaharu harus mengikuti tahapan dan aturan-aturannya.Perkembangan Pemanfaatan Gaharu . gaharu menjadi komoditi primadona dan memiliki nilai komersial yang cukup tinggi sehingga banyak diburu oleh konsumen. Pemasaran gaharu yang merupakan salah satu bentuk pemanfaatan tumbuhan dan satwa liar diatur berdasarkan Peraturan Pemerintah Nomor 8 Tahun 1999 dan Konvensi Perdagangan Internasional tentang jenis flora dan fauna liar yang terancam punah (CITES). pengangkutan untuk peredaran dalam negeri dan pengangkutan untuk pemasaran luar negeri. pengambilan dari alam atau hasil budidaya (penangkaran). 13 ... Gaharu yang diperdagangkan di Indonesia terdiri dari tiga jenis. Alur tata niaga Gaharu di daerah (Kalimantan) PEMASARAN GAHARU Dalam dunia perdagangan gaharu. Sulawesi dan Maluku lebih dikenal dengan nama Aquilaria filaria. (Sulistyo A. yaitu: gaharu dari Sumatera dan Kalimantan dengan jenis Aquilaria malaccensis dan A. sedangkan jenis gaharu Gyrinops lebih banyak diproduksi dari Nusa Tenggara. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 3. yaitu: penentuan kuota.. gaharu dari Papua. baik di Indonesia maupun di luar negeri. microcarpa.

pengangkutan dan peredaran secara domestik produk sampai akhirnya ke konsumen. obat nyamuk. Gambar 4. lulur dan lotion 14 . lulur. Beberapa contoh produk dimaksud dapat dilihat pada gambar 3 dan 4 berikut. cream whitening. Bahkan saat ini sudah dikembangkan daun jenis Aquilaria dan Gyrinops untuk bahan pembuatan minuman teh karena kandungan zat anti oksidan dalam daun yang cukup tinggi. pemanfaatan untuk obat-obatan dan aroma terapi. makmul. produk gaharu yang diperdagangkan dalam negeri saat ini tidak saja terbatas pada chip atau serpihan dengan bermacam-macam kelas. sabun. Pemasaran Dalam Negeri Pemasaran dalam negeri dimulai dari aktivitas pengambilan.A. lotion. pembersih muka. hio. tapi juga sudah mengarah ke produk turunannya. antara lain: minyak. Produk turunan gaharu: sabun transparan. Karena perkembangan teknologi.

Sirup daun gaharu Gaharu leaf tea Gambar 5. termasuk Riau. NTT. kelompok masyarakat maupun lembaga. baik sebagai individu (perorangan). maka terdapat kecenderungan untuk saling menekan harga. Sulawesi. NTB. Maluku. baik dalam menentukan harga maupun kualitas gaharu. namun karena akses yang mudah memasok gaharu pula ke Jakarta. banyak fihak yang terlibat dalam perdagangan gaharu. Secara tradisional daerah pemasok gaharu untuk kota Surabaya adalah Kalimantan. 15 . Pemasaran gaharu dalam negeri terbentuk karena adanya hubungan antara daerah pemasok dengan kota/pusat penerima. misalnya pencari gaharu dan pedagang pengumpul di bagian hulu (hutan atau desa sekitar hutan) lebih banyak dibandingkan dengan pedagang menengah dan besar yang berdomisili di ibukota kabupaten atau propinsi. Daerahdaerah ini walaupun letaknya di Indonesia bagian timur. Produk sirup dan teh untuk bahan minuman Dilihat dari pelaku usaha. Papua. ditambah dari daerah Indonesia bagian barat. Oleh karena itu bentuk pemasaran gaharu di Indonesia lebih cocok dikatakan sebagai pasar “monopsoni”. yaitu sumatera. yaitu pasar yang dikuasai oleh pembeli. Di duga banyak gaharu yang di perdagangkan secara illegal dari sumatera lewat Riau ke Singapura dan Malaysia. Karena jumlah pelaku usaha pemasaran.

malaccensis. microcarpa. yaitu: A. Oleh karena kekhawatiran salah satu species penghasil gaharu yang mungkin bisa cepat punah. yaitu konsumen dan produsen.Secara garis besar. lalu lintas perdagangan gaharu di dalam negeri dapat dilihat pada gambar berikut. Demikian pula dari sisi warna dan aroma sangat sulit bagi orang awam atau pedagang pemula untuk dapat memilah-milahnya. Lalu lintas perdagangan gaharu dalam negeri Beberapa permasalahan yang sering dijumpai di lapangan antara lain: sulitnya menentukan jenis gaharu. B. Kalimantan Sulawesi Papua Maluku Riau  Sumatera Sumatera Jakarta NTT NTB Surabaya Gambar 6. A. . maka jenis Aquilaria yang ada. standar dan kualitas serta harga yang layak sehingga menguntungkan bagi kedua belah fihak. filaria dan Gyrinops diatur perdagangannya oleh konvensi perdagangan internasional yaitu CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) melalui sistem quota. Pemasaran Luar Negeri Secara fisik. A. produk gaharu sulit dibedakan berdasarkan asal jenis tumbuhan dan asal daerahnya.

produk gaharu yang diperdagangkan ke luar negeri mengikuti selera konsumen. wewangian dan aroma terapi. Pada gambar 6 berikut. Gaharu dengan kualitas super (superking. Untuk gaharu yang berkualitas menengah ke bawah.Menurut ASGARIN. Gaharu dalam bentuk gelondongan yang siap dikirim ke Taiwan. ekspor lebih banyak dilakukan ke negara-negara Asia Selatan untuk digunakan sebagai bahan baku pembuatan minyak wangi dan untuk acara-acara ritual dalam bentuk hio. makmul dan lain-lain. 17 . dapat dilihat beberapa gaharu yang masih dalam bentuk gelondongan yang siap untuk diekspor. Dalam beberapa tahun terakhir terdapat kecenderungan pembeli dari Taiwan untuk mengimpor gaharu dari Indonesia dalam bentuk log. Nilai keseluruhan dari gaharu tersebut tidak kurang dari Rp 600 juta. Kayu gaharu yang bentuknya masih gelondongan dan hanya sedikit mengandung gaharu tersebut digunakan sebagai hiasan yang dipasang di suatu ruangan dengan diberikan sedikit sentuan teknologi ukir sehingga terkesan mewah dan mempunyai nilai seni yang sangat tinggi. Gambar 7. super A dan AB) umumnya dipasarkan ke negaranegara Timur Tengah untuk digunakan sebagai bahan acara ritual keagamaan.

pusat perdagangan gaharu dunia yang sangat penting adalah Singapura dan Riyad (Saudi Arabia). Dua negara ini pula yang menjadi daerah atau negara tujuan utama ekspor gaharu dari Indonesia. Pada tahun 2009.000 (K) 76.709 (R) 30.000 (R) 455. Perkembangan kuota dan realisasi ekspor gaharu Indonesia Tahun 2007 2008 2009 A.000 (K) - Tabel diatas memperlihatkan bahwa kuota ekspor gaharu pada tahun 2007 dari ketiga jenis yang dapat dipenuhi hanya dari jenis A. sedangkan pada A.Selama 3 (tiga) tahun terakhir jumlah kuota dan realisasi gaharu yang diekspor sebagaimana dapat dilihat pada tabel berikut.000 (K) 25.000 (R) 25. hal ini terjadi karena ditemukannya potensi baru yang sebelumnya luput dari inventarisasi. filaria yang banyak terpendam di rawa-rawa di Papua. dan sebagian lagi ke Timur Tengah. Menurut ASGARIN. filaria. Menurut sebuah sumber. misalnya untuk jenis A. Pada tahun 2008. malaccensis tidak dapat dipenuhi. China. sedangkan untuk A.000 (K) 30.000 (K) 8. filaria sebanyak tujuh kali lipat. Tabel 5.000(K) 326. Oleh Singapura gaharu yang masuk dilakukan penyortiran dan pengemasan dan kemudian di ekspor kembali ke India.890 (R) A.000 (K) 65. Singapura selain mendapat pasokan gaharu dari Indonesia juga dari negara Asia Tenggara. dan bahkan untuk Gyrinops realisasi ekspornya hanya mencapai 30% dari kuota yang ditetapkan.000 (R) 65. lonjakan kuota yang signifikan terjadi pada jenis A. realisasi ekspor gaharu untuk ketiga jenis dapat terpenuhi 100% dari kuota yang ditetapkan. Sedangkan gaharu yang masuk ke Saudi Arabia di distribusikan lagi ke negara-negara lain di sekitarnya dan sebagian lagi di ekspor ke Inggris dan perancis. Taiwan dan Jepang. Hongkong.000 (K) 23. Malaccensis 30. misalnya Vietnam dan Kamboja.250 (K) 74.000 (R) 173. seperti dapat dilihat pada gambar berikut. filaria 76. malaccensis sebanyak hampir enam kali lipat.882(R) Gyrinops 24. 18 .

Teknik budidaya dimaksud meliputi kegiatan perbanyakan bibit. pemberantasan hama dan penyakit hingga tumbuhan tersebut memiliki volume yang cukup memadai. yaitu secara alami dan buatan.Perkembangan Pemanfaatan Gaharu ... sedangkan pohon-pohon penghasil gaharu yang tumbuh secara alami perlu dikonservasi dan dipelihara dengan baik untuk dijadikan pohon induk penghasil anakan. (Sulistyo A. Luka tersebut menyebabkan pohon terinfeksi oleh penyakit (bakteri. Siran) Hongkong Prancis UK India China Japan Malaysia Taiwan Kwait Oman Qatar Saudi Arabia UAE SINGAPORE Bahrain Middle East Riyadh Indonesia Iraq Iran Afrika Gambar 8.. Secara garis besar proses pembentukan gaharu terdiri dari dua. pemeliharaan. jamur) yang diduga mengubah pentosan atau selulosa menjadi resin atau damar.. 19 . Lalu lintas perdagangan gaharu luar negeri REKAYASA PEMBENTUKAN GAHARU Teknik budidaya perlu dikuasai dengan baik untuk dapat membudidayakan pohon penghasil gaharu. Rekayasa produksi gaharu diarahkan untuk pohon-pohon penghasil gaharu hasil budidaya. penanaman. yang dua-duanya berkaitan dengan proses patologis yang dirangsang oleh adanya luka pada batang patah cabang atau ranting. virus.

5. Rekayasa pembentukan gaharu dengan inokulasi telah dilakukan oleh banyak fihak.Semakin lama kinerja penyakit berlangsung. kegiatan lapangan dan kombinasi keduanya. kegiatan di laboratorium dan kegiatan uji lapangan yaitu: 1. Alur kegiatan rekayasa produksi gaharu. 20 . 6. kadar gaharu menjadi semakin tinggi. 7. dimulai dari kegiatan laboratorium. 4. Identifikasi jamur secara molekuler Penyaringan (screening) Uji efektivitas Formulasi media Produksi inokulan (jamur) Pembangunan plot demonstrasi untuk ujicoba di lapangan Observasi dan evaluasi Alur kegiatan rekayasa produksi gaharu secara garis besar dapat dilihat sebagaimana gambar berikut: Gambar 9. 8. Eksplorasi. koleksi dan isolasi jamur. 3. Proses pembentukan gaharu di hutan alam sulit dipantau dan diamati. Kegiatan yang “berskala laboratorium” dimulai dari kegiatan lapangan. dengan teknik induksi yang bermacam-macam dan jenis jamur yang bervariasi. Oleh karena itu untuk dapat mengamati secara langsung proses pembentukan gaharu dilakukan rekayasa dengan cara inokulasi (penyuntikan) jamur atau cendawan pada pohon penghasil gaharu. 2. Tahapan rekayasa produksi gaharu meliputi banyak kegiatan.

beberapa isolat lain yang juga cocok dan memberikan hasil yang cukup bagus adalah Jambi dan Kalimantan selatan.Perkembangan Pemanfaatan Gaharu . (Sulistyo A. maka secara resmi ke empat jenis isolat tersebut telah di “launching” Menteri Kehutanan (lihat gambar 8) pada Pameran Indo Green yang berlangsung di Jakarta Convention Center (JCC) pada tahun 1999. Siran) Sampai saat sudah berhasil dikoleksi 23 inokulan (isolat) dari sebagian besar propinsi di Indonesia. Launching tersebut juga dimaksudkan untuk memberikan akses kepada publik agar dapat memanfaatkan isolat tersebut untuk ujicoba produksi gaharu. Gorontalo dan Papua. Berdasarkan pengamatan sementara. Sumatera Barat.... Gambar 10. Berdasarkan bukti-bukti keberhasilan tersebut. Diantara isolat tersebut empat isolat sudah diujicoba pada beberapa jenis pohon penghasil gaharu di beberapa daerah dan memberikan hasil yang cukup bagus.. Launching Inokulan Gaharu oleh Menteri Kehutanan Dengan adanya launching tersebut maka secara resmi inokulan prododuksi Puslitbang Hutan dan Konservasi Alam (P3HKA) telah dilepas di pasaran namun masih terbatas. 21 . Keterbatasan tersebut dimaksudkan hanya kepada masyarakat petani gaharu atau pelaku usaha gaharu yang telah mendapatkan pelatihan dari P3HKA saja yang boleh menggunakan inokulan tersebut. Ke empat isolat tersebut adalah: isolat dari Kalimantan Barat.

Bali. baik kondisi ekologis. Bangka. Menado dan Seram. yaitu: Bohorok (sumut). ujicoba ke enam isolat telah dilaksanakan di 15 (lima belas) lokasi yang tersebar di beberapa propinsi di Indonesia. 22 . Sumsel. Carita (Banten). Ujicoba tersebut dilaksanakan di lokasi dengan kondisi yang berbeda. Beberapa faktor penting yang diamati adalah: kondisi kelembaban dan suhu udara. Lombok (NB). Sukabumi. jenis asal isolat dan jenis pohon penghasil gaharu yang diinokulasi. baik kegagalan maupun keberhasilanya. Kalimantan Selatan. Kalimantan Tengah. Penyebaran plot inokulasi dapat dilihat sebagaimana gamber berikut. Kalimantan Barat. Penyebaran plot inokulasi pembentukan gaharu (gambar bintang warna kuning) Evaluasi dan pengamatan terus menerus dilakukan. untuk mengetahui perkembangan inokulasi. Sijunjung dan Padang Pariaman (Sumbar).Untuk melihat efektivitas pembentukan gaharu. keterbukaan tajuk. Jambi. Bioinduction : 15 locations Gambar 11. virulensi inokulan yang digunakan. jarak titik lubang dan lain sebagainya. Bogor (Jabar).

Perkembangan Pemanfaatan Gaharu . Kualitas gaharu tersebut terus meningkat menjadi kacangan setelah 2 tahun inokulasi dan secara signifikan meningkat menjadi tanggung pada 3 tahun setelah inokulasi. Menurut rencana pada tahun 2011 akan dilakukan pemanen lagi untuk melihat perkembangan kualitas gaharu.. Siran) Perkembangan hasil inokulasi yang dilaksanakan di salah satu lplot penelitian yaitu daerah Sukabumi dari waktu ke waktu dapat dilihat sebagaimana tabel berikut. Contoh gaharu hasil panen yang dilakukan secara bertahap adalah sebagai berikut.... Tabel 6. dan terus meningkat menjadi kelas teri setelah 1 tahun. maka hasil gaharu yang dipanen setelah 3 bulan inokulasi memiliki kualitas kemedangan. Pada saat ini pohon yang ditebang secara bertahap tersebut masih hidup dan masih tumbuh baik di lapangan. dengan harapan bahwa gaharu yang akan dipanen tersebut akan mempunyai kualitas` yang lebih bagus lagi dari sebelumnya. (Sulistyo A. 23 . Perkembangan hasil inokulasi menurut waktu Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun 2 tahun 3 tahun Kualitas Kemedangan Kemedangan B Kemedangan A teri kacangan tanggung Apabila di sejajarkan dengan kualitas gaharu hasil alam yang ada di pasaran dalam negeri.

Gaharu hasil panen 3 bulan setelah penyuntikan. dengan kualitas kemedangan C.Gambar 12. 24 . Gaharu hasil panen 9 bulan setelah penyuntikan (inokulasi) dengan kualitas kemedangan A. Gambar 13.

Perkembangan Pemanfaatan Gaharu . Siran) Grade Kemedangan (US $ 100/kg) Gambar 14.. Gaharu hasil panen dua tahun setelah penyuntikan dengan kualitas kacangan 25 . Gaharu hasil panen satu tahun setelah penyuntikan dengan kualitas teri Grade Gubah AB (US $ 200-250/kg) Gambar 15... (Sulistyo A..

Gaharu hasil panen 3 (tiga) tahun setelah penyuntikan dengan kualitas tanggung Berdasarkan survey pasar. Harga gaharu yang cenderung meningkat dengan semakin tertundanya waktu panen. Tabel 7.000 200. referensi harga gaharu hasil alam di pasaran dalam negeri dan penawaran dari pedagang gaharu dari Riyad (gambar sudut kanan atas).000.> US $ 800 Gambar 16. Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun Harga (Rp) 50.000 1.000 26 .000 750. estimasi harga gaharu hasil panen dari plot penelitian P3HKA dapat dilihat sebagai mana tabel berikut.

Grafik hubungan antara terbentuknya gaharu dengan waktu penundaan panen. gaharu hasil panen 9 bulan setelah penyuntikan mengandung zat aktif yang cukup 27 . Berdasarkan pemeriksaan laboratorium.Perkembangan Pemanfaatan Gaharu . Kualitas Hasil rekayasa Super Tanggung Kacangan Teri Kemedangan Hasil alam 1 Hasil alam 2 Hasil alam 3 Hasil alam 4 1 2 3 4 Tahun 5 6 7 8 9 10 Gambar 17.000 US$ 800 atau 7.500.500.. Siran) Umur Setelah Inokulasi 2 tahun 3 tahun 4 tahun Harga (Rp) 2.. (Sulistyo A.. Grafik hubungan antara terbentuknya gaharu dengan waktu dapat dilihat pada grafik sebagai berikut. waktu penundaan panen dan harga di pasaran sangan erat sekali.. Semakin lama proses pembentukan gaharu di pohon maka akan semakin meningkat kualitas gaharu yang akan dihasilkan dan dengan sendirinya akan meningkatkan harga gaharu tersebut.000 ? Hubungan antara kualitas gaharu.

memiliki sifat pestisida Cadinene = konstituen minyak esensial berbagai tanaman Limonene = terpen aroma bunga & buah. setidaknya terdapat 12 (dua belas) komponen kimia sebagaimana dapat dilihat pada gambar berikut.konsituen utama dalam minyak melati Maltol = wangi caramel (manis). insektisida botani. wangi & warna biru Benzylacetone = wangi manis bunga. 28 . anti inflamantory Ambrettolide = wangi musk. manis buah & bunga 1 2 3 4 5 Tahun Gambar 18. bahan kosemtik Isolongifolen = bahan odorant & parfum Indole = wangi bunga & parfum. Azulene = komponen minyak esensial tanaman.banyak. komponen volatile dan kokoa Dumasin = wangi mint. teh dan daun tembakau Valerolactone = wangi herbal Ambrox = odorant tipe amber. Kandungan kimia yang terdapat pada gaharu hasil rekayasa. penguat rasa/aroma pada roti &kue Komponen Kimia Ketoisophorone = wangi manis campuran kayu. Pemeriksaan kandungan kimia pada gaharu hasil alam menunjukkan hasil yang sama dengan gaharu hasil rekayasa jika dua-duanya diambil dari kualitas yang sama.

penyediaan pupuk. pemberantasan hama dan penyakit). infrastruktur. riset dan pengembangan. 29 . pengangkutan. Ketiga subsistem tersebut di atas memerlukan investasi yang cukup besar. Siran) PENUTUP Dengan ditemukannya teknologi inokulasi pembentukan gaharu. subsistem pendukung (kebijakan pemerintah. peralatan inokulasi. (Sulistyo A.. Hanya dengan koordinasi dan integrasi yang baik di antara seluruh komponen masyarakat dan pemerintah. Untuk dapat mewujudkan kondisi dan harapan tersebut.. penyiapan bibit. dan pengamanan). subsistem tengah (penyuntikan.Perkembangan Pemanfaatan Gaharu .. skema kredit dan asuransi). penanaman.. pendidikan dan pelatihan. maka seluruh sektor harus memainkan peran sesuai dengan tugas pokok dan fungsinya masing-masing. tranportasi. terbukalah peluang yang besar untuk kegiatan pengusahaan gaharu yang dimulai dari subsistem hulu (penyiapan lahan. pengolahan. peluang penyerapan tenaga kerja yang besar dan penerimaan asli daerah yang cukup signifikan. penyediaan inokulan. subsistem hilir (pemanenan. maka produk gaharu akan menjadi produk andalan dimasa depan. pemasaran).

30 .

STATUS RISET GAHARU 31 .

32 .

Aspek PRODUKSI 33 .

.

pada umumnya masyarakat yang tinggal di sekitar hutan sudah mengenal gaharu. sehingga pemahaman dan keterampilannya untuk mendukung pengembangan cluster industri gaharu telah sangat memadai. sehingga tidak menyebar jauh. Dalam pengembangan gaharu. khususnya untuk menjaga kesinambungan produksi.PENGEMBANGAN GAHARU DI SUMATERA Mucharromah Fakultas Pertanian Jurusan Perlindungan Tanaman Universitas Bengkulu PENDAHULUAN Gaharu merupakan produk kehutanan yang memiliki nilai ekonomi sangat tinggi dibanding produk kehutanan lainnya. Dari aspek keamanan lingkungan dan keragaman hayati. kecuali dengan campur tangan manusia. sebagian bahkan pernah menjadi pengumpul. sekaligus untuk melindungi ragam pohon penghasil gaharu yang ada di Indonesia. Dari segi kesiapan masyarakat. Pengembangan gaharu ini perlu dilakukan. masyarakat di sekitar hutan merupakan sasaran ideal yang dapat melipatgandakan peran dan fungsi program tersebut. Dari segi keberadaan material bibitnya lokasi sekitar hutan memiliki jumlah tegakan gaharu alam terbanyak. sehingga sangat potensial untuk dikembangkan. mengingat 35 . pengembangan gaharu di sekitar hutan juga akan membantu pengamanan keragaman hayati dan kelestarian hutan. mengingat buah pohon ini bersifat rekalsitran.

dengan tekstur yang sangat keras dan halus tidak berserat. berwarna hitam mengkilat dan berat hingga tenggelam dalam air. Gaharu kualitas super sudah mengeluarkan aroma harum meski tanpa dipanasi atau dibakar. Sejauh ini produksi gaharu Indonesia masih banyak diambil dari alam sehingga disebut sebagai gaharu alam. paningkatan temperatur udara. produksi gaharu justru tidak akan terjadi bila pohonnya tumbuh sangat baik dan tidak terganggu sedikit pun. tetapi juga perlu didukung dengan pengembangan teknik produksi dan pengembangan sistem yang akan mendukung pengembangan produksi. Bentuk gaharu super sangat beragam. pengembangan produksi gaharu tidak cukup hanya dilakukan dengan penanaman bibit pohon penghasilnya saja. Dengan demikian. Oleh karenanya. khususnya yang memiliki kualitas super dan di atasnya. Sementara gaharu 36 . pengembangan gaharu tidak sama dengan pengembangan tanaman pertanian yang dapat langsung menghasilkan. bangsa. Dengan nilai ekonomi gaharu yang sangat tinggi dan permintaan pasar dunia yang terus meningkat. menguatkan tanah. pengembangan gaharu di wilayah sekitar hutan akan memperkuat fungsi hutan tersebut. yaitu meningkatkan kapasitas absorbsi dan retensi air tanah.Aspek PRODUKSI masyarakat sudah dapat memperoleh penghasilan dari usaha pengembangan gaharu yang sangat prospektif secara ekonomi. termasuk dari wilayah barat Indonesia atau Sumatera dan dihargai sangat mahal. Selain itu. Gaharu alam telah dikenal sejak ribuan tahun lalu diperdagangkan ke Timur Tengah oleh para pedagang India dan Indo-China. polusi. maka pengembangan gaharu sangat berpotensi mensejahterakan masyarakat. sehingga tidak mudah longsor serta menyerap CO2 dan menghasilkan O2 yang sangat penting dalam mendukung kehidupan. mengingat pohon penghasil gaharu memiliki morfologi yang sangat mendukung perannya sebagai ’penjaga lingkungan’. longsor. khususnya yang berkaitan dengan pendanaan proses produksi yang memerlukan dana cukup besar. Pada pohon penghasil gaharu. kekurangan air bersih. dan kekurangan oksigen. di samping pemberdayaan dan pemakmuran masyarakat di sekitar wilayah hutan. Namun demikian. dan negara di samping menghindarkan dari bahaya bencana alam kekeringan.

B. sehingga keberadaan pohon penghasil gaharu juga makin terancam akibat banyak yang ditebangi dan dicacah masyarakat untuk diambil gaharunya. Dengan upaya ini. hampir seperti seni memahat. maka produksi gaharu Indonesia akan tetap melimpah dan masyarakat yang memproduksinya juga makin makmur dan sejahtera. khususnya pada proses pasca panen.. Karenanya mereka merupakan kelompok sasaran yang sudah siap menjadi SDM untuk pengembangan gaharu. sehingga lebih mampu menjaga keamanan lingkungan dan keragaman sumberdaya alam di sekitarnya. khususnya di area yang paling potensial yaitu wilayah sekitar hutan.. sehingga membutuhkan banyak tenaga kerja terampil. dan perdagangan gaharu.. Kesiapan SDM Pendukung Proses Produksi Meskipun gaharu sudah sangat lama menjadi salah satu komoditi ekspor Indonesia. pembersihan gaharu dari sisa kayu putihnya.Pengembangan Gaharu di . pembersihan.. Dengan pengalaman mencari gaharu alam yang sudah cukup lama. Kesiapan Teknologi Produksi Berbeda dengan produk pepohonan lainnya yang selalu dihasilkan selama tanaman tumbuh sehat atau dengan kata lain 37 . KESIAPAN PENGEMBANGAN GAHARU A. maka volume perdagangan gaharu makin meningkat. Dengan makin meningkatnya permintaan pasar internasional. Proses ini sangat lambat. Kondisi ini tak akan dapat diatasi kecuali dengan melakukan pengembangan gaharu secara besar-besaran. (Mucharromah) yang memiliki kualitas lebih rendah (kemedangan dan abuk) disuling untuk diambil resinnya dan ampasnya dibuat makmul atau hio untuk ritual keagamaan. namun banyak masyarakat umum yang tidak mengetahui apa yang disebut gaharu. kecuali masyarakat di sekitar wilayah hutan yang sudah pernah terlibat dalam pencarian. banyak masyarakat di sekitar hutan yang terampil membersihkan gaharu sehingga cukup siap untuk mendukung pengembangan gaharu di daerahnya.

Beberapa kelompok peneliti telah mampu melakukan inokulasi yang merangsang pembentukan gaharu (Mucharromah et al. maka teknik produksi inokulan dan induksi pembentukan gaharu dengan inokulasi telah siap untuk dilatihkan kepada masyarakat guna mendukung pengembangan produksi gaharu melalui pemberdayaan masyarakat di sekitar wilayah hutan.d. 2008. baik secara alami oleh faktor abiotik maupun biotik ataupun telah diinduksi oleh manusia... Namun kejadian pembentukan gaharu oleh faktor abiotik dari alam ini sulit ditiru sehingga tidak dapat dijadikan dasar pada proses produksi dalam bentuk industri. Temuan tentang adanya jenis jasad renik yang dapat menginduksi terjadinya akumulasi resin wangi yang selanjutnya membentuk gaharu inilah yang mendasari adanya temuan tentang teknik induksi pembentukan gaharu yang dapat digunakan untuk mendukung proses produksi gaharu dalam skala industri. Faktor abiotik dapat berupa angin atau hujan angin dan petir. Untuk itu penyiapan SDM pendukung pengembangan gaharu juga perlu mempersiapkan personil yang mampu mengenali kualitas 38 . Dengan dukungan operasional. Kesiapan Kontrol Kualitas Produk Untuk keberhasilan dan kesinambungan suatu proses produksi umumnya selalu dilakukan monitoring kualitas produk. selain akibat gesekan hewan dan perilaku manusia yang tidak direncanakan. Santoso et al. gaharu justru tidak akan didapat pada pohon yang tumbuh sehat tanpa ada gangguan apapun. Namun mengingat teknik yang diterapkan belum biasa dilakukan masyarakat. 2009). Sementara pembentukan gaharu oleh faktor biotik dapat disebabkan oleh infeksi jasad renik terhadap tanaman. 2008a. Selain itu juga perlu dilakukan teknik pelatihan produksi inokulan sehingga proses produksi dapat berlangsung lebih efisien. C.c. baik pelatihan teknik inokulasi maupun pelatihan teknik monitoring pembentukan gaharu.b.Aspek PRODUKSI produksi merupakan fungsi dari pertumbuhan tanaman sehat. maka untuk persiapan pelaksanaannya dalam proses produksi dibutuhkan pelatihanpelatihan. Kebanyakan gaharu justru ditemukan pada pohon yang terganggu. 2006. Kadir.

yang terdiri dari: 1. mutu utama = mutu super b.dan mensortasi atau mengumpulkan gaharu yang dihasilkan berdasarkan gradasi kualitas dan kegunaannya. mutu TGD/TK4 e. Abu gaharu yang terbagi dalam 3 kelas mutu. Hal ini membuat gaharu menjadi makin mahal dan nilainya sangat ditentukan oleh kualitas kadar dan kemurnian resin yang dikandungnya. seperti pelukaan yang disertai infeksi patogen melalui inokulasi atau proses lainnya. Adanya aroma harum yang khas dan tahan lama inilah yang membuat gaharu sangat disukai dan dihargai dengan nilai ekonomi yang sangat tinggi. dan tingkat kekerasan dan berat jenis berbeda. mutu utama b. mutu pertama = mutu TGA/TK1 b. dan abu gaharu. Dari segi bentuknya. yaitu: a. tekstur. yang selanjutnya membuat jaringan kayu tersebut memiliki warna. aroma. mutu TGE/TK5 f. Kemedangan.1-1999. Selain itu jaringan yang mengandung resin wangi gaharu juga hanya didapati pada bagian pohon yang mengalami proses tertentu. mutu TGB/TK2 c. dengan 7 kelas mutu. yaitu gubal gaharu. Pada gaharu alam gradasi kualitas ditentukan berdasarkan standar mutu yang telah ditetapkan secara nasional dalam SNI 015009. mutu pertama 39 . mutu TGF/TK6 g. Gubal gaharu. yaitu: a. mutu pertama = mutu AB c. mutu kedua = mutu sabah super 2. yaitu: a. mutu ketujuh = setara dengan M3 3. mutu TGC/TK3 d. dengan 3 tanda mutu. Dalam standar ini kualitas gaharu dibedakan menjadi tiga sortimen. kemedangan. gaharu merupakan jaringan kayu dari pohon jenis tertentu (penghasil gaharu) dengan kandungan resin sesuiterpenoid volatil beraroma harum gaharu yang cukup tinggi. Ketiga sortimen tersebut dibagi lagi dalam 13 kelas kualitas.

Namun pengembangan gaharu di sekitar wilayah hutan kemungkinan akan jauh lebih efisien proses produksinya. Pada hasil uji lanjut teknik produksi gaharu yang dilakukan beberapa bulan lalu di Provinsi Bengkulu. mutu kedua. Saat ini sudah cukup banyak pohon penghasil gaharu yang telah diinokulasi. meskipun sebagian besar masih berada pada mutu TGC (Mucharromah et al. khususnya dari jenis Aquilaria dan Gyrinops..Aspek PRODUKSI c. Perkembangan keberhasilan teknik inokulasi ini sangat prospektif untuk mendukung pengembangan produksi gaharu yang pohon penghasilnya telah mulai banyak dibudidayakan di Sumatera dan wilayah lain di Indonesia. Teknik inokulasi untuk induksi pembentukan gaharu juga telah makin efisien dan murah. standar kualitas gaharu dan harganya akan lebih terjamin. seperti yang telah dilakukan di Kota Bengkulu dan sekitarnya. Pada 6 bulan setelah inokulasi telah dicapai produk kualitas kemedangan TGB dan TGA. Dengan demikian pengembangan gaharu siap dilaksanakan. 2008). proses pembentukan gaharu telah semakin cepat terjadi. Kesiapan Modal dan Kelembagaan Indonesia merupakan negara yang sangat kaya dengan beragam jenis pohon penghasil gaharu. Namun pembedaan kelas kualitas tersebut secara detil sangat sulit dilakukan sehingga pada prakteknya hingga saat ini konsumenlah yang menentukan tingkat mutu produk dan harga gaharu. Hal ini merupakan anomali dari kondisi perdagangan komoditi lainnya. yang biasanya baru dapat dicapai pada 12-18 bulan setelah inokulasi. Untuk itu pelatihan SDM dalam teknik monitoring perkembangan pembentukan gaharu dan kontrol kualitasnya sangat penting dilakukan. tidak hanya di sekitar wilayah hutan tetapi bahkan hingga ke halaman rumah dan perkantoran serta sekolah. Namun dengan tingkat keahlian sortasi. D. di mana pemilik barang merupakan penentu harga. Hal ini menjadi modal utama yang membuat proses produksi gaharu menjadi jauh lebih 40 . di samping lebih besar manfaatnya bagi pengamanan lingkungan dan pemberdayaan serta pemakmuran masyarakat.

satu famili Leguminoceae. dan satu famili Euphorbiaceae (Wiriadinata. Dengan demikian.3 hingga 14 kg dan umumnya semakin banyak dengan makin besarnya diameter pohon (MacMahon. pelatihan monitoring pembentukan gaharu serta upaya produksi gaharu hasil inokulasi. uji produksi. (Mucharromah) mudah dan murah. pelatihan inokulasi. Sejauh ini keberadaan pohon penghasil gaharu di lapangan telah banyak membantu pelaksanaan uji efektivitas inokulasi. Selain itu. Pada gaharu budidaya. Selain itu juga diperlukan adanya kerjasama dan komitmen semua pihak untuk membantu mengawali usaha ini berdasarkan expertise dan bidang pekerjaannya. Di alam tidak semua pohon penghasil gaharu membentuk gaharu atau hanya sedikit sekali menghasilkan gaharu. 1998). Semakin lama maka semakin banyak resin wangi yang terakumulasi dan semakin tinggi kualitas gaharu yang dihasilkan. Namun demikian pengembangan gaharu tetap memerlukan dukungan dana yang relatif besar meskipun rasio keuntungannya terhadap modal juga cukup besar.. Hal ini membuat proses produksi gaharu alam menjadi kian mahal. 2008 dan Sumarna.. tidak semua pohon menghasilkan gaharu. maka pengembangan gaharu hasil budidaya dan inokulasi dapat jauh lebih efisien dibandingkan produksi yang mengandalkan gaharu bentukan alam. sebagaimana disajikan pada analisis usaha inokulasi gaharu (Lampiran 1) dan analisis budidaya gaharu (Lampiran 2). 2002). proses produksi gaharu sangat ditentukan kuantitasnya oleh jumlah lubang atau luka yang diinokulasi dan kualitasnya tergantung dengan lamanya waktu sejak inokulasi hingga panen.Pengembangan Gaharu di . Namun dari 41 . Berdasarkan hasil analisis tersebut maka pengembangan gaharu paling efisien bila dilakukan di area sekitar hutan yang masih kaya dengan tegakan gaharu berdiameter > 20 cm yang dapat diinokulasi untuk mempercepat produksi dan menambah modal awal untuk penanaman pada area yang lebih luas untuk kesinambungan usaha pengembangan gaharu. Jumlah gaharu yang dihasilkan per pohon di hutan alam sangat bervariasi dari 0... Saat ini pembentukan gaharu di alam telah dilaporkan terjadi pada sedikitnya 16 jenis pohon dari beberapa genus famili Thymelaceae.

2009). khususnya cendawan pelapuk kayu. tergantung intensitas atau kadar resin gaharu yang dikandungnya. Bila kualitas seperti ini dapat dihasilkan dari inokulasi pohon pada awal proses pengembangan. Sementara kehadiran jenis cendawan lainnya. Mucharromah dan Surya.000 hingga 16. 2008. sehingga mampu menutupi pembiayaan untuk pengembangan selanjutnya. dan lebih tinggi. justru mendegradasi kembali resin gaharu yang sudah dideposisi bahkan hingga menghancurkan selnya sehingga gaharu yang sudah mulai terbentuk menjadi hancur dan lapuk minimal sebagian dan kualitas gaharu yang dihasilkan akan menurun. karena kualitas seperti gaharu alam tersebut bernilai sangat tinggi. sebagaimana ditunjukkan oleh data mikroskopis perkembangan deposisi resin gaharu pada area jaringan sekitar lubang yang diinokulasi atau hanya dilukai (Mucharromah dan Marantika. double super. yaitu USD 2.Aspek PRODUKSI segi kualitas. Akibatnya jaringan kayu tersebut menjadi halus seperti dilapisi agar dan berwarna coklat kemerahan atau kehitaman. Saat ini kualitas gaharu hasil inokulasi sudah jauh lebih baik dan pada beberapa hasil penelitian sudah mendekati mutu gubal kualitas kemedangan B/C (Santoso.000 per kg di tingkat ’end-consumer’ di luar negeri. 2006) atau bahkan B (Surya. gaharu hasil inokulasi hingga kini belum dapat mencapai kualitas tertinggi gaharu alam. maka penggunaan inokulan unggul dan teknik inokulasi yang meminimalkan kontaminasi akan dapat meningkatkan kualitas gaharu yang dihasilkan dan mengefisienkan proses produksi hingga dapat dilaksanakan dengan modal lebih rendah. Dengan demikian. Pada gaharu kualitas gubal. 42 .komunikasi pribadi. Secara teoritis keunggulan inokulan dalam menginduksi pembentukan gaharu berkaitan dengan jenis dan kemurnian mikroorganisme yang digunakan. maka produksi gaharu selanjutnya tidak banyak memerlukan bantuan modal lagi. akumulasi resin wangi terjadi maksimal hingga luber dan menutupi sel-sel di sekitarnya. 2008 . Terbentuknya gaharu kualitas super atau yang sering disebut gubal super ini kemungkinan akan dapat dicapai seiring dengan pengembangan penelitian inokulan unggul yang terus dilakukan. yaitu super.

2007). 2002). A. 2009) menunjukkan bahwa pada jaringan yang terkontaminasi resin gaharu yang awalnya berwarna coklat bening kemerahan berubah menjadi berwarna kehitaman dan menghilang sebelum akhirnya selnya menjadi hancur. Jenisjenis pohon penghasil gaharu dari spesies Aquilaria malaccensis. sehingga aroma gubal gaharu kualitas terbaik dari berbagai wilayah dapat berbeda (Mucharromah et al...b. dan A. aroma resin gaharu juga sangat menentukan kualitas.... 2008a. A. dikenal menghasilkan gaharu yang disukai konsumen mancanegara sejak jaman dahulu. Pada pengamatan mikroskopis (Mucharromah dan Marantika. hirta. maka kualitas gubal super mungkin akan dapat dicapai. beccariana. 2008). Selain karena kandungan resinnya yang jauh lebih tinggi. Selain itu kekhasan aroma gaharu juga dipengaruhi oleh jenis pohon penghasilnya dan kemungkinan juga jenis mikro organisme inokulannya. 43 . A.. (Mucharromah) Mucharromah et al.Pengembangan Gaharu di . 2006.c. microcarpa. Santoso et al. 2006. kemungkinan karena kemurnian resin yang dikandungnya.. Sumarna. Oleh karena itu dalam proses produksi gaharu dengan inokulasi perlu diterapkan prinsip-prinsip aseptik yang akan membatasi peluang terjadinya kontaminasi (Mucharromah et al. 2008). Dengan teknik inokulasi dan jenis isolat yang lebih murni dan potensial serta waktu antara inokulasi dan panen yang lebih panjang. Sejauh ini aroma gaharu alam lebih lembut dibanding hasil inokulasi. MODEL PENGEMBANGAN GAHARU DI SUMATERA Secara teoritis akumulasi resin wangi gaharu telah dilaporkan distimulasi oleh infeksi cendawan dari jenis tertentu (Mucharromah dan Surya. agallocha yang banyak dijumpai di Sumatera.. Oleh karenanya pengembangan gaharu di wilayah sekitar hutan dengan cara memperbanyak pohon-pohon jenis Aquilaria yang ada di lokasi tersebut dan menginokulasi pohon yang sudah tua untuk membiayai peremajaannya akan dapat mengembalikan potensi produksi gaharu yang dahulu dimiliki Sumatera dan wilayah Indonesia lainnya.

Dengan demikian maka penggunaan jenis inokulan tertentu dan kemurniannya serta penerapan teknik aseptik dalam penyiapan dan aplikasi inokulan. 2005. Mucharromah. Oleh karenanya pengembangan gaharu tidak dapat dilakukan secara mandiri.000 batang yang ditanam di sekitar pohon induk yang diinokulasi. Sejauh ini telah dilakukan pengembangan gaharu sebanyak > 10. ketepatan teknik inokulasi. maka kepada masyarakat pemilik tegakan gaharu yang diameternya telah mencapai > 20 cm ditawarkan kerjasama pengembangan gaharu dengan penanaman kembali dan inokulasi. Meskipun gaharu yang dipanen akan menghasilkan produk yang dapat dijual. pengembangan gaharu memerlukan modal yang cukup besar karena prosesnya cukup kompleks. khususnya pada masyarakat yang tidak memiliki modal dan hanya mengandalkan sumberdaya alam dan keterampilan. Oleh karenanya campur tangan pemerintah sangat diharapkan. karena masih harus melakukan panen dan proses pembersihan gaharu yang bersifat padat karya. 2004. Langenhein. Pertama. Sebagaimana diuraikan sebelumnya. Selanjutnya pohon yang sudah cukup besar (diameter > 44 . Namun kerjasama ini masih membutuhkan cukup banyak modal untuk menjadi usaha pengembangan gaharu yang mandiri. Kerjasama ini meliputi pemeliharaan dan penanaman kembali anakan alam yang ada di sekitar tegakan induk hingga mencapai populasi minimal 10-100 batang tanaman muda per pohon induk diinokulasi untuk produksi gaharu. Oleh karenanya di Bengkulu pengembangan gaharu diawali dengan pengujian efektivitas berbagai isolat cendawan yang berpotensi menginduksi pembentukan gaharu dan diikuti dengan pengembangan inokulan unggul yang masih terus dilakukan untuk peningkatan kualitas. anakan alam atau bibit harus ditanam dan dipelihara.Aspek PRODUKSI Kemampuan cendawan inokulan dalam menstimulir produksi resin juga sangat terkait dengan tingkat akumulasi resin yang merupakan hasil netto dari proses sintesis dikurangi dengan degradasinya serta jenis resin dan kemurniannya (Agrios. dan keterampilan pekerja akan sangat mempengaruhi proses produksi dan kualitas produk. setelah didapat inokulan efektif dan hasil inokulasi yang cukup menjanjikan. 2004). Selain itu. namun untuk pelaksanaan proses panen dan pembersihan tersebut diperlukan modal yang cukup besar.

Selain itu. Setelah dipanen secara total.000-68. sehingga untuk menghasilkan gaharu sebanyak 270 ton sebagaimana jumlah yang diekspor pada tahun 2000-an akan mampu menyerap tenaga kerja sebanyak 56. Kelembagaan tersebut dapat sangat sederhana 45 . (Mucharromah) 20 cm) perlu diinduksi dengan inokulasi jasad renik atau perlakuan lainnya agar membentuk gaharu.. pengembangan gaharu hasil budidaya dan inokulasi makin lama makin memberikan keuntungan melimpah dan makin ’sustainable’. Proses ini dilakukan secara manual dengan melibatkan sejumlah besar tenaga kerja. maka perlu ada suatu kelembagaan yang bertugas untuk membantu penyiapan dan pelaksanaan proses produksinya hingga berhasil berkembang menjadi industri gaharu yang mandiri. dilakukan proses pembersihan untuk memisahkan gaharu dari jaringan kayu yang lebih sedikit kandungan resin wanginya.. sehingga tidak berkelanjutan. Oleh karenanya pengembangan gaharu harus dilakukan secara serius. maka jumlah tenaga kerja yang dikaryakan juga akan semakin meningkat. tetapi dari segi keamanan pekerja dan lingkungan. Dari segi jumlah tenaga kerja yang menangani proses pembersihan produk ini kemungkinan tidak banyak berbeda antara produksi gaharu alam dengan gaharu budidaya. mengingat proses produksi gaharu jauh lebih rumit dibandingkan proses produksi komoditi hasil hutan dan perkebunan atau pertanian lainnya. Selanjutnya pohon yang telah diinokulasi dimonitor hingga waktu panen. Dengan peningkatan permintaan dan kapasitas produksi. Pada gaharu hasil inokulasi. Proses induksi pembentukan gaharu dilakukan dengan memberikan inokulan pada sejumlah besar lubang yang dibuat spiral dengan jarak 7-10 cm horisontal dan 12-20 cm vertikal dari pangkal batang hingga ujung pucuk yang masih bisa dipanjat. sehingga upaya-upaya yang dilakukan akan memberi hasil yang berkelanjutan...000 orang/hari. untuk membersihkan 1 kg gaharu umumnya diperlukan 4-5 orang hari kerja. Proses inokulasi ini selain memerlukan keterampilan. juga keberanian dan ketersediaan personil dengan kondisi fisik yang mendukung pelaksanaan pekerjaan.Pengembangan Gaharu di . Jumlah ini cukup besar dan akan mampu mempekerjakan masyarakat sekitar hutan sebanyak 280 hingga 340 orang/tahun dengan 200 hari kerja/tahun. sementara gaharu alam akan makin habis.

maka pengembangan gaharu perlu dilakukan dengan melibatkan berbagai pihak yang terkait dengan perdagangannya. mengingat wilayah sekitar hutan yang menjadi area pengembangan gaharu umumnya cukup jauh dari lokasi institusi yang mensertifikasi produknya. pelibatan banyak pihak ini bila tidak dipayungi dengan deskripsi tugas yang mendetil dan tidak saling tumpang-tindih. maka dengan adanya aturan kuota. Peran tersebut dapat dilakukan melalui kegiatan penelitian dan pengabdian pada masyarakat yang sudah secara 46 . sehingga cukup menyulitkan meskipun prosesnya sederhana. maka proses pengembangan gaharu yang telah dilakukan sejauh ini berjalan aman. baik oleh pihak swasta maupun perguruan tinggi dan kelompok masyarakat. pengembangan inokulan unggul untuk peningkatan mutu serta pengembangan teknik pengawasan kualitas produk. Sejauh ini pengembangan gaharu yang dilakukan di Provinsi Bengkulu. dibuat secara sangat sederhana dengan kontrak kerjasama antara pemilik pohon/lahan dengan pelaksana yaitu perguruan tinggi. Hal ini dikarenakan upaya pengembangan yang dilakukan masih belum mencapai tahap produksi gaharu yang siap diperdagangkan. Bila sudah mencapai tahap produksi. baik halaman maupun kebun. Namun bila perdagangan gaharu masih diatur oleh kuota yang dalam proses perdagangannya melibatkan banyak pihak. swasta atau kelompok masyarakat. Mengingat pohon yang diinokulasi atau bibit yang ditanam berada di lahan pribadi. Hal ini mungkin perlu disederhanakan dalam upaya pengembangan gaharu yang dilakukan. perguruan tinggi dapat memainkan peran yang dapat menguntungkan semua pihak. Dalam pelaksanaannya. Dalam hal pengembangan gaharu. justru akan dapat menghambat pengembangan gaharu yang dituju. tidak hanya dengan pihak yang dapat membantu pengembangannya.Aspek PRODUKSI bila pengembangan gaharu dapat diberlakukan seperti komoditi pertanian atau perkebunan hasil budidaya. penjualan gaharu hingga kini masih memerlukan adanya sertifikasi jumlah untuk memastikan bahwa batas kuota belum terlewati. Dalam hal ini peran perguruan tinggi yang mengembangkan penelitian gaharu dapat dilakukan dalam bentuk pembinaan kelompok produksi gaharu di sekitar wilayah hutan serta penelitian untuk pemutakhiran teknik produksi.

tidak hanya untuk menjamin peningkatan dan kesinambungan produksi gaharu.N. sehingga keberhasilannya akan lebih terjamin. tetapi juga karena upaya ini memerlukan investasi teknologi dan modal yang cukup besar bagi keberhasilannya. sebagaimana produk pertanian atau perkebunan dan kehutanan lainnya.Pengembangan Gaharu di . Jakarta. Plant Pathology. Academic Press.. kekeringan. 2. New York. Oleh karenanya pengembangan gaharu perlu dilaksanakan dengan perencanaan yang sangat matang dari setiap tahapan prosesnya sehingga dapat berjalan dan meningkatkan kemandirian masyarakat di wilayah sekitar hutan. banjir. 1995. PENUTUP 1.. DAFTAR PUSTAKA Agrios. Analisa Penyebab Terjadinya Gubal dan Kemedangan pada Pohon Gaharu.. dan beragam kerusakan lingkungan lainnya. 1988. Untuk lebih mengefisienkan proses produksi dan menekan pembiayaan maka program pengembangan gaharu perlu dilakukan dengan mengadopsi model yang paling efisien dan praktis. Makalah Dipresentasikan pada Temu Pertama Pakar Gaharu. Hal ini sangat penting untuk diperhatikan mengingat proses pembentukan gaharu tidak berjalan secara otomatis pada tanaman yang tumbuh sehat. tetapi juga untuk melindungi hutan dan keragaman hayati yang ada di sekitarnya serta meningkatkan kapasitas hutan dalam menanggulangi potensi bahaya bencana alam yang disebabkan oleh longsor. Pengembangan gaharu merupakan suatu program yang sangat besar. Hal ini sangat penting dilakukan. (Mucharromah) rutin dilakukan perguruan tinggi dengan dukungan pendanaan dari instansi pemerintah maupun swasta. polusi.. Anonim. yang berpotensi sangat besar untuk pemberdayaan masyarakat di sekitar wilayah hutan. tidak hanya karena menghasilkan produk bernilai ekonomi yang sangat tinggi. G. 20 Oktober1995. 47 .

