P. 1
Isi Buku Gaharu 5 Januari 2011 Full Size

Isi Buku Gaharu 5 Januari 2011 Full Size

|Views: 336|Likes:
Published by Agus Lizar

More info:

Published by: Agus Lizar on Jan 25, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

08/03/2014

pdf

text

original

Sections

  • Sulistyo A. Siran
  • STATUS RISET GAHARU
  • Aspek PRODUKSI
  • Mucharromah
  • Eka Novriyanti
  • Gayuh Rahayu
  • Aspek SILVIKULTUR
  • Atok Subiakto, Erdy Santoso, Maman Turjaman
  • Ragil SB Irianto, Erdy Santoso, Maman Turjaman, Irnayuli R Sitepu
  • Aspek SOSIAL EKONOMI DAN KONSERVASI
  • Sri Suharti
  • Erry Purnomo
  • Pratiwi
  • Titiek Setyawati

ISBN 978-979-3145-63-1

Pengembangan Teknologi Produksi

berbasis pemberdayaan masyarakat
Editor: Sulistyo A. Siran; Maman Turjaman

PENGEMBANGAN TEKNOLOGI PRODUKSI GAHARU BERBASIS PEMBERDAYAAN MASYARAKAT SEKITAR HUTAN
Editor: Sulistyo A. Siran; Maman Turjaman ISBN: 978-979-3145-63-1 Penerbit: Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Kampus Balitbang Kehutanan Jl. Gunung Batu No. 5, Bogor 16110 Telp. (0251) 8633234, 7520067; Fax. (0251) 8638111 E-mail: p3hka_pp@yahoo.co.id

Petikan Undang-Undang Nomor 19 Tahun 2002 tentang Hak Cipta Ketentuan Pidana Pasal 72 (1) Barangsiapa dengan sengaja dan tanpa hak melakukan perbuatan sebagaimana dimaksud dalam Pasal 2 ayat (1) atau Pasal 49 ayat (1) dan ayat (2) dipidana dengan pidana penjara masing-masing paling singkat 1 (satu) bulan dan/atau denda paling sedikit Rp 1.000.000,00 (satu juta rupiah), atau pidana penjara paling lama 7 (tujuh) tahun dan/atau denda paling banyak Rp 5.000.000.000,00 (lima miliar rupiah). (2) Barangsiapa dengan sengaja menyiarkan, memamerkan, mengedarkan, atau menjual kepada umum suatu Ciptaan atau barang hasil pelanggaran Hak Cipta atau Hak Terkait sebagaimana dimaksud pada ayat (1) dipidana dengan pidana penjara paling lama 5 (lima) tahun dan/atau denda paling banyak Rp 500.000.000,00 (lima ratus juta rupiah).

ii

KATA PENGANTAR
Terdapat enam tantangan pembangunan kehutanan yang kita hadapi saat ini, yaitu: degradasi hutan, bencana alam dan lingkungan, pemanasan global, share sektor kehutanan terhadap pertumbuhan ekonomi nasional, desentralisasi sektor kehutanan, dan kontribusi kehutanan dalam hal food, water scarcity, energy, and medicine. Namun, kita masih melihat ada peluang yang merupakan sebuah anugerah bagi bangsa kita, yang bila dibudidayakan dan dikelola secara serius akan dapat menjawab paling tidak lima dari enam tantangan tadi. Anu-gerah yang juga merupakan peluang usaha sektor kehutanan dari jenis HHBK ini bernama “gaharu”. Ide dan gagasan membangun hutan tanaman gaharu juga menarik untuk kita kaji bersama. Kalau selama ini perusahaanperusahaan HTI telah eksis dengan komoditi-komoditi kayu seperti mangium, sengon, mahoni, dan jenis tumbuhan penghasil kayu lainnya, maka bukanlah hal yang mustahil untuk mengembangkan hutan tanaman penghasil gaharu apabila secara finansial menjajikan dan memungkinkan setelah dianalisis kelayakan usahanya. Pengembangan usaha budidaya tanaman HHBK unggulan akan berhasil dengan baik apabila didukung oleh semua stakeholder yang berkepentingan, baik Pemerintah Pusat dalam hal ini Departemen Kehutanan, Pemerintah Daerah, pengusaha, dan petani. Disampaikan terima kasih dan penghargaan yang setinggitingginya kepada semua pihak yang telah berkontribusi hingga terbitnya buku ini.
Jakarta, Nopember 2010

Kepala Badan Litbang Kehutanan

Dr. Ir. Tachrir Fathoni, MSc.

iii

iv

... Sitepu........................... EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp............ DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu ...................................................................... 115 6....... Siran .......... DI PERSEMAIAN Irnayuli R......................... Aryanto...............97 Aspek SILVIKULTUR . UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto..................... Erdy Santoso.......................iii DAFTAR ISI ................... 123 7................................... Yasuyuki Hashidoko.... Ahmad Yani...........................................53 3.... Ragil Setio Budi Irianto........... Maman Turjaman ......... Irianto.....................................................................35 2................. PENGEMBANGAN GAHARU DI SUMATERA Mucharromah....... Sitepu.....................B.......... Maman Turjaman . APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp............... Maman Turjaman....................... Sugeng Sentosa....... DAN Fusarium sp........ Sitepu...... Najmulah.......... 113 5.. TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso.........33 1..........DAFTAR ISI KATA PENGANTAR....... Irnayuli R................................. PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman................................................................................ Aryanto..........................................................1 STATUS RISET GAHARU ..................................... Sugeng Santosa............... 139 v ........ v PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A....................... Ragil S...... Aryanto ..................... PADA Aquilaria microcarpa Eka Novriyanti ................. KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp............................................................................31 Aspek PRODUKSI ................77 4......................................... Irnayuli R...... Erdy Santoso .. Najmulah.......................................................... Ahmad Yani..............................

............. THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo ............................................................................................................................. Erdy Santoso............................................ 193 12........... Irnayuli R........................Daftar Isi 8.......... 181 11........... Sitepu ......................................................... PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti ....................... SUMATERA Titiek Setyawati.................................. POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk. Maman Turjaman............) DI PROVINSI LAMPUNG DAN BENGKULU.............................................................. 159 10...................................... HAMA PADA TANAMAN PENGHASIL GAHARU Ragil SB Irianto. 151 Aspek SOSIAL EKONOMI DAN KONSERVASI ...... KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi ................................................................. 157 9. 213 vi .........................

gaharu sejak zaman dahulu kala sudah digunakan. Dari sisi manfaat. Jawaban yang sudah pasti adalah rumus umum. baik oleh kalangan elit kerajaan. Pertanyaan yang muncul. Dilihat dari wujud dan manfaatnya. lantas kenapa komoditi yang telah populer tersebut sepertinya menghilang begitu lama dan saat ini muncul kembali.) yang telah mengalami proses perubahan fisika dan kimia akibat terinfeksi oleh sejenis jamur. maupun masyarakat 1 . Dalam kehidupan seharihari telah dikenal pepatah “sudah gaharu cendana pula”. gaharu memang sangat unik. Pepatah ini mengindikasikan bahwa sebenarnya komonditi gaharu sudah dipopulerkan oleh nenek moyang kita dan menjadi bukti sejarah bahwa keharuman gaharu telah dikenal sejak ratusan tahun yang lalu. yaitu karena pengambilan jauh lebih besar daripada produksinya. Oleh sebab itu tidak semua pohon penghasil gaharu mengandung gaharu.PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A. Gaharu sebenarnya sebuah produk yang berbentuk gumpalan padat berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar tanaman pohon inang (misalnya: Aquilaria sp. Siran Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu sebuah nama komoditi hasil hutan non kayu yang saat ini menjadi perbincangan banyak kalangan.

Kelangkaan terjadi karena pohon penghasil gaharu ditebang tanpa memperhatikan 2 .-. namun menurut kenyataan. Walaupun sejak 1994 Indonesia berkewajiban melindungi pohon penghasil gaharu. dan ekonomi yang cukup tinggi. dan Suloan (Rp75. Gaharu dengan demikian mempunyai nilai sosial.per kilogram. Saat ini pemanfaatan gaharu telah berkembang demikian meluas antara lain untuk parfum. aroma terapi. kualitas Kemedangan (Rp 1. Selama ini masyarakat hanya tinggal memanen gaharu yang dihasilkan oleh alam.000.. sabun. Besarnya permintaan pasar. dan pola pemanenan yang berlebihan serta perdagangan yang masih mengandalkan pada alam tersebut.. Bertahun-tahun masyarakat dan pemerintah daerah Kalimantan dan Sumatera menikmati berkah dari keberadaan gaharu. harga jual yang tinggi. kualitas Kacangan dengan harga rata-rata Rp15.000. baik sebagai sumber pendapatan masyarakat maupun penerimaan daerah.000. dan stimulan kerja syaraf dan pencernaan.s/d Rp14. disusul kualitas Tanggung dengan harga rata-rata per kilogram Rp 20.-).suku pedalaman di Sumatera dan Kalimantan. harga gaharu dengan kualitas Super di pasaran lokal Samarinda.s/d Rp 50.000.. Seringkali masyarakat tidak tahu pasti kapan pohon penghasil gaharu mulai membentuk gaharu dan bagaimana prosesnya.-). pengharum tubuh dan ruangan.-. dan masuk dalam lampiran Convention on International Trade on Endangered Spcies of Flora and Fauana (Appendix II CITES). Meningkatnya perdagangan gaharu sejak tiga dasawarsa terakhir ini telah menimbulkan kelangkaan produksi gubal gaharu dari alam.s/d Rp 4. bahan obatobatan yang memiliki khasiat sebagai anti asmatik. anti mikrobia. Kalimantan Timur mencapai Rp 40. Tarakan.000. budaya.000.000.000. Berdasarkan informasi..000. body lotion. Secara tradisional gaharu dimanfaatkan antara lain dalam bentuk dupa untuk acara ritual dan keagamaan. kualitas Teri (Rp 10.000.000.000. maka jenis-jenis tertentu misalnya Aquilaria dan Gyrinops saat ini sudah tergolong langka. dan Nunukan. bahan kosmetik dan obat-obatan sederhana.000.000. keberadaan pohon penghasil gaharu tersebut di Indonesia tidak terkecuali di Sumatera dan Kalimantan semakin langka.000.000.-).000.

Oleh karena itu dapat dibayangkan kalau pencari gaharu mendapatkan gaharu kira-kira 5 kilogram. di mana realisasi produksi gaharu pada dekade 80’an pernah mencapai ribuan ton dengan kualitas yang tinggi. Menurut hasil kajian. Guna menghindari agar tumbuhan jenis gaharu di alam tidak punah dan pemanfaatannya dapat lestari maka perlu diupayakan untuk konservasi. Sementara masyarakat secara luas enggan untuk melakukan budidaya pohon penghasil gaharu karena memang tidak memberikan keuntungan apa-apa.. maka jumlah gaharu yang ada di pohon tersebut hanya beberapa gram saja. Prospek untuk mengembalikan gaharu menjadi komoditi andalan kembali terbuka dengan ditemukannya teknologi rekayasa produksi gaharu. sedangkan saat ini produksi tersebut merosot drastis hanya kira-kira puluhan ton saja dengan kualitas yang bervariasi. Dengan teknologi inokulasi maka produksi gaharu dapat direncanakan dan dipercepat melalui induksi jamur pembentuk gaharu pada pohon penghasil gaharu.. Kalaupun ada pohon yang mengandung gaharu. baik in-situ (dalam habitat) maupun ek-situ (di luar habitat) dan budidaya pohon penghasil gaharu. perguruan tinggi. (Sulistyo A. Indikasi menurunnya pupulasi pohon penghasil gaharu ditunjukkan oleh kecenderungan produksi gaharu dari Kalimantan dan Sumatera dari tahun ke tahun. pengusaha 3 . mungkin puluhan atau bahkan ratusan pohon penghasil gaharu yang harus ditebang.Perkembangan Pemanfaatan Gaharu . Praktek semacam inilah yang mengakibatkan jumlah pohon pengahasil gaharu di alam semakin menurun dari tahun ke tahun.. dari 20 pohon penghasil gaharu yang ditebang di hutan alam hanya ada satu atau sering sama sekali tidak ada yang mengandung gaharu. dan LSM konservasi. Namun upaya tersebut tidak mudah dilaksanakan. dan kalaupun ada usaha konservasi dan budidaya namun skalanya terbatas dan hanya dilakukan oleh lembaga penelitian. Siran) ada atau tidak adanya gaharu pada pohon tersebut.. Peningkatan produksi gaharu dimaksud (yang kegiatannya terdiri dari kegiatan di bagian hulu sampai hilir) selanjutnya akan berdampak pada peningkatan penerimaan oleh masyarakat petani.

dan Kepulauan Maluku (1 jenis). di mana salah satu di antaranya adalah gaharu yang bernilai ekonomis tinggi. berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar dari jenis tumbuhan penghasil gaharu yang telah mengalami proses perubahan kimia dan fisika akibat terinfeksi oleh sejenis jamur. Pulau Sulawesi (2 jenis). Kalimantan Barat. yang dilaksanakan pada tahun 2000 ditemukan bahwa Aquilaria spp. Pulau Papua (2 jenis). Oleh sebab itu tidak semua tanaman penghasil gaharu menghasilkan gaharu. dan penerimaan pendapatan asli daerah serta devisa negara. kemudian dalam jumlah terbatas tumbuh di Kepulauan Nusa Tenggara (3 jenis). Di lndonesia hingga saat ini diperkirakan terdapat lebih kurang 25 jenis tumbuhan penghasil gaharu yang dikelompokkan ke dalam delapan marga dan tiga suku. Kalimantan 4 . tumbuhan penghasil gaharu umumnya tumbuh di Pulau Kalimantan (12 jenis) dan Pulau Sumatera (10 jenis). Selain itu hutan hujan tropis Kalimantan juga sangat kaya dengan hasil hutan bukan kayu (HHBK). pemahaman mengenai pentingnya nilai gaharu. GAMBARAN UMUM TUMBUHAN PENGHASIL GAHARU Hutan hujan tropis di Indonesia semenjak tiga puluh tahun yang lalu dikenal sebagai salah satu penghasil utama kayu bulat (log) untuk bahan baku industri perkayuan. Dari pengamatan sebaran Aquilaria spp. Tulisan ini dipaparkan dengan maksud untuk memberikan gambaran secara umum mengenai pemanfaatan gaharu. dan rekayasa pembentukan gaharu yang dapat mengembalikan status komoditi dari kelangkaan menjadi produk andalan. tumbuh tersebar secara luas di Kalimantan Timur. Pulau Jawa (2 jenis). konservasi. Gaharu adalah gumpalan berbentuk padat. Berdasarkan sebaran tempat tumbuh.gaharu. perlunya budidaya.

(-agarofuran. (-)-10-epi-y-eudesmol. KANDUNGAN DAN MANFAAT GAHARU Terdapat beberapa zat penting yang terkandung dalam gubal gaharu yaitu (-agarofuran. populasi Aquilaria spp. Lebih lanjut Susilo (2003) mengatakan bahwa terdapat 17 macam 5 . Indikasi dari menurunnya populasi Aquilaria spp.. salah satu tumbuhan penghasil gaharu terpenting yang banyak tumbuh di Kalimantan telah dimasukkan ke dalam Appendix II sebagai tumbuhan yang terancam punah sehingga dalam penebangan dan perdagangannya perlu dibatasi. agarospirol. beberapa instansi pemerintah dan masyarakat telah melakukan inisiatif untuk mengadakan pelestarian tumbuhan penghasil gaharu dan sekaligus membudidayakan. Akibatnya.. jinkohol II serta oxo-aga-rospirol. Menyadari semakin langkanya tumbuhan penghasil gaharu. Walaupun realisasi produksi gaharu tidak menggambarkan besarnya potensi. di hutan alam semakin menurun dan bahkan pada suatu saat menjadi punah. Siran) Tengah. nor-ketoaaga-rofuran. seluruh jenis Aquilaria telah dimasukkan dalam Appendix II CITES. Aquilaria malaccensis. baik untuk kepentingan konservasi maupun ekonomi. Tingginya permintaan pasar dunia akan gaharu dan harga jual gaharu yang cukup tinggi telah menarik minat masyarakat. jinkohon-eremol. Amerika Serikat pada tahun 1994.Perkembangan Pemanfaatan Gaharu .. (Sulistyo A. terus mengalami penurunan. Untuk mencegah dari kepunahan maka pada pertemuan CITES (The Convention on International Trade in Endangered Species of Wild Flora and Fauna) ke-IX di Florida. antara lain dari pergerakan pencari gaharu yang telah mengarah pada bagian utara Kalimantan Timur. jinkohol. dihydrokaranone. Bahkan sejak tahun 2004. kusunol. baik lokal maupun pendatang untuk melakukan eksploitasi gaharu secara besar-besaran. di pedalaman hutan Kalimantan Barat dan Kalimanatan Tengah serta menurunnya realisasi produksi gaharu dari tahun ke tahun. namun dengan semakin sulitnya mendapatkan gaharu dari waktu ke waktu menunjukkan populasi Aquilaria spp.. dan Kalimantan Selatan.

kebugaran serta bahan minuman (kopi) oleh masyarakat di Kabupaten Berau. dan stres.4 –dihydroxy-dihydro-agarufuran. liver. hepatitis. dan aquillochin. membakar jenazah bagi umat hindu. Limbah bekas gaharu yang telah disuling digunakan untuk dupa dan bahan untuk upacara agama. tasbih. 3. gangguan ginjal. dan obatobatan. saat ini berbagai negara memanfaatkan gaharu selain sebagai bahan pengharum (parfum) dan kosmetik. setanggi (dupa). kanker. dan pengawet berbagai jenis asesori. bahan antibiotic. Gaharu dengan aromanya yang khas digunakan masyarakat di Timur Tengah sebagai bahan wewangian. gaharu dimanfaatkan sebagai obat sakit perut. maka pengetahuan cara pendugaan kandungan gaharu pada tumbuhan penghasil gaharu yang terinfeksi jamur pembentuk gaharu perlu diketahui terutama oleh para pemungut pemula 6 . sedangkan air suling gaharu dimanfaatkan untuk kesehatan. asma. tumor. p-methoxybenzylaceton. Cara Pendugaan Kandungan Gaharu Karena tidak semua tumbuhan penghasil gaharu berisi gaharu. hio.senyawa yang terdapat pada gaharu. agarospirol. Karena aromanya harum. dan tumor yang masih dalam proses uji klinis. Di Cina. asma. Selain itu gaharu telah dipergunakan sebagai bahan baku industri parfum. kecantikan. juga telah berkembang industri pemanfaatan gaharu sebagai bahan baku industri obat herbal alami. kosmetik. gubal gaharu diperdagangkan sebagai komoditi elit untuk keperluan industri parfum. reumatik. TBC. kosmetika. Selanjutnya Oiler (tanpa tahun) dalam Suhartono dan Mardiastuti (2003) menyebutkan terdapat 31 unsur kimia yang terkandung di dalam gaharu dan bahan kimia penyusun utamanya adalah 2-(2-(4 methoxyphenyl)ethil)chromone (27%) dan 2-(2-phenylethyl)chromone (15%). PEMUNGUTAN DAN PENGOLAHAN GAHARU A. malaria. antara lain: noroxoagarofuran. untuk pengobatan stres. Di samping itu dengan perkembangan ilmu dan teknologi industri. radang lambung dan ginjal. kanker.

Cara lain yang berlaku pada masyarakat Dayak Kenyah dan Punan di Kalimantan Timur adalah dengan mengiris dan memotong bagian kayu dari tumbuhan penghasil gaharu yang terkena infeksi penyakit hingga ke bagian tengah batang. Adapun ciri dari tumbuhan penghasil gaharu berisi gaharu antara lain adalah: daun berwarna kuning dan rontok. 7 . Siran) sehingga tidak terjadi salah tebang pada pohon yang tidak berisi gaharu. Potongan kayu berisi gaharu kemudian dikumpulkan dan secara perlahan bagian kayu dipisahkan dari gaharu dengan menggunakan pisau kecil atau pahat cekung. Bilamana terdapat alur coklat kehitaman pada batang menunjukkan adanya kandungan gaharu. puncut atau pahat. Cara penyulingan minyak gaharu dapat dilakukan dengan dua sistem yaitu sistem kukus dan tekanan uap. cabang pohon banyak yang patah.. Harga minyak gaharu di pasaran Jakarta Rp 750. B. banyak terdapat benjolan dan lekukan sepanjang batang atau cabang pohon. Pengolahan Gaharu Sampai saat ini produk gaharu yang berasal dari alam umumnya dipasarkan dalam bentuk bongkahan namun ada pula dalam bentuk minyak hasil sulingan. Sistem Pemungutan Gaharu Pohon dari tumbuhan penghasil gaharu yang telah diyakini mengandung gaharu ditebang. Untuk lebih meyakinkan biasanya serpihan kayu tadi selanjutnya dibakar untuk mengetahui apakah mengeluarkan bau/ aroma wangi khas gaharu. tajuk pohon kecil dan tipis. kulit kayu kering dan rapuh serta bila ditarik mudah putus. (Sulistyo A. Cara pemungutan gaharu semacam ini di Sumatera dan Kalimantan disebut servis.. Setelah ditemukan ciri-ciri tersebut maka dilakukan uji pelukaan pada batang pohon dengan menggunakan kapak atau parang. kemudian dipotong-potong dan dibelah untuk diambil gaharunya. Cara ini disebut tubuk...Perkembangan Pemanfaatan Gaharu . C.000/tolak (1 tolak = 12 cc).

1-1999) diharapkan standar mutu tersebut dapat segera menjadi bahan acuan para pengusaha gaharu. kemedangan. kacangan. TangKacangan isi Teri super gung isi Kacangan Teri laying Tangkosong gung kosong Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan. Muara Kaman Kota Bangun Muara Wahau Super A Super B Super A Super B Kacangan isi Teri isi Kacangan Teri kulit kosong Kacangan A Kacangan B Teri A Teri B 3. Secara umum klasifikasi mutu gaharu dapat dikelompokkan menjadi enam kelas mutu yaitu super. Klasifikasi mutu gaharu di Kota Samarinda dan daerah sekitarnya Klasifikasi mutu No. Keragaman dan ketidakjelasan di dalam penentuan mutu tersebut menyebabkan harga jual yang berbeda dengan kelas mutu yang sama. pedagang pengumpul. Pada Tabel 1 disajikan kriteria dan klasifikasi mutu gaharu. dan cincangan dan setiap kelas mutu dibedakan lagi menjadi beberapa sub kelas mutu. teri. 4. Lokasi Super Tanggung Kacangan Kacangan A Kacangan B Kacangan C Teri Teri A Teri B Teri C Teri kulit A Teri kulit B Kemedangan Kemedangan A Kemedangan B Kemedangan community Sudokan Serbuk Serbuk Cincangan Samarinda Super king Super A Super AB 2. 1. dan pemungut gaharu di dalam menentukan kelas mutu gaharu.KLASIFIKASI MUTU GAHARU Klasifikasi mutu gaharu di Kalimantan Timur khususnya di Kota Samarinda dan daerah sekitarnya hingga saat ini masih belum seragam (Tabel 1) dan penentuannya dilakukan secara visual. 2007 8 . tanggung. Dengan telah ditetapkannya standar nasional untuk mutu gaharu (SNI 01-5009. Tabel 1.

Kelas mutu Harga (Rp/Kg) kg.. Kacangan A 7.per kg.000. Kemedangan Cincangan Sumber : Balai Penelitian dan Pengembangan Kehutanan Kalimantan.000.Perkembangan Pemanfaatan Gaharu .000.per No.25. disusul kualitas tanggung dengan Kalimantan Timur harga rata-rata Rp 10.2.000.000. Secara visual Kacangan C 2. Potongan kecil kayu dari pemisahan gaharu. Tanggung 3. tidak ada campuran dengan serat kayu. 2.000.Berdasarkan Keputusan Kepala Badan Standarisasi Nasional (BSN) No. padat. Gaharu berwarna hitam terkadang bercampur coklat.000.rendah berharga sekitar Rp 25.000.000. Kayu yang mengandung getah gaharu. kadang bercampur serat kayu dan berukuran tanggung. dan pada umumnya Super AB 15.000.000.000. Harga jual gaharu di mencapai Rp 30. 1386/BSN-I/HK.250.1-1999.. mengkilap dan sangat berbau. Klasifikasi Super Kriteria Gaharu berwarna hitam pekat. keras.000..000.000. Kriteria dan klasifikasi mutu gaharu No.000.000..000 Super 20.penyulingan untuk menghasilkan Kacangan B 5. berupa bongkahan atau butiran berukuran besar.000.500. Kualitas gaharu yang paling 1.500.minyak gaharu. padat.500.000 per kg. berupa butiran-butiran lebih kecil dari biji kacang dan lebih tipis atau berdiameter sekitar 1 mm. Teri 5.000. Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan.75. Kacangan 4.beberapa sampel gaharu dapat Teri B 750.- 6. Tanggung 10. berupa butiran-butiran sebesar biji kacang atau berdiameter sekitar 2 mm. bagian dalam tidak berlubang.000. 6.000. Teri A 1. Teri C 500.50.000. (Sulistyo A.71/ 09/99.000. 1. bercampur kayu. bagian dalam kadang berlubang. Siran) Tabel 2. 2006 Berdasarkan informasi pasar di Samarinda (Tabel 3) harga gaharu dengan kualitas super dapat Tabel 3.. telah ditetapkan Standar Nasional mutu gaharu dengan judul dan nomor: Gaharu SNI 01-5009. Teri Kulit A Teri Kulit B Kemedangan A Kemedangan B Kemedangan C Suloan 300. Gaharu berwarna hitam terkadang bercampur coklat.100. Super King 30. 2006 9 .digunakan sebagai bahan baku 3. pasaran Samarinda.000. bercampur kayu. Gaharu berwarna hitam dan coklat. Dalam 5.dilihat pada Gambar 3. keras.4.

berserat kasar dan kayunya yang lunak. syarat lulus uji dan syarat penandaan. (c) teri dan dari pohon atau bagian pohon (d) kemedangan penghasil gaharu.standar ini diuraikan mengenai definisi gaharu. klasifikasi. kemedangan. memiliki kandungan damar wangi dengan aroma yang lemah. serat. kandungan damar wangi. Menurut SNI 01-5009. Sampel gaharu (a) gaharu adalah kayu yang berasal kelas tanggung. syarat mutu. pengambilan contoh. (b) kacangan. Setiap kelas mutu selanjutnya dibedakan lagi menjadi beberapa sub kelas berdasarkan ukuran. bobot. Abu gaharu adalah serbuk kayu sisa pemisahan gaharu dari kayu. ditandai oleh warnanya yang hitam atau kehitaman berseling coklat. dengan aroma yang kuat. spesifikasi.1-1999 yang dimaksud dengan gubal Gambar 1. dan aroma ketika dibakar. istilah. cara uji. warna. 10 . Klasifikasi mutu gaharu terdiri dari gubal gaharu. lambang dan singkatan. cara pemungutan. dan abu gaharu. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia dapat dilihat pada Tabel 4. Kemudian yang dimaksud dengan kemedangan adalah kayu yang berasal dari pohon atau bagian pohon penghasil gaharu. ditandai oleh warnanya yang putih keabu-abuan sampai kecoklat-coklatan.

1. C. 2.. Super Super AB Sabah Super Hitam merata Hitam kecoklatan Hitam kecoklatan Tinggi Cukup Sedang Kuat Kuat Agak kuat Tanggung A Sabah I Tanggung AB Tanggung C Coklat kehitaman Coklat bergaris hitam Coklat bergaris putih tipis Kecoklatan bergaris putih tipis Kecoklatan bergaris putih lebar Putih keabuabuan garis hitam tipis Putih keabuabuan Tinggi Cukup Sedang Sedang Agak kuat Agak kuat Agak kuat Agak kuat 5. Siran) Tabel 4. Mutu V Kemedangan I Sedang Agak kuat 6. 1..Perkembangan Pemanfaatan Gaharu . Mutu VI Kemedangan II Kemedangan III Kurang Kurang kuat 7. 2. 3. 3. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia Kesetaraan dengan standar mutu di pasaran Kandungan damar wangi No Klasifikasi mutu Gubal Mutu Utama Mutu I Mutu II Kemedangan Mutu I Mutu II Mutu III Mutu IV Warna Bau/aroma (dibakar) A. 4.. (Sulistyo A. 1. Mutu VII Abu gaharu Mutu Utama Mutu I Mutu II Kurang Kurang kuat Cincangan Hitam Tinggi Sedang Kurang Kuat Sedang Kurang TATA NIAGA GAHARU Proses pemasaran gaharu di berbagai tempat di Indonesia dimulai dari pemungut gaharu yang menjual gaharu yang ditemukannya kepada pedagang pengumpul di desa atau di kecamatan dan selanjutnya oleh pedagang pengumpul dijual ke pedagang besar (eksportir) di Ibukota Propinsi. B. 3. 11 . 2..

Hasil pembelian dari pedagang perantara ini kemudian dikumpulkan oleh pedagang pengumpul di kecamatan untuk selanjutnya dijual kepada pedagang besar karena adanya ikatan kontrak. baik kepada pedagang pengumpul di desa. Pedagang besar selain memiliki modal besar juga izin usaha yang dikeluarkan oleh instansi pemerintah. pedagang pengumpul di kecamatan maupun langsung kepada pedagang besar (eksportir) di Kota Samarinda. Pemungut gaharu terdiri dari pemungut bebas dan pemungut terikat. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 2. Pembelian gaharu dilakukan sepanjang tahun melalui pedagang pengumpul atau pemungut bebas. Pemungut bebas adalah pemungut gaharu dengan modal kerja sendiri sehingga bebas di dalam menentukan waktu pencarian gaharu dan menjual hasil perolehannya. bahkan untuk mendapatkan jumlah yang diinginkan mereka menanamkan modal yang disalurkan melalui 12 . Contoh alur tata niaga gaharu di Kalimantan dan Sumatra Pedagang pengumpul terdiri dari pedagang perantara di desa yang langsung melakukan pembelian gaharu yang diperoleh para pemungut. Pemungut terikat adalah pemungut gaharu yang dimodali sehingga waktu pencarian dan penjualan hasil perolehannya terikat pada pemberi modal yaitu pedagang pengumpul yang merupakan perpanjangan dari pedagang besar.Salah satu contoh alur tata niaga gaharu di Kalimantan Timur dapat diuraikan seperti pada Gambar 2. Pembelian meningkat bilamana permintaan pasar terhadap gaharu tinggi.

microcarpa. Gaharu yang diperdagangkan di Indonesia terdiri dari tiga jenis. Sulawesi dan Maluku lebih dikenal dengan nama Aquilaria filaria.. Oleh karena itu maka secara umum pemanfaatan gaharu harus mengikuti tahapan dan aturan-aturannya. (Sulistyo A. yaitu: penentuan kuota.. 13 . Apabila diperhatikan maka perdagangan gaharu hasil alam di Indonesia dari dulu hingga saat ini lebih banyak bertumpu pada peyebaran secara ekologis jenis-jenis gaharu tersebut. Alur tata niaga Gaharu di daerah (Kalimantan) PEMASARAN GAHARU Dalam dunia perdagangan gaharu.Perkembangan Pemanfaatan Gaharu . pengangkutan untuk peredaran dalam negeri dan pengangkutan untuk pemasaran luar negeri. sedangkan jenis gaharu Gyrinops lebih banyak diproduksi dari Nusa Tenggara. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 3. pengambilan dari alam atau hasil budidaya (penangkaran).. baik di Indonesia maupun di luar negeri. gaharu dari Papua. Pemasaran gaharu yang merupakan salah satu bentuk pemanfaatan tumbuhan dan satwa liar diatur berdasarkan Peraturan Pemerintah Nomor 8 Tahun 1999 dan Konvensi Perdagangan Internasional tentang jenis flora dan fauna liar yang terancam punah (CITES). yaitu: gaharu dari Sumatera dan Kalimantan dengan jenis Aquilaria malaccensis dan A.. gaharu menjadi komoditi primadona dan memiliki nilai komersial yang cukup tinggi sehingga banyak diburu oleh konsumen. Siran) pedagang pengumpul ataupun secara langsung kepada pemungut untuk modal kerja mencari gaharu.

pemanfaatan untuk obat-obatan dan aroma terapi. Beberapa contoh produk dimaksud dapat dilihat pada gambar 3 dan 4 berikut. makmul. Karena perkembangan teknologi. tapi juga sudah mengarah ke produk turunannya.A. lulur dan lotion 14 . cream whitening. obat nyamuk. antara lain: minyak. hio. lotion. lulur. produk gaharu yang diperdagangkan dalam negeri saat ini tidak saja terbatas pada chip atau serpihan dengan bermacam-macam kelas. Produk turunan gaharu: sabun transparan. Gambar 4. pengangkutan dan peredaran secara domestik produk sampai akhirnya ke konsumen. pembersih muka. Bahkan saat ini sudah dikembangkan daun jenis Aquilaria dan Gyrinops untuk bahan pembuatan minuman teh karena kandungan zat anti oksidan dalam daun yang cukup tinggi. sabun. Pemasaran Dalam Negeri Pemasaran dalam negeri dimulai dari aktivitas pengambilan.

Secara tradisional daerah pemasok gaharu untuk kota Surabaya adalah Kalimantan. misalnya pencari gaharu dan pedagang pengumpul di bagian hulu (hutan atau desa sekitar hutan) lebih banyak dibandingkan dengan pedagang menengah dan besar yang berdomisili di ibukota kabupaten atau propinsi. NTT. 15 . baik dalam menentukan harga maupun kualitas gaharu. Di duga banyak gaharu yang di perdagangkan secara illegal dari sumatera lewat Riau ke Singapura dan Malaysia. Sulawesi. maka terdapat kecenderungan untuk saling menekan harga. Karena jumlah pelaku usaha pemasaran. Maluku.Sirup daun gaharu Gaharu leaf tea Gambar 5. yaitu sumatera. ditambah dari daerah Indonesia bagian barat. Papua. baik sebagai individu (perorangan). Produk sirup dan teh untuk bahan minuman Dilihat dari pelaku usaha. namun karena akses yang mudah memasok gaharu pula ke Jakarta. Pemasaran gaharu dalam negeri terbentuk karena adanya hubungan antara daerah pemasok dengan kota/pusat penerima. NTB. Daerahdaerah ini walaupun letaknya di Indonesia bagian timur. Oleh karena itu bentuk pemasaran gaharu di Indonesia lebih cocok dikatakan sebagai pasar “monopsoni”. banyak fihak yang terlibat dalam perdagangan gaharu. yaitu pasar yang dikuasai oleh pembeli. kelompok masyarakat maupun lembaga. termasuk Riau.

Secara garis besar. Kalimantan Sulawesi Papua Maluku Riau  Sumatera Sumatera Jakarta NTT NTB Surabaya Gambar 6. standar dan kualitas serta harga yang layak sehingga menguntungkan bagi kedua belah fihak. malaccensis. produk gaharu sulit dibedakan berdasarkan asal jenis tumbuhan dan asal daerahnya. A. yaitu: A. Pemasaran Luar Negeri Secara fisik. Oleh karena kekhawatiran salah satu species penghasil gaharu yang mungkin bisa cepat punah. . filaria dan Gyrinops diatur perdagangannya oleh konvensi perdagangan internasional yaitu CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) melalui sistem quota. maka jenis Aquilaria yang ada. A. yaitu konsumen dan produsen. B. lalu lintas perdagangan gaharu di dalam negeri dapat dilihat pada gambar berikut. Demikian pula dari sisi warna dan aroma sangat sulit bagi orang awam atau pedagang pemula untuk dapat memilah-milahnya. Lalu lintas perdagangan gaharu dalam negeri Beberapa permasalahan yang sering dijumpai di lapangan antara lain: sulitnya menentukan jenis gaharu. microcarpa.

super A dan AB) umumnya dipasarkan ke negaranegara Timur Tengah untuk digunakan sebagai bahan acara ritual keagamaan. dapat dilihat beberapa gaharu yang masih dalam bentuk gelondongan yang siap untuk diekspor. ekspor lebih banyak dilakukan ke negara-negara Asia Selatan untuk digunakan sebagai bahan baku pembuatan minyak wangi dan untuk acara-acara ritual dalam bentuk hio. Gaharu dengan kualitas super (superking. Pada gambar 6 berikut. makmul dan lain-lain. Dalam beberapa tahun terakhir terdapat kecenderungan pembeli dari Taiwan untuk mengimpor gaharu dari Indonesia dalam bentuk log. produk gaharu yang diperdagangkan ke luar negeri mengikuti selera konsumen. Kayu gaharu yang bentuknya masih gelondongan dan hanya sedikit mengandung gaharu tersebut digunakan sebagai hiasan yang dipasang di suatu ruangan dengan diberikan sedikit sentuan teknologi ukir sehingga terkesan mewah dan mempunyai nilai seni yang sangat tinggi. Gaharu dalam bentuk gelondongan yang siap dikirim ke Taiwan. wewangian dan aroma terapi. 17 . Nilai keseluruhan dari gaharu tersebut tidak kurang dari Rp 600 juta. Gambar 7.Menurut ASGARIN. Untuk gaharu yang berkualitas menengah ke bawah.

Malaccensis 30. Pada tahun 2009. misalnya untuk jenis A.890 (R) A.000 (K) 8. Singapura selain mendapat pasokan gaharu dari Indonesia juga dari negara Asia Tenggara. Taiwan dan Jepang. Oleh Singapura gaharu yang masuk dilakukan penyortiran dan pengemasan dan kemudian di ekspor kembali ke India. sedangkan untuk A. filaria yang banyak terpendam di rawa-rawa di Papua.000 (K) - Tabel diatas memperlihatkan bahwa kuota ekspor gaharu pada tahun 2007 dari ketiga jenis yang dapat dipenuhi hanya dari jenis A.250 (K) 74. malaccensis tidak dapat dipenuhi.000 (R) 25. dan sebagian lagi ke Timur Tengah. misalnya Vietnam dan Kamboja. filaria sebanyak tujuh kali lipat. sedangkan pada A.000 (R) 65. Menurut sebuah sumber.000 (K) 30.000 (K) 25.000 (K) 23.000(K) 326.000 (R) 455. Dua negara ini pula yang menjadi daerah atau negara tujuan utama ekspor gaharu dari Indonesia.709 (R) 30.882(R) Gyrinops 24. Menurut ASGARIN. lonjakan kuota yang signifikan terjadi pada jenis A.000 (R) 173. 18 . realisasi ekspor gaharu untuk ketiga jenis dapat terpenuhi 100% dari kuota yang ditetapkan. dan bahkan untuk Gyrinops realisasi ekspornya hanya mencapai 30% dari kuota yang ditetapkan.000 (K) 65. China. Hongkong.Selama 3 (tiga) tahun terakhir jumlah kuota dan realisasi gaharu yang diekspor sebagaimana dapat dilihat pada tabel berikut. Sedangkan gaharu yang masuk ke Saudi Arabia di distribusikan lagi ke negara-negara lain di sekitarnya dan sebagian lagi di ekspor ke Inggris dan perancis. Pada tahun 2008. malaccensis sebanyak hampir enam kali lipat. Tabel 5. filaria 76. seperti dapat dilihat pada gambar berikut. filaria. Perkembangan kuota dan realisasi ekspor gaharu Indonesia Tahun 2007 2008 2009 A. pusat perdagangan gaharu dunia yang sangat penting adalah Singapura dan Riyad (Saudi Arabia).000 (K) 76. hal ini terjadi karena ditemukannya potensi baru yang sebelumnya luput dari inventarisasi.

pemeliharaan. Luka tersebut menyebabkan pohon terinfeksi oleh penyakit (bakteri. virus. 19 . penanaman. Siran) Hongkong Prancis UK India China Japan Malaysia Taiwan Kwait Oman Qatar Saudi Arabia UAE SINGAPORE Bahrain Middle East Riyadh Indonesia Iraq Iran Afrika Gambar 8.. pemberantasan hama dan penyakit hingga tumbuhan tersebut memiliki volume yang cukup memadai. jamur) yang diduga mengubah pentosan atau selulosa menjadi resin atau damar.Perkembangan Pemanfaatan Gaharu . yang dua-duanya berkaitan dengan proses patologis yang dirangsang oleh adanya luka pada batang patah cabang atau ranting.. Lalu lintas perdagangan gaharu luar negeri REKAYASA PEMBENTUKAN GAHARU Teknik budidaya perlu dikuasai dengan baik untuk dapat membudidayakan pohon penghasil gaharu. Teknik budidaya dimaksud meliputi kegiatan perbanyakan bibit.. Rekayasa produksi gaharu diarahkan untuk pohon-pohon penghasil gaharu hasil budidaya. (Sulistyo A. yaitu secara alami dan buatan. Secara garis besar proses pembentukan gaharu terdiri dari dua.. sedangkan pohon-pohon penghasil gaharu yang tumbuh secara alami perlu dikonservasi dan dipelihara dengan baik untuk dijadikan pohon induk penghasil anakan.

Oleh karena itu untuk dapat mengamati secara langsung proses pembentukan gaharu dilakukan rekayasa dengan cara inokulasi (penyuntikan) jamur atau cendawan pada pohon penghasil gaharu. kegiatan lapangan dan kombinasi keduanya. 4. 7. Proses pembentukan gaharu di hutan alam sulit dipantau dan diamati. kadar gaharu menjadi semakin tinggi. Tahapan rekayasa produksi gaharu meliputi banyak kegiatan. dengan teknik induksi yang bermacam-macam dan jenis jamur yang bervariasi. 20 . Rekayasa pembentukan gaharu dengan inokulasi telah dilakukan oleh banyak fihak. Identifikasi jamur secara molekuler Penyaringan (screening) Uji efektivitas Formulasi media Produksi inokulan (jamur) Pembangunan plot demonstrasi untuk ujicoba di lapangan Observasi dan evaluasi Alur kegiatan rekayasa produksi gaharu secara garis besar dapat dilihat sebagaimana gambar berikut: Gambar 9. Alur kegiatan rekayasa produksi gaharu.Semakin lama kinerja penyakit berlangsung. 6. Kegiatan yang “berskala laboratorium” dimulai dari kegiatan lapangan. kegiatan di laboratorium dan kegiatan uji lapangan yaitu: 1. 2. 5. 8. koleksi dan isolasi jamur. dimulai dari kegiatan laboratorium. 3. Eksplorasi.

Gorontalo dan Papua...Perkembangan Pemanfaatan Gaharu .. Berdasarkan bukti-bukti keberhasilan tersebut. Berdasarkan pengamatan sementara. maka secara resmi ke empat jenis isolat tersebut telah di “launching” Menteri Kehutanan (lihat gambar 8) pada Pameran Indo Green yang berlangsung di Jakarta Convention Center (JCC) pada tahun 1999. Siran) Sampai saat sudah berhasil dikoleksi 23 inokulan (isolat) dari sebagian besar propinsi di Indonesia. Ke empat isolat tersebut adalah: isolat dari Kalimantan Barat. Keterbatasan tersebut dimaksudkan hanya kepada masyarakat petani gaharu atau pelaku usaha gaharu yang telah mendapatkan pelatihan dari P3HKA saja yang boleh menggunakan inokulan tersebut. beberapa isolat lain yang juga cocok dan memberikan hasil yang cukup bagus adalah Jambi dan Kalimantan selatan.. 21 . Diantara isolat tersebut empat isolat sudah diujicoba pada beberapa jenis pohon penghasil gaharu di beberapa daerah dan memberikan hasil yang cukup bagus. (Sulistyo A. Gambar 10. Launching tersebut juga dimaksudkan untuk memberikan akses kepada publik agar dapat memanfaatkan isolat tersebut untuk ujicoba produksi gaharu. Launching Inokulan Gaharu oleh Menteri Kehutanan Dengan adanya launching tersebut maka secara resmi inokulan prododuksi Puslitbang Hutan dan Konservasi Alam (P3HKA) telah dilepas di pasaran namun masih terbatas. Sumatera Barat.

Carita (Banten). Lombok (NB).Untuk melihat efektivitas pembentukan gaharu. jarak titik lubang dan lain sebagainya. Jambi. Beberapa faktor penting yang diamati adalah: kondisi kelembaban dan suhu udara. Bogor (Jabar). Penyebaran plot inokulasi pembentukan gaharu (gambar bintang warna kuning) Evaluasi dan pengamatan terus menerus dilakukan. Bali. yaitu: Bohorok (sumut). keterbukaan tajuk. Bioinduction : 15 locations Gambar 11. 22 . Kalimantan Barat. Kalimantan Selatan. Penyebaran plot inokulasi dapat dilihat sebagaimana gamber berikut. Sumsel. Sijunjung dan Padang Pariaman (Sumbar). jenis asal isolat dan jenis pohon penghasil gaharu yang diinokulasi. Menado dan Seram. Bangka. Sukabumi. baik kegagalan maupun keberhasilanya. untuk mengetahui perkembangan inokulasi. Ujicoba tersebut dilaksanakan di lokasi dengan kondisi yang berbeda. baik kondisi ekologis. virulensi inokulan yang digunakan. ujicoba ke enam isolat telah dilaksanakan di 15 (lima belas) lokasi yang tersebar di beberapa propinsi di Indonesia. Kalimantan Tengah.

Pada saat ini pohon yang ditebang secara bertahap tersebut masih hidup dan masih tumbuh baik di lapangan... Perkembangan hasil inokulasi menurut waktu Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun 2 tahun 3 tahun Kualitas Kemedangan Kemedangan B Kemedangan A teri kacangan tanggung Apabila di sejajarkan dengan kualitas gaharu hasil alam yang ada di pasaran dalam negeri.. (Sulistyo A. 23 . dan terus meningkat menjadi kelas teri setelah 1 tahun. Kualitas gaharu tersebut terus meningkat menjadi kacangan setelah 2 tahun inokulasi dan secara signifikan meningkat menjadi tanggung pada 3 tahun setelah inokulasi. Siran) Perkembangan hasil inokulasi yang dilaksanakan di salah satu lplot penelitian yaitu daerah Sukabumi dari waktu ke waktu dapat dilihat sebagaimana tabel berikut. dengan harapan bahwa gaharu yang akan dipanen tersebut akan mempunyai kualitas` yang lebih bagus lagi dari sebelumnya. maka hasil gaharu yang dipanen setelah 3 bulan inokulasi memiliki kualitas kemedangan. Menurut rencana pada tahun 2011 akan dilakukan pemanen lagi untuk melihat perkembangan kualitas gaharu. Tabel 6.Perkembangan Pemanfaatan Gaharu . Contoh gaharu hasil panen yang dilakukan secara bertahap adalah sebagai berikut..

Gambar 12. Gaharu hasil panen 3 bulan setelah penyuntikan. dengan kualitas kemedangan C. Gaharu hasil panen 9 bulan setelah penyuntikan (inokulasi) dengan kualitas kemedangan A. Gambar 13. 24 .

Perkembangan Pemanfaatan Gaharu . Siran) Grade Kemedangan (US $ 100/kg) Gambar 14. Gaharu hasil panen dua tahun setelah penyuntikan dengan kualitas kacangan 25 . (Sulistyo A.. Gaharu hasil panen satu tahun setelah penyuntikan dengan kualitas teri Grade Gubah AB (US $ 200-250/kg) Gambar 15....

000 750. Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun Harga (Rp) 50.000 26 . Gaharu hasil panen 3 (tiga) tahun setelah penyuntikan dengan kualitas tanggung Berdasarkan survey pasar. estimasi harga gaharu hasil panen dari plot penelitian P3HKA dapat dilihat sebagai mana tabel berikut. referensi harga gaharu hasil alam di pasaran dalam negeri dan penawaran dari pedagang gaharu dari Riyad (gambar sudut kanan atas).000 1. Harga gaharu yang cenderung meningkat dengan semakin tertundanya waktu panen.000 200. Tabel 7.000.> US $ 800 Gambar 16.

(Sulistyo A.000 ? Hubungan antara kualitas gaharu. waktu penundaan panen dan harga di pasaran sangan erat sekali. Berdasarkan pemeriksaan laboratorium.000 US$ 800 atau 7... Kualitas Hasil rekayasa Super Tanggung Kacangan Teri Kemedangan Hasil alam 1 Hasil alam 2 Hasil alam 3 Hasil alam 4 1 2 3 4 Tahun 5 6 7 8 9 10 Gambar 17.500.500. Grafik hubungan antara terbentuknya gaharu dengan waktu penundaan panen.Perkembangan Pemanfaatan Gaharu . gaharu hasil panen 9 bulan setelah penyuntikan mengandung zat aktif yang cukup 27 . Grafik hubungan antara terbentuknya gaharu dengan waktu dapat dilihat pada grafik sebagai berikut. Siran) Umur Setelah Inokulasi 2 tahun 3 tahun 4 tahun Harga (Rp) 2... Semakin lama proses pembentukan gaharu di pohon maka akan semakin meningkat kualitas gaharu yang akan dihasilkan dan dengan sendirinya akan meningkatkan harga gaharu tersebut.

wangi & warna biru Benzylacetone = wangi manis bunga. penguat rasa/aroma pada roti &kue Komponen Kimia Ketoisophorone = wangi manis campuran kayu. setidaknya terdapat 12 (dua belas) komponen kimia sebagaimana dapat dilihat pada gambar berikut.konsituen utama dalam minyak melati Maltol = wangi caramel (manis). teh dan daun tembakau Valerolactone = wangi herbal Ambrox = odorant tipe amber.banyak. insektisida botani. Pemeriksaan kandungan kimia pada gaharu hasil alam menunjukkan hasil yang sama dengan gaharu hasil rekayasa jika dua-duanya diambil dari kualitas yang sama. memiliki sifat pestisida Cadinene = konstituen minyak esensial berbagai tanaman Limonene = terpen aroma bunga & buah. bahan kosemtik Isolongifolen = bahan odorant & parfum Indole = wangi bunga & parfum. Kandungan kimia yang terdapat pada gaharu hasil rekayasa. 28 . manis buah & bunga 1 2 3 4 5 Tahun Gambar 18. komponen volatile dan kokoa Dumasin = wangi mint. anti inflamantory Ambrettolide = wangi musk. Azulene = komponen minyak esensial tanaman.

penanaman. Untuk dapat mewujudkan kondisi dan harapan tersebut.. subsistem tengah (penyuntikan. peluang penyerapan tenaga kerja yang besar dan penerimaan asli daerah yang cukup signifikan. subsistem pendukung (kebijakan pemerintah. Hanya dengan koordinasi dan integrasi yang baik di antara seluruh komponen masyarakat dan pemerintah. infrastruktur. penyediaan inokulan. Ketiga subsistem tersebut di atas memerlukan investasi yang cukup besar.. pemasaran). pendidikan dan pelatihan. penyiapan bibit. riset dan pengembangan. skema kredit dan asuransi). pengangkutan. 29 . (Sulistyo A. pemberantasan hama dan penyakit). Siran) PENUTUP Dengan ditemukannya teknologi inokulasi pembentukan gaharu. maka produk gaharu akan menjadi produk andalan dimasa depan.. peralatan inokulasi. penyediaan pupuk. maka seluruh sektor harus memainkan peran sesuai dengan tugas pokok dan fungsinya masing-masing. pengolahan.Perkembangan Pemanfaatan Gaharu . terbukalah peluang yang besar untuk kegiatan pengusahaan gaharu yang dimulai dari subsistem hulu (penyiapan lahan. subsistem hilir (pemanenan. tranportasi. dan pengamanan)..

30 .

STATUS RISET GAHARU 31 .

32 .

Aspek PRODUKSI 33 .

