ISBN 978-979-3145-63-1

Pengembangan Teknologi Produksi

berbasis pemberdayaan masyarakat
Editor: Sulistyo A. Siran; Maman Turjaman

PENGEMBANGAN TEKNOLOGI PRODUKSI GAHARU BERBASIS PEMBERDAYAAN MASYARAKAT SEKITAR HUTAN
Editor: Sulistyo A. Siran; Maman Turjaman ISBN: 978-979-3145-63-1 Penerbit: Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Kampus Balitbang Kehutanan Jl. Gunung Batu No. 5, Bogor 16110 Telp. (0251) 8633234, 7520067; Fax. (0251) 8638111 E-mail: p3hka_pp@yahoo.co.id

Petikan Undang-Undang Nomor 19 Tahun 2002 tentang Hak Cipta Ketentuan Pidana Pasal 72 (1) Barangsiapa dengan sengaja dan tanpa hak melakukan perbuatan sebagaimana dimaksud dalam Pasal 2 ayat (1) atau Pasal 49 ayat (1) dan ayat (2) dipidana dengan pidana penjara masing-masing paling singkat 1 (satu) bulan dan/atau denda paling sedikit Rp 1.000.000,00 (satu juta rupiah), atau pidana penjara paling lama 7 (tujuh) tahun dan/atau denda paling banyak Rp 5.000.000.000,00 (lima miliar rupiah). (2) Barangsiapa dengan sengaja menyiarkan, memamerkan, mengedarkan, atau menjual kepada umum suatu Ciptaan atau barang hasil pelanggaran Hak Cipta atau Hak Terkait sebagaimana dimaksud pada ayat (1) dipidana dengan pidana penjara paling lama 5 (lima) tahun dan/atau denda paling banyak Rp 500.000.000,00 (lima ratus juta rupiah).

ii

KATA PENGANTAR
Terdapat enam tantangan pembangunan kehutanan yang kita hadapi saat ini, yaitu: degradasi hutan, bencana alam dan lingkungan, pemanasan global, share sektor kehutanan terhadap pertumbuhan ekonomi nasional, desentralisasi sektor kehutanan, dan kontribusi kehutanan dalam hal food, water scarcity, energy, and medicine. Namun, kita masih melihat ada peluang yang merupakan sebuah anugerah bagi bangsa kita, yang bila dibudidayakan dan dikelola secara serius akan dapat menjawab paling tidak lima dari enam tantangan tadi. Anu-gerah yang juga merupakan peluang usaha sektor kehutanan dari jenis HHBK ini bernama “gaharu”. Ide dan gagasan membangun hutan tanaman gaharu juga menarik untuk kita kaji bersama. Kalau selama ini perusahaanperusahaan HTI telah eksis dengan komoditi-komoditi kayu seperti mangium, sengon, mahoni, dan jenis tumbuhan penghasil kayu lainnya, maka bukanlah hal yang mustahil untuk mengembangkan hutan tanaman penghasil gaharu apabila secara finansial menjajikan dan memungkinkan setelah dianalisis kelayakan usahanya. Pengembangan usaha budidaya tanaman HHBK unggulan akan berhasil dengan baik apabila didukung oleh semua stakeholder yang berkepentingan, baik Pemerintah Pusat dalam hal ini Departemen Kehutanan, Pemerintah Daerah, pengusaha, dan petani. Disampaikan terima kasih dan penghargaan yang setinggitingginya kepada semua pihak yang telah berkontribusi hingga terbitnya buku ini.
Jakarta, Nopember 2010

Kepala Badan Litbang Kehutanan

Dr. Ir. Tachrir Fathoni, MSc.

iii

iv

...77 4..........DAFTAR ISI KATA PENGANTAR............................................. UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto........................ 115 6............... Sitepu.......................................................................... Najmulah.................... PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman......................................97 Aspek SILVIKULTUR ..... 123 7...... PADA Aquilaria microcarpa Eka Novriyanti ................... Ahmad Yani..53 3......31 Aspek PRODUKSI ..... Najmulah................................................................. Sugeng Santosa.... Ragil Setio Budi Irianto.................... Maman Turjaman ..................... Siran .... Maman Turjaman................ Aryanto. Yasuyuki Hashidoko................................................................B................................................................... Sitepu......................... Aryanto..... Aryanto .......... 113 5........ DI PERSEMAIAN Irnayuli R.................................... Maman Turjaman ...........................................33 1....................... PENGEMBANGAN GAHARU DI SUMATERA Mucharromah. Irnayuli R....................... v PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A..... EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp............................................... Erdy Santoso................................. Erdy Santoso ................................. DAN Fusarium sp.. Irnayuli R.. Ahmad Yani............................................................... Sitepu......... APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp...............35 2............................iii DAFTAR ISI ................................................ TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso.................................. Sugeng Sentosa... KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp............... DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu . Ragil S................. 139 v .......1 STATUS RISET GAHARU ........... Irianto.......

.......... KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi ............ Erdy Santoso........... THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo . Irnayuli R.......................................................................................................... SUMATERA Titiek Setyawati....................... Maman Turjaman.......... 193 12..... 159 10............................ 151 Aspek SOSIAL EKONOMI DAN KONSERVASI ...................... POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk......................... 181 11......... 157 9..................... Sitepu .................................................................... PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti .....Daftar Isi 8.............................................................................. HAMA PADA TANAMAN PENGHASIL GAHARU Ragil SB Irianto....................................................................) DI PROVINSI LAMPUNG DAN BENGKULU............................................ 213 vi .................

Dari sisi manfaat. yaitu karena pengambilan jauh lebih besar daripada produksinya. Dalam kehidupan seharihari telah dikenal pepatah “sudah gaharu cendana pula”. Dilihat dari wujud dan manfaatnya. Pertanyaan yang muncul. maupun masyarakat 1 . lantas kenapa komoditi yang telah populer tersebut sepertinya menghilang begitu lama dan saat ini muncul kembali. baik oleh kalangan elit kerajaan. Gaharu sebenarnya sebuah produk yang berbentuk gumpalan padat berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar tanaman pohon inang (misalnya: Aquilaria sp.PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A. Oleh sebab itu tidak semua pohon penghasil gaharu mengandung gaharu. gaharu memang sangat unik.) yang telah mengalami proses perubahan fisika dan kimia akibat terinfeksi oleh sejenis jamur. gaharu sejak zaman dahulu kala sudah digunakan. Pepatah ini mengindikasikan bahwa sebenarnya komonditi gaharu sudah dipopulerkan oleh nenek moyang kita dan menjadi bukti sejarah bahwa keharuman gaharu telah dikenal sejak ratusan tahun yang lalu. Siran Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu sebuah nama komoditi hasil hutan non kayu yang saat ini menjadi perbincangan banyak kalangan. Jawaban yang sudah pasti adalah rumus umum.

000. kualitas Teri (Rp 10. kualitas Kemedangan (Rp 1.000.s/d Rp 50. keberadaan pohon penghasil gaharu tersebut di Indonesia tidak terkecuali di Sumatera dan Kalimantan semakin langka.000.s/d Rp14.000. Kelangkaan terjadi karena pohon penghasil gaharu ditebang tanpa memperhatikan 2 . maka jenis-jenis tertentu misalnya Aquilaria dan Gyrinops saat ini sudah tergolong langka. anti mikrobia. Kalimantan Timur mencapai Rp 40. Berdasarkan informasi. Selama ini masyarakat hanya tinggal memanen gaharu yang dihasilkan oleh alam. namun menurut kenyataan.000. Gaharu dengan demikian mempunyai nilai sosial.000. sabun.-). baik sebagai sumber pendapatan masyarakat maupun penerimaan daerah.000.000.000. Tarakan.-).000. budaya. kualitas Kacangan dengan harga rata-rata Rp15..per kilogram. Seringkali masyarakat tidak tahu pasti kapan pohon penghasil gaharu mulai membentuk gaharu dan bagaimana prosesnya. Meningkatnya perdagangan gaharu sejak tiga dasawarsa terakhir ini telah menimbulkan kelangkaan produksi gubal gaharu dari alam. pengharum tubuh dan ruangan. harga gaharu dengan kualitas Super di pasaran lokal Samarinda. dan pola pemanenan yang berlebihan serta perdagangan yang masih mengandalkan pada alam tersebut. Saat ini pemanfaatan gaharu telah berkembang demikian meluas antara lain untuk parfum.000. disusul kualitas Tanggung dengan harga rata-rata per kilogram Rp 20. dan stimulan kerja syaraf dan pencernaan.-).000. Walaupun sejak 1994 Indonesia berkewajiban melindungi pohon penghasil gaharu. aroma terapi.s/d Rp 4. dan Suloan (Rp75.000.suku pedalaman di Sumatera dan Kalimantan.000. dan Nunukan. dan ekonomi yang cukup tinggi. harga jual yang tinggi.000. Secara tradisional gaharu dimanfaatkan antara lain dalam bentuk dupa untuk acara ritual dan keagamaan. Besarnya permintaan pasar.-. dan masuk dalam lampiran Convention on International Trade on Endangered Spcies of Flora and Fauana (Appendix II CITES). bahan obatobatan yang memiliki khasiat sebagai anti asmatik.-.. Bertahun-tahun masyarakat dan pemerintah daerah Kalimantan dan Sumatera menikmati berkah dari keberadaan gaharu.000. body lotion. bahan kosmetik dan obat-obatan sederhana...000.

Kalaupun ada pohon yang mengandung gaharu. Prospek untuk mengembalikan gaharu menjadi komoditi andalan kembali terbuka dengan ditemukannya teknologi rekayasa produksi gaharu. Menurut hasil kajian.. Siran) ada atau tidak adanya gaharu pada pohon tersebut... mungkin puluhan atau bahkan ratusan pohon penghasil gaharu yang harus ditebang. sedangkan saat ini produksi tersebut merosot drastis hanya kira-kira puluhan ton saja dengan kualitas yang bervariasi. Peningkatan produksi gaharu dimaksud (yang kegiatannya terdiri dari kegiatan di bagian hulu sampai hilir) selanjutnya akan berdampak pada peningkatan penerimaan oleh masyarakat petani. dan LSM konservasi. baik in-situ (dalam habitat) maupun ek-situ (di luar habitat) dan budidaya pohon penghasil gaharu.. dan kalaupun ada usaha konservasi dan budidaya namun skalanya terbatas dan hanya dilakukan oleh lembaga penelitian. Praktek semacam inilah yang mengakibatkan jumlah pohon pengahasil gaharu di alam semakin menurun dari tahun ke tahun. pengusaha 3 . Guna menghindari agar tumbuhan jenis gaharu di alam tidak punah dan pemanfaatannya dapat lestari maka perlu diupayakan untuk konservasi. Dengan teknologi inokulasi maka produksi gaharu dapat direncanakan dan dipercepat melalui induksi jamur pembentuk gaharu pada pohon penghasil gaharu. Sementara masyarakat secara luas enggan untuk melakukan budidaya pohon penghasil gaharu karena memang tidak memberikan keuntungan apa-apa. (Sulistyo A. dari 20 pohon penghasil gaharu yang ditebang di hutan alam hanya ada satu atau sering sama sekali tidak ada yang mengandung gaharu. Oleh karena itu dapat dibayangkan kalau pencari gaharu mendapatkan gaharu kira-kira 5 kilogram. Namun upaya tersebut tidak mudah dilaksanakan.Perkembangan Pemanfaatan Gaharu . maka jumlah gaharu yang ada di pohon tersebut hanya beberapa gram saja. Indikasi menurunnya pupulasi pohon penghasil gaharu ditunjukkan oleh kecenderungan produksi gaharu dari Kalimantan dan Sumatera dari tahun ke tahun. di mana realisasi produksi gaharu pada dekade 80’an pernah mencapai ribuan ton dengan kualitas yang tinggi. perguruan tinggi.

gaharu. Di lndonesia hingga saat ini diperkirakan terdapat lebih kurang 25 jenis tumbuhan penghasil gaharu yang dikelompokkan ke dalam delapan marga dan tiga suku. berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar dari jenis tumbuhan penghasil gaharu yang telah mengalami proses perubahan kimia dan fisika akibat terinfeksi oleh sejenis jamur. Kalimantan 4 . Kalimantan Barat. Berdasarkan sebaran tempat tumbuh. pemahaman mengenai pentingnya nilai gaharu. dan Kepulauan Maluku (1 jenis). perlunya budidaya. konservasi. Pulau Papua (2 jenis). tumbuhan penghasil gaharu umumnya tumbuh di Pulau Kalimantan (12 jenis) dan Pulau Sumatera (10 jenis). Dari pengamatan sebaran Aquilaria spp. Selain itu hutan hujan tropis Kalimantan juga sangat kaya dengan hasil hutan bukan kayu (HHBK). kemudian dalam jumlah terbatas tumbuh di Kepulauan Nusa Tenggara (3 jenis). yang dilaksanakan pada tahun 2000 ditemukan bahwa Aquilaria spp. dan penerimaan pendapatan asli daerah serta devisa negara. Oleh sebab itu tidak semua tanaman penghasil gaharu menghasilkan gaharu. dan rekayasa pembentukan gaharu yang dapat mengembalikan status komoditi dari kelangkaan menjadi produk andalan. Pulau Jawa (2 jenis). tumbuh tersebar secara luas di Kalimantan Timur. Tulisan ini dipaparkan dengan maksud untuk memberikan gambaran secara umum mengenai pemanfaatan gaharu. Pulau Sulawesi (2 jenis). Gaharu adalah gumpalan berbentuk padat. GAMBARAN UMUM TUMBUHAN PENGHASIL GAHARU Hutan hujan tropis di Indonesia semenjak tiga puluh tahun yang lalu dikenal sebagai salah satu penghasil utama kayu bulat (log) untuk bahan baku industri perkayuan. di mana salah satu di antaranya adalah gaharu yang bernilai ekonomis tinggi.