Prosiding Seminar Nasional Gaharu. Indonesia. 2006a. ”http://en.). Respon Acremonium sp. 2008. Bengkulu. Updated April 16th. Makalah Seminar. 1998. 12 Agustus 2008. Santoso. BKS-PTN Wilayah Barat. Makalah Semirata Bidang MIPA. Mucharromah.org/wiki /Agarwood”. Misnawaty. Makalah Seminar Nasional Pengembangan Produksi Gaharu Provinsi Bengkulu untuk Mendukung Peningkatan Ekspor Gaharu Indonesia. 48 .).aol. Rahayu dan E. N. Tingkat Akumulasi Resin Gaharu Akibat Inokulasi Fusarium sp. Universitas Bengkulu. dan Surani. Mucharromah. Mucharromah. Hartal. 14-16 Mei 2008. Universitas Bengkulu. White Lotus Aromatics. Lombok. Teknologi Budidaya dan Produksi Gubal Gaharu di Provinsi Bengkulu. Fakultas Pertanian Universitas Mataram Bekerjasama dengan Balai Pengelolaan Daerah Aliran Sungai Dodokan Moyosari Nusa Tenggara Barat (BP DAS Dodokan Moyosari NTB). Accessed 16 April 2006. dalam Menginduksi Akumulasi Resin Wangi Gaharu pada Batang Aquilaria malaccensis (Lamk.Aspek PRODUKSI Anonim. Santoso. 18 November 2006. Nusa Tenggara Barat. Fenomena Pembentukan Gubal Gaharu pada Aquilaria malaccensis (Lamk. Seameo-Biotrop. Mucharromah.) Merespon Pelukaan dan Infeksi Cendawan. MacMahon. 2006. Agarwood. Asal Gaharu terhadap Alginate dan CaCl2. 31 Oktober 2006. Hipotesa Mekanisme Pembentukan Gubal Gaharu. com/ratrani/ Agarwood. C. DIKTI. Universitas Mataram. 14-16 Mei 2008. Mucharromah. 2001. Terakhir dimodifikasi 11:11. Potensi Tiga Isolat Fusarium sp. Makalah Semirata Bidang MIPA. 2008. pada Berbagai Waktu Setelah Pengeboran Batang Aquilaria malaccensis (Lamk. Laporan Penelitian Fundamental. G. html. (unpublished). FAPERTA UNIB. 2008. 2005. 1-2 Desember 2005. 2006. Maryani. dan Hartal. 2008. BKS-PTN Wilayah Barat. Mucharromah. Hartal.. Studi Mekanisme Akumulasi Resin Wangi Aquilaria malaccensis (Lamk. http://members.).wikipedia. Bogor. dan U.

Surabaya. L.N. Teknik Inokulasi dan Produksi Gaharu. Prosiding Seminar Nasional Gaharu “Peluang dan Tantangan Pengembangan Gaharu di Indonesia”. R. 2005. Skripsi Fakultas Pertanian Universitas Bengkulu. M. Database Entry For Aquilaria agallocha. Texas.. Mulyaningsih. dan Y. Raintree. Y. Bogor. Journal of Tropical Forest Products 2 : 272-285. 11-12 April 1996. L. SEAMEO BIOTROP. Surabaya 11-13 September 2006. Wahyuno. Kerjasama Dirjen PHKA dan ASGARIN. Surabaya 12 September 2006.B. 11-13 September 2006. Azizil. Teknologi Budidaya Tanaman Gaharu untuk Menuju Sistem Produksi Gubal Gaharu secara Berkelanjutan.. Y. Prosiding Seminar Nasional Gaharu. Kerjasama Dirjen PHKA dan ASGARIN. Sumarna. Sumarna.com/ aquilaria. Identifikasi Genus Cendawan yang Berasosiasi dengan Pohon Aquilaria malaccensis (Lamk. Parman dan T. 49 . 2006b. Sites : hhtp//www.A. Y. Purba. Parman..S. 2001.. 1996.) dan Gubal Gaharu Hasil Inokulasi serta Potensinya untuk Menginfeksi Bibit Gaharu. 1997. J. Biodiversitas dan Karakterisasi Jamur Potensial Penginduksi Resin Gaharu. Makalah Workshop Gaharu Tingkat Nasional. Santoso. Kanwil Dephut Propinsi NTB. 2006. Inc. Makalah Temu Pakar Gaharu.Pengembangan Gaharu di .. Mataram.. Bogor. Irianto. Raintree Nutrition.K. Chang and A. E. 1-2 Desember 2005. Agustini. Makalah disampaikan pada Workshop Gaharu Tingkat Nasional. 1-2 Desember 2005. Ngatiman dan Armansyah.T.. 2005. T.rain-tree. Strategi Budidaya dan Pengembangan Produksi Gaharu. Seameo-Biotrop.. Ng. (Mucharromah) Mucharromah dan J.htm. D. A Review on Agar (Gaharu) Producing Aquilaria Species. 2006. Rahman. Makalah Workshop Gaharu Tingkat Nasional. Turjaman. Uji Coba Pembentukan Gaharu dengan Cara Inokulasi. Mulyaningsih. 2007. Date 3/3/06.S. Surya. Studi Etiologi Gubal Gaharu pada Tanaman Ketimunan. Austin.

000 90 1. D. 30 kg/batang (Kemedangan) Total proyeksi hasil : 50 kg/batang Penjualan kelas BC per batang : 60 kg Penjualan powder : 100 kg/batang No A.307 1 1 50 50 Btg Btg Kg Kg 50 50 25 2 50 50 1. Uraian Beban operasional Pembelian batang/tanah Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga ahli inokulasi Tenaga kerja Pemeliharaan/perawatan Operasi lainnya Total A.250 100 1.5 250 500 250 6 25 1.000 90 1.168 50 50 50 1 50 Kg Kg Kg Btg Kg 5 10 5 6 0.1. 2006 50 .000 500 120. Analisis usaha inokulasi gaharu Waktu inokulasi Jumlah tegakan gaharu Proyeksi hasil : 3 tahun : 1 batang : 20 kg/batang (Kelas BC).Aspek PRODUKSI Lampiran 1.450 1 1 1 1 1 1 3 1 Btg Btg Set Btg Btg Btg Thn Btg 100 5.025 104. Beban panen dan pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total A.500 6.826 QTY Unit Harga/unit (Rp’000) Total cost (Rp’000) Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu. Beban zakat/pajak Proyeksi keuntungan 5% % 60 100 Kg Kg 2. Proyeksi penghasilan Penjualan kelas BC Penjualan powder Total proyeksi penghasilan C.500 200 600 36 300 7.031 10.000 5 120.2. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Pengurusan surat-surat Umum lainnya Total Total beban operasi B.500 200 600 12 300 100 5.

000 2.000 24.000 1.000 Total Btg Set Btg Btg Btg Btg 20 3.500 1.000 Unit Unit Unit 2.2.000 5 1 0.000 1.000 1.000 4.Pengembangan Gaharu di ..000 6.000 19.1.000 25. Biaya pra operasi (start-up cost) Sarana & prasarana TBM Rumah jaga Sarana penerangan (PLN) Sarana komunikasi Sarana lainnya Total 1 1 1 1 Total biaya (direkapitulasi) Beban operasi Penanaman pohon baru Land clearing Pembelian bibit Pembuatan lubang Penanaman pohon gaharu Pemupukan Perawatan dan pengamanan Total 1 1..000 4. (Mucharromah) Lampiran 2..000 A+B C C.000 2.000 1. Analisis usaha budidaya gaharu Waktu budidaya Luas lahan Populasi tegakan Rasio jumlah suntikan Jumlah lubang Proyeksi hasil panen per batang Exchange rate IDR : 7 tahun : 1 ha : 1.000 1.000 49.000 1.000 1.000 36.000 10 5 10 1 20.000 3.000 10.000 1.000 No A.000 1.000 5. C.000 1.5 5 24.. Uraian Biaya akuisisi lahan Pembelian lahan Perizinan/sertifikat/notariat Total QTY Unit 1 1 ha Surat* B.000 1 ha Btg Btg Btg Btg ha 1.000 500 5.000 5. Beban inokulasi Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga kerja Pemelihaaan/perawatan Operasi lainnya 51 .000 1.000 Harga/ unit (Rp’000) 15.000 10.000/ha : 80 lubang/kg : 160/batang : 160/80 = 2 kg : 9.000 2.000 Total cost (Rp’000) 15.000 1.000 1 1.000 1.

000 190.000 200.000 4.000.000 4.000 3.000 2.500 Kg % 2. Uraian Beban panen & pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total QTY Unit Harga/ unit (Rp’000) 5 5 10 2 Total cost (Rp’000) 5.000 2.5 10.000 34. 2006 52 .000 20.000 4.500 D Proyeksi penghasilan Penjualan kelas C 2.4.000 40. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Umum lainnya Total Total beban operasi 2.000 71.000 1.000 2.Aspek PRODUKSI No C.3.000 5.000.000 Total proyeksi penghasilan 5% Proyeksi keuntungan E F Beban zakat /pajak Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.000 1.000 1.000 20.000 Kg Kg Kg Kg 5 10 20 0.609.000 Btg Btg Kg Kg C.000 2.000 2.

incense. pemanfaatan gaharu adalah untuk pengobatan.. 2005). Produk ini dihasilkan beberapa spesies penghasil gaharu dalam famili Thymeleaceae...Kajian Kimia Gaharu . Sementara itu. yaitu 27 spesies dari 8 genus dan 3 famili yang tersebar di Sumatera.(Eka Novriyanti) 2 KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp. mulai dari 300 ribu rupiah hingga 25 juta rupiah untuk kualitas double super. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti 53 . Kalimantan. Incense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagaman... dan parfum (Barden et al. PADA Aquilaria microcarpa Eka Novriyanti Balai Penelitian Hutan Penghasil Serat Kuok PENDAHULUAN Gaharu adalah komoditas hasil hutan non-kayu yang bernilai ekonomi tinggi dengan harga pasar bervariasi tergantung kualitasnya. dan Irian (Sumarna. 2000). 2000). meskipun pengunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. Indonesia yang merupakan salah satu pemasok gaharu terbesar memiliki kekayaan jenis penghasil gaharu tertinggi di dunia. Gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut memiliki scent of God’.. sebagai pengharum ruangan sembayang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. Pada prinsipnya. Maluku.

informasi jalur biosintetis gaharu itu sendiri sehingga mungkin dapat dibuat sintetis senyawa. Konsentrasi metabolit sekunder ini bervariasi antar spesies. dan lain-lain pengembangan yang masih sangat luas untuk dilakukan. asma. antar pohon dalam spesies yang sama. dan bermanfaat untuk mengatasi berbagai panyakit seperti sakit gigi. Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. 2004). Informasi mengenai bahan-bahan kimia yang terkandung dalam gaharu penting untuk pemanfaatan produk ini. dalam Isnaini. juga memiliki sifat anti racun. pengembangan senyawa-senyawa dalam gaharu dengan bio-teknologi. obat kuat pada masa kehamilan dan bersalin. tumor. diare.. Metabolit sekunder pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. Namun begitu. atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Commission GIFNFC. hal ini 54 . kayu teras. Adelina. 2007). 1987. diuretic. hepatitis. rangsangan fisiologi. Metabolit sekunder atau zat ekstraktif tanaman dapat efektif dalam melawan hama dan agen penyakit karena analog dengan komponen vital tertentu dari sistem sinyal seluler. antar jaringan (konsentrasi tertinggi berada di kulit. akar. 1987). cacar. kanker. (Hayne. anti mikrobia. Suhartono dan Mardiastuti. ginjal. 2002). Pohon gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. 2000. 2007). Gaharu adalah senyawa fitoaleksin yang merupakan metabolit sekunder dari pohon gaharu sebagai mekanisme pertahanannya. maupun keadaan cekaman (Goodman et al. malaria. 2004. liver. Barden et al. rematik. anti serangga. 2007). Arah pemanfaatan informasi kimia gaharu di antaranya adalah penyusunan standar produk berdasarkan komposisi kimia yang dikandungnya sehingga lebih seragam dalam praktek penentuan kualitas produk. antar spesies. dan jaringan luka). pengembangan pemanfaatan lain dengan terbukanya kemungkinan diidentifikasinya senyawa-senyawa baru dengan manfaat yang baru pula. stimulan kerja saraf dan pencernaan..Aspek PRODUKSI inflamatory (Trupti et al. dan antar musim (Forestry Commission GIFNFC. 2004). pangkal percabangan.

Injeksi dilakukan dalam mode split. ketebalan film 0. analisis kimia gaharu dilakukan dengan analisis GCMS pirolisis menggunakan aparatus Shimadzu GCMSQP2010. dan ditahan pada suhu ini hingga menit ke-60. dan Maluku. Gambar 1 menyajikan luasan infeksi Fusarium sp. Analisis komponen kimia dilakukan untuk gaharu rekayasa hasil inokulasi isolat Fusarium sp. Helium digunakan sebagai gas pembawa (carrier) (0. dioperasikan dengan electron impact (EI) mode pada 70 eV dan suhu ion source 2000C. Identifikasi senyawa dilakukan berdasarkan waktu retensi dan analisis MS. suhu injeksi 2800C. pada batang A. yaitu isothermal 500C selama 5 menit. Kondisi kromatografi adalah sebagai berikut: suhu oven kolom 500C. sedangkan analisis kimia dilakukan untuk sampel berumur ± 1 tahun. ANALISIS KIMIA GAHARU HASIL INOKULASI ISOLAT DARI BEBERAPA DAERAH ASAL Dalam tulisan ini. Mentawai... Kalimantan Tengah Tamiang Layang. Meskipun secara deskriptif isolat asal Bahorok sepertinya menyebabkan infeksi yang paling besar.25 mm.8 ml/min) yang dilengkapi dengan kolom kapiler DB-5 MS (60 mm x 0. Meskipun di awal inokulasi masing-masing isolat memperlihatkan kecepatan pembentukan infeksi yang berbeda sesuai virulensinya.Kajian Kimia Gaharu . dan perlu dicatat tidak satupun isolat yang origin dari lokasi di mana penelitian dilakukan yaitu asal Carita. namun setelah sekian waktu ternyata pengaruhnya terhadap luasan infeksi menjadi tidak signifikan lagi..(Eka Novriyanti) masih memerlukan pemikiran dan terus melakukan penelitianpenelitian lanjutan yang akan membuka satu demi satu kebenaran yang saat ini masih belum terungkap. namun secara statistik.25 μm). 55 . daerah asal isolat tidak berpengaruh nyata terhadap luasan infeksi yang terjadi pada batang pohon penghasil gaharu ini... Pengukuran luasan infeksi dilakukan pada umur inokulasi 6 bulan. asal Bahorok. microcarpa. kemudian increased mencapai 2800C hingga 30 menit. Tidak signifikannya pengaruh asal isolat terhadap luas infeksi diduga disebabkan karena isolat yang diinokulasikan sama-sama Fusarium sp.

.Aspek PRODUKSI Gambar 1.. Burfield. dengan tanpa membedakan jarak suntik menunjukkan bahwa akumulasi konsentrasi relatif tertinggi untuk konstituen terkonfirmasi (Yagura et al. Tamuli. 2009. 2005. Lampiran 1 dibagi menjadi 3 kelompok. Kelompok C: senyawa yang belum dikonfirmasi merupakan konstituen gaharu namun memiliki karakter odorant. Pojanagaroon dan Kaewrak. Kelompok B: senyawa berkarakter odorant namun merupakan hasil pirolisis komponen kayu seperti selulosa dan lignin 3. Lampiran 1 menyajikan komponen kimia hasil analisis py-GCMS terhadap sampel gaharu inokulasi umur satu tahun. namun analisis komponen kimia dari gaharu hasil rekayasa ini menunjukkan adanya perbedaan. Alkhathlan et al. yaitu: 1. Kelompok A pada Lampiran 1. kelompok A: konstituen gaharu yang sudah diidentifikasi pada pekerjaan beberapa peneliti sebelumnya 2. 2006. Sampel yang dianalisi adalah sampel masing-masing dari titik-titik inokulasi dengan jarak suntik 5 cm dan 20 cm. Bhuiyan et al.. 56 . 2003. microcarpa dengan pembeda daerah asal isolat Meskipun secara luasan infeksi tidak menunjukkan pengaruh yang nyata. 2005. Konishi. Nor Azhah et al. 2005. Panjang infeksi pada umur inokulasi 6 bulan di batang A.. 2002.

47%).47%).37%).(Eka Novriyanti) 2008) terjadi pada isolat asal Kalimantan Tengah Tamiang Layang sebesar 12.. Pengaruh kontribusi senyawa dalam kelompok ini pada wangi gaharu memerlukan investigasi lebih lanjut. dan Mentawai (8. dan terakhir Kalimantan Tengah Tamiang Layang (18.71%).23%). isolat asal Kalimantan Tengah Tamiang Layang memberikan hasil gaharu artifisial yang relatif terbaik yang ditunjukan oleh relatif lebih besarnya infeksi yang terjadi dan akumulasi senyawa gaharu terkonfirmasi tertinggi. Dengan kata lain.61%). akumulasi konsentrasi relatif tertinggi dihasilkan oleh isolat asal Maluku (26. diikuti masing-masing Maluku (10.96%). Untuk Kelompok C. Untuk kelompok odorant yang merupakan pirolisis komponen kayu ini. dan Mentawai (11. Bahorok. Kalimantan Tengah Tamiang Layang (12.27%).31%).40%). maka keberadaan senyawa dalam kelompok B tidak bisa dikesampingkan walaupun bukan merupakan konstituen resin gaharu yang sebenarnya. diikuti Bahorok (12. 57 . Keberadaan senyawasenyawa odorant hasil pirolisis komponen kayu ini kemungkinan memiliki peran pada kesatuan wangi yang dihasilkan incense gaharu yang dibakar. Bahorok (22..14%). Kelompok B pada Lampiran 1 merupakan kelompok senyawa berkarakter odorant yang merupakan hasil pirolisis selulosa dan lignin.. Bahorok (10. Maluku. Pola urutan konsentrasi yang sama juga terjadi untuk total konsentrasi relatif komponen berkarakter odorant. Mentawai (24. Ditampilkannya fakta tersebut karena penggunaan gaharu pada umumnya sebagai incense yang menghasilkan wangi hanya jika kayu yang mengandung resinnya dibakar. karena digunakan sebagai incense yang mengumbar wangi saat dibakar. konsentrasi relatif tertinggi justru dihasilkan oleh isolat asal Maluku (12.. Secara kuantitas maupun kualitas (komponen kimia terkonfirmasi). diikuti Mentawai. Namun kontribusi komponen-komponen berkarakter odorant tersebut terhadap wangi gaharu masih memerlukan observasi yang lebih dalam lagi. Perbedaan konsentrasi ini kemungkinan sangat dipengaruhi oleh konsentrasi selulosa dan lignin dari bagian batang yang dijadikan sampel. dan Kalimantan Tengah Tamiang Layang.89%.Kajian Kimia Gaharu .

25% dan 10. Angka-angka ini tidak jauh berbeda karena diduga konsentrasi komponen kayu yang relatif sama pada pohon-pohon sampel yang relatif berumur sama dan tumbuh pada kondisi yang relatif sama.11%. 2008). microcarpa yang memiliki karakterisitik odorant penting Komponen Ambrettolide Ambrox Keterangan Senyawa ini memiliki karakter wangi musk. Senyawa ini pada konsentrasi rendah menyajikan wangi bunga dan merupakan konstituen dalam berbagai wangi bunga dan parfum. Komponen dalam gaharu hasil inokulasi berbagai daerah asal isolat Fusarium sp. Untuk kelompok B. Indole merupakan konstituen utama dalam minyak melati dan karena minyak melati ini berharga mahal. teh. 2008) Ambrox memiliki karakter odorant tipe amber dan juga merupakan anti-inflamatory yang potensial untuk bidang pengobatan (Castro et al.. secara umum jarak suntik 5 cm menghasilkan akumulasi konsentrasi yang lebih tinggi. Valerolactone Ketoisophorone Maltol Indole Isolongifolen 58 .. manis buah. dihasilkan akumulasi masing-masing sebesar 12. pada A. biasanya dimanfaatkan sebagai penguat rasa dan aroma (flavor enhancer) pada roti dan kue (Wikipedia Online. kecuali untuk isolat asal Kalimantan Tengah Tamiang Layang yang justru lebih tinggi akumulasi konsentrasinya pada jarak suntik 20 cm (Tabel 1). jarak suntik 5 cm dan 20 cm menghasilkan akumulasi konsentrasi relatif masing-masing sebesar 11. produk ini dibuat sintetisnya dengan menggunakan indole (Wikipedia Online. Inc. dan bunga (International Flavor and Fragrance. 2008). Tabel 1. Isolongifolene merupakan bahan yang sangat berguna sebagai odorant dan minyak parfum (Bunke dan Schatkowski. 1997). 2002). Komponen ini menyajikan wangi caramel dan digunakan untuk menghasilkan wangi yang manis pada fragrance. Ketoisophorone mengumbar wangi manis campuran kayu.17% dan 12.Aspek PRODUKSI Untuk komponen gaharu terkonfirmasi (Kelompok A).11% untuk jarak suntik 5 cm dan 20 cm. Senyawa ini memiliki wangi herbal yang dimanfaatkan dalam industri parfum dan pewangi (Wikipedia Online. daun tembakau (The Good Scent Company. Secara umum untuk kelompok A. 2008). 2008). dan.

proses yang lambat ini kemungkinan memberi waktu dan kesempatan bagi senyawa tertentu untuk disintesis atau diakumulasikan hingga diperoleh konsentrasi yang relatif lebih tinggi.. The Good Scent Company. Dengan besarnya spasi injeksi akan menyebabkan proses pembentukan senyawa yang terjadi berlangsung relatif lebih lambat.59%) yang menghasilkan konsentrasi relatif lebih tinggi dibandingkan jarak suntik 5 cm (50. 2004).81% dan 20. 2008. 1994. Dikenal juga sebagai cyclopentanone yang memiliki wangi mint.96% untuk jarak suntik 20 cm dan 5 cm. Mann et al. 59 . Blake. Pola yang sama juga terlihat untuk akumulasi konsentrasi relatif pada kelompok senyawa C.. Cadinene Dumasin Benzylacetone Azulene Akumulasi total untuk komponen berkarakter odorant menunjukkan bahwa jarak suntik 20 cm (52. 2008). 2008). 2008. dengan spasi injeksi yang lebih kecil di mana infeksi terjadi lebih cepat dan lebih besar. Di pihak lain. Merupakan material wewangian dan untuk pengobatan serta memiliki sifat pestisida (ChemYQ. Benzylacetone memiliki wangi manis bunga yang merupakan komponen atraktan yang melimpah pada bunga. Namun.Kajian Kimia Gaharu . selain sebagai bahan kosmetik dan flavouring karena memberi wangi sitrus. 2008). Senyawa ini muncul sebagai konstituen minyak esensial berbagai tanaman (Wikipedia Online. Kajian lebih dalam lagi diperlukan untuk mengetahui perkembangan atau perubahan yang terjadi dengan semakin lamanya waktu inokulasi. Geraniol dan limonen juga dimanfaatkan dalam pengobatan herbal dan konstituen dalam berbagai tanaman obat (Wikipedia Online.. ada kemungkinan proses sintesis terjadi lebih cepat dibandingkan jarak injeksi yang lebih besar sehingga dihasilkan senyawa-senyawa baru yang lain yang berkarakter odorant namun akumulasinya belum cukup tinggi saat observasi dilakukan. yang ditunjukan oleh infeksi yang lebih kecil.23%).. 2004). masing-masing 24. Azulene sangat sering ditemukan sebagai komponen dalam minyak esensial tanaman dalam family Asteraceae dan memiliki wangi dan warna biru pada minyak dan ekstraknya (LyndShiveley.(Eka Novriyanti) Komponen Limonene Keterangan Limonene merupakan terpen yang memiliki aroma bunga dan buah. Limonen merupakan monoterpeneoid yang digunakan sebagai insektisida botani.. juga merupakan komponen volatil pada kokoa (Wikipedia Online.

2007). 2008). 1999. Senyawa asetosiringon juga tercatat pada semua gaharu hasil inokulasi kelima daerah asal isolat dalam penelitian ini. Fotouhi et al. 2004). Rho et al. 2000). 1986). senyawa 4H-pyran-4-one dan derivatnya (Abrishami et a. derivat cyclopentane (Wikipedia Onlie. 2008). eugenol (Cowan. dumasin (ChemYQ... 2006). Beberapa di antara komponen ini bahkan juga memiliki karakter wangi yang diketahui merupakan konstituen minyak esensial dan digunakan secara komersil dalam industri parfum dan pengharum seperti vanillin. Asetosiringon merupakan bioaktif dalam interaksi tanamanmikroba yang mempercepat pendeteksian kehadiran patogen oleh tanaman di mana konsentrasi senyawa ini meningkat dalam tanaman seiring dengan meningkatnya konsentrasi mikroba (Baker et al. 2008). Eugenol. PubChem Compound. 2007. 60 . Eugenol serta isoeugenol digunakan dalam produksi vanilin yang merupakan bahan penting dalam industri wewangian (Cowan. isoeugenol. Dalam Hua (2001) disebutkan bahwa konsentrasi asetosiringon meningkat 10 kali lipat ketika suatu jaringan aktif tanaman dilukai. 2008). di mana senyawa ini merupakan fenolik yang dihasilkan tanaman sebagai respon alami terhadap pelukaan (Sheikholeslam dan Weeks.. 1999).. syringal-dehyde (Pedroso et al. dan isometileugenol merupakan empat senyawa fenilpropanoid dari 12 senyawa volatil yang diketahui menyebabkan wangi yang manis pada Clarkia breweri (Rhodes. Rhodes. Koeduka et al. dan guaiakol merupakan intermediet dalam pembuatan eugenol dan vanilin (Li dan Rosazza.Aspek PRODUKSI Hasil analisis py-GCMS juga menunjukkan adanya senyawasenyawa yang pada beberapa hasil penelitian lain disebutkan sebagai senyawa pertahananan.. Sedangkan koniferil alkohol merupakan intermediet dalam biosintetis eugenol dan isoeugenol (Cowan. metileugenol. 2002. 2008. 2008).. dan elimicin (Rossi et al. 2008). 1999). benzoic acid (NBCI..

pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masinng sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. memiliki sifat antimikrobial (Torssel.. minyak esensial. deodoran. 2000). Senyawa-senyawa yang berdasarkan beberapa referensi diketahui merupakan pertahanan pada tanaman tertentu dan terdeteksi pada gaharu hasil inokulasi Senyawa Eugenol Keterangan Bersifat bakteriostatik terhadap jamur dan bakteri (Cowan. Letak dan jumlah grup hidroksil pada grup fenol diduga berkaitan dengan daya racun relative-nya terhadap mikroorganisme. 2008a). 2. Merupakan dimetil eter dari pirokatekol. Koniferil alkohol Guaiakol Katekol dan pirogalol Veratrol KESIMPULAN 1. 2008). Eugenol digunakan dalam pembuatan parfum. 1983. di mana daya racun akan semakin meningkat dengan semakin tingginya hidroksilasi (Cowan. pada A.. contohnya adalah yang terdapat pada Linum usitiltissimum (Sengbusch.. dan parasitisida (Wikipedia. 2008). Pada gaharu rekayasa hasil inokulasi Fusarium sp. Merupakan senyawa pertahanan tipe fitoaleksin yang termasuk dalam grup fenilpropanoid. sedatif. Hasil inokulasi Fusarium sp. yang juga digunakan sebagai antiseptik dan parasitisida (Li dan Rosazza. Adalah fenol terhidroksilasi yang bersifat toksik pada mikroorganisme. Merupakan intermediet dalam pembuatan eugenol dan vanilin. ekspektoran. Konstituen resveratrol yang diturunkan dari asam p-hidroksisinamat dan 3 unit malonat. p:144).(Eka Novriyanti) Tabel 2. Eugenol dan isoeugenol diturunkan dari prekursor lignin. 61 . dan obat-obatan.. microcarpa ditemukan beberapa komponen senyawa yang sudah diidentifikasi merupakan konstituen gaharu dan beberapa senyawa lain yang memiliki karakter odorant dan secara komersil digunakan dalam industri perfumery dan flavoring. 1999). yaitu asam ferulat ataupun koniferil alkohol (Rhodes. Kedua senyawa ini dan turunannya digunakan sebagai antiseptik. 1999).Kajian Kimia Gaharu . Senyawa ini digunakan untuk menghasilkan isoeugenol yang diperlukan untuk membuat vanilin yang juga merupakan bahan yang penting dalam obat-obatan dan industri parfum dan pengharum.

S. Teimuri-Mofrad. P. [20 Juni 2008]. N. Stimulatory Effect of Acetosyringone on Plant/Pathogen Recognition. A. Yasmin. S. United State Patent. Hasnida. [2 Februari 2007]. A. A. http://www. Bayat. DAFTAR PUSTAKA Abrishami. D. D. N. L. A. E. Y. Anak. com/MedicinalPlantConstituents. N. Majid. Whitaker.. A. S.usda. 2002. Mock. Song. [22 Mei 2007].com [31 Desember 2008]. 2008. J. Rice. Isolongifolanol Derivates. M. M. Shahrisa. Molecules 7: 239–244. Chang. Averyanov. B. A.net. Mulliken.. Deahl. T. http://www. daerah asal isolat menunjukkan perbedaan dalam konsentrasi senyawa-senyawa gaharu yang terbentuk. J. Said.traffic. 2004. gov/research/publications/publications. . Heart of the Matter: Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. Blanchette. namun isolat asal Maluku menunjukkan konsentrasi yang relatif lebih tinggi untuk total senyawa dengan karakter odoran. A. A. R. Mailina. asal Kalimantan Tengah menunjukkan konsentrasi senyawa konstituen gaharu terkonfirmasi yang lebih tinggi. Bunke. 1997. F.3. [21 Juni 2008]. J. Secara umum. Baker. 2004 Medicinal Plant Constituents. Comparison of Chemical Profiles of Selected Gaharu Oils from Peninsular Malayia. A. S. M. Barden. J. R. naturalhealthwizards.therainforestproject. N. Azah. N. Blake. D. Meskipun secara statistik tidak memperlihatkan perbedaan yang signifikan terhadap luasan infeksi yang terbentuk setelah 6 bulan inokulasi. H. Sustainable Agarwood Production in Aquilaria Trees.ars. Synthesis of Some Aldoxime Derivatives of 4H-Pyran-4-ones. The Malaysian Journal of Analytical Sciences 12 (2): 338-340. freepatentsonline.. C. A. 2000. C. http://www. inokulasi Fusarium sp. www. Robert.org. K. their Production and their Use. Husni. Schatkowski. Y. www. Y.pdf. 2006. htm.

Sánchez. M.iff. http://www. 1991. J. Nogueras. 1987. 63 . [2 Februari 2007]. 1987. Badan Litbang Kehutanan Jakarta. FAO. Thymelaceae. Plant Products as Antimicrobial Agents. M. S. A. Hua. Tumbuhan Berguna Indonesia Jilid III. M. T. A. 2002. M. Investigation of Electrooxidation Reaction of Some Tetrahydrobenzo[b]pyran Derivatives. T. http: // treechemicals. Tsuneya. S. L. International Flavor and Fragrance. Shiga. W. Dumasin.gov. Food safety and Quality: Flavoruing Index.pdf. 2005a. Ishihara.org/ ag/agn/jecfa-flav/index. 2008.Burfield. S. Tetrahedron 58 (29): 5941-5949. T. Hills. http://www.cfm.cropwatch.. J. http://www. Convention on International Trade in endangered Species of Wild Fauna and flora: Amendments to Appendices I and II of CITES. 2008.nsf/0/45BD7B214C6F661E8025699000 5D79C2 [31 Desember 2008]. Electrochem. Salido. Clinical Microbiology Review 12 (4): 564-582. Chemicals from Trees. Phytochemistry 30 (2): 563566. M. Applied Microbiology 32: 278-281. Agarwood Chemistry. and K.com/ Ingredients. Berlin: SpringerVerlag.html?showSynonyms=1 [ 1 November 2008: 2. E.org. www. 2004. M. 2007. 2008. CITES. Yayasan Sarana Wana Jaya. Fotouhi. Heravi. Altarejos. http://www. K.uk/review/extraction. Uneyama. Cowan. Inc. csl. J. Castro.chemyq.cites.. Sci. 2001. Forestry Commission GIFNFC. ChemYQ. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. M. Three Sesquiterpenes from Agarwood. Hayne. 1999. [14 Juli 2007]. hlm: 1467-1469.. Synthesis of Ambrox® from Labdanolic Acid. 3: 721-726.fao. Int. Terjemahan dari: Nuttige Planten Van Indonesie.31 pm]. Succinaldehyde. Fatehi. Heartwood and Tree Exudates.org/common/cop/13/raw / props/ID-Aguilaria-Gyrinops.com/ En/xz/xz11 [3 April 2008].

Nat. D. Kim. D. Bull.cgi?cid=243. Li. R. Jackson. Chang.. Kaewrak. Chem. Sci. Orlova. F. Rho. Rosazza. Biocatalytic Synthesis of Vanillin. N. are Biosynthesized via Reduction of a Coniferyl Alcohol Ester. M. Bogor. and I. Lee.. Chem. Y. Brazilian Jour. Kim. [22 Mei 2007]. W. A. 2006. Aromaticplant project. [20 Juni 2008]. Benzoic acid. Characteristic Aromatic Constituents of Spices. J. USA. Fridman. Shimada. 50 (3): 419-422. Y. www. 2004. Pichersky. Lynd-Shiveley. J. [1 Desember 2008]. 2008. http://pubchem. Kiyosawa. Natl. 2007.ncbi. Biavatti. 2004. Soc. Six New 2-(2-Phenylethyl)chromones from Agarwood. Induksi Produksi Gubal Gaharu melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik (Disertasi). Bhattacharrya. of Pharmacognosy 18(1): 63-69. S. Kish. D. S. Azulene and Chamomile. R. Koeduka. S. New 5-Hydroxy-2-(hydroxymethyl)-4H-pyran-4one Derivative has Both Tyrosinase Inhibitory and Antioxidant Properties. K. C. J. 2000. gov/summary/ summary. 2008.org. H. Pharm.. W. E. Microbial Transformation of Terpenes. Mechanical Methods to Stimulate Aloes Wood Formation in Aquiliria crassna Pierre ex H Lec (Kritsana) Trees. Acad. T.actahort. S. Pedroso. Noel. G. Lewis. Baiga. B. 1962. C.nih. B. Konoshima. G. Spassova. Pojanagaroon. H. N. Campos. Applied and Environmental Microbiology 66 (2): 684-687. C. J. Isolation of Syringaldehyde from Mikania laevigata Medicinal: Extract and its Influence on the Fatty Acid Profile of Mice. N. www. E. S. P.. Prema. E. Barison. F. T. T. S. 64 . and P. A. Lab. India. M. Program Pascasarjana Institut Pertanian Bogor.. Santos. I. NCBI PubChem. H.Aspek PRODUKSI Isnaini. 2006. S. Gang. Baek. Dudareva. Y. Vassão. S. ISHS Acta Hort 676. Korean Chem. A.com. Deschamps. P. M. 28 (3): 471-473. Proc. Konishi. J. T. A. You.nlm. L. M. P. 2002. Steil. D. Eugenol and Isoeugenol.. T. Bull.

Kajian Kimia Gaharu .....(Eka Novriyanti)

Rhodes, D. 2008. Secondary Products Derived from Aromatic Amino Acids: Eugenol and Isoeugenol. www.hort.purdue.edu. [20 Juni 2008]. Rossi, P. G., L. Bao, A. Luciani, P. Panighi, J. M. Desjobert, J. Costa, J. Casanova, J. M. Bolla, and L. Berti. 2007. (E)-Methy-lisoeugenol and Elemicin: Antibacterial Components of Daucus carota L. Essential Oil Against Campylobacter jejuni. J. Agric. Food Chem. 55 (18): 7332-7336. Sengbusch, P. V. 2008. Phenolic Compounds. http://www.biologie. unihamburg. de/b-online/e20/20d.htm. [10 April 2008]. Sheikholeslam, S. N., D. P. Weeks. 1987. Acetosyringone Promotes High Efficiency Transformation of Arabidopsis thaliana Explants by Agrobacterium tumafacien. Plant Molecular Biology 8: 291198. Sumarna, Y. 2005. Budidaya Gaharu. Seri Agribusines. Penebar Swadaya. Jakarta. The Good Scent Company. 2008. Limonene; Ketoisophorone; Syringaldehyde, Tiglaldehyde. http://www.thegoodscents company.com/gca/gc1014951.html [20 Juni 2008]. Torssell, K. B. G. 1983. Natural Product Chemistry. John Wiley & Son Limited. Chichester, New Tork, brisbane, Toronto, Singapore. Trupti, C., P. Bhutada, K. Nandakumar, R. Somani, P. Miniyar, Y. Mundhada, S. Gore, K. Kain. 2007. Analgesik and Antiimflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. Pharmacologyonline 1: 288-298. Vidhyasekaran, P. 2000. Physiology of Disease Resistant in Plant. CRC Press Inc. Boca Raton, Florida. Verpoorte, R., R. van der Heijden, J. Memelink. 2000. General Strategies. In Verpoorte, R. and A. W. Alfermann (eds). Metabolic Engineering of Plant Secondary Metabolism. Kluwer Academic Publisher. Dordrecht, Boston, London. p: 31-50. Wikipedia Online. 2008. Pyrrolidine; Propargyl Alcohol; Ptalic Acid; Mesityl Oxide; Maltol; Indole; Glutanic Acid, Furanone; Elemicin; DABCO; Crotonic Acid; Cadinene; Butyric Acid; Benzylacetone; Caprylic Acid. http://en.wikipedia.org/wiki/. [1 juni 2008].

65

Aspek PRODUKSI

Yagura, T., N. Shibayama, M. Ito, F. Kiuchi, G. Honda. 2005. Three Novel Diepoxy Tetrahydrochromones from Agarwood Artificially Produced by Intentional Wounding. Tetrahedron Letters 46: 4395-4398. Yagura, T., M. Ito, F. Kiuchi, G. Honda, Y. Shimada. 2003. Four New 2-(2-Phenylethyl) Chromone Derivatives from Withered Wood of Aquilaria sinensis. Chem. Pharm. Bull. 51:560-564. Zaika, E. I., R. A. Perlow, E. Matz, S. Broyde, R. Gilboa. 2004. Sub-strate Discrimination by Formamidopyrimidine-DNA Glycosylase. The Jour. of Biol. Chem. 279 (6) issue 6: 4849-4861.

66

Kajian Kimia Gaharu .....(Eka Novriyanti)

Lampiran 1. Komponen dalam gaharu hasil inokulasi Fusarium sp. pada A. microcarpa
Konsentrasi Relatif (%) Nama senyawa 5 cm Bo 20 cm 5 cm Kt 20 cm Me 5 cm 20 cm Mu 5 cm 20 cm

A. Komponen aromatis yang sudah diidentifikasi sebagai konstituen gaharu 4-(2’-Methyl-3’-butenyl) azulene 2,5-DIMETHOXY-4ETHYLBENZALDEHYDE 2-Hydroxy-4methylbenzaldehyde 4-Ethoxy-3methoxybenzaldehyde 4-METHYL-2,5DIMETHOXYBENZALDEHYDE Benzaldehyde, 2,4-dihydroxy Benzaldehyde, 2,4-dimethoxy- (CAS) 2,4-Dimethoxybenzaldehyde Benzaldehyde, 3,4-dihydroxy- (CAS) 3,4-Dihydroxybenzaldehyde Benzaldehyde, 3-hydroxy- (CAS) m-Hydroxybenzaldehyde Benzaldehyde, 4,6-dimethoxy2,3-dimethyl- (CAS) 2,4-Dimethoxy-5,6-dimethyl Benzaldehyde, 4-[[4-(acetyloxy)-3,5dimethoxyphenyl]methoxy]3-methoxy Benzaldehyde, 4-hydroxy(CAS) p-Hydroxybenzaldehyde 1,2-benzenedicarboxylic acid, diisooctyl ester (CAS) Isooctyl phthalate 2-Butanone, 4-phenyl- (CAS) Benzylacetone 2-Butanone, 3,3-dimethyl(CAS) 3,3-Dimethyl-2butanone 0,09 0,09 4,35 0,42 0,06 0,08 0,08 2,37 0,30 0,49 3,66 0,08 0,06 0,21 1,52 0,22 0,07 4,65 0,10 1,45 0,09 4,42 0,11 4,60 0,25 -

-

-

0,32

0,29

0,26

-

0,24

0,28

-

0,37

-

-

0,39

-

-

0,29

-

-

0,36

-

-

-

-

-

-

-

0,37

-

-

0,54

0,48

-

-

0,07

-

0,12

0,43 -

0,23 -

0,44 -

-

0,24 -

0,04

-

0,41 0,04

-

0,53 -

0,05

-

67

Aspek PRODUKSI

Konsentrasi Relatif (%) Nama senyawa 5 cm 2-Butanone, 3-phenyl- (CAS) 4H-1-Benzopyran-4-one, 2-(3,4-dihydroxyphenyl)-7-(. beta.-D-glucopyranosyl) 4H-1-Benzopyran-4one, 2-methyl- (CAS) 2-Methylchromone 4H-1-Benzopyran-4-one, 5,7-dihydroxy-2-methyl- (CAS) 2-Methyl-5,7-dihydroxy 4H-1-Benzopyran-4-one, 6-dihydroxy-2-methyl- (CAS) 6-Hydroxy-2-methylchromone 2-Coumaranone .gamma.-Eudesmol Hexadecanoic acid, 2-(octadecyloxy)-, tetradecyl ester (CAS) TETRADECYL Hexadecanoic acid, methyl ester (CAS) Methyl palmitate 2,4-Hexadienedioic acid, 3,4-diethyl-, dimethyl ester, (Z,Z)- (CAS) CIS.CIS.D 2,4-Hexadienedioic acid, 3-methyl-4-propyl-, dimethyl ester, (Z,E)- (CAS) .alpha.-humulene 1-Naphthalenol, 1,2,3,4-tetrahydro- (CAS) 1-Tetralol 1-Ethynyl-3,4-dihydro-2naphthalenecarbadehyde Phenol, 2,6-dimethoxy- (CAS) 2,6-Dimethoxyphenol Phenol, 3,4-dimethoxy- (CAS) 3,4-dimethoxyphenol Benzenepropanoic acid, methyl ester (CAS) Methyl hydrocinnamate Bo 20 cm 5 cm Kt 20 cm 0,05 Me 5 cm 20 cm Mu 5 cm 0,15 20 cm -

-

-

-

0,18

-

-

-

-

-

0,06

-

0,36

-

-

0,34

-

-

-

-

0,46

-

-

-

-

-

0,04 -

-

-

-

-

0,28 -

0,03

-

-

-

-

0,69

-

0,05 0,85

-

-

0,12

-

0,16

-

0,09

0,17

-

-

-

-

-

-

0,11 0,07

-

-

2,94 0,25 -

0,08 3,37 0,33 -

2,74 0,33 -

3,67 0,40 0,25

3,11 0,24 -

3,05 0,42 -

4,22 0,40 -

2,83 0,22 -

68

19 0.17 0.17 5.66 2.26 0.5dimethoxyphenyl).67 6.4.65 - - 0.02 - 0.57 0. 3-methyl(CAS) 3-methylpyrocathecol 0.30 8.8A-OCTAHYDRONAPHTHALENE Jumlah Rataan untuk kedua jarak suntik Bo 20 cm 0.18 0..50 4.49 6.(CAS) Acetol Ethanone.20 0.60 4.2.20 9.03 - - 0.83 0.. Komponen aromatis yang merupakan pyrolisis dari bagian kayu 4H-Pyran-4-one.21 0.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm Propanoic acid.38 0.22 0.(CAS) Acetosyringone ACETOVANILLONE Ethanone.15 3.58 0.6.27 0.96 B..31 - 1.66 0.28 5 cm Kt 20 cm 0.25 0.2DIMETHYL-..3.17 0. METHYL Benzenepropanoic acid (CAS) Phenylpropionic acid 3.04 3.66 0.15 4.20 0.12 - 0. 3-(2-propynyloxy)-.6.89 9. 3-Hydroxy-2methyl. anhydride (CAS) Propionic anhydride Propanoic acid.49 - 0.2-benzenediol.4A.61 0.14 0.66 0. 1-(4-hydroxy3-methoxyphenyl).5.20 1.44 - - 12. ethenyl ester (CAS) vinyl propionate CYCLOPENTANEPROPANOIC ACID.74 0.29 0.79 0.12 5. ethyl ester (CAS) ETHYL 3-PROPARGYL Propanoic acid.8-HEXAHYDRO-2HCHROMENE 1.Kajian Kimia Gaharu .94 0.86 1.84 0. 1-ACETYL-2.95 10.58 13.74 16.62 10.28 69 .46 1.19 0.28 8.30 12.2-Benzenediol (CAS) Pyrocathecol 1.49 2.59 8.58 3.17 0.5.(CAS) Acetovanillone 1.(CAS) 5-hydroxy-2methyl-4H-pyran-4-one 2-Propanone.24 Me 5 cm 20 cm Mu 5 cm 20 cm 0. 1-(acetyloxy)(CAS) Acetol acetate 2-Propanone.56 0.12 0.99 0. 5-Hydroxy2-methyl. 1-hydroxy.(CAS) Maltol 4H-Pyran-4-one.4. 1-(4-hydroxy-3.14 0.17 0.95 6.7.27 0.55 0.87 0.

36 0. 2-methoxy-4-propyl(CAS) 5-PROPYL-GUAIACOL Phenol.35 11.06 0. methyl ester (CAS) 3.11 1.37 Bo 20 cm 1.DELTA.4.07 - - - - - - 70 .92 0.64 - 0.03 - 0.30 1. Komponen berkarakter odorant lainnya yang belum disebutkan sebagai konstituen gaharu Ascaridole 2H-Pyran-2-one.31 11. 4-ethenyl-.18 0.64 - 0. 3.35 1.57 0.69 0.13 0.34 11.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 3-Methoxy-pyrocathecol 4-METHYL CATHECOL Phenol.54 12. 6-ethyltetrahydro.16 - - 0.90 0.71 1.23 Me 5 cm 1.(CAS) Guaiacol Phenol.70 0. 4-methyl. 3-methoxy.57 2.24 - 0.22 0.43 1.07 14.13 0.52 0. methyl ester (CAS) METHYL 4-VINYLBENZOATE 2.27 1. 3-methyl.19 0.23 0.18 12.45 2. 4-ethyl-2-methoxy(CAS) p-Ethylguaiacol Phenol (CAS) Izal Jumlah Rataan untuk kedua jarak suntik 1.52 11. 2-methyl.24 0.14 0.40 20 cm 1.82 0.18 0.36 13.18 1.08 0.4.37 0.14 0.63 20 cm 1.31 0.50 0.40 0.5-Trimethoxybenzoic Benzoic acid.VALEROLACTONE Oxacycloheptadec-8-en-2-one (CAS) Ambrettolide Oxacycloheptadecan-2-one (CAS) Dihydroambrettolide Benzoic acid.39 0.01 0.06 - - 0.82 0.47 C.40 5 cm 1.12 0.(CAS) m-Cresol Phenol.47 Mu 5 cm 1. 2-methoxy.5-trimethoxy-.82 0.19 0.28 Kt 20 cm 2.46 0.14 - 0. 4-(methylamino)Benzoic acid.89 10.35 0.15 0.39 13.(CAS) p -Cresol Phenol.(CAS) m-Guaiacol Phenol.87 11.(CAS) o-Cresol Phenol.11 0.43 12.(CAS) 6-ETHYL-.05 0.