.

masyarakat di sekitar hutan merupakan sasaran ideal yang dapat melipatgandakan peran dan fungsi program tersebut. Dalam pengembangan gaharu. sehingga sangat potensial untuk dikembangkan. kecuali dengan campur tangan manusia. Pengembangan gaharu ini perlu dilakukan. mengingat buah pohon ini bersifat rekalsitran. khususnya untuk menjaga kesinambungan produksi. Dari aspek keamanan lingkungan dan keragaman hayati. sehingga tidak menyebar jauh. pengembangan gaharu di sekitar hutan juga akan membantu pengamanan keragaman hayati dan kelestarian hutan. sebagian bahkan pernah menjadi pengumpul. mengingat 35 .PENGEMBANGAN GAHARU DI SUMATERA Mucharromah Fakultas Pertanian Jurusan Perlindungan Tanaman Universitas Bengkulu PENDAHULUAN Gaharu merupakan produk kehutanan yang memiliki nilai ekonomi sangat tinggi dibanding produk kehutanan lainnya. sehingga pemahaman dan keterampilannya untuk mendukung pengembangan cluster industri gaharu telah sangat memadai. Dari segi kesiapan masyarakat. pada umumnya masyarakat yang tinggal di sekitar hutan sudah mengenal gaharu. Dari segi keberadaan material bibitnya lokasi sekitar hutan memiliki jumlah tegakan gaharu alam terbanyak. sekaligus untuk melindungi ragam pohon penghasil gaharu yang ada di Indonesia.

dengan tekstur yang sangat keras dan halus tidak berserat. kekurangan air bersih. Pada pohon penghasil gaharu. Sementara gaharu 36 . termasuk dari wilayah barat Indonesia atau Sumatera dan dihargai sangat mahal. Dengan demikian.Aspek PRODUKSI masyarakat sudah dapat memperoleh penghasilan dari usaha pengembangan gaharu yang sangat prospektif secara ekonomi. khususnya yang berkaitan dengan pendanaan proses produksi yang memerlukan dana cukup besar. Bentuk gaharu super sangat beragam. bangsa. di samping pemberdayaan dan pemakmuran masyarakat di sekitar wilayah hutan. berwarna hitam mengkilat dan berat hingga tenggelam dalam air. Gaharu alam telah dikenal sejak ribuan tahun lalu diperdagangkan ke Timur Tengah oleh para pedagang India dan Indo-China. dan negara di samping menghindarkan dari bahaya bencana alam kekeringan. pengembangan gaharu tidak sama dengan pengembangan tanaman pertanian yang dapat langsung menghasilkan. paningkatan temperatur udara. mengingat pohon penghasil gaharu memiliki morfologi yang sangat mendukung perannya sebagai ’penjaga lingkungan’. Namun demikian. khususnya yang memiliki kualitas super dan di atasnya. yaitu meningkatkan kapasitas absorbsi dan retensi air tanah. pengembangan produksi gaharu tidak cukup hanya dilakukan dengan penanaman bibit pohon penghasilnya saja. produksi gaharu justru tidak akan terjadi bila pohonnya tumbuh sangat baik dan tidak terganggu sedikit pun. sehingga tidak mudah longsor serta menyerap CO2 dan menghasilkan O2 yang sangat penting dalam mendukung kehidupan. pengembangan gaharu di wilayah sekitar hutan akan memperkuat fungsi hutan tersebut. Sejauh ini produksi gaharu Indonesia masih banyak diambil dari alam sehingga disebut sebagai gaharu alam. Gaharu kualitas super sudah mengeluarkan aroma harum meski tanpa dipanasi atau dibakar. menguatkan tanah. Selain itu. polusi. longsor. Oleh karenanya. maka pengembangan gaharu sangat berpotensi mensejahterakan masyarakat. tetapi juga perlu didukung dengan pengembangan teknik produksi dan pengembangan sistem yang akan mendukung pengembangan produksi. dan kekurangan oksigen. Dengan nilai ekonomi gaharu yang sangat tinggi dan permintaan pasar dunia yang terus meningkat.

Pengembangan Gaharu di . khususnya di area yang paling potensial yaitu wilayah sekitar hutan.. Kesiapan Teknologi Produksi Berbeda dengan produk pepohonan lainnya yang selalu dihasilkan selama tanaman tumbuh sehat atau dengan kata lain 37 . pembersihan. Dengan upaya ini.. dan perdagangan gaharu. sehingga keberadaan pohon penghasil gaharu juga makin terancam akibat banyak yang ditebangi dan dicacah masyarakat untuk diambil gaharunya. KESIAPAN PENGEMBANGAN GAHARU A. kecuali masyarakat di sekitar wilayah hutan yang sudah pernah terlibat dalam pencarian... hampir seperti seni memahat. khususnya pada proses pasca panen. Proses ini sangat lambat. B. Kesiapan SDM Pendukung Proses Produksi Meskipun gaharu sudah sangat lama menjadi salah satu komoditi ekspor Indonesia. maka volume perdagangan gaharu makin meningkat. sehingga lebih mampu menjaga keamanan lingkungan dan keragaman sumberdaya alam di sekitarnya. Karenanya mereka merupakan kelompok sasaran yang sudah siap menjadi SDM untuk pengembangan gaharu. (Mucharromah) yang memiliki kualitas lebih rendah (kemedangan dan abuk) disuling untuk diambil resinnya dan ampasnya dibuat makmul atau hio untuk ritual keagamaan. sehingga membutuhkan banyak tenaga kerja terampil. Kondisi ini tak akan dapat diatasi kecuali dengan melakukan pengembangan gaharu secara besar-besaran. pembersihan gaharu dari sisa kayu putihnya. namun banyak masyarakat umum yang tidak mengetahui apa yang disebut gaharu. Dengan makin meningkatnya permintaan pasar internasional. Dengan pengalaman mencari gaharu alam yang sudah cukup lama. banyak masyarakat di sekitar hutan yang terampil membersihkan gaharu sehingga cukup siap untuk mendukung pengembangan gaharu di daerahnya. maka produksi gaharu Indonesia akan tetap melimpah dan masyarakat yang memproduksinya juga makin makmur dan sejahtera.

baik pelatihan teknik inokulasi maupun pelatihan teknik monitoring pembentukan gaharu. gaharu justru tidak akan didapat pada pohon yang tumbuh sehat tanpa ada gangguan apapun. Temuan tentang adanya jenis jasad renik yang dapat menginduksi terjadinya akumulasi resin wangi yang selanjutnya membentuk gaharu inilah yang mendasari adanya temuan tentang teknik induksi pembentukan gaharu yang dapat digunakan untuk mendukung proses produksi gaharu dalam skala industri.d. Kebanyakan gaharu justru ditemukan pada pohon yang terganggu.Aspek PRODUKSI produksi merupakan fungsi dari pertumbuhan tanaman sehat. C. 2006. Kadir. 2008. selain akibat gesekan hewan dan perilaku manusia yang tidak direncanakan. maka untuk persiapan pelaksanaannya dalam proses produksi dibutuhkan pelatihanpelatihan. Namun mengingat teknik yang diterapkan belum biasa dilakukan masyarakat.. baik secara alami oleh faktor abiotik maupun biotik ataupun telah diinduksi oleh manusia.c.b. Namun kejadian pembentukan gaharu oleh faktor abiotik dari alam ini sulit ditiru sehingga tidak dapat dijadikan dasar pada proses produksi dalam bentuk industri. 2009). Santoso et al. Selain itu juga perlu dilakukan teknik pelatihan produksi inokulan sehingga proses produksi dapat berlangsung lebih efisien. 2008a. Beberapa kelompok peneliti telah mampu melakukan inokulasi yang merangsang pembentukan gaharu (Mucharromah et al. Untuk itu penyiapan SDM pendukung pengembangan gaharu juga perlu mempersiapkan personil yang mampu mengenali kualitas 38 . Faktor abiotik dapat berupa angin atau hujan angin dan petir. Sementara pembentukan gaharu oleh faktor biotik dapat disebabkan oleh infeksi jasad renik terhadap tanaman.. maka teknik produksi inokulan dan induksi pembentukan gaharu dengan inokulasi telah siap untuk dilatihkan kepada masyarakat guna mendukung pengembangan produksi gaharu melalui pemberdayaan masyarakat di sekitar wilayah hutan. Dengan dukungan operasional. Kesiapan Kontrol Kualitas Produk Untuk keberhasilan dan kesinambungan suatu proses produksi umumnya selalu dilakukan monitoring kualitas produk.

Dari segi bentuknya. mutu pertama 39 . yaitu: a. mutu pertama = mutu TGA/TK1 b. Dalam standar ini kualitas gaharu dibedakan menjadi tiga sortimen. gaharu merupakan jaringan kayu dari pohon jenis tertentu (penghasil gaharu) dengan kandungan resin sesuiterpenoid volatil beraroma harum gaharu yang cukup tinggi. Hal ini membuat gaharu menjadi makin mahal dan nilainya sangat ditentukan oleh kualitas kadar dan kemurnian resin yang dikandungnya. kemedangan. mutu TGB/TK2 c. dengan 3 tanda mutu. seperti pelukaan yang disertai infeksi patogen melalui inokulasi atau proses lainnya. mutu pertama = mutu AB c. aroma. mutu TGE/TK5 f. Pada gaharu alam gradasi kualitas ditentukan berdasarkan standar mutu yang telah ditetapkan secara nasional dalam SNI 015009. Ketiga sortimen tersebut dibagi lagi dalam 13 kelas kualitas. yang selanjutnya membuat jaringan kayu tersebut memiliki warna. mutu TGD/TK4 e. Gubal gaharu. yaitu gubal gaharu. yaitu: a. Adanya aroma harum yang khas dan tahan lama inilah yang membuat gaharu sangat disukai dan dihargai dengan nilai ekonomi yang sangat tinggi. mutu TGF/TK6 g. dengan 7 kelas mutu. mutu kedua = mutu sabah super 2. tekstur. Selain itu jaringan yang mengandung resin wangi gaharu juga hanya didapati pada bagian pohon yang mengalami proses tertentu. mutu utama = mutu super b.1-1999. Abu gaharu yang terbagi dalam 3 kelas mutu. mutu ketujuh = setara dengan M3 3. dan abu gaharu. mutu utama b. yang terdiri dari: 1. yaitu: a. dan tingkat kekerasan dan berat jenis berbeda. mutu TGC/TK3 d.dan mensortasi atau mengumpulkan gaharu yang dihasilkan berdasarkan gradasi kualitas dan kegunaannya. Kemedangan.

. Namun pengembangan gaharu di sekitar wilayah hutan kemungkinan akan jauh lebih efisien proses produksinya. Saat ini sudah cukup banyak pohon penghasil gaharu yang telah diinokulasi. Teknik inokulasi untuk induksi pembentukan gaharu juga telah makin efisien dan murah. seperti yang telah dilakukan di Kota Bengkulu dan sekitarnya. D. Dengan demikian pengembangan gaharu siap dilaksanakan. Namun pembedaan kelas kualitas tersebut secara detil sangat sulit dilakukan sehingga pada prakteknya hingga saat ini konsumenlah yang menentukan tingkat mutu produk dan harga gaharu. yang biasanya baru dapat dicapai pada 12-18 bulan setelah inokulasi. Untuk itu pelatihan SDM dalam teknik monitoring perkembangan pembentukan gaharu dan kontrol kualitasnya sangat penting dilakukan. Hal ini merupakan anomali dari kondisi perdagangan komoditi lainnya. Namun dengan tingkat keahlian sortasi.Aspek PRODUKSI c. meskipun sebagian besar masih berada pada mutu TGC (Mucharromah et al. di samping lebih besar manfaatnya bagi pengamanan lingkungan dan pemberdayaan serta pemakmuran masyarakat. di mana pemilik barang merupakan penentu harga. Kesiapan Modal dan Kelembagaan Indonesia merupakan negara yang sangat kaya dengan beragam jenis pohon penghasil gaharu. 2008). Perkembangan keberhasilan teknik inokulasi ini sangat prospektif untuk mendukung pengembangan produksi gaharu yang pohon penghasilnya telah mulai banyak dibudidayakan di Sumatera dan wilayah lain di Indonesia. Pada 6 bulan setelah inokulasi telah dicapai produk kualitas kemedangan TGB dan TGA. Pada hasil uji lanjut teknik produksi gaharu yang dilakukan beberapa bulan lalu di Provinsi Bengkulu. proses pembentukan gaharu telah semakin cepat terjadi. mutu kedua. standar kualitas gaharu dan harganya akan lebih terjamin. tidak hanya di sekitar wilayah hutan tetapi bahkan hingga ke halaman rumah dan perkantoran serta sekolah. khususnya dari jenis Aquilaria dan Gyrinops. Hal ini menjadi modal utama yang membuat proses produksi gaharu menjadi jauh lebih 40 .

proses produksi gaharu sangat ditentukan kuantitasnya oleh jumlah lubang atau luka yang diinokulasi dan kualitasnya tergantung dengan lamanya waktu sejak inokulasi hingga panen. tidak semua pohon menghasilkan gaharu. Hal ini membuat proses produksi gaharu alam menjadi kian mahal. Namun dari 41 . Namun demikian pengembangan gaharu tetap memerlukan dukungan dana yang relatif besar meskipun rasio keuntungannya terhadap modal juga cukup besar. Sejauh ini keberadaan pohon penghasil gaharu di lapangan telah banyak membantu pelaksanaan uji efektivitas inokulasi. Pada gaharu budidaya. Di alam tidak semua pohon penghasil gaharu membentuk gaharu atau hanya sedikit sekali menghasilkan gaharu.. (Mucharromah) mudah dan murah. Dengan demikian. Selain itu. Berdasarkan hasil analisis tersebut maka pengembangan gaharu paling efisien bila dilakukan di area sekitar hutan yang masih kaya dengan tegakan gaharu berdiameter > 20 cm yang dapat diinokulasi untuk mempercepat produksi dan menambah modal awal untuk penanaman pada area yang lebih luas untuk kesinambungan usaha pengembangan gaharu. Saat ini pembentukan gaharu di alam telah dilaporkan terjadi pada sedikitnya 16 jenis pohon dari beberapa genus famili Thymelaceae. Selain itu juga diperlukan adanya kerjasama dan komitmen semua pihak untuk membantu mengawali usaha ini berdasarkan expertise dan bidang pekerjaannya... pelatihan monitoring pembentukan gaharu serta upaya produksi gaharu hasil inokulasi. dan satu famili Euphorbiaceae (Wiriadinata. pelatihan inokulasi. sebagaimana disajikan pada analisis usaha inokulasi gaharu (Lampiran 1) dan analisis budidaya gaharu (Lampiran 2). 1998).3 hingga 14 kg dan umumnya semakin banyak dengan makin besarnya diameter pohon (MacMahon. maka pengembangan gaharu hasil budidaya dan inokulasi dapat jauh lebih efisien dibandingkan produksi yang mengandalkan gaharu bentukan alam. 2002).. Jumlah gaharu yang dihasilkan per pohon di hutan alam sangat bervariasi dari 0. satu famili Leguminoceae. Semakin lama maka semakin banyak resin wangi yang terakumulasi dan semakin tinggi kualitas gaharu yang dihasilkan. 2008 dan Sumarna. uji produksi.Pengembangan Gaharu di .

karena kualitas seperti gaharu alam tersebut bernilai sangat tinggi. yaitu super.Aspek PRODUKSI segi kualitas. gaharu hasil inokulasi hingga kini belum dapat mencapai kualitas tertinggi gaharu alam. 2009). tergantung intensitas atau kadar resin gaharu yang dikandungnya. Secara teoritis keunggulan inokulan dalam menginduksi pembentukan gaharu berkaitan dengan jenis dan kemurnian mikroorganisme yang digunakan. khususnya cendawan pelapuk kayu. maka produksi gaharu selanjutnya tidak banyak memerlukan bantuan modal lagi. Saat ini kualitas gaharu hasil inokulasi sudah jauh lebih baik dan pada beberapa hasil penelitian sudah mendekati mutu gubal kualitas kemedangan B/C (Santoso. 2008. maka penggunaan inokulan unggul dan teknik inokulasi yang meminimalkan kontaminasi akan dapat meningkatkan kualitas gaharu yang dihasilkan dan mengefisienkan proses produksi hingga dapat dilaksanakan dengan modal lebih rendah. sebagaimana ditunjukkan oleh data mikroskopis perkembangan deposisi resin gaharu pada area jaringan sekitar lubang yang diinokulasi atau hanya dilukai (Mucharromah dan Marantika. Mucharromah dan Surya. dan lebih tinggi. justru mendegradasi kembali resin gaharu yang sudah dideposisi bahkan hingga menghancurkan selnya sehingga gaharu yang sudah mulai terbentuk menjadi hancur dan lapuk minimal sebagian dan kualitas gaharu yang dihasilkan akan menurun. 2008 . double super. 2006) atau bahkan B (Surya. Sementara kehadiran jenis cendawan lainnya. Pada gaharu kualitas gubal.000 per kg di tingkat ’end-consumer’ di luar negeri. sehingga mampu menutupi pembiayaan untuk pengembangan selanjutnya. yaitu USD 2.000 hingga 16. akumulasi resin wangi terjadi maksimal hingga luber dan menutupi sel-sel di sekitarnya. 42 . Bila kualitas seperti ini dapat dihasilkan dari inokulasi pohon pada awal proses pengembangan. Dengan demikian. Akibatnya jaringan kayu tersebut menjadi halus seperti dilapisi agar dan berwarna coklat kemerahan atau kehitaman. Terbentuknya gaharu kualitas super atau yang sering disebut gubal super ini kemungkinan akan dapat dicapai seiring dengan pengembangan penelitian inokulan unggul yang terus dilakukan.komunikasi pribadi.

Oleh karena itu dalam proses produksi gaharu dengan inokulasi perlu diterapkan prinsip-prinsip aseptik yang akan membatasi peluang terjadinya kontaminasi (Mucharromah et al.c. Sejauh ini aroma gaharu alam lebih lembut dibanding hasil inokulasi. 2006. 2007).. 43 . maka kualitas gubal super mungkin akan dapat dicapai. Oleh karenanya pengembangan gaharu di wilayah sekitar hutan dengan cara memperbanyak pohon-pohon jenis Aquilaria yang ada di lokasi tersebut dan menginokulasi pohon yang sudah tua untuk membiayai peremajaannya akan dapat mengembalikan potensi produksi gaharu yang dahulu dimiliki Sumatera dan wilayah Indonesia lainnya.. A. Santoso et al.. aroma resin gaharu juga sangat menentukan kualitas. Sumarna. 2008)....b.. Dengan teknik inokulasi dan jenis isolat yang lebih murni dan potensial serta waktu antara inokulasi dan panen yang lebih panjang. A. 2006.. 2009) menunjukkan bahwa pada jaringan yang terkontaminasi resin gaharu yang awalnya berwarna coklat bening kemerahan berubah menjadi berwarna kehitaman dan menghilang sebelum akhirnya selnya menjadi hancur. agallocha yang banyak dijumpai di Sumatera. microcarpa. kemungkinan karena kemurnian resin yang dikandungnya. Pada pengamatan mikroskopis (Mucharromah dan Marantika.Pengembangan Gaharu di . Jenisjenis pohon penghasil gaharu dari spesies Aquilaria malaccensis. Selain itu kekhasan aroma gaharu juga dipengaruhi oleh jenis pohon penghasilnya dan kemungkinan juga jenis mikro organisme inokulannya. 2008). MODEL PENGEMBANGAN GAHARU DI SUMATERA Secara teoritis akumulasi resin wangi gaharu telah dilaporkan distimulasi oleh infeksi cendawan dari jenis tertentu (Mucharromah dan Surya. dan A. 2002). (Mucharromah) Mucharromah et al. beccariana. sehingga aroma gubal gaharu kualitas terbaik dari berbagai wilayah dapat berbeda (Mucharromah et al. dikenal menghasilkan gaharu yang disukai konsumen mancanegara sejak jaman dahulu. A. 2008a. Selain karena kandungan resinnya yang jauh lebih tinggi. hirta.

Sebagaimana diuraikan sebelumnya. pengembangan gaharu memerlukan modal yang cukup besar karena prosesnya cukup kompleks. Mucharromah. Selain itu.Aspek PRODUKSI Kemampuan cendawan inokulan dalam menstimulir produksi resin juga sangat terkait dengan tingkat akumulasi resin yang merupakan hasil netto dari proses sintesis dikurangi dengan degradasinya serta jenis resin dan kemurniannya (Agrios. 2005. khususnya pada masyarakat yang tidak memiliki modal dan hanya mengandalkan sumberdaya alam dan keterampilan. Sejauh ini telah dilakukan pengembangan gaharu sebanyak > 10. 2004). namun untuk pelaksanaan proses panen dan pembersihan tersebut diperlukan modal yang cukup besar. Oleh karenanya pengembangan gaharu tidak dapat dilakukan secara mandiri. Namun kerjasama ini masih membutuhkan cukup banyak modal untuk menjadi usaha pengembangan gaharu yang mandiri. setelah didapat inokulan efektif dan hasil inokulasi yang cukup menjanjikan. Kerjasama ini meliputi pemeliharaan dan penanaman kembali anakan alam yang ada di sekitar tegakan induk hingga mencapai populasi minimal 10-100 batang tanaman muda per pohon induk diinokulasi untuk produksi gaharu. Selanjutnya pohon yang sudah cukup besar (diameter > 44 . dan keterampilan pekerja akan sangat mempengaruhi proses produksi dan kualitas produk. Dengan demikian maka penggunaan jenis inokulan tertentu dan kemurniannya serta penerapan teknik aseptik dalam penyiapan dan aplikasi inokulan. ketepatan teknik inokulasi. anakan alam atau bibit harus ditanam dan dipelihara. Pertama. Langenhein. Oleh karenanya campur tangan pemerintah sangat diharapkan. Oleh karenanya di Bengkulu pengembangan gaharu diawali dengan pengujian efektivitas berbagai isolat cendawan yang berpotensi menginduksi pembentukan gaharu dan diikuti dengan pengembangan inokulan unggul yang masih terus dilakukan untuk peningkatan kualitas. maka kepada masyarakat pemilik tegakan gaharu yang diameternya telah mencapai > 20 cm ditawarkan kerjasama pengembangan gaharu dengan penanaman kembali dan inokulasi.000 batang yang ditanam di sekitar pohon induk yang diinokulasi. karena masih harus melakukan panen dan proses pembersihan gaharu yang bersifat padat karya. 2004. Meskipun gaharu yang dipanen akan menghasilkan produk yang dapat dijual.

. sementara gaharu alam akan makin habis. Jumlah ini cukup besar dan akan mampu mempekerjakan masyarakat sekitar hutan sebanyak 280 hingga 340 orang/tahun dengan 200 hari kerja/tahun. Dari segi jumlah tenaga kerja yang menangani proses pembersihan produk ini kemungkinan tidak banyak berbeda antara produksi gaharu alam dengan gaharu budidaya. Pada gaharu hasil inokulasi.. juga keberanian dan ketersediaan personil dengan kondisi fisik yang mendukung pelaksanaan pekerjaan. tetapi dari segi keamanan pekerja dan lingkungan. sehingga untuk menghasilkan gaharu sebanyak 270 ton sebagaimana jumlah yang diekspor pada tahun 2000-an akan mampu menyerap tenaga kerja sebanyak 56. Proses ini dilakukan secara manual dengan melibatkan sejumlah besar tenaga kerja.. Proses induksi pembentukan gaharu dilakukan dengan memberikan inokulan pada sejumlah besar lubang yang dibuat spiral dengan jarak 7-10 cm horisontal dan 12-20 cm vertikal dari pangkal batang hingga ujung pucuk yang masih bisa dipanjat.Pengembangan Gaharu di . dilakukan proses pembersihan untuk memisahkan gaharu dari jaringan kayu yang lebih sedikit kandungan resin wanginya.. Selanjutnya pohon yang telah diinokulasi dimonitor hingga waktu panen.000-68. Oleh karenanya pengembangan gaharu harus dilakukan secara serius. sehingga upaya-upaya yang dilakukan akan memberi hasil yang berkelanjutan. pengembangan gaharu hasil budidaya dan inokulasi makin lama makin memberikan keuntungan melimpah dan makin ’sustainable’. sehingga tidak berkelanjutan. maka jumlah tenaga kerja yang dikaryakan juga akan semakin meningkat. Setelah dipanen secara total. mengingat proses produksi gaharu jauh lebih rumit dibandingkan proses produksi komoditi hasil hutan dan perkebunan atau pertanian lainnya. maka perlu ada suatu kelembagaan yang bertugas untuk membantu penyiapan dan pelaksanaan proses produksinya hingga berhasil berkembang menjadi industri gaharu yang mandiri. Dengan peningkatan permintaan dan kapasitas produksi. untuk membersihkan 1 kg gaharu umumnya diperlukan 4-5 orang hari kerja. Kelembagaan tersebut dapat sangat sederhana 45 . Selain itu. Proses inokulasi ini selain memerlukan keterampilan. (Mucharromah) 20 cm) perlu diinduksi dengan inokulasi jasad renik atau perlakuan lainnya agar membentuk gaharu.000 orang/hari.

Hal ini mungkin perlu disederhanakan dalam upaya pengembangan gaharu yang dilakukan. maka proses pengembangan gaharu yang telah dilakukan sejauh ini berjalan aman. Dalam hal ini peran perguruan tinggi yang mengembangkan penelitian gaharu dapat dilakukan dalam bentuk pembinaan kelompok produksi gaharu di sekitar wilayah hutan serta penelitian untuk pemutakhiran teknik produksi. swasta atau kelompok masyarakat. tidak hanya dengan pihak yang dapat membantu pengembangannya. Sejauh ini pengembangan gaharu yang dilakukan di Provinsi Bengkulu. mengingat wilayah sekitar hutan yang menjadi area pengembangan gaharu umumnya cukup jauh dari lokasi institusi yang mensertifikasi produknya. justru akan dapat menghambat pengembangan gaharu yang dituju. pelibatan banyak pihak ini bila tidak dipayungi dengan deskripsi tugas yang mendetil dan tidak saling tumpang-tindih. Namun bila perdagangan gaharu masih diatur oleh kuota yang dalam proses perdagangannya melibatkan banyak pihak. Mengingat pohon yang diinokulasi atau bibit yang ditanam berada di lahan pribadi.Aspek PRODUKSI bila pengembangan gaharu dapat diberlakukan seperti komoditi pertanian atau perkebunan hasil budidaya. sehingga cukup menyulitkan meskipun prosesnya sederhana. Bila sudah mencapai tahap produksi. baik halaman maupun kebun. perguruan tinggi dapat memainkan peran yang dapat menguntungkan semua pihak. pengembangan inokulan unggul untuk peningkatan mutu serta pengembangan teknik pengawasan kualitas produk. Dalam hal pengembangan gaharu. penjualan gaharu hingga kini masih memerlukan adanya sertifikasi jumlah untuk memastikan bahwa batas kuota belum terlewati. Hal ini dikarenakan upaya pengembangan yang dilakukan masih belum mencapai tahap produksi gaharu yang siap diperdagangkan. baik oleh pihak swasta maupun perguruan tinggi dan kelompok masyarakat. Peran tersebut dapat dilakukan melalui kegiatan penelitian dan pengabdian pada masyarakat yang sudah secara 46 . maka dengan adanya aturan kuota. Dalam pelaksanaannya. dibuat secara sangat sederhana dengan kontrak kerjasama antara pemilik pohon/lahan dengan pelaksana yaitu perguruan tinggi. maka pengembangan gaharu perlu dilakukan dengan melibatkan berbagai pihak yang terkait dengan perdagangannya.

tidak hanya untuk menjamin peningkatan dan kesinambungan produksi gaharu. sehingga keberhasilannya akan lebih terjamin. DAFTAR PUSTAKA Agrios. sebagaimana produk pertanian atau perkebunan dan kehutanan lainnya.. Hal ini sangat penting untuk diperhatikan mengingat proses pembentukan gaharu tidak berjalan secara otomatis pada tanaman yang tumbuh sehat. New York. 1988. 20 Oktober1995. Pengembangan gaharu merupakan suatu program yang sangat besar. tetapi juga untuk melindungi hutan dan keragaman hayati yang ada di sekitarnya serta meningkatkan kapasitas hutan dalam menanggulangi potensi bahaya bencana alam yang disebabkan oleh longsor. Anonim. PENUTUP 1. dan beragam kerusakan lingkungan lainnya. yang berpotensi sangat besar untuk pemberdayaan masyarakat di sekitar wilayah hutan. 1995. banjir.. (Mucharromah) rutin dilakukan perguruan tinggi dengan dukungan pendanaan dari instansi pemerintah maupun swasta. Oleh karenanya pengembangan gaharu perlu dilaksanakan dengan perencanaan yang sangat matang dari setiap tahapan prosesnya sehingga dapat berjalan dan meningkatkan kemandirian masyarakat di wilayah sekitar hutan. Analisa Penyebab Terjadinya Gubal dan Kemedangan pada Pohon Gaharu. Jakarta. polusi. tetapi juga karena upaya ini memerlukan investasi teknologi dan modal yang cukup besar bagi keberhasilannya. G.Pengembangan Gaharu di . Hal ini sangat penting dilakukan. 2. tidak hanya karena menghasilkan produk bernilai ekonomi yang sangat tinggi. 47 .N. Makalah Dipresentasikan pada Temu Pertama Pakar Gaharu.. Untuk lebih mengefisienkan proses produksi dan menekan pembiayaan maka program pengembangan gaharu perlu dilakukan dengan mengadopsi model yang paling efisien dan praktis. Academic Press.. Plant Pathology. kekeringan.

31 Oktober 2006. 2008. White Lotus Aromatics. 2005. Studi Mekanisme Akumulasi Resin Wangi Aquilaria malaccensis (Lamk. Indonesia. Makalah Seminar Nasional Pengembangan Produksi Gaharu Provinsi Bengkulu untuk Mendukung Peningkatan Ekspor Gaharu Indonesia.). DIKTI. Universitas Bengkulu. Accessed 16 April 2006. Misnawaty. 48 . Mucharromah. Mucharromah. dalam Menginduksi Akumulasi Resin Wangi Gaharu pada Batang Aquilaria malaccensis (Lamk. Makalah Semirata Bidang MIPA. C. Bengkulu. MacMahon. 1998. Fakultas Pertanian Universitas Mataram Bekerjasama dengan Balai Pengelolaan Daerah Aliran Sungai Dodokan Moyosari Nusa Tenggara Barat (BP DAS Dodokan Moyosari NTB). Maryani. 2006a. N. Universitas Bengkulu. pada Berbagai Waktu Setelah Pengeboran Batang Aquilaria malaccensis (Lamk. Santoso.). html. Seameo-Biotrop. Mucharromah. 2006. dan Hartal. G. 2008. Hartal. http://members. BKS-PTN Wilayah Barat. BKS-PTN Wilayah Barat. Makalah Semirata Bidang MIPA. Prosiding Seminar Nasional Gaharu. ”http://en. 14-16 Mei 2008. Nusa Tenggara Barat. Tingkat Akumulasi Resin Gaharu Akibat Inokulasi Fusarium sp. Respon Acremonium sp. Laporan Penelitian Fundamental. Hipotesa Mekanisme Pembentukan Gubal Gaharu. FAPERTA UNIB. Fenomena Pembentukan Gubal Gaharu pada Aquilaria malaccensis (Lamk. com/ratrani/ Agarwood.wikipedia. Bogor. (unpublished). Mucharromah. Agarwood. 2001. Asal Gaharu terhadap Alginate dan CaCl2. 1-2 Desember 2005. 2008. 2008. Lombok. Mucharromah. Santoso. Hartal.org/wiki /Agarwood”.aol. 12 Agustus 2008. dan U. Makalah Seminar. Terakhir dimodifikasi 11:11. dan Surani. 18 November 2006.. Updated April 16th. Rahayu dan E.) Merespon Pelukaan dan Infeksi Cendawan. 14-16 Mei 2008. Potensi Tiga Isolat Fusarium sp.). Mucharromah. 2006. Teknologi Budidaya dan Produksi Gubal Gaharu di Provinsi Bengkulu.Aspek PRODUKSI Anonim. Universitas Mataram.

. Teknik Inokulasi dan Produksi Gaharu. Seameo-Biotrop. Y. Texas. Journal of Tropical Forest Products 2 : 272-285..S. 2006. Agustini. (Mucharromah) Mucharromah dan J. 1-2 Desember 2005. 1-2 Desember 2005. Makalah Temu Pakar Gaharu. Santoso. 11-12 April 1996. Inc.N. Surabaya. dan Y. Teknologi Budidaya Tanaman Gaharu untuk Menuju Sistem Produksi Gubal Gaharu secara Berkelanjutan. 49 . Y..S. 2001. Purba. L. A Review on Agar (Gaharu) Producing Aquilaria Species.. L. Bogor. Y. 2005.K. D.T. 1997. R. Kerjasama Dirjen PHKA dan ASGARIN. Makalah Workshop Gaharu Tingkat Nasional.com/ aquilaria. 2006. Ng.. Sites : hhtp//www. Date 3/3/06. Sumarna. Skripsi Fakultas Pertanian Universitas Bengkulu. Studi Etiologi Gubal Gaharu pada Tanaman Ketimunan. Makalah disampaikan pada Workshop Gaharu Tingkat Nasional.htm. Makalah Workshop Gaharu Tingkat Nasional. Austin.. Kanwil Dephut Propinsi NTB. T. Surabaya 12 September 2006. Ngatiman dan Armansyah. Strategi Budidaya dan Pengembangan Produksi Gaharu.. E. 2007. Wahyuno. Surabaya 11-13 September 2006. 2005. J. Surya. Identifikasi Genus Cendawan yang Berasosiasi dengan Pohon Aquilaria malaccensis (Lamk. Prosiding Seminar Nasional Gaharu. Chang and A.A. Raintree. Turjaman. Parman dan T. Mulyaningsih. Prosiding Seminar Nasional Gaharu “Peluang dan Tantangan Pengembangan Gaharu di Indonesia”.Pengembangan Gaharu di . 11-13 September 2006. SEAMEO BIOTROP. Rahman. Bogor. 1996. Irianto. 2006b. Azizil.B. M. Raintree Nutrition.rain-tree. Mulyaningsih. Sumarna.. Biodiversitas dan Karakterisasi Jamur Potensial Penginduksi Resin Gaharu. Database Entry For Aquilaria agallocha. Mataram. Parman.) dan Gubal Gaharu Hasil Inokulasi serta Potensinya untuk Menginfeksi Bibit Gaharu. Uji Coba Pembentukan Gaharu dengan Cara Inokulasi. Kerjasama Dirjen PHKA dan ASGARIN.

Beban panen dan pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total A.5 250 500 250 6 25 1.000 90 1.Aspek PRODUKSI Lampiran 1. 30 kg/batang (Kemedangan) Total proyeksi hasil : 50 kg/batang Penjualan kelas BC per batang : 60 kg Penjualan powder : 100 kg/batang No A.031 10.500 200 600 36 300 7.450 1 1 1 1 1 1 3 1 Btg Btg Set Btg Btg Btg Thn Btg 100 5. Proyeksi penghasilan Penjualan kelas BC Penjualan powder Total proyeksi penghasilan C.000 5 120.500 200 600 12 300 100 5.1. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Pengurusan surat-surat Umum lainnya Total Total beban operasi B. Analisis usaha inokulasi gaharu Waktu inokulasi Jumlah tegakan gaharu Proyeksi hasil : 3 tahun : 1 batang : 20 kg/batang (Kelas BC). D.826 QTY Unit Harga/unit (Rp’000) Total cost (Rp’000) Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.250 100 1. 2006 50 . Uraian Beban operasional Pembelian batang/tanah Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga ahli inokulasi Tenaga kerja Pemeliharaan/perawatan Operasi lainnya Total A.025 104.307 1 1 50 50 Btg Btg Kg Kg 50 50 25 2 50 50 1. Beban zakat/pajak Proyeksi keuntungan 5% % 60 100 Kg Kg 2.000 90 1.500 6.000 500 120.2.168 50 50 50 1 50 Kg Kg Kg Btg Kg 5 10 5 6 0.

000 1.000 24.. Analisis usaha budidaya gaharu Waktu budidaya Luas lahan Populasi tegakan Rasio jumlah suntikan Jumlah lubang Proyeksi hasil panen per batang Exchange rate IDR : 7 tahun : 1 ha : 1.000 1.000 1.000 1..000 1 1. C.000 6.000 No A.000 1 ha Btg Btg Btg Btg ha 1.000 10 5 10 1 20.000/ha : 80 lubang/kg : 160/batang : 160/80 = 2 kg : 9.000 1.000 5.000 19.000 A+B C C.000 2.000 10.000 1.000 1.000 Total cost (Rp’000) 15.000 1.000 36.5 5 24.000 25.000 5 1 0..000 10.000 1.000 2.000 4.000 Harga/ unit (Rp’000) 15.000 5.. Biaya pra operasi (start-up cost) Sarana & prasarana TBM Rumah jaga Sarana penerangan (PLN) Sarana komunikasi Sarana lainnya Total 1 1 1 1 Total biaya (direkapitulasi) Beban operasi Penanaman pohon baru Land clearing Pembelian bibit Pembuatan lubang Penanaman pohon gaharu Pemupukan Perawatan dan pengamanan Total 1 1.000 Total Btg Set Btg Btg Btg Btg 20 3.000 2.Pengembangan Gaharu di .1.000 1.000 1.000 Unit Unit Unit 2. Beban inokulasi Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga kerja Pemelihaaan/perawatan Operasi lainnya 51 .000 500 5. Uraian Biaya akuisisi lahan Pembelian lahan Perizinan/sertifikat/notariat Total QTY Unit 1 1 ha Surat* B.500 1.000 4.000 49. (Mucharromah) Lampiran 2.2.000 3.000 1.000 1.

000 Btg Btg Kg Kg C.000 3.500 Kg % 2.000 2.000 4.000 20.000 40.000 2.000 4.000 190.000 2.000 71.000 2.000 Total proyeksi penghasilan 5% Proyeksi keuntungan E F Beban zakat /pajak Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu. 2006 52 .3.500 D Proyeksi penghasilan Penjualan kelas C 2.000 4.000 200.000 1.609. Uraian Beban panen & pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total QTY Unit Harga/ unit (Rp’000) 5 5 10 2 Total cost (Rp’000) 5. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Umum lainnya Total Total beban operasi 2.000 2.4.Aspek PRODUKSI No C.000 34.000 1.000 Kg Kg Kg Kg 5 10 20 0.000 5.000 20.000.5 10.000 1.000.

pemanfaatan gaharu adalah untuk pengobatan.. Sementara itu. PADA Aquilaria microcarpa Eka Novriyanti Balai Penelitian Hutan Penghasil Serat Kuok PENDAHULUAN Gaharu adalah komoditas hasil hutan non-kayu yang bernilai ekonomi tinggi dengan harga pasar bervariasi tergantung kualitasnya. incense.. yaitu 27 spesies dari 8 genus dan 3 famili yang tersebar di Sumatera. 2000). dan Irian (Sumarna.(Eka Novriyanti) 2 KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp. 2000). Pada prinsipnya. sebagai pengharum ruangan sembayang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. Produk ini dihasilkan beberapa spesies penghasil gaharu dalam famili Thymeleaceae. Indonesia yang merupakan salah satu pemasok gaharu terbesar memiliki kekayaan jenis penghasil gaharu tertinggi di dunia. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti 53 ..Kajian Kimia Gaharu . Maluku. Kalimantan.. 2005). meskipun pengunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. mulai dari 300 ribu rupiah hingga 25 juta rupiah untuk kualitas double super. Gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut memiliki scent of God’... dan parfum (Barden et al. Incense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagaman.

Gaharu adalah senyawa fitoaleksin yang merupakan metabolit sekunder dari pohon gaharu sebagai mekanisme pertahanannya. informasi jalur biosintetis gaharu itu sendiri sehingga mungkin dapat dibuat sintetis senyawa. rematik. anti serangga. Adelina. antar jaringan (konsentrasi tertinggi berada di kulit. antar pohon dalam spesies yang sama. atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Commission GIFNFC.Aspek PRODUKSI inflamatory (Trupti et al. dan lain-lain pengembangan yang masih sangat luas untuk dilakukan. Metabolit sekunder pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. Informasi mengenai bahan-bahan kimia yang terkandung dalam gaharu penting untuk pemanfaatan produk ini. 2004).. Suhartono dan Mardiastuti.. pengembangan pemanfaatan lain dengan terbukanya kemungkinan diidentifikasinya senyawa-senyawa baru dengan manfaat yang baru pula. 1987). pangkal percabangan. Konsentrasi metabolit sekunder ini bervariasi antar spesies. dan jaringan luka). 2004. asma. pengembangan senyawa-senyawa dalam gaharu dengan bio-teknologi. cacar. diuretic. maupun keadaan cekaman (Goodman et al. 2000. Arah pemanfaatan informasi kimia gaharu di antaranya adalah penyusunan standar produk berdasarkan komposisi kimia yang dikandungnya sehingga lebih seragam dalam praktek penentuan kualitas produk. Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. antar spesies. malaria. ginjal. 2002). (Hayne. akar. obat kuat pada masa kehamilan dan bersalin. stimulan kerja saraf dan pencernaan. hepatitis. kayu teras. 2007). juga memiliki sifat anti racun. dan antar musim (Forestry Commission GIFNFC. Barden et al. diare. Metabolit sekunder atau zat ekstraktif tanaman dapat efektif dalam melawan hama dan agen penyakit karena analog dengan komponen vital tertentu dari sistem sinyal seluler. anti mikrobia. 2004). 2007). Pohon gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. dalam Isnaini. 1987. liver. tumor. rangsangan fisiologi. Namun begitu. 2007). hal ini 54 . kanker. dan bermanfaat untuk mengatasi berbagai panyakit seperti sakit gigi.

namun setelah sekian waktu ternyata pengaruhnya terhadap luasan infeksi menjadi tidak signifikan lagi. microcarpa. Kalimantan Tengah Tamiang Layang. dan perlu dicatat tidak satupun isolat yang origin dari lokasi di mana penelitian dilakukan yaitu asal Carita. Kondisi kromatografi adalah sebagai berikut: suhu oven kolom 500C. dioperasikan dengan electron impact (EI) mode pada 70 eV dan suhu ion source 2000C. Pengukuran luasan infeksi dilakukan pada umur inokulasi 6 bulan. dan ditahan pada suhu ini hingga menit ke-60. suhu injeksi 2800C.25 mm. Tidak signifikannya pengaruh asal isolat terhadap luas infeksi diduga disebabkan karena isolat yang diinokulasikan sama-sama Fusarium sp.. Meskipun di awal inokulasi masing-masing isolat memperlihatkan kecepatan pembentukan infeksi yang berbeda sesuai virulensinya.(Eka Novriyanti) masih memerlukan pemikiran dan terus melakukan penelitianpenelitian lanjutan yang akan membuka satu demi satu kebenaran yang saat ini masih belum terungkap. Meskipun secara deskriptif isolat asal Bahorok sepertinya menyebabkan infeksi yang paling besar. Injeksi dilakukan dalam mode split. Identifikasi senyawa dilakukan berdasarkan waktu retensi dan analisis MS. ANALISIS KIMIA GAHARU HASIL INOKULASI ISOLAT DARI BEBERAPA DAERAH ASAL Dalam tulisan ini. ketebalan film 0. kemudian increased mencapai 2800C hingga 30 menit. pada batang A.. Gambar 1 menyajikan luasan infeksi Fusarium sp. dan Maluku.. Analisis komponen kimia dilakukan untuk gaharu rekayasa hasil inokulasi isolat Fusarium sp. Mentawai. Helium digunakan sebagai gas pembawa (carrier) (0. namun secara statistik. analisis kimia gaharu dilakukan dengan analisis GCMS pirolisis menggunakan aparatus Shimadzu GCMSQP2010. yaitu isothermal 500C selama 5 menit. daerah asal isolat tidak berpengaruh nyata terhadap luasan infeksi yang terjadi pada batang pohon penghasil gaharu ini. sedangkan analisis kimia dilakukan untuk sampel berumur ± 1 tahun.8 ml/min) yang dilengkapi dengan kolom kapiler DB-5 MS (60 mm x 0. asal Bahorok..Kajian Kimia Gaharu ..25 μm). 55 .

yaitu: 1. Tamuli.. Kelompok B: senyawa berkarakter odorant namun merupakan hasil pirolisis komponen kayu seperti selulosa dan lignin 3. microcarpa dengan pembeda daerah asal isolat Meskipun secara luasan infeksi tidak menunjukkan pengaruh yang nyata. Kelompok C: senyawa yang belum dikonfirmasi merupakan konstituen gaharu namun memiliki karakter odorant. kelompok A: konstituen gaharu yang sudah diidentifikasi pada pekerjaan beberapa peneliti sebelumnya 2. namun analisis komponen kimia dari gaharu hasil rekayasa ini menunjukkan adanya perbedaan. Panjang infeksi pada umur inokulasi 6 bulan di batang A. Nor Azhah et al. 2003.. Konishi. 56 . 2005. Bhuiyan et al. Lampiran 1 menyajikan komponen kimia hasil analisis py-GCMS terhadap sampel gaharu inokulasi umur satu tahun. 2006. 2009.. Burfield. 2002. 2005. Kelompok A pada Lampiran 1.Aspek PRODUKSI Gambar 1. Lampiran 1 dibagi menjadi 3 kelompok. Sampel yang dianalisi adalah sampel masing-masing dari titik-titik inokulasi dengan jarak suntik 5 cm dan 20 cm. dengan tanpa membedakan jarak suntik menunjukkan bahwa akumulasi konsentrasi relatif tertinggi untuk konstituen terkonfirmasi (Yagura et al. 2005. Alkhathlan et al. Pojanagaroon dan Kaewrak..

47%). 57 . Pola urutan konsentrasi yang sama juga terjadi untuk total konsentrasi relatif komponen berkarakter odorant.14%). dan terakhir Kalimantan Tengah Tamiang Layang (18. diikuti Mentawai.37%).47%). Keberadaan senyawasenyawa odorant hasil pirolisis komponen kayu ini kemungkinan memiliki peran pada kesatuan wangi yang dihasilkan incense gaharu yang dibakar. Bahorok (10. dan Mentawai (8.96%).. diikuti masing-masing Maluku (10. akumulasi konsentrasi relatif tertinggi dihasilkan oleh isolat asal Maluku (26. isolat asal Kalimantan Tengah Tamiang Layang memberikan hasil gaharu artifisial yang relatif terbaik yang ditunjukan oleh relatif lebih besarnya infeksi yang terjadi dan akumulasi senyawa gaharu terkonfirmasi tertinggi.(Eka Novriyanti) 2008) terjadi pada isolat asal Kalimantan Tengah Tamiang Layang sebesar 12.23%). Namun kontribusi komponen-komponen berkarakter odorant tersebut terhadap wangi gaharu masih memerlukan observasi yang lebih dalam lagi. dan Mentawai (11.Kajian Kimia Gaharu . dan Kalimantan Tengah Tamiang Layang. maka keberadaan senyawa dalam kelompok B tidak bisa dikesampingkan walaupun bukan merupakan konstituen resin gaharu yang sebenarnya.27%). Untuk kelompok odorant yang merupakan pirolisis komponen kayu ini. konsentrasi relatif tertinggi justru dihasilkan oleh isolat asal Maluku (12. Bahorok (22. Kalimantan Tengah Tamiang Layang (12. Bahorok.71%). diikuti Bahorok (12.89%. Untuk Kelompok C... Kelompok B pada Lampiran 1 merupakan kelompok senyawa berkarakter odorant yang merupakan hasil pirolisis selulosa dan lignin.40%). karena digunakan sebagai incense yang mengumbar wangi saat dibakar. Dengan kata lain.61%). Pengaruh kontribusi senyawa dalam kelompok ini pada wangi gaharu memerlukan investigasi lebih lanjut. Perbedaan konsentrasi ini kemungkinan sangat dipengaruhi oleh konsentrasi selulosa dan lignin dari bagian batang yang dijadikan sampel..31%). Secara kuantitas maupun kualitas (komponen kimia terkonfirmasi). Maluku. Ditampilkannya fakta tersebut karena penggunaan gaharu pada umumnya sebagai incense yang menghasilkan wangi hanya jika kayu yang mengandung resinnya dibakar. Mentawai (24.

Komponen dalam gaharu hasil inokulasi berbagai daerah asal isolat Fusarium sp. Senyawa ini memiliki wangi herbal yang dimanfaatkan dalam industri parfum dan pewangi (Wikipedia Online. kecuali untuk isolat asal Kalimantan Tengah Tamiang Layang yang justru lebih tinggi akumulasi konsentrasinya pada jarak suntik 20 cm (Tabel 1). 2008).11%. dihasilkan akumulasi masing-masing sebesar 12. 2008).. biasanya dimanfaatkan sebagai penguat rasa dan aroma (flavor enhancer) pada roti dan kue (Wikipedia Online. Inc. 2002). Senyawa ini pada konsentrasi rendah menyajikan wangi bunga dan merupakan konstituen dalam berbagai wangi bunga dan parfum. 2008) Ambrox memiliki karakter odorant tipe amber dan juga merupakan anti-inflamatory yang potensial untuk bidang pengobatan (Castro et al. Tabel 1. Ketoisophorone mengumbar wangi manis campuran kayu. manis buah. Indole merupakan konstituen utama dalam minyak melati dan karena minyak melati ini berharga mahal. Isolongifolene merupakan bahan yang sangat berguna sebagai odorant dan minyak parfum (Bunke dan Schatkowski. Secara umum untuk kelompok A. 1997).11% untuk jarak suntik 5 cm dan 20 cm. dan bunga (International Flavor and Fragrance. daun tembakau (The Good Scent Company. 2008). microcarpa yang memiliki karakterisitik odorant penting Komponen Ambrettolide Ambrox Keterangan Senyawa ini memiliki karakter wangi musk.. dan. Valerolactone Ketoisophorone Maltol Indole Isolongifolen 58 . teh. 2008). secara umum jarak suntik 5 cm menghasilkan akumulasi konsentrasi yang lebih tinggi.25% dan 10.Aspek PRODUKSI Untuk komponen gaharu terkonfirmasi (Kelompok A). Komponen ini menyajikan wangi caramel dan digunakan untuk menghasilkan wangi yang manis pada fragrance.17% dan 12. jarak suntik 5 cm dan 20 cm menghasilkan akumulasi konsentrasi relatif masing-masing sebesar 11. produk ini dibuat sintetisnya dengan menggunakan indole (Wikipedia Online. Angka-angka ini tidak jauh berbeda karena diduga konsentrasi komponen kayu yang relatif sama pada pohon-pohon sampel yang relatif berumur sama dan tumbuh pada kondisi yang relatif sama. Untuk kelompok B. pada A.

81% dan 20. Pola yang sama juga terlihat untuk akumulasi konsentrasi relatif pada kelompok senyawa C.. proses yang lambat ini kemungkinan memberi waktu dan kesempatan bagi senyawa tertentu untuk disintesis atau diakumulasikan hingga diperoleh konsentrasi yang relatif lebih tinggi. 2008).Kajian Kimia Gaharu . masing-masing 24. ada kemungkinan proses sintesis terjadi lebih cepat dibandingkan jarak injeksi yang lebih besar sehingga dihasilkan senyawa-senyawa baru yang lain yang berkarakter odorant namun akumulasinya belum cukup tinggi saat observasi dilakukan. Dengan besarnya spasi injeksi akan menyebabkan proses pembentukan senyawa yang terjadi berlangsung relatif lebih lambat. Senyawa ini muncul sebagai konstituen minyak esensial berbagai tanaman (Wikipedia Online.23%). Cadinene Dumasin Benzylacetone Azulene Akumulasi total untuk komponen berkarakter odorant menunjukkan bahwa jarak suntik 20 cm (52.96% untuk jarak suntik 20 cm dan 5 cm. 59 . Geraniol dan limonen juga dimanfaatkan dalam pengobatan herbal dan konstituen dalam berbagai tanaman obat (Wikipedia Online.. 2008). Di pihak lain. Dikenal juga sebagai cyclopentanone yang memiliki wangi mint. The Good Scent Company. 2004). dengan spasi injeksi yang lebih kecil di mana infeksi terjadi lebih cepat dan lebih besar. Blake. 2004). juga merupakan komponen volatil pada kokoa (Wikipedia Online. Kajian lebih dalam lagi diperlukan untuk mengetahui perkembangan atau perubahan yang terjadi dengan semakin lamanya waktu inokulasi. Limonen merupakan monoterpeneoid yang digunakan sebagai insektisida botani. 2008).. selain sebagai bahan kosmetik dan flavouring karena memberi wangi sitrus.59%) yang menghasilkan konsentrasi relatif lebih tinggi dibandingkan jarak suntik 5 cm (50.. 1994. yang ditunjukan oleh infeksi yang lebih kecil.(Eka Novriyanti) Komponen Limonene Keterangan Limonene merupakan terpen yang memiliki aroma bunga dan buah. Benzylacetone memiliki wangi manis bunga yang merupakan komponen atraktan yang melimpah pada bunga.. Namun. 2008. 2008. Mann et al. Merupakan material wewangian dan untuk pengobatan serta memiliki sifat pestisida (ChemYQ. Azulene sangat sering ditemukan sebagai komponen dalam minyak esensial tanaman dalam family Asteraceae dan memiliki wangi dan warna biru pada minyak dan ekstraknya (LyndShiveley.