beberapa instansi pemerintah dan masyarakat telah melakukan inisiatif untuk mengadakan pelestarian tumbuhan penghasil gaharu dan sekaligus membudidayakan. agarospirol. jinkohol... Menyadari semakin langkanya tumbuhan penghasil gaharu. Lebih lanjut Susilo (2003) mengatakan bahwa terdapat 17 macam 5 . di pedalaman hutan Kalimantan Barat dan Kalimanatan Tengah serta menurunnya realisasi produksi gaharu dari tahun ke tahun. (-)-10-epi-y-eudesmol. dihydrokaranone. namun dengan semakin sulitnya mendapatkan gaharu dari waktu ke waktu menunjukkan populasi Aquilaria spp. (Sulistyo A. Siran) Tengah. salah satu tumbuhan penghasil gaharu terpenting yang banyak tumbuh di Kalimantan telah dimasukkan ke dalam Appendix II sebagai tumbuhan yang terancam punah sehingga dalam penebangan dan perdagangannya perlu dibatasi. populasi Aquilaria spp. Indikasi dari menurunnya populasi Aquilaria spp. Walaupun realisasi produksi gaharu tidak menggambarkan besarnya potensi. jinkohol II serta oxo-aga-rospirol. seluruh jenis Aquilaria telah dimasukkan dalam Appendix II CITES. (-agarofuran. baik lokal maupun pendatang untuk melakukan eksploitasi gaharu secara besar-besaran. Tingginya permintaan pasar dunia akan gaharu dan harga jual gaharu yang cukup tinggi telah menarik minat masyarakat.. terus mengalami penurunan. nor-ketoaaga-rofuran. Akibatnya. dan Kalimantan Selatan. Bahkan sejak tahun 2004. jinkohon-eremol. Untuk mencegah dari kepunahan maka pada pertemuan CITES (The Convention on International Trade in Endangered Species of Wild Flora and Fauna) ke-IX di Florida.. KANDUNGAN DAN MANFAAT GAHARU Terdapat beberapa zat penting yang terkandung dalam gubal gaharu yaitu (-agarofuran. antara lain dari pergerakan pencari gaharu yang telah mengarah pada bagian utara Kalimantan Timur. baik untuk kepentingan konservasi maupun ekonomi. Aquilaria malaccensis. kusunol. Amerika Serikat pada tahun 1994.Perkembangan Pemanfaatan Gaharu . di hutan alam semakin menurun dan bahkan pada suatu saat menjadi punah.

kanker. radang lambung dan ginjal. maka pengetahuan cara pendugaan kandungan gaharu pada tumbuhan penghasil gaharu yang terinfeksi jamur pembentuk gaharu perlu diketahui terutama oleh para pemungut pemula 6 . bahan antibiotic. Limbah bekas gaharu yang telah disuling digunakan untuk dupa dan bahan untuk upacara agama. dan stres. membakar jenazah bagi umat hindu. agarospirol. malaria. hepatitis. 3. Di samping itu dengan perkembangan ilmu dan teknologi industri.senyawa yang terdapat pada gaharu. Gaharu dengan aromanya yang khas digunakan masyarakat di Timur Tengah sebagai bahan wewangian. asma. Karena aromanya harum. juga telah berkembang industri pemanfaatan gaharu sebagai bahan baku industri obat herbal alami. gubal gaharu diperdagangkan sebagai komoditi elit untuk keperluan industri parfum. kosmetika. gangguan ginjal. dan pengawet berbagai jenis asesori. untuk pengobatan stres. saat ini berbagai negara memanfaatkan gaharu selain sebagai bahan pengharum (parfum) dan kosmetik. kanker. antara lain: noroxoagarofuran. Selain itu gaharu telah dipergunakan sebagai bahan baku industri parfum. sedangkan air suling gaharu dimanfaatkan untuk kesehatan. reumatik. setanggi (dupa). TBC. Selanjutnya Oiler (tanpa tahun) dalam Suhartono dan Mardiastuti (2003) menyebutkan terdapat 31 unsur kimia yang terkandung di dalam gaharu dan bahan kimia penyusun utamanya adalah 2-(2-(4 methoxyphenyl)ethil)chromone (27%) dan 2-(2-phenylethyl)chromone (15%). PEMUNGUTAN DAN PENGOLAHAN GAHARU A. kecantikan. Di Cina. kosmetik. p-methoxybenzylaceton.4 –dihydroxy-dihydro-agarufuran. kebugaran serta bahan minuman (kopi) oleh masyarakat di Kabupaten Berau. gaharu dimanfaatkan sebagai obat sakit perut. hio. liver. dan tumor yang masih dalam proses uji klinis. asma. tasbih. dan aquillochin. Cara Pendugaan Kandungan Gaharu Karena tidak semua tumbuhan penghasil gaharu berisi gaharu. dan obatobatan. tumor.

7 . Cara ini disebut tubuk. Cara lain yang berlaku pada masyarakat Dayak Kenyah dan Punan di Kalimantan Timur adalah dengan mengiris dan memotong bagian kayu dari tumbuhan penghasil gaharu yang terkena infeksi penyakit hingga ke bagian tengah batang.000/tolak (1 tolak = 12 cc). Untuk lebih meyakinkan biasanya serpihan kayu tadi selanjutnya dibakar untuk mengetahui apakah mengeluarkan bau/ aroma wangi khas gaharu. Siran) sehingga tidak terjadi salah tebang pada pohon yang tidak berisi gaharu. (Sulistyo A. Adapun ciri dari tumbuhan penghasil gaharu berisi gaharu antara lain adalah: daun berwarna kuning dan rontok. Potongan kayu berisi gaharu kemudian dikumpulkan dan secara perlahan bagian kayu dipisahkan dari gaharu dengan menggunakan pisau kecil atau pahat cekung. C. tajuk pohon kecil dan tipis. Pengolahan Gaharu Sampai saat ini produk gaharu yang berasal dari alam umumnya dipasarkan dalam bentuk bongkahan namun ada pula dalam bentuk minyak hasil sulingan. Setelah ditemukan ciri-ciri tersebut maka dilakukan uji pelukaan pada batang pohon dengan menggunakan kapak atau parang... Bilamana terdapat alur coklat kehitaman pada batang menunjukkan adanya kandungan gaharu. banyak terdapat benjolan dan lekukan sepanjang batang atau cabang pohon. Cara penyulingan minyak gaharu dapat dilakukan dengan dua sistem yaitu sistem kukus dan tekanan uap.. Sistem Pemungutan Gaharu Pohon dari tumbuhan penghasil gaharu yang telah diyakini mengandung gaharu ditebang. Harga minyak gaharu di pasaran Jakarta Rp 750. cabang pohon banyak yang patah. puncut atau pahat.Perkembangan Pemanfaatan Gaharu .. Cara pemungutan gaharu semacam ini di Sumatera dan Kalimantan disebut servis. kulit kayu kering dan rapuh serta bila ditarik mudah putus. B. kemudian dipotong-potong dan dibelah untuk diambil gaharunya.

1-1999) diharapkan standar mutu tersebut dapat segera menjadi bahan acuan para pengusaha gaharu. Pada Tabel 1 disajikan kriteria dan klasifikasi mutu gaharu. Tabel 1. 1. pedagang pengumpul. dan cincangan dan setiap kelas mutu dibedakan lagi menjadi beberapa sub kelas mutu. teri. 4. kacangan. 2007 8 . Lokasi Super Tanggung Kacangan Kacangan A Kacangan B Kacangan C Teri Teri A Teri B Teri C Teri kulit A Teri kulit B Kemedangan Kemedangan A Kemedangan B Kemedangan community Sudokan Serbuk Serbuk Cincangan Samarinda Super king Super A Super AB 2. tanggung. Dengan telah ditetapkannya standar nasional untuk mutu gaharu (SNI 01-5009. TangKacangan isi Teri super gung isi Kacangan Teri laying Tangkosong gung kosong Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan. Klasifikasi mutu gaharu di Kota Samarinda dan daerah sekitarnya Klasifikasi mutu No. Keragaman dan ketidakjelasan di dalam penentuan mutu tersebut menyebabkan harga jual yang berbeda dengan kelas mutu yang sama. dan pemungut gaharu di dalam menentukan kelas mutu gaharu. Muara Kaman Kota Bangun Muara Wahau Super A Super B Super A Super B Kacangan isi Teri isi Kacangan Teri kulit kosong Kacangan A Kacangan B Teri A Teri B 3. Secara umum klasifikasi mutu gaharu dapat dikelompokkan menjadi enam kelas mutu yaitu super.KLASIFIKASI MUTU GAHARU Klasifikasi mutu gaharu di Kalimantan Timur khususnya di Kota Samarinda dan daerah sekitarnya hingga saat ini masih belum seragam (Tabel 1) dan penentuannya dilakukan secara visual. kemedangan.

000. 1.100. Dalam 5.71/ 09/99.000 Super 20. tidak ada campuran dengan serat kayu.per kg. Kelas mutu Harga (Rp/Kg) kg.000.minyak gaharu.000. bagian dalam tidak berlubang.250.1-1999.000. Potongan kecil kayu dari pemisahan gaharu. bercampur kayu. mengkilap dan sangat berbau.000.000.000. Teri 5.000.2.rendah berharga sekitar Rp 25..000.000. Kemedangan Cincangan Sumber : Balai Penelitian dan Pengembangan Kehutanan Kalimantan. keras.dilihat pada Gambar 3. 2006 Berdasarkan informasi pasar di Samarinda (Tabel 3) harga gaharu dengan kualitas super dapat Tabel 3.000. Gaharu berwarna hitam dan coklat.25. Kualitas gaharu yang paling 1.000.. 1386/BSN-I/HK. Klasifikasi Super Kriteria Gaharu berwarna hitam pekat. Harga jual gaharu di mencapai Rp 30. berupa butiran-butiran lebih kecil dari biji kacang dan lebih tipis atau berdiameter sekitar 1 mm.beberapa sampel gaharu dapat Teri B 750.75. Gaharu berwarna hitam terkadang bercampur coklat. Teri A 1.000. telah ditetapkan Standar Nasional mutu gaharu dengan judul dan nomor: Gaharu SNI 01-5009. Super King 30.. (Sulistyo A.000. berupa butiran-butiran sebesar biji kacang atau berdiameter sekitar 2 mm.penyulingan untuk menghasilkan Kacangan B 5.000. disusul kualitas tanggung dengan Kalimantan Timur harga rata-rata Rp 10. Kayu yang mengandung getah gaharu. Teri C 500.. pasaran Samarinda. kadang bercampur serat kayu dan berukuran tanggung.000.per No..50. padat. 2006 9 . Secara visual Kacangan C 2. Kacangan 4.000 per kg.000. Kacangan A 7. 2. padat.- 6. Tanggung 3.000. Kriteria dan klasifikasi mutu gaharu No.000.4. keras.500.000. Teri Kulit A Teri Kulit B Kemedangan A Kemedangan B Kemedangan C Suloan 300.000.500.000.Berdasarkan Keputusan Kepala Badan Standarisasi Nasional (BSN) No. dan pada umumnya Super AB 15.500. Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan. Gaharu berwarna hitam terkadang bercampur coklat. 6. berupa bongkahan atau butiran berukuran besar.Perkembangan Pemanfaatan Gaharu . Siran) Tabel 2.000. Tanggung 10.000.digunakan sebagai bahan baku 3. bagian dalam kadang berlubang. bercampur kayu.

Kemudian yang dimaksud dengan kemedangan adalah kayu yang berasal dari pohon atau bagian pohon penghasil gaharu. Menurut SNI 01-5009. lambang dan singkatan. syarat mutu. dan aroma ketika dibakar. (c) teri dan dari pohon atau bagian pohon (d) kemedangan penghasil gaharu. (b) kacangan. ditandai oleh warnanya yang putih keabu-abuan sampai kecoklat-coklatan. dan abu gaharu. syarat lulus uji dan syarat penandaan. kemedangan. Setiap kelas mutu selanjutnya dibedakan lagi menjadi beberapa sub kelas berdasarkan ukuran.1-1999 yang dimaksud dengan gubal Gambar 1. spesifikasi. Klasifikasi mutu gaharu terdiri dari gubal gaharu. memiliki kandungan damar wangi dengan aroma yang lemah. Abu gaharu adalah serbuk kayu sisa pemisahan gaharu dari kayu.standar ini diuraikan mengenai definisi gaharu. cara uji. berserat kasar dan kayunya yang lunak. dengan aroma yang kuat. cara pemungutan. ditandai oleh warnanya yang hitam atau kehitaman berseling coklat. pengambilan contoh. 10 . klasifikasi. Sampel gaharu (a) gaharu adalah kayu yang berasal kelas tanggung. serat. kandungan damar wangi. warna. istilah. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia dapat dilihat pada Tabel 4. bobot.

. C. B. 1.. Mutu VII Abu gaharu Mutu Utama Mutu I Mutu II Kurang Kurang kuat Cincangan Hitam Tinggi Sedang Kurang Kuat Sedang Kurang TATA NIAGA GAHARU Proses pemasaran gaharu di berbagai tempat di Indonesia dimulai dari pemungut gaharu yang menjual gaharu yang ditemukannya kepada pedagang pengumpul di desa atau di kecamatan dan selanjutnya oleh pedagang pengumpul dijual ke pedagang besar (eksportir) di Ibukota Propinsi. Mutu VI Kemedangan II Kemedangan III Kurang Kurang kuat 7. 2. Super Super AB Sabah Super Hitam merata Hitam kecoklatan Hitam kecoklatan Tinggi Cukup Sedang Kuat Kuat Agak kuat Tanggung A Sabah I Tanggung AB Tanggung C Coklat kehitaman Coklat bergaris hitam Coklat bergaris putih tipis Kecoklatan bergaris putih tipis Kecoklatan bergaris putih lebar Putih keabuabuan garis hitam tipis Putih keabuabuan Tinggi Cukup Sedang Sedang Agak kuat Agak kuat Agak kuat Agak kuat 5. 3. 4.Perkembangan Pemanfaatan Gaharu . 2. 3. 3. Mutu V Kemedangan I Sedang Agak kuat 6. 2. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia Kesetaraan dengan standar mutu di pasaran Kandungan damar wangi No Klasifikasi mutu Gubal Mutu Utama Mutu I Mutu II Kemedangan Mutu I Mutu II Mutu III Mutu IV Warna Bau/aroma (dibakar) A.. 1. Siran) Tabel 4. 11 . 1.. (Sulistyo A.