).99 - 4. beta. (3.03 0.78 Bo 20 cm 0..17 1.alpha. m-nitrophenyl ester (CAS) m-Nitrophenyl butyrate Carveol. 3-methyl(CAS) Citraconic anhydride Citronellyl acetate .09 Me 5 cm 1.5-furandione.95 0..66 5 cm 0.45 0..98 1.98 Kt 20 cm 0.93 0.7.04 - 0.7-triol.76 0. dimethylhydrazone (CAS) Cyclopentanone dimethylhydrazone Cyclopropyl carbinol Cyclopentanone (CAS) Dumasin 1-Eicosanol (CAS) n-Eicosanol TRANS-ISOELEMICIN Ethanone.(CAS) Isoeugenol Phenol.22 - 0. 2-methoxy-4-(1propenyl)-.14 1.6.93 - 3.beta. 2-methoxy-4-(1propenyl).84 - 0. cisCholestane-3.38 - 4.61 - 4. (E).12 - 0.33 - 6.5-dihydroxyphenyl)(CAS) Quinacetophenone Phenol.20 - 4.(CAS) (E)isoeugenol Phenol.33 - - 0.24 - 0.25 1.38 0.42 4.67 0.(CAS) 2-acetylbutyrolactone 0.-Cyclocitral Cyclopentanone.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm .beta.45 1.70 0.85 - - - - - 0.22 - - 1.20 71 .beta.6.23 20 cm 0.61 - - - - - - - 0. 1-(2. dihydro-..71 0.(CAS) Eugenol 5-BUTYL-2-VALERYLFURAN 2(3H)-Furanone.07 0.31 - 0.93 - 0.(CAS) 2.26 0. 2-methoxy-4-(2propenyl).5.55 Mu 5 cm 1.Kajian Kimia Gaharu .53 0. 3-acetyldihydro.30 0.66 20 cm 2.beta..51 0.-bisabolene 2-Butanone (CAS) Mehtyl ethyl ketone Butyric acid.65 0.32 1..28 1..

54 0.56 0.GAMMA.09 - 0.4-Dimethylbut-2enolide 2(5H)-Furanone.65 - 0.09 - 0. 5. 5-methyl(identity?) (CAS) 2-Penten-4olide 2(3H)-Furanone. 5-hexyldihydro.77 0.59 0. acetate (CAS) 2-HEPTYL ACETATE 2-Heptanone.25 - - 0.5-dimethyl(CAS) 4.36 0.56 0.40 0.98 0.75 1.03 0.38 0.5-Dihydrodecanoic acid. 3-methyl.54 - 0. 2-methyl.30 0.(CAS) 4-decanolide 2-Furancarboxaldehyde (CAS) Furfural 2-Furanmethanol (CAS) Furfuryl alcohol 2-Furanmethanol.54 - 0.48 0.70 - 0.65 0.66 - 0. delta.71 0. tetrahydro(CAS) Tetrahydrofurfuryl alcohol 2-Heptanol.26 - 0.14 0.-lactone Muskolactone Bo 20 cm 5 cm 0.09 - - - - - - - 0.69 - 0.02 - 72 .18 Kt 20 cm Me 5 cm 20 cm 0.06 0.63 - 0.23 0.09 Mu 5 cm 20 cm - - - - - - 0.60 0.(CAS) 3-Methyl-2-heptanone Hexanoic acid.28 0.51 0.03 0.39 0.21 0.31 0.93 - - 0.21 0.HEXALACTONE 3.04 0.03 - 0.(CAS) 2-methylindole 6-Nitro-5-hydroxy-1.11 - 0.55 0.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 2(5H)-Furanone. 1-methylethyl ester (CAS) Isopropyl hexanoate 3-Hexenoic acid 1H-Indole (CAS) Indole 1H-Indole.35 - 0.76 - 0.13 0.74 1.64 0.18 0.2dimethylindole Indolizine (CAS) Indolizin Ionol 2 3-pentanone CAS) Diethyl ketone 1-Penten-3-one (CAS) Ethyl vinyl ketone .31 - 0.

13 0.6.15 0.20 Me 5 cm 20 cm 0.89 2..70 0. 5-methyl(CAS) Orcinol Benzaldehyde.21 Mu 5 cm 0.86 - 0.21 0.11 0.01 0.Kajian Kimia Gaharu .3-Benzenediol.(CAS) N-Acetyl-L-isoleucine 5.04 0.04 0.65 3.50 - 0. 1-(1-METHYLPENTYL)3-(2.42 0. 4-ethyl.57 0.89 0.5-dimethoxy.(CAS) NITROSOPIPERIDINE PIPERIDINE.15 - 0.34 - 0.(CAS) 4-Ethylresorcinol 1.7-dimethoxy-2-methylindan1-one Lineolone METHYL MALONIC ACID p-Menthane-2-one-1. 4-methyl.19 Kt 20 cm 0. N-acetyl. 9-TRIMETHYLSILYL 1.29 - 0.(CAS) 4-methyl-4-nonanol 2.48 2.3-Benzenediol.20 0.40 0..13 0.3.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm L-isoleucine. 1-nitroso. 6-methyl-9(trimethylsilyl).5-DIHYDROXYNORBORNANE Piperidine.58 73 .21 0.13 20 cm 0..43 0.45 3.52 0.57 3.3-d3 (CAS) 2.22 0. 4-hydroxy3.52 0.93 - 0.5-DIMETHOXY-PHENYL)PROPIONIC ACID 3-PHENYL-PROPIONIC ACID ISOPROPYL ESTER 2-PROPYNOIC ACID 9H-Purine.17 - 0.50 5.19 0.(CAS) Syringaldehyde Bo 20 cm 0.5-Norbornanediol (CAS) 2..6-TRIDEUTERIO-OMENTHONE Benzene.50 0.58 0.(CAS) 6-METHYLPURINE.04 5 cm 0.56 - 0.47 0. 1-methoxy-4-methyl(CAS) p-methylanisole NEROLIDOL ISOMER 4-Nonanol.

50 Kt 20 cm 0. . 4-hydroxy-3-methoxy.(CAS) Zingerone Ethanone.(CAS) Vanillin Benzeneacetic acid.40 5 cm 0.11 0.70 - 1.61 0. 1-(2-furanyl).23 - 0.hydroxy-2-methoxy.alpha.01 20 cm 0.alpha.72 0.27 0.15 - 0.4-dimethoxy(CAS) Vanillin methyl ether Benzaldehyde.12 0.23 - - 0.(CAS) Homovanillic acid ISO-VELLERAL Benzenemethanol.97 0.4-dimethoxy.13 - 1.59 20 cm 0.52 Mu 5 cm 0.52 Me 5 cm 0.13 0.39 1.12 0.96 0.48 0. 4-(4-hydroxy3-methoxyphenyl).02 - - - - - - - - 0.28 - 2. hexahydro3-methylene.5-DIMETHYL-3(2H) FURANONE 2-ETHYL-4-HYDROXY-5METHYL-3(2H)FURANONE 2-HYDROXY-5-METHYL-2(5H)FURANONE 3-HYDROXY-5-METHYL-2(5H)FURANONE 0.14 0.17 - 2.11 0.32 - - - - - - - - 0.77 0.55 0. 5-methyl(CAS) 5-Methyl-2-oxo-2.3DIHYDROFURAN 2(3H)-Furanone.(CAS) 6-HYDROXYCYCLO 2(5H)-FURANONE 2.38 Bo 20 cm 0.09 0.10 - 0.14 - 1.26 74 .Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm (E)-2-hydroxy-4’phenylstilbene 1-TRICOSENE Benzaldehyde.06 - 0.20 0.(CAS) 2-Acetyfuran 2-ACETYL FURAN 2(3H)-Furanone (CAS) .Furanone 2(3H)-Furanone.21 - - 0.36 - 1.45 0. 4-hydroxy-3methoxy.(CAS) 2-methoxymandelic acid Benzeneacetic acid.04 0.63 - - - - - 0. 3. 3.45 - - - - - 0.(CAS) Veratryl alcohol 2-Butanone.

19 45..87 - 1.95 2.86 18. (2002)..95 0. Azah et al. Koeduka et al. (2007). Kt = Kalimantan Tengah Tamiang Layang.30 - Me 5 cm 1. Rho et al. (2006). The Good Scent Company (2008).06 2.02 20 cm 1. (2002).65 5 cm - Kt 20 cm 1.3-dihydroxy-6-methoxy-8methyl.56 Bo = Bahorok. (2008).33 0. Valentines et al. Rossi et al.57 19.93 22.10 3.52 3.14 44. (2008). Hua et al. (2004).29 26. (2008). Pedroso et al.65 46.06 Mu 5 cm 20 cm 1..80 2.10 52.31 17. Baker et al. Abrishami et al.33 26.01 44. Inc (2008).30 45.23 0.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm 5-HYDROXYMETHYLDIHYDRO-FURAN-2-ONE HYDROXY DIMETHYL FURANONE 2-(Acetyloxy)-1-[2-(acetyloxy02-(3-furanyl)ethyl]-5a[(acetyloxy)methyl]hexah 2-Methoxy-4-methylphenol Phenol. (2004). 75 .37 25.62 0. 2.6dimethoxyphenol 9H-Xanthen-9-one.(CAS) 4-allyl-2. Sheikholeslam & Weeks (1987).71 21. Lynd-Shiveley (2004). (2005). 1.34 43.(CAS) 6-O-METHYLXanthosine (CAS) Xanthine riboside Jumlah Rataan untuk kedua jarak suntik Total Rataan total untuk kedua jarak suntik Keterangan: Referensi: Bo 20 cm 1.12 24.23 - - - - 0.32 37. ChemYQ (2008). Bunke & schatkowski (1997).83 43.33 50.6-dimethoxy-4-(2propenyl). Zaika et al.81 - 2.48 49. (2001).06 - - - 18. International flavor and fragrance.13 0.. (2007).23 27.70 25.05 3.17 2. Castro et al.Kajian Kimia Gaharu .34 46. Wikipedia encyclopedia Online (2008). Me = Mentawai. Mu = maluku FAO (2008).18 0. Fotouhi et al.

76 .

kresna. Najmulah. sebenarnya merupakan endapan resin yang terakumulasi pada jaringan kayu sebagai reaksi pohon terhadap pelukaan atau infeksi penyakit. Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu yang merupakan produk komersil bernilai ekonomis tinggi. Maman Turjaman. Ragil Setio Budi Irianto. Sitepu. Saat ini. komoditas ini dikenal dengan berbagai nama seperti agarwood. chip. Ahmad Yani. Menurut Suhartono dan Mardiastuti (2002). serbuk. Dalam perdagangan internasional. perdagangan produk ini di Indonesia pertama kali tercatat pada abad ke-5 Masehi. Gaharu telah diperdagangkan sejak ratusan tahun lalu. Bentuk perdagangan gaharu beragam. di mana China dilaporkan sebagai pembeli utama. jinkoh. karas. aloeswood.3 TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso. gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut sebagai ‘scent of God’. mulai dari bongkahan. Irnayuli R. Komoditas berbentuk minyak biasanya diperoleh dari penyulingan atau ekstraksi chip gaharu dari kelas yang bermutu rendah. meskipun penggunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. 77 . oudh. Sugeng Santosa. dan masih banyak lagi nama lainnya. dan minyak gaharu (Surata dan Widnyana. 2001).

Untuk menghasilkan gaharu secara artifisial. 2000). Suhartono dan Mardiastuti. malaria. Penelitian-penelitian ini terutama didorong oleh berbagai hal seperti pasokan komersil untuk gaharu yang masih sangat tergantung dari produksi alam yang karena tingginya intensitas pemungutan produk ini telah menyebabkan tercantumnya genus utama tanaman penghasil gaharu. hepatitis.. 2007) dan diketahui bermanfaat untuk mengatasi berbagai penyakit seperti sakit gigi. liver. di mana selama proses tersebut berlangsung dihasilkan variasi mutu dan pada akhir proses dapat diperoleh gaharu dengan mutu paling tinggi (Sumadiwangsa dan Harbagung. Namun pembentukan gaharu oleh faktor abiotik. Adelina. gula merah. kanker. 2002). Proses pembentukan gaharu juga membutuhkan waktu yang lama. juga memiliki sifat anti racun. sebagai pengharum ruangan. Barden et al. mekanisme pembentukan dapat menyebar ke bagian lain pada pohon. seperti yang telah disebutkan sebelumnya tidak menyebabkan terjadinya penyebaran mekanisme pembentukan ini ke bagian lain dari pohon yang tidak terkena efek langsung faktor abiotik tersebut. tidak semua tanaman penghasilnya mengandung gaharu yang hanya terpicu pembentukannya jika terjadi kondisi cekaman. incense. dan parfum (Barden et al.Aspek PRODUKSI Pada prinsipnya. terpicu oleh faktor biotik maupun abiotik. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti imflamatory (Trupti et al. ginjal. 2000). rematik. anti mikrobia. dan yang lainnya dapat memicu pembentukan gaharu. 2000). tumor.. diare.. sembahyang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. 2004. 1987. In-cense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagamaan. pemanfaatan gaharu adalah untuk pengobatan. stimulan kerja saraf dan pencernaan (Heyne. diuretic. Penelitian mengenai berbagai aspek yang terkait dengan gaharu sudah dilakukan sejak lama dan semakin berkembang dewasa ini. cacar. Terbentuknya gaharu pada tanaman penghasilnya. 2000.. Lain halnya jika pembentukan gaharu dipicu oleh faktor biotik seperti jamur atau jasad renik lainnya. Gyrinops dan Aquilaria dalam Appendix II CITES. oli. asma. pengaruh bahan-bahan kimia seperti metal jasmonat. Sementara itu. pelukaan mekanis pada batang. karena 78 . obat kuat pada masa kehamilan dan bersalin. Selain itu.

BAHAN DAN METODE A. microcarpa 79 . Bahan Bahan yang digunakan pada kegiatan ini adalah 21 isolat Fusarium spp. microcarpa pada kegiatan ini bahan berupa pohon A. yang telah menunjukkan adanya pembentukan gaharu secara alami. Tabel 1. maka kualitas dan kuantitas produk gaharu yang dihasilkan akan lebih memuaskan. yang diinokulasi di Laboratorium Mikrobiologi Hutan.. Batang Aquilaria spp. Sumatera. NTB dan Sulawesi (Tabel 1). Inokulasi jenis fungi Fusarium spp. Kalimantan.(Erdy Santoso. Dengan terjadinya penyebaran pembentukan gaharu ke jaringan lain pada batang pohon. yaitu Potato Dekstrose Agar (PDA). Isolat-isolat yang diamati No 1 2 3 4 5 6 7 8 9 10 11 Kode Ga 1 Ga 2 Ga 3 Ga 4 Ga 5 Ga 6 Ga 7 Ga 8 Ga 9 Ga 10 Ga 11 Asal lokasi Kalimantan Tengah Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Sumatera Barat Gorontalo No 12 13 14 15 16 17 18 19 20 21 Kode Ga 12 Ga 13 Ga 14 Ga 15 Ga 16 Ga 17 Ga 18 Ga 19 Ga 20 Ga 21 Asal lokasi Lampung Bengkulu Bogor Mentawai Kaltim LK Kalbar Yanlapa NTB Kalsel MIC Kalteng TL Media yang digunakan untuk menambahkan fungi. Isolat fungi tersebut diperoleh dari batang Aquilaria spp. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Bogor. diambil dari beberapa tanaman gaharu yang terdapat di Jawa.. Maluku.. dkk) penyebab mekanisme ini adalah mahluk yang melakukan semua aktivitas yang diperlukan untuk kehidupannya.Teknologi Induksi Pohon . pada A..

Jambi. baik secara horizontal maupun vertikal. Inokulasi dilakukan pada semua pohon contoh. diinkubasi dengan cara diletakkan pada ruang tertutup yang kelembabannya dijaga dengan cara memasukkan kapas yang telah dibasahi aquadesh steril. yang diamati adalah bentuk dan miselium. Untuk fungi pembentuk gaharu asal Gorontalo. Kalbar. mata bor ukuran 3 mm. setelah itu koloni yang tumbuh pada gelas obyek diamati di bawah mikroskop setelah preparat diberi zat pewarna. kemudian diinokulasi pada suhu kamar dan diletakkan di ruangan inokulasi selama tujuh hari.Aspek PRODUKSI umur 13 tahun. Identifikasi juga mengamati ciri makrokonidia. Inokulasi Pohon contoh adalah A. semua peralatan yang digunakan disterilkan terlebih dahulu dengan alkohol 70% untuk menghindari adanya kontaminasi dari mikrobamikroba lain. Sebelum penginjeksian. yaitu Fusarium spp. Sediaan kultur dibuat dengan cara memindahkan potongan kecil isolat fungi menggunakan alat pelubang gabus berdiameter lima mm. Rancangan acak lengkap dengan perlakuan daerah asal isolat (I). B. Alat inokulasi. dan Padang (Sumatera Barat). Jambi (13) dan Padang (14) serta campuran dari keempat isolat tersebut (15). genset. diamati juga warna koloni dan keberadaan aerial miselium. Teknik Inokulasi 1. microcarpa di Hutan Penelitian Carita. isolat diletakkan pada gelas obyek yang kemudian ditutup dengan cover glass preparat. Metode Untuk identifikasi masing-masing koloni ditumbuhkan pada media PDA dalam cawan petri. mikrokonidia serta bentuk konidiofor. Kalimantan Barat (12). asal Gorontalo (II). Sediaan kultur diinkubasi selama tujuh hari. C. Masing-masing isolat diinokulasikan pada 3 ulangan. Pengeboran dilakukan 80 . terdiri dari bor listrik. Untuk pengamatan morfologi dilakukan melalui mikroskop parameter. dan lain-lain. yang diamati adalah ukuran diameter koloni.

cair selanjutnya diinjeksikan sebanyak 1 ml untuk setiap lubang bor di batang pohon. Pengamatan dan Pengambilan Contoh Gaharu Pengamatan infeksi dilakukan pada umur inokulasi 2 bulan dan 6 bulan dengan mengukur panjang infeksi vertikal dan horizontal yang terjadi pada permukaaan batang A. microcarpa. 1. yang berasal dari berbagai daerah sangat 81 . Inokulum Fusarium spp.Teknologi Induksi Pohon . warna koloni dan diameter koloni isolat Fusarium spp.. A Gambar 1. HASIL DAN PEMBAHASAN A... Keragaman Isolat Fusarium spp. Pengeboran batang pohon contoh (A) dan injeksi isolat pada lubang bor (B) B 2. dkk) dengan kedalaman mencapai 1/3 diameter batang dengan tujuan inokulum cair nantinya mencapai kambium dan bagian floem kayu. Keragaman Morfologi Isolat Fusarium spp. Lubang injeksi dibiarkan terbuka untuk memberi kondisi aerasi bagi mikroba yang diinokulasikan..(Erdy Santoso. Pengambilan data dilakukan secara acak pada beberapa titik injeksi inokulasi dan nilai panjang infeksi merupakan rata-rata dari panjang titiktitik infeksi tersebut dalam satu pohon. yang Berasal dari Berbagai Daerah Karakter morfologi aerial miselium.

+++ Banyak a.++ Ada. kuning muda Putih. kuning muda Putih.++ Warna Medium PDA Putih.++ Ada. ++ Cukup banyak.+ Ada. Keragaman karakter morfologi Fusarium spp. Keragaman morfologi Fusarium spp. Koloni pada 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 Kelimpahan relatif aerial miselium: + Sedikit. unggu Putih krem Putih. putih Putih. disebabkan oleh perbedaan asal isolat. Keberadaan Aerial Miselium 82 .++ Ada.Aspek PRODUKSI beragam (Tabel 2).+ Ada.+++ Ada.+++ Ada.++ Ada.+++ Ada. kuning. yang berasal dari berbagai daerah Kode isolat Karakter morfologi Asal lokasi Diameter koloni mm/7 hari Kalteng Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Padang Gorontalo Lampung Bangka Bogor Mentawai Kaltim LK Kalbar Yanlapa Mataram Kalsel MIC Kaltel TL 61 49 48 50 45 38 59 49 59 61 58 58 59 61 56 57 59 58 52 50 69 Aerial Miselium Ada.+++ Ada. Tabel 2. coklat muda Coklat muda Putih Putih Putih Putih krem Putih Putih krem. kuning muda Putih Putih.+ Ada.++ Ada.+++ Ada.++ Ada.+++ Ada. Tabel 2.++ Ada.++ Tidak ada Ada. coklat muda Putih Putih kecoklatan Putih tulang. merah muda Putih Putih Coklet.++ Ada.+++ Ada. krem No.

memiliki aerial miselium. Ga-9.. sedangkan isolat Ga-3. Isolat Ga-18. Irawati (2004) melaporkan bahwa secara umum cendawan yang ditumbuhkan pada kondisi terang secara terus-menerus akan membentuk aerial miselium relatif lebih banyak. Ga-13. Hasil yang diperoleh menunjukkan bahwa warna koloni putih terdapat pada isolat Ga-4. dan Ga17 memiliki kelimpahan aerial miselium relatif banyak (Tabel 2). Ga-6. Ga8. karena pada penelitian semua isolat yang diuji mendapat perlakuan cahaya yang sama. Isolat ga-17 dan Ga-21 memiliki kemiripan warna koloni dengan isolat Fusarium yang berasal dari Riau yang telah teridentifikasi dan merupakan spesies Fusarium solani (Luciasih et al. Ga-10. dan Ga-16 merupakan isolat dengan kelimpahan aerial miselium sedikit. 2006). Walaupun sebagian besar isolat Fusarium spp. Warna Koloni Selain aerial miselium. maka perbedaan kelimpahan aerial miselium adalah disebabkan oleh karakter masing-masing isolat. Namun. Ga-14. Ga-13. keragaman morfologi isolat Fusarium spp. adalah warna koloni. Ga-11. Isolat yang tidak memiliki aerial miselium dijumpai pada Ga-15 asal Mentawai. Ditemukan juga isolat yang memiliki warna koloni yang sangat berbeda dengan isolat lain. Isolat Ga-1. Selain warna putih. Ga-6. Ga-17. cokelat muda (Ga-2). dan Ga-20 memiliki warna koloni putih dan kuning muda. 2004). dan Ga-19 (Gambar 2. Aerial miselium yang terbentuk dengan kelimpahan relatif banyak merupakan mekanisme fototropi terhadap kehadiran cahaya (Irawati. dan Gambar 4). yaitu warna hifa miselium didominasi 83 . Ga-12. dan Ga-21). namun terdapat perbedaan antar isolat jika dilihat berdasarkan kerlimpahan relatif aerial miseliumnya. Ga-19. Gambar 3. putih krem (Ga-7. Ga-10. Fusarium solani merupakan spesies yang kosmopolit dengan ciri khas kelimpahan mikrokonidianya elips. b. beberapa isolat memiliki warna putih dan warna kuning muda pada isolat Ga-1.Karakter aerial miselium terdapat hampir pada setiap isolat Fusarium spp. Ga-5. Isolat Ga-10 dan Ga11 memiliki warna koloni putih dan warna cokelat muda (peach).

Ga-14. Keragaman diameter koloni Fusarium spp. Ga-7. Namun. Ga-12. Diameter koloni merupakan veriebel yang berhubungan erat dengan kecepatan tumbuh. Keragaman Mikro dan Makrokonidia serta Konidiofor Isolat Fusarium spp. Ga-5. Ga-18. diperoleh adanya hubungan yang erat antara kecepatan tumbuh hifa dengan kehadiran aerial miselium. Gambar 3. Semua isolat yang diuji dapat diklasifikasikan menjadi tiga kelompok. Cendawan yang tidak berpigmen umumnya berwarna hialin. Ga-3. dan Ga-21) (Tabel 2. Ga-19. kecepatan tumbuh merupakan karakter yang khas pada setiap isolat. Ga-17. Ga-3. Fusarium spp. Gambar 2.Aspek PRODUKSI oleh warna ungu namun memiliki warna koloni putih sedikit tipis pada aerial miselium yang terletak pada bagian tepi koloni (Gambar 3). bentuk. dan isolat dengan diameter lebih dari 50 mm (isolat Ga-1. berkisar antara 30-69 mm. Ga-5. percabangan konidiofor. misalnya terhadap inangnya. Keragaman yang terdapat pada warna koloni berhubungan dengan pigmen yang dikandung oleh dinding sel hifa. dan Ga-21. Ga-16. Ga-18. yaitu diameter kurang dari 40 mm (isolat Ga-6). Ga-11. Diameter Koloni Diameter koloni Fusarium spp. Ga-13. Ga-6. Ga-10. maka isolat perlu diuji. memiliki keragaman pada karakter morfologi juga tampak adanya keragaman karakter mikrokonidia dan makrokonidia dari isolat yang diuji. Ga-8. Ga-15. Selain itu. Ga-7. 2. Hasil pengamatan menunjukkan bahwa keragaman terlihat pada karakter jumlah septa makrokonidia. dan kelimpahan mikrokonidia. dan Ga-20). Kecepatan tumbuh yang tinggi dapat berhubungan juga dengan kemampuan virulensi. Ga10. Pada beberapa isolat Fusarium. Ga-20. dari ke-10 isolat tersebut terdapat perbedaan pada 84 . Untuk mengetahui kemampuan virulensi. isolat dengan diameter antara 40-50 mm (isolat Ga-2. Ga-4. Ga-9. dan Gambar 4). Ga-8. Jumlah septa makrokonidia dominan berjumlah 2-3 yang dimiliki oleh isolat Ga-1. berhubungan dengan kecepatan tumbuh hifa. c.

Ga-5.. Ga-3. Ga-14. Ga-11. Ga-8. Ga-2. 85 . Ga-7. GA-7. Ga-15. dan Ga16) umur tujuh hari pada medium PDA.. (isolat Ga-1. Sedangkan isolat Ga-1.. (isolat Ga-9. Gambar 2.. Ga-10. Ga-6. Ga-12. Ga-3. Ga-4. Keragaman morfologi Fusarium spp. dkk) percabangan konidifornya. dan Ga-10 memiliki konidiofor sederhana (Tabel 3).(Erdy Santoso.Teknologi Induksi Pohon . Ga-6. Isolat dengan konidiofor bercabang adalah Ga-18 dan Ga-21. dan Ga-8) umur tujuh hari pada medium PDA Gambar 3. Ga-13. Keragaman morfologi Fusarium spp. Ga-5.

oval Elips.Aspek PRODUKSI Gambar 4. sekat 3 Elips Elips Elips Elips. Keragaman morfologi Fusarium spp. Ga-20. oval Elips Elips. Keragaman karakter makrokonidia Fusarium spp. namun dari ke-3 isolat tersebut dapat dibedakan berdasarkan 86 . oval Elips Elips. lonjong Elips. yang berasal dari berbagai daerah Karakter histologi No Kode Makrokonidia Jumlah septa 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 3 4 3 4-7 2 3 2 2 5 3 4 5 4 7 4 7 5 3 4 2 3 Konidiofor Simpel Bercabang Simpel Simpel Simpel Simpel Simpel Simpel Simpel Simpel Bercabang Simpel Simpel Simpel Bercabang Simpel Bercabang Bercabang Simpel Bercabang Bercabang Mikrokonidia Kelimpahan Banyak Banyak Banyak Banyak Sedikit Sedikit Sedikit Sedikit Sedikit Banyak Banyak Banyak Sedikit Sedikit Banyak Sedikit Sedikit Banyak Banyak Sedikit Banyak Bentuk Elips Elips. dan Ga-15 memiliki jumlah septa empat. sekat Elips. dan Ga-21) umur tujuh hari pada medium PDA Tabel 3. Ga-3. oval Elips. Ga-19. sekat Elips Elips Elips Elips Elips Elips. oval Elips Isolat Ga-2. (isolat Ga-17. Ga-18.

Ga-6. Sedangkan F. Isolat Ga-13 memiliki bentuk konidifor simpel dan Ga-15 bentuk konidifornya bercabang. solani dengan mikrokonidianya berbentuk elips. Ga-3. Isolat Ga-14 berbeda dengan isolat Ga-16 karena pada isolat Ga-16 mikrokonidianya bersekat (Gambar 7). Di antara ketiga spesies tersebut F.Teknologi Induksi Pohon . tricinctum berdasarkan karakter bentuk makrokonidianya. sambunicum (isolat Ga-1). Spesies tersebut merupakan F. F. Genus Fusarium memiliki kemiripan dengan Cylindrocarpon pada karakter morfologi. solani keberadaannya paling dominan sehingga perlu mendapat perhatian khusus.. tricinctum (isolat Ga-2. dan Ga9).. bentuk mikrokonidianya elips dan oval. dan F. Ga-8. Fusarium solani berbeda dengan F. solani (isolat Ga-4. Cowan (1999) menerangkan bahwa tanaman memiliki kemampuan yang tidak terbatas dalam mensintesis substansi 87 .. dan Ga-16 merupakan isolat yang memiliki jumlah septa makrokonidia relatif banyak.. Mikrokonidia pada berbagai Fusarium memiliki bentuk yang khas. beberapa isolat telah teridentifikasi sampai pada tingkat spesies. yaitu berbentuk bulan sabit (fusoid) sehingga memungkinkan dapat dengan mudah dibedakan dengan genus lain yang memiliki ciri mirip Fusarium. namun kedua isolat tersebut berbeda pada tipe makrokonidianya. solani dibedakan dari F. dkk) percabangan konidifor dan bentuk mikrokonidianya. Isolat Ga-12 memiliki ukuran relatif lebih besar pada makrokonidianya apabila dibandingkan dengan Ga-14 (Gambar 5 dan Gambar 6).(Erdy Santoso. Ga-7. yaitu isolat Ga-12 dan Ga-14 memiliki kemiripan pada bentuk konidiofor dan bentuk mikrokonidia. (2006) melaporkan bahwa keragaman antar Fusarium spp. namun Booth (1971) membedakan Cylindrocarpon karena karakter pangkal konidianya yang relatif tumpul dan tidak memiliki hock/foot cell yang jelas seperti pada Fusarium spp. antara lain berdasarkan karakter kelimpahan dan bentuk mikrokonidianya. Isolat Ga-2 memiliki konidifor bercabang. Ga-14. juga bentuk mikrokonidianya relatif lebih besar untuk F. dan Ga-5).. Isolat Ga-12. yaitu berkisar 5-7 (Tabel 3). Luciasih et al. dari 21 isolat Fusarium spp. Dua dari tiga isolat tersebut. sambunicum.

Pada umumnya senyawa-senyawa tersebut merupakan metabolit sekunder yang seringkali berperan dalam mekanisme pertahanan tanaman terhadap serangan mikroorganisme. Ga-17. Ga-20. Ga8. Ga-9. Ga12. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. (isolat Ga-4. dan Ga-18) dengan perbesaran 40x 88 . Ga-14. Ga-5. Ga. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. Ga-11. (isolat Ga-1. GA-10.Aspek PRODUKSI aromatis yang kebanyakan merupakan senyawa fenol atau turunan oksigen-tersubstitusinya. dan Ga-21) dengan perbesaran 40x Gambar 6. serangga ataupun herbivora. Gambar 5.2. GA-7. Ga-15.

Fitoantisipin adalah senyawa aktif anti mikrobial yang telah terdapat pada tanaman. (isolat Ga-3. dkk) Gambar 7. Metabolit sekunder dalam sistem pertahanan tanaman. Terdapat jalur biosintesis yang terpicu pada level gen setelah pelukaan atau infeksi dan ada yang terjadi pada level senyawa.. 2004).. dan triterpena). kadangkala terpicu pengaktifannya saat pelukaan. 2004). di mana senyawa yang telah ada secara enzimatis dirubah menjadi senyawa aktif ketika pelukaan.Teknologi Induksi Pohon . Vidhyasekaran. ekspresi dari jalur biosintesis yang terlibat akan berbeda.. Berdasarkan berbagai fungsi tersebut. 2000. dan Ga-19) dengan per-besaran 40x Gaharu merupakan senyawa fitoaleksin dari pohon gaharu sebagai mekanisme pertahanannya terhadap infeksi patogen. memainkan peranan penting (Verpoorte et al. sedangkan pada tanaman lain biosintesis sesquiterpenoid 89 . Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. Ga-16. Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. Ga-6.. atraktan serangga. Biosintesis keduanya terpicu pada level gen (Verpoorte et al. 2000). fitoaleksin sebagai agen anti mikrobial (sesqui-. Sebagai contoh. dalam Isnaini.(Erdy Santoso. biosintesis sesquiterpena tertentu pada solanaceae terpicu oleh infeksi mikroba. Pohon penghasil gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. 2000). di-.. Ga-13. rangsangan fisiologi maupun keadaan cekaman (Goodman et al. Fitoaleksin adalah senyawa aktif anti mikrobial yang diproduksi secara de novo setelah pelukaan atau infeksi. baik fitoantisipin maupun fitoaleksin. di antaranya sebagai minyak esensial (monoterpenoid). Metabolit sekunder tanaman yang diturunkan dari terpenoid memiliki berbagai fungsi dalam tanaman.. Kayu beresin ini merupakan metabolit sekunder yang dibentuk tanaman sebagai respon pertahanan.

Senyawa kimia yang dimiliki pohon merupakan salah satu upaya pertahanan pohon terhadap mikroorganisme penyebab penyakit. akar. Daya tahan pohon akan menentukan pemenang antara pohon dengan penyakit yang disebabkan mikro-organisme tersebut. rasa. antar jaringan (konsentrasi tertinggi berada di kulit. senyawa pertahanan tipe fitoaleksin. Gaharu sendiri telah diidentifikasi sebagai sesquiterpenoid. Rowell (1984) menyatakan bahwa di antara fungsi zat ekstratif adalah sebagai bagian dari mekanisme sistem pertahanan pohon terhadap serangan mikroorganisme. 2000). dan antar musim. Kerentanan pohon dalam menghadapi infeksi jamur akan berkaitan dengan 90 . Konsentrasi metabolit sekunder bervariasi antar spesies. kayu teras. Zat ekstratif pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. 2007). Analisis Infeksi Batang Dalam kondisi menghadapi infeksi oleh jamur. Jenis-jenis tropis dan sub-tropis umumnya mengandung jumlah ekstratif yang lebih banyak dibanding jenis-jenis di daerah temperet (Forestry Comission GIFNFC. memberi bau. Dalam hal pembentukan gaharu tentunya diharapkan penyakitlah yang akan menang. Zat ekstratif yang terdiri dari bermacam-macam bahan ini memilki fungsi yang penting dalam daya tahan terhadap serangan jamur dan serangga. Metabolit sekunder tanaman efektif dalam melawan hama dan agen penyakit. pangkal percabangan. anthraquinone biasa ditemukan di seluruh bagian tanaman (Verpoorte. pohon penghasil gaharu akan memberi respon untuk mempertahankan dan memulihkan dirinya. B. antar pohon dalam spesies yang sama. Metabolit sekunder pada kayu dapat disebut sebagai zat ekstratif. misalnya pada Morinda citrifolia. sehingga dihasilkan produk gaharu yang diinginkan. 2007).Aspek PRODUKSI merupakan ekspresi pembentukan yang umum. dan warna pada kayu. 1987). dan jaringan luka). antar spesies. karena analog dengan komponen vital tertentu dari sistem sinyal seluler atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Comission GIFNFC.

Pada umur inokulasi 2 bulan isolat Fusarium spp. 91 . isolat asal Gorontalo menyebabkan infeksi yang paling besar pada batang pohon penghasil gaharu. Padang. dan yang terendah adalah infeksi yang terbentuk oleh isolat asal Jambi. diikuti oleh isolat campuran (Tabel 4). secara statistik asal isolat tidak 1. yaitu 4.193a inokulasi 2 bulan.Teknologi Induksi Pohon . Berbeda dengan kondisi pada Tabel 4. asal Gorontalo memperlihatkan nilai infeksi yang paling besar. Dari hasil analisis sidik ragam. microcarpa.. Namun sama Padang 2. microcarpa pada umur inokulasi 2 bulan dan 6 bulan.. Hasil uji lanjut Duncan memastikan bahwa pada dua bulan sejak inokulasi. pada umur inokulasi 6 umur inokulasi bulan. dkk) gaharu yang terbentuk.13 cm diikuti oleh isolat campuran. Kalbar.(Erdy Santoso.223a terhadap infeksi yang terbentuk pada Kalimantan Barat batang A. dapat direfleksikan masing-masing oleh besar infeksi dan komponen kimianya. Pada Gambar 8 terlihat panjang infeksi yang terjadi pada batang pohon A.133a terlihat bahwa infeksi tertinggi masih Keterangan: Nilai yang diikuti oleh huruf yang disebabkan oleh isolat asal Gorontalo sama tidak berbeda nya-ta pada 0. terlihat bahwa asal isolat berpengaruh nyata terhadap panjang infeksi yang terjadi pada batang A.05 dan campuran. isolat campuran menyebabkan infeksi yang lebih tinggi dibandingkan Asal isolat Rataan isolat yang lain (Gambar 8). microcarpa. dari Gambar 8 Gorontalo 4.857a lagi memberikan pengaruh nyata Jambi 2. Pada saat (Isolate origin) (Mean value) ini.297a halnya dengan kondisi pada umur Campuran 3. Uji lanjut Duncan untuk infeksi 2 bulan umur 2 bulan...

186 pada 5%). microcarpa 92 . Panjang infeksi batang A. microcarpa Gambar sejak dua bulan inokulasi hingga bulan keenam. Gambar 9 menunjukkan perubahan panjang infeksi yang Gambar 9. Namun sama halnya dengan kondisi pada umur inokulasi 2 bulan. huruf yang sama tidak berbeda nya- Gambar 8. mita pada 0. Panjang infeksi batang A. Namun begitu. Meskipun terjadi 9 menunjukkan perubahan panjang infeksi yang terjadi sejak masihbulan inokulasi hingga bulan keenam. Gorontalo terlihat tidak mengalami bulan keenam oleh isolat asal sedangkan infeksi oleh keempat asal perkembangan. microcarpa Gambar 8. Meskipun masih dua merupakan isolat yang menyebabkan infeksi terbesar. asal daerah isolat tidak memberikan pengaruh nyata pada laju infeksi yang terjadi (nilai signifikansi 0. tetapi infeksi bulan keenam oleh isolat asal Gorontalo terlihat infeksi merupakan isolat yang menyebabkan infeksi terbesar.05 crocarpa. secara statistik untuk bulan keenam inokulasi. dari Gambar 8 Aspek PRODUKSI terlihat bahwa infeksi tertinggi masih disebabkan oleh isolat asal Gorontalo dan campuran.bentuk pada batang A. tetapitidak mengalami perkembangan. sedangkan infeksi oleh keempat asal isolat yang 71 | lain menunjukkan peningkatan yang beragam. Laju infeksi pada batang A.

(Erdy Santoso. Hampir semua isolat memiliki aerial miselium. Secara morfologi isolat Fusarium spp. microcarpa ini dapat dikatakan bahwa isolat asal Gorontalo menyebabkan infeksi yang terbesar. KESIMPULAN 1.. yang berarti isolat ini menghasilkan kuantitas gaharu yang paling besar. Meskipun tetap menyebabkan infeksi yang besar.. asal Gorontalo menyebabkan infeksi yang paling besar. namun ada kemungkinan hal ini masih merupakan pengaruh dari isolat asal Gorontalo tersebut. Ga-11. Secara histologi isolat Fusarium spp. memiliki karakter makrokonidia bersepta 3-4 dan makrokonidia didominasi oleh bentuk elips. 2. dan Ga-17 merupakan isolat yang memiliki kecepatan tumbuh tinggi apabila dibandingkan dengan isolat Fusarium yang lain. 4. dan ungu. Hal ini diduga ada kaitannya dengan pertahanan masing-masing pohon contoh. jadi sebaiknya isolat ini digunakan untuk inokulasi 93 . Meskipun isolat campuran menunjukkan panjang infeksi yang lebih tinggi saat 6 bulan setelah inokulasi. dkk) Perkembangan infeksi yang terjadi hingga 6 bulan setelah inokulasi menunjukkan asal daerah isolat tidak lagi memberikan pengaruh yang nyata. pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masing sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk.. didominasi warna putih. kuning. Hasil inokulasi Fusarium spp. kekonsistenan perkembangan infeksi sebaiknya diteliti lebih lanjut dengan mengikuti perkembangan laju infeksi oleh isolat asal Gorontalo ini hingga kurun waktu tertentu. Uji perbedaan kecepatan tumbuh menunjukkan bahwa isolat Ga9. Isolat Fusarium spp. Dari perkembangan infeksi pada pohon A.. namun terdapat warna koloni merah muda. 3.Teknologi Induksi Pohon . meskipun yang terbesar masih disebabkan oleh isolat campuran dan isolat asal Gorontalo.

120-127. Rm. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. Tumbuhan Berguna Indonesia. DAFTAR PUSTAKA Adelina.. Disertasi). (1971). Teresia. W. Heartwood and Tree Exudates. Clinical microbiology Review. Keanekaragaman Jenis Jamur yang Potensial dalam Pembentukan Gaharu dari Batang Aquilaria spp. [2 Februari 2007]. http: // treechemicals. Michael (2000). gov. 2004.12 (4) : 564-582. Program Pascasarjana Institut Pertanian Bogor. and S. A. Badan Litbang Kehutanan. 2004. Jilid III. 1984. M. Forest and Landscape Denmark. Barden. Y. 2006. (England : Commonwealth Mycological Institute). M. Irawati. dan E. K. 1987. microcarpa jika diinginkan hasil gaharu dalam jumlah besar. Wahyuno. 267-269. Forestry Commission GIFNFC. Isnaini. Magelang. C. 1999.uk/review/extraction. pp. N. Pusat Litbang Hutan dan Konservasi Alam. The Chemistry of Solid Wood. csl.. Santoso. Berlin : SpringerVerlag. Rowell. Chemicals from Trees. pp. Jakarta. Nooranie. Cowan.SL. Hills.dk. Booth. Bogor. (1987). The Genus Cylondrocarpon. Bogor Luciasih. Hua SST. Heyne. pp.A. 6-7. A.cfm. Applied Microbiology 32 : 278-281. TRAFFIC Network. pp.kvl. Seed Leaflet : Aquilaria malaccensis Lamk.Aspek PRODUKSI pada A. Jurnal Penelitian Hutan dan Konservasi Alam III(5):555-564. www. Washington : American Chemical Society. E. Induksi Produksi Gubal Gaharu Melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik. 2001. Karakterisasi Mikoriza Rhizocstonia dari Perakaran Tanaman Vanili Sehat. 2004. [14 Juli 2007]. A. 2. Tesis. Plant Products as Antimicrobial Agents. D. Heart of The Matter Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. 2007. 94 .

. R van der Heijden. Boca Raton. dkk) Soehartono. Balai Penelitian Kehutanan Kupang. C. Metabolic Engineering of Plant Secondary Metabolism. R. Laju Pertumbuhan Tegakan Gaharu (Aquilaria malaccensis) di Riau yang Ditanam dengan Intensitas Budidaya Tinggi dan Manual. Sumadiwangsa. Pusat Penelitian Hasil Hutan. Florida. I K. P. J. Kain.. 95 . Mardiastuti. (Editors). CRC Press Inc. p : 1-30. In Verpoorte. Kluwer Academic Publisher. R. P. Bogor. A. E. 2000. R. and Alfermann. 2002. Teknik Budidaya Gaharu.. 2001.. London. Boston. W. Surata. Miniyar. Widnyana... CITES and Implementation in Indonesia. Plant Secondary Metabolism. dan Harbagung. Physiology of Disease Resistant in Plant. Verpoorte.. P.Teknologi Induksi Pohon . Info Hasil Hutan 6 (1) : 1-16. R. A. Vidhyasekaran. Metabolic Engineering of Plant Secondary Metabolism. and Alfermann. Mundhada. Nagao Natural Environment Foundation. Memelink. Analgesik and AntiImflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. W. S. 2000. R. Dordrecht. Dordrecht. 2000. S. I M. T. Pharmacology-online 1 : 288-298. 2007. Verpoorte. Aisuli 14. Trupti. K. Bhutada.. In : Verpoorte. Somani. 2000. General Strategies.(Erdy Santoso. p : 31-50. Kluwer Academic Publisher. Jakarta. Boston. A. Nandakumar. Gore. London. (Editors). K. Y.

96 .