. 1999).. 2002. Beberapa di antara komponen ini bahkan juga memiliki karakter wangi yang diketahui merupakan konstituen minyak esensial dan digunakan secara komersil dalam industri parfum dan pengharum seperti vanillin. benzoic acid (NBCI. 2000). Dalam Hua (2001) disebutkan bahwa konsentrasi asetosiringon meningkat 10 kali lipat ketika suatu jaringan aktif tanaman dilukai.. Asetosiringon merupakan bioaktif dalam interaksi tanamanmikroba yang mempercepat pendeteksian kehadiran patogen oleh tanaman di mana konsentrasi senyawa ini meningkat dalam tanaman seiring dengan meningkatnya konsentrasi mikroba (Baker et al. eugenol (Cowan. Senyawa asetosiringon juga tercatat pada semua gaharu hasil inokulasi kelima daerah asal isolat dalam penelitian ini. 2004). 60 . isoeugenol. dumasin (ChemYQ. senyawa 4H-pyran-4-one dan derivatnya (Abrishami et a. syringal-dehyde (Pedroso et al. 2008). 2008. Rho et al. metileugenol. Rhodes. Eugenol serta isoeugenol digunakan dalam produksi vanilin yang merupakan bahan penting dalam industri wewangian (Cowan. 2006). 2008). 1999.. Fotouhi et al. 2007). 2008). PubChem Compound. 1986). Eugenol. 2008). dan elimicin (Rossi et al.. derivat cyclopentane (Wikipedia Onlie. 2008).Aspek PRODUKSI Hasil analisis py-GCMS juga menunjukkan adanya senyawasenyawa yang pada beberapa hasil penelitian lain disebutkan sebagai senyawa pertahananan. Sedangkan koniferil alkohol merupakan intermediet dalam biosintetis eugenol dan isoeugenol (Cowan. di mana senyawa ini merupakan fenolik yang dihasilkan tanaman sebagai respon alami terhadap pelukaan (Sheikholeslam dan Weeks.. dan isometileugenol merupakan empat senyawa fenilpropanoid dari 12 senyawa volatil yang diketahui menyebabkan wangi yang manis pada Clarkia breweri (Rhodes. dan guaiakol merupakan intermediet dalam pembuatan eugenol dan vanilin (Li dan Rosazza. 2007. 2008).. Koeduka et al. 1999).

2. di mana daya racun akan semakin meningkat dengan semakin tingginya hidroksilasi (Cowan. Merupakan senyawa pertahanan tipe fitoaleksin yang termasuk dalam grup fenilpropanoid. minyak esensial. Senyawa ini digunakan untuk menghasilkan isoeugenol yang diperlukan untuk membuat vanilin yang juga merupakan bahan yang penting dalam obat-obatan dan industri parfum dan pengharum. Adalah fenol terhidroksilasi yang bersifat toksik pada mikroorganisme. pada A. Eugenol digunakan dalam pembuatan parfum.(Eka Novriyanti) Tabel 2.. Pada gaharu rekayasa hasil inokulasi Fusarium sp. dan parasitisida (Wikipedia.. ekspektoran. Letak dan jumlah grup hidroksil pada grup fenol diduga berkaitan dengan daya racun relative-nya terhadap mikroorganisme. Merupakan dimetil eter dari pirokatekol. 2008). 2008).. 2008a). yang juga digunakan sebagai antiseptik dan parasitisida (Li dan Rosazza. 1983..Kajian Kimia Gaharu . 61 . pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masinng sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. 2000). 1999). Eugenol dan isoeugenol diturunkan dari prekursor lignin. Merupakan intermediet dalam pembuatan eugenol dan vanilin. deodoran. p:144). Hasil inokulasi Fusarium sp. sedatif. dan obat-obatan. 1999). yaitu asam ferulat ataupun koniferil alkohol (Rhodes. Kedua senyawa ini dan turunannya digunakan sebagai antiseptik. Koniferil alkohol Guaiakol Katekol dan pirogalol Veratrol KESIMPULAN 1. Konstituen resveratrol yang diturunkan dari asam p-hidroksisinamat dan 3 unit malonat. microcarpa ditemukan beberapa komponen senyawa yang sudah diidentifikasi merupakan konstituen gaharu dan beberapa senyawa lain yang memiliki karakter odorant dan secara komersil digunakan dalam industri perfumery dan flavoring. memiliki sifat antimikrobial (Torssel. Senyawa-senyawa yang berdasarkan beberapa referensi diketahui merupakan pertahanan pada tanaman tertentu dan terdeteksi pada gaharu hasil inokulasi Senyawa Eugenol Keterangan Bersifat bakteriostatik terhadap jamur dan bakteri (Cowan. contohnya adalah yang terdapat pada Linum usitiltissimum (Sengbusch.

Synthesis of Some Aldoxime Derivatives of 4H-Pyran-4-ones. daerah asal isolat menunjukkan perbedaan dalam konsentrasi senyawa-senyawa gaharu yang terbentuk. 1997. Said.. [20 Juni 2008]. C. 2000. M. Rice. R. [2 Februari 2007]. Hasnida. Y. 2006.com [31 Desember 2008]. J. Mulliken. N. Anak. M. L. asal Kalimantan Tengah menunjukkan konsentrasi senyawa konstituen gaharu terkonfirmasi yang lebih tinggi.pdf. T. Chang. their Production and their Use. Husni. Whitaker. Robert. Secara umum. Azah. www. 2004 Medicinal Plant Constituents.ars.3.usda. Majid. http://www. N. Comparison of Chemical Profiles of Selected Gaharu Oils from Peninsular Malayia. Y. A. Isolongifolanol Derivates. Stimulatory Effect of Acetosyringone on Plant/Pathogen Recognition. Meskipun secara statistik tidak memperlihatkan perbedaan yang signifikan terhadap luasan infeksi yang terbentuk setelah 6 bulan inokulasi. A. [22 Mei 2007]. J. Song. Y. E. A. S. namun isolat asal Maluku menunjukkan konsentrasi yang relatif lebih tinggi untuk total senyawa dengan karakter odoran. A. A. Mailina. Sustainable Agarwood Production in Aquilaria Trees. freepatentsonline. Blake. Bayat. Teimuri-Mofrad. naturalhealthwizards. The Malaysian Journal of Analytical Sciences 12 (2): 338-340. F. R. [21 Juni 2008]. Schatkowski. A. 2002. D. http://www. Mock. 2004. C. S.org. A. htm. Molecules 7: 239–244. Bunke. M. com/MedicinalPlantConstituents. D. Deahl. A. A. Baker. N. 2008.. K. Blanchette. www. P. D. J. N. Barden. http://www. N. Shahrisa. United State Patent. Heart of the Matter: Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. S. Averyanov. .traffic. Yasmin.net. J. inokulasi Fusarium sp. H. A.therainforestproject. gov/research/publications/publications. DAFTAR PUSTAKA Abrishami. S. B..

Ishihara. Fotouhi.iff. Synthesis of Ambrox® from Labdanolic Acid. Investigation of Electrooxidation Reaction of Some Tetrahydrobenzo[b]pyran Derivatives. Chemicals from Trees. http://www.uk/review/extraction.com/ Ingredients. A.. Terjemahan dari: Nuttige Planten Van Indonesie. Clinical Microbiology Review 12 (4): 564-582. Nogueras. ChemYQ. Castro. T. 2001. W. J. hlm: 1467-1469.31 pm]. Sci. http://www.chemyq. Dumasin. J.nsf/0/45BD7B214C6F661E8025699000 5D79C2 [31 Desember 2008]. Tetrahedron 58 (29): 5941-5949. Cowan. Thymelaceae. Tsuneya. 2002. Sánchez. FAO. Salido. and K. http://www. 2008. 2004. Tumbuhan Berguna Indonesia Jilid III. M. Succinaldehyde. Uneyama. S. Yayasan Sarana Wana Jaya. M. M. E.com/ En/xz/xz11 [3 April 2008]. 1987. 1999. M. A. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. www. 1987. Food safety and Quality: Flavoruing Index.cites.Burfield. Convention on International Trade in endangered Species of Wild Fauna and flora: Amendments to Appendices I and II of CITES. http: // treechemicals. K. Forestry Commission GIFNFC.. L.org/common/cop/13/raw / props/ID-Aguilaria-Gyrinops. M. 1991. 3: 721-726.gov. Plant Products as Antimicrobial Agents. International Flavor and Fragrance. Int. Inc.pdf.org. csl. Altarejos. Hayne. 2007. CITES.cropwatch. 2008. Berlin: SpringerVerlag. Shiga.html?showSynonyms=1 [ 1 November 2008: 2. S. Fatehi. Three Sesquiterpenes from Agarwood. http://www.. [2 Februari 2007]. 2005a. [14 Juli 2007]. Hua. T. Badan Litbang Kehutanan Jakarta. Heravi.cfm. Phytochemistry 30 (2): 563566. S. Hills. J. M. Heartwood and Tree Exudates.org/ ag/agn/jecfa-flav/index. 2008.fao. M. Applied Microbiology 32: 278-281. 63 . Agarwood Chemistry. T. Electrochem.

W. M. Y. Benzoic acid. M. Bogor. Pedroso. D. and I. are Biosynthesized via Reduction of a Coniferyl Alcohol Ester. T. Soc. T. S. C. S. E. Bhattacharrya. Natl. Nat. Steil.ncbi. R. Spassova. W. Gang. E. B. Barison. www. C. Biavatti. N.actahort. S. T. Sci. Biocatalytic Synthesis of Vanillin. Deschamps. S. Y. Fridman. J. P. [22 Mei 2007]. H. 2006. S. 1962. Konishi. J.. G. Program Pascasarjana Institut Pertanian Bogor. S. Azulene and Chamomile. 2002. S. You. Proc. Applied and Environmental Microbiology 66 (2): 684-687. Rosazza. 2008. ISHS Acta Hort 676. 28 (3): 471-473. K. Kish. Chem... of Pharmacognosy 18(1): 63-69. Konoshima. Shimada. Koeduka. M. Aromaticplant project. Brazilian Jour. Kim. Kim. N. Prema. Chem. 2004. E.. www. 2004. Pharm. D. 50 (3): 419-422. Noel. Acad. A. C. [1 Desember 2008]. Y. P. Jackson. Bull. A. I. Orlova. USA. P. B. Characteristic Aromatic Constituents of Spices. T. T. Pichersky. http://pubchem. and P. Induksi Produksi Gubal Gaharu melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik (Disertasi). Campos.. H. Microbial Transformation of Terpenes. H.cgi?cid=243. Lynd-Shiveley.Aspek PRODUKSI Isnaini. Baiga. D.org. J. L. Baek. F. Kiyosawa. 2000. NCBI PubChem. Chang. India. 2008. 2007.com. Vassão. Korean Chem. Lewis. [20 Juni 2008]. Pojanagaroon. Bull. Lee. S. Lab. Li. Isolation of Syringaldehyde from Mikania laevigata Medicinal: Extract and its Influence on the Fatty Acid Profile of Mice. A. gov/summary/ summary. Dudareva. 2006. Rho. F.. J. N. Eugenol and Isoeugenol. Kaewrak. G. New 5-Hydroxy-2-(hydroxymethyl)-4H-pyran-4one Derivative has Both Tyrosinase Inhibitory and Antioxidant Properties. J.nih. R. D. 64 . Six New 2-(2-Phenylethyl)chromones from Agarwood. A. Santos.nlm. M. Mechanical Methods to Stimulate Aloes Wood Formation in Aquiliria crassna Pierre ex H Lec (Kritsana) Trees.

Kajian Kimia Gaharu .....(Eka Novriyanti)

Rhodes, D. 2008. Secondary Products Derived from Aromatic Amino Acids: Eugenol and Isoeugenol. www.hort.purdue.edu. [20 Juni 2008]. Rossi, P. G., L. Bao, A. Luciani, P. Panighi, J. M. Desjobert, J. Costa, J. Casanova, J. M. Bolla, and L. Berti. 2007. (E)-Methy-lisoeugenol and Elemicin: Antibacterial Components of Daucus carota L. Essential Oil Against Campylobacter jejuni. J. Agric. Food Chem. 55 (18): 7332-7336. Sengbusch, P. V. 2008. Phenolic Compounds. http://www.biologie. unihamburg. de/b-online/e20/20d.htm. [10 April 2008]. Sheikholeslam, S. N., D. P. Weeks. 1987. Acetosyringone Promotes High Efficiency Transformation of Arabidopsis thaliana Explants by Agrobacterium tumafacien. Plant Molecular Biology 8: 291198. Sumarna, Y. 2005. Budidaya Gaharu. Seri Agribusines. Penebar Swadaya. Jakarta. The Good Scent Company. 2008. Limonene; Ketoisophorone; Syringaldehyde, Tiglaldehyde. http://www.thegoodscents company.com/gca/gc1014951.html [20 Juni 2008]. Torssell, K. B. G. 1983. Natural Product Chemistry. John Wiley & Son Limited. Chichester, New Tork, brisbane, Toronto, Singapore. Trupti, C., P. Bhutada, K. Nandakumar, R. Somani, P. Miniyar, Y. Mundhada, S. Gore, K. Kain. 2007. Analgesik and Antiimflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. Pharmacologyonline 1: 288-298. Vidhyasekaran, P. 2000. Physiology of Disease Resistant in Plant. CRC Press Inc. Boca Raton, Florida. Verpoorte, R., R. van der Heijden, J. Memelink. 2000. General Strategies. In Verpoorte, R. and A. W. Alfermann (eds). Metabolic Engineering of Plant Secondary Metabolism. Kluwer Academic Publisher. Dordrecht, Boston, London. p: 31-50. Wikipedia Online. 2008. Pyrrolidine; Propargyl Alcohol; Ptalic Acid; Mesityl Oxide; Maltol; Indole; Glutanic Acid, Furanone; Elemicin; DABCO; Crotonic Acid; Cadinene; Butyric Acid; Benzylacetone; Caprylic Acid. http://en.wikipedia.org/wiki/. [1 juni 2008].

65

Aspek PRODUKSI

Yagura, T., N. Shibayama, M. Ito, F. Kiuchi, G. Honda. 2005. Three Novel Diepoxy Tetrahydrochromones from Agarwood Artificially Produced by Intentional Wounding. Tetrahedron Letters 46: 4395-4398. Yagura, T., M. Ito, F. Kiuchi, G. Honda, Y. Shimada. 2003. Four New 2-(2-Phenylethyl) Chromone Derivatives from Withered Wood of Aquilaria sinensis. Chem. Pharm. Bull. 51:560-564. Zaika, E. I., R. A. Perlow, E. Matz, S. Broyde, R. Gilboa. 2004. Sub-strate Discrimination by Formamidopyrimidine-DNA Glycosylase. The Jour. of Biol. Chem. 279 (6) issue 6: 4849-4861.

66

Kajian Kimia Gaharu .....(Eka Novriyanti)

Lampiran 1. Komponen dalam gaharu hasil inokulasi Fusarium sp. pada A. microcarpa
Konsentrasi Relatif (%) Nama senyawa 5 cm Bo 20 cm 5 cm Kt 20 cm Me 5 cm 20 cm Mu 5 cm 20 cm

A. Komponen aromatis yang sudah diidentifikasi sebagai konstituen gaharu 4-(2’-Methyl-3’-butenyl) azulene 2,5-DIMETHOXY-4ETHYLBENZALDEHYDE 2-Hydroxy-4methylbenzaldehyde 4-Ethoxy-3methoxybenzaldehyde 4-METHYL-2,5DIMETHOXYBENZALDEHYDE Benzaldehyde, 2,4-dihydroxy Benzaldehyde, 2,4-dimethoxy- (CAS) 2,4-Dimethoxybenzaldehyde Benzaldehyde, 3,4-dihydroxy- (CAS) 3,4-Dihydroxybenzaldehyde Benzaldehyde, 3-hydroxy- (CAS) m-Hydroxybenzaldehyde Benzaldehyde, 4,6-dimethoxy2,3-dimethyl- (CAS) 2,4-Dimethoxy-5,6-dimethyl Benzaldehyde, 4-[[4-(acetyloxy)-3,5dimethoxyphenyl]methoxy]3-methoxy Benzaldehyde, 4-hydroxy(CAS) p-Hydroxybenzaldehyde 1,2-benzenedicarboxylic acid, diisooctyl ester (CAS) Isooctyl phthalate 2-Butanone, 4-phenyl- (CAS) Benzylacetone 2-Butanone, 3,3-dimethyl(CAS) 3,3-Dimethyl-2butanone 0,09 0,09 4,35 0,42 0,06 0,08 0,08 2,37 0,30 0,49 3,66 0,08 0,06 0,21 1,52 0,22 0,07 4,65 0,10 1,45 0,09 4,42 0,11 4,60 0,25 -

-

-

0,32

0,29

0,26

-

0,24

0,28

-

0,37

-

-

0,39

-

-

0,29

-

-

0,36

-

-

-

-

-

-

-

0,37

-

-

0,54

0,48

-

-

0,07

-

0,12

0,43 -

0,23 -

0,44 -

-

0,24 -

0,04

-

0,41 0,04

-

0,53 -

0,05

-

67

Aspek PRODUKSI

Konsentrasi Relatif (%) Nama senyawa 5 cm 2-Butanone, 3-phenyl- (CAS) 4H-1-Benzopyran-4-one, 2-(3,4-dihydroxyphenyl)-7-(. beta.-D-glucopyranosyl) 4H-1-Benzopyran-4one, 2-methyl- (CAS) 2-Methylchromone 4H-1-Benzopyran-4-one, 5,7-dihydroxy-2-methyl- (CAS) 2-Methyl-5,7-dihydroxy 4H-1-Benzopyran-4-one, 6-dihydroxy-2-methyl- (CAS) 6-Hydroxy-2-methylchromone 2-Coumaranone .gamma.-Eudesmol Hexadecanoic acid, 2-(octadecyloxy)-, tetradecyl ester (CAS) TETRADECYL Hexadecanoic acid, methyl ester (CAS) Methyl palmitate 2,4-Hexadienedioic acid, 3,4-diethyl-, dimethyl ester, (Z,Z)- (CAS) CIS.CIS.D 2,4-Hexadienedioic acid, 3-methyl-4-propyl-, dimethyl ester, (Z,E)- (CAS) .alpha.-humulene 1-Naphthalenol, 1,2,3,4-tetrahydro- (CAS) 1-Tetralol 1-Ethynyl-3,4-dihydro-2naphthalenecarbadehyde Phenol, 2,6-dimethoxy- (CAS) 2,6-Dimethoxyphenol Phenol, 3,4-dimethoxy- (CAS) 3,4-dimethoxyphenol Benzenepropanoic acid, methyl ester (CAS) Methyl hydrocinnamate Bo 20 cm 5 cm Kt 20 cm 0,05 Me 5 cm 20 cm Mu 5 cm 0,15 20 cm -

-

-

-

0,18

-

-

-

-

-

0,06

-

0,36

-

-

0,34

-

-

-

-

0,46

-

-

-

-

-

0,04 -

-

-

-

-

0,28 -

0,03

-

-

-

-

0,69

-

0,05 0,85

-

-

0,12

-

0,16

-

0,09

0,17

-

-

-

-

-

-

0,11 0,07

-

-

2,94 0,25 -

0,08 3,37 0,33 -

2,74 0,33 -

3,67 0,40 0,25

3,11 0,24 -

3,05 0,42 -

4,22 0,40 -

2,83 0,22 -

68

15 4.79 0.6. 3-methyl(CAS) 3-methylpyrocathecol 0. 1-ACETYL-2.49 2.26 0.31 - 1.20 0.74 0.12 0.28 8.19 0.28 5 cm Kt 20 cm 0.12 5.66 0.94 0..20 9. ethyl ester (CAS) ETHYL 3-PROPARGYL Propanoic acid.89 9.66 0. 1-hydroxy.(CAS) Acetosyringone ACETOVANILLONE Ethanone.99 0.04 3.21 0.17 0.67 6.5dimethoxyphenyl).2.14 0.74 16.30 8.4.49 6.58 13.95 10. 1-(acetyloxy)(CAS) Acetol acetate 2-Propanone.2-benzenediol.14 0.96 B.46 1.56 0.58 0.8-HEXAHYDRO-2HCHROMENE 1.03 - - 0.65 - - 0.Kajian Kimia Gaharu .22 0.55 0.24 Me 5 cm 20 cm Mu 5 cm 20 cm 0.17 0.12 - 0..86 1.29 0.02 - 0.(CAS) Acetol Ethanone.3.5.62 10.2-Benzenediol (CAS) Pyrocathecol 1.5.58 3. 3-(2-propynyloxy)-.57 0.4A.60 4.(CAS) Maltol 4H-Pyran-4-one.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm Propanoic acid.66 2.8A-OCTAHYDRONAPHTHALENE Jumlah Rataan untuk kedua jarak suntik Bo 20 cm 0.18 0.(CAS) 5-hydroxy-2methyl-4H-pyran-4-one 2-Propanone.20 1.27 0.30 12.17 5.50 4.28 69 . 5-Hydroxy2-methyl.66 0.59 8.6. Komponen aromatis yang merupakan pyrolisis dari bagian kayu 4H-Pyran-4-one.17 0. 1-(4-hydroxy3-methoxyphenyl).20 0.87 0. 3-Hydroxy-2methyl.(CAS) Acetovanillone 1.38 0.17 0.27 0.84 0..7. anhydride (CAS) Propionic anhydride Propanoic acid.61 0.25 0.95 6.4.83 0.49 - 0..15 3. METHYL Benzenepropanoic acid (CAS) Phenylpropionic acid 3. ethenyl ester (CAS) vinyl propionate CYCLOPENTANEPROPANOIC ACID. 1-(4-hydroxy-3.19 0.2DIMETHYL-.44 - - 12.

37 Bo 20 cm 1.37 0.19 0.39 13.63 20 cm 1.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 3-Methoxy-pyrocathecol 4-METHYL CATHECOL Phenol.35 11.23 0.07 - - - - - - 70 .18 12.14 0.06 - - 0.(CAS) o-Cresol Phenol.14 - 0. 3-methoxy.(CAS) 6-ETHYL-.18 0.82 0. 4-(methylamino)Benzoic acid. 2-methoxy-4-propyl(CAS) 5-PROPYL-GUAIACOL Phenol.11 1.82 0.64 - 0. 2-methoxy.18 0.05 0.30 1.57 2.08 0.39 0.31 0.40 20 cm 1.87 11.22 0. 6-ethyltetrahydro.52 0.4.24 - 0.(CAS) m-Cresol Phenol.5-trimethoxy-.13 0.06 0. 3.69 0.40 5 cm 1.46 0. 4-ethyl-2-methoxy(CAS) p-Ethylguaiacol Phenol (CAS) Izal Jumlah Rataan untuk kedua jarak suntik 1.13 0.4.31 11.43 1.47 Mu 5 cm 1.52 11.70 0.14 0.28 Kt 20 cm 2.47 C. 2-methyl. methyl ester (CAS) METHYL 4-VINYLBENZOATE 2.5-Trimethoxybenzoic Benzoic acid.03 - 0.64 - 0.43 12.(CAS) Guaiacol Phenol.07 14.18 1.45 2.89 10. Komponen berkarakter odorant lainnya yang belum disebutkan sebagai konstituen gaharu Ascaridole 2H-Pyran-2-one.90 0.24 0. 3-methyl.12 0.DELTA.27 1. 4-ethenyl-. 4-methyl.54 12.35 0.(CAS) m-Guaiacol Phenol.(CAS) p -Cresol Phenol.82 0.71 1.01 0.23 Me 5 cm 1.VALEROLACTONE Oxacycloheptadec-8-en-2-one (CAS) Ambrettolide Oxacycloheptadecan-2-one (CAS) Dihydroambrettolide Benzoic acid.16 - - 0.35 1.34 11.40 0.15 0.50 0.36 13.36 0. methyl ester (CAS) 3.92 0.11 0.19 0.57 0.

(CAS) 2-acetylbutyrolactone 0.25 1.12 - 0.71 0.beta.85 - - - - - 0.98 1.61 - 4. (E).84 - 0.(CAS) 2.76 0. beta. 2-methoxy-4-(2propenyl).7-triol.99 - 4. cisCholestane-3.6..09 Me 5 cm 1.24 - 0.-Cyclocitral Cyclopentanone.).beta.5.98 Kt 20 cm 0.45 1..45 0.5-dihydroxyphenyl)(CAS) Quinacetophenone Phenol..53 0.14 1.26 0.33 - - 0.(CAS) (E)isoeugenol Phenol.38 - 4.70 0.alpha.5-furandione..-bisabolene 2-Butanone (CAS) Mehtyl ethyl ketone Butyric acid.66 5 cm 0.23 20 cm 0.20 71 .. m-nitrophenyl ester (CAS) m-Nitrophenyl butyrate Carveol.78 Bo 20 cm 0.93 - 3. 3-methyl(CAS) Citraconic anhydride Citronellyl acetate .22 - 0.42 4.66 20 cm 2.04 - 0.32 1.65 0.33 - 6.30 0. 1-(2.17 1.7.07 0.28 1.67 0.38 0.95 0.93 - 0.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm .20 - 4. dimethylhydrazone (CAS) Cyclopentanone dimethylhydrazone Cyclopropyl carbinol Cyclopentanone (CAS) Dumasin 1-Eicosanol (CAS) n-Eicosanol TRANS-ISOELEMICIN Ethanone.(CAS) Isoeugenol Phenol. 2-methoxy-4-(1propenyl).51 0.(CAS) Eugenol 5-BUTYL-2-VALERYLFURAN 2(3H)-Furanone.03 0..93 0.beta.55 Mu 5 cm 1.6.. (3.31 - 0. 2-methoxy-4-(1propenyl)-.beta.Kajian Kimia Gaharu . 3-acetyldihydro.22 - - 1.61 - - - - - - - 0. dihydro-.

HEXALACTONE 3.06 0. 1-methylethyl ester (CAS) Isopropyl hexanoate 3-Hexenoic acid 1H-Indole (CAS) Indole 1H-Indole.93 - - 0.09 - - - - - - - 0.70 - 0.71 0.13 0.35 - 0.18 0.21 0.54 0.75 1.-lactone Muskolactone Bo 20 cm 5 cm 0.54 - 0.21 0.26 - 0. 2-methyl.5-Dihydrodecanoic acid.(CAS) 3-Methyl-2-heptanone Hexanoic acid. 3-methyl.(CAS) 2-methylindole 6-Nitro-5-hydroxy-1.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 2(5H)-Furanone. delta.02 - 72 .25 - - 0.59 0. tetrahydro(CAS) Tetrahydrofurfuryl alcohol 2-Heptanol.03 0.39 0.66 - 0.31 0.36 0.60 0.GAMMA. acetate (CAS) 2-HEPTYL ACETATE 2-Heptanone.5-dimethyl(CAS) 4.09 Mu 5 cm 20 cm - - - - - - 0.65 - 0.76 - 0.56 0.98 0.28 0.55 0.74 1.48 0.14 0.30 0.31 - 0.51 0.69 - 0.54 - 0.11 - 0. 5.03 0.63 - 0.77 0.40 0.38 0.4-Dimethylbut-2enolide 2(5H)-Furanone.(CAS) 4-decanolide 2-Furancarboxaldehyde (CAS) Furfural 2-Furanmethanol (CAS) Furfuryl alcohol 2-Furanmethanol.09 - 0.23 0.04 0.64 0.18 Kt 20 cm Me 5 cm 20 cm 0.2dimethylindole Indolizine (CAS) Indolizin Ionol 2 3-pentanone CAS) Diethyl ketone 1-Penten-3-one (CAS) Ethyl vinyl ketone .56 0. 5-hexyldihydro.09 - 0.03 - 0.65 0. 5-methyl(identity?) (CAS) 2-Penten-4olide 2(3H)-Furanone.

. 4-hydroxy3.20 Me 5 cm 20 cm 0.48 2.40 0.15 - 0.21 0.6.45 3..50 0.17 - 0.Kajian Kimia Gaharu .(CAS) Syringaldehyde Bo 20 cm 0.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm L-isoleucine. 1-(1-METHYLPENTYL)3-(2.19 Kt 20 cm 0.(CAS) 6-METHYLPURINE.13 20 cm 0. 5-methyl(CAS) Orcinol Benzaldehyde.52 0.13 0.42 0.3-d3 (CAS) 2.(CAS) NITROSOPIPERIDINE PIPERIDINE.50 - 0..52 0.20 0.3-Benzenediol.(CAS) N-Acetyl-L-isoleucine 5. 1-methoxy-4-methyl(CAS) p-methylanisole NEROLIDOL ISOMER 4-Nonanol.04 5 cm 0.5-DIHYDROXYNORBORNANE Piperidine.86 - 0.65 3.3-Benzenediol.6-TRIDEUTERIO-OMENTHONE Benzene.58 73 ..04 0.(CAS) 4-Ethylresorcinol 1.43 0.7-dimethoxy-2-methylindan1-one Lineolone METHYL MALONIC ACID p-Menthane-2-one-1.22 0. 1-nitroso.89 0.11 0.56 - 0.70 0.5-dimethoxy.01 0.57 3.89 2.29 - 0. N-acetyl.58 0.93 - 0.13 0.47 0.(CAS) 4-methyl-4-nonanol 2. 9-TRIMETHYLSILYL 1.15 0. 6-methyl-9(trimethylsilyl).5-DIMETHOXY-PHENYL)PROPIONIC ACID 3-PHENYL-PROPIONIC ACID ISOPROPYL ESTER 2-PROPYNOIC ACID 9H-Purine.19 0.3. 4-methyl.57 0.34 - 0.50 5. 4-ethyl.04 0.5-Norbornanediol (CAS) 2.21 Mu 5 cm 0.21 0.

39 1.09 0.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm (E)-2-hydroxy-4’phenylstilbene 1-TRICOSENE Benzaldehyde.(CAS) Vanillin Benzeneacetic acid.(CAS) 2-Acetyfuran 2-ACETYL FURAN 2(3H)-Furanone (CAS) .02 - - - - - - - - 0.50 Kt 20 cm 0.alpha.06 - 0.10 - 0.52 Mu 5 cm 0.52 Me 5 cm 0. hexahydro3-methylene.40 5 cm 0.4-dimethoxy(CAS) Vanillin methyl ether Benzaldehyde.20 0.59 20 cm 0.11 0.38 Bo 20 cm 0. .45 - - - - - 0.(CAS) Homovanillic acid ISO-VELLERAL Benzenemethanol.4-dimethoxy. 5-methyl(CAS) 5-Methyl-2-oxo-2.13 0. 4-hydroxy-3-methoxy.(CAS) Veratryl alcohol 2-Butanone.11 0.63 - - - - - 0.hydroxy-2-methoxy.26 74 .(CAS) 6-HYDROXYCYCLO 2(5H)-FURANONE 2.17 - 2. 3.13 - 1.70 - 1.72 0. 1-(2-furanyl).04 0.77 0.97 0.23 - - 0.61 0. 3.55 0.21 - - 0.(CAS) 2-methoxymandelic acid Benzeneacetic acid.01 20 cm 0.28 - 2.27 0.14 0.23 - 0. 4-(4-hydroxy3-methoxyphenyl).45 0.15 - 0.3DIHYDROFURAN 2(3H)-Furanone.5-DIMETHYL-3(2H) FURANONE 2-ETHYL-4-HYDROXY-5METHYL-3(2H)FURANONE 2-HYDROXY-5-METHYL-2(5H)FURANONE 3-HYDROXY-5-METHYL-2(5H)FURANONE 0.36 - 1.alpha.48 0. 4-hydroxy-3methoxy.32 - - - - - - - - 0.12 0.Furanone 2(3H)-Furanone.14 - 1.96 0.(CAS) Zingerone Ethanone.12 0.

31 17. (2008).48 49. Me = Mentawai.33 26. (2008).10 52. Wikipedia encyclopedia Online (2008).19 45. Fotouhi et al. The Good Scent Company (2008).95 2. Bunke & schatkowski (1997). Kt = Kalimantan Tengah Tamiang Layang.30 - Me 5 cm 1.65 5 cm - Kt 20 cm 1. (2004). Rossi et al.32 37. (2002).(CAS) 4-allyl-2. Baker et al.23 0.57 19.02 20 cm 1. (2005).34 46.. Sheikholeslam & Weeks (1987). (2006). Hua et al.65 46.81 - 2. (2007). (2001).33 50.33 0.(CAS) 6-O-METHYLXanthosine (CAS) Xanthine riboside Jumlah Rataan untuk kedua jarak suntik Total Rataan total untuk kedua jarak suntik Keterangan: Referensi: Bo 20 cm 1. Lynd-Shiveley (2004). (2004).3-dihydroxy-6-methoxy-8methyl.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm 5-HYDROXYMETHYLDIHYDRO-FURAN-2-ONE HYDROXY DIMETHYL FURANONE 2-(Acetyloxy)-1-[2-(acetyloxy02-(3-furanyl)ethyl]-5a[(acetyloxy)methyl]hexah 2-Methoxy-4-methylphenol Phenol.83 43. (2002).6-dimethoxy-4-(2propenyl).37 25.29 26.13 0. ChemYQ (2008)... Pedroso et al.06 2.12 24.52 3.05 3. International flavor and fragrance..86 18. Valentines et al. 75 .Kajian Kimia Gaharu . 2. Zaika et al.18 0. Azah et al.71 21.10 3.87 - 1. 1.14 44.30 45. (2008).23 27. Castro et al.93 22.23 - - - - 0.01 44.62 0. Rho et al.06 - - - 18. Abrishami et al. Inc (2008).17 2. Mu = maluku FAO (2008). (2007).6dimethoxyphenol 9H-Xanthen-9-one. Koeduka et al.80 2.06 Mu 5 cm 20 cm 1.34 43.95 0.70 25.56 Bo = Bahorok.

76 .

meskipun penggunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. Dalam perdagangan internasional. Bentuk perdagangan gaharu beragam. karas. 77 . gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut sebagai ‘scent of God’. sebenarnya merupakan endapan resin yang terakumulasi pada jaringan kayu sebagai reaksi pohon terhadap pelukaan atau infeksi penyakit. Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu yang merupakan produk komersil bernilai ekonomis tinggi. Ahmad Yani.3 TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso. aloeswood. perdagangan produk ini di Indonesia pertama kali tercatat pada abad ke-5 Masehi. Sugeng Santosa. Gaharu telah diperdagangkan sejak ratusan tahun lalu. di mana China dilaporkan sebagai pembeli utama. Maman Turjaman. Menurut Suhartono dan Mardiastuti (2002). jinkoh. serbuk. 2001). dan masih banyak lagi nama lainnya. oudh. Ragil Setio Budi Irianto. Komoditas berbentuk minyak biasanya diperoleh dari penyulingan atau ekstraksi chip gaharu dari kelas yang bermutu rendah. kresna. Sitepu. komoditas ini dikenal dengan berbagai nama seperti agarwood. Saat ini. chip. Irnayuli R. dan minyak gaharu (Surata dan Widnyana. mulai dari bongkahan. Najmulah.

Gyrinops dan Aquilaria dalam Appendix II CITES. incense. asma. 2004. obat kuat pada masa kehamilan dan bersalin. sembahyang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. ginjal. 2000. Penelitian mengenai berbagai aspek yang terkait dengan gaharu sudah dilakukan sejak lama dan semakin berkembang dewasa ini. 2000). sebagai pengharum ruangan. 2002). diuretic. di mana selama proses tersebut berlangsung dihasilkan variasi mutu dan pada akhir proses dapat diperoleh gaharu dengan mutu paling tinggi (Sumadiwangsa dan Harbagung. pelukaan mekanis pada batang. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti imflamatory (Trupti et al. juga memiliki sifat anti racun. malaria. tumor. Sementara itu. pemanfaatan gaharu adalah untuk pengobatan. Proses pembentukan gaharu juga membutuhkan waktu yang lama. Untuk menghasilkan gaharu secara artifisial. karena 78 . dan parfum (Barden et al. rematik. dan yang lainnya dapat memicu pembentukan gaharu. oli. Barden et al. cacar. terpicu oleh faktor biotik maupun abiotik. hepatitis. In-cense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagamaan. pengaruh bahan-bahan kimia seperti metal jasmonat. liver. kanker. 1987.Aspek PRODUKSI Pada prinsipnya.. anti mikrobia. Lain halnya jika pembentukan gaharu dipicu oleh faktor biotik seperti jamur atau jasad renik lainnya. Namun pembentukan gaharu oleh faktor abiotik. gula merah. tidak semua tanaman penghasilnya mengandung gaharu yang hanya terpicu pembentukannya jika terjadi kondisi cekaman. 2000). 2000). stimulan kerja saraf dan pencernaan (Heyne. 2007) dan diketahui bermanfaat untuk mengatasi berbagai penyakit seperti sakit gigi.. Adelina.. Suhartono dan Mardiastuti. seperti yang telah disebutkan sebelumnya tidak menyebabkan terjadinya penyebaran mekanisme pembentukan ini ke bagian lain dari pohon yang tidak terkena efek langsung faktor abiotik tersebut.. mekanisme pembentukan dapat menyebar ke bagian lain pada pohon. Terbentuknya gaharu pada tanaman penghasilnya. diare. Selain itu. Penelitian-penelitian ini terutama didorong oleh berbagai hal seperti pasokan komersil untuk gaharu yang masih sangat tergantung dari produksi alam yang karena tingginya intensitas pemungutan produk ini telah menyebabkan tercantumnya genus utama tanaman penghasil gaharu.

. Tabel 1. yang telah menunjukkan adanya pembentukan gaharu secara alami.. pada A. Inokulasi jenis fungi Fusarium spp. Batang Aquilaria spp.. maka kualitas dan kuantitas produk gaharu yang dihasilkan akan lebih memuaskan..(Erdy Santoso. microcarpa pada kegiatan ini bahan berupa pohon A. yang diinokulasi di Laboratorium Mikrobiologi Hutan. Bahan Bahan yang digunakan pada kegiatan ini adalah 21 isolat Fusarium spp. Maluku. Sumatera. yaitu Potato Dekstrose Agar (PDA). Dengan terjadinya penyebaran pembentukan gaharu ke jaringan lain pada batang pohon. Isolat-isolat yang diamati No 1 2 3 4 5 6 7 8 9 10 11 Kode Ga 1 Ga 2 Ga 3 Ga 4 Ga 5 Ga 6 Ga 7 Ga 8 Ga 9 Ga 10 Ga 11 Asal lokasi Kalimantan Tengah Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Sumatera Barat Gorontalo No 12 13 14 15 16 17 18 19 20 21 Kode Ga 12 Ga 13 Ga 14 Ga 15 Ga 16 Ga 17 Ga 18 Ga 19 Ga 20 Ga 21 Asal lokasi Lampung Bengkulu Bogor Mentawai Kaltim LK Kalbar Yanlapa NTB Kalsel MIC Kalteng TL Media yang digunakan untuk menambahkan fungi. dkk) penyebab mekanisme ini adalah mahluk yang melakukan semua aktivitas yang diperlukan untuk kehidupannya. Kalimantan.Teknologi Induksi Pohon . microcarpa 79 . BAHAN DAN METODE A. diambil dari beberapa tanaman gaharu yang terdapat di Jawa. Isolat fungi tersebut diperoleh dari batang Aquilaria spp. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Bogor. NTB dan Sulawesi (Tabel 1).

Inokulasi Pohon contoh adalah A. diinkubasi dengan cara diletakkan pada ruang tertutup yang kelembabannya dijaga dengan cara memasukkan kapas yang telah dibasahi aquadesh steril. Jambi. Untuk fungi pembentuk gaharu asal Gorontalo. mata bor ukuran 3 mm. yang diamati adalah ukuran diameter koloni. yaitu Fusarium spp. dan lain-lain. semua peralatan yang digunakan disterilkan terlebih dahulu dengan alkohol 70% untuk menghindari adanya kontaminasi dari mikrobamikroba lain. Jambi (13) dan Padang (14) serta campuran dari keempat isolat tersebut (15). Alat inokulasi. Sediaan kultur dibuat dengan cara memindahkan potongan kecil isolat fungi menggunakan alat pelubang gabus berdiameter lima mm. microcarpa di Hutan Penelitian Carita. Rancangan acak lengkap dengan perlakuan daerah asal isolat (I). Sebelum penginjeksian. dan Padang (Sumatera Barat). setelah itu koloni yang tumbuh pada gelas obyek diamati di bawah mikroskop setelah preparat diberi zat pewarna. Sediaan kultur diinkubasi selama tujuh hari. Identifikasi juga mengamati ciri makrokonidia. yang diamati adalah bentuk dan miselium. diamati juga warna koloni dan keberadaan aerial miselium. asal Gorontalo (II). Pengeboran dilakukan 80 . Kalbar. isolat diletakkan pada gelas obyek yang kemudian ditutup dengan cover glass preparat.Aspek PRODUKSI umur 13 tahun. baik secara horizontal maupun vertikal. Kalimantan Barat (12). genset. Inokulasi dilakukan pada semua pohon contoh. mikrokonidia serta bentuk konidiofor. Metode Untuk identifikasi masing-masing koloni ditumbuhkan pada media PDA dalam cawan petri. kemudian diinokulasi pada suhu kamar dan diletakkan di ruangan inokulasi selama tujuh hari. Masing-masing isolat diinokulasikan pada 3 ulangan. terdiri dari bor listrik. B. Teknik Inokulasi 1. Untuk pengamatan morfologi dilakukan melalui mikroskop parameter. C.

Teknologi Induksi Pohon .(Erdy Santoso. Pengamatan dan Pengambilan Contoh Gaharu Pengamatan infeksi dilakukan pada umur inokulasi 2 bulan dan 6 bulan dengan mengukur panjang infeksi vertikal dan horizontal yang terjadi pada permukaaan batang A. dkk) dengan kedalaman mencapai 1/3 diameter batang dengan tujuan inokulum cair nantinya mencapai kambium dan bagian floem kayu. yang berasal dari berbagai daerah sangat 81 . A Gambar 1. Inokulum Fusarium spp. 1. HASIL DAN PEMBAHASAN A.. microcarpa. Keragaman Morfologi Isolat Fusarium spp. yang Berasal dari Berbagai Daerah Karakter morfologi aerial miselium. Keragaman Isolat Fusarium spp.. Pengeboran batang pohon contoh (A) dan injeksi isolat pada lubang bor (B) B 2. cair selanjutnya diinjeksikan sebanyak 1 ml untuk setiap lubang bor di batang pohon. Lubang injeksi dibiarkan terbuka untuk memberi kondisi aerasi bagi mikroba yang diinokulasikan... Pengambilan data dilakukan secara acak pada beberapa titik injeksi inokulasi dan nilai panjang infeksi merupakan rata-rata dari panjang titiktitik infeksi tersebut dalam satu pohon. warna koloni dan diameter koloni isolat Fusarium spp.

++ Tidak ada Ada. Keragaman morfologi Fusarium spp. krem No.+++ Ada.+++ Ada.+++ Ada.++ Ada.++ Ada. kuning muda Putih. disebabkan oleh perbedaan asal isolat. kuning. Tabel 2. Keragaman karakter morfologi Fusarium spp.+++ Ada.+++ Ada. kuning muda Putih Putih.+ Ada.++ Ada. coklat muda Coklat muda Putih Putih Putih Putih krem Putih Putih krem.+++ Ada. coklat muda Putih Putih kecoklatan Putih tulang. ++ Cukup banyak.++ Ada. yang berasal dari berbagai daerah Kode isolat Karakter morfologi Asal lokasi Diameter koloni mm/7 hari Kalteng Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Padang Gorontalo Lampung Bangka Bogor Mentawai Kaltim LK Kalbar Yanlapa Mataram Kalsel MIC Kaltel TL 61 49 48 50 45 38 59 49 59 61 58 58 59 61 56 57 59 58 52 50 69 Aerial Miselium Ada.++ Ada. +++ Banyak a. putih Putih.+++ Ada.+ Ada.++ Ada.++ Ada.++ Warna Medium PDA Putih.Aspek PRODUKSI beragam (Tabel 2). Tabel 2. unggu Putih krem Putih.++ Ada. Koloni pada 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 Kelimpahan relatif aerial miselium: + Sedikit.+ Ada. merah muda Putih Putih Coklet. Keberadaan Aerial Miselium 82 . kuning muda Putih.

Ga-6.. memiliki aerial miselium. Namun. dan Ga17 memiliki kelimpahan aerial miselium relatif banyak (Tabel 2). Walaupun sebagian besar isolat Fusarium spp. b. maka perbedaan kelimpahan aerial miselium adalah disebabkan oleh karakter masing-masing isolat. Fusarium solani merupakan spesies yang kosmopolit dengan ciri khas kelimpahan mikrokonidianya elips. yaitu warna hifa miselium didominasi 83 . putih krem (Ga-7. Selain warna putih. Ga-9. cokelat muda (Ga-2). Ditemukan juga isolat yang memiliki warna koloni yang sangat berbeda dengan isolat lain. keragaman morfologi isolat Fusarium spp. Ga-13. Ga-10. 2004). Ga8. dan Ga-19 (Gambar 2. sedangkan isolat Ga-3. Ga-14. dan Ga-16 merupakan isolat dengan kelimpahan aerial miselium sedikit. Isolat Ga-1. Ga-5. Isolat Ga-18. Hasil yang diperoleh menunjukkan bahwa warna koloni putih terdapat pada isolat Ga-4. Ga-19. beberapa isolat memiliki warna putih dan warna kuning muda pada isolat Ga-1.Karakter aerial miselium terdapat hampir pada setiap isolat Fusarium spp. Isolat Ga-10 dan Ga11 memiliki warna koloni putih dan warna cokelat muda (peach). dan Gambar 4). dan Ga-21). Ga-17. namun terdapat perbedaan antar isolat jika dilihat berdasarkan kerlimpahan relatif aerial miseliumnya. Ga-10. Ga-13. Gambar 3. Isolat ga-17 dan Ga-21 memiliki kemiripan warna koloni dengan isolat Fusarium yang berasal dari Riau yang telah teridentifikasi dan merupakan spesies Fusarium solani (Luciasih et al. Isolat yang tidak memiliki aerial miselium dijumpai pada Ga-15 asal Mentawai. Ga-6. Irawati (2004) melaporkan bahwa secara umum cendawan yang ditumbuhkan pada kondisi terang secara terus-menerus akan membentuk aerial miselium relatif lebih banyak. dan Ga-20 memiliki warna koloni putih dan kuning muda. Aerial miselium yang terbentuk dengan kelimpahan relatif banyak merupakan mekanisme fototropi terhadap kehadiran cahaya (Irawati. Ga-11. karena pada penelitian semua isolat yang diuji mendapat perlakuan cahaya yang sama. 2006). Ga-12. Warna Koloni Selain aerial miselium. adalah warna koloni.

Cendawan yang tidak berpigmen umumnya berwarna hialin. Ga-8. dan Gambar 4). Ga-7. Ga-20. Gambar 2. dan Ga-21. Ga-16. Ga-17. Gambar 3. Kecepatan tumbuh yang tinggi dapat berhubungan juga dengan kemampuan virulensi. Ga-3. bentuk. Fusarium spp. Selain itu.Aspek PRODUKSI oleh warna ungu namun memiliki warna koloni putih sedikit tipis pada aerial miselium yang terletak pada bagian tepi koloni (Gambar 3). Keragaman Mikro dan Makrokonidia serta Konidiofor Isolat Fusarium spp. misalnya terhadap inangnya. Pada beberapa isolat Fusarium. dan Ga-21) (Tabel 2. Keragaman yang terdapat pada warna koloni berhubungan dengan pigmen yang dikandung oleh dinding sel hifa. 2. maka isolat perlu diuji. diperoleh adanya hubungan yang erat antara kecepatan tumbuh hifa dengan kehadiran aerial miselium. isolat dengan diameter antara 40-50 mm (isolat Ga-2. Diameter Koloni Diameter koloni Fusarium spp. Ga-5. berkisar antara 30-69 mm. Jumlah septa makrokonidia dominan berjumlah 2-3 yang dimiliki oleh isolat Ga-1. Ga-8. yaitu diameter kurang dari 40 mm (isolat Ga-6). dari ke-10 isolat tersebut terdapat perbedaan pada 84 . Untuk mengetahui kemampuan virulensi. Diameter koloni merupakan veriebel yang berhubungan erat dengan kecepatan tumbuh. dan kelimpahan mikrokonidia. Ga-5. Ga-10. Ga-7. Semua isolat yang diuji dapat diklasifikasikan menjadi tiga kelompok. Ga-19. Ga-13. Ga-18. Keragaman diameter koloni Fusarium spp. Ga-6. Ga-3. percabangan konidiofor. berhubungan dengan kecepatan tumbuh hifa. memiliki keragaman pada karakter morfologi juga tampak adanya keragaman karakter mikrokonidia dan makrokonidia dari isolat yang diuji. c. dan isolat dengan diameter lebih dari 50 mm (isolat Ga-1. Hasil pengamatan menunjukkan bahwa keragaman terlihat pada karakter jumlah septa makrokonidia. kecepatan tumbuh merupakan karakter yang khas pada setiap isolat. Ga-15. dan Ga-20). Ga-18. Namun. Ga-4. Ga10. Ga-14. Ga-9. Ga-11. Ga-12.

(Erdy Santoso. Gambar 2. (isolat Ga-9. dan Ga16) umur tujuh hari pada medium PDA.. Ga-12. Isolat dengan konidiofor bercabang adalah Ga-18 dan Ga-21. Ga-5. GA-7. Ga-7. dkk) percabangan konidifornya. Ga-10.. Keragaman morfologi Fusarium spp. Ga-2. 85 . Ga-14. dan Ga-10 memiliki konidiofor sederhana (Tabel 3). Ga-15. Ga-8. dan Ga-8) umur tujuh hari pada medium PDA Gambar 3. Ga-3. Sedangkan isolat Ga-1. Keragaman morfologi Fusarium spp.Teknologi Induksi Pohon .. Ga-6. (isolat Ga-1. Ga-13. Ga-11. Ga-6.. Ga-3. Ga-5. Ga-4.

oval Elips. oval Elips. Ga-3. oval Elips Isolat Ga-2.Aspek PRODUKSI Gambar 4. sekat Elips. lonjong Elips. Keragaman morfologi Fusarium spp. Keragaman karakter makrokonidia Fusarium spp. Ga-20. dan Ga-21) umur tujuh hari pada medium PDA Tabel 3. dan Ga-15 memiliki jumlah septa empat. yang berasal dari berbagai daerah Karakter histologi No Kode Makrokonidia Jumlah septa 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 3 4 3 4-7 2 3 2 2 5 3 4 5 4 7 4 7 5 3 4 2 3 Konidiofor Simpel Bercabang Simpel Simpel Simpel Simpel Simpel Simpel Simpel Simpel Bercabang Simpel Simpel Simpel Bercabang Simpel Bercabang Bercabang Simpel Bercabang Bercabang Mikrokonidia Kelimpahan Banyak Banyak Banyak Banyak Sedikit Sedikit Sedikit Sedikit Sedikit Banyak Banyak Banyak Sedikit Sedikit Banyak Sedikit Sedikit Banyak Banyak Sedikit Banyak Bentuk Elips Elips. Ga-19. oval Elips Elips. Ga-18. (isolat Ga-17. namun dari ke-3 isolat tersebut dapat dibedakan berdasarkan 86 . sekat 3 Elips Elips Elips Elips. sekat Elips Elips Elips Elips Elips Elips. oval Elips Elips.

sambunicum (isolat Ga-1). sambunicum. Spesies tersebut merupakan F. dkk) percabangan konidifor dan bentuk mikrokonidianya. Mikrokonidia pada berbagai Fusarium memiliki bentuk yang khas. Ga-3. Genus Fusarium memiliki kemiripan dengan Cylindrocarpon pada karakter morfologi. Isolat Ga-13 memiliki bentuk konidifor simpel dan Ga-15 bentuk konidifornya bercabang. Di antara ketiga spesies tersebut F. bentuk mikrokonidianya elips dan oval. solani dengan mikrokonidianya berbentuk elips. yaitu berkisar 5-7 (Tabel 3). Ga-8. antara lain berdasarkan karakter kelimpahan dan bentuk mikrokonidianya. dari 21 isolat Fusarium spp. tricinctum berdasarkan karakter bentuk makrokonidianya. Ga-14. dan Ga-5). solani (isolat Ga-4. dan F. yaitu berbentuk bulan sabit (fusoid) sehingga memungkinkan dapat dengan mudah dibedakan dengan genus lain yang memiliki ciri mirip Fusarium. Isolat Ga-12. juga bentuk mikrokonidianya relatif lebih besar untuk F. solani keberadaannya paling dominan sehingga perlu mendapat perhatian khusus. F. namun Booth (1971) membedakan Cylindrocarpon karena karakter pangkal konidianya yang relatif tumpul dan tidak memiliki hock/foot cell yang jelas seperti pada Fusarium spp. tricinctum (isolat Ga-2. Luciasih et al.(Erdy Santoso. dan Ga9). beberapa isolat telah teridentifikasi sampai pada tingkat spesies. Dua dari tiga isolat tersebut. Sedangkan F. Ga-7.. dan Ga-16 merupakan isolat yang memiliki jumlah septa makrokonidia relatif banyak.. (2006) melaporkan bahwa keragaman antar Fusarium spp. Isolat Ga-14 berbeda dengan isolat Ga-16 karena pada isolat Ga-16 mikrokonidianya bersekat (Gambar 7). yaitu isolat Ga-12 dan Ga-14 memiliki kemiripan pada bentuk konidiofor dan bentuk mikrokonidia. solani dibedakan dari F. Fusarium solani berbeda dengan F.. namun kedua isolat tersebut berbeda pada tipe makrokonidianya.. Ga-6.Teknologi Induksi Pohon . Isolat Ga-2 memiliki konidifor bercabang. Isolat Ga-12 memiliki ukuran relatif lebih besar pada makrokonidianya apabila dibandingkan dengan Ga-14 (Gambar 5 dan Gambar 6). Cowan (1999) menerangkan bahwa tanaman memiliki kemampuan yang tidak terbatas dalam mensintesis substansi 87 ..