Pembelian gaharu dilakukan sepanjang tahun melalui pedagang pengumpul atau pemungut bebas.Salah satu contoh alur tata niaga gaharu di Kalimantan Timur dapat diuraikan seperti pada Gambar 2. bahkan untuk mendapatkan jumlah yang diinginkan mereka menanamkan modal yang disalurkan melalui 12 . Pemungut gaharu terdiri dari pemungut bebas dan pemungut terikat. Pemungut bebas adalah pemungut gaharu dengan modal kerja sendiri sehingga bebas di dalam menentukan waktu pencarian gaharu dan menjual hasil perolehannya. Pembelian meningkat bilamana permintaan pasar terhadap gaharu tinggi. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 2. baik kepada pedagang pengumpul di desa. Pedagang besar selain memiliki modal besar juga izin usaha yang dikeluarkan oleh instansi pemerintah. pedagang pengumpul di kecamatan maupun langsung kepada pedagang besar (eksportir) di Kota Samarinda. Contoh alur tata niaga gaharu di Kalimantan dan Sumatra Pedagang pengumpul terdiri dari pedagang perantara di desa yang langsung melakukan pembelian gaharu yang diperoleh para pemungut. Hasil pembelian dari pedagang perantara ini kemudian dikumpulkan oleh pedagang pengumpul di kecamatan untuk selanjutnya dijual kepada pedagang besar karena adanya ikatan kontrak. Pemungut terikat adalah pemungut gaharu yang dimodali sehingga waktu pencarian dan penjualan hasil perolehannya terikat pada pemberi modal yaitu pedagang pengumpul yang merupakan perpanjangan dari pedagang besar.

Siran) pedagang pengumpul ataupun secara langsung kepada pemungut untuk modal kerja mencari gaharu..Perkembangan Pemanfaatan Gaharu . Gaharu yang diperdagangkan di Indonesia terdiri dari tiga jenis. pengambilan dari alam atau hasil budidaya (penangkaran). Alur tata niaga Gaharu di daerah (Kalimantan) PEMASARAN GAHARU Dalam dunia perdagangan gaharu.. yaitu: gaharu dari Sumatera dan Kalimantan dengan jenis Aquilaria malaccensis dan A. Oleh karena itu maka secara umum pemanfaatan gaharu harus mengikuti tahapan dan aturan-aturannya.. sedangkan jenis gaharu Gyrinops lebih banyak diproduksi dari Nusa Tenggara.. Pemasaran gaharu yang merupakan salah satu bentuk pemanfaatan tumbuhan dan satwa liar diatur berdasarkan Peraturan Pemerintah Nomor 8 Tahun 1999 dan Konvensi Perdagangan Internasional tentang jenis flora dan fauna liar yang terancam punah (CITES). pengangkutan untuk peredaran dalam negeri dan pengangkutan untuk pemasaran luar negeri. gaharu dari Papua. Sulawesi dan Maluku lebih dikenal dengan nama Aquilaria filaria. 13 . (Sulistyo A. gaharu menjadi komoditi primadona dan memiliki nilai komersial yang cukup tinggi sehingga banyak diburu oleh konsumen. baik di Indonesia maupun di luar negeri. microcarpa. yaitu: penentuan kuota. Apabila diperhatikan maka perdagangan gaharu hasil alam di Indonesia dari dulu hingga saat ini lebih banyak bertumpu pada peyebaran secara ekologis jenis-jenis gaharu tersebut. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 3.

Bahkan saat ini sudah dikembangkan daun jenis Aquilaria dan Gyrinops untuk bahan pembuatan minuman teh karena kandungan zat anti oksidan dalam daun yang cukup tinggi. pengangkutan dan peredaran secara domestik produk sampai akhirnya ke konsumen. sabun. Produk turunan gaharu: sabun transparan. lulur. makmul. Gambar 4. pemanfaatan untuk obat-obatan dan aroma terapi. Karena perkembangan teknologi.A. lotion. Beberapa contoh produk dimaksud dapat dilihat pada gambar 3 dan 4 berikut. tapi juga sudah mengarah ke produk turunannya. produk gaharu yang diperdagangkan dalam negeri saat ini tidak saja terbatas pada chip atau serpihan dengan bermacam-macam kelas. obat nyamuk. cream whitening. antara lain: minyak. lulur dan lotion 14 . hio. pembersih muka. Pemasaran Dalam Negeri Pemasaran dalam negeri dimulai dari aktivitas pengambilan.

NTT. baik dalam menentukan harga maupun kualitas gaharu. Pemasaran gaharu dalam negeri terbentuk karena adanya hubungan antara daerah pemasok dengan kota/pusat penerima. Produk sirup dan teh untuk bahan minuman Dilihat dari pelaku usaha. baik sebagai individu (perorangan). termasuk Riau. maka terdapat kecenderungan untuk saling menekan harga. yaitu pasar yang dikuasai oleh pembeli. ditambah dari daerah Indonesia bagian barat. Daerahdaerah ini walaupun letaknya di Indonesia bagian timur. Maluku. Sulawesi.Sirup daun gaharu Gaharu leaf tea Gambar 5. Oleh karena itu bentuk pemasaran gaharu di Indonesia lebih cocok dikatakan sebagai pasar “monopsoni”. 15 . Secara tradisional daerah pemasok gaharu untuk kota Surabaya adalah Kalimantan. Karena jumlah pelaku usaha pemasaran. misalnya pencari gaharu dan pedagang pengumpul di bagian hulu (hutan atau desa sekitar hutan) lebih banyak dibandingkan dengan pedagang menengah dan besar yang berdomisili di ibukota kabupaten atau propinsi. Di duga banyak gaharu yang di perdagangkan secara illegal dari sumatera lewat Riau ke Singapura dan Malaysia. yaitu sumatera. Papua. namun karena akses yang mudah memasok gaharu pula ke Jakarta. banyak fihak yang terlibat dalam perdagangan gaharu. kelompok masyarakat maupun lembaga. NTB.

Kalimantan Sulawesi Papua Maluku Riau  Sumatera Sumatera Jakarta NTT NTB Surabaya Gambar 6. Pemasaran Luar Negeri Secara fisik. produk gaharu sulit dibedakan berdasarkan asal jenis tumbuhan dan asal daerahnya. standar dan kualitas serta harga yang layak sehingga menguntungkan bagi kedua belah fihak. filaria dan Gyrinops diatur perdagangannya oleh konvensi perdagangan internasional yaitu CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) melalui sistem quota. A. Demikian pula dari sisi warna dan aroma sangat sulit bagi orang awam atau pedagang pemula untuk dapat memilah-milahnya. Lalu lintas perdagangan gaharu dalam negeri Beberapa permasalahan yang sering dijumpai di lapangan antara lain: sulitnya menentukan jenis gaharu. yaitu: A. maka jenis Aquilaria yang ada. malaccensis. lalu lintas perdagangan gaharu di dalam negeri dapat dilihat pada gambar berikut. B. Oleh karena kekhawatiran salah satu species penghasil gaharu yang mungkin bisa cepat punah. yaitu konsumen dan produsen. A. microcarpa.Secara garis besar. .

ekspor lebih banyak dilakukan ke negara-negara Asia Selatan untuk digunakan sebagai bahan baku pembuatan minyak wangi dan untuk acara-acara ritual dalam bentuk hio. Kayu gaharu yang bentuknya masih gelondongan dan hanya sedikit mengandung gaharu tersebut digunakan sebagai hiasan yang dipasang di suatu ruangan dengan diberikan sedikit sentuan teknologi ukir sehingga terkesan mewah dan mempunyai nilai seni yang sangat tinggi. wewangian dan aroma terapi. super A dan AB) umumnya dipasarkan ke negaranegara Timur Tengah untuk digunakan sebagai bahan acara ritual keagamaan. Gambar 7. Gaharu dengan kualitas super (superking. Gaharu dalam bentuk gelondongan yang siap dikirim ke Taiwan. 17 .Menurut ASGARIN. produk gaharu yang diperdagangkan ke luar negeri mengikuti selera konsumen. dapat dilihat beberapa gaharu yang masih dalam bentuk gelondongan yang siap untuk diekspor. Pada gambar 6 berikut. makmul dan lain-lain. Untuk gaharu yang berkualitas menengah ke bawah. Nilai keseluruhan dari gaharu tersebut tidak kurang dari Rp 600 juta. Dalam beberapa tahun terakhir terdapat kecenderungan pembeli dari Taiwan untuk mengimpor gaharu dari Indonesia dalam bentuk log.

000 (R) 455. seperti dapat dilihat pada gambar berikut. Menurut ASGARIN.000(K) 326.000 (R) 25. Tabel 5. Menurut sebuah sumber.000 (K) - Tabel diatas memperlihatkan bahwa kuota ekspor gaharu pada tahun 2007 dari ketiga jenis yang dapat dipenuhi hanya dari jenis A.709 (R) 30.250 (K) 74. Dua negara ini pula yang menjadi daerah atau negara tujuan utama ekspor gaharu dari Indonesia. filaria sebanyak tujuh kali lipat. Perkembangan kuota dan realisasi ekspor gaharu Indonesia Tahun 2007 2008 2009 A.000 (R) 173. filaria 76. dan bahkan untuk Gyrinops realisasi ekspornya hanya mencapai 30% dari kuota yang ditetapkan. hal ini terjadi karena ditemukannya potensi baru yang sebelumnya luput dari inventarisasi. Taiwan dan Jepang.Selama 3 (tiga) tahun terakhir jumlah kuota dan realisasi gaharu yang diekspor sebagaimana dapat dilihat pada tabel berikut.000 (K) 23. pusat perdagangan gaharu dunia yang sangat penting adalah Singapura dan Riyad (Saudi Arabia).000 (K) 76.000 (K) 65.890 (R) A.000 (K) 25. malaccensis tidak dapat dipenuhi.882(R) Gyrinops 24. lonjakan kuota yang signifikan terjadi pada jenis A. China. filaria. Singapura selain mendapat pasokan gaharu dari Indonesia juga dari negara Asia Tenggara. filaria yang banyak terpendam di rawa-rawa di Papua.000 (K) 30. misalnya Vietnam dan Kamboja. misalnya untuk jenis A. realisasi ekspor gaharu untuk ketiga jenis dapat terpenuhi 100% dari kuota yang ditetapkan. Hongkong. sedangkan pada A. Sedangkan gaharu yang masuk ke Saudi Arabia di distribusikan lagi ke negara-negara lain di sekitarnya dan sebagian lagi di ekspor ke Inggris dan perancis. sedangkan untuk A.000 (K) 8. Malaccensis 30. 18 . dan sebagian lagi ke Timur Tengah. Oleh Singapura gaharu yang masuk dilakukan penyortiran dan pengemasan dan kemudian di ekspor kembali ke India. Pada tahun 2009.000 (R) 65. malaccensis sebanyak hampir enam kali lipat. Pada tahun 2008.

19 . Rekayasa produksi gaharu diarahkan untuk pohon-pohon penghasil gaharu hasil budidaya. (Sulistyo A.Perkembangan Pemanfaatan Gaharu . Lalu lintas perdagangan gaharu luar negeri REKAYASA PEMBENTUKAN GAHARU Teknik budidaya perlu dikuasai dengan baik untuk dapat membudidayakan pohon penghasil gaharu. penanaman. pemeliharaan. pemberantasan hama dan penyakit hingga tumbuhan tersebut memiliki volume yang cukup memadai. Teknik budidaya dimaksud meliputi kegiatan perbanyakan bibit. sedangkan pohon-pohon penghasil gaharu yang tumbuh secara alami perlu dikonservasi dan dipelihara dengan baik untuk dijadikan pohon induk penghasil anakan... yang dua-duanya berkaitan dengan proses patologis yang dirangsang oleh adanya luka pada batang patah cabang atau ranting. virus. Luka tersebut menyebabkan pohon terinfeksi oleh penyakit (bakteri... jamur) yang diduga mengubah pentosan atau selulosa menjadi resin atau damar. Secara garis besar proses pembentukan gaharu terdiri dari dua. Siran) Hongkong Prancis UK India China Japan Malaysia Taiwan Kwait Oman Qatar Saudi Arabia UAE SINGAPORE Bahrain Middle East Riyadh Indonesia Iraq Iran Afrika Gambar 8. yaitu secara alami dan buatan.

8.Semakin lama kinerja penyakit berlangsung. dimulai dari kegiatan laboratorium. koleksi dan isolasi jamur. Alur kegiatan rekayasa produksi gaharu. Tahapan rekayasa produksi gaharu meliputi banyak kegiatan. 20 . Oleh karena itu untuk dapat mengamati secara langsung proses pembentukan gaharu dilakukan rekayasa dengan cara inokulasi (penyuntikan) jamur atau cendawan pada pohon penghasil gaharu. Eksplorasi. 2. kegiatan di laboratorium dan kegiatan uji lapangan yaitu: 1. kegiatan lapangan dan kombinasi keduanya. 5. dengan teknik induksi yang bermacam-macam dan jenis jamur yang bervariasi. 7. Kegiatan yang “berskala laboratorium” dimulai dari kegiatan lapangan. kadar gaharu menjadi semakin tinggi. Identifikasi jamur secara molekuler Penyaringan (screening) Uji efektivitas Formulasi media Produksi inokulan (jamur) Pembangunan plot demonstrasi untuk ujicoba di lapangan Observasi dan evaluasi Alur kegiatan rekayasa produksi gaharu secara garis besar dapat dilihat sebagaimana gambar berikut: Gambar 9. Rekayasa pembentukan gaharu dengan inokulasi telah dilakukan oleh banyak fihak. 6. 4. 3. Proses pembentukan gaharu di hutan alam sulit dipantau dan diamati.

beberapa isolat lain yang juga cocok dan memberikan hasil yang cukup bagus adalah Jambi dan Kalimantan selatan.. Launching tersebut juga dimaksudkan untuk memberikan akses kepada publik agar dapat memanfaatkan isolat tersebut untuk ujicoba produksi gaharu... Berdasarkan pengamatan sementara. Launching Inokulan Gaharu oleh Menteri Kehutanan Dengan adanya launching tersebut maka secara resmi inokulan prododuksi Puslitbang Hutan dan Konservasi Alam (P3HKA) telah dilepas di pasaran namun masih terbatas. Sumatera Barat. Diantara isolat tersebut empat isolat sudah diujicoba pada beberapa jenis pohon penghasil gaharu di beberapa daerah dan memberikan hasil yang cukup bagus.Perkembangan Pemanfaatan Gaharu . (Sulistyo A. Keterbatasan tersebut dimaksudkan hanya kepada masyarakat petani gaharu atau pelaku usaha gaharu yang telah mendapatkan pelatihan dari P3HKA saja yang boleh menggunakan inokulan tersebut. Siran) Sampai saat sudah berhasil dikoleksi 23 inokulan (isolat) dari sebagian besar propinsi di Indonesia.. Berdasarkan bukti-bukti keberhasilan tersebut. 21 . Gambar 10. Ke empat isolat tersebut adalah: isolat dari Kalimantan Barat. maka secara resmi ke empat jenis isolat tersebut telah di “launching” Menteri Kehutanan (lihat gambar 8) pada Pameran Indo Green yang berlangsung di Jakarta Convention Center (JCC) pada tahun 1999. Gorontalo dan Papua.