(1999) menyatakan bahwa beberapa isolat Acremonium sp. filaria) dan A. Institut Pertanian Bogor Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Esti Wulandari Departemen Biologi. Rahayu et al. Magnoliopsida. Proses pembentukan gubal pada pohon gaharu. bulbigenium. FMIPA. Thymelaeaceae). malaccensis. microcarpa) umur 97 . DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu Departemen Biologi. Selain itu. A. F. A. Institut Pertanian Bogor LATAR BALAKANG Gaharu merupakan salah satu komoditi hasil hutan bukan kayu (HHBK) yang dihasilkan oleh beberapa spesies pohon gaharu (Aquilaria sp. DAN Fusarium sp. FMIPA. A. Menurut Nobuchi dan Siripatanadilok (1991). dan F. asal gubal gaharu pada Gyrinops verstegii (sin. lateritium telah berhasil diisolasi oleh Santoso (1996).4 EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp. hingga saat ini masih terus diteliti. Beberapa spesies Fusarium seperti F. gubal gaharu diduga dapat terbentuk melalui infeksi cendawan. oxyporum. crassna.. malaccensis mampu menginduksi gejala pembentukan gubal pada pohon gaharu (A.

oxysporum. cucumerinum dapat membangkitkan SAR tanaman semangka terhadap infeksi Colletotrichum lagenarium. Sebagai contoh. pada beberapa kasus infeksi cendawan pada tumbuhan. Rahayu et al. (1995) juga menemukan proses SAR dari infeksi Pseudomonas lachrymans pada timun terhadap F.sp. Bahan Bahan dan alat yang digunakan adalah pohon A. perubahan warna kayu dan adanya senyawa terpenoid dijadikan indikator efektivitas dan interaksi antara inokulan dalam pembentukan gubal. dan Fusarium sp. (2007) dan Rahayu (2008) juga menyatakan bahwa Acremonium sp. oxysporum f. Oleh sebab itu penelitian ini bertujuan untuk mengetahui efektivitas dan interaksi antara Acremonium sp. Padahal menurut Sticher et al. Infeksi ganda Fusarium sp. biakan Acremonium sp. Oleh sebab itu. BAHAN DAN METODE A. microcarpa). Banten. terhadap Acremonium sp. infeksi cendawan yang pertama dapat membangkitkan resistensi yang disebut Systemic Acquired Resistance (SAR) terhadap infeksi cendawan kedua. seringkali diperoleh dari satu gejala gubal. Caruso dan Kuc (1977) menyatakan bahwa infeksi F. melalui pemanfaatan kedua cendawan tersebut sebagai penginduksi ganda memerlukan informasi awal mengenai kemungkinan terbentuknya SAR yang dibangkitkan oleh Fusarium sp. terhadap Fusarium sp. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam). dan sebaliknya. terdeteksi senyawa oleoresin (Prema dan Bhattacharyya. merangsang perubahan warna kayu dan pembentukan senyawa terpenoid. dan Fusarium sp. hasil induksi cendawan. dan Acremonium sp. Padang (koleksi Laboratorium Mikrobiologi Hutan.Aspek PRODUKSI 2 tahun. yang berasal dari Aquilaria sp.525 (koleksi IPBCC. IPBCC 07. dalam pembentukan gubal pada pohon gaharu (A. Pada gubal gaharu. larutan gula 2%. Acremonium sp. Mekanisme infeksi kedua cendawan ini pada satu lokasi infeksi belum dipelajari. microcarpa umur 13 tahun di Hutan Penelitian Carita. Departemen Biologi FMIPA IPB). 1962). 98 . (1997). Liu et al.

serta batang dengan perlakuan tunggal (diberi Acremonium sp. dan diinkubasi selama 3 minggu menggunakan inkubator bergoyang. Fusarium sp. dan alat pencetaknya. saja (AA) atau Fusarium sp. Batang di sekitar lubang dikupas kulitnya. pohon dilubangi lagi pada jarak 15 cm secara vertikal dari deretan lubang yang pertama. Perubahan warna batang dan pembentukan wangi merupakan indikator pembentukan gubal.alkohol. Jarak antar set perlakuan dalam 1 pohon ± 30 cm. Acremonium sp. kemudian zona perubahan warna batang diukur secara horizontal 99 . aquades. Ke dalam lubang pada deretan kedua ini dimasukkan inokulan 2. kemudian dibentuk berupa pelet dengan ukuran 4 mm x 40 mm. dan Fusarium sp. ditumbuhkan pada media serbuk gergaji selama 2 minggu. dan Fusarium sp. diremajakan pada media agaragar kentang dekstrosa (Difco) dan diinkubasi pada suhu ruang selama 7 hari. batang yang dilubangi dan diberi larutan gula (G). yang dilubangi saja (B). Pertama-tama. sederetan lubang dibuat di sekeliling batang utama (mulai ketinggian 0. bor. Uji Efektivitas dan Interaksi Acremonium sp. dengan kedalaman lubang maksimal 1/3 diameter batang. Ke dalam deretan lubang ini dimasukkan inokulan 1 sampai lubang dipenuhi oleh inokulan.5-1 m di atas permukaan tanah) dengan mata bor berdiameter 4 mm. lubang diberi larutan gula 2% sebelum pemberian inokulan. ditumbuhkan pada 300 ml media cair. Batang yang tidak diberi perlakuan (K). Pembuatan Inokulan Acremonium sp. 2. Seminggu kemudian. Jarak antar lubang dalam deretan sekitar 5 cm. saja (FF)) digunakan sebagai pembanding. Metode 1. Efektivitas dan interaksi diukur melalui perkembangan pembentukan gejala gubal di sekitar daerah induksi. B. Pengamatan dilakukan setiap 1 bulan selama 4 bulan. Biakan ini akan digunakan sebagai sumber inokulum untuk pembuatan inokulan. Untuk inokulan berupa pelet. meteran. bahan pelet. mata bor berukuran 4 mm. Pasangan inokulan (FA atau AF) adalah set perlakuan.

kemudian diamati wanginya secara organoleptik ketika kayu dibakar. Sebanyak 5 ml etanol absolut ditambahkan ke dalam larutan. kemudian disaring pada cawan petri steril dan diuapkan sampai kering (sampai terbentuk endapan berwarna kuning). 3. Setelah diamati tingkat wanginya. Bila terdapat pengaruh nyata dari perlakuan yang diamati maka setiap taraf perlakuan 100 . 1987).1 menggunakan Rancangan Acak Lengkap (RAL) satu faktor dengan waktu dan uji F pada α = 5%. Tingkat perubahan warna kayu ditetapkan berdasarkan sistem skor (0 = putih. Wangi ditetapkan berdasarkan sistem skor (0 = tidak wangi. 3 = coklat kehitaman). sampelsampel dari kayu yang mengalami perubahan warna dipisahkan dari bagian yang sehat. lebar zona perubahan warna. Deteksi Senyawa Terpenoid Senyawa terpenoid dideteksi dengan metode LiebermanBurchard (Harborne. 1987). Sebanyak 0. Tingkat perubahan warna kayu dinyatakan dalam rataan dari hasil pengamatan 3 responden. 2 = wangi). kemudian absorbansinya diukur dengan spektrofotometer pada λ 268 nm. Tingkat wangi dinyatakan dalam rataan skor dari 3 responden. Wangi dinyatakan dalam tingkat wangi dan persentase titik induksi dengan kategori agak wangi dan sangat wangi. Pada endapan ditambahkan 1 ml dietil eter pekat. Perubahan warna menjadi merah atau ungu menunjukkan adanya senyawa triterpenoid (Harbone. Kayu di sekitar titik inokulasi dipahat. tingkat perubahan warna. Perubahan warna diamati pada 10 titik untuk setiap pohon. dan tingkat wangi) dianalisis dengan SAS versi 9. dihomogenisasi lalu dipindahkan ke tabung reaksi steril. 4. 1 = putih kecoklatan. Analisis Data Data hasil pengamatan (panjang.4 g kayu yang berubah warna direndam dalam 5 ml etanol absolut panas. ditambahkan 3 tetes asam asetat anhidrat dan 1 tetes H2SO4 pekat. 2 = coklat. 1 = agak wangi. Daerah yang menunjukkan perubahan warna kayu dari putih menjadi coklat-kehitaman diambil dengan dipahat dan dibawa ke laboratorium untuk pengamatan selanjutnya.Aspek PRODUKSI dan vertikal.

70a 0.62ab 0.45c 1.59ab 101 .82a 0.87a 0. Gejala pembentukan gubal akibat inokulan ganda juga cenderung tidak berbeda nyata dari inokulan tunggalnya.00 6. Sedangkan pada parameter lainnya..37 31.94a 0.14a 3. Berdasarkan persentase titik induksi pada kategori wangi.07 39. HASIL A. dkk.30a Lebar (cm) 0.Efektivitas dan Interaksi . Di antara inokulan ganda..75b 2. Tabel 1. inokulan ganda lebih efektif..63ab 0.24 4.18a Wangi (skor) Titik induksi agak wangi (%) 34.54ab 3. Pemberian gula menyebabkan gejala pembentukan gubal gaharu menjadi tertekan. Efektivitas inokulan tunggal maupun ganda Acremonium dan Fusarium relatif lebih tinggi dalam merangsang pembentukan gejala gubal gaharu dibandingkan dengan metode induksi lainnya. Efektivitas Inokulan dalam Menginduksi Gejala Pembentukan Gubal Gaharu Secara umum semua perlakuan menyebabkan perubahan warna kayu dan merangsang munculnya perubahan aroma kayu (Tabel 1). Sebagai inokulan tunggal A dan F memiliki efektivitas yang relatif sama. AF justru lebih baik.39 0.55 20.) dibandingkan dengan menggunakan uji lanjut Duncan pada taraf 5%.12 Titik induksi wangi (%) 1. Pembentukan gejala gubal gaharu hasil inokulasi cendawan tunggal dan ganda Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Inokulan tunggal Inokulan ganda AA FF AF FA 2.20a 3..83a Warna (skor) 1.16 0.(Gayu Rahayu. AF lebih efektif dalam menginduksi pembentukan wangi daripada FA dan inokulan tunggal.90b 1.

Aspek PRODUKSI

Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Kontrol positif Kontrol negatif
*

Lebar (cm) 0,55b 0,73ab 0,00c

Warna (skor) 1,02d 1,16d 0,00e

Wangi (skor)

Titik induksi agak wangi (%) 10,41 11,11 0,00

Titik induksi wangi (%) 0,00 0,00 0,00

G B K

1,86b 2,87ab 0,00c

0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Kayu mengalami perubahan warna dari putih menjadi coklat atau coklat kehitaman (Gambar 1). Pemberian inokulan tidak berpengaruh pada panjang dan lebar zona perubahan warna. Namun panjang zona perubahan warna tertinggi terjadi berturut-turut pada kayu yang diberi perlakuan ganda FA dan AF. Sedangkan tingkat perubahan warna dipengaruhi oleh inokulan. Tingkat perubahan warna tertinggi pada FA dan berbeda nyata dari perlakuan lainnya.

Pemberian inokulan juga tidak berpengaruh nyata terhadap pembentukan wangi. Berbeda dengan perubahan warna kayu, tingkat wangi tertinggi terjadi pada kayu yang diberi inokulan ganda AF. Secara rataan nilai tingkat wangi yang terbentuk dari hasil perlakuan inokulan termasuk dalam kategori tidak wangi, Meskipun demikian, pemberian inokulan meningkatkan persentase titik induksi yang wangi. Bahkan inokulan tunggal AA dan inokulan ganda menghasilkan titik induksi pada kategori wangi (Tabel 1).

a

b

c

d

Gambar 1. Perubahan warna kayu dengan tingkat kegelapan yang berbeda dari (a) intensitas terendah sampai (d) intensitas tertinggi

102

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Periode induksi berpengaruh pada semua parameter pembentukan gubal kecuali panjang zona perubahan warna (Tabel 2). Secara umum, nilai parameter pembentukan gubal tertinggi terjadi pada bulan ke-2, kecuali tingkat perubahan warna. Pada bulan ke-2 induksi, intensitas warna cenderung naik, tapi intensitas warna kayu pada bulan ke-4 relatif sama dengan bulan ke-3.
Tabel 2. Pengaruh periode induksi pada gejala pembentukan gubal gaharu
Rataan* Perubahan warna kayu Bulan Panjang (cm) 1 2 3 4
*

Lebar (cm) 0,68a 0,71a 0,65b 0,65b

Tingkat (skor) 0,83c 1,24b 1,67a 1,65a

Wangi (skor)

Titik induksi agak wangi (%) 8,43 39,47 17,45 18,45

Titik induksi wangi (%) 0,00 0,00 0,00 6,74

2,46ab 2,58a 2,32ab 2,26b

0,32c 0,64a 0,51b 0,36c

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

B. Interaksi Inokulan 1 dan Inokulan 2
Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2 (Tabel 3). Inokulasi F sebelum inokulasi A tidak mempengaruhi pembentukan gejala gubal pada titik A termasuk pembentukan wangi. Kehadiran F justru cenderung meningkatkan respon perubahan warna kayu akibat inokulasi A. Demikian pula inokulasi A sebelum F tidak mempengaruhi pembentukan gejala gubal pada titik F, kecuali warna pada F menjadi lebih gelap dan persentase titik induksi yang wangi relatif lebih tinggi dibandingkan dengan inokulan tunggalnya. Inokulan ganda AF dan FA menghasilkan masing-masing 8,33% titik induksi pada kategori wangi. Infeksi sekunder juga tidak secara konsisten mempengaruhi infeksi primer (Tabel 4). Inokulasi F sebelum inokulasi A cenderung tidak mempengaruhi pembentukan gejala gubal termasuk tingkat

103

Aspek PRODUKSI

wangi, kecuali pada perubahan warna kayu. Intensitas warna pada titik induksi F lebih baik dibandingkan dengan perlakuan tunggalnya. Infeksi kedua oleh F juga cenderung tidak mempengaruhi gejala pembentukan gubal dan tingkat wangi. Infeksi sekunder oleh cendawan yang sama dengan cendawan tidak berpengaruh pada pembentukan gejala gubal (Tabel 5). Meskipun demikian, secara umum nilai parameter gejala gubal pada titik infeksi sekunder lebih rendah daripada pada titik infeksi primernya. Inokulan A dan F memiliki potensi yang relatif sama dalam merangsang pembentukan wangi.
Tabel 3. Pengaruh inokulan 1 terhadap inokulan 2 dalam gejala pembentukan gubal gaharu
Rataan* Perla-kuan Perubahan warna kayu Panjang (cm) FAa AAa AFf FFf GGg BBb KKk
*

Lebar (cm) 0,71bcd 0,66bcd 0,83abcd 0,75abcd 0,53d 0,65cd 0,00e

Warna (skor) 2,15ab 1,82bc 1,57cd 1,36de 1,02e 1,13e 0,00f

Wangi (skor) 0,60ab 0,63ab 0,70a 0,62ab 0,38c 0,47bc 0,00d

Titik induksi agak wangi (%) 26,37 36,11 40,27 27,78 0,00 0,00 0,00

Titik induksi wangi (%) 8,33 0,00 8,33 0,00 0,00 0,00 0,00

2,73abc 1,96bc 2,52abc 2,61abc 1,75c 2,40abc 0,00e

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 4. Pengaruh infeksi sekunder dengan cendawan yang berbeda dari cendawan penginfeksi primer
Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,68ab 3,87a Lebar (cm) 0,99ab 0,95abc Warna (skor) 1,53cd 2,22a Wangi (skor) Titik induksi agak wangi (%) 34,37 13,89 Titik induksi wangi (%) 0,00 0,00

FFF FAF

0,62ab 0,50bc

104

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,13abc 3,88a 1,98bc 3,35abc 0,00d Lebar (cm) 0,96abc 1,06a 0,56d 0,80abcd 0,00e Warna (skor) 1,98ab 1,93ab 1,01e 1,20de 0,00f Wangi (skor) Titik induksi agak wangi (%) 32,63 38,86 20,83 13,89 0,00 Titik induksi wangi (%) 2,78 4,15 0,00 0,00 0,00

AAA AFA GGG BBB KKK
*

0,63ab 0,70a 0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 5. Pengaruh infeksi sekunder cendawan yang sama dengan cendawan penginfeksi primernya
Rataan* Perlakuan Panjang (cm) 3,13abc 1,96bc 3,68ab 2,61abc Lebar (cm) 0,96abc 0,66bcd 0,99ab 0,75abcd Warna (skor) 1,98ab 1,82bc 1,53cd 1,36de Wangi (skor) 0,63ab 0,63ab 0,62ab 0,61ab Titik induksi agak wangi (%) 32,63 36,11 34,37 27,78 Titik induksi wangi (%) 2,78 0,00 0,00 0,00

AAA AAa FFF FFf
*

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

C. Pembentukan Senyawa Terpenoid
Senyawa terpenoid terdeteksi pada semua perlakuan. Pada perlakuan tunggal FF dan gandanya terbentuk warna merah, yang menunjukkan adanya senyawa triterpenoid. Warna merah pada minyak gaharu dijadikan sebagai pembanding kandungan triterpenoid perlakuan. Pada ekstrak kayu B, G, dan inokulan A terbentuk warna hijau. Warna hijau ini menunjukkan adanya senyawa sterol (Harborne, 1987). Sedangkan pada K tidak terbentuk

105

Nilai absorbasi ekstrak kayu gaharu yang berubah warna Perlakuan K G B AF A AF F FA F FA A AA FF Bulan ke1 0 0.27* 0.20** 0.14** 2 0 0. Tabel 6.12** 0. Hal ini menunjukkan bahwa pada K tidak terdapat senyawa triterpenoid maupun sterol. nilai absorbansi ekstrak terpenoid hasil perlakuan kurang dari nilai absorbansi minyak gaharu (0. Hal ini menunjukkan bahwa inokulan ganda tidak efektif dalam meningkatkan kandungan senyawa terpenoid.45* 0.06* 0. perlakuan tunggal FF terbentuk endapan merah dan memiliki nilai absorbansi yang relatif tinggi. Pada 3 bsi.29* 0. ** Endapan berwarna merah-kecoklatan 106 .06* 3 0 0.34* 0. Hal ini menunjukkan bahwa pemberian inokulan 2 tidak mempengaruhi besarnya nilai absorban inokulan 1.25* 0.22* 0.12** 0.813) sebagai pembandingnya.05* 0. Hal ini menunjukkan kandungan triterpenoid yang relatif tinggi pula (Tabel 6). Secara umum.11* 0.19** 0.40* 0.24* 0.12** 0. secara umum nilai absorban perlakuan inokulan ganda hampir sama dengan inokulan tunggal (Tabel 6). Inokulan AF maupun FA juga tidak mempengaruhi kandungan terpenoid.23** 0.25** 4 0 0. Kandungan senyawa triterpenoid pada zona perubahan warna bervariasi pada setiap perlakuan selama 4 bsi (Tabel 6).21* 0.20** 0.14* 0.12* 0. Selain itu.11** 0.23** 0.06* 0.15* * Endapan berwarna hijau.39* 0. Begitu pula dengan nilai absorban inokulan 1 yang tidak dipengaruhi oleh inokulan 2.20* 0.15* 0.Aspek PRODUKSI warna (bening).23* 0.

inokulasi Acremonium sp. pada pohon kontrol daun-daun tidak mengalami klorosis sampai akhir pengamatan. Sebelumnya.. dkk. Pohon semakin merana ketika diserang ulat. di New Zealand. dan Fusarium sp. Fotosintat sebagai sumber karbon dalam pembentukan metabolit sekunder antimikrob pun terganggu. Secara umum inokulan tunggal mengakibatkan klorosis pada daun-daun di dua cabang dekat lubang induksi. Berkurangnya jumlah daun secara drastis dapat menghambat proses fotosintesis. Penurunan kebugaran ditunjukkan oleh adanya daundaun yang mengalami klorosis pada cabang pertama dan kedua dari daerah lubang induksi dan kemudian daun-daun ini gugur. jumlah daun yang mengalami klorosis tidak berbeda dengan 1 bsi. Pelukaan.) PEMBAHASAN A. perkembangan gejala pembentukan gubal pun terganggu. karena daun merupakan tempat utama berlangsungnya fotosintesis. Perubahan warna kayu terjadi pada semua perlakuan. tetapi klorosis hampir memenuhi luasan helai daun. Selain itu. karena kemungkinan sumber karbon lebih diutamakan untuk pembentukan tunas baru. berasosiasi dengan gejala perubahan warna kayu dan dicline pada Quercus sp.. menyebabkan perubahan warna kayu dari putih menjadi gelap. adanya inokulan juga menjadi penyebab klorosis. dan Fusarium sp. Caruso and Kuc (1977) menyatakan bahwa Colletotrichum lagenarium menyebabkan klorosis pada daun tanaman semangka dan muskmelon.. Pada 2 bsi. Efektivitas Induksi Pohon-pohon yang diberi perlakuan menurun kebugarannya mulai 1 bsi.Efektivitas dan Interaksi . Ketersediaan hara terganggu karena jalur distribusinya ke daun terhambat akibat pengeboran. (1997) juga menyatakan bahwa perubahan warna kayu menjadi warna coklat (browning) dapat disebabkan oleh serangan patogen (cendawan) 107 . larutan gula. Pada akhirnya. Sedangkan pada pohon yang diberi inokulan ganda klorosis terjadi pada tiga cabang dekat lubang induksi. Tajuk-tajuk pohon menjadi gundul. Walker et al.. Menurut Braithwaite (2007) Acremonium sp. Berbeda dengan daun-daun pada pohon perlakuan.(Gayu Rahayu. Klorosis mungkin berhubungan dengan ketersediaan hara.

Menurut Nobuchi and Siripatanadilok (1991). Hal ini didukung oleh pernyataan Rahayu dan Situmorang (2006). Namun. Periode inkubasi cenderung mempengaruhi semua parameter gejala gubal gaharu. bahwa perubahan warna dari putih menjadi coklat-kehitaman merupakan gejala awal terbentuknya senyawa gaharu. Pada penelitian ini senyawa triterpenoid dan sterol juga terdeteksi. 2007). Senyawa wangi merupakan senyawa yang mudah menguap sehingga kemungkinan besar tergolong senyawa seskuiterpenoid.. Pemberian larutan gula (G) menekan perkembangan gejala pembentukan gubal gaharu. Perubahan warna kayu pada gaharu mungkin dapat mengindikasi adanya senyawa gaharu. Sedangkan pada parameter lainnya. 2007). Namun demikian metabolisme isopentenil pirofosfat sebagai pekursor pembentukan terpenoid (McGarvey and Croteau. Semakin lama periode induksi semakin gelap warna kayu. 1995) mungkin tidak berhenti pada produk seskuiterpenoid tetapi dapat masuk dalam jalur metabolisme selanjutnya. Aroma wangi mulai terdeteksi pada bulan ke-2 dan menurun pada bulan berikutnya. intensitas warna kayu lebih rendah dibandingkan 108 . Berdasarkan persentase titik induksi yang wangi.. nilai tertinggi diperoleh pada bulan ke-2 induksi. inokulan ganda lebih baik dari inokulan tunggal maupun cara induksi lainnya. Hal ini disebabkan karena gula tersebut segera dipergunakan pohon untuk proses penyembuhan daripada dimanfaatkan oleh cendawan. Aroma wangi merupakan bagian dari senyawa gaharu (Rahayu et al. Hal ini menunjukkan bahwa metabolisme terpenoid dapat berlangsung terus dan berakhir pada produk selain seskuiterpenoid ketika dipanen. Aroma wangi dan frekuensi wangi pada pemberian inokulan ganda AF relatif lebih tinggi dibandingkan dengan perlakuan lainnya. perubahan warna kayu menjadi coklat muncul setelah sel-sel kehilangan pati akibat pelukaan. Kemungkinan besar fenomena ini berhubungan dengan kebugaran pohon yang menurun mulai bulan ke-2. Hal ini membuktikan bahwa wangi merupakan respon spesifik terhadap bentuk gangguan (Rahayu et al.Aspek PRODUKSI dan kerusakan fisik.

polonica. Paine et al. Heterobasidion mungkin merangsang pohon membentuk senyawa fitoaleksin yang bersifat anti C. dkk. (1997) menyatakan bahwa serangan cendawan pada pohon Pinus akan merangsang pohon untuk membentuk senyawa terpenoid sebagai pertahanan pohon. Acremonium dan Fusarium dikenal sebagai penyebab busuk batang atau kanker batang pada pohon berkayu. dalam bentuk inokulan tunggal atau inokulan ganda dapat merangsang pohon gaharu membentuk senyawa terpenoid. (1999) menyatakan bahwa pada Norway spruce (P.) dengan pemberian inokulan ganda FA. annosum. abies) terhadap C. polonica adalah penyebab bluestain saja dan tidak menyebabkan busuk batang.(Gayu Rahayu. polonica terbentuk SAR setelah 3 minggu infeksi H.. Hal ini berbeda dari hasil penelitian Krokene et al. dan Fusarium sp. Sedangkan pada perlakuan B. Pada penelitian ini triterpenoid mulai terdeteksi pada 1 bsi. Pembentukan Senyawa Gaharu Acremonium sp. pada A. Krokene et al. dan inokulan tunggal AA terbentuk warna hijau. Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2. Putri (2007) juga menyatakan bahwa pemberian Acremonium sp. Heterobasidion juga menyebabkan busuk batang tetapi C. 109 .. Kemungkinan lain adalah periode inokulasi antara inokulan 1 dan inokulan 2 yang hanya berselang 1 minggu.Efektivitas dan Interaksi . Selain itu penelitian sebelumnya. Sesuai dengan pernyataan Rahayu et al.. crassna terbukti dapat merangsang pembentukan senyawa terpenoid. (1999) yang membuktikan bahwa inokulasi Heterobasidion annosum yang diikuti oleh Ceratocystis polonica menekan pembentukan gejala bluestain pada pohon Norway spruce (Picea abies).. (1999) bahwa terjadinya pembentukan wangi gaharu tidak selalu diikuti oleh perubahan warna kayu. G. Triterpenoid terdeteksi pada pemberian inokulan tunggal FF dan inokulan ganda yang ditunjukkan dengan terbentuknya endapan berwarna merah pada pengujian Lieberman-Burchard. Kemungkinan besar hal ini disebabkan aktivitas patologis yang berbeda. B. Hal ini menunjukkan bahwa aroma wangi yang dihasilkan tidak selalu sebanding dengan intensitas warna kayu.

D. Gagné.A. Dehbi. Phytopathol.W. Phytopathol. Induced Resistance to Phatogenic Fungi in Norway Spruce. J. DAFTAR PUSTAKA Benhamou. M.M. S.L. Pay and C. Metode Fitokimia. 121: 565-569. Beever. Protection of Watermelon and Muskmelon Against Colletotrichum lagenarium by Colletotrichum lagenarium. Hill. N. Inglis. Institut Teknologi Bandung.B. 2007. Soc.. R.R. 67: 1285-1289.A. SIMPULAN Semua pohon yag diinokulasi menurun kebugarannya sejak 1 bulan setelah inokulasi. T..D. Harbone. Dick.L. Braithwaite. F. Padmawinata K dan I Sudiro (penerjemah). Quéré. P. Semua inokulan.E. 1999. A. 90(1): 45-56. Solheim. Ramsfield. 1987.Aspek PRODUKSI Warna hijau ini mengindikasikan yang terbentuk adalah senyawa sterol. Inokulan ganda terutama AF lebih efektif daripada inokulan tunggal dalam merangsang pembentukan wangi... Amer. Waipara. 2000. kecuali inokulan tunggal A merangsang pohon membentuk triterpenoid. Christiansen. New Zealand Plant Protection 60:297-303 Caruso. Plant Physiol. C. Franceschi. 1977. Kuc.F. M. J. H. Krokene. Bandung Terjemahan dari: Phytochem Methods. Harborne (1987) menyatakan bahwa sterol merupakan salah satu senyawa yang tergolong ke dalam senyawa terpenoid. L. Investigation of Oak Tree Decline In Theauckland Region. E. J. BacterialMediated Induced Resistance in Cucumber: Beneficial Effect of the Endophytic Bacterium Serratia plymuthica on the Protection Against Infection by Pythium ultimum. N. V. Berryman. 110 . Induksi dengan inokulan 1 yang hanya berselang 1 minggu dari pemberian inokulan 2 tidak membangkitkan resistensi pohon terhadap inokulan 2.

85:1064-1068. Makalah dipresentasikan dalam 3rd Asian Conference on Crop Protection. Métraux. Interactions Among Scolytid Bark Beetles. L. Acremonium and MethylJasmonate Induce Terpenoid Formation in Agarwood Tree (Aquilaria crassna). Harrington. J. Entomol. J. Tuzun. L.C. Makalah dipresentasikan dalam International Conference on Microbiology and Biotechnology. Hlm 1-3.(Gayu Rahayu. Phytopathol. Y. 1700 Fribourg.J. Perhimpunan Fitopatologi Indonesia. Santoso. 3 route A Gockel. and F. and Host Conifers.. 1995. G. Induction of Systemic Resistance in Cucumber by Plant Growth-Promoting Rhizobacteria: Duration of Protection and Effect of Host Resistance on Protection and Root Colonization. Rahayu. 1997.. Jakarta. Sticher.. G. Annu. 16-18 September 1999. Rahayu. Makalah Diskusi Hasil Penelitian dalam Menunjang Pemanfaatan Hutan yang Lestari. Bull. Purwokerto. Putri dan Juliarni. Terpenoid Metabolism. T.D. Bogor. 22-24 August 2007.. Switzerland. 111 .. Purwokerto. 1991. K. McGarvey. G. Systemic Acquired Resistance. Yogyakarta. Umboh. Croteau. D. hlm 573-581. Raffa. Pusat Litbang Hutan dan Konservasi Alam. Université de Fribourg. Pembentukan Gaharu dengan Cara Inokulasi.L. 2008. S. Institute de Biologie Végétale. Kyoto Univ. 11-12 Maret 1996. Forest 63:226-235. Isnaini. 42:179-206.Efektivitas dan Interaksi .. Potensi Hifomiset dalam Menginduksi Pembentukan Gubal Gaharu. 1996. Prosiding Kongres Nasional XV dan Seminar Perhimpunan Fitopatologi Indonesia. dkk. T. Rev. Siripatanadilok. Plant Cell 7:1015-1026. Mauch-Mani. A. 1999.. 1995.J. M. T. 11-12 November 2008. Paine. Kloepper. Preliminary Observation of Aquilaria crassna Wood Associated with the Formation of Aloeswood.. their Associated Fungi. Nobuchi.. Increasing Fragrance and Terpenoid Production in Aquilaria crassna by Multi-Application of MethylJasmonate Comparing to Single Induction of Acremonium sp.. E.W. 1997. 2007. S.) Liu. Rahayu.F.I. B.P.

112 .

Aspek SILVIKULTUR 113 .

114 .

5 UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto. eksploitasi gaharu alam dilakukan tanpa mengindahkan kelestariannya. khususnya jamur Fusarium sp. Namun gaharu alam dapat mencapai kualitas tertinggi (kelas super) yang harganya bisa mencapai Rp 30 juta/kg. melainkan ditujukan untuk menghasilkan resin gaharu yang terbentuk dari respon tanaman atas infeksi mikroba. Di alam. (Santoso et al. 2007. Phialophora sp. Akibatnya populasi jenis-jenis gaharu menyusut tajam. Trichoderma sp. Pythium sp.. dan Popullaria sp. gaharu harus dihasilkan dari pohon hasil budidaya. sehingga jenis ini dimasukkan dalam Appendix II CITES (Santoso et al. Parman et al. 1996.. Budidaya gaharu memerlukan input iptek agar pertumbuhan dan produksi resin gaharu dapat optimal. Daijo and Oller. Karena potensi harga yang sangat tinggi. Konsekuensinya. dalam perdagangan resmi. bukan dari alam... Dukungan iptek dimaksud 115 . 1987).... 2001. 2007). Sidiyasa dan Suharti. kurang dari 5% gaharu terbentuk dari populasi pohon dan bila terbentuk biasanya kurang dari 10% biomas kayu pada pohon yang terinfeksi. Cylindrocarpon sp. Erdy Santoso.. Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Pengembangan tanaman gaharu umumnya tidak bertujuan untuk menghasilkan kayu.

2. baik pertumbuhan maupun produktivitas resin gaharunya. Namun informasi iptek mengenai teknik perbenihan dan teknik perbanyakan vegetatif gaharu masih sangat terbatas. Perbanyakan bibit pohon penghasil gaharu dapat dilakukan. Biji pohon penghasil gaharu tergolong rekalsitran (Hou. Pembahasan makalah ini difokuskan pada aspek pembibitan atau perbanyakan bibit pohon penghasil gaharu. malacensis asal Sukabumi. dan 8 minggu) dan temperatur penyimpanan (25.Aspek SILVIKULTUR berkaitan dengan aspek pembibitan dan penyuntikan stimulan gaharu.9-6. Penerapan perbanyakan vegetatif dan pemuliaan pohon berpotensi untuk menghasilkan bibit klon gaharu yang memiliki keunggulan. Perlakuan pada uji waktu simpan bibit cabutan adalah tiga waktu simpan (1.1oC dan 4. Bibit cabutan yang digunakan dalam uji waktu simpan cabutan adalah campuran Aquilaria microcarpa dan A. 116 . Perbanyakan Generatif Pengujian pada perbanyakan generatif dilakukan pada benih (biji) dan cabutan (anakan alam). 1980). Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. METODE A. Biji rekalsitran umumnya cepat berkecambah dan tidak dapat disimpan dalam jangka panjang (Roberts and King. dan 3 hari penyimpanan) serta kondisi penyapihan (dalam sungkup dan tanpa sungkup). Perlakuan pada uji penyimpanan benih adalah waktu (0.5oC). Benih pohon penghasil gaharu yang digunakan pada uji penyimpanan dan daya kecambah benih adalah campuran Aquilaria microcarpa dan A. Proyek ITTO PD 425/06 berupaya untuk mengembangkan dan menerapkan iptek pada penanaman pohon penghasil gaharu agar pertumbuhan dan produktivitas resin gaharunya tinggi. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. baik secara generatif maupun vegetatif.4-26. malacensis. 1960). Makalah ini menyajikan hasil penelitian berkaitan dengan aspek perbenihan dan perbanyakan stek gaharu. 6. 4. 2.

Kondisi penyimpanan (kondisi ruang dan dalam re-frigerator) tidak secara nyata mempengaruhi perkecambahan benih (P Anova = 0. Penyiraman 2 kali seminggu. Subiakto dan Sakai. Perbanyakan Generatif Biji gaharu tergolong rekalsitran. Perlakuan pada pengujian pertama menggunakan prosedur rutin... Uji produksi bibit stek gaharu dilakukan dalam tiga tahap. Di Tabel 1. dan 3 kali pada bulan ketiga. Persen kecambah dari hasil uji lain pihak. yaitu media campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 2:1. 2 kali pada bulan kedua. Perbanyakan Vegetatif Teknik perbanyakan vegetatif yang digunakan pada penelitian ini adalah teknik stek pucuk. Pada pengujian kedua perlakuan intensitas penyiraman dikurangi menjadi sekali seminggu dengan media arang sekam.Uji Produksi Bibit . HASIL DAN PEMBAHASAN A. Uji penyimpanan benih dilakukan untuk mengetahui seberapa lama benih gaharu dapat disimpan.(Atok Subiakto. 2007). Hasil uji pengecambahan biji dari dua kondisi penyimpanan disajikan pada Tabel 1 dan Tabel 2. dkk. Penelitian dilakukan pada rumah kaca yang menggunakan sistem pendingin kabut KOFFCO system (Sakai dan Subiakto. 2007.) B. periode penyimpenyimpanan biji panan mempengaruhi persen Periode Kondisi Refrigerator kecam-bah benih (P Anova = < simpan ruang (%) (%) 0. Bahan stek yang digunakan pada pengujian ini adalah A.0001). Secara teknis pengecambahan biji gaharu mudah dilakukan. Pada pengujian ketiga. media tabur dapat menggunakan arang sekam Langsung 2 minggu 4 minggu 6 minggu 8 minggu 82 69 77 56 48 69 69 61 24 117 .0993).. media menggunakan campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 1:1 dan intensitas penyiraman 1 kali pada bulan pertama. sehingga harus secepatnya dikecambahkan. malacensis..

Pada jenis-jenis biji rekalsitran seperti meranti.4 minggu 64 58 annya cenderung lebih besar 6 minggu 37 48 bila bibit disimpan dalam 8 minggu 29 9 jangka waktu yang lebih lama. Persen tumbuh bibit cabutan dari uji penyimpanan dan dapat pula dilakukan dengan kondisi tanam bibit menggunakan bibit yang diperoleh dari cabutan di Periode Dalam Tanpa bawah pohon induknya. Dalam pengujian ini media kecambah yang digunakan adalah arang sekam padi. Perbanyakan generatif Tabel 3. Umumnya bibit cabutan yang masih memiliki kotiledon dapat langsung ditanam dalam kantong plastik tanpa penyungkupan. pengecambahan harus dilakukan segera setelah pengunduhan buah. Pada Tabel 2 simpan ruang (%) (%) tampak ada penurunan antara Langsung 74 persen berkecambah dan 2 minggu 50 54 persen jadi bibit. Hasil uji penanaman 3 76 38 cabutan disajikan pada Tabel 3. Oleh sebab itu untuk mendapatkan persen jadi bibit yang tinggi. Persen jadi bibit (6 minggu setelah penaburan) dari hasil uji dimulai pada minggu kedua penyim-panan biji dan persen jadi bibit dihitung pada minggu keenam setelah Periode Kondisi Refrigerator penaburan. Penurun. Pada jenis gaharu penyimpanan pada kondisi ruang selama 2 bulan masih dapat menghasilkan kecambah dengan tingkat keberhasilan 48%. 118 . Penggunaan sungkup meningkatkan secara nyata persen tumbuh bibit cabutan (P Anova = < 0. kotiledonnya telah luruh. Perkecambahan umumnya Tabel 2. Pasimpan sungkup (%) sungkup (%) (hari) da pengujian penanaman 0 80 40 cabutan digunakan bibit 1 76 46 gaharu berukuran tinggi 2 87 24 7 cm. penaburan biji dilakukan segera setelah buah yang masak dan jatuh.Aspek SILVIKULTUR atau zeolit.0001).

Uji produksi stek dilakukan dalam tiga tahap penelitian. Hasil pengujian menunjukkan media berpengaruh secara nyata (P Anova = 0.(Atok Subiakto. temperatur. adapun perlakuan yang diuji adalah tiga jenis media (arang sekam padi.Uji Produksi Bibit . maka dilakukan pengujian lebih lanjut. dkk. Perbanyakan Vegetatif Uji produksi stek gaharu dilakukan dengan menggunakan teknologi KOFFCO system yang dikembangkan oleh Badan Litbang Kehutanan dan Komatsu (Sakai dan Subiakto. Hasil pengujian ini membuktikan bahwa kelembaban tinggi di dalam sungkup mempengaruhi keberhasilan penanaman bibit cabutan.. penyungkupan harus rapat agar kelembaban dalam sungkup dapat dijaga pada level di atas 95%. dan zeolit). Ratarata persen jadi stek pada uji tahap pertama berkisar antara 4047%. Hasil uji produksi stek gaharu disajikan pada Tabel 4. namun persen berakar masih di bawah 70%. Penyimpanan bibit cabutan selama tiga hari masih memberikan hasil yang cukup baik (76%) bila penanamannya menggunakan sungkup. Sungkup dapat dibuat dari plastik PVC transparan. yaitu cahaya. Pada tahap pertama digunakan prosedur baku pembuatan stek.6600) dalam persen jadi stek. Pembuatan stek dinilai dapat diusahakan secara ekonomis bila persen jadi mencapai 70% (Subiakto dan Sakai.) Namun bila kotiledon telah luruh.0083) terhadap persen jadi stek. 2007. Teknologi ini mengatur kondisi lingkungan. B. maka penanaman bibit cabutan harus melalui tahap penyungkupan.. Perlakuan jenis tidak menunjukkan perbedaan nyata (P Anova = 0. Pada pengujian tahap kedua. Subiakto dan Sakai.. Perlakuannya adalah jenis dan wadah tanam (tabur) stek. Media terbaik adalah zeolit. pasir. 2007). penyiraman dikurangi menjadi satu kali seminggu. dan media pada tingkat optimal bagi pertumbuhan (Sakai et al. Mengingat persen jadi stek masih di bawah 70%.8276) dalam persen jadi stek. kelembaban.. 2007). Demikian pula perlakuan wadah tanam tidak menunjukkan perbedaan nyata (P Anova = 0. Zeolit merupakan media dengan porositas yang baik dan tidak ditumbuhi oleh cendawan 119 .. 2002).

crassna dan A. microcarpa Campuran A. Tabel 4. crassna dan A. microcarpa Campuran A. crassna A. penyiraman berpengaruh secara nyata terhadap persen berakar stek (P Anova = 0. dan 3 kali seminggu). Perlakuan yang diuji adalah tingkat penyiraman (1 kali seminggu. crassna dan A.Aspek SILVIKULTUR ataupun alga. Pada pengujian ketiga digunakan media campuran cocopeat dan sekam padi yang telah disteril. microcarpa Campuran A. Persen berakar stek dari rangkaian uji produksi stek Tahapan riset 1 1 1 1 2 2 2 3 3 3 Spesies A.0210). siram 3 kali seminggu. microcarpa A. Hasil pengujian menunjukkan bahwa pada tingkat kepercayaan 5%. media coco-peat : sekam = 2:1 Tanpa pot-tray. media coco-peat : sekam = 2:1 Dengan pot-tray. siram 2 kali seminggu Media cocopeat : sekam = 1:1. media coco-peat : sekam = 2:1 Dengan pot-tray. siram 3 kali seminggu. crassna dan A. siram 1 kali seminggu Media cocopeat : sekam = 1:1. termasuk cendawan pembusuk. siram 3 kali seminggu. crassna dan A. 2 kali seminggu. siram 1 kali seminggu Media cocopeat : sekam = 1:1. Karena zeolit adalah media yang berat dan relatif lebih mahal. microcarpa Campuran A. microcarpa Campuran A. Efek dari penyiraman adalah menyebabkan jenuhnya media dan meningkatkan pertumbuhan cendawan. siram 3 kali seminggu. media coco-peat : sekam = 2:1 Media sekam bakar. microcarpa Perlakuan Tanpa pot-tray. siram 3 kali seminggu Persen berakar (%) 40 42 44 47 17 31 55 53 69 49 120 . crassna A. siram 1 kali seminggu Media pasir. microcarpa Campuran A. maka perlu dicoba media lain yang memiliki tingkat porositas relatif sama dengan zeolit. siram 1 kali seminggu Media zeolit. crassna dan A. Penyiraman terbaik adalah dua kali seminggu dengan persen berakar 69%.

Penyiraman terbaik dilakukan dua kali dalam seminggu. Mass Propagation Method from The Cutting of Three Dipterocarps Species... For. C. C. Series I. 6. Bogor. Pembuatan stek gaharu tersebut dilaksanakan pada rumah kaca dengan KOFFCO system. J.. com/scent-of-earth/alag. C. Benih gaharu tidak perlu disimpan dalam refrigerator. 121 . 7:73-80. Mataram. Studi Etiologi Gubal Gaharu Pada Tanaman Ketimunan. 1-15. J. D. T. cukup disimpan pada suhu ruangan. Scent of Earth.. Thymelaceae. Sakai. Subiakto.yahoo. Res. W. Pedoman Pembuatan Stek Jenisjenis Dipterokarpa dengan KOFFCO System. 2002. Kamata. dan Y. JICA. Santoso. 2007. Penanaman bibit cabutan menggunakan sungkup menghasilkan persen tumbuh lebih baik dibandingkan bila tidak menggunakan sungkup.. V. benih masih dapat disimpan selama dua bulan. Parman. A. Komatsu. dkk. Badan Litbang Kehutanan. Walter-Noodhoff. Hou. H. Groningen. Pen. Makalah Temu Pakar Gaharu di Kanwil Dephut Propinsi NTB. 2001. Namun dengan mengantisipasi penurunan daya kecambah. and A. IV-5 : 499-509. Nuroniah. A.) KESIMPULAN 1. 1960. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil Gaharu Aquilaria microcarpa. p.Uji Produksi Bibit .G...G. Vol. URL:http://store. A. Sakai. Subiakto. S. Rahman. Turjaman. 1996.J..(Atok Subiakto. Htn & KA.html (diakses : 5 Febuari 2001). dan N. Mulyaningsih. E. Persen kecambah terbaik diperoleh dari benih yang langsung dikecambahkan setelah pengunduhan. Oller. ed). Gunawan. dan D. Media terbaik untuk penyetekan gaharu adalah campuran antara serbuk kulit kelapa (cocopeat) dan sekam padi dengan perbandingan 1:1. The Netherland. DAFTAR PUSTAKA Daijo. dan M. 2. 2007. In : Flora Malesiana (Van Steenis.

Komatsu. Cisarua. K. W. Manajemen Persemaian KOFFCO System.. dan M. Arbuscular Mycorrhizal Fungi Increased Early Growth of Two Timber Forest Product Species Dyera polyphylla and Aquilaria filaria Under Greenhouse Conditions. A. and M. BHD. 2006. King. 1980. 2007. Bogor. H.. Badan Litbang Kehutanan. E. M. Makalah Utama Diskusi Pemanfaatan Kayu Kurang Dikenal. Subiakto. 122 . In : Recalcitran Crop Seeds (Chin. 1-5. dan C. Tamai. Turjaman. 1987.. Suharti. eds). E. Kuala Lumpur. Roberts. Bogor. and E. Malaysia. Y. Sakai. Mycorrhiza 16 : 459-464.Aspek SILVIKULTUR Sidiyasa. Tropical Press SDN. F. JICA. H. The Characteristic of Recalcitrant Seeds. and Roberts. Santoso. H. Jenis-Jenis Tumbuhan Penghasil Gaharu.

sehingga untuk mencegah punahnya pohon penghasil gaharu. dan minyak esensial untuk kegiatan keagaman. Sitepu Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Yasuyuki Hashidoko Lab.6 APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp. Graduate School of Agriculture. Pohon penghasil gaharu yang ditemukan dengan ciri-ciri adanya lubang kecil yang disebut lubang semut. perburuan gaharu dilakukan secara agresif dan tidak bijaksana. Aquilaria 123 . bahkan kegiatan sehari-hari. budaya. DI PERSEMAIAN Irnayuli R. sejak November 1994. Cara perburuan ini mengancam kelestarian gaharu di habitat alaminya. ditebang dan dipanen gaharunya. Hokkaido University Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu (dalam Bahasa Inggris dikenal dengan agarwood atau eaglewood) adalah kayu resin yang bernilai komersial tinggi karena digunakan sebagai dupa. bahan aditif minyak wangi. of Ecological Chemistry. Division of Applied Bioscience. Di alam.

Kedua genus ini ditemukan tumbuh alami di paling tidak 12 negara. Malaysia. Keberadaan gaharu semakin menipis di alam.Aspek SILVIKULTUR dan Gyrinops. dalam Gunn et al. perlu upaya budidaya pohon penghasil gaharu. Gonystylus. Butan. Kegiatan budidaya pohon penghasil gaharu tidak terlepas dari penyediaan bibit yang berkualitas tinggi. pohon menghasilkan metabolit sekunder atau senyawa resin yang menyebabkan bau wangi ketika dibakar. penggunaan biji yang bermutu baik dan inokulasi mikroba yang dapat memacu pertumbuhan. yaitu Aetoxylon. Budidaya merupakan kunci utama dalam meningkatkan produksi gaharu yang semakin menipis. Istilah RPPT digunakan untuk bakteri yang dapat membantu pertumbuhan tanaman melalui 124 . dua genus pohon penghasil gaharu terpenting yang termasuk ke dalam famili Thymelaeaceae (Ordo: Myrtales dan Kelas: Magnoliopsida) telah masuk ke dalam daftar CITES (the Convention on the International Trade in Endangered Species of Wild Flora and Fauna). Wikstroemia. seperti bakteri penghuni perakaran yang disebut rhizobakteri pemacu pertumbuhan tanaman (RPPT atau plant growth promoting rhizobacteria). Thailand. Indonesia. 2004).. Phaleria.49 (2004) mencatat ada 24 spesies yang termasuk genus Aquilaria dan tujuh spesies termasuk ke dalam genus Gyrinops. Kamboja. Appendix II TRAFFIC-CITES-CoP13 Prop. persiapan bibit kehutanan dilakukan mulai di persemaian. Gaharu hasil budidaya diharapkan akan dapat memenuhi kebutuhan pasokan gaharu untuk ekspor ke negara-negara pemakai. dan Papua New Guinea (Barden et al. Vietnam. Selain ditemukan pada kedua genus di atas. Lain halnya dengan komoditas pertanian yang langsung ditanam di lapangan. Myanmar. Enkleia. Gaharu terjadi melalui proses patogenisitas di mana jenis patogen fungi tertentu menginfeksi jenis pohon tertentu dan sebagai respon terhadap serangan patogen. termasuk Bangladesh. produk unik ini juga dapat terjadi pada beberapa genus tanaman lainnya. Filipina. Agar ketersediaan produk gaharu dan pohon penghasil gaharu tidak punah dan untuk menjaga kesinambungan produksi gaharu yang lestari. Lao PRD. Upaya peningkatan mutu bibit di persemaian dapat dilakukan dengan pemupukan.

misalnya dapat memproduksi tiga jenis fitohormon... Azospirillum sp.(Irna R. (2006) mengatakan bahwa dalam studi pemanfaatan bakteri penambat nitrogen untuk meningkatkan produksi tanaman. Sitepu. dan kinetin.. Namun. maka dilakukan penelitian uji aplikasi bakteri penghasil AIA/auksin dalam memacu pertumbuhan bibit penghasil gaharu Aquilaria sp.. 2006). 1995. Mikroorganisme yang menghuni rhizosfir berbagai macam tanaman umumnya memproduksi auksin sebagai metabolit sekunder sebagai respon terhadap suplai eksudat akar yang berlimpah di zona perakaran. solubilisasi atau mineralisasi fosfat. Lucy et al. 1994.. (1986) dalam Ahmad et al. Glick. dan pencegahan terjadinya serangan patogen tular tanah (Garbaye. giberelin (AG).. 2006). membantu proses terbentuknya mikoriza. dkk) mekanisme yang beragam. di persemaian. Sedangkan Pseudomonas putida GR12-2 pada bibit canola meningkatkan panjang akar sampai tiga kali lipat. AG. Mekanisme ini meliputi produksi fitohormon. Dalam penelitian ini. 2006). sequestration besi oleh siderofor. yaitu asam indol asetat (AIA/auksin). dan sitokinin (berbagai sumber dalam Narula et al. Untuk menguji hipotesa ini. Kokalis-Burelle et al.Aplikasi Rhizobakteri Penghasil . sampai saat ini informasi penelitian tentang pemanfaatan bakteri fitohormon untuk tanaman kehutanan di daerah tropis masih terbatas. sehingga respon peningkatan pertumbuhan tanaman disebabkan oleh mekanisme lain dan bukan nitrogen. penambatan nitrogen. Narula et al. Di antara mekanisme ini. bakteri terlebih dahulu diseleksi secara in vitro untuk 125 .. Dikatakan bahwa bakteri penghasil hormon pertumbuhan diduga memegang peranan penting dalam memacu pertumbuhan tanaman. Sedangkan Azospirillum chroococcum diketahui dapat memproduksi AIA. dan diduga adalah produksi fitohormon oleh bakteri penambat nitrogen tersebut.. yang dikenal sebagai bakteri penambat nitrogen. (2005) melaporkan bahwa Azospirilum brazilance meningkatkan jumlah dan panjang akar lateral. fitohormon mendapatkan perhatian penelitian karena aplikasi bakteri penghasil fitohormon dilaporkan meningkatkan produksi tanaman inang secara berkesinambungan (Narula et al. Barbieri et al. 1995. 2004). kandungan nitrogen pada tanaman yang diinokulasi tidak meningkat secara myata. baik secara langsung maupun tidak langsung (Glick.