Pada umumnya senyawa-senyawa tersebut merupakan metabolit sekunder yang seringkali berperan dalam mekanisme pertahanan tanaman terhadap serangan mikroorganisme. Ga. Ga-9. Ga-15. dan Ga-21) dengan perbesaran 40x Gambar 6. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. dan Ga-18) dengan perbesaran 40x 88 . (isolat Ga-1.2.Aspek PRODUKSI aromatis yang kebanyakan merupakan senyawa fenol atau turunan oksigen-tersubstitusinya. GA-7. Ga-17. (isolat Ga-4. Ga-5. Ga8. Ga-11. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. Ga-14. Gambar 5. serangga ataupun herbivora. GA-10. Ga-20. Ga12.

Ga-6. 2000).. atraktan serangga. sedangkan pada tanaman lain biosintesis sesquiterpenoid 89 . dalam Isnaini. Pohon penghasil gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. memainkan peranan penting (Verpoorte et al.. dan Ga-19) dengan per-besaran 40x Gaharu merupakan senyawa fitoaleksin dari pohon gaharu sebagai mekanisme pertahanannya terhadap infeksi patogen. ekspresi dari jalur biosintesis yang terlibat akan berbeda. Terdapat jalur biosintesis yang terpicu pada level gen setelah pelukaan atau infeksi dan ada yang terjadi pada level senyawa. dkk) Gambar 7.Teknologi Induksi Pohon . Sebagai contoh. Kayu beresin ini merupakan metabolit sekunder yang dibentuk tanaman sebagai respon pertahanan. dan triterpena). Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. di-. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. baik fitoantisipin maupun fitoaleksin. Metabolit sekunder tanaman yang diturunkan dari terpenoid memiliki berbagai fungsi dalam tanaman. Ga-16. Ga-13.(Erdy Santoso. 2004). Metabolit sekunder dalam sistem pertahanan tanaman.. 2004). Vidhyasekaran. biosintesis sesquiterpena tertentu pada solanaceae terpicu oleh infeksi mikroba... Berdasarkan berbagai fungsi tersebut. kadangkala terpicu pengaktifannya saat pelukaan. 2000. Biosintesis keduanya terpicu pada level gen (Verpoorte et al. 2000). di antaranya sebagai minyak esensial (monoterpenoid). (isolat Ga-3. di mana senyawa yang telah ada secara enzimatis dirubah menjadi senyawa aktif ketika pelukaan. fitoaleksin sebagai agen anti mikrobial (sesqui-. Fitoaleksin adalah senyawa aktif anti mikrobial yang diproduksi secara de novo setelah pelukaan atau infeksi. Fitoantisipin adalah senyawa aktif anti mikrobial yang telah terdapat pada tanaman.. rangsangan fisiologi maupun keadaan cekaman (Goodman et al.

rasa. Dalam hal pembentukan gaharu tentunya diharapkan penyakitlah yang akan menang. akar. 2007). Zat ekstratif yang terdiri dari bermacam-macam bahan ini memilki fungsi yang penting dalam daya tahan terhadap serangan jamur dan serangga. Analisis Infeksi Batang Dalam kondisi menghadapi infeksi oleh jamur. 2007). anthraquinone biasa ditemukan di seluruh bagian tanaman (Verpoorte. B. karena analog dengan komponen vital tertentu dari sistem sinyal seluler atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Comission GIFNFC. senyawa pertahanan tipe fitoaleksin. Rowell (1984) menyatakan bahwa di antara fungsi zat ekstratif adalah sebagai bagian dari mekanisme sistem pertahanan pohon terhadap serangan mikroorganisme. Metabolit sekunder pada kayu dapat disebut sebagai zat ekstratif. Kerentanan pohon dalam menghadapi infeksi jamur akan berkaitan dengan 90 . antar spesies. Metabolit sekunder tanaman efektif dalam melawan hama dan agen penyakit.Aspek PRODUKSI merupakan ekspresi pembentukan yang umum. pohon penghasil gaharu akan memberi respon untuk mempertahankan dan memulihkan dirinya. 1987). Jenis-jenis tropis dan sub-tropis umumnya mengandung jumlah ekstratif yang lebih banyak dibanding jenis-jenis di daerah temperet (Forestry Comission GIFNFC. Senyawa kimia yang dimiliki pohon merupakan salah satu upaya pertahanan pohon terhadap mikroorganisme penyebab penyakit. 2000). Zat ekstratif pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. kayu teras. dan warna pada kayu. antar pohon dalam spesies yang sama. sehingga dihasilkan produk gaharu yang diinginkan. memberi bau. misalnya pada Morinda citrifolia. dan jaringan luka). dan antar musim. Daya tahan pohon akan menentukan pemenang antara pohon dengan penyakit yang disebabkan mikro-organisme tersebut. Konsentrasi metabolit sekunder bervariasi antar spesies. antar jaringan (konsentrasi tertinggi berada di kulit. Gaharu sendiri telah diidentifikasi sebagai sesquiterpenoid. pangkal percabangan.

yaitu 4.193a inokulasi 2 bulan. Pada saat (Isolate origin) (Mean value) ini. dapat direfleksikan masing-masing oleh besar infeksi dan komponen kimianya. microcarpa pada umur inokulasi 2 bulan dan 6 bulan.133a terlihat bahwa infeksi tertinggi masih Keterangan: Nilai yang diikuti oleh huruf yang disebabkan oleh isolat asal Gorontalo sama tidak berbeda nya-ta pada 0. isolat asal Gorontalo menyebabkan infeksi yang paling besar pada batang pohon penghasil gaharu. dan yang terendah adalah infeksi yang terbentuk oleh isolat asal Jambi. diikuti oleh isolat campuran (Tabel 4). dkk) gaharu yang terbentuk. Kalbar. 91 . microcarpa. asal Gorontalo memperlihatkan nilai infeksi yang paling besar.297a halnya dengan kondisi pada umur Campuran 3. Dari hasil analisis sidik ragam. Namun sama Padang 2.223a terhadap infeksi yang terbentuk pada Kalimantan Barat batang A..Teknologi Induksi Pohon . Hasil uji lanjut Duncan memastikan bahwa pada dua bulan sejak inokulasi.. terlihat bahwa asal isolat berpengaruh nyata terhadap panjang infeksi yang terjadi pada batang A.05 dan campuran. dari Gambar 8 Gorontalo 4.(Erdy Santoso. secara statistik asal isolat tidak 1.857a lagi memberikan pengaruh nyata Jambi 2.13 cm diikuti oleh isolat campuran. microcarpa. Padang. Pada umur inokulasi 2 bulan isolat Fusarium spp. Uji lanjut Duncan untuk infeksi 2 bulan umur 2 bulan. isolat campuran menyebabkan infeksi yang lebih tinggi dibandingkan Asal isolat Rataan isolat yang lain (Gambar 8). Pada Gambar 8 terlihat panjang infeksi yang terjadi pada batang pohon A.. Berbeda dengan kondisi pada Tabel 4. pada umur inokulasi 6 umur inokulasi bulan..

Meskipun masih dua merupakan isolat yang menyebabkan infeksi terbesar.bentuk pada batang A. microcarpa 92 . microcarpa Gambar 8. Panjang infeksi batang A. Laju infeksi pada batang A.05 crocarpa. sedangkan infeksi oleh keempat asal isolat yang 71 | lain menunjukkan peningkatan yang beragam. asal daerah isolat tidak memberikan pengaruh nyata pada laju infeksi yang terjadi (nilai signifikansi 0. Namun begitu. dari Gambar 8 Aspek PRODUKSI terlihat bahwa infeksi tertinggi masih disebabkan oleh isolat asal Gorontalo dan campuran. Meskipun terjadi 9 menunjukkan perubahan panjang infeksi yang terjadi sejak masihbulan inokulasi hingga bulan keenam. Gorontalo terlihat tidak mengalami bulan keenam oleh isolat asal sedangkan infeksi oleh keempat asal perkembangan. Gambar 9 menunjukkan perubahan panjang infeksi yang Gambar 9. mita pada 0.186 pada 5%). huruf yang sama tidak berbeda nya- Gambar 8. Namun sama halnya dengan kondisi pada umur inokulasi 2 bulan. tetapi infeksi bulan keenam oleh isolat asal Gorontalo terlihat infeksi merupakan isolat yang menyebabkan infeksi terbesar. tetapitidak mengalami perkembangan. Panjang infeksi batang A. microcarpa Gambar sejak dua bulan inokulasi hingga bulan keenam. secara statistik untuk bulan keenam inokulasi.

Teknologi Induksi Pohon . Ga-11. Isolat Fusarium spp. KESIMPULAN 1.. jadi sebaiknya isolat ini digunakan untuk inokulasi 93 . asal Gorontalo menyebabkan infeksi yang paling besar. Secara histologi isolat Fusarium spp. pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masing sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. kekonsistenan perkembangan infeksi sebaiknya diteliti lebih lanjut dengan mengikuti perkembangan laju infeksi oleh isolat asal Gorontalo ini hingga kurun waktu tertentu. Secara morfologi isolat Fusarium spp. 2.. meskipun yang terbesar masih disebabkan oleh isolat campuran dan isolat asal Gorontalo. Uji perbedaan kecepatan tumbuh menunjukkan bahwa isolat Ga9. yang berarti isolat ini menghasilkan kuantitas gaharu yang paling besar. Hasil inokulasi Fusarium spp. dan ungu. Hal ini diduga ada kaitannya dengan pertahanan masing-masing pohon contoh. 4. Meskipun tetap menyebabkan infeksi yang besar. kuning.(Erdy Santoso. dan Ga-17 merupakan isolat yang memiliki kecepatan tumbuh tinggi apabila dibandingkan dengan isolat Fusarium yang lain. 3. Meskipun isolat campuran menunjukkan panjang infeksi yang lebih tinggi saat 6 bulan setelah inokulasi. namun ada kemungkinan hal ini masih merupakan pengaruh dari isolat asal Gorontalo tersebut. dkk) Perkembangan infeksi yang terjadi hingga 6 bulan setelah inokulasi menunjukkan asal daerah isolat tidak lagi memberikan pengaruh yang nyata.. Hampir semua isolat memiliki aerial miselium. namun terdapat warna koloni merah muda. memiliki karakter makrokonidia bersepta 3-4 dan makrokonidia didominasi oleh bentuk elips.. Dari perkembangan infeksi pada pohon A. didominasi warna putih. microcarpa ini dapat dikatakan bahwa isolat asal Gorontalo menyebabkan infeksi yang terbesar.

Nooranie. Heart of The Matter Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. TRAFFIC Network. Tesis. 2004. 2006. 2007. Chemicals from Trees. Barden. 267-269. M. (1987). Y. Seed Leaflet : Aquilaria malaccensis Lamk. Isnaini. pp. Teresia. (1971). Program Pascasarjana Institut Pertanian Bogor. Rm.12 (4) : 564-582. Applied Microbiology 32 : 278-281. pp. A. Jakarta. W. 120-127. Disertasi). M. Hua SST. The Genus Cylondrocarpon. Berlin : SpringerVerlag. dan E.uk/review/extraction. [2 Februari 2007]. and S.SL. 2004.Aspek PRODUKSI pada A. E. Heartwood and Tree Exudates. DAFTAR PUSTAKA Adelina. Induksi Produksi Gubal Gaharu Melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik.kvl. Irawati. Booth. pp. 2001. 2004. The Chemistry of Solid Wood. Jurnal Penelitian Hutan dan Konservasi Alam III(5):555-564. microcarpa jika diinginkan hasil gaharu dalam jumlah besar. 2. Jilid III. 94 .dk. Badan Litbang Kehutanan. Karakterisasi Mikoriza Rhizocstonia dari Perakaran Tanaman Vanili Sehat. N. D. Washington : American Chemical Society. Cowan. (England : Commonwealth Mycological Institute). Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. [14 Juli 2007]. Forestry Commission GIFNFC. A. Michael (2000). pp. Plant Products as Antimicrobial Agents. A.. 6-7. http: // treechemicals. csl. Santoso. Clinical microbiology Review. 1984. Forest and Landscape Denmark. Hills. Heyne. Bogor Luciasih..A. C. gov. 1987. www. Magelang. Keanekaragaman Jenis Jamur yang Potensial dalam Pembentukan Gaharu dari Batang Aquilaria spp. Pusat Litbang Hutan dan Konservasi Alam. Tumbuhan Berguna Indonesia. Bogor. K. Rowell.cfm. Wahyuno. 1999.

. 95 . W. 2007. Analgesik and AntiImflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. 2000. Bhutada. 2000. Nandakumar. Verpoorte. Boston. dkk) Soehartono. 2001. In : Verpoorte. Verpoorte. Kluwer Academic Publisher. Miniyar. Aisuli 14. In Verpoorte.. Florida. CRC Press Inc. P. S. Pharmacology-online 1 : 288-298. Metabolic Engineering of Plant Secondary Metabolism. 2000. J. and Alfermann. Memelink. Dordrecht.. Gore. Jakarta. P. C. Balai Penelitian Kehutanan Kupang. K. Kain. Physiology of Disease Resistant in Plant. Widnyana. p : 31-50. A. R. A. 2002. Somani. Trupti. Laju Pertumbuhan Tegakan Gaharu (Aquilaria malaccensis) di Riau yang Ditanam dengan Intensitas Budidaya Tinggi dan Manual. Boca Raton. Teknik Budidaya Gaharu. London. A.(Erdy Santoso. and Alfermann. R. I K.. Metabolic Engineering of Plant Secondary Metabolism. (Editors). Mardiastuti.. Mundhada. Sumadiwangsa. I M. CITES and Implementation in Indonesia. R van der Heijden. S. Nagao Natural Environment Foundation. Y. P. K. General Strategies.Teknologi Induksi Pohon .. Bogor. Dordrecht.. Surata. Info Hasil Hutan 6 (1) : 1-16. 2000. R. W. Plant Secondary Metabolism. Vidhyasekaran. dan Harbagung. (Editors). p : 1-30. E. London. R.. T. Pusat Penelitian Hasil Hutan. Kluwer Academic Publisher. R. Boston.

96 .

malaccensis mampu menginduksi gejala pembentukan gubal pada pohon gaharu (A. Rahayu et al. bulbigenium. filaria) dan A. crassna. microcarpa) umur 97 . lateritium telah berhasil diisolasi oleh Santoso (1996). FMIPA. Magnoliopsida. Menurut Nobuchi dan Siripatanadilok (1991). oxyporum. F. Thymelaeaceae). Beberapa spesies Fusarium seperti F. Institut Pertanian Bogor LATAR BALAKANG Gaharu merupakan salah satu komoditi hasil hutan bukan kayu (HHBK) yang dihasilkan oleh beberapa spesies pohon gaharu (Aquilaria sp. asal gubal gaharu pada Gyrinops verstegii (sin. DAN Fusarium sp. Institut Pertanian Bogor Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Esti Wulandari Departemen Biologi. A. malaccensis.. Proses pembentukan gubal pada pohon gaharu. hingga saat ini masih terus diteliti. FMIPA. (1999) menyatakan bahwa beberapa isolat Acremonium sp.4 EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp. dan F. Selain itu. A. A. DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu Departemen Biologi. gubal gaharu diduga dapat terbentuk melalui infeksi cendawan.

(1995) juga menemukan proses SAR dari infeksi Pseudomonas lachrymans pada timun terhadap F. microcarpa umur 13 tahun di Hutan Penelitian Carita. terhadap Fusarium sp. dalam pembentukan gubal pada pohon gaharu (A. 1962). Caruso dan Kuc (1977) menyatakan bahwa infeksi F. larutan gula 2%. Acremonium sp. merangsang perubahan warna kayu dan pembentukan senyawa terpenoid. dan Fusarium sp. Oleh sebab itu penelitian ini bertujuan untuk mengetahui efektivitas dan interaksi antara Acremonium sp. biakan Acremonium sp. seringkali diperoleh dari satu gejala gubal. Pada gubal gaharu. melalui pemanfaatan kedua cendawan tersebut sebagai penginduksi ganda memerlukan informasi awal mengenai kemungkinan terbentuknya SAR yang dibangkitkan oleh Fusarium sp. Infeksi ganda Fusarium sp. Banten. (1997). dan sebaliknya.525 (koleksi IPBCC. cucumerinum dapat membangkitkan SAR tanaman semangka terhadap infeksi Colletotrichum lagenarium. infeksi cendawan yang pertama dapat membangkitkan resistensi yang disebut Systemic Acquired Resistance (SAR) terhadap infeksi cendawan kedua. Liu et al. oxysporum. perubahan warna kayu dan adanya senyawa terpenoid dijadikan indikator efektivitas dan interaksi antara inokulan dalam pembentukan gubal. Padahal menurut Sticher et al. terdeteksi senyawa oleoresin (Prema dan Bhattacharyya. IPBCC 07. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam). 98 . dan Acremonium sp.sp. Mekanisme infeksi kedua cendawan ini pada satu lokasi infeksi belum dipelajari. Rahayu et al. microcarpa).Aspek PRODUKSI 2 tahun. hasil induksi cendawan. Departemen Biologi FMIPA IPB). dan Fusarium sp. Padang (koleksi Laboratorium Mikrobiologi Hutan. Oleh sebab itu. terhadap Acremonium sp. Bahan Bahan dan alat yang digunakan adalah pohon A. Sebagai contoh. BAHAN DAN METODE A. oxysporum f. yang berasal dari Aquilaria sp. pada beberapa kasus infeksi cendawan pada tumbuhan. (2007) dan Rahayu (2008) juga menyatakan bahwa Acremonium sp.

serta batang dengan perlakuan tunggal (diberi Acremonium sp. 2. Batang yang tidak diberi perlakuan (K). dan diinkubasi selama 3 minggu menggunakan inkubator bergoyang. Pasangan inokulan (FA atau AF) adalah set perlakuan. saja (AA) atau Fusarium sp. Efektivitas dan interaksi diukur melalui perkembangan pembentukan gejala gubal di sekitar daerah induksi.5-1 m di atas permukaan tanah) dengan mata bor berdiameter 4 mm. meteran. yang dilubangi saja (B). Ke dalam lubang pada deretan kedua ini dimasukkan inokulan 2. Seminggu kemudian. batang yang dilubangi dan diberi larutan gula (G). mata bor berukuran 4 mm. B. Fusarium sp. Ke dalam deretan lubang ini dimasukkan inokulan 1 sampai lubang dipenuhi oleh inokulan. bahan pelet. dengan kedalaman lubang maksimal 1/3 diameter batang. Untuk inokulan berupa pelet. bor. dan Fusarium sp. Uji Efektivitas dan Interaksi Acremonium sp. Metode 1. Pertama-tama. Pengamatan dilakukan setiap 1 bulan selama 4 bulan. Batang di sekitar lubang dikupas kulitnya. Jarak antar lubang dalam deretan sekitar 5 cm. Biakan ini akan digunakan sebagai sumber inokulum untuk pembuatan inokulan. ditumbuhkan pada 300 ml media cair. saja (FF)) digunakan sebagai pembanding. dan Fusarium sp. Perubahan warna batang dan pembentukan wangi merupakan indikator pembentukan gubal. Acremonium sp. kemudian dibentuk berupa pelet dengan ukuran 4 mm x 40 mm. Jarak antar set perlakuan dalam 1 pohon ± 30 cm. ditumbuhkan pada media serbuk gergaji selama 2 minggu. kemudian zona perubahan warna batang diukur secara horizontal 99 . pohon dilubangi lagi pada jarak 15 cm secara vertikal dari deretan lubang yang pertama. lubang diberi larutan gula 2% sebelum pemberian inokulan.alkohol. aquades. diremajakan pada media agaragar kentang dekstrosa (Difco) dan diinkubasi pada suhu ruang selama 7 hari. dan alat pencetaknya. Pembuatan Inokulan Acremonium sp. sederetan lubang dibuat di sekeliling batang utama (mulai ketinggian 0.

Deteksi Senyawa Terpenoid Senyawa terpenoid dideteksi dengan metode LiebermanBurchard (Harborne. Bila terdapat pengaruh nyata dari perlakuan yang diamati maka setiap taraf perlakuan 100 . Tingkat perubahan warna kayu ditetapkan berdasarkan sistem skor (0 = putih. sampelsampel dari kayu yang mengalami perubahan warna dipisahkan dari bagian yang sehat.Aspek PRODUKSI dan vertikal. tingkat perubahan warna. 1987). 4. Setelah diamati tingkat wanginya. Perubahan warna diamati pada 10 titik untuk setiap pohon. 3 = coklat kehitaman). Daerah yang menunjukkan perubahan warna kayu dari putih menjadi coklat-kehitaman diambil dengan dipahat dan dibawa ke laboratorium untuk pengamatan selanjutnya. 3. kemudian diamati wanginya secara organoleptik ketika kayu dibakar. dihomogenisasi lalu dipindahkan ke tabung reaksi steril. Wangi dinyatakan dalam tingkat wangi dan persentase titik induksi dengan kategori agak wangi dan sangat wangi. 2 = coklat. Analisis Data Data hasil pengamatan (panjang. Tingkat perubahan warna kayu dinyatakan dalam rataan dari hasil pengamatan 3 responden. ditambahkan 3 tetes asam asetat anhidrat dan 1 tetes H2SO4 pekat. Sebanyak 0. lebar zona perubahan warna. 1 = agak wangi.1 menggunakan Rancangan Acak Lengkap (RAL) satu faktor dengan waktu dan uji F pada α = 5%. Kayu di sekitar titik inokulasi dipahat. Tingkat wangi dinyatakan dalam rataan skor dari 3 responden. Wangi ditetapkan berdasarkan sistem skor (0 = tidak wangi. 1987). 2 = wangi). kemudian absorbansinya diukur dengan spektrofotometer pada λ 268 nm. Perubahan warna menjadi merah atau ungu menunjukkan adanya senyawa triterpenoid (Harbone. kemudian disaring pada cawan petri steril dan diuapkan sampai kering (sampai terbentuk endapan berwarna kuning).4 g kayu yang berubah warna direndam dalam 5 ml etanol absolut panas. Sebanyak 5 ml etanol absolut ditambahkan ke dalam larutan. 1 = putih kecoklatan. Pada endapan ditambahkan 1 ml dietil eter pekat. dan tingkat wangi) dianalisis dengan SAS versi 9.

39 0.20a 3...45c 1.30a Lebar (cm) 0. Gejala pembentukan gubal akibat inokulan ganda juga cenderung tidak berbeda nyata dari inokulan tunggalnya. AF justru lebih baik. inokulan ganda lebih efektif. Berdasarkan persentase titik induksi pada kategori wangi.55 20. HASIL A.59ab 101 .07 39.63ab 0. Pembentukan gejala gubal gaharu hasil inokulasi cendawan tunggal dan ganda Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Inokulan tunggal Inokulan ganda AA FF AF FA 2.12 Titik induksi wangi (%) 1. dkk.94a 0. Sebagai inokulan tunggal A dan F memiliki efektivitas yang relatif sama.24 4.14a 3.87a 0. Sedangkan pada parameter lainnya.82a 0. Efektivitas inokulan tunggal maupun ganda Acremonium dan Fusarium relatif lebih tinggi dalam merangsang pembentukan gejala gubal gaharu dibandingkan dengan metode induksi lainnya.54ab 3.62ab 0..00 6.83a Warna (skor) 1. Di antara inokulan ganda. AF lebih efektif dalam menginduksi pembentukan wangi daripada FA dan inokulan tunggal.Efektivitas dan Interaksi .(Gayu Rahayu.90b 1..75b 2. Pemberian gula menyebabkan gejala pembentukan gubal gaharu menjadi tertekan.37 31. Tabel 1.18a Wangi (skor) Titik induksi agak wangi (%) 34. Efektivitas Inokulan dalam Menginduksi Gejala Pembentukan Gubal Gaharu Secara umum semua perlakuan menyebabkan perubahan warna kayu dan merangsang munculnya perubahan aroma kayu (Tabel 1).16 0.70a 0.) dibandingkan dengan menggunakan uji lanjut Duncan pada taraf 5%.

Aspek PRODUKSI

Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Kontrol positif Kontrol negatif
*

Lebar (cm) 0,55b 0,73ab 0,00c

Warna (skor) 1,02d 1,16d 0,00e

Wangi (skor)

Titik induksi agak wangi (%) 10,41 11,11 0,00

Titik induksi wangi (%) 0,00 0,00 0,00

G B K

1,86b 2,87ab 0,00c

0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Kayu mengalami perubahan warna dari putih menjadi coklat atau coklat kehitaman (Gambar 1). Pemberian inokulan tidak berpengaruh pada panjang dan lebar zona perubahan warna. Namun panjang zona perubahan warna tertinggi terjadi berturut-turut pada kayu yang diberi perlakuan ganda FA dan AF. Sedangkan tingkat perubahan warna dipengaruhi oleh inokulan. Tingkat perubahan warna tertinggi pada FA dan berbeda nyata dari perlakuan lainnya.

Pemberian inokulan juga tidak berpengaruh nyata terhadap pembentukan wangi. Berbeda dengan perubahan warna kayu, tingkat wangi tertinggi terjadi pada kayu yang diberi inokulan ganda AF. Secara rataan nilai tingkat wangi yang terbentuk dari hasil perlakuan inokulan termasuk dalam kategori tidak wangi, Meskipun demikian, pemberian inokulan meningkatkan persentase titik induksi yang wangi. Bahkan inokulan tunggal AA dan inokulan ganda menghasilkan titik induksi pada kategori wangi (Tabel 1).

a

b

c

d

Gambar 1. Perubahan warna kayu dengan tingkat kegelapan yang berbeda dari (a) intensitas terendah sampai (d) intensitas tertinggi

102

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Periode induksi berpengaruh pada semua parameter pembentukan gubal kecuali panjang zona perubahan warna (Tabel 2). Secara umum, nilai parameter pembentukan gubal tertinggi terjadi pada bulan ke-2, kecuali tingkat perubahan warna. Pada bulan ke-2 induksi, intensitas warna cenderung naik, tapi intensitas warna kayu pada bulan ke-4 relatif sama dengan bulan ke-3.
Tabel 2. Pengaruh periode induksi pada gejala pembentukan gubal gaharu
Rataan* Perubahan warna kayu Bulan Panjang (cm) 1 2 3 4
*

Lebar (cm) 0,68a 0,71a 0,65b 0,65b

Tingkat (skor) 0,83c 1,24b 1,67a 1,65a

Wangi (skor)

Titik induksi agak wangi (%) 8,43 39,47 17,45 18,45

Titik induksi wangi (%) 0,00 0,00 0,00 6,74

2,46ab 2,58a 2,32ab 2,26b

0,32c 0,64a 0,51b 0,36c

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

B. Interaksi Inokulan 1 dan Inokulan 2
Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2 (Tabel 3). Inokulasi F sebelum inokulasi A tidak mempengaruhi pembentukan gejala gubal pada titik A termasuk pembentukan wangi. Kehadiran F justru cenderung meningkatkan respon perubahan warna kayu akibat inokulasi A. Demikian pula inokulasi A sebelum F tidak mempengaruhi pembentukan gejala gubal pada titik F, kecuali warna pada F menjadi lebih gelap dan persentase titik induksi yang wangi relatif lebih tinggi dibandingkan dengan inokulan tunggalnya. Inokulan ganda AF dan FA menghasilkan masing-masing 8,33% titik induksi pada kategori wangi. Infeksi sekunder juga tidak secara konsisten mempengaruhi infeksi primer (Tabel 4). Inokulasi F sebelum inokulasi A cenderung tidak mempengaruhi pembentukan gejala gubal termasuk tingkat

103

Aspek PRODUKSI

wangi, kecuali pada perubahan warna kayu. Intensitas warna pada titik induksi F lebih baik dibandingkan dengan perlakuan tunggalnya. Infeksi kedua oleh F juga cenderung tidak mempengaruhi gejala pembentukan gubal dan tingkat wangi. Infeksi sekunder oleh cendawan yang sama dengan cendawan tidak berpengaruh pada pembentukan gejala gubal (Tabel 5). Meskipun demikian, secara umum nilai parameter gejala gubal pada titik infeksi sekunder lebih rendah daripada pada titik infeksi primernya. Inokulan A dan F memiliki potensi yang relatif sama dalam merangsang pembentukan wangi.
Tabel 3. Pengaruh inokulan 1 terhadap inokulan 2 dalam gejala pembentukan gubal gaharu
Rataan* Perla-kuan Perubahan warna kayu Panjang (cm) FAa AAa AFf FFf GGg BBb KKk
*

Lebar (cm) 0,71bcd 0,66bcd 0,83abcd 0,75abcd 0,53d 0,65cd 0,00e

Warna (skor) 2,15ab 1,82bc 1,57cd 1,36de 1,02e 1,13e 0,00f

Wangi (skor) 0,60ab 0,63ab 0,70a 0,62ab 0,38c 0,47bc 0,00d

Titik induksi agak wangi (%) 26,37 36,11 40,27 27,78 0,00 0,00 0,00

Titik induksi wangi (%) 8,33 0,00 8,33 0,00 0,00 0,00 0,00

2,73abc 1,96bc 2,52abc 2,61abc 1,75c 2,40abc 0,00e

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 4. Pengaruh infeksi sekunder dengan cendawan yang berbeda dari cendawan penginfeksi primer
Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,68ab 3,87a Lebar (cm) 0,99ab 0,95abc Warna (skor) 1,53cd 2,22a Wangi (skor) Titik induksi agak wangi (%) 34,37 13,89 Titik induksi wangi (%) 0,00 0,00

FFF FAF

0,62ab 0,50bc

104

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,13abc 3,88a 1,98bc 3,35abc 0,00d Lebar (cm) 0,96abc 1,06a 0,56d 0,80abcd 0,00e Warna (skor) 1,98ab 1,93ab 1,01e 1,20de 0,00f Wangi (skor) Titik induksi agak wangi (%) 32,63 38,86 20,83 13,89 0,00 Titik induksi wangi (%) 2,78 4,15 0,00 0,00 0,00

AAA AFA GGG BBB KKK
*

0,63ab 0,70a 0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 5. Pengaruh infeksi sekunder cendawan yang sama dengan cendawan penginfeksi primernya
Rataan* Perlakuan Panjang (cm) 3,13abc 1,96bc 3,68ab 2,61abc Lebar (cm) 0,96abc 0,66bcd 0,99ab 0,75abcd Warna (skor) 1,98ab 1,82bc 1,53cd 1,36de Wangi (skor) 0,63ab 0,63ab 0,62ab 0,61ab Titik induksi agak wangi (%) 32,63 36,11 34,37 27,78 Titik induksi wangi (%) 2,78 0,00 0,00 0,00

AAA AAa FFF FFf
*

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

C. Pembentukan Senyawa Terpenoid
Senyawa terpenoid terdeteksi pada semua perlakuan. Pada perlakuan tunggal FF dan gandanya terbentuk warna merah, yang menunjukkan adanya senyawa triterpenoid. Warna merah pada minyak gaharu dijadikan sebagai pembanding kandungan triterpenoid perlakuan. Pada ekstrak kayu B, G, dan inokulan A terbentuk warna hijau. Warna hijau ini menunjukkan adanya senyawa sterol (Harborne, 1987). Sedangkan pada K tidak terbentuk

105

27* 0.12* 0. Begitu pula dengan nilai absorban inokulan 1 yang tidak dipengaruhi oleh inokulan 2.813) sebagai pembandingnya. ** Endapan berwarna merah-kecoklatan 106 . Secara umum.34* 0.Aspek PRODUKSI warna (bening).06* 0.15* 0. Nilai absorbasi ekstrak kayu gaharu yang berubah warna Perlakuan K G B AF A AF F FA F FA A AA FF Bulan ke1 0 0. Hal ini menunjukkan kandungan triterpenoid yang relatif tinggi pula (Tabel 6).29* 0. Hal ini menunjukkan bahwa inokulan ganda tidak efektif dalam meningkatkan kandungan senyawa terpenoid.12** 0.15* * Endapan berwarna hijau.25* 0. Inokulan AF maupun FA juga tidak mempengaruhi kandungan terpenoid. Selain itu.20** 0.20** 0.06* 3 0 0. Hal ini menunjukkan bahwa pada K tidak terdapat senyawa triterpenoid maupun sterol.23** 0.45* 0.11* 0.20* 0. Pada 3 bsi.23** 0.06* 0.39* 0. secara umum nilai absorban perlakuan inokulan ganda hampir sama dengan inokulan tunggal (Tabel 6). Hal ini menunjukkan bahwa pemberian inokulan 2 tidak mempengaruhi besarnya nilai absorban inokulan 1.40* 0.12** 0.05* 0. Kandungan senyawa triterpenoid pada zona perubahan warna bervariasi pada setiap perlakuan selama 4 bsi (Tabel 6).25** 4 0 0.23* 0.19** 0. nilai absorbansi ekstrak terpenoid hasil perlakuan kurang dari nilai absorbansi minyak gaharu (0.12** 0. perlakuan tunggal FF terbentuk endapan merah dan memiliki nilai absorbansi yang relatif tinggi.24* 0.11** 0. Tabel 6.14* 0.21* 0.14** 2 0 0.22* 0.

. Perubahan warna kayu terjadi pada semua perlakuan. dan Fusarium sp. karena daun merupakan tempat utama berlangsungnya fotosintesis.Efektivitas dan Interaksi . Berkurangnya jumlah daun secara drastis dapat menghambat proses fotosintesis. dan Fusarium sp. tetapi klorosis hampir memenuhi luasan helai daun.. di New Zealand. inokulasi Acremonium sp. Secara umum inokulan tunggal mengakibatkan klorosis pada daun-daun di dua cabang dekat lubang induksi. menyebabkan perubahan warna kayu dari putih menjadi gelap. (1997) juga menyatakan bahwa perubahan warna kayu menjadi warna coklat (browning) dapat disebabkan oleh serangan patogen (cendawan) 107 . Selain itu. karena kemungkinan sumber karbon lebih diutamakan untuk pembentukan tunas baru. Pada 2 bsi. Ketersediaan hara terganggu karena jalur distribusinya ke daun terhambat akibat pengeboran. Walker et al.) PEMBAHASAN A. adanya inokulan juga menjadi penyebab klorosis. pada pohon kontrol daun-daun tidak mengalami klorosis sampai akhir pengamatan. larutan gula. Pelukaan. Klorosis mungkin berhubungan dengan ketersediaan hara. Caruso and Kuc (1977) menyatakan bahwa Colletotrichum lagenarium menyebabkan klorosis pada daun tanaman semangka dan muskmelon. Efektivitas Induksi Pohon-pohon yang diberi perlakuan menurun kebugarannya mulai 1 bsi. Berbeda dengan daun-daun pada pohon perlakuan. Sedangkan pada pohon yang diberi inokulan ganda klorosis terjadi pada tiga cabang dekat lubang induksi.(Gayu Rahayu. berasosiasi dengan gejala perubahan warna kayu dan dicline pada Quercus sp. Pohon semakin merana ketika diserang ulat. perkembangan gejala pembentukan gubal pun terganggu. Menurut Braithwaite (2007) Acremonium sp.. Fotosintat sebagai sumber karbon dalam pembentukan metabolit sekunder antimikrob pun terganggu. jumlah daun yang mengalami klorosis tidak berbeda dengan 1 bsi. Sebelumnya. dkk.. Tajuk-tajuk pohon menjadi gundul. Penurunan kebugaran ditunjukkan oleh adanya daundaun yang mengalami klorosis pada cabang pertama dan kedua dari daerah lubang induksi dan kemudian daun-daun ini gugur. Pada akhirnya.

Periode inkubasi cenderung mempengaruhi semua parameter gejala gubal gaharu. 2007). perubahan warna kayu menjadi coklat muncul setelah sel-sel kehilangan pati akibat pelukaan. Hal ini disebabkan karena gula tersebut segera dipergunakan pohon untuk proses penyembuhan daripada dimanfaatkan oleh cendawan. Perubahan warna kayu pada gaharu mungkin dapat mengindikasi adanya senyawa gaharu. Sedangkan pada parameter lainnya. Namun. Namun demikian metabolisme isopentenil pirofosfat sebagai pekursor pembentukan terpenoid (McGarvey and Croteau. Senyawa wangi merupakan senyawa yang mudah menguap sehingga kemungkinan besar tergolong senyawa seskuiterpenoid.. Hal ini menunjukkan bahwa metabolisme terpenoid dapat berlangsung terus dan berakhir pada produk selain seskuiterpenoid ketika dipanen. Menurut Nobuchi and Siripatanadilok (1991). bahwa perubahan warna dari putih menjadi coklat-kehitaman merupakan gejala awal terbentuknya senyawa gaharu. Semakin lama periode induksi semakin gelap warna kayu.. Kemungkinan besar fenomena ini berhubungan dengan kebugaran pohon yang menurun mulai bulan ke-2. Aroma wangi mulai terdeteksi pada bulan ke-2 dan menurun pada bulan berikutnya.Aspek PRODUKSI dan kerusakan fisik. Pemberian larutan gula (G) menekan perkembangan gejala pembentukan gubal gaharu. Aroma wangi dan frekuensi wangi pada pemberian inokulan ganda AF relatif lebih tinggi dibandingkan dengan perlakuan lainnya. Pada penelitian ini senyawa triterpenoid dan sterol juga terdeteksi. nilai tertinggi diperoleh pada bulan ke-2 induksi. Aroma wangi merupakan bagian dari senyawa gaharu (Rahayu et al. inokulan ganda lebih baik dari inokulan tunggal maupun cara induksi lainnya. Berdasarkan persentase titik induksi yang wangi. intensitas warna kayu lebih rendah dibandingkan 108 . Hal ini didukung oleh pernyataan Rahayu dan Situmorang (2006). Hal ini membuktikan bahwa wangi merupakan respon spesifik terhadap bentuk gangguan (Rahayu et al. 1995) mungkin tidak berhenti pada produk seskuiterpenoid tetapi dapat masuk dalam jalur metabolisme selanjutnya. 2007).

B. Kemungkinan besar hal ini disebabkan aktivitas patologis yang berbeda. Selain itu penelitian sebelumnya.. (1999) yang membuktikan bahwa inokulasi Heterobasidion annosum yang diikuti oleh Ceratocystis polonica menekan pembentukan gejala bluestain pada pohon Norway spruce (Picea abies)...(Gayu Rahayu.. polonica. Acremonium dan Fusarium dikenal sebagai penyebab busuk batang atau kanker batang pada pohon berkayu. Pada penelitian ini triterpenoid mulai terdeteksi pada 1 bsi. annosum. Triterpenoid terdeteksi pada pemberian inokulan tunggal FF dan inokulan ganda yang ditunjukkan dengan terbentuknya endapan berwarna merah pada pengujian Lieberman-Burchard. Krokene et al. crassna terbukti dapat merangsang pembentukan senyawa terpenoid. polonica adalah penyebab bluestain saja dan tidak menyebabkan busuk batang. Heterobasidion mungkin merangsang pohon membentuk senyawa fitoaleksin yang bersifat anti C.Efektivitas dan Interaksi . Putri (2007) juga menyatakan bahwa pemberian Acremonium sp.) dengan pemberian inokulan ganda FA. Hal ini menunjukkan bahwa aroma wangi yang dihasilkan tidak selalu sebanding dengan intensitas warna kayu. G. Sesuai dengan pernyataan Rahayu et al. Pembentukan Senyawa Gaharu Acremonium sp. (1999) bahwa terjadinya pembentukan wangi gaharu tidak selalu diikuti oleh perubahan warna kayu. dkk. Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2. Paine et al. Hal ini berbeda dari hasil penelitian Krokene et al. 109 . Heterobasidion juga menyebabkan busuk batang tetapi C. Kemungkinan lain adalah periode inokulasi antara inokulan 1 dan inokulan 2 yang hanya berselang 1 minggu. pada A. (1997) menyatakan bahwa serangan cendawan pada pohon Pinus akan merangsang pohon untuk membentuk senyawa terpenoid sebagai pertahanan pohon. abies) terhadap C. dan Fusarium sp. Sedangkan pada perlakuan B. (1999) menyatakan bahwa pada Norway spruce (P. polonica terbentuk SAR setelah 3 minggu infeksi H. dan inokulan tunggal AA terbentuk warna hijau. dalam bentuk inokulan tunggal atau inokulan ganda dapat merangsang pohon gaharu membentuk senyawa terpenoid.

Dick.E.L. Plant Physiol. Pay and C. Institut Teknologi Bandung.A. 110 . V. T. Beever. M. Padmawinata K dan I Sudiro (penerjemah).W. Kuc.R. Inglis. kecuali inokulan tunggal A merangsang pohon membentuk triterpenoid. Phytopathol. J. L. Amer.B. J.M. 2007. 67: 1285-1289.Aspek PRODUKSI Warna hijau ini mengindikasikan yang terbentuk adalah senyawa sterol. M.. N. Quéré. Harborne (1987) menyatakan bahwa sterol merupakan salah satu senyawa yang tergolong ke dalam senyawa terpenoid.. Gagné. 121: 565-569. New Zealand Plant Protection 60:297-303 Caruso. F. BacterialMediated Induced Resistance in Cucumber: Beneficial Effect of the Endophytic Bacterium Serratia plymuthica on the Protection Against Infection by Pythium ultimum. A.. Solheim. Hill. N. Induced Resistance to Phatogenic Fungi in Norway Spruce. E. Dehbi. Waipara. 1999. J. Krokene.F. Ramsfield. Phytopathol. P. H. Bandung Terjemahan dari: Phytochem Methods. SIMPULAN Semua pohon yag diinokulasi menurun kebugarannya sejak 1 bulan setelah inokulasi. Induksi dengan inokulan 1 yang hanya berselang 1 minggu dari pemberian inokulan 2 tidak membangkitkan resistensi pohon terhadap inokulan 2. 90(1): 45-56. Semua inokulan. R. Investigation of Oak Tree Decline In Theauckland Region. DAFTAR PUSTAKA Benhamou. 1987. 2000. D.L.. S. Inokulan ganda terutama AF lebih efektif daripada inokulan tunggal dalam merangsang pembentukan wangi. Harbone. Braithwaite.D. Metode Fitokimia. 1977. Soc. Berryman. C.A. Franceschi. Christiansen. Protection of Watermelon and Muskmelon Against Colletotrichum lagenarium by Colletotrichum lagenarium.

P.W. 111 . and F. Kyoto Univ. Makalah dipresentasikan dalam 3rd Asian Conference on Crop Protection. Terpenoid Metabolism. 16-18 September 1999. L.. their Associated Fungi. K. Acremonium and MethylJasmonate Induce Terpenoid Formation in Agarwood Tree (Aquilaria crassna). T.(Gayu Rahayu. 85:1064-1068. McGarvey. Plant Cell 7:1015-1026.. 1995. Pusat Litbang Hutan dan Konservasi Alam. B. D. Purwokerto. Phytopathol. 3 route A Gockel.Efektivitas dan Interaksi . 42:179-206. hlm 573-581. 1997. 22-24 August 2007.. T.J. Umboh. L. Rahayu. Sticher. 1700 Fribourg.. Pembentukan Gaharu dengan Cara Inokulasi. Raffa. Métraux. Croteau. 1996. Makalah Diskusi Hasil Penelitian dalam Menunjang Pemanfaatan Hutan yang Lestari. 2008. J. G.. Potensi Hifomiset dalam Menginduksi Pembentukan Gubal Gaharu. J. Rev. Increasing Fragrance and Terpenoid Production in Aquilaria crassna by Multi-Application of MethylJasmonate Comparing to Single Induction of Acremonium sp. S. Rahayu.I. Systemic Acquired Resistance. Kloepper. Entomol. Université de Fribourg. Makalah dipresentasikan dalam International Conference on Microbiology and Biotechnology.D. Bogor. Isnaini. 11-12 Maret 1996. Induction of Systemic Resistance in Cucumber by Plant Growth-Promoting Rhizobacteria: Duration of Protection and Effect of Host Resistance on Protection and Root Colonization. Perhimpunan Fitopatologi Indonesia.J. Tuzun. 1991. 1995. and Host Conifers. Putri dan Juliarni. Jakarta.. E. 11-12 November 2008. 1997. A. Annu. Yogyakarta. dkk...C. Santoso. S. Bull. Harrington..F. 1999. Switzerland. Hlm 1-3. Preliminary Observation of Aquilaria crassna Wood Associated with the Formation of Aloeswood. Y.) Liu. M. Mauch-Mani.L. T. 2007. Interactions Among Scolytid Bark Beetles. Prosiding Kongres Nasional XV dan Seminar Perhimpunan Fitopatologi Indonesia. Paine. Purwokerto. Forest 63:226-235. Institute de Biologie Végétale.. G. Nobuchi. Siripatanadilok. G. Rahayu.

112 .

Aspek SILVIKULTUR 113 .

114 .

Trichoderma sp. sehingga jenis ini dimasukkan dalam Appendix II CITES (Santoso et al.. Dukungan iptek dimaksud 115 . gaharu harus dihasilkan dari pohon hasil budidaya. 1996. Pythium sp. Phialophora sp. Erdy Santoso. Di alam. khususnya jamur Fusarium sp. 1987). Konsekuensinya... melainkan ditujukan untuk menghasilkan resin gaharu yang terbentuk dari respon tanaman atas infeksi mikroba. Sidiyasa dan Suharti. bukan dari alam.. (Santoso et al. 2001. 2007).. Budidaya gaharu memerlukan input iptek agar pertumbuhan dan produksi resin gaharu dapat optimal. Cylindrocarpon sp..5 UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto. Daijo and Oller. Namun gaharu alam dapat mencapai kualitas tertinggi (kelas super) yang harganya bisa mencapai Rp 30 juta/kg. Akibatnya populasi jenis-jenis gaharu menyusut tajam. Karena potensi harga yang sangat tinggi. Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Pengembangan tanaman gaharu umumnya tidak bertujuan untuk menghasilkan kayu.. kurang dari 5% gaharu terbentuk dari populasi pohon dan bila terbentuk biasanya kurang dari 10% biomas kayu pada pohon yang terinfeksi. Parman et al. dan Popullaria sp. dalam perdagangan resmi. eksploitasi gaharu alam dilakukan tanpa mengindahkan kelestariannya.. 2007.

9-6. 6. malacensis asal Sukabumi.4-26. Pembahasan makalah ini difokuskan pada aspek pembibitan atau perbanyakan bibit pohon penghasil gaharu. baik pertumbuhan maupun produktivitas resin gaharunya. 2. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan.1oC dan 4. 1960). METODE A. 116 . Biji rekalsitran umumnya cepat berkecambah dan tidak dapat disimpan dalam jangka panjang (Roberts and King. Perbanyakan Generatif Pengujian pada perbanyakan generatif dilakukan pada benih (biji) dan cabutan (anakan alam). Bibit cabutan yang digunakan dalam uji waktu simpan cabutan adalah campuran Aquilaria microcarpa dan A.Aspek SILVIKULTUR berkaitan dengan aspek pembibitan dan penyuntikan stimulan gaharu. Penerapan perbanyakan vegetatif dan pemuliaan pohon berpotensi untuk menghasilkan bibit klon gaharu yang memiliki keunggulan. baik secara generatif maupun vegetatif. 4. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. dan 3 hari penyimpanan) serta kondisi penyapihan (dalam sungkup dan tanpa sungkup). malacensis. Proyek ITTO PD 425/06 berupaya untuk mengembangkan dan menerapkan iptek pada penanaman pohon penghasil gaharu agar pertumbuhan dan produktivitas resin gaharunya tinggi. Biji pohon penghasil gaharu tergolong rekalsitran (Hou. Namun informasi iptek mengenai teknik perbenihan dan teknik perbanyakan vegetatif gaharu masih sangat terbatas. Perbanyakan bibit pohon penghasil gaharu dapat dilakukan. 2. dan 8 minggu) dan temperatur penyimpanan (25. Perlakuan pada uji waktu simpan bibit cabutan adalah tiga waktu simpan (1. Perlakuan pada uji penyimpanan benih adalah waktu (0. Benih pohon penghasil gaharu yang digunakan pada uji penyimpanan dan daya kecambah benih adalah campuran Aquilaria microcarpa dan A. 1980). Makalah ini menyajikan hasil penelitian berkaitan dengan aspek perbenihan dan perbanyakan stek gaharu.5oC).

Perlakuan pada pengujian pertama menggunakan prosedur rutin. Uji penyimpanan benih dilakukan untuk mengetahui seberapa lama benih gaharu dapat disimpan. media menggunakan campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 1:1 dan intensitas penyiraman 1 kali pada bulan pertama.0001).Uji Produksi Bibit . HASIL DAN PEMBAHASAN A. Penyiraman 2 kali seminggu. Bahan stek yang digunakan pada pengujian ini adalah A.(Atok Subiakto.0993).. Secara teknis pengecambahan biji gaharu mudah dilakukan. Uji produksi bibit stek gaharu dilakukan dalam tiga tahap. dan 3 kali pada bulan ketiga.. yaitu media campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 2:1. Pada pengujian kedua perlakuan intensitas penyiraman dikurangi menjadi sekali seminggu dengan media arang sekam.) B. Persen kecambah dari hasil uji lain pihak. Pada pengujian ketiga. Perbanyakan Vegetatif Teknik perbanyakan vegetatif yang digunakan pada penelitian ini adalah teknik stek pucuk. 2007).. Penelitian dilakukan pada rumah kaca yang menggunakan sistem pendingin kabut KOFFCO system (Sakai dan Subiakto. malacensis. sehingga harus secepatnya dikecambahkan. periode penyimpenyimpanan biji panan mempengaruhi persen Periode Kondisi Refrigerator kecam-bah benih (P Anova = < simpan ruang (%) (%) 0. Perbanyakan Generatif Biji gaharu tergolong rekalsitran.. media tabur dapat menggunakan arang sekam Langsung 2 minggu 4 minggu 6 minggu 8 minggu 82 69 77 56 48 69 69 61 24 117 . Subiakto dan Sakai. 2 kali pada bulan kedua. 2007. Hasil uji pengecambahan biji dari dua kondisi penyimpanan disajikan pada Tabel 1 dan Tabel 2. Kondisi penyimpanan (kondisi ruang dan dalam re-frigerator) tidak secara nyata mempengaruhi perkecambahan benih (P Anova = 0. Di Tabel 1. dkk.

Pada jenis gaharu penyimpanan pada kondisi ruang selama 2 bulan masih dapat menghasilkan kecambah dengan tingkat keberhasilan 48%. kotiledonnya telah luruh. Perbanyakan generatif Tabel 3. Penurun. penaburan biji dilakukan segera setelah buah yang masak dan jatuh. Persen jadi bibit (6 minggu setelah penaburan) dari hasil uji dimulai pada minggu kedua penyim-panan biji dan persen jadi bibit dihitung pada minggu keenam setelah Periode Kondisi Refrigerator penaburan. Pada Tabel 2 simpan ruang (%) (%) tampak ada penurunan antara Langsung 74 persen berkecambah dan 2 minggu 50 54 persen jadi bibit. Hasil uji penanaman 3 76 38 cabutan disajikan pada Tabel 3.4 minggu 64 58 annya cenderung lebih besar 6 minggu 37 48 bila bibit disimpan dalam 8 minggu 29 9 jangka waktu yang lebih lama. Persen tumbuh bibit cabutan dari uji penyimpanan dan dapat pula dilakukan dengan kondisi tanam bibit menggunakan bibit yang diperoleh dari cabutan di Periode Dalam Tanpa bawah pohon induknya. 118 . Pada jenis-jenis biji rekalsitran seperti meranti. Dalam pengujian ini media kecambah yang digunakan adalah arang sekam padi.0001). Perkecambahan umumnya Tabel 2. Penggunaan sungkup meningkatkan secara nyata persen tumbuh bibit cabutan (P Anova = < 0. pengecambahan harus dilakukan segera setelah pengunduhan buah. Umumnya bibit cabutan yang masih memiliki kotiledon dapat langsung ditanam dalam kantong plastik tanpa penyungkupan. Pasimpan sungkup (%) sungkup (%) (hari) da pengujian penanaman 0 80 40 cabutan digunakan bibit 1 76 46 gaharu berukuran tinggi 2 87 24 7 cm. Oleh sebab itu untuk mendapatkan persen jadi bibit yang tinggi.Aspek SILVIKULTUR atau zeolit.