Bali. virulensi inokulan yang digunakan. Sukabumi. Menado dan Seram. Bangka. untuk mengetahui perkembangan inokulasi. ujicoba ke enam isolat telah dilaksanakan di 15 (lima belas) lokasi yang tersebar di beberapa propinsi di Indonesia. baik kegagalan maupun keberhasilanya. jenis asal isolat dan jenis pohon penghasil gaharu yang diinokulasi. Sijunjung dan Padang Pariaman (Sumbar). Beberapa faktor penting yang diamati adalah: kondisi kelembaban dan suhu udara. Sumsel. Penyebaran plot inokulasi pembentukan gaharu (gambar bintang warna kuning) Evaluasi dan pengamatan terus menerus dilakukan. Bogor (Jabar).Untuk melihat efektivitas pembentukan gaharu. Kalimantan Barat. 22 . Penyebaran plot inokulasi dapat dilihat sebagaimana gamber berikut. Kalimantan Tengah. baik kondisi ekologis. jarak titik lubang dan lain sebagainya. Ujicoba tersebut dilaksanakan di lokasi dengan kondisi yang berbeda. Bioinduction : 15 locations Gambar 11. yaitu: Bohorok (sumut). Kalimantan Selatan. Jambi. keterbukaan tajuk. Lombok (NB). Carita (Banten).

dan terus meningkat menjadi kelas teri setelah 1 tahun.. Contoh gaharu hasil panen yang dilakukan secara bertahap adalah sebagai berikut.Perkembangan Pemanfaatan Gaharu . dengan harapan bahwa gaharu yang akan dipanen tersebut akan mempunyai kualitas` yang lebih bagus lagi dari sebelumnya. Kualitas gaharu tersebut terus meningkat menjadi kacangan setelah 2 tahun inokulasi dan secara signifikan meningkat menjadi tanggung pada 3 tahun setelah inokulasi. maka hasil gaharu yang dipanen setelah 3 bulan inokulasi memiliki kualitas kemedangan. Siran) Perkembangan hasil inokulasi yang dilaksanakan di salah satu lplot penelitian yaitu daerah Sukabumi dari waktu ke waktu dapat dilihat sebagaimana tabel berikut. Perkembangan hasil inokulasi menurut waktu Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun 2 tahun 3 tahun Kualitas Kemedangan Kemedangan B Kemedangan A teri kacangan tanggung Apabila di sejajarkan dengan kualitas gaharu hasil alam yang ada di pasaran dalam negeri.. Pada saat ini pohon yang ditebang secara bertahap tersebut masih hidup dan masih tumbuh baik di lapangan. (Sulistyo A.. Menurut rencana pada tahun 2011 akan dilakukan pemanen lagi untuk melihat perkembangan kualitas gaharu.. Tabel 6. 23 .

Gambar 12. 24 . Gambar 13. Gaharu hasil panen 3 bulan setelah penyuntikan. Gaharu hasil panen 9 bulan setelah penyuntikan (inokulasi) dengan kualitas kemedangan A. dengan kualitas kemedangan C.

..Perkembangan Pemanfaatan Gaharu . Gaharu hasil panen satu tahun setelah penyuntikan dengan kualitas teri Grade Gubah AB (US $ 200-250/kg) Gambar 15. Gaharu hasil panen dua tahun setelah penyuntikan dengan kualitas kacangan 25 .. Siran) Grade Kemedangan (US $ 100/kg) Gambar 14.. (Sulistyo A.

000.000 750. Gaharu hasil panen 3 (tiga) tahun setelah penyuntikan dengan kualitas tanggung Berdasarkan survey pasar. estimasi harga gaharu hasil panen dari plot penelitian P3HKA dapat dilihat sebagai mana tabel berikut.000 200.000 26 . referensi harga gaharu hasil alam di pasaran dalam negeri dan penawaran dari pedagang gaharu dari Riyad (gambar sudut kanan atas). Harga gaharu yang cenderung meningkat dengan semakin tertundanya waktu panen.> US $ 800 Gambar 16. Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun Harga (Rp) 50. Tabel 7.000 1.

000 ? Hubungan antara kualitas gaharu. Grafik hubungan antara terbentuknya gaharu dengan waktu dapat dilihat pada grafik sebagai berikut. gaharu hasil panen 9 bulan setelah penyuntikan mengandung zat aktif yang cukup 27 ..000 US$ 800 atau 7.500. Kualitas Hasil rekayasa Super Tanggung Kacangan Teri Kemedangan Hasil alam 1 Hasil alam 2 Hasil alam 3 Hasil alam 4 1 2 3 4 Tahun 5 6 7 8 9 10 Gambar 17... Semakin lama proses pembentukan gaharu di pohon maka akan semakin meningkat kualitas gaharu yang akan dihasilkan dan dengan sendirinya akan meningkatkan harga gaharu tersebut. waktu penundaan panen dan harga di pasaran sangan erat sekali. Siran) Umur Setelah Inokulasi 2 tahun 3 tahun 4 tahun Harga (Rp) 2. Grafik hubungan antara terbentuknya gaharu dengan waktu penundaan panen.500. Berdasarkan pemeriksaan laboratorium.Perkembangan Pemanfaatan Gaharu .. (Sulistyo A.

Azulene = komponen minyak esensial tanaman. setidaknya terdapat 12 (dua belas) komponen kimia sebagaimana dapat dilihat pada gambar berikut.konsituen utama dalam minyak melati Maltol = wangi caramel (manis). teh dan daun tembakau Valerolactone = wangi herbal Ambrox = odorant tipe amber. Kandungan kimia yang terdapat pada gaharu hasil rekayasa. wangi & warna biru Benzylacetone = wangi manis bunga. Pemeriksaan kandungan kimia pada gaharu hasil alam menunjukkan hasil yang sama dengan gaharu hasil rekayasa jika dua-duanya diambil dari kualitas yang sama. anti inflamantory Ambrettolide = wangi musk. bahan kosemtik Isolongifolen = bahan odorant & parfum Indole = wangi bunga & parfum. komponen volatile dan kokoa Dumasin = wangi mint. memiliki sifat pestisida Cadinene = konstituen minyak esensial berbagai tanaman Limonene = terpen aroma bunga & buah. 28 .banyak. manis buah & bunga 1 2 3 4 5 Tahun Gambar 18. insektisida botani. penguat rasa/aroma pada roti &kue Komponen Kimia Ketoisophorone = wangi manis campuran kayu.

(Sulistyo A.Perkembangan Pemanfaatan Gaharu . penyiapan bibit. infrastruktur. pengolahan.. subsistem tengah (penyuntikan. terbukalah peluang yang besar untuk kegiatan pengusahaan gaharu yang dimulai dari subsistem hulu (penyiapan lahan. pendidikan dan pelatihan. Hanya dengan koordinasi dan integrasi yang baik di antara seluruh komponen masyarakat dan pemerintah. Ketiga subsistem tersebut di atas memerlukan investasi yang cukup besar.. riset dan pengembangan. 29 . penanaman. maka seluruh sektor harus memainkan peran sesuai dengan tugas pokok dan fungsinya masing-masing. pengangkutan.. tranportasi. maka produk gaharu akan menjadi produk andalan dimasa depan. peluang penyerapan tenaga kerja yang besar dan penerimaan asli daerah yang cukup signifikan. peralatan inokulasi. penyediaan pupuk. subsistem pendukung (kebijakan pemerintah.. Siran) PENUTUP Dengan ditemukannya teknologi inokulasi pembentukan gaharu. skema kredit dan asuransi). Untuk dapat mewujudkan kondisi dan harapan tersebut. dan pengamanan). subsistem hilir (pemanenan. penyediaan inokulan. pemasaran). pemberantasan hama dan penyakit).

30 .

STATUS RISET GAHARU 31 .

32 .

Aspek PRODUKSI 33 .

.

sehingga pemahaman dan keterampilannya untuk mendukung pengembangan cluster industri gaharu telah sangat memadai. mengingat 35 . kecuali dengan campur tangan manusia. sekaligus untuk melindungi ragam pohon penghasil gaharu yang ada di Indonesia.PENGEMBANGAN GAHARU DI SUMATERA Mucharromah Fakultas Pertanian Jurusan Perlindungan Tanaman Universitas Bengkulu PENDAHULUAN Gaharu merupakan produk kehutanan yang memiliki nilai ekonomi sangat tinggi dibanding produk kehutanan lainnya. Pengembangan gaharu ini perlu dilakukan. pengembangan gaharu di sekitar hutan juga akan membantu pengamanan keragaman hayati dan kelestarian hutan. sehingga tidak menyebar jauh. sebagian bahkan pernah menjadi pengumpul. pada umumnya masyarakat yang tinggal di sekitar hutan sudah mengenal gaharu. Dalam pengembangan gaharu. Dari segi kesiapan masyarakat. Dari aspek keamanan lingkungan dan keragaman hayati. mengingat buah pohon ini bersifat rekalsitran. Dari segi keberadaan material bibitnya lokasi sekitar hutan memiliki jumlah tegakan gaharu alam terbanyak. sehingga sangat potensial untuk dikembangkan. masyarakat di sekitar hutan merupakan sasaran ideal yang dapat melipatgandakan peran dan fungsi program tersebut. khususnya untuk menjaga kesinambungan produksi.

tetapi juga perlu didukung dengan pengembangan teknik produksi dan pengembangan sistem yang akan mendukung pengembangan produksi. menguatkan tanah. Dengan nilai ekonomi gaharu yang sangat tinggi dan permintaan pasar dunia yang terus meningkat. berwarna hitam mengkilat dan berat hingga tenggelam dalam air. pengembangan gaharu tidak sama dengan pengembangan tanaman pertanian yang dapat langsung menghasilkan. di samping pemberdayaan dan pemakmuran masyarakat di sekitar wilayah hutan. Selain itu.Aspek PRODUKSI masyarakat sudah dapat memperoleh penghasilan dari usaha pengembangan gaharu yang sangat prospektif secara ekonomi. bangsa. dan negara di samping menghindarkan dari bahaya bencana alam kekeringan. sehingga tidak mudah longsor serta menyerap CO2 dan menghasilkan O2 yang sangat penting dalam mendukung kehidupan. dengan tekstur yang sangat keras dan halus tidak berserat. Gaharu alam telah dikenal sejak ribuan tahun lalu diperdagangkan ke Timur Tengah oleh para pedagang India dan Indo-China. Namun demikian. khususnya yang memiliki kualitas super dan di atasnya. yaitu meningkatkan kapasitas absorbsi dan retensi air tanah. Dengan demikian. paningkatan temperatur udara. produksi gaharu justru tidak akan terjadi bila pohonnya tumbuh sangat baik dan tidak terganggu sedikit pun. Sementara gaharu 36 . kekurangan air bersih. polusi. pengembangan gaharu di wilayah sekitar hutan akan memperkuat fungsi hutan tersebut. Bentuk gaharu super sangat beragam. khususnya yang berkaitan dengan pendanaan proses produksi yang memerlukan dana cukup besar. dan kekurangan oksigen. mengingat pohon penghasil gaharu memiliki morfologi yang sangat mendukung perannya sebagai ’penjaga lingkungan’. Gaharu kualitas super sudah mengeluarkan aroma harum meski tanpa dipanasi atau dibakar. pengembangan produksi gaharu tidak cukup hanya dilakukan dengan penanaman bibit pohon penghasilnya saja. longsor. Sejauh ini produksi gaharu Indonesia masih banyak diambil dari alam sehingga disebut sebagai gaharu alam. termasuk dari wilayah barat Indonesia atau Sumatera dan dihargai sangat mahal. Oleh karenanya. Pada pohon penghasil gaharu. maka pengembangan gaharu sangat berpotensi mensejahterakan masyarakat.

khususnya di area yang paling potensial yaitu wilayah sekitar hutan. B. sehingga lebih mampu menjaga keamanan lingkungan dan keragaman sumberdaya alam di sekitarnya. Kesiapan Teknologi Produksi Berbeda dengan produk pepohonan lainnya yang selalu dihasilkan selama tanaman tumbuh sehat atau dengan kata lain 37 ..Pengembangan Gaharu di . Kesiapan SDM Pendukung Proses Produksi Meskipun gaharu sudah sangat lama menjadi salah satu komoditi ekspor Indonesia. maka volume perdagangan gaharu makin meningkat. Karenanya mereka merupakan kelompok sasaran yang sudah siap menjadi SDM untuk pengembangan gaharu. pembersihan gaharu dari sisa kayu putihnya. Dengan upaya ini. Dengan pengalaman mencari gaharu alam yang sudah cukup lama.. hampir seperti seni memahat. sehingga keberadaan pohon penghasil gaharu juga makin terancam akibat banyak yang ditebangi dan dicacah masyarakat untuk diambil gaharunya. maka produksi gaharu Indonesia akan tetap melimpah dan masyarakat yang memproduksinya juga makin makmur dan sejahtera. Proses ini sangat lambat. namun banyak masyarakat umum yang tidak mengetahui apa yang disebut gaharu. Dengan makin meningkatnya permintaan pasar internasional. pembersihan. Kondisi ini tak akan dapat diatasi kecuali dengan melakukan pengembangan gaharu secara besar-besaran. sehingga membutuhkan banyak tenaga kerja terampil. banyak masyarakat di sekitar hutan yang terampil membersihkan gaharu sehingga cukup siap untuk mendukung pengembangan gaharu di daerahnya... KESIAPAN PENGEMBANGAN GAHARU A. khususnya pada proses pasca panen. kecuali masyarakat di sekitar wilayah hutan yang sudah pernah terlibat dalam pencarian. (Mucharromah) yang memiliki kualitas lebih rendah (kemedangan dan abuk) disuling untuk diambil resinnya dan ampasnya dibuat makmul atau hio untuk ritual keagamaan. dan perdagangan gaharu.