(1991) yang dimodifikasi sebagai berikut: Rhizobakteri ditumbuhkan dalam media agar Winogradsky’s yang dimodifikasi (AWM) yang diberi 100 mg/L L-tryptophan (C 11H 12N 2O 2). Karakterisasi in vitro dan Persiapan Inokulum Rhizobakteri diisolasi dari rhizosfir dan rhizoplan bibit atau sapling menggunakan media campuran mineral Winogradsky’s bebas N dengan pH 5. Analisa sekuens DNA menggunakan BigDye Terminator v3.. dan diinkubasi dalam gelap pada suhu 28°C. Segera setelah agar diinokulasi rhizobakteri. USA) dengan empat pilihan primer.. 2002). dan/atau 1080RM (5 ACGAGCTGACGACA 3). membran dipindahkan dan ditumpuk pada kertas saring berdiameter 55 mm No. 518R (5 GTATTACCGCGGCTGCTGG 3). Katakterisasi kualitatif menggunakan metode colorimetric Brick et al.2 yang mengandung 1% sukrosa sebagai sumber karbon dan 0. Toyo Roshi Kaisha Ltd. Foste City. (1991).1 cycle (Applied Biosystems. Setelah inkubasi selama 3 hari. Seleksi awal rhizobakteri secara in vitro dilakukan untuk mengetahui kemampuannya dalam memproduksi fitohormon (asam indol asetat-AIA) melalui karakterisasi kualitatif dan kuantitatif. 926F (5 AAACTCAAAGGAATTGACGG 3).45mm. yaitu: 1. 1112F (5 GTCCCGCAACGAGCGCAAC 3). 4.6-6. 2 (Advantec. diameter 47 mm. Bakteri Penghasil Fitohormon: Identifikasi.3% gellan gum sebagai bahan pemadat (Hashidoko et al. 3.Aspek SILVIKULTUR mengetahui kapasitasnya sebagai bakteri penghasil fitohormon AIA/auksin. BAHAN DAN METODE A. media ditumpuk dengan membran nitrocellulose berukuran pori 0. Rhizobakteri ini kemudian diidentifikasi secara molekuler mengikuti metode Weisburg et al. 126 . Homologi sekuens ditelusuri dengan menggunakan BLASTN online DNA database in National Center for Bio-technology Information (NCBI). 2.

digunakan juga satu isolat bakteri pemacu asosiasi mikoriza. Namun demikian. Sedangkan karakterisasi AIA secara kuantitatif dilakukan mengikuti metode Narula (2004).. Perubahan warna diamati setelah 30 menit kemudian.Aplikasi Rhizobakteri Penghasil . Kemudian larutan Salkowski ditambahkan pada supernatant kultur rhizobakteri. Rhizobakteri yang mampu memproduksi AIA akan membentuk cincin halo warna merah di sekitar koloni. dkk) Tokyo. diketahui berasosiasi dengan fungi mikoriza arbuskula. Dari ketiga uji pendahuluan untuk mendapatkan bakteri penghasil AIA. Setelah 0. Glickmann dan Dessaux (1995) menyatakan bahwa larutan Salkowsky memberikan respon positif tidak hanya terhadap auksin (IAA) melainkan juga terhadap asam indolpirufat dan indoleacetamide. CK8 karena Aquilaria sp. Tidak adanya korelasi yang spesifik ini mengindikasikan bahwa kepekatan warna merah bukan merupakan indikasi tingginya kuantitas IAA yang dihasilkan.. dan merah tua. maka dipilih sembilan bakteri (Tabel 1). yaitu Chromobacterium sp. Sitepu. Selain itu.. Rhizobakteri yang membentuk cincin halo berwarna merah muda sampai merah pekat digunakan untuk uji kuantitatif AIA. Strain rhizobakteri yang bereaksi positif dengan larutan Salkowski kemudian diuji untuk mengetahui kemampuannya dalam memacu pertumbuhan akar Vigna radiata sebagai tanaman uji. pembentukan warna dibaca pada A665nm.5 jam.(Irna R. Japan) yang telah direndam sebelumnya dalam larutan Salkowski. kemudian dikelompokkan menjadi merah muda. Rhizobakteri dikulturkan pada media MW cair yang ditambah dengan 100mg/L L-tryptophan dan diinkubasikan pada suhu 28°C dalam kondisi statis di dalam gelap selama 7 hari. untuk mengetahui kemampuan bakteri dalam membantu terbentuknya asosiasi mikoriza pada bibit Aquilaria sp. melainkan diduga merupakan indikasi perbedaan/variasi derifat dari senyawa indol yang dikonversi dari L-triptophan. radiata tidak menunjukkan adanya korelasi yang positif antara intensitas kepekatan warna merah dengan laju pertumbuhan tanaman (tinggi dan total panjang akar). merah. 127 .. Intensitas warna yang terbentuk. uji lanjutan pada V.

Tabel 1. Sel bakteri yang ditumbuhkan pada media cair MW + 100 mg/L L-tryptophan diinkubasi dengan menggoyang selama 3 hari pada suhu 28ºC. CK67 NI CK53 NI CK54 Proteobacteria S. CK34 Bacillus sp. Inokulasi dilakukan pada bibit yang berumur 4 minggu dengan cara merendam bibit dalam larutan bakteri selama 30 menit. * isolat mycorrhization helper bacteria. Bibit ditumbuhkan di rumah kaca dan disiram setiap hari dengan air keran. CK41 Azospirillum sp. NI: bakteri yang belum teridentifikasi. kemudian ditanam dalam polybag yang berisi 500 g media tanah yang tidak steril. Pengamatan dilakukan terhadap tinggi. teysmanniana Rizoplan Rizoplan Rizoplan Merah muda Merah muda Merah muda pupus Merah muda pupus Merah muda pupus Merah tua Merah tua Merah muda Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Burkholderia Proteosp. CK8 (DQ195926) Proteobacteria * Catatan: S: Shorea. 1 ml larutan bakteri juga disebarkan di daerah perakaran. balangeran S. Pada saat penanaman. CK28 bacteria (DQ195889) Burkholderia Proteosp. diameter. setelah itu kultur bakteri agak dikentalkan dengan menambahkan 0. Rizoplan S. Inokulasi Bakteri Fitohormon pada Bibit Aquilaria sp. Rizoplan Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Hopea sp.5 th NI CK 61 Chromobacterium sp. teysmanniana Rizoplan Sapling ~1th Bibit~ 6 bln Nyaru Menteng Nyaru Menteng Pembi-bitan UP Nyaru Menteng Serratia sp. AIA: asam indol asetat 128 . S. Informasi bakteri PGPR penghasil fitohormon yang digunakan sebagai inokulum Strain bakteri Stenotrophomonas sp. dan bobot kering biomassa.Aspek SILVIKULTUR B. teysmanniana S. CK59 bacteria (DQ195914) Dipterocarpus sp.5% gellan gum selama 30 menit. CK26 Sub kelas Proteobacteria Bacilli Proteobacteria Hasil analisa colorimetric AIA Merah Inang Substrat Sta-dium Asal lokasi Dipterocarpus sp. UP: Universitas Palangkaraya. parviflora Rizoplan Rizoplan Sapling ~1 bln Sapling ~1. H: Hopea.

yaitu tinggi. Parameter yang diukur untuk mengetahui respon bibit terhadap inokulasi. Data dianalisa secara statistik dengan analisa sidik ragam menggunakan program SPSS®version 10. Rancangan Percobaan dan Analisa Data Penelitian menggunakan rancangan acak lengkap dengan faktor tunggal..(Irna R.... dkk) a b Gambar 1. indeks mutu bibit. dan persentase peningkatan pertumbuhan. yang masing-masing diulang sebanyak 10 bibit per perlakuan. Warna merah yang terbentuk di sekitar koloni setelah direaksikan dengan reagen Salkowski (a): Pembentukan warna pada membrane nitroselulose 3 hari setelah inkubasi. Data yang berbeda nyata diuji lanjut dengan Least Significant Difference untuk mengelompokkan perlakuan yang tidak berbeda nyata. Bakteri NICK53 yang membentuk warna merah tua dibanding dengan kontrol media tanpa bakteri C. diameter.0 (SPSS Inc. yaitu 10 isolat bakteri. berat kering total. (b): Pembentukan warna pada media cair. Chicago.Aplikasi Rhizobakteri Penghasil .. Analisa persentase peningkatan pertumbuhan dilakukan sebagai berikut: %Peningkatan = Bibit yang diinokulasi bibit kontrol Bibit kontrol x 100% 129 . Sitepu. USA).

Dijelaskan bahwa tanaman hutan pertumbuhannya jauh lebih lambat dari tanaman pertanian sehingga untuk pertumbuhan stadium awal di persemaian. bibit yang tumbuh di lantai hutan perlu memiliki kemampuan untuk segera tumbuh tinggi bersaing dengan bibit di sekitarnya untuk mendapatkan cahaya agar dapat tumbuh baik. parviflora umur kurang lebih 1. netral atau negatif terhadap pertumbuhan tanaman jika dibandingkan dengan tanaman yang tidak diinokulasi (kontrol negatif ). Pertumbuhan diameter tidak menunjukkan respon yang konsisten terhadap inokulasi (Tabel 2). Pada habitat hutan yang rimbun dengan kanopi yang bertingkat.Aspek SILVIKULTUR HASIL DAN PEMBAHASAN Bibit Aquilaria sp. Respon tanaman diamati melalui pertumbuhan tinggi dan diameter setiap bulannya. Kalimantan Tengah. β Proteobacteria) merupakan isolat yang paling konsisten dalam memberikan pengaruh paling efektif dalam meningkatkan pertumbuhan tinggi selama lima bulan setelah inokulasi (Gambar 2).2-38. 130 . Bakteri fitohormon memberikan pengaruh nyata terhadap tinggi tanaman mulai 1-5 bulan setelah inokulasi (P < 0. CK8 (DQ195926. β Proteobacteria) dan Chromobacterium sp. Dua isolat bakteri. yaitu Burkholderia sp. berkisar antara 12. Bakteri fitohormon memberikan pengaruh positif. Peningkatan pertumbuhan tinggi bibit Aquilaria sp. tinggi merupakan parameter yang reliable untuk mengamati respon bibit terhadap inokulasi mikroba pemacu pertumbuhan.05). Semua bibit yang diinokulasi secara signifikan memiliki pertumbuhan tinggi yang lebih baik daripada tanaman kontrol melalui analisa Least Significant Difference (LSD). menunjukkan respon beragam terhadap inokulasi bakteri fitohormon (Gambar 2).5 tahun dari arboretum Nyaru Menteng. Kedua bakteri ini berasal dari rhizoplan S. Respon yang serupa juga telah dilaporkan oleh Sitepu et al.7% dibandingkan dengan bibit yang tidak diinokulasi pada lima bulan setelah inokulasi. (2007) bahwa respon diameter bibit Shorea selanica terhadap inokulasi RPPT tidak konsisten. teysmanniana umur kurang lebih 1 tahun dan S. CK28 (DQ195889.

Tidak responnya bibit terhadap bakteri. Angka di atas notasi adalah peningkatan pertumbuhan dibanding kontrol Inokulasi tidak memberikan pengaruh nyata terhadap pertumbuhan tinggi. 1994.Aplikasi Rhizobakteri Penghasil . yaitu Shorea leprosula. rasio pucuk terhadap akar. bibit cenderung tumbuh lambat (Tabel 2). Pengaruh bakteri PGPR terhadap pertumbuhan tinggi bibit Aquilaria sp. kemudian bebas untuk berinteraksi dengan bakteri yang diinokulasikan. Hopea odorata. tidak disterilisasi pada saat inokulasi bakteri sehingga mikroba alami yang terdapat dalam tanah. Shorea acuminata.. juga terhadap berat kering total. sampai 5 bulan setelah inokulasi. Fungi mikoriza dilaporkan baru berperan efektif tujuh bulan setelah inokulasi pada tanaman dipterokarpa. ditumbuhkan di bawah tegakan meranti di Hutan Penelitian Dramaga. enam bulan setelah inokulasi. dapat dijelaskan sebagai berikut: Tanah sebagai media tumbuh dan bibit Aquilaria sp. 1990.. dan indeks mutu bibit (Gambar 3 dan Gambar 4). Diduga tidak adanya respon bibit yang nyata pada bulan keenam dan selanjutnya disebabkan karena bibit telah terinfeksi oleh fungi mikoriza secara alami yang dapat berasal dari tanah maupun air yang dipakai untuk menyiram tanaman walaupun analisa infeksi mikoriza alami tidak dilakukan. 2005)... Sitepu. dkk) Gambar 2. dan Shorea pinanga (Lee. Inokulasi juga tidak berpengaruh terhadap pertumbuhan setelah bibit dipindah ke lapangan. Bibit Aquilaria sp..(Irna R. Turjaman et al.. Yazid et al. enam bulan setelah inokulasi. 131 .

05. Berat kering total bibit Aquilaria sp.Aspek SILVIKULTUR Tabel 2.05 *: nyata pada taraf 0. P/A: Pucuk/akar Gambar 3. Analisa sidik ragam pada parameter pertumbuhan yang diukur Parameter Diameter (mm) Tinggi (cm) Berat Kering Pucuk (g) Berat Kering akar (g) Berat Kering Total (g) Rasio P/A Indeks Mutu Bibit tn * tn * Analisa sidik ragam * * tn tn tn tn tn * * tn * tn tn Catatan: tn: tidak nyata pada taraf 0. Tabel 1. yang diinokulasi bakteri 132 .

2001). Brule et al. dkk) Gambar 4. yang diinokulasi bakteri Pada bibit Aquiliaria sp. 133 . Bakteri tertentu dapat berperan dalam merangsang terbentuknya asosiasi mikoriza antara fungi mikoriza dan tanaman inangnya... Penelitian yang dilakukan oleh Enebak et al. (1998) pada bibit loblolly dan slash pine melaporkan bahwa inokulasi RPPT meningkatkan biomassa tegakan.. MHB) juga telah dilaporkan.. monteilii meningkatkan biomassa fungi di dalam tanah (Founoune et al.. yaitu pada enam bulan setelah inokulasi.. Salah satu dari kedua inokulan yang paling efektif. Sedangkan Paenibacillus monteilii dan Paenibacillus resinovorans memacu simbiosis antara Pisolithus alba dengan Acacia holosericea di mana P.Aplikasi Rhizobakteri Penghasil . Gambar 4. yaitu Chromobacterium sp... dalam penelitian ini. Penelitian yang dilakukan oleh Poole et al. dan Rhodococcus sp.(Irna R. CK8 adalah bakteri yang telah diuji secara in vitro dapat membantu pertumbuhan miselia fungi ektomikoriza Laccaria sp. 1994. Indeks mutu bibit Aquilaria sp. Pengaruh tidak langsung dari inokulasi RPPT berupa pembentukan asosiasi mikoriza (disebut sebagai mycorrhizal helper bacteria. (2001) menyatakan bahwa bakteri Paenibacillus sp. Burkholderia sp. Sitepu. merangsang infeksi ektomikoriza pada tahapan pembentukan akar lateral antara Laccaria rufus dan Pinus sylvestris. pengaruh mikoriza dimulai lebih awal. 2002). Pseudomonas fluorescense BBc6R8 memacu simbiosis antara Laccaria bicolor S238N-Douglas fir (Pseudotsuga menziesii) dan efek dari bakteri MHB ini paling efektif pada saat fungi mikoriza tumbuh berada pada kondisi yang tidak optimal (Garbaye.

Dari hasil in vitro didapat sembilan bakteri penghasil indol yang kemudian diuji lanjut pada bibit Aquilaria sp.Aspek SILVIKULTUR Untuk mengetahui apakah fenomena MHB ini juga berlaku untuk Aquilaria sp.2-38. baik di persemaian maupun di lapangan. menunjukkan respon beragam terhadap inokulasi bakteri penghasil fitohormon. Dalam hal ini bibit bermikroba dapat meningkatkan ketahanan tumbuh tanaman pada kondisi ekstrim. Uji lanjutan inokulasi ganda dengan fungi mikoriza arbuskula perlu dilakukan untuk mengetahui mikroba yang berperan dalam memacu pertumbuhan bibit pada stadia lanjut di persemaian sebelum dipindah ke lapangan. terhadap inokulasi menghasilkan satu bakteri penghasil indol yang efektif. dan apakah hipotesa di atas benar. KESIMPULAN Bibit Aquilaria sp. CK28 dan Chromobacterium sp. Respon pertumbuhan bibit Aquilaria sp. Inokulasi bakteri penghasil fitohormon dapat meningkatkan tinggi bibit Aquilaria sp. pendekatan yang dilakukan adalah menyeleksi bakteri secara in vitro terlebih dahulu sebelum dilakukan uji pada tanaman target di persemaian. Dua isolat Burkholderia sp. CK28 yang menghasilkan warna pink muda pada uji colorimetric. 134 . Uji in vitro merupakan metode yang praktis. Dalam penelitian ini. maka perlu uji lebih lanjut untuk mengetahui pengaruh inokulasi ganda antara bakteri dan fungi mikoriza arbuskula dalam memacu pertumbuhan bibit. terutama dalam menyeleksi isolat dalam jumlah besar sebelum dilakukan uji selanjutnya. CK8 adalah dua bakteri yang secara konsisten memacu pertumbuhan tinggi. Penelitian yang dilakukan oleh Kashyap et al. (2004) menunjukkan bahwa inokulasi ganda fungi mikoriza arbuskula dan bakteri Azotobacter dengan tambahan asam indol butirat secara nyata meningkatkan survival rate sapling Morus alba (Moraceae) yang ditanam pada kondisi yang bergaram tinggi dari 25-50%. yaitu Burkholderia sp.7% dibandingkan dengan bibit yang tidak diinokulasi. Peningkatan pertumbuhan tinggi bervariasi dari 12. segera setelah inokulasi berturut-turut selama lima bulan.

Founoune. Garbaye. I.A. J. P. 1991. F.S.M. Effect of plant growthpromoting rhizobacteria on loblolly and slash pine seedlings. A. Applied and Environmental Microbiology 57: 535-538. Sitepu.(Irna R. B. Brick. G. G.. The enhancement of plant growth by free-living bacteria. 2005. dan M.. and S. Courrier. Lorquin. C. 1995. 1994.. Rapid in situ assay for indoleacetic acid production by bacteria immobilized on a nitrocellulose membrane. 1998. J. I. New Phytologist 153: 81-89.. Enebak. A critical examination of the specificity of the Salkowski reagent for indolic compounds produced by phytopathogenic bacteria.C. M. Dessaux. Gerard.. Ahmad. Sommer. S. Wei. Kloepper.R. Khan. New Phytologist 128: 197-210. 135 . Glickmann.M.L. Rousselet.C. S. Sall. F. Glick. 1995. J..E. Mycorrhiza Helper Bacteria stimulate ectomycorrhizal symbiosis of Acacia holosericea with Pisolithus alba. Branget. S. 2001.Aplikasi Rhizobakteri Penghasil . DAFTAR PUSTAKA Ahmad. Lemoine. Applied Environmental Microbiology 61: 793-796. Canadian Journal of Microbiology 41: 109-117. Helper bacteria: a new dimension to the mycorrhizal symbiosis.. Ba. Survival in the soil of the ectomycorrhizal fungus Laccaria bicolor and the effects of mycorrhiza helper Pseudomonas fluorescens. Chotte. and J. Indole acetic acid production by the indigenous isolates of Azotobacter and fluorescent Pseudomonas in the presence and absence of tryptophan. and J. Neyra. Soil Biology and Bio-chemistry 33: 1683-1694. Garbaye. Forest Science 44: 139-144. and J. Brulé. Frey-Klett.W. 2002. M. H.. R. and Y. Bostock.L. J. J. Pierrat. Silverstone.M. dkk) Ucapan Terimakasih Para penulis mengucapkan terimakasih kepada Bapak Ahmad Yani dan Bapak Zaenal yang telah membantu pengukuran dan perawatan tanaman di Hutan Penelitian Dramaga. Duponnois.. Turkish Journal of Biology 29: 29-34. E. R.

M. Tamai. Y. Sunari. Bending.M. 18 pp. and B. Plant Soil Environment 52:119-129.D. Screening of plant-growth promoting rhizobacteria from Dipterocarpaceae plants growing in Indonesian tropical rain forests. M. pp. G. Osaki. and M. 2004. Sitepu. Soft gel medium solidified with gellan gum for preliminary screening for rootassociating.H. 2006. E. Canberra. and K. N. S. J. Reddy.. Singadan. Applied Soil Ecology 31: 91-100. Stevens.. M. Bacteria associated with Pinus sylvestris-Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro. Gans. Narula. 2004. Applications of free living plant growth-promoting rhizobacteria. Narula. I. Tahara. Poole. Segah. Glick. J. and S.S. N. E. Lucy. 2001. Turjaman.67. 2006. The mycorrhizal association of the Dipterocarpaceae in the tropical rain forests of Malaysia. P.S. Biofertilizer technology-A manual. W.R. and P. B. Behl.... Hisar. Bio-science Biotechnology Biochemistry 66: 2259–2263. Cha. The Australian National University. Read. 2004. Reed. Inoculation with the ectomycorrhizal fungi 136 .K. M. Chatterton. free-living nitrogen-fixing bacteria inhabiting the rhizoplane of plants. Deubel. M. Paranodules and colonization of wheat roots by phytohormone producing bacteria in soil.W.Y. M. Hashidoko. H. New Phytologist 151: 743-751.J. S. Plant growth-promoting rhizobacteria as transplants amendments and their effects on indigenous rhizo-sphere microorganisms. PhD Dissertation. R.51. 91 pp. Department of Microbiology. Eaglewood in Papua New Guinea. Hokkaido University. Whipps. A. N. 1990..Aspek SILVIKULTUR Gunn. CCS Haryana Agricultural University. Lee. Y. and W. Tada.. Tawaraya. L. 2005.J. and investigations of their functions on seedling growth. 2007. Kloepper. 2002. Limin.R.V. AMBIO 19: 383-385. India. and D. Resource Management in Asia-Pacific Working Paper No. Kokalis-Burelle. Antonie van Leeuwenhoek 86: 1-25. J. Osaki. Merbach.

S. Journal of Bacteriology 173: 697-707. and D. (Dipterocarpaceae) seedlings following ectomycorrhizal inoculation with an exotic strain of Pisolithus tinctorius.M. Lapeyrie. Forest Ecology Management 67: 339-343. S. 137 .(Irna R. D. 16S ribosomal DNA amplification for phylogenic study.. S. Lane.M. Pelletier... Barns.. New Forest 30: 67-73.Aplikasi Rhizobakteri Penghasil . improves early growth of Shorea pinanga nursery seedlings.S. and F. Lee.J.. 1994. Yazid. 1991. dkk) Pisolithus arhizus and Scleroderma sp.. G. Weisburg. W. Sitepu.A. Growth stimulition of Hopea spp.

138 .

Jenis-jenis ini merupakan sumber utama dari kayu gaharu (semacam kayu yang 139 . Papua Nugini. dan Aquilaria yang memproduksi gaharu (Ding Hou. Myanmar. 2001). Pada saat ini Aquilaria. Enkleia. Thymeleaceae terdiri dari 50 genera dengan Aetoxylon. Ragil S. Bhutan.. Sitepu. Karena disebabkan tingginya nilai produk gaharu. Irianto.7 PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman. Sugeng Sentosa. Aryanto. Najmulah. Thailand.. Ahmad Yani. Jenis-jenis Aquilaria pada umumnya banyak dijumpai pada hutan-hutan primer dan sekunder dataran rendah di Indonesia. 1999). Oyen dan Dung. Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Salah satu famili pohon tropika yang sekarang menjadi perhatian dunia internasional adalah Thymelaeaceae. dan Gonystylus dimasukkan ke dalam CITES (Convention on the International Trade in Endangered Species) Appendix II (CITES 2005). Phaleria. India. Malaysia. Bangladesh.B. Famili pohon ini sangat penting karena menghasilkan produk gaharu dan kayu mewah untuk masyarakat di sekitar kawasan hutan di kawasan Asia (Lemmens et al. 1960). dan Filipina. Vietnam. 1998. Irnayuli R. Gyrinops. Wikstroemia. Gonystylus. China. maka jenisjenis ini mengalami kelebihan pemanenan di seluruh kawasan Asia selama 20 tahun terakhir (Paoli et al. Cambodia. Gyrinops.

Namun demikian. 2000). 1990). Pada saat ini kegiatan reforestasi memproduksi ratusan juta bibit tanaman hutan setiap tahunnya. dan produk komersial lainnya (Eurling dan Gravendeel. Parkia biglobosa. Tectona grandis (Rajan et al.. Ketersediaan nutrisi tanah merupakan salah satu faktor pembatas untuk pertumbuhan awal dalam kegiatan penanaman bibit-bibit tanaman hutan pada kondisi lahan hutan yang terdegradasi (Santiago et al. 1998). Telah banyak dilaporkan dalam beberapa jurnal internasional pentingnya pemanfaatan fungi mikoriza arbuskula dari beberapa jenis tanaman hutan yang berbeda untuk membantu kegiatan reforestasi. Tujuan dari penelitian ini adalah menentukan tingkat pengaruh fungi mikoriza arbuskula pada jenis-jenis Aquilaria. sebab pada umumnya kondisi lahan hutan tropika di Indonesia kahat unsur hara terutama N dan P. grandiflora (Giri and Mukerji.Aspek SILVIKULTUR mempunyai resin wangi) yang termasuk dalam urutan teratas dari kelompok hasil hutan bukan kayu bernilai sangat tinggi yang berasal dari hutan tropika. 2005). obat tradisional. Dari hasil studi literatur.. Produk gaharu biasanya digunakan sebagai bahan dasar parfum. Pada tahap awal pertumbuhan jenis Aquilaria sering mengalami pertumbuhan yang lambat. belum dilaporkan adanya uji inokulasi fungi mikoriza arbuskula pada jenis-jenis Aquilaria. 1996). Penggunaan bibit tanaman hutan yang vigor sangat diperlukan dalam kegiatan reforestasi. incence. Tamarindus indica. baik di tingkat persemaian maupun di lapangan. Pada kenyataannya ketersediaan bibit biasanya cenderung dibuat dengan kualitas rendah dan mengalami defisiensi unsur hara dan pada akhirnya mengalami kematian yang tinggi pada saat telah ditanam di tingkat lapang. 140 . sulit sekali untuk melakukan pengaturan perlindungan genus ini dan termasuk juga dalam pengaturan kelestarian produksi gaharu alami. Sesbania aegyptiaca dan S. Zizyphus mauritiana (Guissou et al. 2002). Fungi mikoriza arbuskula (FMA) telah diuji dengan hasil yang signifikan pertumbuhannya pada jenis Leucaena leucocephala (Michelsen dan Rosendahl. 2004). jenis Aquilaria berkurang populasinya di alam.. 11 jenis Eucalyptus (Adjoud et al.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

BAHAN DAN METODE
A. Perbenihan dan Perkecambahan
Benih Aquilaria crassna diperoleh dari Dramaga (Bogor), A. malaccensis dikoleksi dari Desa Gudang (Pulau Bangka), A. microcarpa dari Desa Mianas (Kalimantan Barat), A. beccariana berasal dari Sanggau (Kalimantan Barat). Semua benih Aquilaria spp. direndam selama dua jam, kemudian disterilisasi dengan sodium hypochlorit (5%) selama lima menit. Setelah disterilisasi, benih tersebut dicuci beberapa kali dengan air sampai bersih. Benih Aquilaria spp. dikecambahkan pada bak plastik yang berisi media zeolite. Benih Aquilaria spp. mulai berkecambah 21 hari setelah ditaburkan.

B. Media Semai
Jenis tanah ultisol diambil dari Hutan Penelitian Haurbentes, Jasinga dan kemudian disimpan di rumah kaca. Media semai tersebut disaring dengan diameter saringan lima mm. pH media adalah 4,7; P tersedia (Bray-1) adalah 0,17 mg kg-1, dan N total (Kjeldahl) was 1.7 mg kg-1. Kemudian media semai disterilisasi pada temperatur 121oC selama 30 menit.

C. Inokulum Mikoriza Arbuskula
Fungi mikoriza arbuskula, G. decipiens, G. clarum, Glomus sp. ZEA, dan Glomus sp. ACA diisolasi dari Desa Kalampangan, Palangkaraya, Kalimantan Tengah melalui teknik pot kultur. Teknik pot kultur dimulai dengan cara spora tunggal. Inang yang digunakan untuk mempropagasi FMA adalah Pueraria javanica. Pot plastik diisi dengan zeolite steril dan ditambahkan 5 g dari masingmasing jenis FMA. Kemudian ditanam benih P. javanica yang telah berumur enam hari pada pot plastik tersebut. Pot-pot disusun pada rak-rak besi di rumah kaca dan dipelihara selama 90 hari. Spora, hifa eksternal, dan akar yang terkolonisasi dari masing-masing jenis FMA diamati di bawah mikroskop.

141

Aspek SILVIKULTUR

D. Inokulasi FMA
Polybag (ukuran 15 cm x 10 cm) diisi tanah steril 500 g. Inokulasi FMA diberikan 5 g untuk setiap pot dan diletakkan dekat akar semai Aquilaria spp. Semai empat jenis Aquilaria yang tidak diinokulasi sebagai kontrol. Dari hasil penelitian pendahuluan, penggunaan inokulum steril tidak memberikan pengaruh pertumbuhan pada Aquilaria spp. Semai dipelihara dan disiram setiap hari pada kondisi rumah kaca dan diamati selama 6 bulan. Temperatur di rumah kacar berkisar antara 26-35oC dan kelembaban udara 8090%. Gulma dan hama yang mengganggu semai dimonitor setiap hari.

E. Parameter Pertumbuhan
Percobaan inokulasi pada jenis-jenis Aquilaria terdiri atas (a) kontrol (tanpa inokulum); (b) Entrophospora sp.; (c) G. decipiens; (d) G. clarum; (e) Glomus sp. ZEA; dan (f) Glomus sp. ACA. Desain penelitian dilakukan dengan rancangan acak lengkap (RAL) dengan 30 ulangan. Parameter yang diukur adalah tinggi, diameter, dan daya hidup semai. Setelah berumur enam bulan, dilakukan pemanenan pucuk dan akar semai Aquilaria. Semua sampel di-oven pada suhu 70oC selama tiga hari. Analisis N dan P jaringan semai dilakukan dengan metode semi-micro Kjeldahl dan vanadomolybdate-yellow assay (Olsen and Sommers, 1982). Pada tingkat lapang, percobaan yang dilakukan hanya pada jenis A. beccariana dengan desain RAL yang sama. Percobaan dilakukan di Kawasan Hutan Dengan Tujuan Khusus (KHDTK) Dramaga di bawah naungan tegakan Gmelina arborea. Paramater yang diamati pada tingkat lapang ini adalah tinggi dan diameter A. beccariana yang telah dilakukan selama dua tahun.

F. Kolonisasi Mikoriza Arbuskula
Akar dari masing-masing jenis Aquilaria dicuci untuk membersihkan partikel-partikel tanah yang masih menempel. Akar dibersihkan dalam 100 g l-1 KOH selama satu jam, diasamkan dalam larutan HCl dan diberi warna dengan 500 mg l -1 tryphan blue dalam lactoglycerol (Brundrett et al., 1996). Kemudian akar

142

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

dicuci dalam 50% glycerol dan 100 potong akar berukuran satu cm diamati di bawah mikroskop compound dengan perbesaran 200x. Penghitungan kolonisasi mikoriza dilakukan dengan sistem skoring keberadaan dan tidak adanya struktur FMA (McGonigle et al., 1990).

G. Analisis Statistik
Analisis statistik menggunakan ANOVA dengan software StatView 5.0 (Abacus Concepts). Sedangkan analisis statistik lanjutan menggunakan uji beda nyata terkecil (LSD) apabila nilai F signifikan.

HASIL DAN PEMBAHASAN
Lima jenis fungi mikoriza arbuskula (FMA) sangat efektif mengkolonisasi sistem perakaran dari A. crassna, A. malaccensis, A. Microcarpa, dan A. beccariana setelah enam bulan diinokulasi pada kondisi rumah kaca. Dari hasil penelitian sebelumnya Santoso et al. (2008), kolonisasi FMA yang terjadi pada akar bibit A. microcarpa dimulai sebelum minggu ke-7 setelah inokulasi. Tidak ada perbedaan nyata antara lima jenis FMA dalam mengkolonisasi perakaran empat jenis Aquilaria. Kolonisasi FMA dapat meningkatkan parameter pertumbuhan tinggi, diameter batang, berat kering, berat basah, dan daya hidup semai Aquilaria di persemaian (Tabel 1). Pada jenis A. crassna, A. Malaccensis, dan A. microcarpa, penggunaan FMA Entrophospora sp. lebih efektif meningkatkan parameter pertumbuhan dibandingkan jenis FMA lainnya. Khusus FMA G. clarum sangat efektif meningkatkan parameter pertumbuhan pada jenis A. beccariana. Semai yang tidak diinokulasi terkolonisasi oleh FMA yang tidak teridentifikasi (110%), tetapi tidak dapat mempengaruhi pertumbuhan empat jenis Aquilaria. Kolonisasi FMA mampu meningkatkan serapan N dan P pada jaringan empat jenis Aquilaria dibandingkan semai yang tidak diinokulasi (Tabel 2). Peningkatan serapan N dan P ini memberikan pengaruh pada peningkatan dari parameter pertumbuhan empat jenis Aquilaria. Pada tingkat lapang, dilakukan kegiatan penanaman hanya pada jenis A. beccariana dua tahun setelah diinokulasi oleh FMA. Hasil penelitian pada tingkat lapang menunjukkan bahwa

143

Aspek SILVIKULTUR

jenis G. clarum lebih efektif dalam meningkatkan pertumbuhan A. beccariana dibandingkan dengan kontrol dan jenis FMA lain yang telah diujicobakan. Dari hasil penelitian ini memberikan informasi yang sangat penting dalam memanfaatkan inokulum FMA pada jenis-jenis Aquilaria spp. Regenerasi jenis-jenis Aquilaria yang berkelanjutan dapat dibantu dengan adanya pemanfaatan teknologi FMA dimulai pada saat di persemaian. Penggunaan FMA yang efektif dapat meningkatkan pertumbuhan Aquilaria yang sangat signifikan, sehingga biomassa pohon penghasil gaharu yang akan dipanen akan meningkat, artinya produk gaharu hasil induksi yang akan dipanen lebih meningkat produksinya. Penelitian ini sejalan dengan penelitian yang terdahulu, yaitu tentang pemanfaatan FMA pada 11 jenis Eucalyptus spp. (Adjoud et al., 1996), 17 jenis tanaman legume (Duponnois et al., 2001), Sesbania aegyptiaca dan S. grandiflora (Giri dan Mukerji, 2004). Penelitian pemanfaatan FMA pada jenis-jenis pohon tropika (Muthukumar et al., 2001) dan khususnya jenis-jenis Aquilaria menunjukkan bahwa ada kemungkinan inokulum FMA dapat menurunkan penggunaan pupuk kimia di persemaian. Meskipun perhitungan tentang keuntungan dan biaya penggunaan FMA belum diuji dalam penelitian ini, hasilnya tidak diragukan lagi menunjukkan FMA dapat menurunkan penggunaan pupuk kimia dalam penyediaan semai tanaman penghasil gaharu. Selanjutnya mekanisme penggunaan FMA sebagai pemacu pertumbuhan jenisjenis Aquilaria pada tanah masam dan pada tanah yang populasi FMA sangat rendah harus menjadi perhatian dan pertimbangan untuk mengetahui keberadaan FMA alami. Pola penanaman jenis-jenis Aquilaria dengan pola agroforestry sangat membantu mempercepat ketersediaan pohon-pohon penghasil gaharu di Indonesia. Pada prinsipnya, pencampuran dilakukan untuk melindungi pertumbuhan semai Aquilaria pada tahun pertama dan kedua dari sengatan sinar matahari. Jenis-jenis Aquilaria yang telah dikolonisasi oleh FMA akan dapat mempunyai hubungan antara sistem perakaran pohon jenis-jenis lain, sehingga kebutuhan nutrisi untuk pertumbuhan gaharu dapat terpenuhi.

144

KESIMPULAN DAN REKOMENDASI 1. dan A. jengkol. Gc = G.. beccariana lebih memilih jenis FMA G. sangat efektif dalam memacu pertumbuhan tanaman dan serapan nurtisi pada jenis A. microcarpa. malaccensis. kelapa.. sengon.. baik di tingkat semaian maupun lapangan. gmelina. Gg = G.Aca = Glomus sp. 2.Penggunaan Fungsi Mikoriza . crassna. G. dan beberapa jenis lain pohon buah-buahan. Pertumbuhan tinggi dan diameter pohon penghasil gaharu Aquilaria beccariana setelah dua tahun ditanam di tingkat lapang. ZEA. ACA. kelapa sawit. Direkomendasikan untuk menggunakan jenis FMA efektif untuk mempercepat pertumbuhan jenis-jenis Aquilaria mulai di tingkat persemaian. melinjo. Jenis FMA Entrophospora sp. A.(Maman Turjaman.) Jenis-jenis pohon yang direkomendasikan sebagai pohon pencampur dengan pohon penghasil gaharu adalah pohon karet. Gambar 1. Penggunaan FMA pada jenis-jenis Aquilaria sangat signifikan dalam memacu pertumbuhan awal di persemaian dan lapangan. G.. Ent = Entrophospora sp.ZEA = Glomus sp. Ketersediaan inokulum FMA di tingkat 145 .clarum. dkk. decipiens.. Khusus jenis pohon penghasil gaharu A. clarum untuk memacu pertumbuhan tanaman dan serapan nutrisinya. K = Kontrol.

Founoune. Mycorrhiza 14 : 307-312. Plenchette. Duponnois. 2005. Pontanier (2005). Halli-Hargas and F. Guisso..G. Inoculation of Acacia holosericea with Ectomycorrhizal Fungi in a Semiarid Site in Senegal : Growth Response and Influences on The Mycorrhizal Soil Infectivity After 2 Years Plantation. Biology and Fertility Soils 26 : 194-198. Bougher. Giri. T.M. Lapeyrie. H. Thymelaeaceae.G. 1-15. B. D.) Benth. Dell. N. to Arbuscular Mycorrhizal Fungi in a Phosphorus-Deficient Sandy Soil. R. Gravendeel. and Zizyphus mauritiana Lam. 146 . 2005. ACIAR Monograph 32. Convention on International Trade in Endangered Species of Wild Fauna and Flora. Responses of Parkia biglobosa (Jacq.J. M. DAFTAR PUSTAKA Adjoud. agar penggunaan FMA menjadi efektif dan efisien. The Netherlands. Brundrett. 2004. Series I. Forest Ecology and Management 207 : 351-362. 1996. Vol. Appendices I.Ouadba.Aspek SILVIKULTUR pengguna dan sosialisasi penggunaanya perlu dilakukan. Tamarindus indica L. 1960. Masse and R. S. Guinko and R. Working with Mycorrhizas in Forestry and Agriculture. II and III of CITES. Duponnois. (ed) Flora Malesiana. CITES... Plant Systematics and Evolution 254 : 1-12. C. and K. p. Wolters-Noordhoff. 6. J-M. 1998.M. Mukerji. Ding Hou. R. and B. UNEP. A. 1996. Mycorrhizal Inoculant Alleviates Salt Stress in Sesbania aegyptiaca and Sesbania grandiflora Under Field Conditions : Evidence for Reduced Sodium and Improved Magnesium Uptake. Groningen.. B.C. 48 pp. M. TrnL-TrnF Sequence Data Imply Paraphyly of Aquilaria and Gyrinops (Thymelaeaceae) and Provide New Perspectives for Agarwood Identification. Grove and N. Malajczuk. Response of 11 Eucalyptus Species to Inoculation with Three Arbuscular Mycorrhizal Fungi. Bâ. C. Mycorrhiza 6 : 129-135.G. In : Van Steenis. T. Eurlings. D. Canberra.

R. Evans. G. A..M. Fairchild and J. 1998.. American Society of Agronomy. Forest Ecology and Management 126: 91-95. Madison.) Lemmens. Wong (Eds. T.J. K.R. Dung (Eds. R.G. Rajeshkannan. Rosendhal. Soerianegara and W. New Forests 24 : 15-25.J. Indonesia.J. Peart.. Phosphate-Solubilizing and Asymbiotic Nitrogen-Fixing Bacteria Under Tropical Nursery Conditions.E. McGonigle.. S. Samsoedin.A. Plant and Soil 124 : 7-13. 1982..X. L.K. 19. A. dkk. p 403-430. I. and Mycorrhizal Fungi on The Growth Brazilian Rosewood. S. Timber Trees : Minor Commercial Timbers.P.L. New Phytologist 115 : 495-501. and N. Swan. Rajan. 5 (2).. Conservation Biology 15 : 1721-1732. in Two Tropical Soils.H. Ex Benth. Oyen.).. Prosea. 2008.).Penggunaan Fungsi Mikoriza . T.. Gunawan dan M. Sommers. Phosphorus and Drought Stress on The Growth of Acacia nilotica and Leucaena leucocephala Seedlings. Q.. G. A New Method Which Gives an Objective Measure of Colonization of Roots by Vesicular-Arbuscular Mycorrhizal Fungi. Bagyaraj. M. Michelsen.C. Indonesia. Leighton and I.D. 1990. Plant Resources of South-East Asia No. D. 2001. 1999.. Essential-Oil Plants. G. Muthukumar. Miller. E. 1990. and L. Turjaman. Garcia and M. Santiago. Scotti.D.. B. and S.) Methods of Soil Analysis Part 2 Chemical and Micro-biological Properties. Biology and Fertility Soils 34 : 417-426 Olsen.W. Phosphorus. Indonesia. 2001.P. Bogor. M. Effect of Post-Planting Inoculation with Bradyrhizobium sp. Prosea. An Ecological and Economic Assessment of The Nontimber Forest Product Gaharu Wood in Gunung Palung National Park. Screening of Arbuscular Mycorrhizal Fungi for Their Symbiotic Efficiency with Tectona grandis..A. Plant Resources of South-East Asia No. Response of Neem (Azadirachta indica A. Santoso. Juss) to Indigenous Arbuscular Mycorrhizal Fungi. D. 2000. Reddy and D. Udaiyan and V.(Maman Turjaman. Dalbergia nigra Allem.H.M.R. Bogor. West Kalimantan. Paoli. In : Page AL (ed. The Effect of VA Mycorrhizal Fungi. 2002. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil 147 .

Bogor. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam. 148 .Aspek SILVIKULTUR Gaharu. Jurnal Penelitian Hutan dan Konservasi Alam IV (5): 499-509.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

Lampiran 1. Kolonisasi mikoriza arbuskula dan pertumbuhan pada jenisjenis Aquilaria setelah enam bulan pada kondisi di rumah kaca
Kolonisasi AM Tinggi (cm) Diameter (mm) Berat basah Pucuk (g) Akar (g) Berat kering Pucuk (g) Akar (g) Daya hidup (%)

Perlakuan

A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA 10a 85b 71b 79b 61b 84b 15,40a 19,20b 32,18d 45,30e 32,03d 26,24c 1,90a 2,37b 3,94c 5,02d 3,75c 3,53c 0,30a 5,46e 4,74d 6,74f 3,14b 3,84c 0,10a 2,54c 1,64b 2,82d 1,38c 1,20b 0,09a 1,76c 1,59c 2,30d 0,97b 1,19b 0,02a 0,78c 0,41b 0,91d 0,36b 0,28b 73 100 100 100 100 100 2a 97b 88b 83b 85b 87b 13,39a 24,74d 21,99c 20,28c 17,24b 18,09b 2,23a 3,89c 3,67c 3,58c 2,84b 2,98b 0,75a 4,32c 3,87c 3,46c 2,24b 2,70b 0,34a 2,29c 3,41d 1,55b 1,08b 1,23b 0,23a 1,31c 1,44c 0,95b 0,64b 0,76b 0,09a 0,37b 0,57c 0,30b 0,24b 0,28b 67 100 97 93 87 90 1a 97b 88b 83b 84b 86b 16,43a 25,97c 21,91b 19,96b 22,33b 21,30b 2,28a 3,88c 3,02b 2,94b 3,26b 3,12b 1,46a 4,68c 2,92b 2,90b 2,62b 2,74b 0,52a 2,24c 1,20b 1,28b 1,38b 1,22b 0,41a 1,44c 0,88b 1,95c 0,79b 0,89b 0,18a 0,48c 0,27b 0,78c 0,27b 0,26b 73 100 100 97 90 93 4a* 73b 63b 78b 78b 59b 20,90 a 46,14 c 29,58 b 32,43 b 38,94 c 24,60 a 2,9 a 5,4 c 4,1 b 4,4 b 4,7 b 3,7 a 0,68a 1,06a 0,33a 3,82b 3,26b 0,86a 2,99b 4,19b 0,13a 1,35b 1,56b 0,27a 1,01b 1,52b 70 100 100 100 87 100

12,58b 5,72b 11,64b 7,36b 8,82b 9,92b 4,3b 4,54b

13,46b 6,94b

149

Aspek SILVIKULTUR

Lampiran 2. Kandungan N dan P pada jenis-jenis Aquilaria setelah enam bulan diinokulasi oleh beberapa jenis fungi mikoriza arbuskula (FMA)
N Concentrations (mg/g) N Content (mg/plant) P Concentrations (mg/g) P Content (mg/plant)

Perlakuan A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA

7,9 ± 0,1a* 9,8 ± 0,1c 8,2 ± 0,2a 8,7 ± 0,2b 8,7 ± 0,1b 10,8 ± 0,2d

2,6 ± 0,6a 37,7 ± 4,3d 26,7 ± 4,1c 7,4 ± 1,0b 25,8 ± 3,6c 45,9 ± 9,6d

0,78 ± 0,02a 1,42 ± 0,03e 0,85 ± 0,02b 0,95 ± 0,02c 0,96 ± 0,03c 1,22 ± 0,02d

0,26 ± 0,06a 5,4 ± 0,6d 2,8 ± 0,5c 0,82 ± 0,14b 2,85 ± 0,41c 5,14 ± 1,0d

8,6 ± 0,2a 12,1 ± 0,1d 10,7 ± 0,1c 10,4 ± 0,1b 11,1 ± 0,2c 10,9 ± 0,2c

3,49 ± 0,5a 17,28 ± 2,0c 9,02 ± 0,7b 20,5 ± 3,3c 8,8 ± 0,9b 9,7 ± 1,8b

0,65 ± 0,02a 0,73 ± 0,01b 0,85 ± 0,01c 0,72 ± 0,02b 0,77 ± 0,03b 1,04 ± 0,03d

0,26 ± 0,04a 1,06 ± 0,15d 0,75 ± 0,07c 1,60 ± 0,20e 0,6 ± 0,07b 0,92 ± 0,17c

7,8 ± 0,1a 9,6 ± 0,2c 9,6 ± 0,1c 9,3 ± 0,1c 9,4 ± 0,1c 8,9 ± 0,2b

1,02 ± 0,07a 16,9 ± 1,5d 11,7 ± 0,9c 8,3 ± 0,4b 9,17 ± 1,35b 8,28 ± 0,40b

0,65 ± 0,02a 1,12 ± 0,03d 0,86 ± 0,01c 0,78 ± 0,02b 0,77 ± 0,03b 0,77 ± 0,02b

0,08 ± 0,01a 1,97 ± 0,18d 1,20 ± 0,18c 0,70 ± 0,03b 0,75 ± 0,12b 0,9 ± 0,1b

6,0 ± 0,1a 9,9 ± 0,2c 10,6 ± 0,1c 11,3 ± 0,d 9,4 ± 0,1b 8,8 ± 0,2b

5,02 ± 0,07a 10,2 ± 1,0c 11,8 ± 0,8c 12,5 ± 0,4d 9,17 ± 1,35b 9,28 ± 0,40b

0,40 ± 0,02a 0,98 ± 0,02d 0,89 ± 0,03c 1,11 ± 0,02e 0,77 ± 0,03b 0,97 ± 0,02d

0,10 ± 0,01a 0,87 ± 0,20d 1,25 ± 0,21c 1,95 ± 0,03e 0,75 ± 0,12b 1,04 ± 0,1c

*Nilai-nilai dengan huruf yang sama adalah tidak berbeda nyata (P<0.05).

150

8
HAMA PADA TANAMAN PENGHASIL GAHARU
Ragil SB Irianto, Erdy Santoso, Maman Turjaman, Irnayuli R. Sitepu
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Tanaman penghasil gaharu yang ada di Indonesia sekitar 27 jenis, beberapa di antaranya yang cukup potensial menghasilkan gaharu yaitu Aquilaria spp., Aetoxylontallum spp., Gyrinops spp., dan Gonystylus spp. Pemanfaatan gaharu di Indonesia oleh masyarakat terutama di pedalaman Pulau Sumatera dan Kalimantan telah berlangsung ratusan tahun yang lalu. Secara tradisional gaharu dimanfaatkan, antara lain dalam bentuk dupa untuk upacara keagamaan, pengharum tubuh dan ruangan, bahan kosmetik dan obat-obatan sederhana. Produk gaharu saat ini sangat dicari oleh para pencari gaharu, karena harganya yang cukup mahal, dimana harga gaharu super dapat mencapai sekitar Rp 40 juta/kg. Akibat dari harga yang cukup tinggi tersebut, maka para pencari gaharu semakin intensif untuk mendapatkannya, saat ini para pencari gaharu mulai memfokuskan mencari gaharu di Pulau Papua yang potensi alamnya (gaharu) masih cukup tinggi dibandingkan dengan di Pulau Kalimantan atau Sumatera.