B. penyiraman dikurangi menjadi satu kali seminggu. kelembaban. Hasil pengujian ini membuktikan bahwa kelembaban tinggi di dalam sungkup mempengaruhi keberhasilan penanaman bibit cabutan.0083) terhadap persen jadi stek. 2007).) Namun bila kotiledon telah luruh. Media terbaik adalah zeolit. Pembuatan stek dinilai dapat diusahakan secara ekonomis bila persen jadi mencapai 70% (Subiakto dan Sakai. Perlakuan jenis tidak menunjukkan perbedaan nyata (P Anova = 0. 2002). Mengingat persen jadi stek masih di bawah 70%. dkk. Zeolit merupakan media dengan porositas yang baik dan tidak ditumbuhi oleh cendawan 119 . 2007. Teknologi ini mengatur kondisi lingkungan. temperatur. Perbanyakan Vegetatif Uji produksi stek gaharu dilakukan dengan menggunakan teknologi KOFFCO system yang dikembangkan oleh Badan Litbang Kehutanan dan Komatsu (Sakai dan Subiakto. dan media pada tingkat optimal bagi pertumbuhan (Sakai et al.. Hasil pengujian menunjukkan media berpengaruh secara nyata (P Anova = 0. Demikian pula perlakuan wadah tanam tidak menunjukkan perbedaan nyata (P Anova = 0. adapun perlakuan yang diuji adalah tiga jenis media (arang sekam padi. yaitu cahaya. pasir.6600) dalam persen jadi stek. penyungkupan harus rapat agar kelembaban dalam sungkup dapat dijaga pada level di atas 95%.. Penyimpanan bibit cabutan selama tiga hari masih memberikan hasil yang cukup baik (76%) bila penanamannya menggunakan sungkup. Hasil uji produksi stek gaharu disajikan pada Tabel 4. maka penanaman bibit cabutan harus melalui tahap penyungkupan. Uji produksi stek dilakukan dalam tiga tahap penelitian. Pada tahap pertama digunakan prosedur baku pembuatan stek.Uji Produksi Bibit . Ratarata persen jadi stek pada uji tahap pertama berkisar antara 4047%. namun persen berakar masih di bawah 70%. dan zeolit).. Subiakto dan Sakai. Perlakuannya adalah jenis dan wadah tanam (tabur) stek... maka dilakukan pengujian lebih lanjut.8276) dalam persen jadi stek.(Atok Subiakto. 2007). Pada pengujian tahap kedua. Sungkup dapat dibuat dari plastik PVC transparan.

microcarpa Campuran A. siram 3 kali seminggu. siram 3 kali seminggu. maka perlu dicoba media lain yang memiliki tingkat porositas relatif sama dengan zeolit. microcarpa Campuran A. siram 1 kali seminggu Media cocopeat : sekam = 1:1. media coco-peat : sekam = 2:1 Tanpa pot-tray. siram 3 kali seminggu Persen berakar (%) 40 42 44 47 17 31 55 53 69 49 120 . Penyiraman terbaik adalah dua kali seminggu dengan persen berakar 69%. microcarpa Campuran A. Perlakuan yang diuji adalah tingkat penyiraman (1 kali seminggu. crassna dan A.Aspek SILVIKULTUR ataupun alga. siram 3 kali seminggu. microcarpa Campuran A.0210). dan 3 kali seminggu). penyiraman berpengaruh secara nyata terhadap persen berakar stek (P Anova = 0. crassna dan A. siram 2 kali seminggu Media cocopeat : sekam = 1:1. termasuk cendawan pembusuk. microcarpa Campuran A. 2 kali seminggu. Hasil pengujian menunjukkan bahwa pada tingkat kepercayaan 5%. siram 1 kali seminggu Media pasir. media coco-peat : sekam = 2:1 Media sekam bakar. microcarpa A. Pada pengujian ketiga digunakan media campuran cocopeat dan sekam padi yang telah disteril. siram 1 kali seminggu Media cocopeat : sekam = 1:1. crassna dan A. Karena zeolit adalah media yang berat dan relatif lebih mahal. siram 3 kali seminggu. Efek dari penyiraman adalah menyebabkan jenuhnya media dan meningkatkan pertumbuhan cendawan. Tabel 4. microcarpa Campuran A. Persen berakar stek dari rangkaian uji produksi stek Tahapan riset 1 1 1 1 2 2 2 3 3 3 Spesies A. media coco-peat : sekam = 2:1 Dengan pot-tray. crassna A. siram 1 kali seminggu Media zeolit. crassna dan A. crassna dan A. crassna A. media coco-peat : sekam = 2:1 Dengan pot-tray. crassna dan A. microcarpa Perlakuan Tanpa pot-tray.

Persen kecambah terbaik diperoleh dari benih yang langsung dikecambahkan setelah pengunduhan. Oller. Badan Litbang Kehutanan.Uji Produksi Bibit ..(Atok Subiakto. Nuroniah. Gunawan. dan D.J. Groningen. 2. A. J. com/scent-of-earth/alag. Penanaman bibit cabutan menggunakan sungkup menghasilkan persen tumbuh lebih baik dibandingkan bila tidak menggunakan sungkup. Thymelaceae.G. The Netherland. Mataram. Studi Etiologi Gubal Gaharu Pada Tanaman Ketimunan. Rahman. Namun dengan mengantisipasi penurunan daya kecambah.yahoo.) KESIMPULAN 1. Hou. Pen. Media terbaik untuk penyetekan gaharu adalah campuran antara serbuk kulit kelapa (cocopeat) dan sekam padi dengan perbandingan 1:1. Turjaman. Makalah Temu Pakar Gaharu di Kanwil Dephut Propinsi NTB. T. and A. ed). C. Mass Propagation Method from The Cutting of Three Dipterocarps Species. Bogor. Kamata. In : Flora Malesiana (Van Steenis. Parman. Subiakto. Pedoman Pembuatan Stek Jenisjenis Dipterokarpa dengan KOFFCO System. A. Scent of Earth. Subiakto. Santoso.. Benih gaharu tidak perlu disimpan dalam refrigerator.. Res..G. W. Series I. 121 . For. Walter-Noodhoff. D. IV-5 : 499-509. dan Y. 1960. 1996. 6. S. 2007.html (diakses : 5 Febuari 2001). Penyiraman terbaik dilakukan dua kali dalam seminggu. dkk. dan M. cukup disimpan pada suhu ruangan. 2007.. dan N. A. 1-15. p. E. 7:73-80. 2002.. DAFTAR PUSTAKA Daijo. Mulyaningsih. benih masih dapat disimpan selama dua bulan.. J. C. 2001. Sakai. H. V. Vol. C. Htn & KA. URL:http://store. Komatsu. Sakai. Pembuatan stek gaharu tersebut dilaksanakan pada rumah kaca dengan KOFFCO system. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil Gaharu Aquilaria microcarpa. JICA..

Aspek SILVIKULTUR Sidiyasa. Makalah Utama Diskusi Pemanfaatan Kayu Kurang Dikenal. A. Y. Manajemen Persemaian KOFFCO System. Jenis-Jenis Tumbuhan Penghasil Gaharu.. Roberts.. 1-5. Subiakto. H. Malaysia. 1987. and Roberts. Tamai. Bogor. Turjaman. Sakai. and M. Santoso. 1980. The Characteristic of Recalcitrant Seeds. and E. Komatsu. W. dan M. H. In : Recalcitran Crop Seeds (Chin. Badan Litbang Kehutanan. King. Bogor. Kuala Lumpur. Mycorrhiza 16 : 459-464. E. dan C. Suharti. 2007. Cisarua. H. BHD. eds). M. F. 2006. 122 . Arbuscular Mycorrhizal Fungi Increased Early Growth of Two Timber Forest Product Species Dyera polyphylla and Aquilaria filaria Under Greenhouse Conditions.. JICA. Tropical Press SDN. K. E.

6 APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp. Di alam. Hokkaido University Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu (dalam Bahasa Inggris dikenal dengan agarwood atau eaglewood) adalah kayu resin yang bernilai komersial tinggi karena digunakan sebagai dupa. ditebang dan dipanen gaharunya. perburuan gaharu dilakukan secara agresif dan tidak bijaksana. bahkan kegiatan sehari-hari. Aquilaria 123 . Division of Applied Bioscience. Sitepu Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Yasuyuki Hashidoko Lab. bahan aditif minyak wangi. sehingga untuk mencegah punahnya pohon penghasil gaharu. budaya. dan minyak esensial untuk kegiatan keagaman. of Ecological Chemistry. Pohon penghasil gaharu yang ditemukan dengan ciri-ciri adanya lubang kecil yang disebut lubang semut. sejak November 1994. Cara perburuan ini mengancam kelestarian gaharu di habitat alaminya. Graduate School of Agriculture. DI PERSEMAIAN Irnayuli R.

perlu upaya budidaya pohon penghasil gaharu. Kedua genus ini ditemukan tumbuh alami di paling tidak 12 negara. pohon menghasilkan metabolit sekunder atau senyawa resin yang menyebabkan bau wangi ketika dibakar. Agar ketersediaan produk gaharu dan pohon penghasil gaharu tidak punah dan untuk menjaga kesinambungan produksi gaharu yang lestari. persiapan bibit kehutanan dilakukan mulai di persemaian. Phaleria. Wikstroemia. Appendix II TRAFFIC-CITES-CoP13 Prop. dua genus pohon penghasil gaharu terpenting yang termasuk ke dalam famili Thymelaeaceae (Ordo: Myrtales dan Kelas: Magnoliopsida) telah masuk ke dalam daftar CITES (the Convention on the International Trade in Endangered Species of Wild Flora and Fauna). yaitu Aetoxylon. Gaharu hasil budidaya diharapkan akan dapat memenuhi kebutuhan pasokan gaharu untuk ekspor ke negara-negara pemakai. termasuk Bangladesh. Budidaya merupakan kunci utama dalam meningkatkan produksi gaharu yang semakin menipis. dan Papua New Guinea (Barden et al. Istilah RPPT digunakan untuk bakteri yang dapat membantu pertumbuhan tanaman melalui 124 . 2004). Indonesia.Aspek SILVIKULTUR dan Gyrinops. Kegiatan budidaya pohon penghasil gaharu tidak terlepas dari penyediaan bibit yang berkualitas tinggi. dalam Gunn et al.49 (2004) mencatat ada 24 spesies yang termasuk genus Aquilaria dan tujuh spesies termasuk ke dalam genus Gyrinops. Malaysia. Vietnam. Selain ditemukan pada kedua genus di atas. Keberadaan gaharu semakin menipis di alam. Upaya peningkatan mutu bibit di persemaian dapat dilakukan dengan pemupukan. Lain halnya dengan komoditas pertanian yang langsung ditanam di lapangan. Enkleia. Gonystylus. Filipina. Butan. Kamboja. Gaharu terjadi melalui proses patogenisitas di mana jenis patogen fungi tertentu menginfeksi jenis pohon tertentu dan sebagai respon terhadap serangan patogen. Myanmar. Thailand. seperti bakteri penghuni perakaran yang disebut rhizobakteri pemacu pertumbuhan tanaman (RPPT atau plant growth promoting rhizobacteria). Lao PRD.. produk unik ini juga dapat terjadi pada beberapa genus tanaman lainnya. penggunaan biji yang bermutu baik dan inokulasi mikroba yang dapat memacu pertumbuhan.

(2005) melaporkan bahwa Azospirilum brazilance meningkatkan jumlah dan panjang akar lateral. Sedangkan Pseudomonas putida GR12-2 pada bibit canola meningkatkan panjang akar sampai tiga kali lipat. giberelin (AG). AG.(Irna R. bakteri terlebih dahulu diseleksi secara in vitro untuk 125 .. 1995.. Azospirillum sp. Namun. Kokalis-Burelle et al. sequestration besi oleh siderofor. (2006) mengatakan bahwa dalam studi pemanfaatan bakteri penambat nitrogen untuk meningkatkan produksi tanaman. Sitepu. solubilisasi atau mineralisasi fosfat. fitohormon mendapatkan perhatian penelitian karena aplikasi bakteri penghasil fitohormon dilaporkan meningkatkan produksi tanaman inang secara berkesinambungan (Narula et al. (1986) dalam Ahmad et al. dan kinetin. 1995.Aplikasi Rhizobakteri Penghasil . penambatan nitrogen. dan sitokinin (berbagai sumber dalam Narula et al. Narula et al. Dalam penelitian ini. 2004). yang dikenal sebagai bakteri penambat nitrogen. Sedangkan Azospirillum chroococcum diketahui dapat memproduksi AIA. sehingga respon peningkatan pertumbuhan tanaman disebabkan oleh mekanisme lain dan bukan nitrogen. baik secara langsung maupun tidak langsung (Glick. dan diduga adalah produksi fitohormon oleh bakteri penambat nitrogen tersebut.. Glick.. sampai saat ini informasi penelitian tentang pemanfaatan bakteri fitohormon untuk tanaman kehutanan di daerah tropis masih terbatas. dan pencegahan terjadinya serangan patogen tular tanah (Garbaye. Lucy et al. Dikatakan bahwa bakteri penghasil hormon pertumbuhan diduga memegang peranan penting dalam memacu pertumbuhan tanaman. yaitu asam indol asetat (AIA/auksin). misalnya dapat memproduksi tiga jenis fitohormon. 2006). kandungan nitrogen pada tanaman yang diinokulasi tidak meningkat secara myata. di persemaian. Barbieri et al. 2006).. dkk) mekanisme yang beragam.. Mikroorganisme yang menghuni rhizosfir berbagai macam tanaman umumnya memproduksi auksin sebagai metabolit sekunder sebagai respon terhadap suplai eksudat akar yang berlimpah di zona perakaran. membantu proses terbentuknya mikoriza.. Untuk menguji hipotesa ini. Di antara mekanisme ini. 2006).. Mekanisme ini meliputi produksi fitohormon. maka dilakukan penelitian uji aplikasi bakteri penghasil AIA/auksin dalam memacu pertumbuhan bibit penghasil gaharu Aquilaria sp. 1994.

2002).3% gellan gum sebagai bahan pemadat (Hashidoko et al. 926F (5 AAACTCAAAGGAATTGACGG 3). Analisa sekuens DNA menggunakan BigDye Terminator v3. BAHAN DAN METODE A. Bakteri Penghasil Fitohormon: Identifikasi. 518R (5 GTATTACCGCGGCTGCTGG 3). Toyo Roshi Kaisha Ltd. (1991) yang dimodifikasi sebagai berikut: Rhizobakteri ditumbuhkan dalam media agar Winogradsky’s yang dimodifikasi (AWM) yang diberi 100 mg/L L-tryptophan (C 11H 12N 2O 2). Rhizobakteri ini kemudian diidentifikasi secara molekuler mengikuti metode Weisburg et al. 126 . Foste City. Karakterisasi in vitro dan Persiapan Inokulum Rhizobakteri diisolasi dari rhizosfir dan rhizoplan bibit atau sapling menggunakan media campuran mineral Winogradsky’s bebas N dengan pH 5. media ditumpuk dengan membran nitrocellulose berukuran pori 0. dan/atau 1080RM (5 ACGAGCTGACGACA 3). diameter 47 mm. 2.. Setelah inkubasi selama 3 hari. 3.1 cycle (Applied Biosystems. dan diinkubasi dalam gelap pada suhu 28°C.45mm. Homologi sekuens ditelusuri dengan menggunakan BLASTN online DNA database in National Center for Bio-technology Information (NCBI). 2 (Advantec. Katakterisasi kualitatif menggunakan metode colorimetric Brick et al. yaitu: 1. Segera setelah agar diinokulasi rhizobakteri.6-6. USA) dengan empat pilihan primer. 4. membran dipindahkan dan ditumpuk pada kertas saring berdiameter 55 mm No.Aspek SILVIKULTUR mengetahui kapasitasnya sebagai bakteri penghasil fitohormon AIA/auksin. 1112F (5 GTCCCGCAACGAGCGCAAC 3).2 yang mengandung 1% sukrosa sebagai sumber karbon dan 0.. Seleksi awal rhizobakteri secara in vitro dilakukan untuk mengetahui kemampuannya dalam memproduksi fitohormon (asam indol asetat-AIA) melalui karakterisasi kualitatif dan kuantitatif. (1991).

dkk) Tokyo. Glickmann dan Dessaux (1995) menyatakan bahwa larutan Salkowsky memberikan respon positif tidak hanya terhadap auksin (IAA) melainkan juga terhadap asam indolpirufat dan indoleacetamide. Namun demikian.(Irna R. Selain itu.Aplikasi Rhizobakteri Penghasil . pembentukan warna dibaca pada A665nm.. Setelah 0. untuk mengetahui kemampuan bakteri dalam membantu terbentuknya asosiasi mikoriza pada bibit Aquilaria sp. CK8 karena Aquilaria sp. diketahui berasosiasi dengan fungi mikoriza arbuskula. dan merah tua. Rhizobakteri yang membentuk cincin halo berwarna merah muda sampai merah pekat digunakan untuk uji kuantitatif AIA.. uji lanjutan pada V. Rhizobakteri yang mampu memproduksi AIA akan membentuk cincin halo warna merah di sekitar koloni. Sedangkan karakterisasi AIA secara kuantitatif dilakukan mengikuti metode Narula (2004). Perubahan warna diamati setelah 30 menit kemudian. kemudian dikelompokkan menjadi merah muda. melainkan diduga merupakan indikasi perbedaan/variasi derifat dari senyawa indol yang dikonversi dari L-triptophan. maka dipilih sembilan bakteri (Tabel 1). 127 .5 jam. Japan) yang telah direndam sebelumnya dalam larutan Salkowski. yaitu Chromobacterium sp. Kemudian larutan Salkowski ditambahkan pada supernatant kultur rhizobakteri. merah. Sitepu. Dari ketiga uji pendahuluan untuk mendapatkan bakteri penghasil AIA.. radiata tidak menunjukkan adanya korelasi yang positif antara intensitas kepekatan warna merah dengan laju pertumbuhan tanaman (tinggi dan total panjang akar).. Tidak adanya korelasi yang spesifik ini mengindikasikan bahwa kepekatan warna merah bukan merupakan indikasi tingginya kuantitas IAA yang dihasilkan. digunakan juga satu isolat bakteri pemacu asosiasi mikoriza. Strain rhizobakteri yang bereaksi positif dengan larutan Salkowski kemudian diuji untuk mengetahui kemampuannya dalam memacu pertumbuhan akar Vigna radiata sebagai tanaman uji. Intensitas warna yang terbentuk. Rhizobakteri dikulturkan pada media MW cair yang ditambah dengan 100mg/L L-tryptophan dan diinkubasikan pada suhu 28°C dalam kondisi statis di dalam gelap selama 7 hari.

CK28 bacteria (DQ195889) Burkholderia Proteosp.5 th NI CK 61 Chromobacterium sp. Sel bakteri yang ditumbuhkan pada media cair MW + 100 mg/L L-tryptophan diinkubasi dengan menggoyang selama 3 hari pada suhu 28ºC. Rizoplan Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Hopea sp. CK41 Azospirillum sp. CK67 NI CK53 NI CK54 Proteobacteria S.5% gellan gum selama 30 menit. Informasi bakteri PGPR penghasil fitohormon yang digunakan sebagai inokulum Strain bakteri Stenotrophomonas sp. Inokulasi Bakteri Fitohormon pada Bibit Aquilaria sp. parviflora Rizoplan Rizoplan Sapling ~1 bln Sapling ~1. setelah itu kultur bakteri agak dikentalkan dengan menambahkan 0. Inokulasi dilakukan pada bibit yang berumur 4 minggu dengan cara merendam bibit dalam larutan bakteri selama 30 menit. CK26 Sub kelas Proteobacteria Bacilli Proteobacteria Hasil analisa colorimetric AIA Merah Inang Substrat Sta-dium Asal lokasi Dipterocarpus sp. teysmanniana S. kemudian ditanam dalam polybag yang berisi 500 g media tanah yang tidak steril. 1 ml larutan bakteri juga disebarkan di daerah perakaran. CK59 bacteria (DQ195914) Dipterocarpus sp. dan bobot kering biomassa. diameter. * isolat mycorrhization helper bacteria. Rizoplan S. Tabel 1. Bibit ditumbuhkan di rumah kaca dan disiram setiap hari dengan air keran. UP: Universitas Palangkaraya. Pengamatan dilakukan terhadap tinggi. teysmanniana Rizoplan Rizoplan Rizoplan Merah muda Merah muda Merah muda pupus Merah muda pupus Merah muda pupus Merah tua Merah tua Merah muda Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Burkholderia Proteosp. teysmanniana Rizoplan Sapling ~1th Bibit~ 6 bln Nyaru Menteng Nyaru Menteng Pembi-bitan UP Nyaru Menteng Serratia sp. H: Hopea. CK34 Bacillus sp. CK8 (DQ195926) Proteobacteria * Catatan: S: Shorea. Pada saat penanaman. NI: bakteri yang belum teridentifikasi. AIA: asam indol asetat 128 . S.Aspek SILVIKULTUR B. balangeran S.

yaitu tinggi. indeks mutu bibit. (b): Pembentukan warna pada media cair. USA). Data yang berbeda nyata diuji lanjut dengan Least Significant Difference untuk mengelompokkan perlakuan yang tidak berbeda nyata.. Warna merah yang terbentuk di sekitar koloni setelah direaksikan dengan reagen Salkowski (a): Pembentukan warna pada membrane nitroselulose 3 hari setelah inkubasi. Data dianalisa secara statistik dengan analisa sidik ragam menggunakan program SPSS®version 10. diameter.. yang masing-masing diulang sebanyak 10 bibit per perlakuan. dkk) a b Gambar 1.. Bakteri NICK53 yang membentuk warna merah tua dibanding dengan kontrol media tanpa bakteri C.Aplikasi Rhizobakteri Penghasil . Sitepu. Rancangan Percobaan dan Analisa Data Penelitian menggunakan rancangan acak lengkap dengan faktor tunggal. berat kering total..(Irna R. dan persentase peningkatan pertumbuhan.0 (SPSS Inc. Parameter yang diukur untuk mengetahui respon bibit terhadap inokulasi. yaitu 10 isolat bakteri. Chicago.. Analisa persentase peningkatan pertumbuhan dilakukan sebagai berikut: %Peningkatan = Bibit yang diinokulasi bibit kontrol Bibit kontrol x 100% 129 .

130 . teysmanniana umur kurang lebih 1 tahun dan S. parviflora umur kurang lebih 1. Dijelaskan bahwa tanaman hutan pertumbuhannya jauh lebih lambat dari tanaman pertanian sehingga untuk pertumbuhan stadium awal di persemaian. menunjukkan respon beragam terhadap inokulasi bakteri fitohormon (Gambar 2). Pertumbuhan diameter tidak menunjukkan respon yang konsisten terhadap inokulasi (Tabel 2).Aspek SILVIKULTUR HASIL DAN PEMBAHASAN Bibit Aquilaria sp. bibit yang tumbuh di lantai hutan perlu memiliki kemampuan untuk segera tumbuh tinggi bersaing dengan bibit di sekitarnya untuk mendapatkan cahaya agar dapat tumbuh baik. CK8 (DQ195926.2-38. Peningkatan pertumbuhan tinggi bibit Aquilaria sp. Kalimantan Tengah. β Proteobacteria) merupakan isolat yang paling konsisten dalam memberikan pengaruh paling efektif dalam meningkatkan pertumbuhan tinggi selama lima bulan setelah inokulasi (Gambar 2). Pada habitat hutan yang rimbun dengan kanopi yang bertingkat. Respon yang serupa juga telah dilaporkan oleh Sitepu et al. Semua bibit yang diinokulasi secara signifikan memiliki pertumbuhan tinggi yang lebih baik daripada tanaman kontrol melalui analisa Least Significant Difference (LSD). Kedua bakteri ini berasal dari rhizoplan S. Dua isolat bakteri.7% dibandingkan dengan bibit yang tidak diinokulasi pada lima bulan setelah inokulasi. berkisar antara 12.05). tinggi merupakan parameter yang reliable untuk mengamati respon bibit terhadap inokulasi mikroba pemacu pertumbuhan. β Proteobacteria) dan Chromobacterium sp. yaitu Burkholderia sp. Bakteri fitohormon memberikan pengaruh nyata terhadap tinggi tanaman mulai 1-5 bulan setelah inokulasi (P < 0. Respon tanaman diamati melalui pertumbuhan tinggi dan diameter setiap bulannya. (2007) bahwa respon diameter bibit Shorea selanica terhadap inokulasi RPPT tidak konsisten. CK28 (DQ195889.5 tahun dari arboretum Nyaru Menteng. netral atau negatif terhadap pertumbuhan tanaman jika dibandingkan dengan tanaman yang tidak diinokulasi (kontrol negatif ). Bakteri fitohormon memberikan pengaruh positif.

enam bulan setelah inokulasi. Shorea acuminata. rasio pucuk terhadap akar. Angka di atas notasi adalah peningkatan pertumbuhan dibanding kontrol Inokulasi tidak memberikan pengaruh nyata terhadap pertumbuhan tinggi. dkk) Gambar 2.. kemudian bebas untuk berinteraksi dengan bakteri yang diinokulasikan. sampai 5 bulan setelah inokulasi. 1994. Sitepu..(Irna R. Yazid et al. Bibit Aquilaria sp. Pengaruh bakteri PGPR terhadap pertumbuhan tinggi bibit Aquilaria sp. juga terhadap berat kering total. yaitu Shorea leprosula. Tidak responnya bibit terhadap bakteri. ditumbuhkan di bawah tegakan meranti di Hutan Penelitian Dramaga. 131 . Inokulasi juga tidak berpengaruh terhadap pertumbuhan setelah bibit dipindah ke lapangan. dan indeks mutu bibit (Gambar 3 dan Gambar 4). Diduga tidak adanya respon bibit yang nyata pada bulan keenam dan selanjutnya disebabkan karena bibit telah terinfeksi oleh fungi mikoriza secara alami yang dapat berasal dari tanah maupun air yang dipakai untuk menyiram tanaman walaupun analisa infeksi mikoriza alami tidak dilakukan. 2005). tidak disterilisasi pada saat inokulasi bakteri sehingga mikroba alami yang terdapat dalam tanah. dapat dijelaskan sebagai berikut: Tanah sebagai media tumbuh dan bibit Aquilaria sp..Aplikasi Rhizobakteri Penghasil . Turjaman et al. 1990. bibit cenderung tumbuh lambat (Tabel 2).. enam bulan setelah inokulasi.. Fungi mikoriza dilaporkan baru berperan efektif tujuh bulan setelah inokulasi pada tanaman dipterokarpa. Hopea odorata.. dan Shorea pinanga (Lee.

Tabel 1. Analisa sidik ragam pada parameter pertumbuhan yang diukur Parameter Diameter (mm) Tinggi (cm) Berat Kering Pucuk (g) Berat Kering akar (g) Berat Kering Total (g) Rasio P/A Indeks Mutu Bibit tn * tn * Analisa sidik ragam * * tn tn tn tn tn * * tn * tn tn Catatan: tn: tidak nyata pada taraf 0.05. P/A: Pucuk/akar Gambar 3.Aspek SILVIKULTUR Tabel 2. yang diinokulasi bakteri 132 .05 *: nyata pada taraf 0. Berat kering total bibit Aquilaria sp.

MHB) juga telah dilaporkan.. dan Rhodococcus sp. (2001) menyatakan bahwa bakteri Paenibacillus sp. pengaruh mikoriza dimulai lebih awal. CK8 adalah bakteri yang telah diuji secara in vitro dapat membantu pertumbuhan miselia fungi ektomikoriza Laccaria sp. monteilii meningkatkan biomassa fungi di dalam tanah (Founoune et al.. Pengaruh tidak langsung dari inokulasi RPPT berupa pembentukan asosiasi mikoriza (disebut sebagai mycorrhizal helper bacteria.. Penelitian yang dilakukan oleh Poole et al.. 2002). dkk) Gambar 4. merangsang infeksi ektomikoriza pada tahapan pembentukan akar lateral antara Laccaria rufus dan Pinus sylvestris. yaitu pada enam bulan setelah inokulasi.. Penelitian yang dilakukan oleh Enebak et al. Salah satu dari kedua inokulan yang paling efektif. 133 . yang diinokulasi bakteri Pada bibit Aquiliaria sp.. yaitu Chromobacterium sp. (1998) pada bibit loblolly dan slash pine melaporkan bahwa inokulasi RPPT meningkatkan biomassa tegakan.Aplikasi Rhizobakteri Penghasil .. Indeks mutu bibit Aquilaria sp. Burkholderia sp. Bakteri tertentu dapat berperan dalam merangsang terbentuknya asosiasi mikoriza antara fungi mikoriza dan tanaman inangnya.(Irna R.. 1994. dalam penelitian ini. Gambar 4. Brule et al. Pseudomonas fluorescense BBc6R8 memacu simbiosis antara Laccaria bicolor S238N-Douglas fir (Pseudotsuga menziesii) dan efek dari bakteri MHB ini paling efektif pada saat fungi mikoriza tumbuh berada pada kondisi yang tidak optimal (Garbaye. Sitepu. Sedangkan Paenibacillus monteilii dan Paenibacillus resinovorans memacu simbiosis antara Pisolithus alba dengan Acacia holosericea di mana P. 2001).

pendekatan yang dilakukan adalah menyeleksi bakteri secara in vitro terlebih dahulu sebelum dilakukan uji pada tanaman target di persemaian. yaitu Burkholderia sp. Uji lanjutan inokulasi ganda dengan fungi mikoriza arbuskula perlu dilakukan untuk mengetahui mikroba yang berperan dalam memacu pertumbuhan bibit pada stadia lanjut di persemaian sebelum dipindah ke lapangan. Uji in vitro merupakan metode yang praktis. CK8 adalah dua bakteri yang secara konsisten memacu pertumbuhan tinggi. Respon pertumbuhan bibit Aquilaria sp. terutama dalam menyeleksi isolat dalam jumlah besar sebelum dilakukan uji selanjutnya. 134 . KESIMPULAN Bibit Aquilaria sp.7% dibandingkan dengan bibit yang tidak diinokulasi. menunjukkan respon beragam terhadap inokulasi bakteri penghasil fitohormon. Dari hasil in vitro didapat sembilan bakteri penghasil indol yang kemudian diuji lanjut pada bibit Aquilaria sp. terhadap inokulasi menghasilkan satu bakteri penghasil indol yang efektif. baik di persemaian maupun di lapangan. Dua isolat Burkholderia sp. Peningkatan pertumbuhan tinggi bervariasi dari 12. Dalam penelitian ini. CK28 dan Chromobacterium sp. maka perlu uji lebih lanjut untuk mengetahui pengaruh inokulasi ganda antara bakteri dan fungi mikoriza arbuskula dalam memacu pertumbuhan bibit. dan apakah hipotesa di atas benar. Dalam hal ini bibit bermikroba dapat meningkatkan ketahanan tumbuh tanaman pada kondisi ekstrim. Inokulasi bakteri penghasil fitohormon dapat meningkatkan tinggi bibit Aquilaria sp. Penelitian yang dilakukan oleh Kashyap et al. CK28 yang menghasilkan warna pink muda pada uji colorimetric. (2004) menunjukkan bahwa inokulasi ganda fungi mikoriza arbuskula dan bakteri Azotobacter dengan tambahan asam indol butirat secara nyata meningkatkan survival rate sapling Morus alba (Moraceae) yang ditanam pada kondisi yang bergaram tinggi dari 25-50%. segera setelah inokulasi berturut-turut selama lima bulan.Aspek SILVIKULTUR Untuk mengetahui apakah fenomena MHB ini juga berlaku untuk Aquilaria sp.2-38.

and J. Bostock. J. Rousselet. Dessaux. Turkish Journal of Biology 29: 29-34. S. Wei..(Irna R. Effect of plant growthpromoting rhizobacteria on loblolly and slash pine seedlings. F.. dan M. and Y. Helper bacteria: a new dimension to the mycorrhizal symbiosis. M. Khan... A critical examination of the specificity of the Salkowski reagent for indolic compounds produced by phytopathogenic bacteria. 1994. Glick. Chotte.. Canadian Journal of Microbiology 41: 109-117. DAFTAR PUSTAKA Ahmad. Enebak.. Duponnois. and S.. Frey-Klett. J. 1995. G. R. Ahmad. 1991. Garbaye. 1998. Founoune. Indole acetic acid production by the indigenous isolates of Azotobacter and fluorescent Pseudomonas in the presence and absence of tryptophan. F. New Phytologist 153: 81-89. 135 . Courrier. J. Silverstone. Brulé.A. New Phytologist 128: 197-210. R. Survival in the soil of the ectomycorrhizal fungus Laccaria bicolor and the effects of mycorrhiza helper Pseudomonas fluorescens. Neyra. Forest Science 44: 139-144. J. Brick.E. Applied and Environmental Microbiology 57: 535-538.C. and J. E.L.C.M. Glickmann.. S. Sall.M. Garbaye. 2001. 1995.Aplikasi Rhizobakteri Penghasil . Gerard. Kloepper. 2002.S. Soil Biology and Bio-chemistry 33: 1683-1694. Lemoine. J. 2005. Applied Environmental Microbiology 61: 793-796. dkk) Ucapan Terimakasih Para penulis mengucapkan terimakasih kepada Bapak Ahmad Yani dan Bapak Zaenal yang telah membantu pengukuran dan perawatan tanaman di Hutan Penelitian Dramaga. Mycorrhiza Helper Bacteria stimulate ectomycorrhizal symbiosis of Acacia holosericea with Pisolithus alba.M. P.W. Sommer. Lorquin.R. Ba. Pierrat. and J. The enhancement of plant growth by free-living bacteria. G. S. C. M. Rapid in situ assay for indoleacetic acid production by bacteria immobilized on a nitrocellulose membrane. Sitepu. I. B. H. A.. Branget. I.L.

. Singadan. Reed. New Phytologist 151: 743-751. Soft gel medium solidified with gellan gum for preliminary screening for rootassociating. Lee. Poole. Tada... Applied Soil Ecology 31: 91-100. Chatterton. Kloepper. Department of Microbiology. J. Plant Soil Environment 52:119-129. Eaglewood in Papua New Guinea. 2004.V. R.M. B. S. Canberra.. Bending. and B. India. Narula. Antonie van Leeuwenhoek 86: 1-25.S. Paranodules and colonization of wheat roots by phytohormone producing bacteria in soil. Plant growth-promoting rhizobacteria as transplants amendments and their effects on indigenous rhizo-sphere microorganisms. Whipps.W. S. N. Bacteria associated with Pinus sylvestris-Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro.D. M. Sunari. P.R. 2001. and M. and investigations of their functions on seedling growth. Merbach. Gans. Behl. PhD Dissertation. The Australian National University.51.R. The mycorrhizal association of the Dipterocarpaceae in the tropical rain forests of Malaysia. G. J. Tamai. and K. and S. and P. Read. Hashidoko. Biofertilizer technology-A manual. I. Stevens.J.Aspek SILVIKULTUR Gunn. Limin. Narula. Kokalis-Burelle. Bio-science Biotechnology Biochemistry 66: 2259–2263. Lucy.H. Tahara.. N. M.67.Y. pp. AMBIO 19: 383-385. J. Hokkaido University. 91 pp. 2004. Reddy. 18 pp. Y. M. Cha.S. Sitepu. 2006. E. Hisar.K. E. Osaki. M. 2006. Screening of plant-growth promoting rhizobacteria from Dipterocarpaceae plants growing in Indonesian tropical rain forests. M. Turjaman. Resource Management in Asia-Pacific Working Paper No. H. 2004. Applications of free living plant growth-promoting rhizobacteria. and D. 1990. A. CCS Haryana Agricultural University. free-living nitrogen-fixing bacteria inhabiting the rhizoplane of plants. 2007. Osaki. Segah. and W. Glick. Deubel. Tawaraya.. Inoculation with the ectomycorrhizal fungi 136 . W. 2002. M. Y.. L.J. 2005. N.

Weisburg. dkk) Pisolithus arhizus and Scleroderma sp. and D.A. G.(Irna R.. Lapeyrie. Lee. improves early growth of Shorea pinanga nursery seedlings. New Forest 30: 67-73. 1994. S.. Journal of Bacteriology 173: 697-707.Aplikasi Rhizobakteri Penghasil . D. (Dipterocarpaceae) seedlings following ectomycorrhizal inoculation with an exotic strain of Pisolithus tinctorius. 1991. Lane. Barns. W.S. 137 ..J.. 16S ribosomal DNA amplification for phylogenic study..M.. and F.M. Forest Ecology Management 67: 339-343. S. Sitepu. Pelletier. S. Yazid. Growth stimulition of Hopea spp.

138 .

Malaysia. Ahmad Yani. Sitepu. Sugeng Sentosa. maka jenisjenis ini mengalami kelebihan pemanenan di seluruh kawasan Asia selama 20 tahun terakhir (Paoli et al. India. Myanmar.. dan Gonystylus dimasukkan ke dalam CITES (Convention on the International Trade in Endangered Species) Appendix II (CITES 2005). Thymeleaceae terdiri dari 50 genera dengan Aetoxylon. Thailand. Papua Nugini. Ragil S. Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Salah satu famili pohon tropika yang sekarang menjadi perhatian dunia internasional adalah Thymelaeaceae. Cambodia. Karena disebabkan tingginya nilai produk gaharu. Gonystylus. 1960). 2001). Aryanto. Vietnam. dan Aquilaria yang memproduksi gaharu (Ding Hou. Jenis-jenis ini merupakan sumber utama dari kayu gaharu (semacam kayu yang 139 . Enkleia. Najmulah. Oyen dan Dung. Gyrinops. Wikstroemia.7 PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman.B. Bhutan. Famili pohon ini sangat penting karena menghasilkan produk gaharu dan kayu mewah untuk masyarakat di sekitar kawasan hutan di kawasan Asia (Lemmens et al. Irianto.. Gyrinops. Irnayuli R. Jenis-jenis Aquilaria pada umumnya banyak dijumpai pada hutan-hutan primer dan sekunder dataran rendah di Indonesia. dan Filipina. 1999). 1998. China. Pada saat ini Aquilaria. Phaleria. Bangladesh.

Aspek SILVIKULTUR mempunyai resin wangi) yang termasuk dalam urutan teratas dari kelompok hasil hutan bukan kayu bernilai sangat tinggi yang berasal dari hutan tropika. 2000). incence. belum dilaporkan adanya uji inokulasi fungi mikoriza arbuskula pada jenis-jenis Aquilaria. Parkia biglobosa. obat tradisional.. dan produk komersial lainnya (Eurling dan Gravendeel. Telah banyak dilaporkan dalam beberapa jurnal internasional pentingnya pemanfaatan fungi mikoriza arbuskula dari beberapa jenis tanaman hutan yang berbeda untuk membantu kegiatan reforestasi. baik di tingkat persemaian maupun di lapangan. 1990). Tectona grandis (Rajan et al. 140 . grandiflora (Giri and Mukerji. Pada saat ini kegiatan reforestasi memproduksi ratusan juta bibit tanaman hutan setiap tahunnya. Tujuan dari penelitian ini adalah menentukan tingkat pengaruh fungi mikoriza arbuskula pada jenis-jenis Aquilaria. jenis Aquilaria berkurang populasinya di alam. Namun demikian. Fungi mikoriza arbuskula (FMA) telah diuji dengan hasil yang signifikan pertumbuhannya pada jenis Leucaena leucocephala (Michelsen dan Rosendahl. 2005). 2004). Pada tahap awal pertumbuhan jenis Aquilaria sering mengalami pertumbuhan yang lambat. sebab pada umumnya kondisi lahan hutan tropika di Indonesia kahat unsur hara terutama N dan P. sulit sekali untuk melakukan pengaturan perlindungan genus ini dan termasuk juga dalam pengaturan kelestarian produksi gaharu alami. Produk gaharu biasanya digunakan sebagai bahan dasar parfum.. Dari hasil studi literatur. 1996).. 11 jenis Eucalyptus (Adjoud et al. Pada kenyataannya ketersediaan bibit biasanya cenderung dibuat dengan kualitas rendah dan mengalami defisiensi unsur hara dan pada akhirnya mengalami kematian yang tinggi pada saat telah ditanam di tingkat lapang. Zizyphus mauritiana (Guissou et al. 1998). Ketersediaan nutrisi tanah merupakan salah satu faktor pembatas untuk pertumbuhan awal dalam kegiatan penanaman bibit-bibit tanaman hutan pada kondisi lahan hutan yang terdegradasi (Santiago et al. Tamarindus indica. Penggunaan bibit tanaman hutan yang vigor sangat diperlukan dalam kegiatan reforestasi. 2002). Sesbania aegyptiaca dan S.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

BAHAN DAN METODE
A. Perbenihan dan Perkecambahan
Benih Aquilaria crassna diperoleh dari Dramaga (Bogor), A. malaccensis dikoleksi dari Desa Gudang (Pulau Bangka), A. microcarpa dari Desa Mianas (Kalimantan Barat), A. beccariana berasal dari Sanggau (Kalimantan Barat). Semua benih Aquilaria spp. direndam selama dua jam, kemudian disterilisasi dengan sodium hypochlorit (5%) selama lima menit. Setelah disterilisasi, benih tersebut dicuci beberapa kali dengan air sampai bersih. Benih Aquilaria spp. dikecambahkan pada bak plastik yang berisi media zeolite. Benih Aquilaria spp. mulai berkecambah 21 hari setelah ditaburkan.

B. Media Semai
Jenis tanah ultisol diambil dari Hutan Penelitian Haurbentes, Jasinga dan kemudian disimpan di rumah kaca. Media semai tersebut disaring dengan diameter saringan lima mm. pH media adalah 4,7; P tersedia (Bray-1) adalah 0,17 mg kg-1, dan N total (Kjeldahl) was 1.7 mg kg-1. Kemudian media semai disterilisasi pada temperatur 121oC selama 30 menit.

C. Inokulum Mikoriza Arbuskula
Fungi mikoriza arbuskula, G. decipiens, G. clarum, Glomus sp. ZEA, dan Glomus sp. ACA diisolasi dari Desa Kalampangan, Palangkaraya, Kalimantan Tengah melalui teknik pot kultur. Teknik pot kultur dimulai dengan cara spora tunggal. Inang yang digunakan untuk mempropagasi FMA adalah Pueraria javanica. Pot plastik diisi dengan zeolite steril dan ditambahkan 5 g dari masingmasing jenis FMA. Kemudian ditanam benih P. javanica yang telah berumur enam hari pada pot plastik tersebut. Pot-pot disusun pada rak-rak besi di rumah kaca dan dipelihara selama 90 hari. Spora, hifa eksternal, dan akar yang terkolonisasi dari masing-masing jenis FMA diamati di bawah mikroskop.

141

Aspek SILVIKULTUR

D. Inokulasi FMA
Polybag (ukuran 15 cm x 10 cm) diisi tanah steril 500 g. Inokulasi FMA diberikan 5 g untuk setiap pot dan diletakkan dekat akar semai Aquilaria spp. Semai empat jenis Aquilaria yang tidak diinokulasi sebagai kontrol. Dari hasil penelitian pendahuluan, penggunaan inokulum steril tidak memberikan pengaruh pertumbuhan pada Aquilaria spp. Semai dipelihara dan disiram setiap hari pada kondisi rumah kaca dan diamati selama 6 bulan. Temperatur di rumah kacar berkisar antara 26-35oC dan kelembaban udara 8090%. Gulma dan hama yang mengganggu semai dimonitor setiap hari.

E. Parameter Pertumbuhan
Percobaan inokulasi pada jenis-jenis Aquilaria terdiri atas (a) kontrol (tanpa inokulum); (b) Entrophospora sp.; (c) G. decipiens; (d) G. clarum; (e) Glomus sp. ZEA; dan (f) Glomus sp. ACA. Desain penelitian dilakukan dengan rancangan acak lengkap (RAL) dengan 30 ulangan. Parameter yang diukur adalah tinggi, diameter, dan daya hidup semai. Setelah berumur enam bulan, dilakukan pemanenan pucuk dan akar semai Aquilaria. Semua sampel di-oven pada suhu 70oC selama tiga hari. Analisis N dan P jaringan semai dilakukan dengan metode semi-micro Kjeldahl dan vanadomolybdate-yellow assay (Olsen and Sommers, 1982). Pada tingkat lapang, percobaan yang dilakukan hanya pada jenis A. beccariana dengan desain RAL yang sama. Percobaan dilakukan di Kawasan Hutan Dengan Tujuan Khusus (KHDTK) Dramaga di bawah naungan tegakan Gmelina arborea. Paramater yang diamati pada tingkat lapang ini adalah tinggi dan diameter A. beccariana yang telah dilakukan selama dua tahun.

F. Kolonisasi Mikoriza Arbuskula
Akar dari masing-masing jenis Aquilaria dicuci untuk membersihkan partikel-partikel tanah yang masih menempel. Akar dibersihkan dalam 100 g l-1 KOH selama satu jam, diasamkan dalam larutan HCl dan diberi warna dengan 500 mg l -1 tryphan blue dalam lactoglycerol (Brundrett et al., 1996). Kemudian akar

142

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

dicuci dalam 50% glycerol dan 100 potong akar berukuran satu cm diamati di bawah mikroskop compound dengan perbesaran 200x. Penghitungan kolonisasi mikoriza dilakukan dengan sistem skoring keberadaan dan tidak adanya struktur FMA (McGonigle et al., 1990).

G. Analisis Statistik
Analisis statistik menggunakan ANOVA dengan software StatView 5.0 (Abacus Concepts). Sedangkan analisis statistik lanjutan menggunakan uji beda nyata terkecil (LSD) apabila nilai F signifikan.

HASIL DAN PEMBAHASAN
Lima jenis fungi mikoriza arbuskula (FMA) sangat efektif mengkolonisasi sistem perakaran dari A. crassna, A. malaccensis, A. Microcarpa, dan A. beccariana setelah enam bulan diinokulasi pada kondisi rumah kaca. Dari hasil penelitian sebelumnya Santoso et al. (2008), kolonisasi FMA yang terjadi pada akar bibit A. microcarpa dimulai sebelum minggu ke-7 setelah inokulasi. Tidak ada perbedaan nyata antara lima jenis FMA dalam mengkolonisasi perakaran empat jenis Aquilaria. Kolonisasi FMA dapat meningkatkan parameter pertumbuhan tinggi, diameter batang, berat kering, berat basah, dan daya hidup semai Aquilaria di persemaian (Tabel 1). Pada jenis A. crassna, A. Malaccensis, dan A. microcarpa, penggunaan FMA Entrophospora sp. lebih efektif meningkatkan parameter pertumbuhan dibandingkan jenis FMA lainnya. Khusus FMA G. clarum sangat efektif meningkatkan parameter pertumbuhan pada jenis A. beccariana. Semai yang tidak diinokulasi terkolonisasi oleh FMA yang tidak teridentifikasi (110%), tetapi tidak dapat mempengaruhi pertumbuhan empat jenis Aquilaria. Kolonisasi FMA mampu meningkatkan serapan N dan P pada jaringan empat jenis Aquilaria dibandingkan semai yang tidak diinokulasi (Tabel 2). Peningkatan serapan N dan P ini memberikan pengaruh pada peningkatan dari parameter pertumbuhan empat jenis Aquilaria. Pada tingkat lapang, dilakukan kegiatan penanaman hanya pada jenis A. beccariana dua tahun setelah diinokulasi oleh FMA. Hasil penelitian pada tingkat lapang menunjukkan bahwa

143

Aspek SILVIKULTUR

jenis G. clarum lebih efektif dalam meningkatkan pertumbuhan A. beccariana dibandingkan dengan kontrol dan jenis FMA lain yang telah diujicobakan. Dari hasil penelitian ini memberikan informasi yang sangat penting dalam memanfaatkan inokulum FMA pada jenis-jenis Aquilaria spp. Regenerasi jenis-jenis Aquilaria yang berkelanjutan dapat dibantu dengan adanya pemanfaatan teknologi FMA dimulai pada saat di persemaian. Penggunaan FMA yang efektif dapat meningkatkan pertumbuhan Aquilaria yang sangat signifikan, sehingga biomassa pohon penghasil gaharu yang akan dipanen akan meningkat, artinya produk gaharu hasil induksi yang akan dipanen lebih meningkat produksinya. Penelitian ini sejalan dengan penelitian yang terdahulu, yaitu tentang pemanfaatan FMA pada 11 jenis Eucalyptus spp. (Adjoud et al., 1996), 17 jenis tanaman legume (Duponnois et al., 2001), Sesbania aegyptiaca dan S. grandiflora (Giri dan Mukerji, 2004). Penelitian pemanfaatan FMA pada jenis-jenis pohon tropika (Muthukumar et al., 2001) dan khususnya jenis-jenis Aquilaria menunjukkan bahwa ada kemungkinan inokulum FMA dapat menurunkan penggunaan pupuk kimia di persemaian. Meskipun perhitungan tentang keuntungan dan biaya penggunaan FMA belum diuji dalam penelitian ini, hasilnya tidak diragukan lagi menunjukkan FMA dapat menurunkan penggunaan pupuk kimia dalam penyediaan semai tanaman penghasil gaharu. Selanjutnya mekanisme penggunaan FMA sebagai pemacu pertumbuhan jenisjenis Aquilaria pada tanah masam dan pada tanah yang populasi FMA sangat rendah harus menjadi perhatian dan pertimbangan untuk mengetahui keberadaan FMA alami. Pola penanaman jenis-jenis Aquilaria dengan pola agroforestry sangat membantu mempercepat ketersediaan pohon-pohon penghasil gaharu di Indonesia. Pada prinsipnya, pencampuran dilakukan untuk melindungi pertumbuhan semai Aquilaria pada tahun pertama dan kedua dari sengatan sinar matahari. Jenis-jenis Aquilaria yang telah dikolonisasi oleh FMA akan dapat mempunyai hubungan antara sistem perakaran pohon jenis-jenis lain, sehingga kebutuhan nutrisi untuk pertumbuhan gaharu dapat terpenuhi.

144

G. kelapa sawit. Gc = G..) Jenis-jenis pohon yang direkomendasikan sebagai pohon pencampur dengan pohon penghasil gaharu adalah pohon karet. gmelina. K = Kontrol. Jenis FMA Entrophospora sp. beccariana lebih memilih jenis FMA G. jengkol. KESIMPULAN DAN REKOMENDASI 1. Gambar 1.(Maman Turjaman.Aca = Glomus sp.. malaccensis. dan beberapa jenis lain pohon buah-buahan.Penggunaan Fungsi Mikoriza . Khusus jenis pohon penghasil gaharu A. Pertumbuhan tinggi dan diameter pohon penghasil gaharu Aquilaria beccariana setelah dua tahun ditanam di tingkat lapang. dkk.. clarum untuk memacu pertumbuhan tanaman dan serapan nutrisinya. ZEA. Penggunaan FMA pada jenis-jenis Aquilaria sangat signifikan dalam memacu pertumbuhan awal di persemaian dan lapangan. baik di tingkat semaian maupun lapangan. melinjo. Gg = G. crassna. sangat efektif dalam memacu pertumbuhan tanaman dan serapan nurtisi pada jenis A. Direkomendasikan untuk menggunakan jenis FMA efektif untuk mempercepat pertumbuhan jenis-jenis Aquilaria mulai di tingkat persemaian. dan A. 2. kelapa.. sengon. microcarpa.ZEA = Glomus sp. Ent = Entrophospora sp. decipiens. A. Ketersediaan inokulum FMA di tingkat 145 . ACA. G.clarum..