2008a. Namun kejadian pembentukan gaharu oleh faktor abiotik dari alam ini sulit ditiru sehingga tidak dapat dijadikan dasar pada proses produksi dalam bentuk industri.d. maka teknik produksi inokulan dan induksi pembentukan gaharu dengan inokulasi telah siap untuk dilatihkan kepada masyarakat guna mendukung pengembangan produksi gaharu melalui pemberdayaan masyarakat di sekitar wilayah hutan. Temuan tentang adanya jenis jasad renik yang dapat menginduksi terjadinya akumulasi resin wangi yang selanjutnya membentuk gaharu inilah yang mendasari adanya temuan tentang teknik induksi pembentukan gaharu yang dapat digunakan untuk mendukung proses produksi gaharu dalam skala industri. 2008.b.. Faktor abiotik dapat berupa angin atau hujan angin dan petir. Santoso et al. Kesiapan Kontrol Kualitas Produk Untuk keberhasilan dan kesinambungan suatu proses produksi umumnya selalu dilakukan monitoring kualitas produk. Namun mengingat teknik yang diterapkan belum biasa dilakukan masyarakat.. Beberapa kelompok peneliti telah mampu melakukan inokulasi yang merangsang pembentukan gaharu (Mucharromah et al. baik secara alami oleh faktor abiotik maupun biotik ataupun telah diinduksi oleh manusia. Sementara pembentukan gaharu oleh faktor biotik dapat disebabkan oleh infeksi jasad renik terhadap tanaman. selain akibat gesekan hewan dan perilaku manusia yang tidak direncanakan. 2009).c. Selain itu juga perlu dilakukan teknik pelatihan produksi inokulan sehingga proses produksi dapat berlangsung lebih efisien. Kebanyakan gaharu justru ditemukan pada pohon yang terganggu.Aspek PRODUKSI produksi merupakan fungsi dari pertumbuhan tanaman sehat. Kadir. Untuk itu penyiapan SDM pendukung pengembangan gaharu juga perlu mempersiapkan personil yang mampu mengenali kualitas 38 . 2006. gaharu justru tidak akan didapat pada pohon yang tumbuh sehat tanpa ada gangguan apapun. maka untuk persiapan pelaksanaannya dalam proses produksi dibutuhkan pelatihanpelatihan. baik pelatihan teknik inokulasi maupun pelatihan teknik monitoring pembentukan gaharu. C. Dengan dukungan operasional.

mutu TGE/TK5 f. dan abu gaharu. yang terdiri dari: 1. aroma. mutu utama b.dan mensortasi atau mengumpulkan gaharu yang dihasilkan berdasarkan gradasi kualitas dan kegunaannya. mutu TGB/TK2 c. mutu TGF/TK6 g. Pada gaharu alam gradasi kualitas ditentukan berdasarkan standar mutu yang telah ditetapkan secara nasional dalam SNI 015009. Kemedangan. Abu gaharu yang terbagi dalam 3 kelas mutu. kemedangan. mutu TGD/TK4 e. mutu pertama 39 . Gubal gaharu. Dari segi bentuknya. yaitu gubal gaharu. Hal ini membuat gaharu menjadi makin mahal dan nilainya sangat ditentukan oleh kualitas kadar dan kemurnian resin yang dikandungnya. mutu ketujuh = setara dengan M3 3. mutu utama = mutu super b. mutu pertama = mutu AB c. Ketiga sortimen tersebut dibagi lagi dalam 13 kelas kualitas. Adanya aroma harum yang khas dan tahan lama inilah yang membuat gaharu sangat disukai dan dihargai dengan nilai ekonomi yang sangat tinggi. yaitu: a. dan tingkat kekerasan dan berat jenis berbeda. Dalam standar ini kualitas gaharu dibedakan menjadi tiga sortimen. tekstur. mutu TGC/TK3 d. Selain itu jaringan yang mengandung resin wangi gaharu juga hanya didapati pada bagian pohon yang mengalami proses tertentu. yaitu: a. yaitu: a.1-1999. mutu pertama = mutu TGA/TK1 b. yang selanjutnya membuat jaringan kayu tersebut memiliki warna. gaharu merupakan jaringan kayu dari pohon jenis tertentu (penghasil gaharu) dengan kandungan resin sesuiterpenoid volatil beraroma harum gaharu yang cukup tinggi. dengan 7 kelas mutu. seperti pelukaan yang disertai infeksi patogen melalui inokulasi atau proses lainnya. mutu kedua = mutu sabah super 2. dengan 3 tanda mutu.

D. seperti yang telah dilakukan di Kota Bengkulu dan sekitarnya. Pada hasil uji lanjut teknik produksi gaharu yang dilakukan beberapa bulan lalu di Provinsi Bengkulu. di mana pemilik barang merupakan penentu harga. Dengan demikian pengembangan gaharu siap dilaksanakan.. di samping lebih besar manfaatnya bagi pengamanan lingkungan dan pemberdayaan serta pemakmuran masyarakat. 2008). Saat ini sudah cukup banyak pohon penghasil gaharu yang telah diinokulasi. yang biasanya baru dapat dicapai pada 12-18 bulan setelah inokulasi. Namun pembedaan kelas kualitas tersebut secara detil sangat sulit dilakukan sehingga pada prakteknya hingga saat ini konsumenlah yang menentukan tingkat mutu produk dan harga gaharu. Pada 6 bulan setelah inokulasi telah dicapai produk kualitas kemedangan TGB dan TGA. standar kualitas gaharu dan harganya akan lebih terjamin.Aspek PRODUKSI c. khususnya dari jenis Aquilaria dan Gyrinops. proses pembentukan gaharu telah semakin cepat terjadi. Untuk itu pelatihan SDM dalam teknik monitoring perkembangan pembentukan gaharu dan kontrol kualitasnya sangat penting dilakukan. Hal ini menjadi modal utama yang membuat proses produksi gaharu menjadi jauh lebih 40 . Teknik inokulasi untuk induksi pembentukan gaharu juga telah makin efisien dan murah. meskipun sebagian besar masih berada pada mutu TGC (Mucharromah et al. Perkembangan keberhasilan teknik inokulasi ini sangat prospektif untuk mendukung pengembangan produksi gaharu yang pohon penghasilnya telah mulai banyak dibudidayakan di Sumatera dan wilayah lain di Indonesia. mutu kedua. Namun dengan tingkat keahlian sortasi. tidak hanya di sekitar wilayah hutan tetapi bahkan hingga ke halaman rumah dan perkantoran serta sekolah. Hal ini merupakan anomali dari kondisi perdagangan komoditi lainnya. Namun pengembangan gaharu di sekitar wilayah hutan kemungkinan akan jauh lebih efisien proses produksinya. Kesiapan Modal dan Kelembagaan Indonesia merupakan negara yang sangat kaya dengan beragam jenis pohon penghasil gaharu.

2008 dan Sumarna. tidak semua pohon menghasilkan gaharu. Dengan demikian. Sejauh ini keberadaan pohon penghasil gaharu di lapangan telah banyak membantu pelaksanaan uji efektivitas inokulasi. proses produksi gaharu sangat ditentukan kuantitasnya oleh jumlah lubang atau luka yang diinokulasi dan kualitasnya tergantung dengan lamanya waktu sejak inokulasi hingga panen. sebagaimana disajikan pada analisis usaha inokulasi gaharu (Lampiran 1) dan analisis budidaya gaharu (Lampiran 2).. maka pengembangan gaharu hasil budidaya dan inokulasi dapat jauh lebih efisien dibandingkan produksi yang mengandalkan gaharu bentukan alam. dan satu famili Euphorbiaceae (Wiriadinata. Namun dari 41 . pelatihan inokulasi. uji produksi. Namun demikian pengembangan gaharu tetap memerlukan dukungan dana yang relatif besar meskipun rasio keuntungannya terhadap modal juga cukup besar. Saat ini pembentukan gaharu di alam telah dilaporkan terjadi pada sedikitnya 16 jenis pohon dari beberapa genus famili Thymelaceae.. Semakin lama maka semakin banyak resin wangi yang terakumulasi dan semakin tinggi kualitas gaharu yang dihasilkan. Di alam tidak semua pohon penghasil gaharu membentuk gaharu atau hanya sedikit sekali menghasilkan gaharu.3 hingga 14 kg dan umumnya semakin banyak dengan makin besarnya diameter pohon (MacMahon. Selain itu. pelatihan monitoring pembentukan gaharu serta upaya produksi gaharu hasil inokulasi.. Pada gaharu budidaya.Pengembangan Gaharu di . satu famili Leguminoceae. 2002). Jumlah gaharu yang dihasilkan per pohon di hutan alam sangat bervariasi dari 0. Selain itu juga diperlukan adanya kerjasama dan komitmen semua pihak untuk membantu mengawali usaha ini berdasarkan expertise dan bidang pekerjaannya. 1998). (Mucharromah) mudah dan murah.. Hal ini membuat proses produksi gaharu alam menjadi kian mahal. Berdasarkan hasil analisis tersebut maka pengembangan gaharu paling efisien bila dilakukan di area sekitar hutan yang masih kaya dengan tegakan gaharu berdiameter > 20 cm yang dapat diinokulasi untuk mempercepat produksi dan menambah modal awal untuk penanaman pada area yang lebih luas untuk kesinambungan usaha pengembangan gaharu.

dan lebih tinggi. yaitu USD 2. Dengan demikian. khususnya cendawan pelapuk kayu. maka penggunaan inokulan unggul dan teknik inokulasi yang meminimalkan kontaminasi akan dapat meningkatkan kualitas gaharu yang dihasilkan dan mengefisienkan proses produksi hingga dapat dilaksanakan dengan modal lebih rendah. Terbentuknya gaharu kualitas super atau yang sering disebut gubal super ini kemungkinan akan dapat dicapai seiring dengan pengembangan penelitian inokulan unggul yang terus dilakukan. sehingga mampu menutupi pembiayaan untuk pengembangan selanjutnya.000 hingga 16. Sementara kehadiran jenis cendawan lainnya. 2006) atau bahkan B (Surya.komunikasi pribadi. gaharu hasil inokulasi hingga kini belum dapat mencapai kualitas tertinggi gaharu alam. maka produksi gaharu selanjutnya tidak banyak memerlukan bantuan modal lagi.000 per kg di tingkat ’end-consumer’ di luar negeri. yaitu super. akumulasi resin wangi terjadi maksimal hingga luber dan menutupi sel-sel di sekitarnya. justru mendegradasi kembali resin gaharu yang sudah dideposisi bahkan hingga menghancurkan selnya sehingga gaharu yang sudah mulai terbentuk menjadi hancur dan lapuk minimal sebagian dan kualitas gaharu yang dihasilkan akan menurun.Aspek PRODUKSI segi kualitas. double super. Akibatnya jaringan kayu tersebut menjadi halus seperti dilapisi agar dan berwarna coklat kemerahan atau kehitaman. Bila kualitas seperti ini dapat dihasilkan dari inokulasi pohon pada awal proses pengembangan. sebagaimana ditunjukkan oleh data mikroskopis perkembangan deposisi resin gaharu pada area jaringan sekitar lubang yang diinokulasi atau hanya dilukai (Mucharromah dan Marantika. tergantung intensitas atau kadar resin gaharu yang dikandungnya. 2008. 2009). Saat ini kualitas gaharu hasil inokulasi sudah jauh lebih baik dan pada beberapa hasil penelitian sudah mendekati mutu gubal kualitas kemedangan B/C (Santoso. 42 . Secara teoritis keunggulan inokulan dalam menginduksi pembentukan gaharu berkaitan dengan jenis dan kemurnian mikroorganisme yang digunakan. 2008 . Mucharromah dan Surya. Pada gaharu kualitas gubal. karena kualitas seperti gaharu alam tersebut bernilai sangat tinggi.