151

Aspek SILVIKULTUR

Dengan semakin langkanya tanaman penghasil gaharu di lapang dan harganya yang cukup tinggi tersebut, maka para peneliti kehutanan, rimbawan, dan masyarakat awam mulai mendomestikasi atau menanam tanaman penghasil gaharu di luar habitat aslinya. Saat ini banyak sekali para petani maupun orang kota yang mulai menanam tanaman penghasil gaharu dalam skala kecil dari beberapa pohon sampai dengan ribuan pohon. Penanaman tanaman penghasil gaharu yang monokultur dan di luar habitat aslinya pada umumnya akan rentan terhadap serangan hama dan penyakit. Dimulai dua tahun yang lalu banyak sekali sentra penanaman tanaman penghasil gaharu yang terserang hama daun Heortia vitessoides Moore. Sentra penanaman tanaman penghasil gaharu yang terserang hama dan telah dilaporkan terdapat di KHDTK Carita (2008), Sanggau (2007), Mataram (2009), dan lain-lain.

HAMA Heortio vitessoides
A. Gejala Serangan
Gejala serangan tingkat awal adalah permukaan daun yang muda dimakan oleh larva instar pertama dan daun tersebut hanya meninggalkan tulang-tulang daunnya. Pada stadia lebih lanjut ulatulat tersebut mulai menyerang daun-daun pada bagian cabang lebih atasnya dan menyebabkan tanaman menjadi gundul. Ngengat meletakkan telurnya pada bagian bawah permukaan daun yang muda pada cabang tanaman yang dekat dengan permukaan tanah.

B. Siklus Hidup
1. Telur
Ngengat meletakkan telurnya yang berwarna putih kekuningkuningan yang akan segera berubah menjadi kuning kehijauhijauan dalam bentuk kluster pada bagian bawah permukaan daun

152

(Ragil SB Irianto. Larva instar terakhir pada saat akan berkepompong mulai berhenti makan dan ulat turun ke permukaan tanah untuk berkepompong. Ngengat Serangga dewasa berbentuk ngengat yang aktif pada waktu malam.. jumlah telur yang dihasilkan per imago betina berkisar antara 350-500. ulat ini terdiri dari 5 instar dan berlangsung selama 23 hari. 4. 3.. Ngengat (4 Hari) Kepompong (8 Hari) Telur (10 Hari) Larva (23 Hari) Gambar 1. vitessoides pada instar pertama berwarna kuning pucat dan pada instar selanjutnya menjadi hijau kekuning-kuningan. Larva/Ulat Ulat H. dkk. Pupa Larva instar terakhir sebelum berkepompong akan berhenti makan dan turun ke permukaan tanah dengan bantuan benang sutera yang dihasilkannya. vitessoides 153 .) yang muda pada cabang tanaman yang dekat dengan permukaan tanah. Stadium pupa berkisar 8 hari. Stadium ngengat berkisar sekitar 4 hari. Telur akan menetas sekitar 10 hari. Ulat akan membungkus dirinya dengan butiran-butiran tanah atau serpihan-serpihan serasah yang ada di permukaan dengan bantuan benang-benang suteranya. Siklus hidup hama daun tanaman penghasil gaharu H. 2.. Ngengat betina dapat meletakkan telur sebanyak 350-500.Hama pada Tanaman ..

dimana tanaman masih bisa dijangkau oleh orang dengan berdiri tanpa bantuan alat. yaitu dengan cara mengambil ulat atau telur yang ada di tanaman tersebut. dan lain-lain untuk merangsang tumbuhnya tunas-tunas baru. Jangka Pendek 1. dan lain-lain. Predator Rangrang Semut rangrang (Oecophylla smaradigna) merupakan serangga yang mudah ditemukan di kampung-kampung pada tanamantanaman yang banyak mengeluarkan nektar. seperti tanaman nangka. B. Kimiawi Pengendalian kimiawi dapat dilakukan dengan insektisida kontak. sudah populer di tingkat petani. Jangka Menengah 1. Karena hama ini memakan daun dan pada serangan berat umumnya tanaman gundul. sistemik atau dengan insektisida yang berbahan aktif mikroorganisme. 3. rambutan. durian. seperti Beauveria bassiana atau Bacillus thuringiensis. Mekanis Pengendalian mekanis merupakan pengendalian yang sangat sederhana. maka disarankan pada saat penyemprotan dikombinasikan dengan pemupukan lewat daun dengan pupuk daun seperti gandasil.Aspek SILVIKULTUR STRATEGI PENGENDALIAN A. Pengendalian dengan cara ini mudah diaplikasikan terutama pada pesemaian atau bibit yang baru dua tahun. melinjo. Nabati Pengendalian nabati merupakan pengendalian yang cukup sederhana dan dapat dilakukan oleh petani sendiri dengan mengambil bahan-bahan yang ada di sekitar lokasi penanaman tanaman gaharu. Pencarian sarang semut rangrang yang memiliki ratu merupakan salah satu faktor 154 . 2. growmore.

P. J. Semut Sahabat Petani: Meningkatkan Hasil Buah-Buahan dan Menjaga Kelestarian Lingkungan Bersama Semut Rangrang.Hama pada Tanaman . C. Cuc. Musuh Alami Musuh alami. Mele.. P. and S. 2. vitessoides merupakan suatu cara pengendalian yang sangat diharapkan dalam jangka panjang. 2002.. V.) keberhasilan dalam perkembangan populasi serangga tersebut dalam jangka panjang. 155 . DAFTAR PUSTAKA Kalita. V. Geobios 29: 13-16.. Heortia vitessoides Moore A Serious Pest of Agarwod Plant (Aquilaria malaccensis Lamk). C. Agricultural and Forest Entomology 10: 13-22. 2008. P. Teknik Silvikultur Pengendalian dengan cara teknik silvikultur merupakan salah satu cara pengendalian yang sudah menyatu dengan penanaman suatu tanaman dan termasuk pengendalian yang sudah cukup dikenal oleh petani. dkk. Jangka Panjang 1. T. dan N. 59 p. Nath. A Historical Review of Research on The Weaver Ant Oecophylla in Biological Control.(Ragil SB Irianto. Mele. 2004. ICRAF.. R. Bhattacharyya. baik parasit maupun predator dari serangga perusak daun tanaman penghasil gaharu H.. T.

156 .

Aspek SOSIAL EKONOMI DAN KONSERVASI 157 .

158 .

pau d’aquila (Portugis). Gyrinops. chenxiang (China). akan menghasilkan resin/substansi aromatik berupa gumpalan atau padatan berwarna coklat muda sampai coklat kehitaman yang terbentuk pada lapisan dalam dari jenis kayu tertentu sebagai reaksi dari infeksi/ luka tersebut. rusak atau terinfeksi. ood. gaharu (Indonesia). oudh. aloeswood. Aquilaria yang merupakan tanaman penghasil gaharu saat ini menjadi jenis yang dilindungi 159 . Tanaman penghasil gaharu secara alami tumbuh di wilayah Asia Selatan dan Asia Tenggara. oodh (Arab). Sejenis resin beraroma ini berasal dari tanaman jenis Aquilaria. Resin ini sebetulnya dapat melindungi tanaman dari infeksi yang lebih besar sehingga dapat dianggap sebagai sistim imun yang dihasilkan (Squidoo. 2008). Beberapa nama diberikan pada gaharu seperti agarwood. baik disebabkan penyakit atau serangan serangga. dan Gonystylus. dan adlerholz (Jerman).9 PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti Pusat Litbang Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu tanaman hutan yang mempunyai nilai ekonomi tinggi karena kayunya mengandung resin yang harum. Jika tanaman ini terluka. bois d’aigle (Perancis).

Namun karena pengusahaan gaharu memerlukan modal yang tidak sedikit. Salah satu bentuk kemitraan yang dapat dikembangkan adalah pola PHBM (Pengelolaan Hutan Berbasis Masyarakat). Kesepakatan internasional seperti CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) yang disepakati oleh 169 negara ditetapkan untuk menjamin bahwa perdagangan gaharu tidak mengganggu survival dari Aquilaria. dan Kalimantan Selatan. PHBM diharapkan menjadi suatu cara yang efektif karena melibatkan masyarakat sekitar hutan dan parapihak pemangku 160 . tingginya harga gaharu dan makin langkanya tanaman gaharu di hutan alam juga mendorong masyarakat di berbagai daerah untuk melakukan budidaya gaharu seperti yang terjadi di Riau. perlu dikembangkan suatu skema kerjasama antara pemilik modal dengan masyarakat. eksploitasi gaharu secara ilegal ternyata tetap berlangsung dan konsumen yang kurang memahami hal ini secara tidak sadar justru menciptakan permintaan yang tinggi yang dapat membahayakan keberadaan tanaman Aquilaria (Blanchette. permintaan akan gaharu jauh melebihi supply yang ada. maka masyarakat yang mampu membudidayakan gaharu adalah kelompok yang memiliki permodalan yang kuat. Upaya pembudidayaan tersebut makin berkembang karena ditunjang oleh kemajuan hasil penelitian yang menunjukkan bahwa budidaya gaharu memberikan keuntungan yang layak bagi pelakunya. 2008). 2006). Jambi. Sumatera Utara. Sampai saat ini.Aspek SOSIAL EKONOMI DAN KONSERVASI di banyak negara dan eksploitasi gaharu dari hutan alam dianggap sebagai kegiatan ilegal. Untuk mengembangkan budidaya gaharu secara lebih luas. Meskipun demikian. Sebagai akibatnya pada beberapa tahun terakhir ada kecenderungan besar-besaran untuk mambudidayakan gaharu terutama di wilayah Asia Tenggara (Squidoo. Pengembangan budidaya gaharu dengan pola PHBM (sistem bagi hasil) merupakan salah satu alternatif bentuk usahatani produktif yang selain bertujuan untuk mengembangkan budidaya gaharu secara luas juga sekaligus dapat meningkatkan pendapatan masyarakat serta mengurangi tekanan masyarakat terhadap hutan yang tingkat ketergantungannya terhadap hutan tinggi. Di Indonesia.

...... Asosiasi Gaharu Indonesia (Asgarin).. benefit atau penerimaan pada tahun t..... Data dan informasi yang berhasil dihimpun... Data dan informasi serta literatur tersebut dihimpun dari berbagai sumber antara lain.. CITES... biaya pada tahun t..... dan saling mendukung...(Sri Suharti) kepentingan lainnya untuk bekerjasama dan berbagi (ruang..... METODOLOGI Tulisan ini merupakan hasil desk study dari berbagai pustaka..... tingkat diskonto atau potongan (=bunga bank yang berlaku).. NPV atau nilai kini bersih dirumuskan sebagai berikut: n Bt − Ct NPV = ∑ t =0 (1 + i)t ........ BPS.... (1) dimana: NPV Bt Ct i n = = = = = Net Present Value (Nilai Kini Bersih)..... Tulisan ini bertujuan untuk memberikan gambaran tentang prospek pengusahaan gaharu oleh masyarakat melalui pola pengelolaan hutan berbasis masyarakat (PHBM)..... serta berbagai terbitan lainnya. Khusus untuk perhitungan analisis finansial usahatani gaharu digunakan kriteria kelayakan Net Present Value (NPV).... Suatu kegiatan usaha dinyatakan layak secara finansial bila nilai NPV > 0..... Departemen Kehutanan........ IRR atau tingkat pengembalian internal dirumuskan sebagai berut: 161 . umur ekonomi proyek (cakrawala waktu).... diolah dan Dianalisis secara deskriptif... dan data statistik yang tersedia..... saling memperkuat... Internal Rate of Return (IRR). laporan hasil penelitian...Prospek Pengusahaan Gaharu ...... waktu. dan Benefit Cost Ratio (B/C ).... hak dan kewajiban) dengan prinsip saling menguntungkan..

.............. benefit atau penerimaan pada tahun t......... Prospek Pasar Gaharu Indonesia adalah produsen gaharu terbesar di dunia dan menjadi tempat tumbuh endemik beberapa spesies gaharu komersial dari 162 . biaya pada tahun t......... Selanjutnya...............Aspek SOSIAL EKONOMI DAN KONSERVASI IRR = i1 + NPV1 NPV1 − NPV2 (i2 − i1) ......... Kegiatan usaha dikatakan layak apabila B/C > 1...... tingkat diskonto...... (2) dimana: IRR = i1 = NPV1 = i2 = Internal Rate of Raturn (tingkat keuntungan internal)................ nilai B/C dirumuskan sebagai beikut: n Bt ∑ t =0 (1 + i)t B/C = n Ct ∑ t =0 (1 + i)t .... umur ekonomis proyek.. PROSPEK PENGUSAHAAN GAHARU A................. Suatu bisnis dinyatakan layak secara finansial bilai nilai IRR lebih besar dari tingkat suku pinjaman di bank yang berlaku saat ini.......................... (3) dimana: B/C Bt Ct i n = = = = = Benefit Cost Ratio ( Rasio penerimaan-biaya).. nilai NPV mendekati nol positif... NPV2 = nilai NPV negatif mendekati nol... tingkat diskonto untuk menghasilkan NVP2 negatif mendekati nol... tingkat diskonto untuk menghasilkan NPV1 mendekati nol.............

microcarpa.(Sri Suharti) marga Aquilaria seperti A. Selanjutnya. Selain itu. A. karena sulitnya memperoleh bahan 163 . Tingginya harga jual gaharu mendorong masyarakat untuk memburu gaharu. tetapi juga digunakan sebagai bahan baku obat-obatan. Oleh karena itu pada tahun 1995 CITES memasukkan A. filarial. Pada tahun 1985. Hal ini banyak dikeluhkan oleh beberapa eksportir gaharu Indonesia.) dimasukkan dalam Apendix II pada konvensi CITES tanggal 2-14 Oktober 2004 di Bangkok (Gun et al. A. malaccensis.. dan lain-lain. total ekspor gaharu dari Indonesia terus menurun hingga jauh di bawah ambang kuota CITES. A. Semakin sulitnya mendapatkan gaharu di hutan alam telah mengakibatkan semua pohon gaharu (Aquilaria spp. maka sejak tahun 2005 Departemen Kehutanan kembali menurunkan kuota ekspor menjadi hanya 125 ton/tahun (Anonim. Seiring dengan kemajuan ilmu pengetahuan dan teknologi industri. karena adanya kekhawatiran akan punahnya spesies gaharu di Indonesia. Namun dari sisi negara pengekspor. Bahkan sejak tahun 2000. namun eksploitasi hutan alam tropis dan perburuan gaharu yang tidak terkendali telah mengakibatkan spesies-spesies gaharu menjadi langka. 2005). tingginya permintaan gaharu belum dapat dipenuhi karena kekurangan bahan baku bermutu tinggi untuk ekspor. 2005). malaccensis. 2004). dan pengawet berbagai jenis asesoris. Perkembangan yang terjadi selanjutnya ternyata kurang begitu bagus. gaharu tidak hanya digunakan sebagai bahan wangi-wangian (industri parfum).. A. beccariana. hirta. tidak hanya dengan cara memungut dari pohon gaharu yang mati alami melainkan juga dengan menebang pohon hidup.487 ton. beberapa agama di dunia mensyaratkan wangi gaharu yang dibakar sebagai sarana peribadatan (untuk keperluan kegiatan religi).245 kg pada tahun 2005 menjadi 39..400 kg tahun 2006. Permintaan terhadap gaharu terus meningkat karena banyaknya manfaat gaharu. penghasil gaharu terbaik ke dalam daftar Ap-pendix II dan sejak saat itu ekspor gaharu dibatasi oleh kuota yaitu hanya 250 ton/tahun (Anonim. Ekspor untuk pasar Timur Tengah sebagai contoh menurun dari 67. kosmetika. dupa...Prospek Pengusahaan Gaharu . dan Gyrinops spp. jumlah ekspor gaharu Indonesia mencapai sekitar 1.

Hasil pemanenan dan ekspor gaharu jenis Aquilqria spp.000 300.000 Kuota hasil aktual*) n/a 160. yaitu hanya naik menjadi Rp100.000 150. dari Indonesia tahun 1995 . ≠): the reason for the unavailability of data for 1995 1nd 1998 is not known 164 . Penurunan kemampuan ekspor Indonesia tersebut sangat berpengaruh terhadap perkembangan harga gaharu. filarial dan jenis lain 287. Kenaikan pesat terjadi pada saat krisis ekonomi melanda Indonesia tahun 1997.577 293.593 305.649 245. Pada awalnya kenaikan harga gaharu relatif lambat. Sebagai gambaran. Keluhan kekurangan bahan baku gaharu untuk ekspor juga dialami oleh pemasok pasar Singapura.483 147. CV Ama Ina Rua. pada tahun 2006 hanya mampu mengekspor 2-3 ton/bulan (Adijaya.000 75.000 225. Sebagai contoh.079 81.238 81. 2009).000/kg pada tahun 1993.000 50.401 81. Tabel 1.593 287.826 70.002 (termasuk A.filarial 180. **): CITES Annual Report Data Compiled by UNEP-WCMC.523 (termasuk A.000 225.000 75.377 74.245 n/a Tahun 1995 1996 1997 1998 1999 2000 2001 2002 2003 *): CITES Management Authority of Indonesia.212 76.Aspek SOSIAL EKONOMI DAN KONSERVASI baku gubal super yang diminta. baik di pasar dunia maupun di tingkat pengumpul.000 Aktual ekspor berdasar CITES Indonesia*) n/a≠)) 299. Penurunan kemampuan ekspor Indonesia tersebut sudah diprediksi oleh berbagai pihak karena eksploitasi hutan dan perburuan gaharu yang tidak terkendali.150 219.000 120.772 175.000 300.377 74.826 n/a n/a Total ekspor gaharu (semua spesies)*) n/a≠ 299.000 50.2003 Kuota hasil panen resmi*) n/a 300. Pada tahun 1980.000 70.000/ kg untuk kualitas rendah dan Rp 80.000/kg untuk kualitas super. harga gaharu di tingkat pengumpul berkisar antara Rp 30.000 kg) 148. eksportir di Jakarta yang pada tahun 2005 bisa mengekspor 5-6 ton/bulan.546 n/a Net ekspor laporan CITES **) 323.000 68.000 180. pada Tabel 1 disajikan data hasil kajian tentang perdagangan gaharu di Indonesia yang diterbitkan CITES pada tahun 2003.002 n/a ≠) 313.000-50.000 150.

165 . Gaharu dihasilkan oleh pohon-pohon terinfeksi yang tumbuh di daerah tropika dan memiliki marga Aquilaria. Gyrinops.. Kondisi tersebut menggambarkan bahwa gaharu sangat prospektif untuk dikembangkan. Hutan Produksi Tetap 36. A.. Myanmar. dan Gonystilus yang keseluruhannya termasuk dalam famili Thymelaeaceae. malaccensis. tersebar di daerah tropis Asia mulai dari India. Malaysia. beccariana. khususnya bagi Indonesia yang memiliki potensi biologis yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. Thailand. dan Indonesia. Enam di antaranya ditemukan di Indonesia (A.65 juta ha. 2009. microcarpa.Prospek Pengusahaan Gaharu .5 juta ha.31 juta ha. Lao PDR. Pakistan. Kamboja. 2007). sehingga produksi gaharu Indonesia terus menurun.8 juta ha. Hutan Produksi yang Dapat Dikonversi 22. B. A. Hutan Produksi Terbatas 22. Dari kawasan hutan tersebut khususnya dari kawasan hutan produksi alam.. cumingiana.(Sri Suharti) di mana harga gaharu mencapai Rp 3-5 juta/kg. dan Taman Buru 0. dihasilkan gaharu sebagai salah satu hasil hutan bukan kayu yang bernilai ekonomi tinggi. Philipina. Pada saat ini luas kawasan hutan dan perairan Indonesia berdasarkan Keputusan Menteri Kehutanan tentang Penunjukkan Kawasan Hutan dan Perairan serta Tata Guna Hutan Kesepakatan (TGHK) tercatat seluas 137.09 juta ha.6 juta ha. Kenaikan harga gaharu terus berlanjut dan makin tajam hingga mencapai Rp10 juta/ kg pada tahun 2000 dan meningkat lagi hingga mencapai Rp 15 juta/ kg pada tahun 2009 (Adijaya. Hutan Lindung 31. A. Indonesia memiliki potensi yang sangat besar untuk menghasilkan gaharu.23 juta ha (Departemen Kehutanan. Marga Aquilaria terdiri dari 15 spesies.. 2006). China Selatan. A. Wiguna. terdiri dari Kawasan Suaka Alam dan Pelestarian Alam 23. hirta. Potensi dan Peluang Usaha Sebagaimana diuraikan sebelumnya. namun potensi yang tersedia tersebut sampai saat ini belum dimanfaatkan secara optimal dan produksi gaharu lebih banyak berasal dari proses alami.

durian (Rizlani dan Aswandi. 2009) atau di bawah tegakan pohon hutan seperti meranti. Sembilan spesies di antaranya terdapat di Indonesia yaitu di Sumatera. Karena sifat permudaan gaharu yang toleran terhadap cahaya (butuh naungan). Kalimantan. Marga Gonystilus memiliki 20 spesies. 2007). mahoni. Hasil rekayasa tersebut dapat dipanen satu atau dua tahun kemudian. Persyaratan tumbuh serta pemeliharaan tanaman penghasil gaharu relatif tidak terlalu rumit. Marga Gyrinops memiliki tujuh spesies.Aspek SOSIAL EKONOMI DAN KONSERVASI dan A. HTI. penanaman pohon gaharu sebaiknya dilakukan secara tumpangsari atau berada di bawah naungan tegakan lain seperti karet. Peninsula. Keberhasilan berbagai hasil penelitian 166 . Maluku. pulai seperti yang dikembangkan di KHDTK Carita. Sabah. Philipina. 2002). Serawak. Enam di antaranya tersebar di Indonesia bagian timur serta satu spesies terdapat di Srilanka (Anonim. Pemanenan dapat dilakukan pada kondisi pohon belum mati. dan lain-lain). dan Nusa Tenggara. kelapa. Pembudidayaan tanaman penghasil gaharu dapat dilakukan secara monokultur maupun tumpangsari dengan tanaman lainnya. Beberapa alternatif pengembangan budidaya pohon penghasil gaharu selain pada hutan produksi (LOA). kemedangan. Bali. filarial). kecuali Jawa. Setelah tanaman penghasil gaharu berumur 5 tahun dengan diameter 15 cm. dan Irian Jaya. Papua New Guinea. tetapi idealnya dipanen setelah pohon mati dengan variasi mutu produksi akan terdiri dari kelas gubal. Hutan Rakyat juga dapat ditanam pada areal tanaman perkebunan (karet. sawit. dan kepulauan Solomon serta kepulauan Nicobar. dan abu/ bubuk (Sumarna. Berbagai hasil penelitian tentang tanaman gaharu memberikan hasil yang sangat menggembirakan karena berbagai jenis tanaman gaharu dari hutan alam ternyata dapat dibudidayakan dan produksi gaharu dapat direkayasa. sawit. Bali. Keenam jenis tersebut terdapat hampir di seluruh kepulauan Indonesia. rekayasa produksi untuk menghasilkan gaharu sudah dapat mulai dilakukan dengan cara teknik induksi/inokulasi penyakit pembentuk gaharu yang sesuai dengan jenis pohon. tersebar di Asia Tenggara mulai dari Malaysia. Indonesia. Jika ditanam secara monokultur dan tanpa naungan resiko kegagalan penanaman (tanaman muda) lebih tinggi.

2. dan kelas kemedangan III sebesar 50%. sehingga kerapatan 400 pohon per hektar. sehingga total produksi 480 kg/ha dengan 3 kualitas masingmasing kelas kemedangan I sebesar 10%. 167 . yang menanam gaharu dari jenis A. Kelayakan Pengusahaan Gaharu Untuk memperoleh gambaran bagaimana kelayakan pengusahaan gaharu melalui budidaya dan rekayasa produksi gaharu. kelas kemedangan II sebesar 40%. Pengusahaan gaharu dilakukan pada luasan satu ha dengan jarak tanam 5 m x 5 m. PT Budidaya Perkasa di Riau dengan menanam A.. Selanjutnya pada tahun 2001-2002 beberapa individu atau kelompok tani juga mulai tertarik untuk membudidayakan jenis pohon penghasil gaharu. malaccensis seluas lebih dari 10 hektar. Sebagai contoh usaha yang dilakukan oleh para petani di Desa Pulau Aro. Tanaman yang bertahan hidup dan menghasilkan gaharu diasumsikan 60% dengan tingkat produksi 2 kg per pohon. Kabupaten Merangin.. Di desa tersebut.(Sri Suharti) tersebut makin mendorong dan menggugah pemburu gaharu untuk melakukan budidaya tanaman gaharu. microcarpa. Upaya pembudidayaan gaharu sudah mulai dirintis sejak tahun 1994/1995 oleh sebuah perusahaan pengekspor gaharu.Prospek Pengusahaan Gaharu . Kecamatan Tabir Ulu.. Analisis finansial tersebut menggunakan beberapa batasan dan asumsi sebagai berikut: 1. malacensis dan A. C. sampai akhir tahun 2002 terdapat sekitar 116 petani yang tergabung dalam Kelompok Tani Penghijauan Indah Jaya yang telah mengembangkan lebih dari seratus ribu bibit gaharu (Anonim. 2007). Selain itu. Selain itu Dinas Kehutanan Riau juga menanam jenis yang sama seluas 10 hektar di Taman Hutan Raya Syarif Hasyim. Jambi. BP DAS Batanghari bekerjasama dengan Badan Litbang Kehutanan pada 2004/2005 membuat demplot budidaya gaharu di antara tegakan tanaman karet rakyat seluas 50 ha (Sumarna. 2008). berikut ini dilakukan contoh analisis finansial budidaya gaharu dengan asumsi tingkat keberhasilan mencapai 60%..

2009). biaya bahan dan peralatan Rp 40. sedangkan upah tenaga kerja untuk inokulasi Rp 30. dan biaya tenaga kerja Rp 74. Harga inokulan diasumsikan Rp 50. Biaya tersebut meliputi biaya pra-investasi dan persiapan lahan serta penanaman sebesar Rp 26. 4. baik tenaga kerja keluarga maupun luar keluarga diasumsikan sebesar Rp 50.350 juta.000/pohon.350 juta. Upah tenaga kerja.32 (Lampiran 1). sehingga total biaya inokulan Rp 20 juta/ha. dan B/C = 3.000/HK. Kalau diperhatikan lebih seksama. 5. kelas kemedangan II = Rp 2 juta/ kg. 6.50 juta. dan kelas kemedangan III = Rp 500 ribu/kg. Berdasarkan asumsi dan batasan tersebut ternyata untuk pengusahaan satu hektar gaharu dibutuhkan biaya sebesar Rp 141. beban biaya yang relatif besar adalah untuk pembelian bahan inokulan. dan tenaga kerja untuk pemungutan hasil (panen) yang besarnya mencapai Rp 77 juta atau sekitar 54.74 juta/ ha. Namun di sisi lain juga dijumpai beberapa kasus ketidakberhasilan pengusahaan gaharu yang disebabkan antara lain oleh kegagalan dalam pemeliharaan. Analisis finansial menggunakan tingkat diskonto sebesar 15%. tenaga kerja untuk inokulasi. Harga jual produksi gaharu hasil inokulasi untuk kelas kemedangan I = Rp 5 juta/kg. kegagalan dalam melakukan inokulasi.50 juta.Aspek SOSIAL EKONOMI DAN KONSERVASI 3. dan adanya pencurian pohon di kebun gaharu (Duryatmo.53%.000/pohon. Peluang Pengembangan Gaharu dengan Pola PHBM Pembudidayaan tanaman penghasil gaharu akhir-akhir ini makin marak karena sebagian masyarakat sudah dapat menikmati hasilnya.47% dari total biaya. PROSPEK PENGUSAHAAN GAHARU DENGAN POLA PHBM A. IRR sebesar 48. 168 . Hasil analisis finansial menunjukkan bahwa pengusahaan gaharu tersebut layak untuk dilaksanakan karena dapat menghasilkan keuntungan bersih nilai kini (NPV) sebesar Rp 147.

baik dalam areal hutan milik (hutan rakyat) maupun dalam kawasan hutan Negara. maka parapihak yang terlibat dalam kegiatan ini dapat memperoleh bagian/ sharing manfaat sesuai kontribusi masing-masing. Salah satu bentuk kemitraan yang dapat dikembangkan adalah melalui pola pengelolaan hutan berbasis masyarakat (PHBM). 2009). dan di sisi lain. akses pasar.(Sri Suharti) Untuk lebih membudayakan penanaman gaharu secara luas. Di satu sisi masyarakat dapat mendayagunakan potensi-potensi kehutanan untuk kesejahteraan mereka. perlu dikembangkan suatu pola kemitraan dalam budidaya tanaman penghasil gaharu. parapihak yang tertarik (pemerintah. Masyarakat dengan keterbatasan sumberdaya yang dimiliki (lahan. baik di lahan milik di luar kawasan hutan maupun di kawasan hutan.. keterampilan.Prospek Pengusahaan Gaharu . dan pengelolaan hutan (Hayat. PHBM merupakan salah satu jawaban dari pergeseran paradigma dalam pengelolaan sumberdaya hutan dari yang berbasis negara (state based) ke arah yang berbasis komunitas/masyarakat (community based) (Indradi. Melalui pola PHBM. sarana prasarana.. 2007). Dengan pola ini diharapkan areal tanam dan juga kualitas dan kuantitas produksi gaharu akan dapat ditingkatkan. Pengembangan gaharu melalui pola PHBM merupakan salah satu alternatif peningkatan produksi gaharu melalui pelibatan masyarakat dalam budidaya gaharu. pengusaha/investor. meningkatkan peluang keberhasilan serta mengurangi resiko kerugian yang diderita. Perubahan paradigma ke arah PHBM menjadi momentum penting bagi masyarakat desa hutan. masyarakat di dalam dan di sekitar kawasan hutan dapat menjadi aset bagi usaha-usaha penjagaan. kelompok usaha bersama/koperasi. input produksi. Pada areal hutan milik. Karena bentuk kerjasamanya adalah kemitraan.. masyarakat) dapat berbagi peran dan tanggung jawab untuk mengembangkan tanaman gaharu. 169 . masyarakat diharapkan melakukan penanaman gaharu pada lahannya sendiri terutama pada lahan kosong (tidak produktif ) secara swadaya. Pengembangan gaharu dengan pola PHBM dapat dilakukan. pemeliharan. dan lain-lain) dapat ikut berperan dalam pengusahaan tanaman gaharu..

Pengembangan tanaman gaharu dalam kawasan hutan dapat dilakukan melalui pelibatan masyarakat sekitar hutan dalam pengelolaan hutan. maka pola tanam yang dikembangkan adalah pola tumpangsari (sisipan atau tanaman sela di antara tegakan yang sudah ada). baik berupa pengadaan bibit. maka perlu diberikan berbagai bentuk insentif. sosial maupun ekologi. biaya inokulasi tanaman maupun informasi tentang peluang dan teknik pengembangan gaharu. Dampak positif yang terjadi selanjutnya adalah sumberdaya hutan akan lebih terjaga dan terpelihara. baik secara ekonomi. Keterlibatan masyarakat dalam pengelolaan hutan meningkatkan posisi tawar serta rasa memiliki masyarakat terhadap sumberdaya hutan yang ada. produktivitas meningkat serta kesejahteraan masyarakat akan meningkat pula. Dalam prakteknya pengembangan hutan rakyat gaharu umumnya dikombinasikan dengan tanaman semusim atau tahunan lainnya yang sudah ada (tanaman sisipan). biaya tanam. Berbagai hasil penelitian menunjukkan bahwa pola kerjasama kemitraan pengelolaan hutan dengan masyarakat desa hutan memberikan dampak positif.Aspek SOSIAL EKONOMI DAN KONSERVASI Agar masyarakat bersedia menanam gaharu. Adanya peningkatan kesejahteraan dari budidaya gaharu selanjutnya akan mengurangi tekanan masyarakat terhadap sumberdaya hutan dalam bentuk illegal logging dan perambahan lahan bahkan masyarakat secara sadar akan mempertahankan 170 . Hal ini sesuai dengan paradigma pembangunan kehutanan yang lebih menitikberatkan pada peningkatan partisipasi masyarakat dalam pengelolaan hutan dan menempatkan masyarakat desa hutan sebagai patner/mitra menuju pengelolaan hutan lestari. baik dalam bentuk bantuan/hibah maupun melalui sistim kredit yang akan dibayar jika tanaman gaharu telah menghasilkan nantinya. Oleh karena kawasan hutan umumnya sudah ditumbuhi dengan berbagai jenis tumbuhan. proporsi tanaman gaharu yang ditanam disesuaikan dengan luasan dan kondisi areal hutan milik yang ada. Oleh karena lahan milik rakyat umumnya tidak begitu luas dan sudah ditumbuhi berbagai jenis tanaman. Pengadaan bibit dan inokulasi dapat difasilitasi oleh mitra kerjasama yang disalurkan kepada petani.

Pengembangan kerjasama memang layak secara ekonomi dalam jangka panjang (sesuai jangka waktu kontrak perjanjian kerjasama). B. Menempatkan masyarakat sebagai mitra dalam pengelolaan hutan secara tidak langsung juga telah memposisikan masyarakat sebagai garda terdepan dalam pengamanan sumberdaya hutan. pemeliharaannya relatif mudah dan bernilai ekonomi tinggi. apapun penyebabnya (Aswandi. Sistim Bagi Hasil dalam PHBM Pengembangan gaharu dengan pola PHBM merupakan salah satu alternatif usaha yang dapat mengakomodasikan kepentingan ekologi di satu sisi dan pertimbangan ekonomi di sisi lain. Tanaman gaharu dipilih karena tanaman ini dapat tumbuh di dalam areal hutan yang sudah banyak ditumbuhi tegakan pohon dengan intensitas cahaya < 70%. 171 . Beberapa skenario sebagai alternatif bentuk kemitraan yang dapat dikembangkan antara lain sebagaimana disajikan dalam Tabel 2. Adanya tujuan bersama yang ingin dicapai... 3. 4. Dari sisi masyarakat. Adanya pengaturan kerjasama yang saling menguntungkan dan adil sesuai dengan kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan bersama.. Adanya kesepahaman tentang resiko dan konsekuensi dari adanya perjanjian kerjasama tersebut.(Sri Suharti) setiap jengkal hutan dari kerusakan. 2. pengembangan gaharu dengan pola PHBM memberikan peluang kepada masyarakat untuk memperoleh manfaat ganda yaitu dari hasil tanaman gaharu jika telah menghasilkan nantinya serta kesempatan untuk memanfaatkan lahan di antara tanaman untuk usahatani tanaman semusim. 2009)..Prospek Pengusahaan Gaharu . Beberapa prinsip utama yang dipegang dalam pengembangan gaharu dengan pola PHBM adalah: 1.

sepanjang modal yang dimiliki mencukupi untuk biaya budidaya tanaman berikut biaya inokulasinya yang cukup besar. baik dari segi permodalan. Sebagaimana sifat usahatani skala kecil oleh masyarakat yang ketergantungannya terhadap lahan usahatani yang dimiliki/digarap sangat tinggi. Alternatif bentuk kemitraan yang dapat dikembangkan Jenis input Skenario I 1 Lahan Saprodi Tenaga kerja Bahan inokulan Biaya inokulasi Pengolahan hasil Pemasaran √ √ √ √ √ √ √ 2 3 Skenario II 1 √ √ √ √ √ √ √ 2 3 Skenario III 1 √ √ √ √ √ √ √ √ √ √ √ √ 2 3 Skenario IV 1 2 3 √ √ Keterangan: 1. Gaharu diusahakan sebagai investasi jangka panjang. 3. tergantung luas lahan garapan dan kepadatan tanaman yang ada. maka gaharu bukan merupakan komoditi utama yang diusahakan. Petani.Aspek SOSIAL EKONOMI DAN KONSERVASI Tabel 2. Berbeda dengan pengusahaan gaharu skala besar yang dilakukan oleh para investor. Investor/Pengusaha. Konsekuensinya. Dengan demikian meskipun investor/penyandang dana 172 . teknologi serta akses terhadap pasar dapat ikut berpartisipasi dalam budidaya tanaman gaharu. diharapkan masyarakat yang memiliki banyak keterbatasan. Dengan pola PHBM. Besarnya bagi hasil yang diperoleh oleh masingmasing pihak yang terlibat dalam PHBM disesuaikan dengan kontribusi masing-masing pihak dan merupakan hasil kesepakatan bersama. budidaya gaharu oleh masyarakat umumnya dilakukan dalam skala kecil dengan pola campuran. populasi tanaman gaharu dalam setiap garapan petani berjumlah relatif sedikit serta tidak seragam. pengembangan gaharu dengan pola PHBM dapat dilakukan di areal hutan milik maupun di dalam kawasan hutan sepanjang persyaratan tumbuhnya terpenuhi. 2. Pemda/Pihak lain Sebagaimana diuraikan sebelumnya.

Kegiatan dilaksanakan dengan melibatkan masyarakat yang telah berusahatani di areal tersebut untuk ikut mengembangkan tanaman penghasil gaharu di lahan garapan mereka. petai. Dengan demikian jumlah 173 . Selama ini masyarakat ikut menggarap lahan di Petak 21 dengan budidaya berbagai tanaman jenis pohon serbaguna (JPSG) dan buah-buahan seperti melinjo. Gaharu ditanam dengan jarak ± 5 m x 5 m. Banten pada tahun 2008 telah dikembangkan uji coba skema kemitraan budidaya tanaman penghasil gaharu dengan pola PHBM. Kegiatan dilaksanakan pada sebagian Petak 21 di areal KHDTK Carita dengan luas ± 40 hektar... Oleh karena areal kerjasama sudah ditumbuhi berbagi jenis tumbuhan. Banten. Apalagi jika pengembangan kemitraan dengan pola PHBM bertujuan untuk meningkatkan kelestarian sumberdaya hutan (dalam hal ini tanaman gaharu yang sudah langka) dan meningkatkan kesejahteraan masyarakat desa hutan dan bukan semata-mata untuk tujuan komersial (mendapat profit terbesar). di areal tersebut juga terdapat berbagi pohon hutan seperti meranti. khaya. durian. cengkeh. belum tentu bagian hasil/sharing yang diperolehnya akan paling besar pula. mahoni. pulai.. C. maka pola tanam yang diterapkan adalah pola tumpangsari (sisipan di antara tanaman yang ada). jengkol. Uji coba ini merupakan kerjasama antara Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam dengan masyarakat sekitar areal KHDTK Carita..Prospek Pengusahaan Gaharu . dan nangka. dan Cilaban sebanyak 49 orang (anggota Kelompok Tani Hutan Giri Wisata Lestari yang dipimpin Ustad Jafar sebanyak 40 orang dan Kelompok Tani Hutan Carita Lestari pimpinan Pak Rembang sebanyak 19 orang). dan hawuan. Uji Coba Pengembangan Gaharu dengan Pola PHBM di KHDTK Carita Di areal KHDTK Carita. Cangkara. Selain tanaman JPSG milik masyarakat. Kelompok masyarakat yang terlibat dalam kegiatan penelitian ini berasal dari Desa Sindang Laut dan Desa Suka Jadi tepatnya dari Kampung Longok.(Sri Suharti) memberikan kontribusi input dengan porsi terbesar.

Beberapa prinsip utama yang disepakati antara pihak pertama (Puslitbang Hutan dan Konservasi Alam) dengan pihak kedua (kelompok masyarakat peserta uji coba) dalam pola kemitraan di areal KHDTK carita adalah: 1. Pihak pertama menyediakan jamur pembentuk gaharu untuk kegiatan inokulasi sebanyak 25% dari jumlah tanaman gaharu pada masing-masing penggarap setelah tanaman gaharu berumur ≥ 5 tahun. Sebelum penanaman. dan masyarakat calon peserta untuk mempelajari prospek partisipasi masyarakat dalam kegiatan dan pemeliharaan tanaman.000 pohon (± 400 pohon/ha). 5. 174 . 3. Pihak pertama menyediakan biaya bagi pihak kedua untuk melakukan kegiatan budidaya penanaman pohon gaharu yang meliputi biaya upah dan bibit tanaman. Pihak pertama memberikan pembinaan teknis budidaya tanaman gaharu secara rutin kepada pihak kedua. 2. Pemda.Aspek SOSIAL EKONOMI DAN KONSERVASI tanaman gaharu yang ditanam di areal kerjasama sebanyak 15. 4. Pihak pertama akan membantu mencarikan investor untuk bekerjasama menyediakan produksi jamur pembentuk gaharu untuk kegiatan inokulasi untuk 75% tanaman gaharu lainnya. Dengan pendekatan yang lebih intensif ini diharapkan masyarakat akan lebih memahami tujuan kerjasama penelitian serta dapat lebih aktif berpartisipasi dalam budidaya tanaman plot uji coba. kegiatan pembangunan demplot uji coba tanaman penghasil gaharu di KHDTK Carita diawali dengan pendekatan yang lebih intensif kepada berbagai pihak yang terkait pengembangan gaharu di areal tersebut seperti Perhutani. Pihak pertama akan memberikan pelatihan budidaya gaharu serta pemanenan gaharu (paket training gaharu) kepada pihak kedua. Setelah diperoleh gambaran prospek partisipasi masyarakat dalam pembangunan demplot uji coba ini dilanjutkan dengan penyusunan rancangan teknis kerjasama penelitian dan penyusunan draft perjanjian kerjasama.

Prospek Pengusahaan Gaharu . Pihak kedua berkewajiban mengikuti aturan teknis dan kaidah konservasi yang berlaku di dalam areal KHDTK Carita. 10. pihak pertama dan pihak kedua memperoleh hasil tanaman gaharu yang ditanam dan dipelihara di lokasi kerjasama dengan proporsi masing-masing 35% untuk pihak pertama dan 60% untuk pihak kedua. Jika sudah menghasilkan.. baik pada tanaman gaharu atau tanaman lainnya di areal kerjasama. 8. Selain pihak pertama dan pihak kedua.5%.(Sri Suharti) 6. Jika pada saat pemanenan tanaman gaharu ternyata ada tanaman yang mati/hilang/tidak/belum menghasilkan.. maka resiko akan ditanggung bersama sehingga perhitungan bagi hasil pada saat panen ditentukan dengan rumus sebagai berikut: = P akhir ∑ tan total − ∑ tan mati x P awal ∑ tan total Keterangan: Pakhir = Proporsi bagi hasil tanaman gaharu yang diterima masingmasing pihak jika ada tanaman yang mati/hilang/tidak/ belum menghasilkan = Proporsi bagi hasil tanaman gaharu sesuai kesepakatan yang tertuang dalam perjanjian kerjasama ini Pawal Butir-butir kesepakatan tersebut tertuang dalam naskah perjanjian kerjasama yang disusun berdasarkan hasil kesepakatan/ negosiasi antara pihak pertama dan pihak kedua. Pihak kedua berkewajiban memelihara dan menjaga keamanan tanaman gaharu dan tanaman hutan lainnya. 9.. kebakaran atau bencana lain yang mengakibatkan kerusakan sumberdaya hutan.. sebagian hasil tanaman gaharu akan diberikan pada Desa Sindang Laut sebesar 2. Pihak kedua berkewajiban melaporkan setiap kejadian seperti serangan hama/penyakit tanaman. 7. 175 .5% dan LMDH (kelompok) 2.

2. DAFTAR PUSTAKA Adijaya.dephut.co.74 juta/ha.id/mod. dan ekologi. Anonim. Trubus online. 2009. Skema kemitraan dengan pola PHBM memberikan kesempatan kepada para-pihak yang berminat mengembangkan tanaman gaharu untuk bekerjasama sesuai dengan input/sumberdaya yang dimiliki dan memperoleh bagian hasil/sharing sesuai dengan kontribusi serta kesepakatan parapihak yang terlibat. http:// www.id/ Halaman/STANDARDISASI_& _LINGUNGAN_ KEHUTANAN/INFO_V02/VI_V02. 176 .online. ekonomi. GAHARU: HHBK yang Menjadi Primadona. meningkatkan produktivitas lahan serta meningkatkan pendapatan masyarakat sekitar hutan. Prinsip utama yang dipegang dalam pengembangan kerjasama kemitraan dengan pola PHBM adalah prinsip kelestarian dan kelayakan secara ekonomi dalam jangka panjang sesuai jangka waktu kontrak serta saling menguntungkan berdasarkan nilai kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan sosial. 5. D.go. Kerjasama kemitraan pengembangan tanaman penghasil gaharu dengan pola PHBM merupakan salah satu alternatif solusi untuk menjaga kelestarian hutan. Gaharu sangat prospektif untuk dikembangkan. dan B/C = 3. Diakses 20 Januari 2009. Gaharu: Harta di Kebun. http:// www. khususnya bagi Indonesia yang memiliki potensi biologi yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu.trubus. IRR sebesar 48. 4.php?mod=publisher&op =viewarticle&cid=8 &artid=290.htm.Aspek SOSIAL EKONOMI DAN KONSERVASI KESIMPULAN DAN SARAN 1.53%. Diakses 16 Februari 2009.32. Info Pusat Standardisasi dan Lingkungan Departemen Kehutanan. 3. Budidaya gaharu layak untuk dilaksanakan karena secara finansial akan memberikan keuntungan bersih nilai kini (NPV) sebesar Rp 147. 2002.

177 .ffi. Diakses 13 Januari.. Sumari and P. Mencari Solusi PHBM di Geumpang..org/index. Eaglewood in Papua New Guinea. 2009. A. Perkembangan Gaharu dan Prospeknya di Indonesia.. Vietnam. 51. http://www. Duryatmo. Departemen Kehutanan. http://forestpathology.. Anonim. 12 Februari.php ?option=com_content&task= view&id= 74&Itemid=1..html. dan Aswandi.. Sustainable Agarwood Production in Aquilaria Trees. Statistik Kehutanan Indonesia 2006.blogspot.umn. Access November.org/eng /com/PC/14/EPC14-09-02-02-A2.pdf. Hayat. 2003. Di akses 4 Maret 2009.htm. http://fwi. Trubus online. Gun. 2009.com/2008/01 /perkembangangaharu-dan-prospeknya-di. Z.or. Diakses 16 Februari 2009. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES).php?mod=publisher &op=viewarticle&cid=1& artid=1618.. http://bpk-aeknauli. http://www.id. P. S.id/id/news /1/tahun/2007/bulan/11/tanggal/17/id/ 60/. M.cfans. Depatemen Kehutanan. Review of Significant Trade Aquilaria malaccensis. com/gaharu. htm.blogspot. 2006. 2009. 2008.id/mod. L. Blanchette.bticnet. B. Prospek Budidaya Gaharu Secara Ringkas. BUDIDAYA GAHARU : Alternatif Pemberdayaan Masyarakat Desa Hutan. Indradi. Diakses 16 Februari 2009. Diakses. Rizlani. http://laksmananursery. Y. Diakses 4 Maret 2009. 2009. Tersandung Wangi Gaharu. 2007. Tropical Rain Fo rest Project. 2009. Diakses 16 Februari 2009.Prospek Pengusahaan Gaharu . http:// www. C. Jakarta. Sungadan. BIOTROP Training and Information Centre. 2005. 2009.(Sri Suharti) Anonim. Chatteron. or.trubus-online. Diakses 16 Februari 2009. 3 2008. Perjalanan Panjang Pengelolaan Hutan Berbasis Masyarakat di Indonesia. Aswandi. Steven. Anonim. R. http:// www. 2007. Working paper No.edu/ agarwood.cites.co. (2004).html.com/2009/01/ prospek-budidaya-gaharu-secara ringkas. Pelatihan Nasional: BUDIDAYA DAN PENGOLAHAN GAHARU. http:// forestry-senu57.

Budidaya dan Rekayasa Produksi Gaharu.3 2008.online. Tinggi Permintaan Terganjal Pasokan. squidoo. . Trubus online. Squidoo. 2006. I. LLC and respective copyright owners. Y.co. Direktorat Jenderal RLPS. Diakses 16 Februari 2009. 2007.trubus. http://www. 2008.php?mod =publisher&op=viewarticle& cid=8 &artid=290. Temu Pakar Pengembangan Gaharu. http://www. Squidoo. Jakarta. Wiguna. Production and marketing of cultivated agarwood. Access November.id/mod.Sumarna.com/agarwood Copyright © 2008.