Malajczuk. Groningen. 1960.. A. Working with Mycorrhizas in Forestry and Agriculture. Lapeyrie. H. to Arbuscular Mycorrhizal Fungi in a Phosphorus-Deficient Sandy Soil. T. Inoculation of Acacia holosericea with Ectomycorrhizal Fungi in a Semiarid Site in Senegal : Growth Response and Influences on The Mycorrhizal Soil Infectivity After 2 Years Plantation. 1-15. II and III of CITES. Mycorrhiza 6 : 129-135. and B. Ding Hou. Masse and R. DAFTAR PUSTAKA Adjoud.. and K. Founoune. 2005.) Benth. B. Brundrett. p. Biology and Fertility Soils 26 : 194-198. Gravendeel. R.. Bâ. Plenchette. (ed) Flora Malesiana. B. S. Thymelaeaceae.. Duponnois. CITES.M. Responses of Parkia biglobosa (Jacq. Canberra. Dell. 146 . Tamarindus indica L. 2005. T.G. Series I. Mycorrhiza 14 : 307-312. Bougher. Response of 11 Eucalyptus Species to Inoculation with Three Arbuscular Mycorrhizal Fungi. Mukerji. 2004. 1998. Grove and N. ACIAR Monograph 32. Appendices I. C. D.M. agar penggunaan FMA menjadi efektif dan efisien. and Zizyphus mauritiana Lam. Halli-Hargas and F. Guinko and R. UNEP. D.Ouadba.J. 1996. N. R. 48 pp. Forest Ecology and Management 207 : 351-362. M. In : Van Steenis. The Netherlands. Convention on International Trade in Endangered Species of Wild Fauna and Flora. Pontanier (2005). Giri. J-M. 6. Mycorrhizal Inoculant Alleviates Salt Stress in Sesbania aegyptiaca and Sesbania grandiflora Under Field Conditions : Evidence for Reduced Sodium and Improved Magnesium Uptake. TrnL-TrnF Sequence Data Imply Paraphyly of Aquilaria and Gyrinops (Thymelaeaceae) and Provide New Perspectives for Agarwood Identification.G. Guisso.C. Vol.G. Wolters-Noordhoff. Eurlings. Duponnois. 1996. M.Aspek SILVIKULTUR pengguna dan sosialisasi penggunaanya perlu dilakukan. C. Plant Systematics and Evolution 254 : 1-12.

Ex Benth. Phosphorus and Drought Stress on The Growth of Acacia nilotica and Leucaena leucocephala Seedlings. Screening of Arbuscular Mycorrhizal Fungi for Their Symbiotic Efficiency with Tectona grandis. Bagyaraj. 1990. Response of Neem (Azadirachta indica A.M.P.Penggunaan Fungsi Mikoriza . McGonigle. D. Santoso. Indonesia. G. Fairchild and J. Muthukumar. 2002. Essential-Oil Plants. 2008.A. New Phytologist 115 : 495-501. Effect of Post-Planting Inoculation with Bradyrhizobium sp. Plant and Soil 124 : 7-13.J. K. R... Plant Resources of South-East Asia No. Soerianegara and W. Wong (Eds.. Timber Trees : Minor Commercial Timbers. Phosphate-Solubilizing and Asymbiotic Nitrogen-Fixing Bacteria Under Tropical Nursery Conditions. E. Conservation Biology 15 : 1721-1732. 1982. A.J. L. and Mycorrhizal Fungi on The Growth Brazilian Rosewood. 1999. Peart. The Effect of VA Mycorrhizal Fungi. 2001. in Two Tropical Soils. Phosphorus..) Lemmens. and N. Prosea. West Kalimantan.E.. dkk. A New Method Which Gives an Objective Measure of Colonization of Roots by Vesicular-Arbuscular Mycorrhizal Fungi. M. Samsoedin.R. and L. Turjaman. Udaiyan and V. Madison.L. Indonesia. I.W.G. Prosea. New Forests 24 : 15-25. Bogor. Juss) to Indigenous Arbuscular Mycorrhizal Fungi. 2000. American Society of Agronomy. A. M. B. Swan.D.).) Methods of Soil Analysis Part 2 Chemical and Micro-biological Properties. G. 1998.M. Biology and Fertility Soils 34 : 417-426 Olsen. Indonesia. T.A. 2001..R. Reddy and D. Rajeshkannan. Evans. 5 (2). Sommers. Oyen.). Forest Ecology and Management 126: 91-95. 19. Dung (Eds. In : Page AL (ed. p 403-430.. and S.C.X. D. Miller. Dalbergia nigra Allem.. Q. Bogor.. T. G. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil 147 . 1990.(Maman Turjaman.H.J.. Plant Resources of South-East Asia No. An Ecological and Economic Assessment of The Nontimber Forest Product Gaharu Wood in Gunung Palung National Park.. Scotti. Leighton and I. Rosendhal.R.K. S.H. Michelsen. Paoli. Rajan. Gunawan dan M. S.P.D. Santiago. Garcia and M..

148 .Aspek SILVIKULTUR Gaharu. Bogor. Jurnal Penelitian Hutan dan Konservasi Alam IV (5): 499-509. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

Lampiran 1. Kolonisasi mikoriza arbuskula dan pertumbuhan pada jenisjenis Aquilaria setelah enam bulan pada kondisi di rumah kaca
Kolonisasi AM Tinggi (cm) Diameter (mm) Berat basah Pucuk (g) Akar (g) Berat kering Pucuk (g) Akar (g) Daya hidup (%)

Perlakuan

A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA 10a 85b 71b 79b 61b 84b 15,40a 19,20b 32,18d 45,30e 32,03d 26,24c 1,90a 2,37b 3,94c 5,02d 3,75c 3,53c 0,30a 5,46e 4,74d 6,74f 3,14b 3,84c 0,10a 2,54c 1,64b 2,82d 1,38c 1,20b 0,09a 1,76c 1,59c 2,30d 0,97b 1,19b 0,02a 0,78c 0,41b 0,91d 0,36b 0,28b 73 100 100 100 100 100 2a 97b 88b 83b 85b 87b 13,39a 24,74d 21,99c 20,28c 17,24b 18,09b 2,23a 3,89c 3,67c 3,58c 2,84b 2,98b 0,75a 4,32c 3,87c 3,46c 2,24b 2,70b 0,34a 2,29c 3,41d 1,55b 1,08b 1,23b 0,23a 1,31c 1,44c 0,95b 0,64b 0,76b 0,09a 0,37b 0,57c 0,30b 0,24b 0,28b 67 100 97 93 87 90 1a 97b 88b 83b 84b 86b 16,43a 25,97c 21,91b 19,96b 22,33b 21,30b 2,28a 3,88c 3,02b 2,94b 3,26b 3,12b 1,46a 4,68c 2,92b 2,90b 2,62b 2,74b 0,52a 2,24c 1,20b 1,28b 1,38b 1,22b 0,41a 1,44c 0,88b 1,95c 0,79b 0,89b 0,18a 0,48c 0,27b 0,78c 0,27b 0,26b 73 100 100 97 90 93 4a* 73b 63b 78b 78b 59b 20,90 a 46,14 c 29,58 b 32,43 b 38,94 c 24,60 a 2,9 a 5,4 c 4,1 b 4,4 b 4,7 b 3,7 a 0,68a 1,06a 0,33a 3,82b 3,26b 0,86a 2,99b 4,19b 0,13a 1,35b 1,56b 0,27a 1,01b 1,52b 70 100 100 100 87 100

12,58b 5,72b 11,64b 7,36b 8,82b 9,92b 4,3b 4,54b

13,46b 6,94b

149

Aspek SILVIKULTUR

Lampiran 2. Kandungan N dan P pada jenis-jenis Aquilaria setelah enam bulan diinokulasi oleh beberapa jenis fungi mikoriza arbuskula (FMA)
N Concentrations (mg/g) N Content (mg/plant) P Concentrations (mg/g) P Content (mg/plant)

Perlakuan A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA

7,9 ± 0,1a* 9,8 ± 0,1c 8,2 ± 0,2a 8,7 ± 0,2b 8,7 ± 0,1b 10,8 ± 0,2d

2,6 ± 0,6a 37,7 ± 4,3d 26,7 ± 4,1c 7,4 ± 1,0b 25,8 ± 3,6c 45,9 ± 9,6d

0,78 ± 0,02a 1,42 ± 0,03e 0,85 ± 0,02b 0,95 ± 0,02c 0,96 ± 0,03c 1,22 ± 0,02d

0,26 ± 0,06a 5,4 ± 0,6d 2,8 ± 0,5c 0,82 ± 0,14b 2,85 ± 0,41c 5,14 ± 1,0d

8,6 ± 0,2a 12,1 ± 0,1d 10,7 ± 0,1c 10,4 ± 0,1b 11,1 ± 0,2c 10,9 ± 0,2c

3,49 ± 0,5a 17,28 ± 2,0c 9,02 ± 0,7b 20,5 ± 3,3c 8,8 ± 0,9b 9,7 ± 1,8b

0,65 ± 0,02a 0,73 ± 0,01b 0,85 ± 0,01c 0,72 ± 0,02b 0,77 ± 0,03b 1,04 ± 0,03d

0,26 ± 0,04a 1,06 ± 0,15d 0,75 ± 0,07c 1,60 ± 0,20e 0,6 ± 0,07b 0,92 ± 0,17c

7,8 ± 0,1a 9,6 ± 0,2c 9,6 ± 0,1c 9,3 ± 0,1c 9,4 ± 0,1c 8,9 ± 0,2b

1,02 ± 0,07a 16,9 ± 1,5d 11,7 ± 0,9c 8,3 ± 0,4b 9,17 ± 1,35b 8,28 ± 0,40b

0,65 ± 0,02a 1,12 ± 0,03d 0,86 ± 0,01c 0,78 ± 0,02b 0,77 ± 0,03b 0,77 ± 0,02b

0,08 ± 0,01a 1,97 ± 0,18d 1,20 ± 0,18c 0,70 ± 0,03b 0,75 ± 0,12b 0,9 ± 0,1b

6,0 ± 0,1a 9,9 ± 0,2c 10,6 ± 0,1c 11,3 ± 0,d 9,4 ± 0,1b 8,8 ± 0,2b

5,02 ± 0,07a 10,2 ± 1,0c 11,8 ± 0,8c 12,5 ± 0,4d 9,17 ± 1,35b 9,28 ± 0,40b

0,40 ± 0,02a 0,98 ± 0,02d 0,89 ± 0,03c 1,11 ± 0,02e 0,77 ± 0,03b 0,97 ± 0,02d

0,10 ± 0,01a 0,87 ± 0,20d 1,25 ± 0,21c 1,95 ± 0,03e 0,75 ± 0,12b 1,04 ± 0,1c

*Nilai-nilai dengan huruf yang sama adalah tidak berbeda nyata (P<0.05).

150

8
HAMA PADA TANAMAN PENGHASIL GAHARU
Ragil SB Irianto, Erdy Santoso, Maman Turjaman, Irnayuli R. Sitepu
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Tanaman penghasil gaharu yang ada di Indonesia sekitar 27 jenis, beberapa di antaranya yang cukup potensial menghasilkan gaharu yaitu Aquilaria spp., Aetoxylontallum spp., Gyrinops spp., dan Gonystylus spp. Pemanfaatan gaharu di Indonesia oleh masyarakat terutama di pedalaman Pulau Sumatera dan Kalimantan telah berlangsung ratusan tahun yang lalu. Secara tradisional gaharu dimanfaatkan, antara lain dalam bentuk dupa untuk upacara keagamaan, pengharum tubuh dan ruangan, bahan kosmetik dan obat-obatan sederhana. Produk gaharu saat ini sangat dicari oleh para pencari gaharu, karena harganya yang cukup mahal, dimana harga gaharu super dapat mencapai sekitar Rp 40 juta/kg. Akibat dari harga yang cukup tinggi tersebut, maka para pencari gaharu semakin intensif untuk mendapatkannya, saat ini para pencari gaharu mulai memfokuskan mencari gaharu di Pulau Papua yang potensi alamnya (gaharu) masih cukup tinggi dibandingkan dengan di Pulau Kalimantan atau Sumatera.

151

Aspek SILVIKULTUR

Dengan semakin langkanya tanaman penghasil gaharu di lapang dan harganya yang cukup tinggi tersebut, maka para peneliti kehutanan, rimbawan, dan masyarakat awam mulai mendomestikasi atau menanam tanaman penghasil gaharu di luar habitat aslinya. Saat ini banyak sekali para petani maupun orang kota yang mulai menanam tanaman penghasil gaharu dalam skala kecil dari beberapa pohon sampai dengan ribuan pohon. Penanaman tanaman penghasil gaharu yang monokultur dan di luar habitat aslinya pada umumnya akan rentan terhadap serangan hama dan penyakit. Dimulai dua tahun yang lalu banyak sekali sentra penanaman tanaman penghasil gaharu yang terserang hama daun Heortia vitessoides Moore. Sentra penanaman tanaman penghasil gaharu yang terserang hama dan telah dilaporkan terdapat di KHDTK Carita (2008), Sanggau (2007), Mataram (2009), dan lain-lain.

HAMA Heortio vitessoides
A. Gejala Serangan
Gejala serangan tingkat awal adalah permukaan daun yang muda dimakan oleh larva instar pertama dan daun tersebut hanya meninggalkan tulang-tulang daunnya. Pada stadia lebih lanjut ulatulat tersebut mulai menyerang daun-daun pada bagian cabang lebih atasnya dan menyebabkan tanaman menjadi gundul. Ngengat meletakkan telurnya pada bagian bawah permukaan daun yang muda pada cabang tanaman yang dekat dengan permukaan tanah.

B. Siklus Hidup
1. Telur
Ngengat meletakkan telurnya yang berwarna putih kekuningkuningan yang akan segera berubah menjadi kuning kehijauhijauan dalam bentuk kluster pada bagian bawah permukaan daun

152

dkk.. 3. 2.(Ragil SB Irianto. Siklus hidup hama daun tanaman penghasil gaharu H. Larva instar terakhir pada saat akan berkepompong mulai berhenti makan dan ulat turun ke permukaan tanah untuk berkepompong. vitessoides pada instar pertama berwarna kuning pucat dan pada instar selanjutnya menjadi hijau kekuning-kuningan. Ulat akan membungkus dirinya dengan butiran-butiran tanah atau serpihan-serpihan serasah yang ada di permukaan dengan bantuan benang-benang suteranya. Stadium pupa berkisar 8 hari. Telur akan menetas sekitar 10 hari.Hama pada Tanaman . ulat ini terdiri dari 5 instar dan berlangsung selama 23 hari. Pupa Larva instar terakhir sebelum berkepompong akan berhenti makan dan turun ke permukaan tanah dengan bantuan benang sutera yang dihasilkannya... Ngengat Serangga dewasa berbentuk ngengat yang aktif pada waktu malam.. vitessoides 153 . 4. Ngengat betina dapat meletakkan telur sebanyak 350-500. Stadium ngengat berkisar sekitar 4 hari. jumlah telur yang dihasilkan per imago betina berkisar antara 350-500. Ngengat (4 Hari) Kepompong (8 Hari) Telur (10 Hari) Larva (23 Hari) Gambar 1.) yang muda pada cabang tanaman yang dekat dengan permukaan tanah. Larva/Ulat Ulat H.

2. dan lain-lain untuk merangsang tumbuhnya tunas-tunas baru. Mekanis Pengendalian mekanis merupakan pengendalian yang sangat sederhana. yaitu dengan cara mengambil ulat atau telur yang ada di tanaman tersebut. 3. dan lain-lain.Aspek SILVIKULTUR STRATEGI PENGENDALIAN A. seperti tanaman nangka. sistemik atau dengan insektisida yang berbahan aktif mikroorganisme. Pencarian sarang semut rangrang yang memiliki ratu merupakan salah satu faktor 154 . growmore. Pengendalian dengan cara ini mudah diaplikasikan terutama pada pesemaian atau bibit yang baru dua tahun. melinjo. sudah populer di tingkat petani. Predator Rangrang Semut rangrang (Oecophylla smaradigna) merupakan serangga yang mudah ditemukan di kampung-kampung pada tanamantanaman yang banyak mengeluarkan nektar. Karena hama ini memakan daun dan pada serangan berat umumnya tanaman gundul. durian. Jangka Pendek 1. Jangka Menengah 1. dimana tanaman masih bisa dijangkau oleh orang dengan berdiri tanpa bantuan alat. Kimiawi Pengendalian kimiawi dapat dilakukan dengan insektisida kontak. seperti Beauveria bassiana atau Bacillus thuringiensis. rambutan. Nabati Pengendalian nabati merupakan pengendalian yang cukup sederhana dan dapat dilakukan oleh petani sendiri dengan mengambil bahan-bahan yang ada di sekitar lokasi penanaman tanaman gaharu. B. maka disarankan pada saat penyemprotan dikombinasikan dengan pemupukan lewat daun dengan pupuk daun seperti gandasil.

Nath. J... 59 p. T. Agricultural and Forest Entomology 10: 13-22. DAFTAR PUSTAKA Kalita. C.) keberhasilan dalam perkembangan populasi serangga tersebut dalam jangka panjang. Cuc. 155 . dan N. and S. Bhattacharyya.. V. 2008.. Semut Sahabat Petani: Meningkatkan Hasil Buah-Buahan dan Menjaga Kelestarian Lingkungan Bersama Semut Rangrang. 2004. V. P.(Ragil SB Irianto. P. Heortia vitessoides Moore A Serious Pest of Agarwod Plant (Aquilaria malaccensis Lamk).Hama pada Tanaman . Jangka Panjang 1. Teknik Silvikultur Pengendalian dengan cara teknik silvikultur merupakan salah satu cara pengendalian yang sudah menyatu dengan penanaman suatu tanaman dan termasuk pengendalian yang sudah cukup dikenal oleh petani. Musuh Alami Musuh alami. vitessoides merupakan suatu cara pengendalian yang sangat diharapkan dalam jangka panjang. T. dkk. R. ICRAF. 2. P. A Historical Review of Research on The Weaver Ant Oecophylla in Biological Control. C. Mele. 2002. baik parasit maupun predator dari serangga perusak daun tanaman penghasil gaharu H. Geobios 29: 13-16. Mele..

156 .

Aspek SOSIAL EKONOMI DAN KONSERVASI 157 .

158 .

bois d’aigle (Perancis). Gyrinops. Jika tanaman ini terluka. oudh. Sejenis resin beraroma ini berasal dari tanaman jenis Aquilaria. aloeswood. Aquilaria yang merupakan tanaman penghasil gaharu saat ini menjadi jenis yang dilindungi 159 . 2008). rusak atau terinfeksi. gaharu (Indonesia). baik disebabkan penyakit atau serangan serangga. dan adlerholz (Jerman). Resin ini sebetulnya dapat melindungi tanaman dari infeksi yang lebih besar sehingga dapat dianggap sebagai sistim imun yang dihasilkan (Squidoo. dan Gonystylus. oodh (Arab). pau d’aquila (Portugis). chenxiang (China). ood. Beberapa nama diberikan pada gaharu seperti agarwood. akan menghasilkan resin/substansi aromatik berupa gumpalan atau padatan berwarna coklat muda sampai coklat kehitaman yang terbentuk pada lapisan dalam dari jenis kayu tertentu sebagai reaksi dari infeksi/ luka tersebut. Tanaman penghasil gaharu secara alami tumbuh di wilayah Asia Selatan dan Asia Tenggara.9 PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti Pusat Litbang Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu tanaman hutan yang mempunyai nilai ekonomi tinggi karena kayunya mengandung resin yang harum.

Meskipun demikian. eksploitasi gaharu secara ilegal ternyata tetap berlangsung dan konsumen yang kurang memahami hal ini secara tidak sadar justru menciptakan permintaan yang tinggi yang dapat membahayakan keberadaan tanaman Aquilaria (Blanchette. Sampai saat ini.Aspek SOSIAL EKONOMI DAN KONSERVASI di banyak negara dan eksploitasi gaharu dari hutan alam dianggap sebagai kegiatan ilegal. Salah satu bentuk kemitraan yang dapat dikembangkan adalah pola PHBM (Pengelolaan Hutan Berbasis Masyarakat). tingginya harga gaharu dan makin langkanya tanaman gaharu di hutan alam juga mendorong masyarakat di berbagai daerah untuk melakukan budidaya gaharu seperti yang terjadi di Riau. Sebagai akibatnya pada beberapa tahun terakhir ada kecenderungan besar-besaran untuk mambudidayakan gaharu terutama di wilayah Asia Tenggara (Squidoo. 2006). Namun karena pengusahaan gaharu memerlukan modal yang tidak sedikit. maka masyarakat yang mampu membudidayakan gaharu adalah kelompok yang memiliki permodalan yang kuat. Upaya pembudidayaan tersebut makin berkembang karena ditunjang oleh kemajuan hasil penelitian yang menunjukkan bahwa budidaya gaharu memberikan keuntungan yang layak bagi pelakunya. Kesepakatan internasional seperti CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) yang disepakati oleh 169 negara ditetapkan untuk menjamin bahwa perdagangan gaharu tidak mengganggu survival dari Aquilaria. Di Indonesia. Pengembangan budidaya gaharu dengan pola PHBM (sistem bagi hasil) merupakan salah satu alternatif bentuk usahatani produktif yang selain bertujuan untuk mengembangkan budidaya gaharu secara luas juga sekaligus dapat meningkatkan pendapatan masyarakat serta mengurangi tekanan masyarakat terhadap hutan yang tingkat ketergantungannya terhadap hutan tinggi. permintaan akan gaharu jauh melebihi supply yang ada. perlu dikembangkan suatu skema kerjasama antara pemilik modal dengan masyarakat. dan Kalimantan Selatan. Sumatera Utara. Untuk mengembangkan budidaya gaharu secara lebih luas. PHBM diharapkan menjadi suatu cara yang efektif karena melibatkan masyarakat sekitar hutan dan parapihak pemangku 160 . Jambi. 2008).

..... Khusus untuk perhitungan analisis finansial usahatani gaharu digunakan kriteria kelayakan Net Present Value (NPV). laporan hasil penelitian... saling memperkuat..... tingkat diskonto atau potongan (=bunga bank yang berlaku)......... (1) dimana: NPV Bt Ct i n = = = = = Net Present Value (Nilai Kini Bersih). Departemen Kehutanan.... Internal Rate of Return (IRR).. NPV atau nilai kini bersih dirumuskan sebagai berikut: n Bt − Ct NPV = ∑ t =0 (1 + i)t ..... diolah dan Dianalisis secara deskriptif... benefit atau penerimaan pada tahun t... hak dan kewajiban) dengan prinsip saling menguntungkan...Prospek Pengusahaan Gaharu .... BPS...... waktu...... Asosiasi Gaharu Indonesia (Asgarin). IRR atau tingkat pengembalian internal dirumuskan sebagai berut: 161 ....... Tulisan ini bertujuan untuk memberikan gambaran tentang prospek pengusahaan gaharu oleh masyarakat melalui pola pengelolaan hutan berbasis masyarakat (PHBM).... Suatu kegiatan usaha dinyatakan layak secara finansial bila nilai NPV > 0. Data dan informasi yang berhasil dihimpun........... dan saling mendukung... dan data statistik yang tersedia. METODOLOGI Tulisan ini merupakan hasil desk study dari berbagai pustaka.. serta berbagai terbitan lainnya.... umur ekonomi proyek (cakrawala waktu).(Sri Suharti) kepentingan lainnya untuk bekerjasama dan berbagi (ruang.. biaya pada tahun t... dan Benefit Cost Ratio (B/C )......... CITES... Data dan informasi serta literatur tersebut dihimpun dari berbagai sumber antara lain..

............. umur ekonomis proyek. Selanjutnya...... tingkat diskonto....... (3) dimana: B/C Bt Ct i n = = = = = Benefit Cost Ratio ( Rasio penerimaan-biaya).. Prospek Pasar Gaharu Indonesia adalah produsen gaharu terbesar di dunia dan menjadi tempat tumbuh endemik beberapa spesies gaharu komersial dari 162 . Suatu bisnis dinyatakan layak secara finansial bilai nilai IRR lebih besar dari tingkat suku pinjaman di bank yang berlaku saat ini... nilai B/C dirumuskan sebagai beikut: n Bt ∑ t =0 (1 + i)t B/C = n Ct ∑ t =0 (1 + i)t ... biaya pada tahun t...................................... tingkat diskonto untuk menghasilkan NVP2 negatif mendekati nol........ benefit atau penerimaan pada tahun t.......Aspek SOSIAL EKONOMI DAN KONSERVASI IRR = i1 + NPV1 NPV1 − NPV2 (i2 − i1) .............. tingkat diskonto untuk menghasilkan NPV1 mendekati nol. Kegiatan usaha dikatakan layak apabila B/C > 1............ (2) dimana: IRR = i1 = NPV1 = i2 = Internal Rate of Raturn (tingkat keuntungan internal)...................... nilai NPV mendekati nol positif....... NPV2 = nilai NPV negatif mendekati nol... PROSPEK PENGUSAHAAN GAHARU A..........

Bahkan sejak tahun 2000. Selain itu.487 ton. Hal ini banyak dikeluhkan oleh beberapa eksportir gaharu Indonesia. maka sejak tahun 2005 Departemen Kehutanan kembali menurunkan kuota ekspor menjadi hanya 125 ton/tahun (Anonim. microcarpa.245 kg pada tahun 2005 menjadi 39. 2004). A. Perkembangan yang terjadi selanjutnya ternyata kurang begitu bagus.. total ekspor gaharu dari Indonesia terus menurun hingga jauh di bawah ambang kuota CITES. beccariana.400 kg tahun 2006. tetapi juga digunakan sebagai bahan baku obat-obatan. Pada tahun 1985. Seiring dengan kemajuan ilmu pengetahuan dan teknologi industri. filarial. Permintaan terhadap gaharu terus meningkat karena banyaknya manfaat gaharu. dan Gyrinops spp.. Selanjutnya. A.. kosmetika. dan lain-lain. malaccensis. gaharu tidak hanya digunakan sebagai bahan wangi-wangian (industri parfum). Oleh karena itu pada tahun 1995 CITES memasukkan A. A.. Ekspor untuk pasar Timur Tengah sebagai contoh menurun dari 67.) dimasukkan dalam Apendix II pada konvensi CITES tanggal 2-14 Oktober 2004 di Bangkok (Gun et al. namun eksploitasi hutan alam tropis dan perburuan gaharu yang tidak terkendali telah mengakibatkan spesies-spesies gaharu menjadi langka. dan pengawet berbagai jenis asesoris. karena sulitnya memperoleh bahan 163 .(Sri Suharti) marga Aquilaria seperti A.Prospek Pengusahaan Gaharu . beberapa agama di dunia mensyaratkan wangi gaharu yang dibakar sebagai sarana peribadatan (untuk keperluan kegiatan religi). Semakin sulitnya mendapatkan gaharu di hutan alam telah mengakibatkan semua pohon gaharu (Aquilaria spp. dupa. malaccensis.. Tingginya harga jual gaharu mendorong masyarakat untuk memburu gaharu. karena adanya kekhawatiran akan punahnya spesies gaharu di Indonesia. 2005). Namun dari sisi negara pengekspor. tingginya permintaan gaharu belum dapat dipenuhi karena kekurangan bahan baku bermutu tinggi untuk ekspor. hirta. penghasil gaharu terbaik ke dalam daftar Ap-pendix II dan sejak saat itu ekspor gaharu dibatasi oleh kuota yaitu hanya 250 ton/tahun (Anonim. 2005). jumlah ekspor gaharu Indonesia mencapai sekitar 1. A. tidak hanya dengan cara memungut dari pohon gaharu yang mati alami melainkan juga dengan menebang pohon hidup.

000 kg) 148.826 n/a n/a Total ekspor gaharu (semua spesies)*) n/a≠ 299. Sebagai contoh.079 81.593 287. Sebagai gambaran. **): CITES Annual Report Data Compiled by UNEP-WCMC.000-50.000 68. Pada tahun 1980. pada tahun 2006 hanya mampu mengekspor 2-3 ton/bulan (Adijaya. 2009).000 75.2003 Kuota hasil panen resmi*) n/a 300. Kenaikan pesat terjadi pada saat krisis ekonomi melanda Indonesia tahun 1997.000 50.000 180. Penurunan kemampuan ekspor Indonesia tersebut sangat berpengaruh terhadap perkembangan harga gaharu.Aspek SOSIAL EKONOMI DAN KONSERVASI baku gubal super yang diminta.649 245.000 Kuota hasil aktual*) n/a 160. baik di pasar dunia maupun di tingkat pengumpul. pada Tabel 1 disajikan data hasil kajian tentang perdagangan gaharu di Indonesia yang diterbitkan CITES pada tahun 2003.000 75.377 74.577 293. Tabel 1.593 305.401 81.150 219.000/kg pada tahun 1993. ≠): the reason for the unavailability of data for 1995 1nd 1998 is not known 164 .377 74. eksportir di Jakarta yang pada tahun 2005 bisa mengekspor 5-6 ton/bulan. Keluhan kekurangan bahan baku gaharu untuk ekspor juga dialami oleh pemasok pasar Singapura.245 n/a Tahun 1995 1996 1997 1998 1999 2000 2001 2002 2003 *): CITES Management Authority of Indonesia.483 147.000 70. Penurunan kemampuan ekspor Indonesia tersebut sudah diprediksi oleh berbagai pihak karena eksploitasi hutan dan perburuan gaharu yang tidak terkendali.772 175. filarial dan jenis lain 287.000 150.000/ kg untuk kualitas rendah dan Rp 80.000 300.212 76. harga gaharu di tingkat pengumpul berkisar antara Rp 30.000 120. CV Ama Ina Rua. Hasil pemanenan dan ekspor gaharu jenis Aquilqria spp.000/kg untuk kualitas super.filarial 180.000 Aktual ekspor berdasar CITES Indonesia*) n/a≠)) 299.238 81.546 n/a Net ekspor laporan CITES **) 323.000 225.000 225.002 (termasuk A. Pada awalnya kenaikan harga gaharu relatif lambat.826 70. dari Indonesia tahun 1995 .000 300.000 150.002 n/a ≠) 313.000 50. yaitu hanya naik menjadi Rp100.523 (termasuk A.

Marga Aquilaria terdiri dari 15 spesies. Kamboja. dan Gonystilus yang keseluruhannya termasuk dalam famili Thymelaeaceae.. Gyrinops.09 juta ha. Hutan Produksi Terbatas 22..8 juta ha.(Sri Suharti) di mana harga gaharu mencapai Rp 3-5 juta/kg. A.5 juta ha. Kondisi tersebut menggambarkan bahwa gaharu sangat prospektif untuk dikembangkan. Potensi dan Peluang Usaha Sebagaimana diuraikan sebelumnya. terdiri dari Kawasan Suaka Alam dan Pelestarian Alam 23. A. A. 2009. microcarpa. Hutan Produksi Tetap 36.. Indonesia memiliki potensi yang sangat besar untuk menghasilkan gaharu.Prospek Pengusahaan Gaharu .23 juta ha (Departemen Kehutanan. 2007). beccariana.. China Selatan. Lao PDR. malaccensis. Thailand. Myanmar. Pada saat ini luas kawasan hutan dan perairan Indonesia berdasarkan Keputusan Menteri Kehutanan tentang Penunjukkan Kawasan Hutan dan Perairan serta Tata Guna Hutan Kesepakatan (TGHK) tercatat seluas 137. 165 . Enam di antaranya ditemukan di Indonesia (A.31 juta ha. cumingiana.65 juta ha. Dari kawasan hutan tersebut khususnya dari kawasan hutan produksi alam. sehingga produksi gaharu Indonesia terus menurun. hirta. A. Wiguna. dan Indonesia. Philipina. khususnya bagi Indonesia yang memiliki potensi biologis yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. dihasilkan gaharu sebagai salah satu hasil hutan bukan kayu yang bernilai ekonomi tinggi. 2006).6 juta ha. B. dan Taman Buru 0. Hutan Lindung 31. tersebar di daerah tropis Asia mulai dari India. Kenaikan harga gaharu terus berlanjut dan makin tajam hingga mencapai Rp10 juta/ kg pada tahun 2000 dan meningkat lagi hingga mencapai Rp 15 juta/ kg pada tahun 2009 (Adijaya. Hutan Produksi yang Dapat Dikonversi 22. Gaharu dihasilkan oleh pohon-pohon terinfeksi yang tumbuh di daerah tropika dan memiliki marga Aquilaria. Pakistan. namun potensi yang tersedia tersebut sampai saat ini belum dimanfaatkan secara optimal dan produksi gaharu lebih banyak berasal dari proses alami. Malaysia.

Jika ditanam secara monokultur dan tanpa naungan resiko kegagalan penanaman (tanaman muda) lebih tinggi. pulai seperti yang dikembangkan di KHDTK Carita. Bali. sawit. Philipina. Pemanenan dapat dilakukan pada kondisi pohon belum mati. Kalimantan. 2002). HTI.Aspek SOSIAL EKONOMI DAN KONSERVASI dan A. Indonesia. dan kepulauan Solomon serta kepulauan Nicobar. Sabah. kelapa. Beberapa alternatif pengembangan budidaya pohon penghasil gaharu selain pada hutan produksi (LOA). dan lain-lain). Enam di antaranya tersebar di Indonesia bagian timur serta satu spesies terdapat di Srilanka (Anonim. filarial). penanaman pohon gaharu sebaiknya dilakukan secara tumpangsari atau berada di bawah naungan tegakan lain seperti karet. Hutan Rakyat juga dapat ditanam pada areal tanaman perkebunan (karet. Setelah tanaman penghasil gaharu berumur 5 tahun dengan diameter 15 cm. Maluku. 2007). Serawak. Papua New Guinea. kecuali Jawa. Pembudidayaan tanaman penghasil gaharu dapat dilakukan secara monokultur maupun tumpangsari dengan tanaman lainnya. Karena sifat permudaan gaharu yang toleran terhadap cahaya (butuh naungan). Marga Gyrinops memiliki tujuh spesies. Berbagai hasil penelitian tentang tanaman gaharu memberikan hasil yang sangat menggembirakan karena berbagai jenis tanaman gaharu dari hutan alam ternyata dapat dibudidayakan dan produksi gaharu dapat direkayasa. Persyaratan tumbuh serta pemeliharaan tanaman penghasil gaharu relatif tidak terlalu rumit. dan Irian Jaya. Marga Gonystilus memiliki 20 spesies. tetapi idealnya dipanen setelah pohon mati dengan variasi mutu produksi akan terdiri dari kelas gubal. dan Nusa Tenggara. kemedangan. durian (Rizlani dan Aswandi. sawit. Hasil rekayasa tersebut dapat dipanen satu atau dua tahun kemudian. Sembilan spesies di antaranya terdapat di Indonesia yaitu di Sumatera. dan abu/ bubuk (Sumarna. Bali. Keenam jenis tersebut terdapat hampir di seluruh kepulauan Indonesia. Peninsula. rekayasa produksi untuk menghasilkan gaharu sudah dapat mulai dilakukan dengan cara teknik induksi/inokulasi penyakit pembentuk gaharu yang sesuai dengan jenis pohon. tersebar di Asia Tenggara mulai dari Malaysia. mahoni. 2009) atau di bawah tegakan pohon hutan seperti meranti. Keberhasilan berbagai hasil penelitian 166 .

C. sehingga total produksi 480 kg/ha dengan 3 kualitas masingmasing kelas kemedangan I sebesar 10%. malaccensis seluas lebih dari 10 hektar. Sebagai contoh usaha yang dilakukan oleh para petani di Desa Pulau Aro. Kelayakan Pengusahaan Gaharu Untuk memperoleh gambaran bagaimana kelayakan pengusahaan gaharu melalui budidaya dan rekayasa produksi gaharu. malacensis dan A. 2008). Tanaman yang bertahan hidup dan menghasilkan gaharu diasumsikan 60% dengan tingkat produksi 2 kg per pohon. sampai akhir tahun 2002 terdapat sekitar 116 petani yang tergabung dalam Kelompok Tani Penghijauan Indah Jaya yang telah mengembangkan lebih dari seratus ribu bibit gaharu (Anonim. yang menanam gaharu dari jenis A. microcarpa.(Sri Suharti) tersebut makin mendorong dan menggugah pemburu gaharu untuk melakukan budidaya tanaman gaharu. Di desa tersebut. Selanjutnya pada tahun 2001-2002 beberapa individu atau kelompok tani juga mulai tertarik untuk membudidayakan jenis pohon penghasil gaharu. kelas kemedangan II sebesar 40%. Selain itu Dinas Kehutanan Riau juga menanam jenis yang sama seluas 10 hektar di Taman Hutan Raya Syarif Hasyim. Jambi. 167 . Analisis finansial tersebut menggunakan beberapa batasan dan asumsi sebagai berikut: 1.. PT Budidaya Perkasa di Riau dengan menanam A.. 2007). berikut ini dilakukan contoh analisis finansial budidaya gaharu dengan asumsi tingkat keberhasilan mencapai 60%. 2. Kabupaten Merangin.Prospek Pengusahaan Gaharu . BP DAS Batanghari bekerjasama dengan Badan Litbang Kehutanan pada 2004/2005 membuat demplot budidaya gaharu di antara tegakan tanaman karet rakyat seluas 50 ha (Sumarna. Selain itu. Pengusahaan gaharu dilakukan pada luasan satu ha dengan jarak tanam 5 m x 5 m. sehingga kerapatan 400 pohon per hektar... dan kelas kemedangan III sebesar 50%. Kecamatan Tabir Ulu. Upaya pembudidayaan gaharu sudah mulai dirintis sejak tahun 1994/1995 oleh sebuah perusahaan pengekspor gaharu.

Harga inokulan diasumsikan Rp 50. dan B/C = 3.Aspek SOSIAL EKONOMI DAN KONSERVASI 3. Namun di sisi lain juga dijumpai beberapa kasus ketidakberhasilan pengusahaan gaharu yang disebabkan antara lain oleh kegagalan dalam pemeliharaan. PROSPEK PENGUSAHAAN GAHARU DENGAN POLA PHBM A. Kalau diperhatikan lebih seksama.47% dari total biaya. Upah tenaga kerja.53%. kelas kemedangan II = Rp 2 juta/ kg.32 (Lampiran 1). Berdasarkan asumsi dan batasan tersebut ternyata untuk pengusahaan satu hektar gaharu dibutuhkan biaya sebesar Rp 141. Harga jual produksi gaharu hasil inokulasi untuk kelas kemedangan I = Rp 5 juta/kg. 4. Peluang Pengembangan Gaharu dengan Pola PHBM Pembudidayaan tanaman penghasil gaharu akhir-akhir ini makin marak karena sebagian masyarakat sudah dapat menikmati hasilnya. 2009). dan kelas kemedangan III = Rp 500 ribu/kg. 168 . dan adanya pencurian pohon di kebun gaharu (Duryatmo. Biaya tersebut meliputi biaya pra-investasi dan persiapan lahan serta penanaman sebesar Rp 26. biaya bahan dan peralatan Rp 40. beban biaya yang relatif besar adalah untuk pembelian bahan inokulan.74 juta/ ha.000/pohon.000/pohon.350 juta.350 juta. dan tenaga kerja untuk pemungutan hasil (panen) yang besarnya mencapai Rp 77 juta atau sekitar 54. sehingga total biaya inokulan Rp 20 juta/ha. Analisis finansial menggunakan tingkat diskonto sebesar 15%. 5. baik tenaga kerja keluarga maupun luar keluarga diasumsikan sebesar Rp 50. sedangkan upah tenaga kerja untuk inokulasi Rp 30. 6. dan biaya tenaga kerja Rp 74. kegagalan dalam melakukan inokulasi.000/HK.50 juta. Hasil analisis finansial menunjukkan bahwa pengusahaan gaharu tersebut layak untuk dilaksanakan karena dapat menghasilkan keuntungan bersih nilai kini (NPV) sebesar Rp 147.50 juta. IRR sebesar 48. tenaga kerja untuk inokulasi.

dan pengelolaan hutan (Hayat.. pemeliharan.. dan lain-lain) dapat ikut berperan dalam pengusahaan tanaman gaharu. akses pasar. Pada areal hutan milik. Masyarakat dengan keterbatasan sumberdaya yang dimiliki (lahan. dan di sisi lain. pengusaha/investor.Prospek Pengusahaan Gaharu . masyarakat di dalam dan di sekitar kawasan hutan dapat menjadi aset bagi usaha-usaha penjagaan. Pengembangan gaharu dengan pola PHBM dapat dilakukan. Melalui pola PHBM.. 2007). baik dalam areal hutan milik (hutan rakyat) maupun dalam kawasan hutan Negara. Dengan pola ini diharapkan areal tanam dan juga kualitas dan kuantitas produksi gaharu akan dapat ditingkatkan. masyarakat diharapkan melakukan penanaman gaharu pada lahannya sendiri terutama pada lahan kosong (tidak produktif ) secara swadaya. sarana prasarana. Perubahan paradigma ke arah PHBM menjadi momentum penting bagi masyarakat desa hutan. Di satu sisi masyarakat dapat mendayagunakan potensi-potensi kehutanan untuk kesejahteraan mereka. Salah satu bentuk kemitraan yang dapat dikembangkan adalah melalui pola pengelolaan hutan berbasis masyarakat (PHBM). Karena bentuk kerjasamanya adalah kemitraan. input produksi.(Sri Suharti) Untuk lebih membudayakan penanaman gaharu secara luas. perlu dikembangkan suatu pola kemitraan dalam budidaya tanaman penghasil gaharu. meningkatkan peluang keberhasilan serta mengurangi resiko kerugian yang diderita. 169 . kelompok usaha bersama/koperasi. PHBM merupakan salah satu jawaban dari pergeseran paradigma dalam pengelolaan sumberdaya hutan dari yang berbasis negara (state based) ke arah yang berbasis komunitas/masyarakat (community based) (Indradi. keterampilan. baik di lahan milik di luar kawasan hutan maupun di kawasan hutan. 2009).. masyarakat) dapat berbagi peran dan tanggung jawab untuk mengembangkan tanaman gaharu. maka parapihak yang terlibat dalam kegiatan ini dapat memperoleh bagian/ sharing manfaat sesuai kontribusi masing-masing. parapihak yang tertarik (pemerintah. Pengembangan gaharu melalui pola PHBM merupakan salah satu alternatif peningkatan produksi gaharu melalui pelibatan masyarakat dalam budidaya gaharu.

Oleh karena kawasan hutan umumnya sudah ditumbuhi dengan berbagai jenis tumbuhan. biaya inokulasi tanaman maupun informasi tentang peluang dan teknik pengembangan gaharu. Adanya peningkatan kesejahteraan dari budidaya gaharu selanjutnya akan mengurangi tekanan masyarakat terhadap sumberdaya hutan dalam bentuk illegal logging dan perambahan lahan bahkan masyarakat secara sadar akan mempertahankan 170 . baik dalam bentuk bantuan/hibah maupun melalui sistim kredit yang akan dibayar jika tanaman gaharu telah menghasilkan nantinya. Pengembangan tanaman gaharu dalam kawasan hutan dapat dilakukan melalui pelibatan masyarakat sekitar hutan dalam pengelolaan hutan.Aspek SOSIAL EKONOMI DAN KONSERVASI Agar masyarakat bersedia menanam gaharu. proporsi tanaman gaharu yang ditanam disesuaikan dengan luasan dan kondisi areal hutan milik yang ada. maka pola tanam yang dikembangkan adalah pola tumpangsari (sisipan atau tanaman sela di antara tegakan yang sudah ada). Dampak positif yang terjadi selanjutnya adalah sumberdaya hutan akan lebih terjaga dan terpelihara. Dalam prakteknya pengembangan hutan rakyat gaharu umumnya dikombinasikan dengan tanaman semusim atau tahunan lainnya yang sudah ada (tanaman sisipan). Pengadaan bibit dan inokulasi dapat difasilitasi oleh mitra kerjasama yang disalurkan kepada petani. Hal ini sesuai dengan paradigma pembangunan kehutanan yang lebih menitikberatkan pada peningkatan partisipasi masyarakat dalam pengelolaan hutan dan menempatkan masyarakat desa hutan sebagai patner/mitra menuju pengelolaan hutan lestari. maka perlu diberikan berbagai bentuk insentif. sosial maupun ekologi. Berbagai hasil penelitian menunjukkan bahwa pola kerjasama kemitraan pengelolaan hutan dengan masyarakat desa hutan memberikan dampak positif. baik secara ekonomi. Keterlibatan masyarakat dalam pengelolaan hutan meningkatkan posisi tawar serta rasa memiliki masyarakat terhadap sumberdaya hutan yang ada. biaya tanam. produktivitas meningkat serta kesejahteraan masyarakat akan meningkat pula. Oleh karena lahan milik rakyat umumnya tidak begitu luas dan sudah ditumbuhi berbagai jenis tanaman. baik berupa pengadaan bibit.

.. apapun penyebabnya (Aswandi.(Sri Suharti) setiap jengkal hutan dari kerusakan. 171 ..Prospek Pengusahaan Gaharu . Menempatkan masyarakat sebagai mitra dalam pengelolaan hutan secara tidak langsung juga telah memposisikan masyarakat sebagai garda terdepan dalam pengamanan sumberdaya hutan. 2009). Adanya tujuan bersama yang ingin dicapai. pemeliharaannya relatif mudah dan bernilai ekonomi tinggi. B. Tanaman gaharu dipilih karena tanaman ini dapat tumbuh di dalam areal hutan yang sudah banyak ditumbuhi tegakan pohon dengan intensitas cahaya < 70%. Beberapa skenario sebagai alternatif bentuk kemitraan yang dapat dikembangkan antara lain sebagaimana disajikan dalam Tabel 2. Beberapa prinsip utama yang dipegang dalam pengembangan gaharu dengan pola PHBM adalah: 1. 2.. Pengembangan kerjasama memang layak secara ekonomi dalam jangka panjang (sesuai jangka waktu kontrak perjanjian kerjasama). Adanya pengaturan kerjasama yang saling menguntungkan dan adil sesuai dengan kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan bersama. Dari sisi masyarakat. 4. Sistim Bagi Hasil dalam PHBM Pengembangan gaharu dengan pola PHBM merupakan salah satu alternatif usaha yang dapat mengakomodasikan kepentingan ekologi di satu sisi dan pertimbangan ekonomi di sisi lain. 3. Adanya kesepahaman tentang resiko dan konsekuensi dari adanya perjanjian kerjasama tersebut. pengembangan gaharu dengan pola PHBM memberikan peluang kepada masyarakat untuk memperoleh manfaat ganda yaitu dari hasil tanaman gaharu jika telah menghasilkan nantinya serta kesempatan untuk memanfaatkan lahan di antara tanaman untuk usahatani tanaman semusim.

Besarnya bagi hasil yang diperoleh oleh masingmasing pihak yang terlibat dalam PHBM disesuaikan dengan kontribusi masing-masing pihak dan merupakan hasil kesepakatan bersama. Konsekuensinya. Sebagaimana sifat usahatani skala kecil oleh masyarakat yang ketergantungannya terhadap lahan usahatani yang dimiliki/digarap sangat tinggi. Dengan pola PHBM. Pemda/Pihak lain Sebagaimana diuraikan sebelumnya. sepanjang modal yang dimiliki mencukupi untuk biaya budidaya tanaman berikut biaya inokulasinya yang cukup besar. maka gaharu bukan merupakan komoditi utama yang diusahakan. Petani. populasi tanaman gaharu dalam setiap garapan petani berjumlah relatif sedikit serta tidak seragam. Investor/Pengusaha. tergantung luas lahan garapan dan kepadatan tanaman yang ada. 3. Alternatif bentuk kemitraan yang dapat dikembangkan Jenis input Skenario I 1 Lahan Saprodi Tenaga kerja Bahan inokulan Biaya inokulasi Pengolahan hasil Pemasaran √ √ √ √ √ √ √ 2 3 Skenario II 1 √ √ √ √ √ √ √ 2 3 Skenario III 1 √ √ √ √ √ √ √ √ √ √ √ √ 2 3 Skenario IV 1 2 3 √ √ Keterangan: 1. Gaharu diusahakan sebagai investasi jangka panjang. budidaya gaharu oleh masyarakat umumnya dilakukan dalam skala kecil dengan pola campuran. Berbeda dengan pengusahaan gaharu skala besar yang dilakukan oleh para investor. pengembangan gaharu dengan pola PHBM dapat dilakukan di areal hutan milik maupun di dalam kawasan hutan sepanjang persyaratan tumbuhnya terpenuhi. teknologi serta akses terhadap pasar dapat ikut berpartisipasi dalam budidaya tanaman gaharu. 2. diharapkan masyarakat yang memiliki banyak keterbatasan. baik dari segi permodalan. Dengan demikian meskipun investor/penyandang dana 172 .Aspek SOSIAL EKONOMI DAN KONSERVASI Tabel 2.

mahoni. pulai.. di areal tersebut juga terdapat berbagi pohon hutan seperti meranti. Kegiatan dilaksanakan dengan melibatkan masyarakat yang telah berusahatani di areal tersebut untuk ikut mengembangkan tanaman penghasil gaharu di lahan garapan mereka. maka pola tanam yang diterapkan adalah pola tumpangsari (sisipan di antara tanaman yang ada). Apalagi jika pengembangan kemitraan dengan pola PHBM bertujuan untuk meningkatkan kelestarian sumberdaya hutan (dalam hal ini tanaman gaharu yang sudah langka) dan meningkatkan kesejahteraan masyarakat desa hutan dan bukan semata-mata untuk tujuan komersial (mendapat profit terbesar). khaya. Uji Coba Pengembangan Gaharu dengan Pola PHBM di KHDTK Carita Di areal KHDTK Carita.. Kegiatan dilaksanakan pada sebagian Petak 21 di areal KHDTK Carita dengan luas ± 40 hektar.. dan hawuan. durian. Kelompok masyarakat yang terlibat dalam kegiatan penelitian ini berasal dari Desa Sindang Laut dan Desa Suka Jadi tepatnya dari Kampung Longok. petai. Uji coba ini merupakan kerjasama antara Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam dengan masyarakat sekitar areal KHDTK Carita. Selama ini masyarakat ikut menggarap lahan di Petak 21 dengan budidaya berbagai tanaman jenis pohon serbaguna (JPSG) dan buah-buahan seperti melinjo.. C. dan nangka. Gaharu ditanam dengan jarak ± 5 m x 5 m. jengkol. belum tentu bagian hasil/sharing yang diperolehnya akan paling besar pula. Selain tanaman JPSG milik masyarakat. Oleh karena areal kerjasama sudah ditumbuhi berbagi jenis tumbuhan. Dengan demikian jumlah 173 . dan Cilaban sebanyak 49 orang (anggota Kelompok Tani Hutan Giri Wisata Lestari yang dipimpin Ustad Jafar sebanyak 40 orang dan Kelompok Tani Hutan Carita Lestari pimpinan Pak Rembang sebanyak 19 orang). Banten pada tahun 2008 telah dikembangkan uji coba skema kemitraan budidaya tanaman penghasil gaharu dengan pola PHBM. cengkeh. Cangkara.(Sri Suharti) memberikan kontribusi input dengan porsi terbesar. Banten.Prospek Pengusahaan Gaharu .

Sebelum penanaman. Pihak pertama menyediakan biaya bagi pihak kedua untuk melakukan kegiatan budidaya penanaman pohon gaharu yang meliputi biaya upah dan bibit tanaman. Setelah diperoleh gambaran prospek partisipasi masyarakat dalam pembangunan demplot uji coba ini dilanjutkan dengan penyusunan rancangan teknis kerjasama penelitian dan penyusunan draft perjanjian kerjasama.Aspek SOSIAL EKONOMI DAN KONSERVASI tanaman gaharu yang ditanam di areal kerjasama sebanyak 15. kegiatan pembangunan demplot uji coba tanaman penghasil gaharu di KHDTK Carita diawali dengan pendekatan yang lebih intensif kepada berbagai pihak yang terkait pengembangan gaharu di areal tersebut seperti Perhutani. dan masyarakat calon peserta untuk mempelajari prospek partisipasi masyarakat dalam kegiatan dan pemeliharaan tanaman. Pihak pertama akan membantu mencarikan investor untuk bekerjasama menyediakan produksi jamur pembentuk gaharu untuk kegiatan inokulasi untuk 75% tanaman gaharu lainnya. 4. 2. Pemda. Pihak pertama memberikan pembinaan teknis budidaya tanaman gaharu secara rutin kepada pihak kedua. 3. Dengan pendekatan yang lebih intensif ini diharapkan masyarakat akan lebih memahami tujuan kerjasama penelitian serta dapat lebih aktif berpartisipasi dalam budidaya tanaman plot uji coba. Pihak pertama akan memberikan pelatihan budidaya gaharu serta pemanenan gaharu (paket training gaharu) kepada pihak kedua. 174 .000 pohon (± 400 pohon/ha). Beberapa prinsip utama yang disepakati antara pihak pertama (Puslitbang Hutan dan Konservasi Alam) dengan pihak kedua (kelompok masyarakat peserta uji coba) dalam pola kemitraan di areal KHDTK carita adalah: 1. Pihak pertama menyediakan jamur pembentuk gaharu untuk kegiatan inokulasi sebanyak 25% dari jumlah tanaman gaharu pada masing-masing penggarap setelah tanaman gaharu berumur ≥ 5 tahun. 5.