(Mucharromah) Mucharromah et al.b.c. A. 2006. 2009) menunjukkan bahwa pada jaringan yang terkontaminasi resin gaharu yang awalnya berwarna coklat bening kemerahan berubah menjadi berwarna kehitaman dan menghilang sebelum akhirnya selnya menjadi hancur. maka kualitas gubal super mungkin akan dapat dicapai.. 2006.. beccariana... aroma resin gaharu juga sangat menentukan kualitas.. 2002). 2008a. 2008).. Pada pengamatan mikroskopis (Mucharromah dan Marantika. hirta.. 43 . Oleh karenanya pengembangan gaharu di wilayah sekitar hutan dengan cara memperbanyak pohon-pohon jenis Aquilaria yang ada di lokasi tersebut dan menginokulasi pohon yang sudah tua untuk membiayai peremajaannya akan dapat mengembalikan potensi produksi gaharu yang dahulu dimiliki Sumatera dan wilayah Indonesia lainnya. dikenal menghasilkan gaharu yang disukai konsumen mancanegara sejak jaman dahulu. Dengan teknik inokulasi dan jenis isolat yang lebih murni dan potensial serta waktu antara inokulasi dan panen yang lebih panjang. 2008). kemungkinan karena kemurnian resin yang dikandungnya. MODEL PENGEMBANGAN GAHARU DI SUMATERA Secara teoritis akumulasi resin wangi gaharu telah dilaporkan distimulasi oleh infeksi cendawan dari jenis tertentu (Mucharromah dan Surya. agallocha yang banyak dijumpai di Sumatera. Selain itu kekhasan aroma gaharu juga dipengaruhi oleh jenis pohon penghasilnya dan kemungkinan juga jenis mikro organisme inokulannya.Pengembangan Gaharu di . Sumarna. A. sehingga aroma gubal gaharu kualitas terbaik dari berbagai wilayah dapat berbeda (Mucharromah et al. microcarpa. Oleh karena itu dalam proses produksi gaharu dengan inokulasi perlu diterapkan prinsip-prinsip aseptik yang akan membatasi peluang terjadinya kontaminasi (Mucharromah et al. Sejauh ini aroma gaharu alam lebih lembut dibanding hasil inokulasi. Jenisjenis pohon penghasil gaharu dari spesies Aquilaria malaccensis. A. 2007). Santoso et al. dan A. Selain karena kandungan resinnya yang jauh lebih tinggi..

maka kepada masyarakat pemilik tegakan gaharu yang diameternya telah mencapai > 20 cm ditawarkan kerjasama pengembangan gaharu dengan penanaman kembali dan inokulasi. Dengan demikian maka penggunaan jenis inokulan tertentu dan kemurniannya serta penerapan teknik aseptik dalam penyiapan dan aplikasi inokulan. ketepatan teknik inokulasi. karena masih harus melakukan panen dan proses pembersihan gaharu yang bersifat padat karya. Namun kerjasama ini masih membutuhkan cukup banyak modal untuk menjadi usaha pengembangan gaharu yang mandiri. Meskipun gaharu yang dipanen akan menghasilkan produk yang dapat dijual.000 batang yang ditanam di sekitar pohon induk yang diinokulasi. Sebagaimana diuraikan sebelumnya. Mucharromah. Pertama. namun untuk pelaksanaan proses panen dan pembersihan tersebut diperlukan modal yang cukup besar. Kerjasama ini meliputi pemeliharaan dan penanaman kembali anakan alam yang ada di sekitar tegakan induk hingga mencapai populasi minimal 10-100 batang tanaman muda per pohon induk diinokulasi untuk produksi gaharu. Oleh karenanya pengembangan gaharu tidak dapat dilakukan secara mandiri. Sejauh ini telah dilakukan pengembangan gaharu sebanyak > 10.Aspek PRODUKSI Kemampuan cendawan inokulan dalam menstimulir produksi resin juga sangat terkait dengan tingkat akumulasi resin yang merupakan hasil netto dari proses sintesis dikurangi dengan degradasinya serta jenis resin dan kemurniannya (Agrios. Oleh karenanya di Bengkulu pengembangan gaharu diawali dengan pengujian efektivitas berbagai isolat cendawan yang berpotensi menginduksi pembentukan gaharu dan diikuti dengan pengembangan inokulan unggul yang masih terus dilakukan untuk peningkatan kualitas. Selain itu. 2005. Oleh karenanya campur tangan pemerintah sangat diharapkan. 2004). khususnya pada masyarakat yang tidak memiliki modal dan hanya mengandalkan sumberdaya alam dan keterampilan. Langenhein. dan keterampilan pekerja akan sangat mempengaruhi proses produksi dan kualitas produk. anakan alam atau bibit harus ditanam dan dipelihara. setelah didapat inokulan efektif dan hasil inokulasi yang cukup menjanjikan. Selanjutnya pohon yang sudah cukup besar (diameter > 44 . 2004. pengembangan gaharu memerlukan modal yang cukup besar karena prosesnya cukup kompleks.

sehingga upaya-upaya yang dilakukan akan memberi hasil yang berkelanjutan. sehingga untuk menghasilkan gaharu sebanyak 270 ton sebagaimana jumlah yang diekspor pada tahun 2000-an akan mampu menyerap tenaga kerja sebanyak 56. Selanjutnya pohon yang telah diinokulasi dimonitor hingga waktu panen.000-68. maka jumlah tenaga kerja yang dikaryakan juga akan semakin meningkat. Setelah dipanen secara total. juga keberanian dan ketersediaan personil dengan kondisi fisik yang mendukung pelaksanaan pekerjaan.Pengembangan Gaharu di ... sehingga tidak berkelanjutan.. Oleh karenanya pengembangan gaharu harus dilakukan secara serius. Dengan peningkatan permintaan dan kapasitas produksi. mengingat proses produksi gaharu jauh lebih rumit dibandingkan proses produksi komoditi hasil hutan dan perkebunan atau pertanian lainnya. Kelembagaan tersebut dapat sangat sederhana 45 . pengembangan gaharu hasil budidaya dan inokulasi makin lama makin memberikan keuntungan melimpah dan makin ’sustainable’. Dari segi jumlah tenaga kerja yang menangani proses pembersihan produk ini kemungkinan tidak banyak berbeda antara produksi gaharu alam dengan gaharu budidaya. Selain itu. sementara gaharu alam akan makin habis. Proses inokulasi ini selain memerlukan keterampilan. (Mucharromah) 20 cm) perlu diinduksi dengan inokulasi jasad renik atau perlakuan lainnya agar membentuk gaharu. untuk membersihkan 1 kg gaharu umumnya diperlukan 4-5 orang hari kerja. Jumlah ini cukup besar dan akan mampu mempekerjakan masyarakat sekitar hutan sebanyak 280 hingga 340 orang/tahun dengan 200 hari kerja/tahun. Proses induksi pembentukan gaharu dilakukan dengan memberikan inokulan pada sejumlah besar lubang yang dibuat spiral dengan jarak 7-10 cm horisontal dan 12-20 cm vertikal dari pangkal batang hingga ujung pucuk yang masih bisa dipanjat. maka perlu ada suatu kelembagaan yang bertugas untuk membantu penyiapan dan pelaksanaan proses produksinya hingga berhasil berkembang menjadi industri gaharu yang mandiri. Pada gaharu hasil inokulasi. Proses ini dilakukan secara manual dengan melibatkan sejumlah besar tenaga kerja. tetapi dari segi keamanan pekerja dan lingkungan. dilakukan proses pembersihan untuk memisahkan gaharu dari jaringan kayu yang lebih sedikit kandungan resin wanginya..000 orang/hari.

pelibatan banyak pihak ini bila tidak dipayungi dengan deskripsi tugas yang mendetil dan tidak saling tumpang-tindih. Bila sudah mencapai tahap produksi. swasta atau kelompok masyarakat. tidak hanya dengan pihak yang dapat membantu pengembangannya. Peran tersebut dapat dilakukan melalui kegiatan penelitian dan pengabdian pada masyarakat yang sudah secara 46 . sehingga cukup menyulitkan meskipun prosesnya sederhana. pengembangan inokulan unggul untuk peningkatan mutu serta pengembangan teknik pengawasan kualitas produk. Sejauh ini pengembangan gaharu yang dilakukan di Provinsi Bengkulu. Mengingat pohon yang diinokulasi atau bibit yang ditanam berada di lahan pribadi. Dalam hal pengembangan gaharu. maka dengan adanya aturan kuota. Dalam hal ini peran perguruan tinggi yang mengembangkan penelitian gaharu dapat dilakukan dalam bentuk pembinaan kelompok produksi gaharu di sekitar wilayah hutan serta penelitian untuk pemutakhiran teknik produksi. maka proses pengembangan gaharu yang telah dilakukan sejauh ini berjalan aman. Hal ini mungkin perlu disederhanakan dalam upaya pengembangan gaharu yang dilakukan. Hal ini dikarenakan upaya pengembangan yang dilakukan masih belum mencapai tahap produksi gaharu yang siap diperdagangkan.Aspek PRODUKSI bila pengembangan gaharu dapat diberlakukan seperti komoditi pertanian atau perkebunan hasil budidaya. dibuat secara sangat sederhana dengan kontrak kerjasama antara pemilik pohon/lahan dengan pelaksana yaitu perguruan tinggi. justru akan dapat menghambat pengembangan gaharu yang dituju. baik halaman maupun kebun. Namun bila perdagangan gaharu masih diatur oleh kuota yang dalam proses perdagangannya melibatkan banyak pihak. baik oleh pihak swasta maupun perguruan tinggi dan kelompok masyarakat. mengingat wilayah sekitar hutan yang menjadi area pengembangan gaharu umumnya cukup jauh dari lokasi institusi yang mensertifikasi produknya. maka pengembangan gaharu perlu dilakukan dengan melibatkan berbagai pihak yang terkait dengan perdagangannya. perguruan tinggi dapat memainkan peran yang dapat menguntungkan semua pihak. penjualan gaharu hingga kini masih memerlukan adanya sertifikasi jumlah untuk memastikan bahwa batas kuota belum terlewati. Dalam pelaksanaannya.

Academic Press. Plant Pathology. PENUTUP 1. 1988. Untuk lebih mengefisienkan proses produksi dan menekan pembiayaan maka program pengembangan gaharu perlu dilakukan dengan mengadopsi model yang paling efisien dan praktis. Hal ini sangat penting dilakukan. Oleh karenanya pengembangan gaharu perlu dilaksanakan dengan perencanaan yang sangat matang dari setiap tahapan prosesnya sehingga dapat berjalan dan meningkatkan kemandirian masyarakat di wilayah sekitar hutan.. Analisa Penyebab Terjadinya Gubal dan Kemedangan pada Pohon Gaharu. Makalah Dipresentasikan pada Temu Pertama Pakar Gaharu.. kekeringan. banjir. 2.N. (Mucharromah) rutin dilakukan perguruan tinggi dengan dukungan pendanaan dari instansi pemerintah maupun swasta. tidak hanya untuk menjamin peningkatan dan kesinambungan produksi gaharu. DAFTAR PUSTAKA Agrios. New York.. tetapi juga untuk melindungi hutan dan keragaman hayati yang ada di sekitarnya serta meningkatkan kapasitas hutan dalam menanggulangi potensi bahaya bencana alam yang disebabkan oleh longsor. dan beragam kerusakan lingkungan lainnya. Hal ini sangat penting untuk diperhatikan mengingat proses pembentukan gaharu tidak berjalan secara otomatis pada tanaman yang tumbuh sehat. tidak hanya karena menghasilkan produk bernilai ekonomi yang sangat tinggi. polusi. sehingga keberhasilannya akan lebih terjamin. Anonim. 1995.Pengembangan Gaharu di . 47 .. Jakarta. Pengembangan gaharu merupakan suatu program yang sangat besar. tetapi juga karena upaya ini memerlukan investasi teknologi dan modal yang cukup besar bagi keberhasilannya. G. 20 Oktober1995. sebagaimana produk pertanian atau perkebunan dan kehutanan lainnya. yang berpotensi sangat besar untuk pemberdayaan masyarakat di sekitar wilayah hutan.

Studi Mekanisme Akumulasi Resin Wangi Aquilaria malaccensis (Lamk. Mucharromah.). Teknologi Budidaya dan Produksi Gubal Gaharu di Provinsi Bengkulu.org/wiki /Agarwood”. MacMahon.wikipedia. Fakultas Pertanian Universitas Mataram Bekerjasama dengan Balai Pengelolaan Daerah Aliran Sungai Dodokan Moyosari Nusa Tenggara Barat (BP DAS Dodokan Moyosari NTB). dan Hartal. Laporan Penelitian Fundamental. ”http://en. dan Surani. White Lotus Aromatics. dalam Menginduksi Akumulasi Resin Wangi Gaharu pada Batang Aquilaria malaccensis (Lamk. Makalah Seminar Nasional Pengembangan Produksi Gaharu Provinsi Bengkulu untuk Mendukung Peningkatan Ekspor Gaharu Indonesia. G. Hartal. Terakhir dimodifikasi 11:11. Updated April 16th. Misnawaty. Universitas Bengkulu. com/ratrani/ Agarwood. Respon Acremonium sp. Potensi Tiga Isolat Fusarium sp. 2008. 2006.) Merespon Pelukaan dan Infeksi Cendawan.). Mucharromah. 1-2 Desember 2005. 1998. Bogor. 2006. pada Berbagai Waktu Setelah Pengeboran Batang Aquilaria malaccensis (Lamk. BKS-PTN Wilayah Barat. 2008. Accessed 16 April 2006. Makalah Seminar. Rahayu dan E. Fenomena Pembentukan Gubal Gaharu pada Aquilaria malaccensis (Lamk. Mucharromah. 2008.. Hipotesa Mekanisme Pembentukan Gubal Gaharu. Makalah Semirata Bidang MIPA. Tingkat Akumulasi Resin Gaharu Akibat Inokulasi Fusarium sp. Mucharromah. DIKTI. Universitas Mataram. Indonesia. Hartal. Seameo-Biotrop. Agarwood. 2008. Santoso. http://members. FAPERTA UNIB. 14-16 Mei 2008. dan U. Makalah Semirata Bidang MIPA. 48 . 18 November 2006. Maryani. Universitas Bengkulu. Mucharromah. C. 12 Agustus 2008. html. 2001. 31 Oktober 2006. Santoso. N. Prosiding Seminar Nasional Gaharu. 14-16 Mei 2008. Lombok. 2006a.Aspek PRODUKSI Anonim.aol. BKS-PTN Wilayah Barat. Mucharromah. Asal Gaharu terhadap Alginate dan CaCl2.). Bengkulu. Nusa Tenggara Barat. (unpublished). 2005.

Pengembangan Gaharu di . 1-2 Desember 2005. Wahyuno. Parman. Skripsi Fakultas Pertanian Universitas Bengkulu. Austin.B. 2005. Purba. Turjaman.. 2001. Rahman. Strategi Budidaya dan Pengembangan Produksi Gaharu. Surabaya 11-13 September 2006. Inc. Teknologi Budidaya Tanaman Gaharu untuk Menuju Sistem Produksi Gubal Gaharu secara Berkelanjutan. Kanwil Dephut Propinsi NTB. 2006. (Mucharromah) Mucharromah dan J.. 11-12 April 1996.T. 1997. 2005..S. Chang and A. 2006b. Prosiding Seminar Nasional Gaharu “Peluang dan Tantangan Pengembangan Gaharu di Indonesia”. Uji Coba Pembentukan Gaharu dengan Cara Inokulasi. Irianto. Seameo-Biotrop. M.) dan Gubal Gaharu Hasil Inokulasi serta Potensinya untuk Menginfeksi Bibit Gaharu. Surya. Mulyaningsih. Journal of Tropical Forest Products 2 : 272-285. E. Raintree Nutrition. Y.N. Santoso. Parman dan T. Ng. Makalah disampaikan pada Workshop Gaharu Tingkat Nasional.. D.rain-tree..S. Y. J. Bogor. Biodiversitas dan Karakterisasi Jamur Potensial Penginduksi Resin Gaharu. Makalah Workshop Gaharu Tingkat Nasional. L. Ngatiman dan Armansyah. SEAMEO BIOTROP. 2007. Prosiding Seminar Nasional Gaharu.htm. Sites : hhtp//www. Y. 11-13 September 2006. Date 3/3/06. Kerjasama Dirjen PHKA dan ASGARIN. 49 .K. Database Entry For Aquilaria agallocha. Azizil. Texas. Mulyaningsih.. L. Makalah Workshop Gaharu Tingkat Nasional. Studi Etiologi Gubal Gaharu pada Tanaman Ketimunan.. 1-2 Desember 2005. 1996. Bogor. Sumarna. Makalah Temu Pakar Gaharu. Identifikasi Genus Cendawan yang Berasosiasi dengan Pohon Aquilaria malaccensis (Lamk. Kerjasama Dirjen PHKA dan ASGARIN. dan Y. Teknik Inokulasi dan Produksi Gaharu. Surabaya. 2006. A Review on Agar (Gaharu) Producing Aquilaria Species. R.com/ aquilaria. Mataram. Sumarna. T.A.. Surabaya 12 September 2006. Agustini. Raintree.