Lampiran 1. Tenaga kerja upahan 3.53% 3.000/phn. KCl Rp 6000/kg.Lampiran 1. Sewa lahan 4. Persiapan lahan & tanam 3. Cash inflow (Rp 1000) a. Pra-investasi 2. Pupuk Urea 3. Pupuk TSP/SP-36 4. IV. Nilai output Gaharu kemedangan I (10%) Gaharu kemedangan II (40%) Gaharu kemedangan III (50%) Cash outflow (Rp 1000) a.742 48. TSP Rp 7000/kg. IRR. IRR (%) c. Keterangan I. dan B/C dari Pengusahaan tanaman gaharu per hektar 0 0 0 0 0 0 0 0 0 480 744000 240000 384000 120000 0 0 1250 0 1250 0 375 1050 900 300 0 0 2625 0 250 700 600 300 300 0 2150 0 0 0 0 0 0 0 0 1 2 3 4 5 Tahun ke6 7 8 Total No. Pupuk kandang 6. Pupuk KCl 5. Peralatan pertanian 7. 500 3000 1250 250 5000 0 0 0 0 0 250 0 250 6750 125 350 300 150 0 0 7675 0 125 350 300 300 0 0 1075 0 250 700 600 300 0 0 1850 0 250 700 600 300 250 0 2100 0 375 1050 900 300 0 20000 22625 0 2500 2500 250 5250 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 500 5500 20000 500 26500 6750 1750 4900 4200 1950 800 20000 40350 III. Tenaga kerja inokulasi Biaya tenaga kerja Total biaya Cash flow Cash flow komulatif a.000/tanaman . B/C 0 0 0 0 5250 -5250 -5250 147. Harga bibit Rp 15. Biaya tenaga kerja 1. 744000 II. Biaya bahan & peralatan 1.3176 2500 1000 0 3500 16425 -16425 -21675 2500 1000 0 3500 7075 -7075 -28750 2000 500 0 2500 6850 -6850 -35600 1500 500 0 2000 6600 -6600 -42200 1500 500 12000 14000 39125 -39125 -81325 1500 500 0 2000 7125 -7125 -88450 1500 500 0 2000 6650 -6650 -95100 20000 25000 0 45000 46250 697750 602650 33000 29500 12000 74500 141350 602650 179 Catatan: Produksi gaharu 480 kg/ha dengan harga rata-rata Rp 1. jumlah tanaman 400 phn/ha dibutuhkan 450 phn dg sulaman. Output (kg) b. Pra investasi 1. K2= Rp 2 juta/kg dan K3=Rp 500. dan pupuk kandang Rp 150/kg Harga inokulan Rp 50. Harga pupuk urea Rp 2500/kg.000/kg Harga gaharu K1= Rp 5 juta/kg. Analisis NPV.000/kg. Tenaga kerja keluarga 2. NPV (DF 15%) b. Lain-lain Biaya pra investasi b.550. Bahan inokulan Biaya bahan & peralatan c. Bibit tanaman gaharu 2.

Aspek SOSIAL EKONOMI DAN KONSERVASI 180 .

Therefore there is a big opportunity for the Indonesian farmers to establish eaglewood plantation. soil properties and plant diversity surrounding the newly grown and existing gaharu stands in South Kalimantan Province. This is because. the gaharu production may be considered low. the gaharu export market remains open. The success of gaharu formation may not be only due to inoculants but may also be influenced by environmental characteristics (climate. namely. climate. 181 . South Kalimantan INTRODUCTION Eaglewood (gaharu) may play an important role in gaining foreign exchange and as a source of income for people living in out. In South Kalimantan. Most of the gaharu formation usually relays on natural infection. The present work focused on characterizing the environment.10 THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo Lambung Mangkurat University. Only small group of farmers using introduced inoculants.and in-side the forest in Indonesia. There is a lack of information on factors influencing the success of gaharu formation. soil properties and plant species).

0 oS 3.4 3. Location-wise. Hulu Sungai Selatan (HSS) and Hulu Sungai Tengah (HST).5 Layuh (2.6 2. 182 .0 2.1 115. Climatic Characters The climate parameters collected were rainfall. Site Distribution of selected sites for the project can be seen in Figure 1. The data obtained were for the last 9 years observation.8 km 115.2 Belanti (3) (HSS) Rejo (Banjar) 115.3 North 115. HST) Aluan (3) (HST) Bawan (HST) Gading (HST) Batung (HST) Layuh (HKK) (HST) Rasau (HST) Kambat (2. The selected study sites B. air temperature and relative humidity.2 3.8 3. The data were supplied by the Weather Bureau in Banjarbaru.Aspek SOSIAL EKONOMI DAN KONSERVASI METHODS A. HST) Kalaka (HST) Kandangan (HSS) Madang (HSS) 115.7 Wawai (HST) 115.4 2. 115. 14 sites would be used for newly planted eaglewood trees and 9 sites for inoculation trial. South Kalimantan.6 Figure 1. The sites located in Banjar.6 22.4 oE 115. The climatic data for all sites were represented by Kandangan weather station. The selected site were used for growing eagle wood and inoculation.

In each site. total nitrogen (N).(Erry Purnomo) C. 183 .. Method used for particle fraction analysis was described in Klute (1986) and the methods for other soil properties were described in Page et al. Plant Diversity The diversity of plant species was determined to show its association with the success of inoculation. The average annual rainfall in the study area was 2361. D.. and CO2 evolution. total potassium (K) and total phosphorus (P). plant species grown under gaharu tree were collected plant within area of 6x6 m2. cation exchange capacity (CEC). electric conductivity (EC). The pattern of air temperature and relative humidity are shown in Figure 2b and 2c. RESULTS A. (1982).The Environmental Characteristics . A significant low rainfall occurred in the period of July-September. air temperature and relative humidity for the last 9 years are shown in Figure 2. Soil Properties Soil properties measured were particle fraction analysis. The rainy season commenced in October and ended in July each year. respectively. The rainfall distribution can be observed in Figure 2a.72 mm. the content of total carbon (C). soil pH. Climatic Characters The average rainfall...

air temperature [b] and relative humidity [c] for the last 9 years. the content of total carbon (C). Soil properties measures were particle fraction analysis. Bars indicate the standard error mean 9 years observation B. The particle fraction analysis (Figure 3) shows that all soil samples dominated by slit fraction. Soil Properties The soil properties of each site are presented in Figures 3-11. Total nitrogen (N). 184 . soil pH. total potassium (K) and total phosphorus (P). and CO2 evolution. level of status of each soil property will be made available as categorized by Djaenuddin et al. electric conductivity (EC).Aspek SOSIAL EKONOMI DAN KONSERVASI 500 [a] 400 30 [b] 29 Air temperature (oC) 30 [b] 29 Rainfall (mm) 300 200 100 28 27 26 25 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month Air temperature (oC) 28 27 26 25 0 l t r r r r ary ary rch pri May June July gus mbe tobe mbe mbe nu ru Ma A Au pte Oc ove ece Ja Feb N D Se Month Figure 2. The rainfall [a]. cation exchange capacity (CEC). (1994). followed by clay and sand fractions. If applicable.

It was found that Wawai and Belanti 13 sites had very low and moderate levels of N content. The K and P contents of the soils from all sites are demonstrated in Figures 6. Most of the selected sites contained very low C. namely.. respectively.5 0. Mandala and Madang Low had K content of moderate level.16 gsa da i H i 15 T Lan Man Waw and Waasauyuh K ang ur Gaat (2Belandang angk M R La Mad Ha mb H Ma Ka Site Figure 4.5 Total C content (%) 1. Most of the soil classified as very low to low level of K concentration.0 Low 1. only 5 sites had low C.0 0.0 Very low Be ti lan t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin .. The low level of C and N content confirms the low level of organic matter content of the soil. Particle fraction analysis of each soil 2.The Environmental Characteristics .16 angsa andala awai dingin awa au (10 Kate g Hig adin (2 & 3 lanti 1 ng Lo gkinkin W as M W Man uh an aur G bat da Han Be TL R Lay Mad H Ma Kam Site Figure 3..5 Moderate 2. Two sites.(Erry Purnomo) The category range of total C total content was very low to low (Figure 4). 100 80 60 Sand Silt Clay % 40 20 0 n Bela 5 ti 1 t ) ) i s 3 g h 3 w .. The N content of the soils (Figure 5) was generally low. The total C of soil for each site 185 .

there were 3-5 plant species. C.15 0.Aspek SOSIAL EKONOMI DAN KONSERVASI 0. except for Hangkinkin site. The low EC readings indicate the absence of salinity problem. Only one site (Belanti 13) had a slightly acidic value (Figure 8). There were 3 sites and 2 sites had CEC of moderate and high. The total N of soil for each site One site (Rasau 10) had a very high K level.00 Very low la n Be 16 ngsat dalawai 3 inginawai (10) ates High ding & 3) ti 13 Low inkin n a d W sau h K ng r Ga t (2 elan ang ngk 5ti 1 T La Ma W Man B ad Ha Ra Layu ada Hau mba M M Ka Site Figure 5. The CEC of the soils were commonly low (Figure 10).05 0. Except.10 0. Only one site (Rasau 10) was categorized as very high (Figure 7). The low CEC indicates a low storage cation capacity and results in prone to cation leaching. Number of Plant Species It was observed that the number of plant species was varied from site to site (Figure 12). At 5 sites. 186 .20 Total N content (%) Low 0. For EC reading. The CO2 evolution as an indication microbial activity was similar site-wise (Figure 11). it was observed that the microbial was lower than the other sites. at Madang Low. Most of total P content of the soils was categorized as very low to low.25 Moderate 0. all soils had EC below 1 mS cm-1 (Figure 9). respectively. The low EC readings may be associated with the far distance from the shore. Almost all the soil pH of the selected soils was categorized into very acidic to acidic category.

.16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 7. 1200 1000 Total K content (%) 800 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s i .(Erry Purnomo) The other 8 sites had 5-14 plant species and one site had 22 plant species.16 gsa dalawai 3inginawa u (10 ate High ding & 3nti 13 Lowinkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2Belaadangangk M H L M d Ha am b a M K Site Figure 6.The Environmental Characteristics . Total K content of soil for each site 2600 2400 Total P content (%) 2200 2000 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s . Total P content of soil for each site 187 ....

Soil pH for each site 130 Electric conductivity (mScm-1) 120 110 100 2 1 0 nt Bela ) ) t s .16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 9. Electrical conductivity readings for soil each site Cation exchnage capacity (cmol[+]kg-1) 40 30 High 20 Moderate 10 Low Very low ) ) t s i g a 3 3 h n n . Cation exchange capacity of soil for each site 188 .16 gsa dal ai ngi wa (10 ate Hig din & 3 ti 1 Low nki 15 T Lan Man Waw andi Wa asau yuh K ang ur Gaat (2Belan dang angki R La n ti a M H ad Ha m b a M M Bel Ka Site 0 Gambar 10.Aspek SOSIAL EKONOMI DAN KONSERVASI 7 Neutral Slightly acidic 6 Soil pH H2O 5 Acidic 4 Very acidic la i 3 6 in in ai 10) 3) 13 ow at es igh ng 5 .1 angs anda awanding aw au (uh Katng Hr Gadi (2 & lantiang Lngkink WRas y W Ma M BeMad Ha n ti 1 T L L a Ma d a H a u m b a t a Bela K Site 0 Figure 8.

The schedule of inoculation may have to consider the climatic condition throughout the year. June and October the rainfall ranged 132-151 mm...(Erry Purnomo) 2000 1600 1200 CO2 evolution (mg C kg-1) 800 400 0 an t Bel ) ) t s i g a 3 . CO2 evolution from soil from each site DISCUSSION The rainfall pattern was typical the study area.16 gsa da H i i 15 T Lan Man W aw and W a asau yuh Kdang ur Ga at (2 Belan dang angk M nti R La Ma H Ha amb Ma ela B K 0 Sites Gambar 12. The number of plant species found in each site 189 ..16 gsa dal wai 3 inginawa u (10 ate High din & 3nti 1 g Low inkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2BelaadanHangk M L M d Ha am b a M K Site Gambar 11. The lowest rainfall was observed in the period of July-September ranging 54-84 mm.The Environmental Characteristics . In May. 25 Number of plant species each site 20 15 10 5 t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin . The highest rainfall occurred in the period of November-April ranging 215-358 mm..

Mrs. Banjar. This may result in the failure of gaharu formation. CONCLUSION The selected sites were distributed in regencies. improving the fertility status may results in healthier eaglewood trees.Aspek SOSIAL EKONOMI DAN KONSERVASI The low fertility status according to Djaenuddin et al. From field observation. namely. it was found that there was gaharu trees growth variation under different plan species grown surrounding the gaharu trees. the soil in each site was considered very poor. M Yani. Presto Janu Saputra and Storus for supporting the field work. Dr. (1994) leads the need to amend to improve the soil fertility status. Plants grown under the gaharu was quite divers from site to site. Hulu Sungai Selatan and Hulu Sungai Tengah. It is too early to gain any conclusion on the effect of environmental characters on gaharu production. In general. Therefore. ACKNOWLEDGEMENT I would like to thank ITTO for funding the work. 190 . Maman Turjaman for the invitation to be involved in the project. The number plant species were varied from site to site. The annual total rainfall in the area under study was 2361 mm. However. I also acknowledge the anonymous reviewer who critically commented on the manuscript. The rainy season began in October and ease in June. further study is still needed to investigate the relationship between soil properties or plant diversity on eaglewood growth or the success of inoculants application. The healthy trees may immune to the infection. It seems that there was a shading affect on the gaharu trees growth.

SSSA.H. SSSA. Ds. and Jordens. Marsudi. H. V.. E. A.. Miller. L. A. ASA.. Laporan Teknis No.. Pp 1159. Basuni. Bogor.. Klute. (1982) Methods of soil Analysis. and Keeney. D. D. Madison. Dai. Widagdo. S.. M. Madison. R. (In Indonesian).L. Part 1 Physical and mineralogy methods. Versi 1.0. Hakim. 2nd Edition. ASA.REFERENCE Djaenuddin. Hardjowigeno. April 1994. 2nd Edition. Subagjo. Chemical and microbiological properties. 7. 191 . Suwandi. (1986) Methods of soil Analysis..R. S. Land Suitability for Agricultural and Silviculture Plants. Pp... N.1188 Page. Center for Soil and Agroclimate Research. Bachri. Ismangun. Sukardi. J. Suharta...R.

Aspek SOSIAL EKONOMI DAN KONSERVASI 192 .

Oleh karena itu beberapa 193 ..(Pratiwi) 11 KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu hasil hutan non kayu yang mempunyai nilai penting.. Enkleia spp. Sidiyasa et al. seperti Aquilaria spp... sehingga hasil hutan non kayu ini menjadi subjek pemanenan yang cukup tinggi. yaitu A. Genus ini termasuk dalam famili Thymelaeaceae.Karakteristik Lahan Habitat .. Awalnya gaharu berasal dari pohon tropika yang terinfeksi jamur. Salah satu upaya yang dapat dilakukan adalah dengan mengembangkan tanaman gaharu dalam hutan tanaman di beberapa area. malaccensis dan A... Ada beberapa jenis tumbuhan yang dapat menghasilkan gaharu. karena secara ekonomis jenis ini dapat meningkatkan devisa negara dan sumber penghasilan bagi masyarakat yang hidup di dalam maupun sekitar hutan. Gaharu merupakan salah satu kayu aromatik penting. Aetoxylon spp. microcarpa. Karena jenis pohon ini mempunyai nilai ekonomi tinggi. Wikstromeae spp.. maka keberadaan jenis ini perlu dipertahankan. dan Gyrinops spp.. Gonystylus spp.. (Chakrabarty et al. 1994. 1986).. Dalam kegiatan penelitian ini difokuskan pada jenis-jenis pohon dari genus Aquilaria.

dan Sukabumi. Carita terletak di Kabupaten Pandeglang. Selanjutnya Pratiwi dan Mulyanto (2000) menyatakan bahwa penyebaran tumbuhan. Tanah yang berbeda dengan sistem lingkungan yang bervariasi akan menentukan vegetasi yang ada di atasnya. dan iklim (termasuk iklim mikro) harus dipertimbangkan sebagai bagian dari ekosistem yang terintegrasi. sebagaimana juga diharapkan dapat meningkatkan pendapatan dan kesejahteraan masyarakat. Lokasi dan Waktu Penelitian Penelitian dilakukan pada bulan September 2008 di Carita. dan waktu. Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah dan topografi serta vegetasi. 1991). Provinsi Banten sedangkan 194 . Sifat-sifat tanah yang spesifik mempengaruhi komposisi vegetasi yang ada di atasnya (Pratiwi. di samping air. Sepanjang komponen tanah bervariasi. organisme. topografi. Diharapkan informasi ini dapat mendukung pengembangan hutan tanaman pohon penghasil gaharu. Dramaga. maka penelitian ini bertujuan untuk mendapatkan informasi tentang sifat-sifat habitat pohon penghasil gaharu di hutan tanaman gaharu di daerah Carita. maka tanah dan karakteristiknya akan berbeda-beda dari satu tempat ke tempat lain. jenis tanah. sehingga keberadaan jenis ini dapat dilestarikan. termasuk sifat-sifat tanahnya dan komposisi vegetasi tumbuhan bawah yang ada di sekitarnya. agar kemampuan lahannya dapat diketahui.Aspek SOSIAL EKONOMI DAN KONSERVASI informasi sehubungan dengan habitat pohon penghasil gaharu perlu diinventarisasi. dan energi matahari. METODOLOGI A. udara. Pratiwi dan Mulyanto (2000) serta Jenny (1941) menyebutkan bahwa tanah merupakan hasil proses pelapukan batuan yang dipengaruhi oleh faktor-faktor iklim. Sehubungan dengan hal tersebut di atas. Secara administrasi pemerintahan. Dramaga. dan Sukabumi. Tanah sebagai bagian dari suatu ekosistem merupakan salah satu komponen penyangga kehidupan.

(Pratiwi) Dramaga terletak di Kabupaten Bogor... Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. Bahan lain adalah berupa data hasil analisis vegetasi untuk tingkat semai (termasuk tumbuhan bawah).959 mm. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. Sedangkan alat yang dipakai dalam penelitian lapangan adalah alat-alat tulis. 1951) dan curah hujan sekitar 3. Jumlah contoh tanah yang diambil di masing-masing lokasi adalah sebanyak 6 buah. Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Temperatur udara bervariasi antara 24ºC sampai 30ºC...600 mm per tahun. dan Sukabumi. Jawa Barat serta Sukabumi di Provinsi Jawa Barat. B. Bahan dan Alat Penelitian Sebagai bahan penelitian adalah contoh tanah yang diambil dalam plot penelitian di Carita.Karakteristik Lahan Habitat . 1951) dan curah hujan tahunan sekitar 3. Munsell Color Chart. Metode Penelitian Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah.000 mm per tahun. 1. 2005). Kelembaban udara rata-rata berkisar antara 80% sampai 90%. topografi. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. C. Kelembaban udara ratarata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam.000 (Lembaga Penelitian 195 . Pengamatan terhadap sifat-sifat tanah dan topografi dilakukan di dalam plot yang sama dengan pengamatan vegetasi. Pengambilan Contoh Tanah Plot dibuat di area yang telah dipilih berdasarkan peta tanah Jawa dan Madura pada skala 1:500. alat-alat survei lapangan seperti bor tanah. dan vegetasi. 1951) dan curah hujan sekitar 3. cangkul. Dramaga. dan meteran.

Kemudian contoh tanah dicampur sesuai kedalamannya. permeabilitas. ketersediaan P. porositas. Contoh tanah diambil dari setiap horizon yang telah diidentifikasi untuk dianalisis di laboratorium. Al. Kriteria pohon adalah tumbuhan dengan diameter setinggi dada (1. berat jenis. contoh tanah diambil pada 20 titik yang tersebar di masing-masing horizon.5 m (Kartawinata et al. Sedangkan tingkat semai dan tumbuhan bawah diamati dengan cara membuat petak 1 m x 1 m di dalam jalur pengamatan pohon dan belta. Sedangkan untuk pengamatan belta dilakukan dengan membuat petak berukuran 10 m x 10 m di sepanjang jalur tersebut dengan interval 10 m. 1976). Sedangkan belta merupakan tumbuhan dengan diameter setinggi dada (1. Mg. meliputi: a) sifat fisik yaitu tekstur. dan > 60 cm di setiap lokasi penelitian. Sifat-sifat tanah yang dianalisis. Pengamatan Vegetasi Pengamatan vegetasi dilakukan terhadap seluruh vegetasi yang ada dalam plot. dan H+ (sifat kimia) (Blackmore et al.3 m) antara 2 cm sampai < 10 cm dan semai merupakan permudaan dari kecambah sampai tinggi < 1. K. KB.Aspek SOSIAL EKONOMI DAN KONSERVASI Tanah. KTK. Seluruh jenis pohon dan belta dihitung dan diukur diameternya. 30-60 cm. Kriteria 196 . Seluruh semai dan tumbuhan bawah yang ada dicatat dan dihitung jumlahnya. Ntotal. dan sifat kimia yaitu pH H2O. Plot-plot contoh berukuran 20 m x 20 m dibuat untuk pengamatan pohon dengan interval 20 m pada jalur sepanjang satu km. Pada setiap kedalaman tanah. 1981). Ca. dan semai. Contoh tanah komposit diambil pada kedalaman 0-30 cm. Pengamatan vegetasi dilakukan terhadap semai dan tumbuhan bawah yang ada di bawah tegakan/pohon penghasil gaharu. Dua macam contoh tanah yang diambil adalah contoh tanah terganggu untuk analisis sifat-sifat fisik dan kimia tanah serta contoh tanah tidak terganggu untuk pengamatan sifat fisik tanah (porositas dan berat jenis tanah).3 m)>10 cm. belta. Dengan demikian ada 18 contoh tanah yang dikumpulkan. Na.. 2.. Corg. yaitu pada tingkat pohon. Total tanah komposit yang dikumpulkan dari masing-masing lokasi adalah enam contoh (tiga untuk analisis sifat fisik tanah dan tiga untuk analisis sifat kimia tanah). 1962).

5 m (Kartawinata et al. Untuk vegetasi. Plot-plot berukuran 1 m x 1 m diletakkan di jalur pengamatan vegetasi di dalam tegakan/pohon penghasil gaharu. Bogor.(Pratiwi) semai adalah permudaan jenis tumbuhan berkayu dari kecambah sampai tinggi < 1. Pada masingmasing lokasi... Seluruh semai dan tumbuhan bawah yang ada dalam plot dicatat nama daerahnya.Karakteristik Lahan Habitat . yaitu: SI = Dimana : 2w a+b SI = Similarity Index w = Jumlah dari nilai penting terkecil untuk jenis yang sama yang ditemukan pada dua komunitas yang dibandingkan (A dan B) a = Jumlah nilai penting dari semua jenis yang ada di komunitas A b = Jumlah nilai penting dari semua jenis yang ada di komunitas B 197 . Indeks kesamaan jenis dihitung dengan menggunakan rumus Sorensen (Mueller-Dum-bois and Ellenberg. dan dihitung jumlahnya serta diukur luas penutupan tajuknya. data yang diperoleh ditentukan spesies dominannya dengan menghitung nilai penting sesuai dengan rumus yang dikemukakan oleh Kartawinata et al. 1974). D... 1976). (1976). Analisis Data Sifat-sifat fisik dan kimia tanah dihitung sesuai dengan formula pada standar prosedur dari setiap karakteristik tanah kemudian ditabulasi untuk setiap horizon. jalur dibuat sebanyak tiga buah masing-masing sepanjang 100 m. P3HKA. Spesies dominan merupakan spesies yang mempunyai nilai penting tertinggi di dalam tipe vegetasi yang bersangkutan.. Jenis yang diperoleh kemudian dibuat spesimen herbariumnya untuk diidentifikasi di laboratorium Botani dan Ekologi Hutan.

Kelembaban udara rata-rata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. khususnya sifat fisik dan kimia. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC.600 mm per tahun. Kelembaban udara rata-rata berkisar antara 80% sampai 90%.Aspek SOSIAL EKONOMI DAN KONSERVASI HASIL DAN PEMBAHASAN A. 1951) dan curah hujan sekitar 3. Bahan induk tanah Carita adalah dari Gunung Danau sedangkan Dramaga dan Sukabumi masing-masing dari Gunung Salak dan Gede Pangrango. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. 2005). Dramaga. Topograpfi di daerah Carita bergelombang sampai bergunung sedangkan di Dramaga datar sampai bergelombang dan di Sukabumi bergelombang sampai berbukit. Vulkanik material dari lokasi-lokasi ini memiliki sifat andesitik. 1. Lokasi penelitian Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC.959 mm. 198 . Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. dan Sukabumi. Temperatur udara bervariasi antara 24ºC sampai 30ºC. Karakteristik Tanah di Daerah Penelitian Karakteristik tanah sangat dipengaruhi oleh faktor-faktor pembentukan tanah dan sifat-sifat tanah. Faktor-Faktor yang Mempengaruhi Pembentukan Tanah di Lokasi Penelitian Penelitian dilakukan di tiga lokasi.000 mm per tahun. Tipe mineral-mineral ini sangat dipengaruhi oleh sifat-sifat tanah. 1951) dan curah hujan tahunan sekitar 3. Ini berarti bahan induk daerah ini kaya akan mineral-mineral ferro-magnesium dan beberapa mineral sebagai sumber elemen basa. 1951) dan curah hujan sekitar 3. yaitu Carita.

2.(Pratiwi) Penggunaan lahan di ketiga lokasi penelitian adalah hutan tanaman pohon penghasil gaharu. Oleh karena itu tanah ini diklasifikasikan sebagai ultisol. porositas. dan Tabel 6).. microcarpa di Darmaga dan A. Sifat Fisik Tanah Sifat fisik tanah. Sedangkan di Dramaga dan Sukabumi. Tabel 2. Berat jenis (BD) tanah di semua lokasi penelitian kurang dari 1 tetapi lebih dari 0. melinjo (Gnetum gnemon). umumnya pohon serbaguna seperti pete (Parkia speciosa). gaharu ditanam secara monokultur dan ditanam masing-masing tahun 1993 dan 1999. Tanah yang memiliki horizon argilik dapat diklasifikasikan sebagai alfisol atau ultisol tergantung kejenuhan basanya (KB). Hal ini menunjukkan bahwa tanah di lokasi penelitian berkembang dari material vulkanik tuff. Pohon penghasil gaharu ditanam bersama dengan tanaman lain. microcarpa di Sukabumi. dan Tabel 3. Dari data tekstur tanah dapat dilihat juga bahwa tanah di dalam profil menunjukkan adanya akumulasi liat. antara lain berkaitan dengan tekstur. berat jenis. durian (Durio zibethinus) dan sebagainya. Sedangkan tanah di lokasi penelitian Sukabumi memiliki KB lebih dari 50% sehingga diklasifikan sebagai alfisol.. Ini berarti seluruh tanah di lokasi penelitian memiliki sub horizon argilik. Ketinggian daerah ini sekitar 100 meter di atas permukaan laut. dan permeabilitas.. Implikasi dari kelas tekstur ini adalah retensi air dan hara pada tanah ini relatif bagus. 199 . jenis yang ditanam adalah Aquilaria microcarpa. Sifat-Sifat Tanah a. Hal ini mengindikasikan bahwa partikel tanah yang dominan adalah fraksi liat. Tanah di Carita dan Dramaga memiliki KB kurang dari 50% (Tabel 4.. Pada tabel tersebut terlihat bahwa ketiga lokasi penelitian memiliki sifat-sifat fisik tanah yang relatif sama. Hasil penelitian sifat-sifat fisik tanah disajikan pada Tabel 1. Data analisis tekstur tanah menunjukkan bahwa tanah di semua lokasi penelitian memiliki kelas tekstur liat. nangka (Artocarpus integra). dengan areal sekitar 5 ha dan dibangun pada tahun 1998 dengan total 346 pohon.Karakteristik Lahan Habitat . Tabel 5.8. Spesies yang ditanam adalah Aquilaria crassna dan A. Di Carita.

87 0.Aspek SOSIAL EKONOMI DAN KONSERVASI Data porositas tanah menunjukkan bahwa di semua lokasi penelitian.55 6.33 8.69 85. porositas tanah di horizon permukaan lebih rendah daripada di bagian bawahnya.33 5.09 Liat (%) 79.99 68.99 63.35 57. 1994).85 Berat Jenis Porositas (%) Tabel 2. Sedangkan berat jenis tanah di tiga kedalaman kurang dari satu.01 Tekstur Debu (%) 25. Informasi ini menunjukkan bahwa terjadi fenomena pemadatan tanah (soil compaction) karena adanya injakan (trampling) dan mungkin adanya jatuhan butir-butir hujan dari batang pohon (stem fall).57 69.90 0. Sifat-sifat fisik tanah di lokasi penelitian Carita Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 8.90 64. Sifat-sifat fisik tanah di lokasi penelitian Dramaga Sifat fisik Kedalaman (cm) Pasir (%) 0-30 30-60 > 60 0 30 60 8.78 Kelas tekstur Liat Liat Liat 0.10 36.98 9. sehingga tanah di lokasi penelitian termasuk dalam ordo andisol dalam sistem taksonomi tanah (Soil Survey Staff.84 0.21 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 200 . Hal ini menunjukkan bahwa tanah ini mempunyai sifat andik.96 65.51 Liat (%) 66.13 Debu (%) 12.93 0.59 11.45 66.48 Kelas tekstur Liat Liat Liat 0. Tabel 1.33 6.08 81.10 22.86 66.

C.97 0. Na. Zn.59 68. Adanya pori-pori yang menurun jumlahnya. Namun demikian Bullock et al.. b.Karakteristik Lahan Habitat . Namun demikian tanah-tanah di lokasi 201 . K. Nilai permeabilitas tanah menunjukkan laju pergerakan air. Sifat-sifat fisik tanah di lokasi penelitian Sukabumi Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 12. di mana lokasi-lokasi ini merupakan hutan tanaman. Pratiwi dan Garsetiasih (2003) menyatakan bahwa pemadatan tanah dapat diakibatkan oleh karena injakan manusia.(Pratiwi) Tabel 3. Hal ini menunjukkan semakin ke dalam jumlah pori-pori semakin kecil yang diakibatkan antara lain oleh adanya pemadatan tanah.15 62.49 84.54 Debu (%) 18. Hal ini terjadi juga di ketiga lokasi penelitian. Fe.86 0. maka akan mengakibatkan kapasitas tanah menampung air dan udara menurun. Sifat Kimia Tanah Sifat-sifat kimia tanah. (1985) menyatakan bahwa nilai ini tergantung bukan saja oleh jumlah pori tetapi juga tingkat kontinuitas pori.90 26. Cu. Al. dan Mn.78 9. Mg. dan Tabel 6. Ca.09 Kelas tekstur Liat Liat Liat 0. Hal ini terlihat pada lokasi penelitian. meliputi pH H2O..83 63. umumnya diikuti dengan penurunan persentase ruang pori atau porositas dan juga penurunan nilai permeabilitas tanah.43 67. Peningkatan berat jenis tanah..73 5. N. kapasitas tukar kation (KTK). P tersedia. Tabel 5. pH H 2O di semua lokasi penelitian umumnya kurang dari lima. Keterangan yang lebih lengkap dapat dilihat pada Tabel 4.. kejenuhan basa (KB).95 11. kecuali Sukabumi.37 Liat (%) 68.75 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 Sedangkan porositas di lokasi penelitian menunjukkan bahwa semakin ke bawah porositasnya semakin kecil.

2004 dan 2005). Mn. Oleh karena itu di ketiga lokasi penelitian tidak ada bahaya keracunan Al. Kandungan P di semua lokasi penelitian tergolong sangat rendah (< 2). Di samping pH. bahan organik juga menyebabkan meningkatnya KTK dengan meningkatnya muatan negatif. dan H+. Rendahnya carbon organik dan nitrogen total berhubungan dengan rendahnya bahan organik. K tergolong medium sedangkan di Carita dan Sukabumi masing-masing tergolong rendah dan tinggi dan Al+3 dan H+ rendah sampai sangat rendah di semua lokasi. dan Co). Hal ini dapat dimengerti karena di lokasi penelitian Carita. Ca. Unsur-unsur ini dikategorikan sebagai unsur hara makro (C. B. Carbon organik dan nitrogen total di lokasi penelitian menurun semakin ke bawah.Aspek SOSIAL EKONOMI DAN KONSERVASI penelitian masih dikategorikan asam. Walaupun tanah-tanah di lokasi penelitian berkembang dari bahan vulkanik andesitik yang kaya akan material-material basa. Pratiwi (2004 dan 2005) menyatakan bahwa unsur ini khususnya di lapisan atas mempunyai fungsi yang sangat penting dalam perkecambahan biji. carbon organik lebih tinggi daripada Sukabumi dan Dramaga. Unsur hara esensial merupakan unsur yang diperlukan oleh tanaman dan fungsinya tidak dapat digantikan oleh unsur lain (Pratiwi. Al+3. H. Cl. Mo. Di areal penelitian Dramaga. dan S) dan unsur hara mikro (Fe. Mg. Tumbuhan bawah merupakan sumber bahan organik. K. Tanah dengan kandungan Al yang tinggi memiliki sifat toksik. P. dijumpai banyak tumbuhan bawah jika dibandingkan dengan lokasi penelitian Sukabumi dan Dramaga. maka reaksinya asam dan kejenuhan basanya kurang dari 100%. ketersediaan dari unsur-unsur esensial ditentukan oleh bahan organik dan proses-proses dinamis yang ada di dalam profil tanah. Menurut Sutanto (1988). Elemen penting lainnya adalah K. N. Perbandingan C/N di semua horizon tergolong tinggi. Hal ini menunjukkan bahwa dekomposisi bahan organik tidak terlalu kuat. Jumlah carbon organik relatif rendah di semua horizon. O. Zn. 202 . namun karena adanya proses pelapukan yang intensif dan juga adanya pencucian (leaching). khususnya di horizon bagian atas. Cu. Reaksi ini mempengaruhi ketersediaan unsur hara esensial. tetapi di Carita.

0515. dan Tabel 6 menunjukkan secara jelas bahwa KTK NH4Oact pH 7 dari seluruh profil sangat tinggi daripada KTK sum of cation. Tabel 5.Karakteristik Lahan Habitat . dan Mn.15 (Rendah) Horizon 2 (30-60 cm) 4. dan Tabel 6 mengindikasikan bahwa tanah di Sukabumi memiliki KB tinggi (39. dan Zn relatif rendah sementara kandungan Mn sedang sampai relatif cukup. Tanah dengan pH lebih tinggi umumnya memiliki KTK yang lebih tinggi. Hal ini disebabkan karena Sukabumi memiliki pH H 2O tertinggi. Dari Tabel 4. Tabel 4.75) dan yang terendah adalah di Carita (13.70 (Rendah) 1. Jumlah kation tertinggi di areal penelitian terdapat di Sukabumi dan yang terendah di Carita. Kandungan kation basa di Sukabumi termasuk tinggi sedangkan di Dramaga medium dan Carita termasuk rendah.07) sedangkan di Dramaga medium (16. Sifat-sifat kimia tanah di lokasi penelitian Dramaga Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) Horizon 1 (0-30 cm) 4. Unsur-unsur Fe.11(Rendah) 203 . Kondisi ini relatif sesuai untuk pertumbuhan tanaman. Kapasitas tukar kation (KTK) menunjukkan tingkat kesuburan tanah. Cu. tetapi diperlukan dalam jumlah sangat sedikit. Unsur-unsur tersebut adalah Fe.12 (Rendah) Horizon 3 (>60 cm) 4.77). Tabel 5.03 (Rendah) 0.. Ada kecenderungan bahwa daerah dengan pH yang tinggi memiliki kejenuhan basa yang tinggi pula. Tanah dengan KTK tinggi dapat menyerap unsur hara. KTK tinggi berarti areal tersebut cukup subur. Tabel 4.50 (Rendah) 1. sehingga ketersediaan hara akan lebih bagus pada areal dengan KTK rendah.60 (Rendah) 1.. Zn. di mana pH daerah Sukabumi lebih tinggi daripada Carita dan Dramaga. Di semua horizon dari tiga lokasi penelitian ini.35-41..(Pratiwi) Unsur hara mikro juga mempengaruhi pertumbuhan tanaman. Kecenderungan ini terjadi di areal penelitian. kation basa didominasi oleh calcium dan magnesium. Cu.01-17.43 (Rendah) 0. KTK tanah dianalisis dengan larutan buffer NH4Oact pH 7 dan KTK sum of cation.03 (Rendah) 0..

75 (Medium) 40.3 (Sangat rendah) Horizon 3 (>60 cm) 1.31 (Medium) 0.19 ( Medium) 0.32 ( Medium) 1.30 (Rendah) 17.26 (Rendah) 16.26 (Medium) 3.53 (Rendah) 0.61 (Medium) 35.09 (Medium) 0.16 (Sangat rendah) 0.68 (Medium) 4.60 (Rendah) 2.72 (Sangat rendah) 0.60 1.70(Medium) 0.48 2.13 (Rendah) Horizon 1 (0-30 cm) 4.99 (Medium) 46.26 (Rendah) 16.14 (Rendah) 1.44 5.29 (Medium) 1.58 (Tinggi) 0.64 4.7 (Sangat rendah) 5.44 (Medium) 0.00 (Sangat rendah) 0.08 (Sangat rendah) 1.14 (Rendah) 1.71 (Sangat rendah) 0.51 (Rendah) 0.01 1.50 (Rendah) 1.90 (Sangat rendah) 0.75 (Rendah) 0.20 Tabel 5.01 (Sangat rendah) 0.49 (Sangat rendah) 0.88 88.80 2.70 (Sangat rendah) Horizon 2 (30-60 cm) 4.28 79.40 5.7 (Sangat rendah) Horizon 2 (30-60 cm) 1.60 (Rendah) 0.17 (Rendah) 1.33 4.52 (Rendah) 0.44 (Medium) 0.36 4.88 (Medium) 5.24 85.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): Al H 0.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 1.20 (Sangat rendah) Horizon 3 (>60 cm) 4.17 (Rendah) 1. Sifat-sifat kimia tanah di lokasi penelitian Carita Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K 1.16 (Rendah) 1.04 3.41 2.20 (Sangat rendah) 204 .

00 28.64 3.52 2.80 16.60 (Rendah) 1.07 (Sangat tinggi) 69.18 (Rendah) 3.35 (Tinggi) 63.98 (Tinggi) 10.03 (Rendah) 14.40 (Rendah) 0.36 (Medium) 41.40 (Sangat rendah) 205 .04 1.90 (Sangat rendah) Horizon 2 (30-60 cm) 5.60 (Rendah) 0.77 (Rendah) 16.07 (Medium) 0.99 (Tinggi) 10.48 1.10 (Rendah) 1.40 Tabel 6. Sifat-sifat kimia tanah di lokasi penelitian Sukabumi Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): 16.86 (Tinggi) Horizon 1 (0-30 cm) 5.53 6..(Pratiwi) Sifat-sifat kimia Na KTK KB (%) KCl (me/100 gr): Al H 0.11 (Rendah) 3..22 (Rendah) 39.49 (Sangat rendah) Horizon 3 (>60 cm) 0.11 (Rendah) 14.52 (Sangat tinggi) 0.21 (Rendah) 13.45 1.56 (Tinggi) 16.05 (Sangat tinggi) 0.48 (Tinggi) 78.36 (Rendah) 0.20 (Rendah) 15.49 (Sangat rendah) Horizon 2 (30-60 cm) 0.84 (Sangat tinggi) 14..22 (Rendah) 0.08 1.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 0.Karakteristik Lahan Habitat .60 17.15 (Rendah) 3.68 2.40 (Medium) 0..70 (Sangat rendah) Horizon 3 (>60 cm) 4.27 (Sangat rendah) 5.00 1.72 1.22 (Rendah) 13.64 (Tinggi) 10.71 (Tinggi) 0.01 (Rendah) 0.94 (Sangat tinggi) 0.43 (Medium) 36.49 7.84 (Rendah) 0.10 (Rendah) 2.

30 Horizon 3 (>60 cm) 6. Areal ini merupakan hutan tanaman pohon penghasil gaharu.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia Al H 0. Dengan demikian untuk tingkat pohon. Tabel 7. 2. Komposisi Tumbuhan Bawah Hasil pengamatan menunjukkan bahwa komposisi jenis tumbuhan bawah di Carita lebih tinggi dibandingkan di Sukabumi dan Dramaga (Tabel 7).52 1. Dramaga. Umum Analisis vegetasi dilakukan terhadap vegetasi/tumbuhan bawah di Carita.56 22. 206 .42 0.36 1. dan Sukabumi. Sistem penanaman di Carita yang multikultur.32 1.76 (Sangat rendah) 0.44 1. Oleh karena itu analisis vegetasi ditekankan pada tumbuhan bawah.40 17.20 1. Di Carita pohon Sukabumi 6 3 penghasil gaharu ditanam dengan sistem campuran dengan jenis tanaman serba guna sedangkan di Sukabumi dan Dramaga ditanam dengan sistem monokultur. Komposisi Vegetasi dan Spesies Dominan 1.56 26.36 B. Jumlah jenis tumbuhan bawah dan familinya di lokasi penelitian Lokasi penelitian Jumlah jenis Jumlah famili Ko n d i s i i n i a g a k nya k a r e n a Carita 30 18 perbedaan sistem penanaman dalam Dramaga 8 16 hutan tanaman tersebut.12 1. sapling serta tiang didominasi oleh gaharu. mendukung beberapa anakan muncul dari jenis-jenis lain selain jenis tanaman penghasil gaharu.25 Horizon 2 (30-60 cm) 2.00 0.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 2.40 (Rendah) 0.12 0.32 (Sangat rendah) 0.

Di Carita jenis dominan dan kodominan dari tumbuhan bawah yang ditemui adalah jampang (Panicum disachyum) dan selaginela (Selaginella plana) sedangkan di Dramaga adalah pakis (Dictyopteris iregularis) dan seuseureuhan (Piper aduncum) serta di Sukabumi adalah jampang (Panicum disachyum) dan rumput pait (Panicum barbatum) (Lampiran 1. Indeks similaritas (%) dari dengan lainnya. Data ini mengindikasikan bahwa habitat dari masing-masing lokasi penelitian secara ekologis memiliki karakteristik yang berbeda-beda. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor lingkungan seperti iklim. Carita - 9 - 35 9 - Darmaga Sukabumi - KESIMPULAN 1. 1974) komposisi jenis tumbuhan bawah di tiap lokasi penelitian berbeda satu Tabel 8. 207 . Jenis Tumbuhan Bawah Dominan Secara ekologis.. Indeks Kesamaan Jenis Tumbuhan Bawah Berdasarkan indeks kesamaan jenis menurut Sorensen (MuellerDumbois and Ellenberg. Jenis dominan merupakan jenis yang mempunyai nilai penting tertinggi di dalam komunitas yang bersangkutan. Hal ini diindikomuni-tas tumbuhan di lokasi penelitian kasikan dengan nilai indeks similaritas yang rendah (<50%) Lokasi Carita Dramaga Sukabumi (Tabel 8). Tanah di tiga lokasi penelitian memiliki bahan induk yang relatif sama.. topografi. Hasil pengamatan menunjukkan bahwa jenis dominan dan kodominan masing-masing areal penelitian berbeda. yaitu material volkanik yang bersifat andesitik. nilai vegetasi ditentukan oleh peran dari jenis dominan.. dan Lampiran 3).(Pratiwi) 3. dan karakteristik tanah. 4.Karakteristik Lahan Habitat .. Nilai ini merupakan hasil dari interaksi di antara jenis dengan kondisikondisi lingkungan. Lampiran 2.

E. Soil Analyses. New York. 1941. tanah Carita kurang subur dibandingkan dengan Dramaga dan Sukabumi. DAFTAR PUSTAKA Allison. Factors of Soil Formation. Trade in Agarwood. Sifat-sifat fisik dan kimia tanah di areal penelitian mendukung pertumbuhan pohon penghasil gaharu. In C. Sehubungan dengan tingkat pelapukan.Aspek SOSIAL EKONOMI DAN KONSERVASI 2. H. 1962. 280 p. Kumar and V.). dan sifat-sifat tanah. McGrawhill. Menon. Tingkat kesuburan ini berhubungan dengan tingkat dari proses pelapukan. 3. 6. 4. Jenis dominan dan kodominan di masing-masing areal penelitian berbeda. K. Organic Matter by Walkey and Black methods. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor-faktor lingkungan seperti iklim.A. Part II. Sedangkan di Dramaga jenis dominan dan kodominan masing-masing adalah pakis (Dictyopteris irregularis) dan seuseureuhan (Piper aduncum). A. 208 . L. Bogor. Black (ed. Jenny. LPT.. Chakrabarty. 1965. Peta Tanah Tinjau Jawa dan Madura. Komposisi jenis tumbuhan bawah juga berbeda di tiap lokasi penelitian sebagaimana diindikasikan dengan nilai SI < 50%. 5. topografi. serta di Sukabumi masing-masing jampang (Panicum disachyum) dan rumput pait (Panicum barbatum). WWF-Traffic India. 1994. Perbedaan sifat-sifat fisik dan kimia tanah di lokasi penelitian disebabkan perbedaan tingkat proses pelapukan yang berhubungan dengan kondisi lingkungan dari proses pelapukan tersebut. Di Carita tumbuhan bawah yang dominan adalah jampang (Panicum disachyum) dan jenis kodominan adalah selaginela (Selaginella plana). Lembaga Penelitian Tanah.

Soil Survey Staff. S. 1994. Prawira. 1991. Dept.H. Forestry and Estate Crops Research Journal 1(1): 27-33. Pusat Litbang Hutan dan Konservasi Alam. K. R.. Soil Conservation Service. Pratiwi.U. Belgium. Bogor. MSc. Key to Soil Taxonomy.S. Pratiwi and B.. West Java. Hutan Penelitian Carita. Report No. New York. Procedure for Collecting Samples and Methods of Analyses for Soil Survey. Ciri dan Sifat Lahan Habitat Mahoni (Swietenia macrophylla King. Ellenberg.A. Soil Characteristics and Vegetation Composition Along a Topotransect in The Gunung Gede Pangrango National Park. Buletin Penelitian Hutan 474: 59-66. 306 p. International Training Center For Post Graduate Soil Scientists. Pratiwi. Hubungan Antara Sifat-Sifat Tanah dan Komposisi Vegetasi di Daerah Tabalar.) di Beberapa Hutan Tanaman di Pulau Jawa. Sidiyasa. Gakuryoku XI(2):127-131. PhD Thesis. Ferguson. Aims and Methods of Vegetation Ecology. The Relationship Between Soil Characteristics with Vegetation Diversity in Tanjung Redep. Rainfall Based on Wet and Dry Period Ratios for Indonesia with Western New Guinea. 2000. 1974.Agric. Sutanto. Jakarta. 233 p. ITC-RUG. Schmidt. Indonesia.. 1984. East Kalimantan. John Willey and Son. 2004. Soil Conservation Service. D. Six Edition. Sutomo..(Pratiwi) Mueller-Dumbois. 209 . 68 p. Pratiwi. and J. A. S. Verhand.. Kalimantan Timur. Charge Properties and Classification of Soils on Volcanic Materials and Limestone in Central Java. Djawatan Meteorologi dan Geofisika. Kalimantan Selatan. Thesis. Kementrian Perhubungan. dan R. 42. and H. 21 p. 2005. 1986. United Stated Department of Agriculture. Gent. Revised ed. 1951. F. 1988.H. Universiteit Gent. Pusat Litbang Hutan dan Konservasi Alam.Karakteristik Lahan Habitat . Buletin Penelitian Hutan 644: 63-76. Mulyanto. 2005. Kabupaten Berau. Minerlogy. Eksplorasi dan Studi Permudaan Jenis-Jenis Penghasil Gaharu di Wilayah Hutan Kintap.. Indonesia. I.