.5%. maka resiko akan ditanggung bersama sehingga perhitungan bagi hasil pada saat panen ditentukan dengan rumus sebagai berikut: = P akhir ∑ tan total − ∑ tan mati x P awal ∑ tan total Keterangan: Pakhir = Proporsi bagi hasil tanaman gaharu yang diterima masingmasing pihak jika ada tanaman yang mati/hilang/tidak/ belum menghasilkan = Proporsi bagi hasil tanaman gaharu sesuai kesepakatan yang tertuang dalam perjanjian kerjasama ini Pawal Butir-butir kesepakatan tersebut tertuang dalam naskah perjanjian kerjasama yang disusun berdasarkan hasil kesepakatan/ negosiasi antara pihak pertama dan pihak kedua. Pihak kedua berkewajiban memelihara dan menjaga keamanan tanaman gaharu dan tanaman hutan lainnya.. Pihak kedua berkewajiban melaporkan setiap kejadian seperti serangan hama/penyakit tanaman. sebagian hasil tanaman gaharu akan diberikan pada Desa Sindang Laut sebesar 2... 175 .Prospek Pengusahaan Gaharu . 8. 10. 9. 7. kebakaran atau bencana lain yang mengakibatkan kerusakan sumberdaya hutan. pihak pertama dan pihak kedua memperoleh hasil tanaman gaharu yang ditanam dan dipelihara di lokasi kerjasama dengan proporsi masing-masing 35% untuk pihak pertama dan 60% untuk pihak kedua. Pihak kedua berkewajiban mengikuti aturan teknis dan kaidah konservasi yang berlaku di dalam areal KHDTK Carita. Jika pada saat pemanenan tanaman gaharu ternyata ada tanaman yang mati/hilang/tidak/belum menghasilkan. Jika sudah menghasilkan. baik pada tanaman gaharu atau tanaman lainnya di areal kerjasama. Selain pihak pertama dan pihak kedua.(Sri Suharti) 6.5% dan LMDH (kelompok) 2.

htm. 176 .dephut. DAFTAR PUSTAKA Adijaya. GAHARU: HHBK yang Menjadi Primadona. Prinsip utama yang dipegang dalam pengembangan kerjasama kemitraan dengan pola PHBM adalah prinsip kelestarian dan kelayakan secara ekonomi dalam jangka panjang sesuai jangka waktu kontrak serta saling menguntungkan berdasarkan nilai kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan sosial. 5. Info Pusat Standardisasi dan Lingkungan Departemen Kehutanan.php?mod=publisher&op =viewarticle&cid=8 &artid=290. 3.Aspek SOSIAL EKONOMI DAN KONSERVASI KESIMPULAN DAN SARAN 1. Gaharu: Harta di Kebun. D. meningkatkan produktivitas lahan serta meningkatkan pendapatan masyarakat sekitar hutan. khususnya bagi Indonesia yang memiliki potensi biologi yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. Skema kemitraan dengan pola PHBM memberikan kesempatan kepada para-pihak yang berminat mengembangkan tanaman gaharu untuk bekerjasama sesuai dengan input/sumberdaya yang dimiliki dan memperoleh bagian hasil/sharing sesuai dengan kontribusi serta kesepakatan parapihak yang terlibat.32.id/mod.online. http:// www. Trubus online.go. Gaharu sangat prospektif untuk dikembangkan.74 juta/ha.co. 4. IRR sebesar 48.53%. Kerjasama kemitraan pengembangan tanaman penghasil gaharu dengan pola PHBM merupakan salah satu alternatif solusi untuk menjaga kelestarian hutan. 2009. Anonim. dan B/C = 3. http:// www. dan ekologi. 2. ekonomi. Budidaya gaharu layak untuk dilaksanakan karena secara finansial akan memberikan keuntungan bersih nilai kini (NPV) sebesar Rp 147. Diakses 16 Februari 2009. Diakses 20 Januari 2009. 2002.id/ Halaman/STANDARDISASI_& _LINGUNGAN_ KEHUTANAN/INFO_V02/VI_V02.trubus.

.. Diakses 4 Maret 2009.id. Diakses. Trubus online. 2009. 2009. Aswandi. Access November. http:// www. P.co. Perkembangan Gaharu dan Prospeknya di Indonesia. Pelatihan Nasional: BUDIDAYA DAN PENGOLAHAN GAHARU..php ?option=com_content&task= view&id= 74&Itemid=1. Chatteron. Z. 2009. Statistik Kehutanan Indonesia 2006. Review of Significant Trade Aquilaria malaccensis. Sustainable Agarwood Production in Aquilaria Trees. com/gaharu. L. Tersandung Wangi Gaharu. Diakses 16 Februari 2009.trubus-online.blogspot. Diakses 16 Februari 2009. Blanchette. http:// forestry-senu57.blogspot. Indradi.(Sri Suharti) Anonim. http://fwi.Prospek Pengusahaan Gaharu . Anonim. Diakses 13 Januari. Diakses 16 Februari 2009. A. Working paper No. Steven. htm. http:// www.pdf. S. 177 . BUDIDAYA GAHARU : Alternatif Pemberdayaan Masyarakat Desa Hutan..cites. Duryatmo.id/id/news /1/tahun/2007/bulan/11/tanggal/17/id/ 60/. Y. 2007. http://laksmananursery. 2008. or.cfans. 51. 3 2008.com/2009/01/ prospek-budidaya-gaharu-secara ringkas. Sumari and P. 2007. Gun.org/index.. Vietnam. (2004). R. 2006. Rizlani.edu/ agarwood. Diakses 16 Februari 2009.. C. http://www. Tropical Rain Fo rest Project. Mencari Solusi PHBM di Geumpang. dan Aswandi.php?mod=publisher &op=viewarticle&cid=1& artid=1618. 2003.or. Jakarta. M. 2005. 2009.com/2008/01 /perkembangangaharu-dan-prospeknya-di. 2009. http://bpk-aeknauli.html. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES)..id/mod.html. BIOTROP Training and Information Centre.ffi. Sungadan. Perjalanan Panjang Pengelolaan Hutan Berbasis Masyarakat di Indonesia.htm. Eaglewood in Papua New Guinea. Prospek Budidaya Gaharu Secara Ringkas. Anonim. http://www.bticnet. Depatemen Kehutanan. B.umn. Di akses 4 Maret 2009. 2009. Departemen Kehutanan. http://forestpathology. Hayat.org/eng /com/PC/14/EPC14-09-02-02-A2. 12 Februari.

online. Jakarta. Wiguna. Squidoo. Direktorat Jenderal RLPS. 2007. Y.3 2008. Trubus online. 2008. . Diakses 16 Februari 2009. squidoo. Squidoo. http://www. 2006.php?mod =publisher&op=viewarticle& cid=8 &artid=290.trubus. Tinggi Permintaan Terganjal Pasokan. Temu Pakar Pengembangan Gaharu. http://www.co. Production and marketing of cultivated agarwood.id/mod. I. Access November. LLC and respective copyright owners. Budidaya dan Rekayasa Produksi Gaharu.com/agarwood Copyright © 2008.Sumarna.

dan B/C dari Pengusahaan tanaman gaharu per hektar 0 0 0 0 0 0 0 0 0 480 744000 240000 384000 120000 0 0 1250 0 1250 0 375 1050 900 300 0 0 2625 0 250 700 600 300 300 0 2150 0 0 0 0 0 0 0 0 1 2 3 4 5 Tahun ke6 7 8 Total No. TSP Rp 7000/kg. 500 3000 1250 250 5000 0 0 0 0 0 250 0 250 6750 125 350 300 150 0 0 7675 0 125 350 300 300 0 0 1075 0 250 700 600 300 0 0 1850 0 250 700 600 300 250 0 2100 0 375 1050 900 300 0 20000 22625 0 2500 2500 250 5250 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 500 5500 20000 500 26500 6750 1750 4900 4200 1950 800 20000 40350 III.Lampiran 1.3176 2500 1000 0 3500 16425 -16425 -21675 2500 1000 0 3500 7075 -7075 -28750 2000 500 0 2500 6850 -6850 -35600 1500 500 0 2000 6600 -6600 -42200 1500 500 12000 14000 39125 -39125 -81325 1500 500 0 2000 7125 -7125 -88450 1500 500 0 2000 6650 -6650 -95100 20000 25000 0 45000 46250 697750 602650 33000 29500 12000 74500 141350 602650 179 Catatan: Produksi gaharu 480 kg/ha dengan harga rata-rata Rp 1.53% 3. Biaya tenaga kerja 1.000/tanaman .000/kg Harga gaharu K1= Rp 5 juta/kg. Pra-investasi 2. Persiapan lahan & tanam 3. IV.000/kg. Bibit tanaman gaharu 2. Output (kg) b. Pupuk Urea 3. 744000 II. NPV (DF 15%) b. Keterangan I. Peralatan pertanian 7. Analisis NPV. dan pupuk kandang Rp 150/kg Harga inokulan Rp 50. Tenaga kerja inokulasi Biaya tenaga kerja Total biaya Cash flow Cash flow komulatif a.000/phn. Pupuk TSP/SP-36 4. KCl Rp 6000/kg. Nilai output Gaharu kemedangan I (10%) Gaharu kemedangan II (40%) Gaharu kemedangan III (50%) Cash outflow (Rp 1000) a. B/C 0 0 0 0 5250 -5250 -5250 147. IRR (%) c.742 48. Tenaga kerja upahan 3. Cash inflow (Rp 1000) a. Lain-lain Biaya pra investasi b. Sewa lahan 4.550. jumlah tanaman 400 phn/ha dibutuhkan 450 phn dg sulaman. Lampiran 1. Harga bibit Rp 15. Pupuk kandang 6. IRR. Bahan inokulan Biaya bahan & peralatan c. Harga pupuk urea Rp 2500/kg. Biaya bahan & peralatan 1. K2= Rp 2 juta/kg dan K3=Rp 500. Pra investasi 1. Pupuk KCl 5. Tenaga kerja keluarga 2.

Aspek SOSIAL EKONOMI DAN KONSERVASI 180 .

10 THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo Lambung Mangkurat University. namely. This is because. soil properties and plant diversity surrounding the newly grown and existing gaharu stands in South Kalimantan Province.and in-side the forest in Indonesia. There is a lack of information on factors influencing the success of gaharu formation. Only small group of farmers using introduced inoculants. soil properties and plant species). The present work focused on characterizing the environment. The success of gaharu formation may not be only due to inoculants but may also be influenced by environmental characteristics (climate. 181 . In South Kalimantan. Most of the gaharu formation usually relays on natural infection. the gaharu production may be considered low. Therefore there is a big opportunity for the Indonesian farmers to establish eaglewood plantation. climate. the gaharu export market remains open. South Kalimantan INTRODUCTION Eaglewood (gaharu) may play an important role in gaining foreign exchange and as a source of income for people living in out.

Location-wise. The climatic data for all sites were represented by Kandangan weather station.5 Layuh (2.8 km 115.2 Belanti (3) (HSS) Rejo (Banjar) 115. 115. The selected study sites B.4 3. The data were supplied by the Weather Bureau in Banjarbaru. HST) Aluan (3) (HST) Bawan (HST) Gading (HST) Batung (HST) Layuh (HKK) (HST) Rasau (HST) Kambat (2.3 North 115. 14 sites would be used for newly planted eaglewood trees and 9 sites for inoculation trial.6 Figure 1. South Kalimantan.1 115.7 Wawai (HST) 115. HST) Kalaka (HST) Kandangan (HSS) Madang (HSS) 115.0 oS 3.Aspek SOSIAL EKONOMI DAN KONSERVASI METHODS A. Site Distribution of selected sites for the project can be seen in Figure 1. The data obtained were for the last 9 years observation. Climatic Characters The climate parameters collected were rainfall.4 oE 115.6 2. 182 .6 22.2 3.0 2. The selected site were used for growing eagle wood and inoculation. air temperature and relative humidity.8 3. Hulu Sungai Selatan (HSS) and Hulu Sungai Tengah (HST). The sites located in Banjar.4 2.

(Erry Purnomo) C. air temperature and relative humidity for the last 9 years are shown in Figure 2. In each site. 183 .. The average annual rainfall in the study area was 2361.. D.72 mm. Method used for particle fraction analysis was described in Klute (1986) and the methods for other soil properties were described in Page et al. The rainfall distribution can be observed in Figure 2a. and CO2 evolution. (1982). total nitrogen (N). The rainy season commenced in October and ended in July each year. The pattern of air temperature and relative humidity are shown in Figure 2b and 2c. plant species grown under gaharu tree were collected plant within area of 6x6 m2. soil pH.. A significant low rainfall occurred in the period of July-September. cation exchange capacity (CEC).. Plant Diversity The diversity of plant species was determined to show its association with the success of inoculation. total potassium (K) and total phosphorus (P). Climatic Characters The average rainfall. RESULTS A. electric conductivity (EC). Soil Properties Soil properties measured were particle fraction analysis. respectively.The Environmental Characteristics . the content of total carbon (C).

The particle fraction analysis (Figure 3) shows that all soil samples dominated by slit fraction. (1994). Bars indicate the standard error mean 9 years observation B. soil pH. the content of total carbon (C). Soil properties measures were particle fraction analysis. followed by clay and sand fractions. 184 . level of status of each soil property will be made available as categorized by Djaenuddin et al. Soil Properties The soil properties of each site are presented in Figures 3-11. The rainfall [a]. electric conductivity (EC). Total nitrogen (N). and CO2 evolution. air temperature [b] and relative humidity [c] for the last 9 years. If applicable. total potassium (K) and total phosphorus (P).Aspek SOSIAL EKONOMI DAN KONSERVASI 500 [a] 400 30 [b] 29 Air temperature (oC) 30 [b] 29 Rainfall (mm) 300 200 100 28 27 26 25 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month Air temperature (oC) 28 27 26 25 0 l t r r r r ary ary rch pri May June July gus mbe tobe mbe mbe nu ru Ma A Au pte Oc ove ece Ja Feb N D Se Month Figure 2. cation exchange capacity (CEC).

The N content of the soils (Figure 5) was generally low. The K and P contents of the soils from all sites are demonstrated in Figures 6. Two sites.5 Total C content (%) 1. Particle fraction analysis of each soil 2. Most of the selected sites contained very low C. Mandala and Madang Low had K content of moderate level. 100 80 60 Sand Silt Clay % 40 20 0 n Bela 5 ti 1 t ) ) i s 3 g h 3 w . only 5 sites had low C. The low level of C and N content confirms the low level of organic matter content of the soil.0 Low 1.16 gsa da i H i 15 T Lan Man Waw and Waasauyuh K ang ur Gaat (2Belandang angk M R La Mad Ha mb H Ma Ka Site Figure 4.. namely.0 0. Most of the soil classified as very low to low level of K concentration.16 angsa andala awai dingin awa au (10 Kate g Hig adin (2 & 3 lanti 1 ng Lo gkinkin W as M W Man uh an aur G bat da Han Be TL R Lay Mad H Ma Kam Site Figure 3.. respectively. It was found that Wawai and Belanti 13 sites had very low and moderate levels of N content.(Erry Purnomo) The category range of total C total content was very low to low (Figure 4). The total C of soil for each site 185 ...0 Very low Be ti lan t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin .5 0.The Environmental Characteristics .5 Moderate 2.

there were 3-5 plant species.25 Moderate 0. The low EC readings indicate the absence of salinity problem. There were 3 sites and 2 sites had CEC of moderate and high. respectively.00 Very low la n Be 16 ngsat dalawai 3 inginawai (10) ates High ding & 3) ti 13 Low inkin n a d W sau h K ng r Ga t (2 elan ang ngk 5ti 1 T La Ma W Man B ad Ha Ra Layu ada Hau mba M M Ka Site Figure 5. Most of total P content of the soils was categorized as very low to low.15 0.10 0.20 Total N content (%) Low 0. Only one site (Rasau 10) was categorized as very high (Figure 7). 186 . at Madang Low. The low CEC indicates a low storage cation capacity and results in prone to cation leaching. Number of Plant Species It was observed that the number of plant species was varied from site to site (Figure 12). The total N of soil for each site One site (Rasau 10) had a very high K level. The low EC readings may be associated with the far distance from the shore. The CO2 evolution as an indication microbial activity was similar site-wise (Figure 11). Except. all soils had EC below 1 mS cm-1 (Figure 9). At 5 sites. Only one site (Belanti 13) had a slightly acidic value (Figure 8). except for Hangkinkin site. For EC reading. Almost all the soil pH of the selected soils was categorized into very acidic to acidic category. The CEC of the soils were commonly low (Figure 10). C. it was observed that the microbial was lower than the other sites.Aspek SOSIAL EKONOMI DAN KONSERVASI 0.05 0.

.. 1200 1000 Total K content (%) 800 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s i .The Environmental Characteristics . Total P content of soil for each site 187 .. Total K content of soil for each site 2600 2400 Total P content (%) 2200 2000 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s ..16 gsa dalawai 3inginawa u (10 ate High ding & 3nti 13 Lowinkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2Belaadangangk M H L M d Ha am b a M K Site Figure 6.(Erry Purnomo) The other 8 sites had 5-14 plant species and one site had 22 plant species.16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 7.

Soil pH for each site 130 Electric conductivity (mScm-1) 120 110 100 2 1 0 nt Bela ) ) t s .Aspek SOSIAL EKONOMI DAN KONSERVASI 7 Neutral Slightly acidic 6 Soil pH H2O 5 Acidic 4 Very acidic la i 3 6 in in ai 10) 3) 13 ow at es igh ng 5 .16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 9. Electrical conductivity readings for soil each site Cation exchnage capacity (cmol[+]kg-1) 40 30 High 20 Moderate 10 Low Very low ) ) t s i g a 3 3 h n n . Cation exchange capacity of soil for each site 188 .16 gsa dal ai ngi wa (10 ate Hig din & 3 ti 1 Low nki 15 T Lan Man Waw andi Wa asau yuh K ang ur Gaat (2Belan dang angki R La n ti a M H ad Ha m b a M M Bel Ka Site 0 Gambar 10.1 angs anda awanding aw au (uh Katng Hr Gadi (2 & lantiang Lngkink WRas y W Ma M BeMad Ha n ti 1 T L L a Ma d a H a u m b a t a Bela K Site 0 Figure 8.

In May... The highest rainfall occurred in the period of November-April ranging 215-358 mm.The Environmental Characteristics .16 gsa da H i i 15 T Lan Man W aw and W a asau yuh Kdang ur Ga at (2 Belan dang angk M nti R La Ma H Ha amb Ma ela B K 0 Sites Gambar 12. CO2 evolution from soil from each site DISCUSSION The rainfall pattern was typical the study area. The number of plant species found in each site 189 .. 25 Number of plant species each site 20 15 10 5 t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin . June and October the rainfall ranged 132-151 mm.. The schedule of inoculation may have to consider the climatic condition throughout the year.16 gsa dal wai 3 inginawa u (10 ate High din & 3nti 1 g Low inkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2BelaadanHangk M L M d Ha am b a M K Site Gambar 11.(Erry Purnomo) 2000 1600 1200 CO2 evolution (mg C kg-1) 800 400 0 an t Bel ) ) t s i g a 3 . The lowest rainfall was observed in the period of July-September ranging 54-84 mm.

improving the fertility status may results in healthier eaglewood trees. From field observation. further study is still needed to investigate the relationship between soil properties or plant diversity on eaglewood growth or the success of inoculants application. It is too early to gain any conclusion on the effect of environmental characters on gaharu production. 190 . it was found that there was gaharu trees growth variation under different plan species grown surrounding the gaharu trees. Banjar. M Yani. The annual total rainfall in the area under study was 2361 mm. Plants grown under the gaharu was quite divers from site to site. In general. However. The number plant species were varied from site to site.Aspek SOSIAL EKONOMI DAN KONSERVASI The low fertility status according to Djaenuddin et al. the soil in each site was considered very poor. This may result in the failure of gaharu formation. The healthy trees may immune to the infection. Therefore. Dr. Presto Janu Saputra and Storus for supporting the field work. Maman Turjaman for the invitation to be involved in the project. ACKNOWLEDGEMENT I would like to thank ITTO for funding the work. (1994) leads the need to amend to improve the soil fertility status. CONCLUSION The selected sites were distributed in regencies. namely. Mrs. It seems that there was a shading affect on the gaharu trees growth. I also acknowledge the anonymous reviewer who critically commented on the manuscript. Hulu Sungai Selatan and Hulu Sungai Tengah. The rainy season began in October and ease in June.

Bogor. R. A.. 2nd Edition. J. SSSA.H. D. V. Bachri. Sukardi. Ismangun.REFERENCE Djaenuddin.0. Madison.. 2nd Edition. Klute. Hakim. S. Madison. Land Suitability for Agricultural and Silviculture Plants. and Keeney. Part 1 Physical and mineralogy methods. Laporan Teknis No... Chemical and microbiological properties. L. Hardjowigeno. Pp 1159.. Pp. (In Indonesian). April 1994. Suharta. Ds.. M.. 191 . Versi 1.R. SSSA. ASA. Subagjo. 7. Dai. (1982) Methods of soil Analysis.1188 Page. E.L. S... and Jordens. H. Marsudi. A. Basuni. Widagdo. Miller. D.R. Suwandi. ASA. (1986) Methods of soil Analysis. Center for Soil and Agroclimate Research... N.

Aspek SOSIAL EKONOMI DAN KONSERVASI 192 .

Gonystylus spp. Oleh karena itu beberapa 193 .(Pratiwi) 11 KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu hasil hutan non kayu yang mempunyai nilai penting... Dalam kegiatan penelitian ini difokuskan pada jenis-jenis pohon dari genus Aquilaria.Karakteristik Lahan Habitat . Enkleia spp. Salah satu upaya yang dapat dilakukan adalah dengan mengembangkan tanaman gaharu dalam hutan tanaman di beberapa area. sehingga hasil hutan non kayu ini menjadi subjek pemanenan yang cukup tinggi. seperti Aquilaria spp. karena secara ekonomis jenis ini dapat meningkatkan devisa negara dan sumber penghasilan bagi masyarakat yang hidup di dalam maupun sekitar hutan. 1994..... Gaharu merupakan salah satu kayu aromatik penting. Sidiyasa et al. malaccensis dan A. yaitu A. 1986). microcarpa. Genus ini termasuk dalam famili Thymelaeaceae. maka keberadaan jenis ini perlu dipertahankan. (Chakrabarty et al. dan Gyrinops spp.. Karena jenis pohon ini mempunyai nilai ekonomi tinggi.... Wikstromeae spp.. Ada beberapa jenis tumbuhan yang dapat menghasilkan gaharu. Aetoxylon spp. Awalnya gaharu berasal dari pohon tropika yang terinfeksi jamur.

Sifat-sifat tanah yang spesifik mempengaruhi komposisi vegetasi yang ada di atasnya (Pratiwi. Secara administrasi pemerintahan. maka penelitian ini bertujuan untuk mendapatkan informasi tentang sifat-sifat habitat pohon penghasil gaharu di hutan tanaman gaharu di daerah Carita. topografi. 1991). Sehubungan dengan hal tersebut di atas.Aspek SOSIAL EKONOMI DAN KONSERVASI informasi sehubungan dengan habitat pohon penghasil gaharu perlu diinventarisasi. Dramaga. jenis tanah. organisme. Pratiwi dan Mulyanto (2000) serta Jenny (1941) menyebutkan bahwa tanah merupakan hasil proses pelapukan batuan yang dipengaruhi oleh faktor-faktor iklim. METODOLOGI A. dan waktu. agar kemampuan lahannya dapat diketahui. Tanah yang berbeda dengan sistem lingkungan yang bervariasi akan menentukan vegetasi yang ada di atasnya. maka tanah dan karakteristiknya akan berbeda-beda dari satu tempat ke tempat lain. dan Sukabumi. dan iklim (termasuk iklim mikro) harus dipertimbangkan sebagai bagian dari ekosistem yang terintegrasi. Selanjutnya Pratiwi dan Mulyanto (2000) menyatakan bahwa penyebaran tumbuhan. dan energi matahari. dan Sukabumi. udara. termasuk sifat-sifat tanahnya dan komposisi vegetasi tumbuhan bawah yang ada di sekitarnya. Carita terletak di Kabupaten Pandeglang. Sepanjang komponen tanah bervariasi. Lokasi dan Waktu Penelitian Penelitian dilakukan pada bulan September 2008 di Carita. sebagaimana juga diharapkan dapat meningkatkan pendapatan dan kesejahteraan masyarakat. Provinsi Banten sedangkan 194 . Tanah sebagai bagian dari suatu ekosistem merupakan salah satu komponen penyangga kehidupan. sehingga keberadaan jenis ini dapat dilestarikan. Dramaga. Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah dan topografi serta vegetasi. Diharapkan informasi ini dapat mendukung pengembangan hutan tanaman pohon penghasil gaharu. di samping air.

dan vegetasi.000 mm per tahun.000 (Lembaga Penelitian 195 . Temperatur udara bervariasi antara 24ºC sampai 30ºC. Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Pengamatan terhadap sifat-sifat tanah dan topografi dilakukan di dalam plot yang sama dengan pengamatan vegetasi. dan Sukabumi.(Pratiwi) Dramaga terletak di Kabupaten Bogor.959 mm. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. Kelembaban udara rata-rata berkisar antara 80% sampai 90%. 1951) dan curah hujan sekitar 3.. 1. cangkul. B. Jawa Barat serta Sukabumi di Provinsi Jawa Barat. Bahan dan Alat Penelitian Sebagai bahan penelitian adalah contoh tanah yang diambil dalam plot penelitian di Carita.. C. topografi. Metode Penelitian Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah. Bahan lain adalah berupa data hasil analisis vegetasi untuk tingkat semai (termasuk tumbuhan bawah). Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. Sedangkan alat yang dipakai dalam penelitian lapangan adalah alat-alat tulis. dan meteran.Karakteristik Lahan Habitat .. Kelembaban udara ratarata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. Munsell Color Chart. Pengambilan Contoh Tanah Plot dibuat di area yang telah dipilih berdasarkan peta tanah Jawa dan Madura pada skala 1:500. alat-alat survei lapangan seperti bor tanah. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. 1951) dan curah hujan tahunan sekitar 3. 1951) dan curah hujan sekitar 3.600 mm per tahun. Dramaga. Jumlah contoh tanah yang diambil di masing-masing lokasi adalah sebanyak 6 buah. 2005)..

dan H+ (sifat kimia) (Blackmore et al. 1976). Sedangkan belta merupakan tumbuhan dengan diameter setinggi dada (1. Seluruh semai dan tumbuhan bawah yang ada dicatat dan dihitung jumlahnya. 30-60 cm. Ca. Contoh tanah diambil dari setiap horizon yang telah diidentifikasi untuk dianalisis di laboratorium. dan semai. Mg. yaitu pada tingkat pohon. porositas. Kriteria 196 ..Aspek SOSIAL EKONOMI DAN KONSERVASI Tanah. Contoh tanah komposit diambil pada kedalaman 0-30 cm. Kriteria pohon adalah tumbuhan dengan diameter setinggi dada (1. Kemudian contoh tanah dicampur sesuai kedalamannya. berat jenis. Pengamatan vegetasi dilakukan terhadap semai dan tumbuhan bawah yang ada di bawah tegakan/pohon penghasil gaharu. Al.3 m)>10 cm. KB. Plot-plot contoh berukuran 20 m x 20 m dibuat untuk pengamatan pohon dengan interval 20 m pada jalur sepanjang satu km. Sedangkan untuk pengamatan belta dilakukan dengan membuat petak berukuran 10 m x 10 m di sepanjang jalur tersebut dengan interval 10 m. KTK. ketersediaan P. Sifat-sifat tanah yang dianalisis. Ntotal. permeabilitas. belta. K.. Pada setiap kedalaman tanah. Total tanah komposit yang dikumpulkan dari masing-masing lokasi adalah enam contoh (tiga untuk analisis sifat fisik tanah dan tiga untuk analisis sifat kimia tanah). 2. 1962). Sedangkan tingkat semai dan tumbuhan bawah diamati dengan cara membuat petak 1 m x 1 m di dalam jalur pengamatan pohon dan belta. Dua macam contoh tanah yang diambil adalah contoh tanah terganggu untuk analisis sifat-sifat fisik dan kimia tanah serta contoh tanah tidak terganggu untuk pengamatan sifat fisik tanah (porositas dan berat jenis tanah). dan > 60 cm di setiap lokasi penelitian.5 m (Kartawinata et al. 1981). Corg. Dengan demikian ada 18 contoh tanah yang dikumpulkan. Pengamatan Vegetasi Pengamatan vegetasi dilakukan terhadap seluruh vegetasi yang ada dalam plot. contoh tanah diambil pada 20 titik yang tersebar di masing-masing horizon. Seluruh jenis pohon dan belta dihitung dan diukur diameternya. Na.3 m) antara 2 cm sampai < 10 cm dan semai merupakan permudaan dari kecambah sampai tinggi < 1. meliputi: a) sifat fisik yaitu tekstur. dan sifat kimia yaitu pH H2O.

(Pratiwi) semai adalah permudaan jenis tumbuhan berkayu dari kecambah sampai tinggi < 1. 1974). Indeks kesamaan jenis dihitung dengan menggunakan rumus Sorensen (Mueller-Dum-bois and Ellenberg. Plot-plot berukuran 1 m x 1 m diletakkan di jalur pengamatan vegetasi di dalam tegakan/pohon penghasil gaharu. Bogor. Pada masingmasing lokasi.. jalur dibuat sebanyak tiga buah masing-masing sepanjang 100 m. dan dihitung jumlahnya serta diukur luas penutupan tajuknya.Karakteristik Lahan Habitat . Untuk vegetasi. data yang diperoleh ditentukan spesies dominannya dengan menghitung nilai penting sesuai dengan rumus yang dikemukakan oleh Kartawinata et al. (1976). yaitu: SI = Dimana : 2w a+b SI = Similarity Index w = Jumlah dari nilai penting terkecil untuk jenis yang sama yang ditemukan pada dua komunitas yang dibandingkan (A dan B) a = Jumlah nilai penting dari semua jenis yang ada di komunitas A b = Jumlah nilai penting dari semua jenis yang ada di komunitas B 197 . Jenis yang diperoleh kemudian dibuat spesimen herbariumnya untuk diidentifikasi di laboratorium Botani dan Ekologi Hutan.. D..5 m (Kartawinata et al. Seluruh semai dan tumbuhan bawah yang ada dalam plot dicatat nama daerahnya.. Spesies dominan merupakan spesies yang mempunyai nilai penting tertinggi di dalam tipe vegetasi yang bersangkutan.. Analisis Data Sifat-sifat fisik dan kimia tanah dihitung sesuai dengan formula pada standar prosedur dari setiap karakteristik tanah kemudian ditabulasi untuk setiap horizon. 1976). P3HKA.

Kelembaban udara rata-rata berkisar antara 80% sampai 90%. Kelembaban udara rata-rata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. khususnya sifat fisik dan kimia. Tipe mineral-mineral ini sangat dipengaruhi oleh sifat-sifat tanah. Bahan induk tanah Carita adalah dari Gunung Danau sedangkan Dramaga dan Sukabumi masing-masing dari Gunung Salak dan Gede Pangrango. Dramaga.959 mm. Topograpfi di daerah Carita bergelombang sampai bergunung sedangkan di Dramaga datar sampai bergelombang dan di Sukabumi bergelombang sampai berbukit. 1951) dan curah hujan tahunan sekitar 3. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. Ini berarti bahan induk daerah ini kaya akan mineral-mineral ferro-magnesium dan beberapa mineral sebagai sumber elemen basa. Vulkanik material dari lokasi-lokasi ini memiliki sifat andesitik. Faktor-Faktor yang Mempengaruhi Pembentukan Tanah di Lokasi Penelitian Penelitian dilakukan di tiga lokasi. dan Sukabumi. yaitu Carita.600 mm per tahun. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. Karakteristik Tanah di Daerah Penelitian Karakteristik tanah sangat dipengaruhi oleh faktor-faktor pembentukan tanah dan sifat-sifat tanah.Aspek SOSIAL EKONOMI DAN KONSERVASI HASIL DAN PEMBAHASAN A. 1. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. 1951) dan curah hujan sekitar 3. Lokasi penelitian Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. Temperatur udara bervariasi antara 24ºC sampai 30ºC. 2005). 198 . 1951) dan curah hujan sekitar 3.000 mm per tahun.

. gaharu ditanam secara monokultur dan ditanam masing-masing tahun 1993 dan 1999. nangka (Artocarpus integra).(Pratiwi) Penggunaan lahan di ketiga lokasi penelitian adalah hutan tanaman pohon penghasil gaharu. Hal ini menunjukkan bahwa tanah di lokasi penelitian berkembang dari material vulkanik tuff. Tabel 5. dan Tabel 3. umumnya pohon serbaguna seperti pete (Parkia speciosa). Implikasi dari kelas tekstur ini adalah retensi air dan hara pada tanah ini relatif bagus. dan permeabilitas. Hasil penelitian sifat-sifat fisik tanah disajikan pada Tabel 1. Di Carita. Hal ini mengindikasikan bahwa partikel tanah yang dominan adalah fraksi liat. antara lain berkaitan dengan tekstur.8. durian (Durio zibethinus) dan sebagainya. Tabel 2.. porositas. Tanah di Carita dan Dramaga memiliki KB kurang dari 50% (Tabel 4. dengan areal sekitar 5 ha dan dibangun pada tahun 1998 dengan total 346 pohon. Pada tabel tersebut terlihat bahwa ketiga lokasi penelitian memiliki sifat-sifat fisik tanah yang relatif sama. 199 .. jenis yang ditanam adalah Aquilaria microcarpa. berat jenis. Sedangkan tanah di lokasi penelitian Sukabumi memiliki KB lebih dari 50% sehingga diklasifikan sebagai alfisol. Tanah yang memiliki horizon argilik dapat diklasifikasikan sebagai alfisol atau ultisol tergantung kejenuhan basanya (KB). dan Tabel 6). Sifat Fisik Tanah Sifat fisik tanah. Oleh karena itu tanah ini diklasifikasikan sebagai ultisol. Sedangkan di Dramaga dan Sukabumi. Ini berarti seluruh tanah di lokasi penelitian memiliki sub horizon argilik. Ketinggian daerah ini sekitar 100 meter di atas permukaan laut. Berat jenis (BD) tanah di semua lokasi penelitian kurang dari 1 tetapi lebih dari 0. microcarpa di Sukabumi.Karakteristik Lahan Habitat . 2. Dari data tekstur tanah dapat dilihat juga bahwa tanah di dalam profil menunjukkan adanya akumulasi liat. Pohon penghasil gaharu ditanam bersama dengan tanaman lain. Data analisis tekstur tanah menunjukkan bahwa tanah di semua lokasi penelitian memiliki kelas tekstur liat. melinjo (Gnetum gnemon). Spesies yang ditanam adalah Aquilaria crassna dan A. microcarpa di Darmaga dan A. Sifat-Sifat Tanah a..

85 Berat Jenis Porositas (%) Tabel 2.98 9.21 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 200 . Informasi ini menunjukkan bahwa terjadi fenomena pemadatan tanah (soil compaction) karena adanya injakan (trampling) dan mungkin adanya jatuhan butir-butir hujan dari batang pohon (stem fall).78 Kelas tekstur Liat Liat Liat 0. Hal ini menunjukkan bahwa tanah ini mempunyai sifat andik.90 0.08 81. porositas tanah di horizon permukaan lebih rendah daripada di bagian bawahnya.59 11. Sedangkan berat jenis tanah di tiga kedalaman kurang dari satu.45 66.01 Tekstur Debu (%) 25.33 6.13 Debu (%) 12.99 68.48 Kelas tekstur Liat Liat Liat 0. sehingga tanah di lokasi penelitian termasuk dalam ordo andisol dalam sistem taksonomi tanah (Soil Survey Staff.10 22.33 8.99 63.86 66. Sifat-sifat fisik tanah di lokasi penelitian Dramaga Sifat fisik Kedalaman (cm) Pasir (%) 0-30 30-60 > 60 0 30 60 8.93 0.Aspek SOSIAL EKONOMI DAN KONSERVASI Data porositas tanah menunjukkan bahwa di semua lokasi penelitian.10 36.35 57.55 6.57 69. Sifat-sifat fisik tanah di lokasi penelitian Carita Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 8.84 0. 1994).90 64.87 0. Tabel 1.96 65.33 5.09 Liat (%) 79.69 85.51 Liat (%) 66.

Namun demikian Bullock et al.86 0.Karakteristik Lahan Habitat .75 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 Sedangkan porositas di lokasi penelitian menunjukkan bahwa semakin ke bawah porositasnya semakin kecil. kejenuhan basa (KB).. Sifat Kimia Tanah Sifat-sifat kimia tanah. Fe. dan Mn. Ca.43 67. Hal ini terlihat pada lokasi penelitian. Nilai permeabilitas tanah menunjukkan laju pergerakan air. umumnya diikuti dengan penurunan persentase ruang pori atau porositas dan juga penurunan nilai permeabilitas tanah.(Pratiwi) Tabel 3.83 63. Pratiwi dan Garsetiasih (2003) menyatakan bahwa pemadatan tanah dapat diakibatkan oleh karena injakan manusia. meliputi pH H2O.15 62. di mana lokasi-lokasi ini merupakan hutan tanaman. Hal ini menunjukkan semakin ke dalam jumlah pori-pori semakin kecil yang diakibatkan antara lain oleh adanya pemadatan tanah.37 Liat (%) 68.. Al. (1985) menyatakan bahwa nilai ini tergantung bukan saja oleh jumlah pori tetapi juga tingkat kontinuitas pori.90 26. pH H 2O di semua lokasi penelitian umumnya kurang dari lima. Sifat-sifat fisik tanah di lokasi penelitian Sukabumi Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 12. b. Keterangan yang lebih lengkap dapat dilihat pada Tabel 4.59 68. Hal ini terjadi juga di ketiga lokasi penelitian.09 Kelas tekstur Liat Liat Liat 0. Zn. K. Cu. Na.54 Debu (%) 18.78 9.. kapasitas tukar kation (KTK). Tabel 5. Peningkatan berat jenis tanah. kecuali Sukabumi.95 11. C. Mg.49 84. P tersedia. maka akan mengakibatkan kapasitas tanah menampung air dan udara menurun.73 5. Adanya pori-pori yang menurun jumlahnya.97 0. N. dan Tabel 6.. Namun demikian tanah-tanah di lokasi 201 .

dan Co). Carbon organik dan nitrogen total di lokasi penelitian menurun semakin ke bawah. Rendahnya carbon organik dan nitrogen total berhubungan dengan rendahnya bahan organik. khususnya di horizon bagian atas. Menurut Sutanto (1988). maka reaksinya asam dan kejenuhan basanya kurang dari 100%. Di samping pH. Walaupun tanah-tanah di lokasi penelitian berkembang dari bahan vulkanik andesitik yang kaya akan material-material basa. P. dan S) dan unsur hara mikro (Fe. Hal ini dapat dimengerti karena di lokasi penelitian Carita. namun karena adanya proses pelapukan yang intensif dan juga adanya pencucian (leaching). K. dijumpai banyak tumbuhan bawah jika dibandingkan dengan lokasi penelitian Sukabumi dan Dramaga. Reaksi ini mempengaruhi ketersediaan unsur hara esensial. Unsur-unsur ini dikategorikan sebagai unsur hara makro (C. Zn. Kandungan P di semua lokasi penelitian tergolong sangat rendah (< 2). Hal ini menunjukkan bahwa dekomposisi bahan organik tidak terlalu kuat. Mn. Pratiwi (2004 dan 2005) menyatakan bahwa unsur ini khususnya di lapisan atas mempunyai fungsi yang sangat penting dalam perkecambahan biji. Mg. Tanah dengan kandungan Al yang tinggi memiliki sifat toksik. Tumbuhan bawah merupakan sumber bahan organik. Mo. Elemen penting lainnya adalah K. K tergolong medium sedangkan di Carita dan Sukabumi masing-masing tergolong rendah dan tinggi dan Al+3 dan H+ rendah sampai sangat rendah di semua lokasi. Di areal penelitian Dramaga. ketersediaan dari unsur-unsur esensial ditentukan oleh bahan organik dan proses-proses dinamis yang ada di dalam profil tanah. H. Unsur hara esensial merupakan unsur yang diperlukan oleh tanaman dan fungsinya tidak dapat digantikan oleh unsur lain (Pratiwi. Al+3. dan H+. Ca. Cu. tetapi di Carita.Aspek SOSIAL EKONOMI DAN KONSERVASI penelitian masih dikategorikan asam. carbon organik lebih tinggi daripada Sukabumi dan Dramaga. Jumlah carbon organik relatif rendah di semua horizon. O. Oleh karena itu di ketiga lokasi penelitian tidak ada bahaya keracunan Al. 2004 dan 2005). 202 . bahan organik juga menyebabkan meningkatnya KTK dengan meningkatnya muatan negatif. Perbandingan C/N di semua horizon tergolong tinggi. Cl. N. B.

03 (Rendah) 0...12 (Rendah) Horizon 3 (>60 cm) 4. Ada kecenderungan bahwa daerah dengan pH yang tinggi memiliki kejenuhan basa yang tinggi pula. Tanah dengan KTK tinggi dapat menyerap unsur hara. Tabel 4. kation basa didominasi oleh calcium dan magnesium. Tabel 4.70 (Rendah) 1.11(Rendah) 203 .(Pratiwi) Unsur hara mikro juga mempengaruhi pertumbuhan tanaman.15 (Rendah) Horizon 2 (30-60 cm) 4. Unsur-unsur tersebut adalah Fe. Hal ini disebabkan karena Sukabumi memiliki pH H 2O tertinggi.77).75) dan yang terendah adalah di Carita (13. Tabel 5.03 (Rendah) 0.01-17. Zn. Kapasitas tukar kation (KTK) menunjukkan tingkat kesuburan tanah.. Unsur-unsur Fe. Tanah dengan pH lebih tinggi umumnya memiliki KTK yang lebih tinggi. KTK tanah dianalisis dengan larutan buffer NH4Oact pH 7 dan KTK sum of cation.0515. Cu. dan Tabel 6 menunjukkan secara jelas bahwa KTK NH4Oact pH 7 dari seluruh profil sangat tinggi daripada KTK sum of cation. Kandungan kation basa di Sukabumi termasuk tinggi sedangkan di Dramaga medium dan Carita termasuk rendah. tetapi diperlukan dalam jumlah sangat sedikit.60 (Rendah) 1. Jumlah kation tertinggi di areal penelitian terdapat di Sukabumi dan yang terendah di Carita.Karakteristik Lahan Habitat . Cu. Tabel 5. Kecenderungan ini terjadi di areal penelitian. di mana pH daerah Sukabumi lebih tinggi daripada Carita dan Dramaga.35-41. Kondisi ini relatif sesuai untuk pertumbuhan tanaman. dan Mn.43 (Rendah) 0.50 (Rendah) 1. sehingga ketersediaan hara akan lebih bagus pada areal dengan KTK rendah. Dari Tabel 4..07) sedangkan di Dramaga medium (16. Sifat-sifat kimia tanah di lokasi penelitian Dramaga Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) Horizon 1 (0-30 cm) 4. dan Tabel 6 mengindikasikan bahwa tanah di Sukabumi memiliki KB tinggi (39. Di semua horizon dari tiga lokasi penelitian ini. dan Zn relatif rendah sementara kandungan Mn sedang sampai relatif cukup. KTK tinggi berarti areal tersebut cukup subur.

75 (Medium) 40.49 (Sangat rendah) 0.13 (Rendah) Horizon 1 (0-30 cm) 4.04 3.44 (Medium) 0.20 (Sangat rendah) 204 .40 5.20 (Sangat rendah) Horizon 3 (>60 cm) 4.16 (Sangat rendah) 0.7 (Sangat rendah) 5.7 (Sangat rendah) Horizon 2 (30-60 cm) 1.17 (Rendah) 1. Sifat-sifat kimia tanah di lokasi penelitian Carita Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K 1.61 (Medium) 35.60 (Rendah) 0.70 (Sangat rendah) Horizon 2 (30-60 cm) 4.08 (Sangat rendah) 1.72 (Sangat rendah) 0.51 (Rendah) 0.26 (Medium) 3.60 (Rendah) 2.41 2.16 (Rendah) 1.26 (Rendah) 16.88 88.50 (Rendah) 1.70(Medium) 0.14 (Rendah) 1.48 2.20 Tabel 5.88 (Medium) 5.36 4.53 (Rendah) 0.58 (Tinggi) 0.32 ( Medium) 1.99 (Medium) 46.44 (Medium) 0.14 (Rendah) 1.80 2.26 (Rendah) 16.71 (Sangat rendah) 0.28 79.33 4.09 (Medium) 0.01 1.60 1.90 (Sangat rendah) 0.75 (Rendah) 0.31 (Medium) 0.64 4.68 (Medium) 4.3 (Sangat rendah) Horizon 3 (>60 cm) 1.44 5.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 1.17 (Rendah) 1.19 ( Medium) 0.52 (Rendah) 0.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): Al H 0.24 85.29 (Medium) 1.01 (Sangat rendah) 0.30 (Rendah) 17.00 (Sangat rendah) 0.

64 (Tinggi) 10.56 (Tinggi) 16.40 Tabel 6.60 17.98 (Tinggi) 10.07 (Sangat tinggi) 69.10 (Rendah) 1.64 3.40 (Rendah) 0.40 (Sangat rendah) 205 .04 1.18 (Rendah) 3..49 7.90 (Sangat rendah) Horizon 2 (30-60 cm) 5.22 (Rendah) 0.01 (Rendah) 0.10 (Rendah) 2.84 (Rendah) 0.08 1.53 6..80 16.Karakteristik Lahan Habitat .05 (Sangat tinggi) 0.94 (Sangat tinggi) 0.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 0.60 (Rendah) 1.99 (Tinggi) 10.70 (Sangat rendah) Horizon 3 (>60 cm) 4.21 (Rendah) 13.40 (Medium) 0.36 (Rendah) 0..84 (Sangat tinggi) 14.20 (Rendah) 15.86 (Tinggi) Horizon 1 (0-30 cm) 5.00 28.43 (Medium) 36.(Pratiwi) Sifat-sifat kimia Na KTK KB (%) KCl (me/100 gr): Al H 0.11 (Rendah) 3.60 (Rendah) 0.36 (Medium) 41.07 (Medium) 0.48 1.48 (Tinggi) 78.11 (Rendah) 14.00 1..35 (Tinggi) 63.71 (Tinggi) 0. Sifat-sifat kimia tanah di lokasi penelitian Sukabumi Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): 16.72 1.52 (Sangat tinggi) 0.15 (Rendah) 3.22 (Rendah) 39.77 (Rendah) 16.49 (Sangat rendah) Horizon 2 (30-60 cm) 0.52 2.68 2.45 1.49 (Sangat rendah) Horizon 3 (>60 cm) 0.22 (Rendah) 13.03 (Rendah) 14.27 (Sangat rendah) 5.

40 17. Areal ini merupakan hutan tanaman pohon penghasil gaharu. sapling serta tiang didominasi oleh gaharu.56 26.20 1. dan Sukabumi. Jumlah jenis tumbuhan bawah dan familinya di lokasi penelitian Lokasi penelitian Jumlah jenis Jumlah famili Ko n d i s i i n i a g a k nya k a r e n a Carita 30 18 perbedaan sistem penanaman dalam Dramaga 8 16 hutan tanaman tersebut.25 Horizon 2 (30-60 cm) 2.12 0. Komposisi Tumbuhan Bawah Hasil pengamatan menunjukkan bahwa komposisi jenis tumbuhan bawah di Carita lebih tinggi dibandingkan di Sukabumi dan Dramaga (Tabel 7). Umum Analisis vegetasi dilakukan terhadap vegetasi/tumbuhan bawah di Carita.76 (Sangat rendah) 0. Di Carita pohon Sukabumi 6 3 penghasil gaharu ditanam dengan sistem campuran dengan jenis tanaman serba guna sedangkan di Sukabumi dan Dramaga ditanam dengan sistem monokultur. mendukung beberapa anakan muncul dari jenis-jenis lain selain jenis tanaman penghasil gaharu. 2. 206 .56 22.36 B.44 1.36 1. Komposisi Vegetasi dan Spesies Dominan 1. Sistem penanaman di Carita yang multikultur.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia Al H 0.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 2. Oleh karena itu analisis vegetasi ditekankan pada tumbuhan bawah.00 0.42 0. Dramaga.32 (Sangat rendah) 0.30 Horizon 3 (>60 cm) 6.52 1. Tabel 7.40 (Rendah) 0.12 1. Dengan demikian untuk tingkat pohon.32 1.

Jenis dominan merupakan jenis yang mempunyai nilai penting tertinggi di dalam komunitas yang bersangkutan. 4. Tanah di tiga lokasi penelitian memiliki bahan induk yang relatif sama. topografi. dan Lampiran 3). dan karakteristik tanah. Indeks Kesamaan Jenis Tumbuhan Bawah Berdasarkan indeks kesamaan jenis menurut Sorensen (MuellerDumbois and Ellenberg. Di Carita jenis dominan dan kodominan dari tumbuhan bawah yang ditemui adalah jampang (Panicum disachyum) dan selaginela (Selaginella plana) sedangkan di Dramaga adalah pakis (Dictyopteris iregularis) dan seuseureuhan (Piper aduncum) serta di Sukabumi adalah jampang (Panicum disachyum) dan rumput pait (Panicum barbatum) (Lampiran 1. Carita - 9 - 35 9 - Darmaga Sukabumi - KESIMPULAN 1. Data ini mengindikasikan bahwa habitat dari masing-masing lokasi penelitian secara ekologis memiliki karakteristik yang berbeda-beda..Karakteristik Lahan Habitat . Indeks similaritas (%) dari dengan lainnya. Jenis Tumbuhan Bawah Dominan Secara ekologis.. nilai vegetasi ditentukan oleh peran dari jenis dominan.(Pratiwi) 3. 1974) komposisi jenis tumbuhan bawah di tiap lokasi penelitian berbeda satu Tabel 8.. Lampiran 2.. Hal ini diindikomuni-tas tumbuhan di lokasi penelitian kasikan dengan nilai indeks similaritas yang rendah (<50%) Lokasi Carita Dramaga Sukabumi (Tabel 8). Hasil pengamatan menunjukkan bahwa jenis dominan dan kodominan masing-masing areal penelitian berbeda. 207 . Nilai ini merupakan hasil dari interaksi di antara jenis dengan kondisikondisi lingkungan. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor lingkungan seperti iklim. yaitu material volkanik yang bersifat andesitik.

DAFTAR PUSTAKA Allison. tanah Carita kurang subur dibandingkan dengan Dramaga dan Sukabumi. New York. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor-faktor lingkungan seperti iklim. LPT. Jenny. 1941. L.A. Organic Matter by Walkey and Black methods. Sifat-sifat fisik dan kimia tanah di areal penelitian mendukung pertumbuhan pohon penghasil gaharu. Menon. Komposisi jenis tumbuhan bawah juga berbeda di tiap lokasi penelitian sebagaimana diindikasikan dengan nilai SI < 50%.. serta di Sukabumi masing-masing jampang (Panicum disachyum) dan rumput pait (Panicum barbatum).). Peta Tanah Tinjau Jawa dan Madura. In C. 4. 6. 1965. 1962. McGrawhill. Part II. Di Carita tumbuhan bawah yang dominan adalah jampang (Panicum disachyum) dan jenis kodominan adalah selaginela (Selaginella plana). A. Soil Analyses. Bogor. 1994. Sedangkan di Dramaga jenis dominan dan kodominan masing-masing adalah pakis (Dictyopteris irregularis) dan seuseureuhan (Piper aduncum). Lembaga Penelitian Tanah. Factors of Soil Formation. WWF-Traffic India. topografi. Black (ed.E. Sehubungan dengan tingkat pelapukan. dan sifat-sifat tanah. Trade in Agarwood. 208 . Chakrabarty. Tingkat kesuburan ini berhubungan dengan tingkat dari proses pelapukan. 280 p. Perbedaan sifat-sifat fisik dan kimia tanah di lokasi penelitian disebabkan perbedaan tingkat proses pelapukan yang berhubungan dengan kondisi lingkungan dari proses pelapukan tersebut.Aspek SOSIAL EKONOMI DAN KONSERVASI 2. H. 3. Kumar and V. K. Jenis dominan dan kodominan di masing-masing areal penelitian berbeda. 5.