031 10.000 90 1.826 QTY Unit Harga/unit (Rp’000) Total cost (Rp’000) Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.1.Aspek PRODUKSI Lampiran 1.000 5 120. D.500 200 600 36 300 7. 2006 50 .500 6.307 1 1 50 50 Btg Btg Kg Kg 50 50 25 2 50 50 1. Beban panen dan pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total A.168 50 50 50 1 50 Kg Kg Kg Btg Kg 5 10 5 6 0.250 100 1.2.450 1 1 1 1 1 1 3 1 Btg Btg Set Btg Btg Btg Thn Btg 100 5. Beban zakat/pajak Proyeksi keuntungan 5% % 60 100 Kg Kg 2. Proyeksi penghasilan Penjualan kelas BC Penjualan powder Total proyeksi penghasilan C. Analisis usaha inokulasi gaharu Waktu inokulasi Jumlah tegakan gaharu Proyeksi hasil : 3 tahun : 1 batang : 20 kg/batang (Kelas BC).000 90 1.500 200 600 12 300 100 5.000 500 120. 30 kg/batang (Kemedangan) Total proyeksi hasil : 50 kg/batang Penjualan kelas BC per batang : 60 kg Penjualan powder : 100 kg/batang No A.025 104. Uraian Beban operasional Pembelian batang/tanah Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga ahli inokulasi Tenaga kerja Pemeliharaan/perawatan Operasi lainnya Total A. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Pengurusan surat-surat Umum lainnya Total Total beban operasi B.5 250 500 250 6 25 1.

5 5 24.000 1..000 1.2.000 A+B C C.000 1. Beban inokulasi Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga kerja Pemelihaaan/perawatan Operasi lainnya 51 .000 2. C.000 3.000 2. (Mucharromah) Lampiran 2.000 1.1..000 19.000 4.000 1.000 10 5 10 1 20. Analisis usaha budidaya gaharu Waktu budidaya Luas lahan Populasi tegakan Rasio jumlah suntikan Jumlah lubang Proyeksi hasil panen per batang Exchange rate IDR : 7 tahun : 1 ha : 1. Biaya pra operasi (start-up cost) Sarana & prasarana TBM Rumah jaga Sarana penerangan (PLN) Sarana komunikasi Sarana lainnya Total 1 1 1 1 Total biaya (direkapitulasi) Beban operasi Penanaman pohon baru Land clearing Pembelian bibit Pembuatan lubang Penanaman pohon gaharu Pemupukan Perawatan dan pengamanan Total 1 1.000 2.000 1.000 25.000 1.000 5.000 10.000 36.000 1.000 5 1 0.000 1 1.000 4.000 1.000 10..000 1.000 24.000 Total cost (Rp’000) 15.Pengembangan Gaharu di .000 Harga/ unit (Rp’000) 15.000 5.000/ha : 80 lubang/kg : 160/batang : 160/80 = 2 kg : 9.000 No A.000 Unit Unit Unit 2.500 1.000 1.000 Total Btg Set Btg Btg Btg Btg 20 3.000 1.000 1.000 6.000 49.. Uraian Biaya akuisisi lahan Pembelian lahan Perizinan/sertifikat/notariat Total QTY Unit 1 1 ha Surat* B.000 1 ha Btg Btg Btg Btg ha 1.000 500 5.

5 10.000 1.3.000 190.000 Btg Btg Kg Kg C.000 2. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Umum lainnya Total Total beban operasi 2.000 3.000 Total proyeksi penghasilan 5% Proyeksi keuntungan E F Beban zakat /pajak Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.000 20.000 71.000.000 34.000 Kg Kg Kg Kg 5 10 20 0.609.000 4.000 2.000 4.4.000.000 2.000 4. Uraian Beban panen & pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total QTY Unit Harga/ unit (Rp’000) 5 5 10 2 Total cost (Rp’000) 5.000 1.000 1.500 D Proyeksi penghasilan Penjualan kelas C 2.000 40.Aspek PRODUKSI No C.000 2. 2006 52 .000 2.500 Kg % 2.000 5.000 200.000 20.

Incense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagaman..(Eka Novriyanti) 2 KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp. mulai dari 300 ribu rupiah hingga 25 juta rupiah untuk kualitas double super. Maluku. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti 53 . yaitu 27 spesies dari 8 genus dan 3 famili yang tersebar di Sumatera. Pada prinsipnya. sebagai pengharum ruangan sembayang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. PADA Aquilaria microcarpa Eka Novriyanti Balai Penelitian Hutan Penghasil Serat Kuok PENDAHULUAN Gaharu adalah komoditas hasil hutan non-kayu yang bernilai ekonomi tinggi dengan harga pasar bervariasi tergantung kualitasnya. dan Irian (Sumarna. Indonesia yang merupakan salah satu pemasok gaharu terbesar memiliki kekayaan jenis penghasil gaharu tertinggi di dunia. Kalimantan. incense. Sementara itu.. Gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut memiliki scent of God’.. dan parfum (Barden et al. Produk ini dihasilkan beberapa spesies penghasil gaharu dalam famili Thymeleaceae.Kajian Kimia Gaharu ... meskipun pengunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. 2005). pemanfaatan gaharu adalah untuk pengobatan. 2000). 2000)..

rematik. anti mikrobia. dan antar musim (Forestry Commission GIFNFC. stimulan kerja saraf dan pencernaan. dan bermanfaat untuk mengatasi berbagai panyakit seperti sakit gigi. 2004).Aspek PRODUKSI inflamatory (Trupti et al. informasi jalur biosintetis gaharu itu sendiri sehingga mungkin dapat dibuat sintetis senyawa. pangkal percabangan. pengembangan pemanfaatan lain dengan terbukanya kemungkinan diidentifikasinya senyawa-senyawa baru dengan manfaat yang baru pula. 2007). asma. Adelina. obat kuat pada masa kehamilan dan bersalin. Pohon gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. akar. (Hayne. Informasi mengenai bahan-bahan kimia yang terkandung dalam gaharu penting untuk pemanfaatan produk ini. Arah pemanfaatan informasi kimia gaharu di antaranya adalah penyusunan standar produk berdasarkan komposisi kimia yang dikandungnya sehingga lebih seragam dalam praktek penentuan kualitas produk. anti serangga. liver. kanker. hal ini 54 . 2004). hepatitis. Konsentrasi metabolit sekunder ini bervariasi antar spesies. Suhartono dan Mardiastuti. 1987). antar jaringan (konsentrasi tertinggi berada di kulit. 1987. diuretic. cacar. 2002). Metabolit sekunder pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills.. kayu teras. Gaharu adalah senyawa fitoaleksin yang merupakan metabolit sekunder dari pohon gaharu sebagai mekanisme pertahanannya. Metabolit sekunder atau zat ekstraktif tanaman dapat efektif dalam melawan hama dan agen penyakit karena analog dengan komponen vital tertentu dari sistem sinyal seluler. 2007). antar spesies. dalam Isnaini. malaria. 2000. juga memiliki sifat anti racun. Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. pengembangan senyawa-senyawa dalam gaharu dengan bio-teknologi. tumor.. Barden et al. antar pohon dalam spesies yang sama. atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Commission GIFNFC. Namun begitu. rangsangan fisiologi. 2004. maupun keadaan cekaman (Goodman et al. diare. ginjal. 2007). dan lain-lain pengembangan yang masih sangat luas untuk dilakukan. dan jaringan luka).

Identifikasi senyawa dilakukan berdasarkan waktu retensi dan analisis MS. dioperasikan dengan electron impact (EI) mode pada 70 eV dan suhu ion source 2000C. namun setelah sekian waktu ternyata pengaruhnya terhadap luasan infeksi menjadi tidak signifikan lagi. dan perlu dicatat tidak satupun isolat yang origin dari lokasi di mana penelitian dilakukan yaitu asal Carita. daerah asal isolat tidak berpengaruh nyata terhadap luasan infeksi yang terjadi pada batang pohon penghasil gaharu ini.. ANALISIS KIMIA GAHARU HASIL INOKULASI ISOLAT DARI BEBERAPA DAERAH ASAL Dalam tulisan ini. ketebalan film 0..8 ml/min) yang dilengkapi dengan kolom kapiler DB-5 MS (60 mm x 0. Mentawai. kemudian increased mencapai 2800C hingga 30 menit. Tidak signifikannya pengaruh asal isolat terhadap luas infeksi diduga disebabkan karena isolat yang diinokulasikan sama-sama Fusarium sp. Gambar 1 menyajikan luasan infeksi Fusarium sp. Meskipun di awal inokulasi masing-masing isolat memperlihatkan kecepatan pembentukan infeksi yang berbeda sesuai virulensinya. analisis kimia gaharu dilakukan dengan analisis GCMS pirolisis menggunakan aparatus Shimadzu GCMSQP2010. dan Maluku. 55 .25 mm. sedangkan analisis kimia dilakukan untuk sampel berumur ± 1 tahun. asal Bahorok. namun secara statistik. microcarpa.25 μm). Meskipun secara deskriptif isolat asal Bahorok sepertinya menyebabkan infeksi yang paling besar.(Eka Novriyanti) masih memerlukan pemikiran dan terus melakukan penelitianpenelitian lanjutan yang akan membuka satu demi satu kebenaran yang saat ini masih belum terungkap... Pengukuran luasan infeksi dilakukan pada umur inokulasi 6 bulan. yaitu isothermal 500C selama 5 menit. dan ditahan pada suhu ini hingga menit ke-60. Helium digunakan sebagai gas pembawa (carrier) (0. pada batang A. suhu injeksi 2800C. Kalimantan Tengah Tamiang Layang. Kondisi kromatografi adalah sebagai berikut: suhu oven kolom 500C. Analisis komponen kimia dilakukan untuk gaharu rekayasa hasil inokulasi isolat Fusarium sp. Injeksi dilakukan dalam mode split.Kajian Kimia Gaharu ..

Bhuiyan et al. Burfield. yaitu: 1. 56 . kelompok A: konstituen gaharu yang sudah diidentifikasi pada pekerjaan beberapa peneliti sebelumnya 2. Panjang infeksi pada umur inokulasi 6 bulan di batang A. 2003. 2002. namun analisis komponen kimia dari gaharu hasil rekayasa ini menunjukkan adanya perbedaan.. dengan tanpa membedakan jarak suntik menunjukkan bahwa akumulasi konsentrasi relatif tertinggi untuk konstituen terkonfirmasi (Yagura et al. Lampiran 1 dibagi menjadi 3 kelompok.. Kelompok C: senyawa yang belum dikonfirmasi merupakan konstituen gaharu namun memiliki karakter odorant... Nor Azhah et al. Kelompok A pada Lampiran 1. 2006. 2005.Aspek PRODUKSI Gambar 1. Tamuli. 2005. Alkhathlan et al. Konishi. Pojanagaroon dan Kaewrak. Kelompok B: senyawa berkarakter odorant namun merupakan hasil pirolisis komponen kayu seperti selulosa dan lignin 3. 2009. 2005. microcarpa dengan pembeda daerah asal isolat Meskipun secara luasan infeksi tidak menunjukkan pengaruh yang nyata. Sampel yang dianalisi adalah sampel masing-masing dari titik-titik inokulasi dengan jarak suntik 5 cm dan 20 cm. Lampiran 1 menyajikan komponen kimia hasil analisis py-GCMS terhadap sampel gaharu inokulasi umur satu tahun.

dan Mentawai (8.27%). Secara kuantitas maupun kualitas (komponen kimia terkonfirmasi).. dan terakhir Kalimantan Tengah Tamiang Layang (18.14%). Bahorok.37%). isolat asal Kalimantan Tengah Tamiang Layang memberikan hasil gaharu artifisial yang relatif terbaik yang ditunjukan oleh relatif lebih besarnya infeksi yang terjadi dan akumulasi senyawa gaharu terkonfirmasi tertinggi. konsentrasi relatif tertinggi justru dihasilkan oleh isolat asal Maluku (12. Pola urutan konsentrasi yang sama juga terjadi untuk total konsentrasi relatif komponen berkarakter odorant.71%). diikuti masing-masing Maluku (10. dan Mentawai (11. Untuk Kelompok C. karena digunakan sebagai incense yang mengumbar wangi saat dibakar.. Namun kontribusi komponen-komponen berkarakter odorant tersebut terhadap wangi gaharu masih memerlukan observasi yang lebih dalam lagi. Perbedaan konsentrasi ini kemungkinan sangat dipengaruhi oleh konsentrasi selulosa dan lignin dari bagian batang yang dijadikan sampel.Kajian Kimia Gaharu .. Mentawai (24. dan Kalimantan Tengah Tamiang Layang. Kelompok B pada Lampiran 1 merupakan kelompok senyawa berkarakter odorant yang merupakan hasil pirolisis selulosa dan lignin.47%).31%). Bahorok (22. maka keberadaan senyawa dalam kelompok B tidak bisa dikesampingkan walaupun bukan merupakan konstituen resin gaharu yang sebenarnya.89%.96%). Maluku.40%). Untuk kelompok odorant yang merupakan pirolisis komponen kayu ini. Keberadaan senyawasenyawa odorant hasil pirolisis komponen kayu ini kemungkinan memiliki peran pada kesatuan wangi yang dihasilkan incense gaharu yang dibakar. akumulasi konsentrasi relatif tertinggi dihasilkan oleh isolat asal Maluku (26..47%). Kalimantan Tengah Tamiang Layang (12.(Eka Novriyanti) 2008) terjadi pada isolat asal Kalimantan Tengah Tamiang Layang sebesar 12. diikuti Bahorok (12. Bahorok (10.23%). Pengaruh kontribusi senyawa dalam kelompok ini pada wangi gaharu memerlukan investigasi lebih lanjut. Dengan kata lain. 57 .61%). diikuti Mentawai. Ditampilkannya fakta tersebut karena penggunaan gaharu pada umumnya sebagai incense yang menghasilkan wangi hanya jika kayu yang mengandung resinnya dibakar.