39 3.17 2.25 0. Parkia speciosa Hassk.25 0.00 100.91 2.85 2.12 0.99 10.71 1.00 14.45 0.98 0. Coniograma intermedia Hieron.05 2. Cyclea barbata Miers.85 1. Melastoma malabathricum L.25 0.29 1. Total Panicum montanum Roxb.43 1.75 0.Sch.05 1.25 0. Selaginellaceae Melastomataceae Meraispermaceae Cyperaceae Solanaceae Polypodiaceae Moraceae Schizophyllaceae Polypodiaceae Dilleniaceae Melastomaceae Rubiaceae Meliaceae Rubiaceae Graminae Verbenaceae Zingiberaceae Piperaceae Rubiaceae Polypodiaceae Thymelaeaceae Leguminosae Euphorbiaceae Rubiaceae Panicum barbatum Lamk.00 5.43 1.30 2.50 0.50 0.71 5.93 1.25 0.25 0.62 0. Stachystarpheta jamaisensis Vahl.43 1.66 8.23 0.73 3. Graminae Curculigo latifolia Dryand.72 4.00 100.62 0.17 7.23 0.28 57. Solanum jamaicence Mill.99 3.81 10.18 6.80 1.93 1.12 0.11 0. Tetracera indica L. Ixora sp. Graminae Ageratum conizoides Linn.09 3.25 0.00 300.18 2. Nilai penting jenis tumbuhan bawah di Carita No.05 2.98 0.70 16. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Nama daerah Jampang Selaginella Harendong merah Cingcau Rumput pait Ilat Parasi Terongan Hatta Peletok Paku anam Pakis Sasahan Harendong Kokopian Mahoni Cacabean Alang-alang Hawuan Kakacangan Pacing Nama botani Famili Kr (%) Fr (%) Dr (%) NP (%) 47.69 2. Aquilaria malaccensis Lamk.58 10.52 5.71 4.75 0.30 2.43 1.57 4. Lygodium circinatum Sw.12 0. Gagajahan Ki koneng Babadotan Pakis anjing Gaharu Pete Kanyere Cingcanan Plectronia sp.82 3.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 1.43 1.49 0. Cyperus difformis Linn.25 0.25 0. Swietenia macrophylla King Morinda bracteosa Hort.43 2.43 2.28 22.86 1.09 2.43 2.10 0.25 0.97 6.39 9.47 2. Compositae 100. Clidenia hirta Don.43 1.36 6.00 5.25 0. Amaryllidiaceae Elaeocarpus glaber Blume Elaeocarpaceae Seuseureuhan Piper aduncum L.76 7.29 5. Dryopteris dentata C.88 7.43 1.Chr.00 9.37 0.83 9.12 81. Gramínea Selaginella plana Hiern.00 Keterangan: Kr Fr Dr NP : Kerapatan relatif : Frekuensi relatif : Dominansi relatif : Nilai penting 210 .09 1.37 0.62 0. Imperata cylindrica Linn. Tapeinochilus teysmannianus K.43 1.48 0.25 0.80 Panicum disachyum Linn.43 1.71 0.43 25. Cecropia peltata L.23 0.43 2.25 8. Morinda bracteosa Hort.43 1.02 4.43 1. Bridelia monoica L.85 4.25 21.43 1.49 1.57 4.43 1.25 0. Dictyopteris irregularis Presl.25 0.62 1.25 0.93 1.50 0.80 1.75 1.70 32.

Rumput padi Areu Babadotan Pacine Oryza grandulata Nees.76 5.25 20.56 300.64 11..00 Fr (%) 16.16 37.06 19.00 Dr (%) 28.21 57.03 16.78 30..42 1. 1 2 3 4 5 6 7 8 Nama daerah Pakis Seuseureuhan Tales Nama botani Dictyopteris irregularis Presl.71 5. Famili Polypodaceae Piperaceae Araceae Graminae Gramínea Compositae Kr (%) 29.00 Rumput pait Panicum barbatum Lamk.04 43.00 16.72 11.Karakteristik Lahan Habitat . Compositae Tapeinochilus teysmannianus K. Ageratum conizoides Linn.89 11.76 5.. Total Zingiberaceae Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 211 . Alocasia sp.(Pratiwi) Lampiran 2.89 17. Nilai penting jenis tumbuhan bawah di Dramaga No.00 NP (%) 74.03 5.72 11.Sch. Piper aduncum Linn.08 34.14 1. Micania scandens Willd.53 100.14 100.55 3.71 5.72 16.89 100.19 22..72 16.76 5.52 5.41 11.

74 2. Compositae Graminae Alang-alang Imperata cilíndrica Linn.38 4. Euphatorium pallascens DC.67 8.35 22.34 16.00 17.87 10.00 NP (%) 139. 1 2 3 4 5 6 Nama daerah Jampang Nama botani Panicum distachyum Linn.33 100.56 24.67 16. Nilai penting jenis tumbuhan bawah di Sukabumi No.00 Rumput pait Panicum barbatum Lamk.57 100.24 4.Lampiran 3.14 30.16 100.9 58.00 Dr (%) 50. Famili Gramínea Graminae Melastomaceae Compositae Kr (%) 56.62 16.67 8.28 3. Harendong Babadotan Kirinyuh Clidenia hirta Don.33 16.06 300.71 14.76 7.94 32. Total Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 212 .57 3. Ageratum conizoides Linn.00 Fr (%) 33.

) DI PROVINSI LAMPUNG DAN BENGKULU.2 milyar rupiah ke kas negara pada tahun 1995. gaharu merupakan komoditi hasil hutan non-kayu penting. Indonesia merupakan salah satu eksportir terbesar produk gaharu dan sudah menyumbangkan sekitar 6. malaccensis Lamk. microcarpa. 1987. seperti A.. Zuhud 1994). dan lain-lain. 2000). selama ini banyak dikenal sebagai bahan untuk membuat wangi-wangian. filaria. A. beccariana.12 POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk. dengan nama perdagangan “agarwood/aloe-wood/ eaglewood”. 2002). A. A. 2001. Heyne. Bagi Suku Dayak Punan di Kalimantan Timur. Gaharu merupakan komoditi hasil hutan bukan kayu yang banyak diminati oleh pasar luar negeri (Soehartono dan Newton. karena merupakan sumber pendapatan terbesar yang memiliki nilai pasar tinggi (Kaskija. bahan obat serta juga kulitnya dapat dibuat untuk bahan tali atau kain (Puri. hirta. SUMATERA Titiek Setyawati Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu. A. Jenis pohon penghasil gaharu menghasilkan resin yang memiliki aroma wangi dan jenis-jenis yang menghasilkan gaharu dengan 213 . Indonesia juga merupakan habitat endemik beberapa jenis gaharu komersial dari marga Aquilaria. Gaharu banyak diproduksi di Indonesia. negara penghasil gaharu terbesar di dunia.

5 sampai 4 kg gaharu dengan harga di tingkat pencari Rp 700.33 pohon/ha (Irian Jaya) (Anonim. Satu pohon biasanya dapat menghasilkan 0. dan Gyrinops 214 . 3. Nusa Tenggara Timur. karena eksploitasi yang berlebihan (Zich dan Compton. Enkleia (1 jenis). Resin yang dihasilkan memiliki aroma wangi yang merupakan ciri khas dalam menentukan kualitas gaharu. informasi mengenai jenis. serta Irian Jaya. Meskipun jumlah ekspor gaharu saat ini mengalami penurunan pesat dibandingkan dengan tahun-tahun sebelumnya. 2007). Karena eksploitasi yang intensif sehingga mengancam keberadaanya di alam. dan Wikstroemia (2 jenis). Potensi yang diperkirakan ada saat ini yaitu 1.000. gaharu ternyata dihasilkan tidak dari satu jenis pohon saja melainkan dari berbagai macam jenis. Gaharu dihasilkan dari proses pembusukan atau infeksi. baik batang maupun akar pohon secara kimiawi oleh beberapa jenis jamur. Nusa Tenggara Barat. 2001) yang tumbuh tersebar di Indonesia. Usaha budidaya jenis pohon penghasil gaharu juga belum banyak mengalami perkembangan yang nyata dan produk gaharu masih lebih banyak dipanen dari hutan alam. 2001). Bahkan beberapa jenis sudah menjadi langka akibat perburuan jenis-jenis tertentu yang tidak terkendali. Jenis yang saat ini banyak dipanen di Irian Jaya sudah sangat terancam keberadaannya.87 pohon/ha (Sumatera). sejak tahun 1994 gaharu masuk dalam Appendix II daftar CITES (Soehartono dan Newton. Gonystylus (2 jenis). yaitu gubal gaharu. kemedangan. masingmasing sortimen akan dibedakan lagi berdasarkan kelas mutunya. kedelapan jenis tersebut masuk dalam marga Aetoxylon (1 jenis). dan 4. Menurut Sidiyasa (1986) dalam Mai dan Suripatty (1996). Dalam proses selanjutnya. Hampir sebagian besar jenis dapat ditemukan di Kalimantan. 2001) dan bahkan semua jenis penghasil gaharu (Aquilaria spp. Dari beberapa pustaka yang ada. Pada umumnya gaharu diperdagangkan dalam tiga kelompok sortimen. Aquilaria (2 jenis).Aspek SOSIAL EKONOMI DAN KONSERVASI kualitas tinggi banyak diperdagangkan ke luar negeri. jenis pohon penghasil gaharu dari marga Aquilaria dan Wiekstroemia memiliki lebih dari 2 jenis (Sellato. keberadaan serta potensi pohon penghasil gaharu yang ada di Indonesia sampai saat ini masih belum terkoleksi dengan baik.37 pohon/ha (Kalimantan). Berdasarkan hasil pengamatan di lapangan. Sumatera. dan abu gaharu.untuk kualitas super.

diharapkan jenis ini dapat keluar dari daftar CITES sebagai jenis yang harus dilindungi. Makalah ini bertujuan untuk memberikan informasi menyangkut aspek potensi dan persebaran gaharu (A. Untuk jenis gaharu yang terbaik di kelasnya harganya bisa melebihi 20 juta rupiah per kilogram tergantung kualitasnya (Anonim. baik ek-situ maupun in-situ.2 milyar rupiah di tahun 1995. maka tidaklah heran jika gaharu sangat dicari oleh para pedagang sedangkan pemanenan masih mengandalkan gaharu yang tumbuh di alam dan pencarian dilakukan oleh masyarakat lokal yang memiliki akses masuk ke dalam hutan. Kelompok tersebut biasanya akan tinggal di hutan selama lebih kurang seminggu untuk mencari 215 . 1997 dalam Soehartono dan Newton.. Mengingat semakin terancamnya keberdaan jenis pohon penghasil gaharu yang ada di habitat alaminya. 2009)... Indonesia dikenal sebagai negara penghasil gaharu terbesar (Direktorat Jenderal PHPA.) di Provinsi Lampung dan Bengkulu. Mengingat harga gaharu yang demikian tinggi.) masuk dalam Appendix II CITES sejak tahun 2004. diperlukan upaya eksplorasi dan konservasi. 2000) dan sudah memberikan sumbangan kepada pemasukan negara sejumlah 6. maka diharapkan tersedia bukti yang kuat menyangkut status jenis-jenis pohon penghasil gaharu di Indonesia. Dengan usia tanam dari 6 hingga 8 tahun gaharu mampu menghasilkan getah sekitar dua kilogram. Sumatera. baik dari sisi potensi dan persebarannya. Dengan tersedianya informasi yang memadai. Harga gaharu saat ini sangat bervariasi tergantung dari kualitasnya. maka diperlukan upaya serius dari berbagai macam pihak yang berkepentingan agar keberadaan jenis-jenis tersebut di Indonesia dapat dipantau. Selama beberapa dekade ini.Potensi dan Kondisi . Masyarakat di lokasi hutan di Sumatera pada umumnya mengumpulkan gaharu dalam kelompok yang masing-masing terdiri dari 3 sampai 5 orang. malaccencis Lamk..(Titiek Setyawati) spp. Harga gaharu saat ini bervariasi mulai dari 5 juta hingga 20 juta rupiah per kilogramnya. karena berbagai macam alasan yang menyangkut status konservasinya. Mengingat keberadaan jenis-jenis pohon penghasil gaharu yang mulai langka dan terancam punah.

Lokasi Penelitian 1. Kondisi topografi di hutan alam ini sedikit berbukit dengan beberapa lokasi memiliki kelerengan hingga 35 derajat. Kabupaten Lampung Tengah. tepatnya di Kabupaten Lampung Tengah. Pada saat ini. Seksi Krui. maka mereka akan menebang pohonnya secara manual menggunakan kampak. Kondisi hutan sebagian sudah dialihfungsikan menjadi lahan perkebunan dan ladang masyarakat. Lampung Survei jenis-jenis pohon penghasil gaharu di Provinsi Lampung dilakukan di satu lokasi yang ada di dalam kawasan Taman Nasional Bukit Barisan Selatan (Hutan Biha) dan dua lokasi di luar kawasan TNBBS. Kecamatan Pesisir Selatan. Areal penelitian masuk dalam Seksi Konservasi Wilayah II Krui dengan luas kawasan ± 96. Kawasan Hutan Bukit Rupi berada di luar kawasan TNBBS namun demikian merupakan kawasan hutan lindung yang dikelola oleh Dinas Kehutanan Provinsi Lampung Tengah.884 ha dengan cakupan wilayah meliputi Resort Merpas. Kabupaten Lampung Barat. Resort Biha. yaitu di Hutan Bukit Rupi dan Hutan Gunung Sugih. Kawasan Hutan Bukit Rupi berada di Desa Segala Midar. Jika gaharu ditemukan. pencarian gaharu makin sulit akibat potensinya yang mulai menurun. Kawasan Hutan Biha masuk dalam Blok Hutan Podomoro.Aspek SOSIAL EKONOMI DAN KONSERVASI gaharu di pedalaman hutan. Pugung 216 . Kecamatan Pubian. METODE PENELITIAN A. sehingga orang harus tinggal lebih dari 2 minggu atau bahkan sebulan hanya untuk mendapatkan gaharu. Seringkali terjadi bahwa kualitas gaharu tidak seperti yang mereka inginkan dan pada akhirnya pohon yang sudah terlanjur ditebang ditinggalkan begitu saja di hutan. dimana ditemukan tegakan gaharu yang masih utuh. Lokasi survei berada di Desa Sumur Jaya. Namun demikian masih ada beberapa lokasi hutan alam.

Curah hujan ratarata di bagian barat adalah 3. yaitu Seksi Konservasi Wilayah I Liwa.(Titiek Setyawati) Tampak.. Krui..Potensi dan Kondisi .000 mm/ th.500 mm/th sedangkan di bagian timur 2. dan Biha. Gambar 1. Peta lokasi survei dan pengamatan 2. Waktu tempuh dari pusat kota Bengkulu sekitar 30 menit dengan jarak sekitar 20 km (Gambar 2). dan Seksi di Provinsi Lampung Konservasi Wilayah III Sukaraja. Topografi kawasan ini bergelombang dan berbukit-bukit dengan ketinggian berkisar antara 0-1.. 217 . Kawasan hutan TNBBS ini terletak di ujung selatan dari rangkaian pegunungan Bukit Barisan dan secara geografis berada pada 4031’5057’ LS dan 103024’1 0 4 0 BT s e d a n g k a n secara administratif p e n ge l o l a a n te r b a g i d a l a m t i g a w i l aya h pengelolaan.000-3. S e k s i Ko n s e r va s i jenis-jenis pohon penghasil gaharu Wilayah Krui. Lokasi penelitian secara detil tertera pada Gambar 1..964 m dpl.500-3. Bengkulu Lokasi kedua kawasan hutan sangat berdekatan dengan Tahura Rojolelo yang terletak di antara 03 42’-03 44’LS sampai 102 21’BT dan berada di ketinggian 10-30 m dpl.

tinta gambar spesial. B. GPS Garmin 12 satelit. pisang. Lokasi penelitian di Kawasan Hutan Binjai Temula (Kec. dan potensi sebaran jenis pohon penghasil gaharu ini adalah semua jenis pohon yang diduga menghasilkan gaharu yang terdapat di kawasan hutan lindung. Pondok Kelapa). alat plak herbarium. fenologi. kertas gambar spesial. larutan sub-limat. Alat yang digunakan untuk pengambilan data di lapangan. dan tanaman palawija lainnya. Bengkulu Utara Kawasan hutan dekat Desa Tanjung Terdana sebagian besar sudah dikonversi menjadi areal persawahan dan perkebunan masyarakat. Tanaman yang umum ditanam antara lain padi. kertas koran. kompas. BAHAN DAN ALAT A. karung plastik. Bahan dan Alat Bahan yang dijadikan sebagai obyek kegiatan ekologi. kelapa sawit.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 2. Prosedur Kerja Kajian lapangan di Kabupaten Lampung Tengah dan Lampung Barat dilakukan pada bulan Oktober dan Desember 2007 sedangan 218 . dan tali rafia. Talang Empat) dan Pungguk Gambo (Kec. pena/alat gambar. jeruk. kertas plak herbarium. kamera digital. tambang nilon. jati. baik primer dan sekunder. antara lain alkohol 96%. kantung plastik. karet.

baik di lahan kering maupun lahan basah. Ketinggian tempat di lahan kering ada 3 macam. Pengumpulan data lapangan. Kuesioner dipersiapkan sebelum kegiatan lapangan dilakukan. Untuk itu digunakan blanko isian mencakup data pohon. 200-500 m.Potensi dan Kondisi . 1. Kecamatan Pondok Kelapa. Pengamatan dan analisis gaharu meliputi beberapa macam kegiatan. Desa Tanjung Terdana. yaitu pada bulan Oktober dan Desember 2008. data kondisi lingkungan tempat tumbuh. Provinsi Bengkulu dilaksanakan dua kali. Eksplorasi dilakukan di berbagai kondisi hutan.(Titiek Setyawati) Kabupaten Bengkulu Utara.. dan 5 orang tenaga teknis lapangan. Beberapa contoh pohon akan diambil untuk keperluan identifikasi dan koleksi herbarium. Desa Dusun Baru. dan data penggunaan tradisional penduduk setempat. baik secara langsung melalui wawancara dengan masyarakat yang tinggal di dekat dan sekitar hutan maupun tidak langsung dengan cara melakukan kajian pustaka. Kegiatan pengamatan dan pengukuran di lapangan dikerjakan oleh seorang peneliti.. 3. Koleksi data primer di lapangan mencakup keanekaragaman jenis pohon penghasil gaharu dan kondisi lingkungan tempat tumbuhnya dengan menggunakan metode eksplorasi dalam jalur-jalur yang sistematik. Pengamatan pertama di Bengkulu dilaksanakan di Hutan Lindung Kelompok Hutan Binjai Temula. yakni topografi datar (kemiringan lereng kurang dari 10%) dan bergelombang berat (kemiringan 25% atau lebih). Panjang tiap jalur eksplorasi yaitu 1 km dengan jarak antar jalur 500 m. Kecamatan Talang Empat dan yang kedua di Hutan Lindung Kelompok Hutan Pungguk Gambo. dan lebih dari 500 m dpl dengan topografi yang berbeda. 3 orang teknisi. antara lain: 2. yaitu antara 0-200 m. Di samping itu dibuat juga blangko isian tersendiri yang digunakan untuk bahan wawancara dengan penduduk yang berisi pertanyaan-pertanyaan menyangkut berbagai macam informasi tentang karakter jenis-jenis pohon penghasil gaharu yang dikenal oleh penduduk setempat. Waktu pengamatan lapangan masing-masing selama 8 dan 10 hari... 219 .

7. Jika anakan yang pertama ditemukan berada jauh dari pohon induk. Pengidentifikasian jenis-jenis pohon penghasil gaharu dan proses koleksi herbarium dari kegiatan eksplorasi. 6. Penulisan deskripsi jenis-jenis pohon penghasil gaharu yang disertai gambar lukisan spesimen herbarium. Pendataan pohon meliputi nama jenis. 10. 8. Pembuatan tally sheet untuk mengisi data tentang masa berbunga dan berbuah jenis-jenis pohon penghasil gaharu. Jarak anakan pertama dengan pohon induk diukur. Penggambaran lukisan spesimen herbarium jenis pohon penghasil gaharu. Pada tiap titik pusat kuadran dilakukan perisalahan 4 individu pohon penghasil gaharu atau pohon lainnya yang terdekat dengan titik pusat atau 1 individu pohon pada tiap kuadran.Aspek SOSIAL EKONOMI DAN KONSERVASI 4. 5. Pengolahan data potensi keberadaan jenis pohon penghasil gaharu dan wilayah sebarannya yang terdapat di dalam kawasan hutan alam. tingkat pancang (tinggi lebih dari 150 cm dengan diameter kurang dari 10 cm) dan tingkat tiang (diameter 10-20 cm) di sekitar titik pusat kuadran. Pengolahan data hasil wawancara dengan masyarakat lokal. dan tinggi pohon. diameter batang. Estimasi regenerasi jenis-jenis pohon penghasil gaharu yang terdapat di kawasan hutan dengan cara menghitung permudaan tingkat semai (tinggi kurang dari 150 cm). maka dibuat risalah anakan menggunakan metoda jalur transek sepanjang 1 km dari titik anakan pertama ditemukan. Selanjutnya dibuat petak 10 m x 10 m di setiap selang 200 m dari jalur transek. 11. 9. Individu pohon tersebut yang dirisalah dibatasi jarak terjauh 25 m dari titik pusat kuadran dan diameter batangnya 20 cm atau lebih. Mengadakan pendugaan potensi dan sebarannya dengan menggunakan metode titik pusat kuadran (quadrant center point method) sepanjang jalur eksplorasi dengan jarak antara titik pertama dan titik berikutnya 50 m. Penduduk yang tinggal di dekat kawasan diminta untuk mengisi blanko kosong yang harus diisi dengan informasi kapan masa 220 .

Beberapa definisi dan kalkulasi yang digunakan dalam analisis vegetasi. Luas bidang dasar untuk tiap plot dijumlah untuk memperoleh LBD tiap pohon dengan menggunakan rumus: LBD (m2) = pi x d (diameter dalam m)2/4 (Kent dan Coker. malaccensis Lamk. 1994). Kelimpahan Relatif (KR). DR merupakan rasio total luas bidang dasar dari suatu jenis terhadap jumlah total luas bidang dasar dari seluruh jenis yang ada. Nilai NP ini diperoleh dengan cara menjumlahkan Dominansi Relatif (DoR).. kering.. Hasil Pengamatan di Lampung Hasil pengamatan yang diperoleh dalam rangka melakukan kajian potensi sebaran jenis A. jumlah buah dan bunga (persentase). Krebs. Nilai Penting (NP): perkiraan secara keseluruhan pentingnya suatu jenis pohon di dalam komunitas lokalnya. 5.. KR merupakan rasio jumlah individu dari suatu jenis terhadap jumlah total jenis di dalam plot dan FR merupakan rasio frekuensi dari suatu jenis terhadap total frekuensi seluruh jenis di dalam plot (Kent dan Coker. Analisis Data 1.. dan Frekuensi Relatif (FR) dari jenis tertentu. 1999. jumlah pohon yang berbuah dan berbunga. 3. dan sebagainya) dan mengisi data curah hujan. HASIL DAN PEMBAHASAN A. 1992. di mana jenis ditemukan. Kepadatan: jumlah individu per plot (100 m2). panas. 4. Luas Bidang Dasar (LBD): luasan bagian melintang dari batang >20 cm sebatas dada (diameter of breast height (dbh)). 1992). kondisi iklim atau cuaca pada saat berbunga atau berbuah (hujan. C.(Titiek Setyawati) berbunga. antara lain: 2. Frekuensi: jumlah unit contoh (10 m x 10 m).Potensi dan Kondisi . di Provinsi Lampung ini menunjukkan bahwa di beberapa lokasi di dalam kawasan Taman Nasional Bukit Barisan Selatan ini masih terdapat 221 .

sapling. Khusus di Bukit Rupi. Di beberapa tempat juga tampak tandatanda bekas perambahan hutan yang tentunya sebagian besar untuk mengambil kayu gaharu. Nampak bahwa kondisi batang tegakan pohon sangat halus dan tidak ditemukan cacat pohon. mereka tidak merasa menanam pohon penghasil gaharu dan menemukan pohon tersebut tumbuh di halaman kebun mereka. dan anakan yang ditemukan pada enam plot sampel tampak cukup banyak. Tampaknya tidak banyak gangguan seperti pengambilan gubal gaharu di kawasan ini. Namun demikian. Kemungkinan besar biji gaharu terbang dan menemukan media yang baik untuk tumbuh besar di kebun milik penduduk tersebut. Di lokasi ini juga dijumpai tegakan pohon penghasil gaharu alami yang tumbuh Gambar 3. Kemungkinan hal ini disebabkan akses ke dalam kawasan hutan yang relatif sulit dibandingkan dengan Kawasan Hutan Biha. Anakan gaharu yang ditemukan tumbuh secara besar di wilayah perkebunan alami di Kawasan Hutan Bukit milik masyarakat (Gambar Rupi. Lampung Tengah 4). karena berdasarkan wawancara dengan pemilik kebun. Lampung Tengah menunjukkan 222 . Lampung Tengah tertera pada Tabel 1. Lampung Tengah. Tegakan dapat dikatakan alami. belum ada laporan bahwa pohon tersebut pernah menghasilkan gaharu atau terinfeksi oleh patogen. jumlah tegakan pohon. Jumlah pohon gaharu yang dapat ditemukan di Bukit Rupi. Tampak pada Gambar 3 kecambah gaharu yang tumbuh melimpah menyerupai permadani di bawah tegakan induknya yang ditemukan di Kawasan Hutan Bukit Rupi. Hasil pengamatan regenerasi alam jenis gaharu di Kawasan Hutan Way Waya.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan alam pohon gaharu meskipun jumlah dan potensi regenerasi alamnya tampak mengalami penurunan seperti yang ada di Kawasan Hutan Biha. Gunung Sugih.

Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Hutan Biha sangat sedikit. sehingga pemungut kayu gaharu setiap saat dapat secara kebetulan maupun ada juga yang dengan niat keras.Potensi dan Kondisi . Nampak pula bahwa sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu. malaccensis Lamk.. Tampak bahwa tidak satu pun jenis penghasil gaharu ditemukan di petak sampel (Tabel 2) di antara 13 jenis pohon hutan yang berhasil diidentifikasi di laboratorium Botani Hutan. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Biha tertera pada Tabel 3. menemukan jenis gaharu tersebut. namun bukan sama sekali tidak ditemukan seperti di Kawasan Hutan Gunung Sugi. Tegakan pohon A. Kurangnya jumlah pohon ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung. sehingga kemungkinan sejak dahulu sudah banyak masyarakat yang memanfaatkan gaharu yang tumbuh alami namun hal ini tidak dibarengi dengan upaya budidayanya. Gambar 4.. Lampung Tengah. yang ditemukan tumbuh secara alami di perkebunan milik masyarakat yang lokasinya berbatasan dengan Kawasan Hutan Bukit Rupi. meskipun lokasinya sama-sama di satu kabupaten... Lampung Tengah 223 .(Titiek Setyawati) perkembangan yang sedikit berbeda dengan yang ada di Bukit Rupi.

dan anakan A. 4. malaccensis Lamk. Penduduk setempat yang sudah melakukan upaya bu-didaya penanaman pohon gaharu (A. Gunung Sugih. Jumlah pohon (> 10 cm) 26 9 8 14 16 8 Jumlah pancang 34 15 21 16 19 17 Jumlah anakan 14 21 30 14 11 9 Tabel 2. 3. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Rupi.) di kebun miliknya di Kawasan Hutan Gunung Sugih. anakan dan semai beberapa jenis pohon alami yang ada dalam 50 plots penelitian di Kawasan Hutan Way Waya. 6. malaccensis Lamk.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 5. pancang. Lampung Tengah No. pancang. 2. Lampung Tengah Pohon No 1 2 3 Nama jenis Artocarpus elasticus Ganophyllum falcatum Bombax valetonii Plot 15 5 4 Batang 45 10 5 Tiang Plot 2 0 0 Batang 6 0 0 Pancang Plot 0 4 2 Batang 0 15 4 Semai Plot 0 0 0 Batang 0 0 0 224 . Jumlah pohon. Lampung Tengah Tabel 1. 5. Jumlah pohon. plot 1.

Hibiscus macrophyllus Plot 4 0 3 3 2 4 2 3 2 1 Batang 5 0 7 5 3 5 3 5 3 1 Tiang Plot 4 1 5 4 1 2 5 5 4 4 Batang 8 4 12 8 2 5 8 6 5 5 Pancang Plot 6 5 0 2 0 3 0 2 0 2 Batang 18 17 0 7 0 10 0 7 0 3 Semai Plot 4 12 11 10 0 6 12 5 13 0 Batang 8 20 23 15 0 12 23 12 20 0 Tabel 3. Kabupaten 225 . Ficus sp.. Desa Sendang Baru.Potensi dan Kondisi .. malaccensis Lamk. Artocarpus sp. oleh karena itu pembuatan plot dilakukan di hutan belukar tersebut. pancang. Kecamatan Sendang Agung. Namun demikian masih terdapat beberapa pohon penghasil gaharu alami yang tersisa di daerah hutan belukar. dan anakan A. Jumlah pohon. 4. Jumlah pohon (> 10 cm) 2 Jumlah pancang 1 2 4 Jumlah anakan 3 8 5 12 Berdasarkan informasi penduduk yang tinggal di Kawasan Hutan Lindung Bukit Sugih (Register 22 Way Waya) bahwa jenis pohon gaharu sudah sulit dijumpai karena adanya pembalakan hutan maupun adanya pencari gaharu di masa lampau. Alstonia angustifolia Pometia pinnata Cananga odorata Litsea sp. 2. Pohon gaharu yang masih ada di Kawasan Hutan Register 22 Way Waya. Lampung Barat No..(Titiek Setyawati) Pohon No 4 5 6 7 8 9 10 11 12 13 Nama jenis Pterospermum diversifolium Laportea stimulans Vitex sp. plot 1.. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Biha. 3.

Tegakan pohon A. dan 34 cm. (Thymelaeaceae). Adapun jenis pohon penghasil gaharu yang ditemui hanya satu jenis yaitu A. dan tingkat anakan terdapat 3 plot dengan jumlah masing-masing 30. Titik yang terdekat berjarak sekitar 5 km dengan jarak tempuh sekitar 1 jam berjalan kaki. Gambar 6. Lampung Barat 226 . Lampung Tengah. 85. 25 cm. sedangkan tingkat tiang tidak dijumpai. tingkat pancang hanya satu batang. dan 102 batang.Aspek SOSIAL EKONOMI DAN KONSERVASI Gunung Sugih. malaccensis Lamk. Dari 50 plot yang dibuat terdapat 5 plot yang dijumpai pohon penghasil gaharu. 28 cm. hanya tinggal sekitar 5 pohon. itu pun terbagi tempatnya menjadi tiga titik dengan jarak tempuh yang berbeda. 30 cm. masing-masing satu batang pohon yang berdiameter 20 cm. malaccensis Lamk. (kiri) dan anakan yang tumbuh di bawahnya (kanan) di lokasi Kawasan Hutan Biha.

20%).Potensi dan Kondisi . (57.(Titiek Setyawati) B. Kedua lokasi berada di Provinsi Bengkulu dan kedua kawasan juga masuk dalam kawasan hutan lindung. memiliki indeks nilai penting yang cukup tinggi pada tingkat pohon. Kecamatan Pondok Kelapa. merupakan jenis yang ditemukan di kedua lokasi penelitian di Bengkulu Utara. Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Kawasan Binjai Temula ini sangat sedikit. Desa Dusun Baru. Sampai saat ini masih terdapat perburuan gaharu di hutan alam dan bahkan masyarakat atau penduduk lokal mengumpulkan anakan pohon gaharu (semai dan pancang) dari hutan alam untuk diperdagangkan. pada Kawasan Lindung Kelompok Hutan 227 . Tegakan gaharu pada tingkat tiang dan pancang tidak ditemukan pada plot sampel namun mendominasi pada tiangkat seedling (38. Hal ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung dan kemungkinan besar juga adalah tingkat reproduksi tegakan yang mulai berkurang. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Pungguk Gambo tertera pada Tabel 5. sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu. Jumlah pohon penghasil gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Binjai Temula tertera pada Tabel 4. Hasil Pengamatan di Kawasan Hutan di Provinsi Bengkulu Hasil menunjukkan bahwa A.... Desa Tanjung Terdana.86% (urutan kedua setelah Cinnamomum porectum (Roxb. malaccensis Lamk.) Kostm.72%). Berdasarkan hasil analisis vegetasi di Kelompok Hutan Binjai Temula. Kecamatan Talang Empat dan Kelompok Hutan Pungguk Gambo.. yaitu 39. Kondisi regenerasi di kawasan ini hampir sama dengan kawasan yang sebelumnya. Tampak bahwa jumlah pohon sangat sedikit dan menurut informasi yang diperoleh dari masyarakat sekitar. Berdasarkan angka nilai pentingnya. yaitu Binjai Temula. sehingga sejak dahulu sudah banyak memanfaatkan gaharu yang tumbuh alami. yaitu di Kelompok Hutan Binjai Temula. Hal ini terjadi terutama di Kawasan Lindung Kelompok Hutan Pungguk Gambo. malaccensis Lamk. A.

dan anakan A. pohon penghasil gaharu (>20 cm) menduduki urutan keempat (43. 3. Kecambah atau biji yang mulai tumbuh (kiri) dan beberapa anakan mulai tinggi (kanan) di areal Kelompok Hutan Pungguk Gambo Tabel 4. plot 1. dan Garcinia diocia Blume (56. (67.30%). 2. Pada plot sampel di lokasi Pungguk Gambo.82%).59% pada tingkat pancang dan berada di urutan keempat (19. pancang. porectum (Roxb. 6. Jumlah pohon. (90. 4. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Binjai Temula. malaccensis Lamk.Aspek SOSIAL EKONOMI DAN KONSERVASI Pungguk Gambo.20%) setelah Vitex pubescens Vahl. Bengkulu Utara No. banyak ditemukan kecambah atau biji-biji yang mulai berkecambah di bawah pohon induknya serta beberapa anakan dengan pertumbuhan yang cukup sehat (Gambar 7). C. Tegakan tidak ditemukan di tingkat tiang dan hanya memiliki nilai penting 3.55%).) Kostm. 5. Jumlah pohon (> 10 cm) 1 1 0 1 1 0 Jumlah pancang 0 0 0 0 0 0 Jumlah anakan 0 3 1 2 3 2 228 .48%) untuk tingkat seedling atau semai. Gambar 7.

. malaccensis Lamk. plot 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 0 1 Jumlah pancang 0 0 0 0 Jumlah anakan 2 1 3 3 Tabel 5. Tegakan pada tingkat pohon terlihat sangat rapat (Gambar 8) dan pada sebagian petak sampel terdapat pohon dengan ukuran diameter yang cukup besar namun belum menampakkan tandatanda terjadinya pembusukan yang mengakibatkan terbentuknya gaharu (Gambar 9).. Namun demikian semai/seedling berukuran tinggi di atas 10 cm saja dihitung dalam petak pengamatan (2 m x 2 m) untuk memperoleh angka nilai penting. 4. karena akan dipungut oleh penduduk untuk diperdagangkan.(Titiek Setyawati) No. Jumlah pohon. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Pungguk Gambo No.. Pada umumnya pohon mulai berbunga dan berbuah pada umur 5 sampai 6 tahun bahkan pohon berukuran sedang bisa menghasilkan biji kurang lebih 1. 3. pancang dan anakan A.5 kg pada musim yang baik. plot 1.Potensi dan Kondisi . Masa 229 . 2.. 5 6 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 1 0 1 0 0 0 0 0 Jumlah pancang 0 0 2 0 0 0 0 0 0 0 Jumlah anakan 0 0 0 0 0 3 0 4 0 0 Biji yang mulai berkecambah tersebut tumbuh sangat rapat dan pada umumnya hanya bertahan beberapa hari saja.

Pembungaan pada bulan Maret-April akan menghasilkan buah di bulan Juli-Agustus (Adelina. 230 . 2001). Penyakit seperti ini tidak ditemukan di lokasi penelitian di Bengkulu Utara. menghisap cairan daun dan menyebabkan helai pucuk daun bergulung dan mengakibatkan anakan menjadi kerdil. Buah ini harus langsung dipanen dari pohonnya. Di Sumatera.Aspek SOSIAL EKONOMI DAN KONSERVASI berbunga dan berbuah biasanya terjadi pada bulan-bulan kering. 2004). Sumarna et al. Tegakan gaharu yang rapat Gambar 9. Gambar 8. Masalah utama di lapangan adalah penyakit pada anakan yang disebabkan oleh serangga kecil yang hinggap di ujung daun anakan. Pohon gaharu dengan diameter ≥ 50 cm Pohon berbunga pada bulan Juli dan Agustus dan menghasilkan buah matang pada bulan November-Desember. Petani menggunakan pestisida jika perlu untuk membasmi serangga ini. 2000. Perkecambahan biji dan anakan yang muda sangat rentan terhadap penyakit damping off yang disebabkan oleh jamur (Kundu dan Ka-chari.. masa berbunga dan berbuah 2 kali dalam setahun. Meskipun ada. Buah yang matang berwarna coklat kehitamhitaman.

2007. Berdasarkan hasil pengamatan lapangan dan estimasi potensi regenerasi alam jenis-jenis pohon penghasil gaharu yang tumbuh di hutan alam di beberapa lokasi contoh di Kabupaten Lampung Tengah dan Lampung Barat. Estimasi potensi stock kayu gaharu di Indonesia yaitu 1.Potensi dan Kondisi . Indonesia merupakan eksportir utama produk gaharu dan dengan tingginya permintaan pasar akhir-akhir ini serta tingginya harga yang ditawarkan di pasar dunia. 2. KESIMPULAN DAN SARAN A. Sebagai akibatnya populasinya di alam makin lama makin berkurang. Tampak bahwa stock di kawasan hutan di Sumatera lebih rendah dibandingkan dengan kawasan hutan yang ada di Kalimantan dan Papua. masih banyak namun demikian kondisinya saat ini menghadapi ancaman penurunan populasi di berbagai tingkatan umur 231 ..(Titiek Setyawati) dilaporkan hanya sedikit di beberapa tempat saja.37 pohon/ha di Kalimantan. tampak bahwa potensi tegakan alam A. Demikian pula dengan potensi regenerasinya yang ditunjukkan dengan sedikitnya jumlah semai maupun anakan yang ada di bawah tegakan alam. Hasil pengamatan di dua lokasi contoh di Kabupaten Bengkulu Utara. Kesimpulan 1.. 3..33 pohon/ha di Papua. malaccensis Lamk. Meskipun tampak bahwa di kawasan Bengkulu Utara di sebagian tempat tampak rapat namun keberadaan pohon penghasil gaharu sendiri tidak menjamin adanya resin gaharu. Beberapa peneliti menduga bahwa hanya 10% dari pohon Aquilaria yang mengandung gaharu.. Namun hal ini tidak mengurangi kerusakan dan berkurangnya populasi gaharu di alam (Anonim.87 pohon/ha di Sumatera. 2001). Saat ini gaharu sudah masuk dalam Appendix II CITES. Bisanya petani akan membuang anakan yang sakit. malaccensis Lamk. sudah mengalami penurunan populasi. dan 4. tampak bahwa potensi tegakan alam A. maka banyak kolektor yang tidak berpengalaman pada akhirnya ikut mengeksploitasi gaharu di alam. Soehartono dan Newton.

Kawasan hutan di Provinsi Lampung dan Bengkulu memiliki potensi yang cukup baik untuk dijadikan areal sumberdaya genetik untuk jenis A. kawasan hutan di Provinsi Bengkulu.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan. mengingat potensi jenis gaharu yang masih tampak baik. malaccensis Lamk. Berlainan dengan temuan yang ada di Provinsi Lampung. Sebagian besar penduduk memperjualbelikan anakan alami untuk 232 . Akibatnya bagi proses regenerasi alaminya terjadi kekosongan tegakan pada tingkat tiang. akibat pemanenan gaharu yang kurang memperhatikan aspek kelestarian. khususnya Kabupaten Lampung Tengah dan Lampung Barat memiliki potensi tegakan alam gaharu yang cukup merata meskipun di beberapa lokasi jumlah sampelnya tidak memadai. B. Saran Provinsi Lampung. Meskipun ada beberapa lokasi sampel dengan kondisi tegakan pohon dewasa yang sangat kurang. 3. Meskipun demikian jenis pohon ini mengalami ancaman serius akibat perburuan. Sedikit lebih baik dari kondisi gaharu di Provinsi Lampung. Untuk data masa pembungaan dan berbuah sampai saat penelitian belum dapat diperoleh mengingat masa pengamatan tidak bertepatan dengan masa berbunga dan berbuah. terutama di tingkat seedling dan sapling. tidak hanya pohonnya namun juga anakan alaminya. sehingga diperlukan penyuluhan bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan Taman Nasional Bukit Barisan Selatan dan kawasan hutan lindung. khususnya Kabupaten Bengkulu Utara memiliki potensi tegakan alam gaharu yang juga cukup baik dilihat dari sisi populasi tegakan alaminya. Tampak pula terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. di Bengkulu ditemukan adanya laporan serangan serangga yang menyebabkan pertumbuhan tegakan gaharu menjadi kerdil. sehingga potensi regenerasi alami akan mengalami hambatan karena ketidakseimbangan pertumbuhan di setiap tingkatan terutama tidak terjadinya pertumbuhan mencapai tingkat tiang.

Downloaded: 24 Januari 2007. Seed Leaflet No. CRC Press. DAFTAR PUSTAKA Adelina.tanam. 2009. Ayo Tanam Gaharu. dan J. terutama gangguan terhadap proses regenerasi alaminya. C. L. I. Krebs. 1992. Jakarta. dan P. CIFOR.depan. 1999. Kent.ayo.. December 2004.c o m / r e a d / xml/2009/07/24/1300220/siapkan. Kachari. 2000. k o m p a s . III.species_gaharu. Badan Penelitian dan Pengembangan Kehutanan. Claiming the Forest. wwf. Mengingat masih terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian.(Titiek Setyawati) dikembangkan lebih lanjut atau ditanam di kebun masyarakat ataupun dijual ke luar daerah Bengkulu. 1987. 103. Vegetation Description and Analysis : A Practical Approach. gaharu Anonim. maka diperlukan penyuluhan atau pendidikan konservasi bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan hutan lindung yang merupakan habitat alami jenis pohon penghasil gaharu ini.Potensi dan Kondisi . Vol. Kaskija. Punan Local Histories and Recent Developments in Bulungan. 2007. Anonim. Desiccation Sensitivity and Recalcitrant Behaviour of Seeds of Aquilaria agallocha Roxb. Behalven Press. Heyne. Ecological Methodology. Tumbuhan Berguna Indonesia. East Kalimantan. Krebs.. Media on line : http// www. II. Yayasan Sarana Wana Jaya. K.. Harper Collins College Publishers. J.. Gaharu (Aquilaria). Seed Science and Technology. 233 . Forest & Landscape Denmark.or. Jim Green. N. 1994. Aquilaria malaccensis Lamk.masa. 2004.id/index. Ecology : The Experimental Analysis of Distribution and Abundance. Kundu. Coker. dan IV. Ko m p a s o n l i n e : h t t p : / / r e g i o n a l . C. J. Siapkan Masa Depan. M.php?fuseactian=whatwedo. 2002. Indonesia. M.

Biological Conservation No. Pengaruh Wadah Penyimpanan dan Kelas Diameter Terhadap Pertumbuhan Stump Wikstroemia polyantha. Soehartono.112 and 11. Irian Jaya. Buletin Penelitian Kehutanan 1(1). Indonesia. 234 .A. Zich. Sumarna. Latin. Forest.R. An information Document Prepared by TRAFFIC Oceania for the Eleventh Meeting of the CITES Plants Committee. dan B. Bogor. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria II. Agarwood (Gaharu) Harvest and Trade in Papua New Guinea : A Preliminary Assessment.C. 1996. dan J. R.113 Regarding Aquilaria spp. Soehartono. Bulungan Ethnobiology Handbook. Resources and People in Bulungan.K. Zuhud. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria I. dan A. Canberra. CIFOR. Australia. Y. with reference to CITES Decisions 11. 2000. Balai Penelitian Kehutanan Manokwari. Centre for Plant Biodiversity Research. 2001. Newton. Mindawati. Pembibitan Jenis Pohon Penghasil Gaharu (Aquilaria malaccensis Lamk). dan N. T. Elements for a History of Settlement. T. Puri. Trade and Social Dynamics in Borneo.Aspek SOSIAL EKONOMI DAN KONSERVASI Mai. A. CIFOR. CSIRO Plant Industry..C.CIFOR.M. The Impact of Gaharu Harvesting in Indonesia. 2001. dan A. Suripatty. East West Center-Prosea. Newton. 96. Pelestarian dan Pemanfaatan Keanekaragaman Tumbuhan Obat Hutan Tropika Indonesia. B. Syaffari. 2001. 2001. 1880-2000. Indonesia. F. 1994. Biological Conservation No 97.A. Bogor. Compton. 2001. E. Sellato. Status and Use in Indonesia. R.

. Lampung Tengah No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Nama lokal Kayu alim Leban Kelat Kelepu Putat Lahu Ketaran Kilada Simpur Terap Sepat Rempelas Lingkem Ranggung Ancau Cempaka Pulai Lupang Medang Kedukduk Gio Kemutul Seru Asam Kandis Nerung Petai Sebasah Beruas Tepa Sago Sidi Nyari Sungkai Nama botanis Aqualaria malaccensis Lamk. Schima wallichii Korth. Ficus variegata Bl. Vitex pubescens Vahl. Antidesma tetandrum Blume Peronema canescens Jack Famili Thymelaeaceae Verbenaceae Myrtaceae Rubiacea Lecythidiaceae Moraceae Moraceae Lauraceae Dilleniaceae Moraceae Rhizophoraceae Dilleniaceae Selaginelaceae Dilleniaceae Rutaceae Rutaceae Apocynaceae Sterculiaceae Lauraceae Melastomataceae Melastomataceae Hypericaceae Theaceae Guttiferae Ulmaceae Mimosaceae Olacaceae Guttiferae Lauraceae Celasteraceae Theaceae Euphorbiaceae Verbenaceae 235 . Strombosia javanica Blume Garcinia celebica L. Cinnanmomum porectum (Roxb..Potensi dan Kondisi .) Kosterm. Garcinia dioica Bl. Clausena excavata Burm. Parkia speciosa Hassk.. Cratoxylum formosum Dyer. Dillenia sumatrana Miq. Daftar jenis pohon yang di survei dalam plot pengamatan gaharu di Bukit Rupi. Comersonia bartamia Merr Dehaasia caesia Blume Clidenia hirta don Kibessia azurea DC.. Eugenia grandis Wight Neonauclea calycina Merr Barringtonia sp. Artocarpus anisophyllus Reinw. Dillenia excelsa Gieg. Carallia brachiata Merr Tetracera indica L. Artocarpus elasticus Reinw. Parasponia parvifolia Miq. Cinnamomum iners Blume Peltophorum grande prain Eurya acuminata APDC. Selaginella plana Hiern. Evodia aromatica Blume Alstonia angustiloba Miq.(Titiek Setyawati) Lampiran 1.

Ganophyllum falcatum Blume Lucuma maingayi Dub Carallia brachiata Merr Famili Thymelaceae Lauraceae Verbenaceae Myrtaceae Leguminosae Lauraceae Dilleniaceae Moraceae Leguminosae Burseraceae Euphorbiaceae Euphorbiaceae Rubiaceae Euphorbiaceae Hyperiaceae Styraxaceae Compositae Rutaceae Lauraceae Annonaceae Liliaceae Euphorbiaceae Symplocaceae Myristicaceae Guttiferae Euphorbiaceae Euphorbiaceae Hyperiaceae Elaeocarpaceae Linnaceae Lauraceae Myrtaceae Rubiaceae Rubiaceae Rubiaceae Sapotaceae Sapotaceae Rhizophoraceae 236 .Gambir Ketepung K.) Kostrm Vitex pubescens Vahl Rhodamnia cinerea Jack Parkia speciosa Hassk Litsea odorifera T et B Dillenia exelsa Gilg Artocarpus elasticus Reinw Archidendron jiringa (Jack) Nielsen Canarium dichotonum Miq Baccaurea racemosa Muell Arg Croton argyratus Blume Neonauclea calycina Merr Glochidion zeylanicum Juss Cratoxylum formosum (jack) Dyer Styrax benzoind Dryand Vernonia arborea Ham. Desa Dusun Baru. Bengkulu Utara No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Nama lokal Karas Gadis Leban Marapuyan Petai Berawas Sipo Terap Jering Tetak Tunjuk Semipis Kademe Semuting Seubo-ubo Kemutun K.Angit Jungjung bukit Sugi Sipunan Kenidai Kendung Naran Kandis Kbg Saka/ Seketut Pelangas Lulus Gamat Marabikang Kemalau Gelam Abang K. Aporusa aurita Miq Cratoxylum sumatranum (Jack) Blume Elaeocarpus stipularis Blume Ixonanthes petiolaris Blume Litsea firma Hook.Br Bridelia monoica Merr Symplocos cochinchinense Lour Horsfieldia glabularis Warb Garcinia dioica Blume Aporusa sp.f Eugenia glomerata K et V Timonius sericanthus Boerl Tarenna sp.Beras Salung Gajah Salung Urat Use Nyaran Ingitdare Nama botanis Aquilaria malaccensis Lamk Cinnamomum porectum (Roxb. Kecamatan Talang Empat.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 2. Tarenna confusa K et V. Daftar jenis pohon yang ada di dalam Kelompok Hutan Binjai Temula. Clausena exavata Actinodaphne glabra Blume Orophea sp Pleomele elliptica H.

Sign up to vote on this title
UsefulNot useful