MSc. Forestry and Estate Crops Research Journal 1(1): 27-33. Eksplorasi dan Studi Permudaan Jenis-Jenis Penghasil Gaharu di Wilayah Hutan Kintap. Sutanto. Jakarta. The Relationship Between Soil Characteristics with Vegetation Diversity in Tanjung Redep. D. Soil Conservation Service. Pratiwi and B. Mulyanto.U. East Kalimantan. ITC-RUG. Kalimantan Selatan. Dept. Buletin Penelitian Hutan 474: 59-66. West Java. 2005. Pusat Litbang Hutan dan Konservasi Alam.H. Aims and Methods of Vegetation Ecology.S.A. 2005. 2004. Pratiwi. United Stated Department of Agriculture. Universiteit Gent. Sutomo.. Gent. K.. 1988. Kabupaten Berau. Pusat Litbang Hutan dan Konservasi Alam.(Pratiwi) Mueller-Dumbois. Soil Characteristics and Vegetation Composition Along a Topotransect in The Gunung Gede Pangrango National Park. PhD Thesis. Bogor. Belgium. Soil Survey Staff.. S.H. Kalimantan Timur. dan R. 21 p.Agric.. 209 . 1974. and J. Procedure for Collecting Samples and Methods of Analyses for Soil Survey. John Willey and Son. New York.. 1986. F. and H. Revised ed. Pratiwi. Hutan Penelitian Carita. 1991. Pratiwi. 306 p. Rainfall Based on Wet and Dry Period Ratios for Indonesia with Western New Guinea.Karakteristik Lahan Habitat . Schmidt. I. 1984. Minerlogy. 42. Ferguson. Soil Conservation Service. Charge Properties and Classification of Soils on Volcanic Materials and Limestone in Central Java. Hubungan Antara Sifat-Sifat Tanah dan Komposisi Vegetasi di Daerah Tabalar. International Training Center For Post Graduate Soil Scientists. Report No. Ciri dan Sifat Lahan Habitat Mahoni (Swietenia macrophylla King.) di Beberapa Hutan Tanaman di Pulau Jawa. Verhand. Key to Soil Taxonomy. 1951. Sidiyasa. S. 233 p. Djawatan Meteorologi dan Geofisika. R. A. Indonesia. Six Edition. Kementrian Perhubungan. Gakuryoku XI(2):127-131.. Thesis. 68 p. Ellenberg. 1994. Indonesia. Prawira. Buletin Penelitian Hutan 644: 63-76. 2000.

25 0.25 0. Aquilaria malaccensis Lamk.76 7. Coniograma intermedia Hieron.43 1.50 0.09 2.73 3.97 6.49 0.91 2.71 5.85 2.43 2.12 0. Swietenia macrophylla King Morinda bracteosa Hort.82 3.75 0.75 1.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 1.81 10. Morinda bracteosa Hort. Cyperus difformis Linn.48 0. Bridelia monoica L.25 0.25 0.18 6. Cyclea barbata Miers.25 0. Amaryllidiaceae Elaeocarpus glaber Blume Elaeocarpaceae Seuseureuhan Piper aduncum L.39 3.25 0.05 1. Graminae Curculigo latifolia Dryand.71 4.00 100.70 16.83 9. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Nama daerah Jampang Selaginella Harendong merah Cingcau Rumput pait Ilat Parasi Terongan Hatta Peletok Paku anam Pakis Sasahan Harendong Kokopian Mahoni Cacabean Alang-alang Hawuan Kakacangan Pacing Nama botani Famili Kr (%) Fr (%) Dr (%) NP (%) 47.47 2. Compositae 100.62 0.09 1.93 1.43 1.Chr.80 Panicum disachyum Linn. Imperata cylindrica Linn.25 8. Total Panicum montanum Roxb.23 0.88 7.43 1. Clidenia hirta Don.71 1.80 1.17 7.69 2.80 1.12 0.28 22.00 100.66 8.43 1.43 1.58 10. Parkia speciosa Hassk.25 21.43 1. Melastoma malabathricum L.57 4.93 1.43 1.37 0.99 3.98 0.36 6.52 5. Nilai penting jenis tumbuhan bawah di Carita No.43 1.75 0.17 2.70 32.43 1.25 0.62 0.05 2.28 57.99 10.29 1.30 2. Tapeinochilus teysmannianus K. Gramínea Selaginella plana Hiern.25 0.71 0.10 0.43 2.57 4. Ixora sp.12 81.25 0.43 1. Stachystarpheta jamaisensis Vahl.39 9.25 0.85 1.86 1.45 0.05 2. Gagajahan Ki koneng Babadotan Pakis anjing Gaharu Pete Kanyere Cingcanan Plectronia sp.93 1.43 1.09 3.02 4. Solanum jamaicence Mill. Tetracera indica L.00 300. Graminae Ageratum conizoides Linn.23 0.62 1.62 0.25 0.00 Keterangan: Kr Fr Dr NP : Kerapatan relatif : Frekuensi relatif : Dominansi relatif : Nilai penting 210 .11 0.00 9. Dictyopteris irregularis Presl.25 0. Lygodium circinatum Sw.Sch. Selaginellaceae Melastomataceae Meraispermaceae Cyperaceae Solanaceae Polypodiaceae Moraceae Schizophyllaceae Polypodiaceae Dilleniaceae Melastomaceae Rubiaceae Meliaceae Rubiaceae Graminae Verbenaceae Zingiberaceae Piperaceae Rubiaceae Polypodiaceae Thymelaeaceae Leguminosae Euphorbiaceae Rubiaceae Panicum barbatum Lamk.50 0.25 0.25 0.43 25.23 0.12 0.43 1.43 2.00 14. Cecropia peltata L.30 2.00 5.18 2.29 5. Dryopteris dentata C.25 0.37 0.43 2.98 0.00 5.50 0.43 1.72 4.85 4.49 1.

Micania scandens Willd..89 100.52 5.76 5.14 100.71 5.14 1. Piper aduncum Linn.64 11.16 37.Karakteristik Lahan Habitat .. Alocasia sp. Ageratum conizoides Linn.00 NP (%) 74. Total Zingiberaceae Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 211 ..25 20.56 300. Famili Polypodaceae Piperaceae Araceae Graminae Gramínea Compositae Kr (%) 29.08 34.72 16.19 22.06 19. Rumput padi Areu Babadotan Pacine Oryza grandulata Nees.00 Rumput pait Panicum barbatum Lamk.(Pratiwi) Lampiran 2.89 17.Sch.55 3.04 43.41 11.78 30.00 16.00 Fr (%) 16.. Nilai penting jenis tumbuhan bawah di Dramaga No.72 16.89 11.76 5. 1 2 3 4 5 6 7 8 Nama daerah Pakis Seuseureuhan Tales Nama botani Dictyopteris irregularis Presl. Compositae Tapeinochilus teysmannianus K.03 16.72 11.42 1.76 5.71 5.72 11.21 57.00 Dr (%) 28.03 5.53 100.

Famili Gramínea Graminae Melastomaceae Compositae Kr (%) 56. Ageratum conizoides Linn.56 24.38 4.33 100.62 16.16 100. Harendong Babadotan Kirinyuh Clidenia hirta Don.00 NP (%) 139.67 8.76 7.33 16.00 Dr (%) 50.06 300. Nilai penting jenis tumbuhan bawah di Sukabumi No.94 32. Euphatorium pallascens DC. 1 2 3 4 5 6 Nama daerah Jampang Nama botani Panicum distachyum Linn.9 58.57 3.00 17.35 22.34 16.67 8.Lampiran 3. Total Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 212 .24 4.14 30. Compositae Graminae Alang-alang Imperata cilíndrica Linn.00 Rumput pait Panicum barbatum Lamk.87 10.28 3.00 Fr (%) 33.67 16.71 14.57 100.74 2.

2001. dan lain-lain. Indonesia merupakan salah satu eksportir terbesar produk gaharu dan sudah menyumbangkan sekitar 6. hirta. 2002). malaccensis Lamk. SUMATERA Titiek Setyawati Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu. negara penghasil gaharu terbesar di dunia.) DI PROVINSI LAMPUNG DAN BENGKULU.2 milyar rupiah ke kas negara pada tahun 1995. A. gaharu merupakan komoditi hasil hutan non-kayu penting. A.. dengan nama perdagangan “agarwood/aloe-wood/ eaglewood”. seperti A. Gaharu merupakan komoditi hasil hutan bukan kayu yang banyak diminati oleh pasar luar negeri (Soehartono dan Newton. Gaharu banyak diproduksi di Indonesia.12 POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk. microcarpa. Jenis pohon penghasil gaharu menghasilkan resin yang memiliki aroma wangi dan jenis-jenis yang menghasilkan gaharu dengan 213 . 1987. Zuhud 1994). filaria. 2000). Heyne. Bagi Suku Dayak Punan di Kalimantan Timur. A. beccariana. selama ini banyak dikenal sebagai bahan untuk membuat wangi-wangian. A. karena merupakan sumber pendapatan terbesar yang memiliki nilai pasar tinggi (Kaskija. bahan obat serta juga kulitnya dapat dibuat untuk bahan tali atau kain (Puri. Indonesia juga merupakan habitat endemik beberapa jenis gaharu komersial dari marga Aquilaria.

2001).5 sampai 4 kg gaharu dengan harga di tingkat pencari Rp 700.37 pohon/ha (Kalimantan). Dari beberapa pustaka yang ada. masingmasing sortimen akan dibedakan lagi berdasarkan kelas mutunya.33 pohon/ha (Irian Jaya) (Anonim.87 pohon/ha (Sumatera). kemedangan. Gaharu dihasilkan dari proses pembusukan atau infeksi. Potensi yang diperkirakan ada saat ini yaitu 1. 2001) yang tumbuh tersebar di Indonesia. dan abu gaharu. Hampir sebagian besar jenis dapat ditemukan di Kalimantan. 2007). Satu pohon biasanya dapat menghasilkan 0. Dalam proses selanjutnya.Aspek SOSIAL EKONOMI DAN KONSERVASI kualitas tinggi banyak diperdagangkan ke luar negeri. informasi mengenai jenis. Gonystylus (2 jenis). sejak tahun 1994 gaharu masuk dalam Appendix II daftar CITES (Soehartono dan Newton. Nusa Tenggara Barat. dan 4. Enkleia (1 jenis). Berdasarkan hasil pengamatan di lapangan. Usaha budidaya jenis pohon penghasil gaharu juga belum banyak mengalami perkembangan yang nyata dan produk gaharu masih lebih banyak dipanen dari hutan alam. Resin yang dihasilkan memiliki aroma wangi yang merupakan ciri khas dalam menentukan kualitas gaharu. Aquilaria (2 jenis). baik batang maupun akar pohon secara kimiawi oleh beberapa jenis jamur. Meskipun jumlah ekspor gaharu saat ini mengalami penurunan pesat dibandingkan dengan tahun-tahun sebelumnya. Pada umumnya gaharu diperdagangkan dalam tiga kelompok sortimen. Menurut Sidiyasa (1986) dalam Mai dan Suripatty (1996). yaitu gubal gaharu. serta Irian Jaya.untuk kualitas super. kedelapan jenis tersebut masuk dalam marga Aetoxylon (1 jenis). keberadaan serta potensi pohon penghasil gaharu yang ada di Indonesia sampai saat ini masih belum terkoleksi dengan baik. Sumatera.000. jenis pohon penghasil gaharu dari marga Aquilaria dan Wiekstroemia memiliki lebih dari 2 jenis (Sellato. 2001) dan bahkan semua jenis penghasil gaharu (Aquilaria spp. Karena eksploitasi yang intensif sehingga mengancam keberadaanya di alam. Bahkan beberapa jenis sudah menjadi langka akibat perburuan jenis-jenis tertentu yang tidak terkendali. Jenis yang saat ini banyak dipanen di Irian Jaya sudah sangat terancam keberadaannya. dan Gyrinops 214 . 3. dan Wikstroemia (2 jenis). gaharu ternyata dihasilkan tidak dari satu jenis pohon saja melainkan dari berbagai macam jenis. Nusa Tenggara Timur. karena eksploitasi yang berlebihan (Zich dan Compton.

2 milyar rupiah di tahun 1995.. baik ek-situ maupun in-situ. Makalah ini bertujuan untuk memberikan informasi menyangkut aspek potensi dan persebaran gaharu (A.) masuk dalam Appendix II CITES sejak tahun 2004. maka diperlukan upaya serius dari berbagai macam pihak yang berkepentingan agar keberadaan jenis-jenis tersebut di Indonesia dapat dipantau. diharapkan jenis ini dapat keluar dari daftar CITES sebagai jenis yang harus dilindungi. maka tidaklah heran jika gaharu sangat dicari oleh para pedagang sedangkan pemanenan masih mengandalkan gaharu yang tumbuh di alam dan pencarian dilakukan oleh masyarakat lokal yang memiliki akses masuk ke dalam hutan.) di Provinsi Lampung dan Bengkulu. maka diharapkan tersedia bukti yang kuat menyangkut status jenis-jenis pohon penghasil gaharu di Indonesia. malaccencis Lamk. Harga gaharu saat ini bervariasi mulai dari 5 juta hingga 20 juta rupiah per kilogramnya. 1997 dalam Soehartono dan Newton. Dengan tersedianya informasi yang memadai. 2000) dan sudah memberikan sumbangan kepada pemasukan negara sejumlah 6. Kelompok tersebut biasanya akan tinggal di hutan selama lebih kurang seminggu untuk mencari 215 . Indonesia dikenal sebagai negara penghasil gaharu terbesar (Direktorat Jenderal PHPA. Mengingat keberadaan jenis-jenis pohon penghasil gaharu yang mulai langka dan terancam punah. 2009).. Untuk jenis gaharu yang terbaik di kelasnya harganya bisa melebihi 20 juta rupiah per kilogram tergantung kualitasnya (Anonim. Selama beberapa dekade ini.. diperlukan upaya eksplorasi dan konservasi. Mengingat harga gaharu yang demikian tinggi. Masyarakat di lokasi hutan di Sumatera pada umumnya mengumpulkan gaharu dalam kelompok yang masing-masing terdiri dari 3 sampai 5 orang. Mengingat semakin terancamnya keberdaan jenis pohon penghasil gaharu yang ada di habitat alaminya. Sumatera.. baik dari sisi potensi dan persebarannya. Dengan usia tanam dari 6 hingga 8 tahun gaharu mampu menghasilkan getah sekitar dua kilogram. Harga gaharu saat ini sangat bervariasi tergantung dari kualitasnya. karena berbagai macam alasan yang menyangkut status konservasinya.(Titiek Setyawati) spp.Potensi dan Kondisi .

Kawasan Hutan Bukit Rupi berada di Desa Segala Midar.Aspek SOSIAL EKONOMI DAN KONSERVASI gaharu di pedalaman hutan. METODE PENELITIAN A. Namun demikian masih ada beberapa lokasi hutan alam. tepatnya di Kabupaten Lampung Tengah. Seringkali terjadi bahwa kualitas gaharu tidak seperti yang mereka inginkan dan pada akhirnya pohon yang sudah terlanjur ditebang ditinggalkan begitu saja di hutan.884 ha dengan cakupan wilayah meliputi Resort Merpas. maka mereka akan menebang pohonnya secara manual menggunakan kampak. Kecamatan Pubian. Kecamatan Pesisir Selatan. Lampung Survei jenis-jenis pohon penghasil gaharu di Provinsi Lampung dilakukan di satu lokasi yang ada di dalam kawasan Taman Nasional Bukit Barisan Selatan (Hutan Biha) dan dua lokasi di luar kawasan TNBBS. Pada saat ini. pencarian gaharu makin sulit akibat potensinya yang mulai menurun. Kabupaten Lampung Tengah. Pugung 216 . Seksi Krui. yaitu di Hutan Bukit Rupi dan Hutan Gunung Sugih. Kondisi hutan sebagian sudah dialihfungsikan menjadi lahan perkebunan dan ladang masyarakat. dimana ditemukan tegakan gaharu yang masih utuh. sehingga orang harus tinggal lebih dari 2 minggu atau bahkan sebulan hanya untuk mendapatkan gaharu. Jika gaharu ditemukan. Kawasan Hutan Bukit Rupi berada di luar kawasan TNBBS namun demikian merupakan kawasan hutan lindung yang dikelola oleh Dinas Kehutanan Provinsi Lampung Tengah. Lokasi Penelitian 1. Kabupaten Lampung Barat. Lokasi survei berada di Desa Sumur Jaya. Kondisi topografi di hutan alam ini sedikit berbukit dengan beberapa lokasi memiliki kelerengan hingga 35 derajat. Areal penelitian masuk dalam Seksi Konservasi Wilayah II Krui dengan luas kawasan ± 96. Kawasan Hutan Biha masuk dalam Blok Hutan Podomoro. Resort Biha.

500 mm/th sedangkan di bagian timur 2. Peta lokasi survei dan pengamatan 2. Kawasan hutan TNBBS ini terletak di ujung selatan dari rangkaian pegunungan Bukit Barisan dan secara geografis berada pada 4031’5057’ LS dan 103024’1 0 4 0 BT s e d a n g k a n secara administratif p e n ge l o l a a n te r b a g i d a l a m t i g a w i l aya h pengelolaan.000 mm/ th..000-3..964 m dpl. Bengkulu Lokasi kedua kawasan hutan sangat berdekatan dengan Tahura Rojolelo yang terletak di antara 03 42’-03 44’LS sampai 102 21’BT dan berada di ketinggian 10-30 m dpl. Gambar 1. S e k s i Ko n s e r va s i jenis-jenis pohon penghasil gaharu Wilayah Krui. Curah hujan ratarata di bagian barat adalah 3.. dan Seksi di Provinsi Lampung Konservasi Wilayah III Sukaraja. Topografi kawasan ini bergelombang dan berbukit-bukit dengan ketinggian berkisar antara 0-1.500-3. dan Biha.. Krui. 217 . Waktu tempuh dari pusat kota Bengkulu sekitar 30 menit dengan jarak sekitar 20 km (Gambar 2).(Titiek Setyawati) Tampak.Potensi dan Kondisi . yaitu Seksi Konservasi Wilayah I Liwa. Lokasi penelitian secara detil tertera pada Gambar 1.

dan tali rafia. dan tanaman palawija lainnya. Bengkulu Utara Kawasan hutan dekat Desa Tanjung Terdana sebagian besar sudah dikonversi menjadi areal persawahan dan perkebunan masyarakat. B. GPS Garmin 12 satelit. kompas. larutan sub-limat. kertas plak herbarium. kantung plastik. Lokasi penelitian di Kawasan Hutan Binjai Temula (Kec. Prosedur Kerja Kajian lapangan di Kabupaten Lampung Tengah dan Lampung Barat dilakukan pada bulan Oktober dan Desember 2007 sedangan 218 . Pondok Kelapa). kelapa sawit. fenologi. dan potensi sebaran jenis pohon penghasil gaharu ini adalah semua jenis pohon yang diduga menghasilkan gaharu yang terdapat di kawasan hutan lindung. karung plastik. baik primer dan sekunder. jati. kertas gambar spesial. pena/alat gambar. Alat yang digunakan untuk pengambilan data di lapangan. kertas koran. BAHAN DAN ALAT A. Tanaman yang umum ditanam antara lain padi. tambang nilon. alat plak herbarium. antara lain alkohol 96%. karet. jeruk. pisang.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 2. Bahan dan Alat Bahan yang dijadikan sebagai obyek kegiatan ekologi. tinta gambar spesial. Talang Empat) dan Pungguk Gambo (Kec. kamera digital.

Waktu pengamatan lapangan masing-masing selama 8 dan 10 hari. dan lebih dari 500 m dpl dengan topografi yang berbeda. Beberapa contoh pohon akan diambil untuk keperluan identifikasi dan koleksi herbarium. Kuesioner dipersiapkan sebelum kegiatan lapangan dilakukan.Potensi dan Kondisi . baik secara langsung melalui wawancara dengan masyarakat yang tinggal di dekat dan sekitar hutan maupun tidak langsung dengan cara melakukan kajian pustaka. Untuk itu digunakan blanko isian mencakup data pohon. 3 orang teknisi. Panjang tiap jalur eksplorasi yaitu 1 km dengan jarak antar jalur 500 m. Koleksi data primer di lapangan mencakup keanekaragaman jenis pohon penghasil gaharu dan kondisi lingkungan tempat tumbuhnya dengan menggunakan metode eksplorasi dalam jalur-jalur yang sistematik. Kecamatan Talang Empat dan yang kedua di Hutan Lindung Kelompok Hutan Pungguk Gambo. antara lain: 2. 219 . Pengumpulan data lapangan. Ketinggian tempat di lahan kering ada 3 macam.. 3. Kecamatan Pondok Kelapa. Provinsi Bengkulu dilaksanakan dua kali.. yaitu antara 0-200 m. 1. dan 5 orang tenaga teknis lapangan. dan data penggunaan tradisional penduduk setempat. data kondisi lingkungan tempat tumbuh. yakni topografi datar (kemiringan lereng kurang dari 10%) dan bergelombang berat (kemiringan 25% atau lebih). Pengamatan pertama di Bengkulu dilaksanakan di Hutan Lindung Kelompok Hutan Binjai Temula. baik di lahan kering maupun lahan basah. Di samping itu dibuat juga blangko isian tersendiri yang digunakan untuk bahan wawancara dengan penduduk yang berisi pertanyaan-pertanyaan menyangkut berbagai macam informasi tentang karakter jenis-jenis pohon penghasil gaharu yang dikenal oleh penduduk setempat.. Eksplorasi dilakukan di berbagai kondisi hutan.(Titiek Setyawati) Kabupaten Bengkulu Utara. 200-500 m.. yaitu pada bulan Oktober dan Desember 2008. Desa Tanjung Terdana. Desa Dusun Baru. Pengamatan dan analisis gaharu meliputi beberapa macam kegiatan. Kegiatan pengamatan dan pengukuran di lapangan dikerjakan oleh seorang peneliti.

5. 10. 9.Aspek SOSIAL EKONOMI DAN KONSERVASI 4. 8. Individu pohon tersebut yang dirisalah dibatasi jarak terjauh 25 m dari titik pusat kuadran dan diameter batangnya 20 cm atau lebih. Penulisan deskripsi jenis-jenis pohon penghasil gaharu yang disertai gambar lukisan spesimen herbarium. 6. tingkat pancang (tinggi lebih dari 150 cm dengan diameter kurang dari 10 cm) dan tingkat tiang (diameter 10-20 cm) di sekitar titik pusat kuadran. Pengolahan data potensi keberadaan jenis pohon penghasil gaharu dan wilayah sebarannya yang terdapat di dalam kawasan hutan alam. Pengidentifikasian jenis-jenis pohon penghasil gaharu dan proses koleksi herbarium dari kegiatan eksplorasi. Pendataan pohon meliputi nama jenis. Estimasi regenerasi jenis-jenis pohon penghasil gaharu yang terdapat di kawasan hutan dengan cara menghitung permudaan tingkat semai (tinggi kurang dari 150 cm). 11. Jarak anakan pertama dengan pohon induk diukur. dan tinggi pohon. Pembuatan tally sheet untuk mengisi data tentang masa berbunga dan berbuah jenis-jenis pohon penghasil gaharu. maka dibuat risalah anakan menggunakan metoda jalur transek sepanjang 1 km dari titik anakan pertama ditemukan. Jika anakan yang pertama ditemukan berada jauh dari pohon induk. Penggambaran lukisan spesimen herbarium jenis pohon penghasil gaharu. Mengadakan pendugaan potensi dan sebarannya dengan menggunakan metode titik pusat kuadran (quadrant center point method) sepanjang jalur eksplorasi dengan jarak antara titik pertama dan titik berikutnya 50 m. Pada tiap titik pusat kuadran dilakukan perisalahan 4 individu pohon penghasil gaharu atau pohon lainnya yang terdekat dengan titik pusat atau 1 individu pohon pada tiap kuadran. 7. Pengolahan data hasil wawancara dengan masyarakat lokal. Selanjutnya dibuat petak 10 m x 10 m di setiap selang 200 m dari jalur transek. Penduduk yang tinggal di dekat kawasan diminta untuk mengisi blanko kosong yang harus diisi dengan informasi kapan masa 220 . diameter batang.

5. Kepadatan: jumlah individu per plot (100 m2). 1994). kering.Potensi dan Kondisi . dan Frekuensi Relatif (FR) dari jenis tertentu. Luas bidang dasar untuk tiap plot dijumlah untuk memperoleh LBD tiap pohon dengan menggunakan rumus: LBD (m2) = pi x d (diameter dalam m)2/4 (Kent dan Coker. Krebs. DR merupakan rasio total luas bidang dasar dari suatu jenis terhadap jumlah total luas bidang dasar dari seluruh jenis yang ada. C. 1999. 1992). jumlah pohon yang berbuah dan berbunga.. antara lain: 2. Luas Bidang Dasar (LBD): luasan bagian melintang dari batang >20 cm sebatas dada (diameter of breast height (dbh)). panas. Hasil Pengamatan di Lampung Hasil pengamatan yang diperoleh dalam rangka melakukan kajian potensi sebaran jenis A. kondisi iklim atau cuaca pada saat berbunga atau berbuah (hujan.. Frekuensi: jumlah unit contoh (10 m x 10 m).. 4. 3. 1992. di Provinsi Lampung ini menunjukkan bahwa di beberapa lokasi di dalam kawasan Taman Nasional Bukit Barisan Selatan ini masih terdapat 221 . dan sebagainya) dan mengisi data curah hujan. Nilai NP ini diperoleh dengan cara menjumlahkan Dominansi Relatif (DoR). Kelimpahan Relatif (KR). KR merupakan rasio jumlah individu dari suatu jenis terhadap jumlah total jenis di dalam plot dan FR merupakan rasio frekuensi dari suatu jenis terhadap total frekuensi seluruh jenis di dalam plot (Kent dan Coker. Beberapa definisi dan kalkulasi yang digunakan dalam analisis vegetasi. malaccensis Lamk. HASIL DAN PEMBAHASAN A.(Titiek Setyawati) berbunga.. di mana jenis ditemukan. jumlah buah dan bunga (persentase). Analisis Data 1. Nilai Penting (NP): perkiraan secara keseluruhan pentingnya suatu jenis pohon di dalam komunitas lokalnya.

Anakan gaharu yang ditemukan tumbuh secara besar di wilayah perkebunan alami di Kawasan Hutan Bukit milik masyarakat (Gambar Rupi. Lampung Tengah. belum ada laporan bahwa pohon tersebut pernah menghasilkan gaharu atau terinfeksi oleh patogen. Namun demikian. Khusus di Bukit Rupi. Lampung Tengah 4). Kemungkinan besar biji gaharu terbang dan menemukan media yang baik untuk tumbuh besar di kebun milik penduduk tersebut. sapling.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan alam pohon gaharu meskipun jumlah dan potensi regenerasi alamnya tampak mengalami penurunan seperti yang ada di Kawasan Hutan Biha. karena berdasarkan wawancara dengan pemilik kebun. Nampak bahwa kondisi batang tegakan pohon sangat halus dan tidak ditemukan cacat pohon. jumlah tegakan pohon. Gunung Sugih. mereka tidak merasa menanam pohon penghasil gaharu dan menemukan pohon tersebut tumbuh di halaman kebun mereka. Tampak pada Gambar 3 kecambah gaharu yang tumbuh melimpah menyerupai permadani di bawah tegakan induknya yang ditemukan di Kawasan Hutan Bukit Rupi. Lampung Tengah menunjukkan 222 . Jumlah pohon gaharu yang dapat ditemukan di Bukit Rupi. dan anakan yang ditemukan pada enam plot sampel tampak cukup banyak. Di lokasi ini juga dijumpai tegakan pohon penghasil gaharu alami yang tumbuh Gambar 3. Tegakan dapat dikatakan alami. Kemungkinan hal ini disebabkan akses ke dalam kawasan hutan yang relatif sulit dibandingkan dengan Kawasan Hutan Biha. Hasil pengamatan regenerasi alam jenis gaharu di Kawasan Hutan Way Waya. Lampung Tengah tertera pada Tabel 1. Di beberapa tempat juga tampak tandatanda bekas perambahan hutan yang tentunya sebagian besar untuk mengambil kayu gaharu. Tampaknya tidak banyak gangguan seperti pengambilan gubal gaharu di kawasan ini.

Nampak pula bahwa sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu. Lampung Tengah. Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Hutan Biha sangat sedikit. Tampak bahwa tidak satu pun jenis penghasil gaharu ditemukan di petak sampel (Tabel 2) di antara 13 jenis pohon hutan yang berhasil diidentifikasi di laboratorium Botani Hutan. Tegakan pohon A.. Gambar 4. meskipun lokasinya sama-sama di satu kabupaten. namun bukan sama sekali tidak ditemukan seperti di Kawasan Hutan Gunung Sugi. Lampung Tengah 223 . Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Biha tertera pada Tabel 3. yang ditemukan tumbuh secara alami di perkebunan milik masyarakat yang lokasinya berbatasan dengan Kawasan Hutan Bukit Rupi.. sehingga kemungkinan sejak dahulu sudah banyak masyarakat yang memanfaatkan gaharu yang tumbuh alami namun hal ini tidak dibarengi dengan upaya budidayanya. sehingga pemungut kayu gaharu setiap saat dapat secara kebetulan maupun ada juga yang dengan niat keras. malaccensis Lamk..Potensi dan Kondisi .(Titiek Setyawati) perkembangan yang sedikit berbeda dengan yang ada di Bukit Rupi. menemukan jenis gaharu tersebut.. Kurangnya jumlah pohon ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung.

5. 4. Penduduk setempat yang sudah melakukan upaya bu-didaya penanaman pohon gaharu (A.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 5. 6. malaccensis Lamk. plot 1. Jumlah pohon. Gunung Sugih. pancang. malaccensis Lamk. dan anakan A. Jumlah pohon (> 10 cm) 26 9 8 14 16 8 Jumlah pancang 34 15 21 16 19 17 Jumlah anakan 14 21 30 14 11 9 Tabel 2. pancang. Lampung Tengah Tabel 1.) di kebun miliknya di Kawasan Hutan Gunung Sugih. anakan dan semai beberapa jenis pohon alami yang ada dalam 50 plots penelitian di Kawasan Hutan Way Waya. 2. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Rupi. 3. Lampung Tengah Pohon No 1 2 3 Nama jenis Artocarpus elasticus Ganophyllum falcatum Bombax valetonii Plot 15 5 4 Batang 45 10 5 Tiang Plot 2 0 0 Batang 6 0 0 Pancang Plot 0 4 2 Batang 0 15 4 Semai Plot 0 0 0 Batang 0 0 0 224 . Lampung Tengah No. Jumlah pohon.

Hibiscus macrophyllus Plot 4 0 3 3 2 4 2 3 2 1 Batang 5 0 7 5 3 5 3 5 3 1 Tiang Plot 4 1 5 4 1 2 5 5 4 4 Batang 8 4 12 8 2 5 8 6 5 5 Pancang Plot 6 5 0 2 0 3 0 2 0 2 Batang 18 17 0 7 0 10 0 7 0 3 Semai Plot 4 12 11 10 0 6 12 5 13 0 Batang 8 20 23 15 0 12 23 12 20 0 Tabel 3. Alstonia angustifolia Pometia pinnata Cananga odorata Litsea sp.Potensi dan Kondisi . Lampung Barat No. 3. 2. Artocarpus sp. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Biha. malaccensis Lamk. Pohon gaharu yang masih ada di Kawasan Hutan Register 22 Way Waya. Kabupaten 225 . Jumlah pohon (> 10 cm) 2 Jumlah pancang 1 2 4 Jumlah anakan 3 8 5 12 Berdasarkan informasi penduduk yang tinggal di Kawasan Hutan Lindung Bukit Sugih (Register 22 Way Waya) bahwa jenis pohon gaharu sudah sulit dijumpai karena adanya pembalakan hutan maupun adanya pencari gaharu di masa lampau. 4.(Titiek Setyawati) Pohon No 4 5 6 7 8 9 10 11 12 13 Nama jenis Pterospermum diversifolium Laportea stimulans Vitex sp. oleh karena itu pembuatan plot dilakukan di hutan belukar tersebut. Ficus sp.. Kecamatan Sendang Agung.. Desa Sendang Baru.. Jumlah pohon. plot 1. Namun demikian masih terdapat beberapa pohon penghasil gaharu alami yang tersisa di daerah hutan belukar. dan anakan A.. pancang.

dan 102 batang. 30 cm. Adapun jenis pohon penghasil gaharu yang ditemui hanya satu jenis yaitu A. Lampung Barat 226 .Aspek SOSIAL EKONOMI DAN KONSERVASI Gunung Sugih. 28 cm. Titik yang terdekat berjarak sekitar 5 km dengan jarak tempuh sekitar 1 jam berjalan kaki. Gambar 6. 85. dan tingkat anakan terdapat 3 plot dengan jumlah masing-masing 30. masing-masing satu batang pohon yang berdiameter 20 cm. Dari 50 plot yang dibuat terdapat 5 plot yang dijumpai pohon penghasil gaharu. dan 34 cm. 25 cm. (Thymelaeaceae). tingkat pancang hanya satu batang. sedangkan tingkat tiang tidak dijumpai. malaccensis Lamk. hanya tinggal sekitar 5 pohon. (kiri) dan anakan yang tumbuh di bawahnya (kanan) di lokasi Kawasan Hutan Biha. Tegakan pohon A. malaccensis Lamk. Lampung Tengah. itu pun terbagi tempatnya menjadi tiga titik dengan jarak tempuh yang berbeda.

memiliki indeks nilai penting yang cukup tinggi pada tingkat pohon. yaitu Binjai Temula. Desa Dusun Baru. Kecamatan Talang Empat dan Kelompok Hutan Pungguk Gambo. Jumlah pohon penghasil gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Binjai Temula tertera pada Tabel 4. yaitu di Kelompok Hutan Binjai Temula. pada Kawasan Lindung Kelompok Hutan 227 . yaitu 39.(Titiek Setyawati) B.. A. Hasil Pengamatan di Kawasan Hutan di Provinsi Bengkulu Hasil menunjukkan bahwa A.86% (urutan kedua setelah Cinnamomum porectum (Roxb.. Hal ini terjadi terutama di Kawasan Lindung Kelompok Hutan Pungguk Gambo. (57.20%). Tampak bahwa jumlah pohon sangat sedikit dan menurut informasi yang diperoleh dari masyarakat sekitar. Hal ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung dan kemungkinan besar juga adalah tingkat reproduksi tegakan yang mulai berkurang. Kondisi regenerasi di kawasan ini hampir sama dengan kawasan yang sebelumnya.72%). Berdasarkan angka nilai pentingnya. Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Kawasan Binjai Temula ini sangat sedikit. sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Pungguk Gambo tertera pada Tabel 5. merupakan jenis yang ditemukan di kedua lokasi penelitian di Bengkulu Utara. Tegakan gaharu pada tingkat tiang dan pancang tidak ditemukan pada plot sampel namun mendominasi pada tiangkat seedling (38...Potensi dan Kondisi . Berdasarkan hasil analisis vegetasi di Kelompok Hutan Binjai Temula. Kedua lokasi berada di Provinsi Bengkulu dan kedua kawasan juga masuk dalam kawasan hutan lindung. Sampai saat ini masih terdapat perburuan gaharu di hutan alam dan bahkan masyarakat atau penduduk lokal mengumpulkan anakan pohon gaharu (semai dan pancang) dari hutan alam untuk diperdagangkan. Kecamatan Pondok Kelapa.) Kostm. sehingga sejak dahulu sudah banyak memanfaatkan gaharu yang tumbuh alami. Desa Tanjung Terdana. malaccensis Lamk. malaccensis Lamk.

plot 1. C. 4. pohon penghasil gaharu (>20 cm) menduduki urutan keempat (43. Pada plot sampel di lokasi Pungguk Gambo. Tegakan tidak ditemukan di tingkat tiang dan hanya memiliki nilai penting 3. (67. 6.30%). 3.59% pada tingkat pancang dan berada di urutan keempat (19. Bengkulu Utara No. Jumlah pohon. dan Garcinia diocia Blume (56.) Kostm. malaccensis Lamk. 2. 5. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Binjai Temula.48%) untuk tingkat seedling atau semai.82%). Kecambah atau biji yang mulai tumbuh (kiri) dan beberapa anakan mulai tinggi (kanan) di areal Kelompok Hutan Pungguk Gambo Tabel 4. pancang.20%) setelah Vitex pubescens Vahl. Gambar 7. dan anakan A. banyak ditemukan kecambah atau biji-biji yang mulai berkecambah di bawah pohon induknya serta beberapa anakan dengan pertumbuhan yang cukup sehat (Gambar 7). Jumlah pohon (> 10 cm) 1 1 0 1 1 0 Jumlah pancang 0 0 0 0 0 0 Jumlah anakan 0 3 1 2 3 2 228 .55%). (90.Aspek SOSIAL EKONOMI DAN KONSERVASI Pungguk Gambo. porectum (Roxb.

5 6 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 1 0 1 0 0 0 0 0 Jumlah pancang 0 0 2 0 0 0 0 0 0 0 Jumlah anakan 0 0 0 0 0 3 0 4 0 0 Biji yang mulai berkecambah tersebut tumbuh sangat rapat dan pada umumnya hanya bertahan beberapa hari saja. Tegakan pada tingkat pohon terlihat sangat rapat (Gambar 8) dan pada sebagian petak sampel terdapat pohon dengan ukuran diameter yang cukup besar namun belum menampakkan tandatanda terjadinya pembusukan yang mengakibatkan terbentuknya gaharu (Gambar 9). Namun demikian semai/seedling berukuran tinggi di atas 10 cm saja dihitung dalam petak pengamatan (2 m x 2 m) untuk memperoleh angka nilai penting. karena akan dipungut oleh penduduk untuk diperdagangkan. plot 1. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Pungguk Gambo No.(Titiek Setyawati) No. Pada umumnya pohon mulai berbunga dan berbuah pada umur 5 sampai 6 tahun bahkan pohon berukuran sedang bisa menghasilkan biji kurang lebih 1...5 kg pada musim yang baik. malaccensis Lamk. Masa 229 .Potensi dan Kondisi . plot 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 0 1 Jumlah pancang 0 0 0 0 Jumlah anakan 2 1 3 3 Tabel 5. 2. 4... pancang dan anakan A. Jumlah pohon. 3.

Gambar 8. Sumarna et al. Pembungaan pada bulan Maret-April akan menghasilkan buah di bulan Juli-Agustus (Adelina. 2000. Tegakan gaharu yang rapat Gambar 9. Di Sumatera. 2001). masa berbunga dan berbuah 2 kali dalam setahun. Penyakit seperti ini tidak ditemukan di lokasi penelitian di Bengkulu Utara.. 2004). Buah ini harus langsung dipanen dari pohonnya. menghisap cairan daun dan menyebabkan helai pucuk daun bergulung dan mengakibatkan anakan menjadi kerdil.Aspek SOSIAL EKONOMI DAN KONSERVASI berbunga dan berbuah biasanya terjadi pada bulan-bulan kering. Petani menggunakan pestisida jika perlu untuk membasmi serangga ini. Buah yang matang berwarna coklat kehitamhitaman. Meskipun ada. Pohon gaharu dengan diameter ≥ 50 cm Pohon berbunga pada bulan Juli dan Agustus dan menghasilkan buah matang pada bulan November-Desember. 230 . Masalah utama di lapangan adalah penyakit pada anakan yang disebabkan oleh serangga kecil yang hinggap di ujung daun anakan. Perkecambahan biji dan anakan yang muda sangat rentan terhadap penyakit damping off yang disebabkan oleh jamur (Kundu dan Ka-chari.

Kesimpulan 1. malaccensis Lamk.(Titiek Setyawati) dilaporkan hanya sedikit di beberapa tempat saja.33 pohon/ha di Papua. malaccensis Lamk. Namun hal ini tidak mengurangi kerusakan dan berkurangnya populasi gaharu di alam (Anonim.37 pohon/ha di Kalimantan. maka banyak kolektor yang tidak berpengalaman pada akhirnya ikut mengeksploitasi gaharu di alam. tampak bahwa potensi tegakan alam A. Berdasarkan hasil pengamatan lapangan dan estimasi potensi regenerasi alam jenis-jenis pohon penghasil gaharu yang tumbuh di hutan alam di beberapa lokasi contoh di Kabupaten Lampung Tengah dan Lampung Barat.. tampak bahwa potensi tegakan alam A. Sebagai akibatnya populasinya di alam makin lama makin berkurang. Indonesia merupakan eksportir utama produk gaharu dan dengan tingginya permintaan pasar akhir-akhir ini serta tingginya harga yang ditawarkan di pasar dunia.. Hasil pengamatan di dua lokasi contoh di Kabupaten Bengkulu Utara.Potensi dan Kondisi . Beberapa peneliti menduga bahwa hanya 10% dari pohon Aquilaria yang mengandung gaharu. Meskipun tampak bahwa di kawasan Bengkulu Utara di sebagian tempat tampak rapat namun keberadaan pohon penghasil gaharu sendiri tidak menjamin adanya resin gaharu. Saat ini gaharu sudah masuk dalam Appendix II CITES. 2007. Soehartono dan Newton. sudah mengalami penurunan populasi. masih banyak namun demikian kondisinya saat ini menghadapi ancaman penurunan populasi di berbagai tingkatan umur 231 . 2001).. 3. Estimasi potensi stock kayu gaharu di Indonesia yaitu 1. dan 4. KESIMPULAN DAN SARAN A. 2.87 pohon/ha di Sumatera.. Bisanya petani akan membuang anakan yang sakit. Demikian pula dengan potensi regenerasinya yang ditunjukkan dengan sedikitnya jumlah semai maupun anakan yang ada di bawah tegakan alam. Tampak bahwa stock di kawasan hutan di Sumatera lebih rendah dibandingkan dengan kawasan hutan yang ada di Kalimantan dan Papua.

Untuk data masa pembungaan dan berbuah sampai saat penelitian belum dapat diperoleh mengingat masa pengamatan tidak bertepatan dengan masa berbunga dan berbuah. khususnya Kabupaten Lampung Tengah dan Lampung Barat memiliki potensi tegakan alam gaharu yang cukup merata meskipun di beberapa lokasi jumlah sampelnya tidak memadai. Meskipun ada beberapa lokasi sampel dengan kondisi tegakan pohon dewasa yang sangat kurang. kawasan hutan di Provinsi Bengkulu. sehingga diperlukan penyuluhan bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan Taman Nasional Bukit Barisan Selatan dan kawasan hutan lindung. Saran Provinsi Lampung. mengingat potensi jenis gaharu yang masih tampak baik. terutama di tingkat seedling dan sapling. 3. Sedikit lebih baik dari kondisi gaharu di Provinsi Lampung. Akibatnya bagi proses regenerasi alaminya terjadi kekosongan tegakan pada tingkat tiang. tidak hanya pohonnya namun juga anakan alaminya. di Bengkulu ditemukan adanya laporan serangan serangga yang menyebabkan pertumbuhan tegakan gaharu menjadi kerdil. akibat pemanenan gaharu yang kurang memperhatikan aspek kelestarian. Berlainan dengan temuan yang ada di Provinsi Lampung. malaccensis Lamk. Tampak pula terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan. Kawasan hutan di Provinsi Lampung dan Bengkulu memiliki potensi yang cukup baik untuk dijadikan areal sumberdaya genetik untuk jenis A. B. sehingga potensi regenerasi alami akan mengalami hambatan karena ketidakseimbangan pertumbuhan di setiap tingkatan terutama tidak terjadinya pertumbuhan mencapai tingkat tiang. Meskipun demikian jenis pohon ini mengalami ancaman serius akibat perburuan. Sebagian besar penduduk memperjualbelikan anakan alami untuk 232 . khususnya Kabupaten Bengkulu Utara memiliki potensi tegakan alam gaharu yang juga cukup baik dilihat dari sisi populasi tegakan alaminya.

Siapkan Masa Depan. dan J. Jim Green. 2007.. C. Ko m p a s o n l i n e : h t t p : / / r e g i o n a l . 1999. dan IV.tanam. M. Kent.(Titiek Setyawati) dikembangkan lebih lanjut atau ditanam di kebun masyarakat ataupun dijual ke luar daerah Bengkulu. terutama gangguan terhadap proses regenerasi alaminya. L.c o m / r e a d / xml/2009/07/24/1300220/siapkan.depan. Ayo Tanam Gaharu. dan P..Potensi dan Kondisi ..or. Kundu. Krebs. Media on line : http// www.masa. K. 1987. Claiming the Forest. gaharu Anonim. Tumbuhan Berguna Indonesia. J. 2004. Anonim. Forest & Landscape Denmark. I. II. Indonesia. Vegetation Description and Analysis : A Practical Approach. Ecological Methodology. CRC Press. Heyne. Badan Penelitian dan Pengembangan Kehutanan. Coker. Kachari. Mengingat masih terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. Punan Local Histories and Recent Developments in Bulungan. Gaharu (Aquilaria). 2009. 233 . East Kalimantan. Kaskija. CIFOR. M. k o m p a s . December 2004. N. Seed Science and Technology. Ecology : The Experimental Analysis of Distribution and Abundance. 1992. Krebs. wwf.ayo. 103.species_gaharu. Jakarta. Vol. J. Yayasan Sarana Wana Jaya.. Desiccation Sensitivity and Recalcitrant Behaviour of Seeds of Aquilaria agallocha Roxb.id/index. Behalven Press. Harper Collins College Publishers. DAFTAR PUSTAKA Adelina. 2002. maka diperlukan penyuluhan atau pendidikan konservasi bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan hutan lindung yang merupakan habitat alami jenis pohon penghasil gaharu ini. 2000. C.php?fuseactian=whatwedo. Aquilaria malaccensis Lamk. III. 1994. Downloaded: 24 Januari 2007. Seed Leaflet No.

Irian Jaya. Sumarna. Zuhud. Newton. 2001. T. 2001.R. Pelestarian dan Pemanfaatan Keanekaragaman Tumbuhan Obat Hutan Tropika Indonesia. Biological Conservation No. 2000. R. F. Bogor. Sellato. Syaffari.Aspek SOSIAL EKONOMI DAN KONSERVASI Mai.K. Indonesia. Agarwood (Gaharu) Harvest and Trade in Papua New Guinea : A Preliminary Assessment. Status and Use in Indonesia. Latin. East West Center-Prosea. 96. CIFOR. Pengaruh Wadah Penyimpanan dan Kelas Diameter Terhadap Pertumbuhan Stump Wikstroemia polyantha.M. The Impact of Gaharu Harvesting in Indonesia. 1994. dan A. with reference to CITES Decisions 11.CIFOR. T. dan B. Pembibitan Jenis Pohon Penghasil Gaharu (Aquilaria malaccensis Lamk). Centre for Plant Biodiversity Research. 2001. Zich. Y. Canberra.113 Regarding Aquilaria spp. Soehartono. Indonesia. Puri. Elements for a History of Settlement. Trade and Social Dynamics in Borneo.C. Bulungan Ethnobiology Handbook. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria I. Compton. B. Newton. 1996. 2001. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria II. CIFOR. R. E. Forest. Biological Conservation No 97. 2001. Suripatty.112 and 11. A. Mindawati. 1880-2000. Resources and People in Bulungan.A. Bogor. Soehartono. Balai Penelitian Kehutanan Manokwari.C. Australia. An information Document Prepared by TRAFFIC Oceania for the Eleventh Meeting of the CITES Plants Committee. dan N. dan A.A.. 234 . dan J. CSIRO Plant Industry. Buletin Penelitian Kehutanan 1(1).

Cinnamomum iners Blume Peltophorum grande prain Eurya acuminata APDC.. Selaginella plana Hiern. Vitex pubescens Vahl. Cinnanmomum porectum (Roxb. Parkia speciosa Hassk. Dillenia sumatrana Miq. Comersonia bartamia Merr Dehaasia caesia Blume Clidenia hirta don Kibessia azurea DC.. Ficus variegata Bl. Clausena excavata Burm.Potensi dan Kondisi . Cratoxylum formosum Dyer. Garcinia dioica Bl. Eugenia grandis Wight Neonauclea calycina Merr Barringtonia sp.. Antidesma tetandrum Blume Peronema canescens Jack Famili Thymelaeaceae Verbenaceae Myrtaceae Rubiacea Lecythidiaceae Moraceae Moraceae Lauraceae Dilleniaceae Moraceae Rhizophoraceae Dilleniaceae Selaginelaceae Dilleniaceae Rutaceae Rutaceae Apocynaceae Sterculiaceae Lauraceae Melastomataceae Melastomataceae Hypericaceae Theaceae Guttiferae Ulmaceae Mimosaceae Olacaceae Guttiferae Lauraceae Celasteraceae Theaceae Euphorbiaceae Verbenaceae 235 . Dillenia excelsa Gieg. Carallia brachiata Merr Tetracera indica L. Lampung Tengah No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Nama lokal Kayu alim Leban Kelat Kelepu Putat Lahu Ketaran Kilada Simpur Terap Sepat Rempelas Lingkem Ranggung Ancau Cempaka Pulai Lupang Medang Kedukduk Gio Kemutul Seru Asam Kandis Nerung Petai Sebasah Beruas Tepa Sago Sidi Nyari Sungkai Nama botanis Aqualaria malaccensis Lamk. Evodia aromatica Blume Alstonia angustiloba Miq.(Titiek Setyawati) Lampiran 1. Artocarpus elasticus Reinw. Schima wallichii Korth. Strombosia javanica Blume Garcinia celebica L.) Kosterm.. Daftar jenis pohon yang di survei dalam plot pengamatan gaharu di Bukit Rupi. Parasponia parvifolia Miq. Artocarpus anisophyllus Reinw.

Angit Jungjung bukit Sugi Sipunan Kenidai Kendung Naran Kandis Kbg Saka/ Seketut Pelangas Lulus Gamat Marabikang Kemalau Gelam Abang K. Ganophyllum falcatum Blume Lucuma maingayi Dub Carallia brachiata Merr Famili Thymelaceae Lauraceae Verbenaceae Myrtaceae Leguminosae Lauraceae Dilleniaceae Moraceae Leguminosae Burseraceae Euphorbiaceae Euphorbiaceae Rubiaceae Euphorbiaceae Hyperiaceae Styraxaceae Compositae Rutaceae Lauraceae Annonaceae Liliaceae Euphorbiaceae Symplocaceae Myristicaceae Guttiferae Euphorbiaceae Euphorbiaceae Hyperiaceae Elaeocarpaceae Linnaceae Lauraceae Myrtaceae Rubiaceae Rubiaceae Rubiaceae Sapotaceae Sapotaceae Rhizophoraceae 236 . Daftar jenis pohon yang ada di dalam Kelompok Hutan Binjai Temula. Bengkulu Utara No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Nama lokal Karas Gadis Leban Marapuyan Petai Berawas Sipo Terap Jering Tetak Tunjuk Semipis Kademe Semuting Seubo-ubo Kemutun K.Beras Salung Gajah Salung Urat Use Nyaran Ingitdare Nama botanis Aquilaria malaccensis Lamk Cinnamomum porectum (Roxb.Gambir Ketepung K. Clausena exavata Actinodaphne glabra Blume Orophea sp Pleomele elliptica H.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 2.Br Bridelia monoica Merr Symplocos cochinchinense Lour Horsfieldia glabularis Warb Garcinia dioica Blume Aporusa sp. Tarenna confusa K et V. Aporusa aurita Miq Cratoxylum sumatranum (Jack) Blume Elaeocarpus stipularis Blume Ixonanthes petiolaris Blume Litsea firma Hook. Kecamatan Talang Empat.f Eugenia glomerata K et V Timonius sericanthus Boerl Tarenna sp. Desa Dusun Baru.) Kostrm Vitex pubescens Vahl Rhodamnia cinerea Jack Parkia speciosa Hassk Litsea odorifera T et B Dillenia exelsa Gilg Artocarpus elasticus Reinw Archidendron jiringa (Jack) Nielsen Canarium dichotonum Miq Baccaurea racemosa Muell Arg Croton argyratus Blume Neonauclea calycina Merr Glochidion zeylanicum Juss Cratoxylum formosum (jack) Dyer Styrax benzoind Dryand Vernonia arborea Ham.

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->