25% dan 10. dan bunga (International Flavor and Fragrance. Isolongifolene merupakan bahan yang sangat berguna sebagai odorant dan minyak parfum (Bunke dan Schatkowski. pada A.11%. 1997). Inc. Indole merupakan konstituen utama dalam minyak melati dan karena minyak melati ini berharga mahal.. manis buah. produk ini dibuat sintetisnya dengan menggunakan indole (Wikipedia Online. 2008). 2008). 2008). Senyawa ini memiliki wangi herbal yang dimanfaatkan dalam industri parfum dan pewangi (Wikipedia Online. 2008) Ambrox memiliki karakter odorant tipe amber dan juga merupakan anti-inflamatory yang potensial untuk bidang pengobatan (Castro et al. kecuali untuk isolat asal Kalimantan Tengah Tamiang Layang yang justru lebih tinggi akumulasi konsentrasinya pada jarak suntik 20 cm (Tabel 1). jarak suntik 5 cm dan 20 cm menghasilkan akumulasi konsentrasi relatif masing-masing sebesar 11. dihasilkan akumulasi masing-masing sebesar 12.. Secara umum untuk kelompok A. 2008). Angka-angka ini tidak jauh berbeda karena diduga konsentrasi komponen kayu yang relatif sama pada pohon-pohon sampel yang relatif berumur sama dan tumbuh pada kondisi yang relatif sama. Tabel 1. teh. microcarpa yang memiliki karakterisitik odorant penting Komponen Ambrettolide Ambrox Keterangan Senyawa ini memiliki karakter wangi musk. daun tembakau (The Good Scent Company. Senyawa ini pada konsentrasi rendah menyajikan wangi bunga dan merupakan konstituen dalam berbagai wangi bunga dan parfum. 2002). Untuk kelompok B. Komponen ini menyajikan wangi caramel dan digunakan untuk menghasilkan wangi yang manis pada fragrance.Aspek PRODUKSI Untuk komponen gaharu terkonfirmasi (Kelompok A).17% dan 12. secara umum jarak suntik 5 cm menghasilkan akumulasi konsentrasi yang lebih tinggi.11% untuk jarak suntik 5 cm dan 20 cm. biasanya dimanfaatkan sebagai penguat rasa dan aroma (flavor enhancer) pada roti dan kue (Wikipedia Online. Komponen dalam gaharu hasil inokulasi berbagai daerah asal isolat Fusarium sp. Ketoisophorone mengumbar wangi manis campuran kayu. Valerolactone Ketoisophorone Maltol Indole Isolongifolen 58 . dan.

Namun. 59 . juga merupakan komponen volatil pada kokoa (Wikipedia Online. Di pihak lain. yang ditunjukan oleh infeksi yang lebih kecil.. 2008). The Good Scent Company. Senyawa ini muncul sebagai konstituen minyak esensial berbagai tanaman (Wikipedia Online. 2008).Kajian Kimia Gaharu . 1994. Limonen merupakan monoterpeneoid yang digunakan sebagai insektisida botani. 2008.96% untuk jarak suntik 20 cm dan 5 cm. Merupakan material wewangian dan untuk pengobatan serta memiliki sifat pestisida (ChemYQ. proses yang lambat ini kemungkinan memberi waktu dan kesempatan bagi senyawa tertentu untuk disintesis atau diakumulasikan hingga diperoleh konsentrasi yang relatif lebih tinggi..81% dan 20. Pola yang sama juga terlihat untuk akumulasi konsentrasi relatif pada kelompok senyawa C.59%) yang menghasilkan konsentrasi relatif lebih tinggi dibandingkan jarak suntik 5 cm (50. Mann et al. Benzylacetone memiliki wangi manis bunga yang merupakan komponen atraktan yang melimpah pada bunga..23%).. Dikenal juga sebagai cyclopentanone yang memiliki wangi mint.(Eka Novriyanti) Komponen Limonene Keterangan Limonene merupakan terpen yang memiliki aroma bunga dan buah. Geraniol dan limonen juga dimanfaatkan dalam pengobatan herbal dan konstituen dalam berbagai tanaman obat (Wikipedia Online. Azulene sangat sering ditemukan sebagai komponen dalam minyak esensial tanaman dalam family Asteraceae dan memiliki wangi dan warna biru pada minyak dan ekstraknya (LyndShiveley. Blake. ada kemungkinan proses sintesis terjadi lebih cepat dibandingkan jarak injeksi yang lebih besar sehingga dihasilkan senyawa-senyawa baru yang lain yang berkarakter odorant namun akumulasinya belum cukup tinggi saat observasi dilakukan. 2008. selain sebagai bahan kosmetik dan flavouring karena memberi wangi sitrus.. Cadinene Dumasin Benzylacetone Azulene Akumulasi total untuk komponen berkarakter odorant menunjukkan bahwa jarak suntik 20 cm (52. dengan spasi injeksi yang lebih kecil di mana infeksi terjadi lebih cepat dan lebih besar. Kajian lebih dalam lagi diperlukan untuk mengetahui perkembangan atau perubahan yang terjadi dengan semakin lamanya waktu inokulasi. 2004). 2008). Dengan besarnya spasi injeksi akan menyebabkan proses pembentukan senyawa yang terjadi berlangsung relatif lebih lambat. masing-masing 24. 2004).

. 1999. Senyawa asetosiringon juga tercatat pada semua gaharu hasil inokulasi kelima daerah asal isolat dalam penelitian ini. dumasin (ChemYQ. 2008). Eugenol. dan guaiakol merupakan intermediet dalam pembuatan eugenol dan vanilin (Li dan Rosazza. Rho et al. 2008). dan isometileugenol merupakan empat senyawa fenilpropanoid dari 12 senyawa volatil yang diketahui menyebabkan wangi yang manis pada Clarkia breweri (Rhodes. 1986).. Eugenol serta isoeugenol digunakan dalam produksi vanilin yang merupakan bahan penting dalam industri wewangian (Cowan. 1999).. 2006). dan elimicin (Rossi et al.. Beberapa di antara komponen ini bahkan juga memiliki karakter wangi yang diketahui merupakan konstituen minyak esensial dan digunakan secara komersil dalam industri parfum dan pengharum seperti vanillin. 2007. Fotouhi et al. PubChem Compound. 2000). syringal-dehyde (Pedroso et al.. di mana senyawa ini merupakan fenolik yang dihasilkan tanaman sebagai respon alami terhadap pelukaan (Sheikholeslam dan Weeks. 2008). Koeduka et al. isoeugenol. 60 . Dalam Hua (2001) disebutkan bahwa konsentrasi asetosiringon meningkat 10 kali lipat ketika suatu jaringan aktif tanaman dilukai. Asetosiringon merupakan bioaktif dalam interaksi tanamanmikroba yang mempercepat pendeteksian kehadiran patogen oleh tanaman di mana konsentrasi senyawa ini meningkat dalam tanaman seiring dengan meningkatnya konsentrasi mikroba (Baker et al. 2002. metileugenol. 2007). 2008).Aspek PRODUKSI Hasil analisis py-GCMS juga menunjukkan adanya senyawasenyawa yang pada beberapa hasil penelitian lain disebutkan sebagai senyawa pertahananan.. 1999). 2008. 2008). benzoic acid (NBCI. derivat cyclopentane (Wikipedia Onlie. eugenol (Cowan. senyawa 4H-pyran-4-one dan derivatnya (Abrishami et a.. Rhodes. 2004). Sedangkan koniferil alkohol merupakan intermediet dalam biosintetis eugenol dan isoeugenol (Cowan. 2008).

Merupakan dimetil eter dari pirokatekol. Merupakan intermediet dalam pembuatan eugenol dan vanilin. Senyawa-senyawa yang berdasarkan beberapa referensi diketahui merupakan pertahanan pada tanaman tertentu dan terdeteksi pada gaharu hasil inokulasi Senyawa Eugenol Keterangan Bersifat bakteriostatik terhadap jamur dan bakteri (Cowan. contohnya adalah yang terdapat pada Linum usitiltissimum (Sengbusch. 2000). Letak dan jumlah grup hidroksil pada grup fenol diduga berkaitan dengan daya racun relative-nya terhadap mikroorganisme. 1999). microcarpa ditemukan beberapa komponen senyawa yang sudah diidentifikasi merupakan konstituen gaharu dan beberapa senyawa lain yang memiliki karakter odorant dan secara komersil digunakan dalam industri perfumery dan flavoring.. Pada gaharu rekayasa hasil inokulasi Fusarium sp.(Eka Novriyanti) Tabel 2.Kajian Kimia Gaharu . Adalah fenol terhidroksilasi yang bersifat toksik pada mikroorganisme. 2008). yaitu asam ferulat ataupun koniferil alkohol (Rhodes. pada A. Senyawa ini digunakan untuk menghasilkan isoeugenol yang diperlukan untuk membuat vanilin yang juga merupakan bahan yang penting dalam obat-obatan dan industri parfum dan pengharum. ekspektoran. 2008). deodoran.. p:144). 61 . memiliki sifat antimikrobial (Torssel. Eugenol digunakan dalam pembuatan parfum. 1999). dan parasitisida (Wikipedia. Hasil inokulasi Fusarium sp. Eugenol dan isoeugenol diturunkan dari prekursor lignin. pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masinng sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. sedatif. 2008a). dan obat-obatan.. yang juga digunakan sebagai antiseptik dan parasitisida (Li dan Rosazza. minyak esensial.. 2. 1983. di mana daya racun akan semakin meningkat dengan semakin tingginya hidroksilasi (Cowan. Kedua senyawa ini dan turunannya digunakan sebagai antiseptik. Konstituen resveratrol yang diturunkan dari asam p-hidroksisinamat dan 3 unit malonat. Koniferil alkohol Guaiakol Katekol dan pirogalol Veratrol KESIMPULAN 1. Merupakan senyawa pertahanan tipe fitoaleksin yang termasuk dalam grup fenilpropanoid.

Y. Stimulatory Effect of Acetosyringone on Plant/Pathogen Recognition. N. A. A. DAFTAR PUSTAKA Abrishami. Mailina. Meskipun secara statistik tidak memperlihatkan perbedaan yang signifikan terhadap luasan infeksi yang terbentuk setelah 6 bulan inokulasi. Robert. Majid.net.org. www. A. A. P. D. J. http://www. their Production and their Use. A. Comparison of Chemical Profiles of Selected Gaharu Oils from Peninsular Malayia. D. Mulliken. Synthesis of Some Aldoxime Derivatives of 4H-Pyran-4-ones. A. Whitaker. Averyanov. Song. N. S. H. Said. R. Y. United State Patent. C. Anak.. inokulasi Fusarium sp. Blanchette. Bayat.. Baker.3. N. Yasmin.com [31 Desember 2008]. [2 Februari 2007].therainforestproject. 2002. A. Barden. 2004 Medicinal Plant Constituents. Sustainable Agarwood Production in Aquilaria Trees. 2004. Blake. Secara umum.. S. R.ars. S. gov/research/publications/publications. 2006. namun isolat asal Maluku menunjukkan konsentrasi yang relatif lebih tinggi untuk total senyawa dengan karakter odoran. 2008. naturalhealthwizards. C. M. com/MedicinalPlantConstituents. J. [20 Juni 2008]. B. www. Teimuri-Mofrad. E. .pdf. [22 Mei 2007]. K. 1997. J. [21 Juni 2008]. Hasnida. Isolongifolanol Derivates. N. 2000. Shahrisa. http://www. Bunke. freepatentsonline. Mock.traffic. M. Heart of the Matter: Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. S.usda. F. daerah asal isolat menunjukkan perbedaan dalam konsentrasi senyawa-senyawa gaharu yang terbentuk. Deahl. J. M. htm. A. A. N. Schatkowski. A. Rice. http://www. T. Azah. Y. Molecules 7: 239–244. D. L. Husni. asal Kalimantan Tengah menunjukkan konsentrasi senyawa konstituen gaharu terkonfirmasi yang lebih tinggi. The Malaysian Journal of Analytical Sciences 12 (2): 338-340. Chang.

[14 Juli 2007]. http://www. Food safety and Quality: Flavoruing Index. Terjemahan dari: Nuttige Planten Van Indonesie. 63 .cropwatch.nsf/0/45BD7B214C6F661E8025699000 5D79C2 [31 Desember 2008]. Succinaldehyde. A. Tumbuhan Berguna Indonesia Jilid III.cfm. 3: 721-726. http://www. 2004. S.uk/review/extraction. T. Electrochem. Fatehi. S. Thymelaceae.. Agarwood Chemistry.Burfield. W. Fotouhi. and K. 2005a. Berlin: SpringerVerlag. M. CITES. Phytochemistry 30 (2): 563566. Inc. Convention on International Trade in endangered Species of Wild Fauna and flora: Amendments to Appendices I and II of CITES. Investigation of Electrooxidation Reaction of Some Tetrahydrobenzo[b]pyran Derivatives. Applied Microbiology 32: 278-281.fao.cites. Cowan. M. FAO. Plant Products as Antimicrobial Agents.pdf.gov. J.chemyq. 2001. Three Sesquiterpenes from Agarwood. J.org/ ag/agn/jecfa-flav/index. Tsuneya. A.. 2008. K. Badan Litbang Kehutanan Jakarta.org. L. T. 1987. csl. 2002. Nogueras. [2 Februari 2007]. ChemYQ. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. Castro. Chemicals from Trees. http: // treechemicals. T. Clinical Microbiology Review 12 (4): 564-582. 1999. Tetrahedron 58 (29): 5941-5949. M. Hills. Sci. Altarejos. http://www. http://www. Shiga. M. 2008. Uneyama.31 pm]. M. Sánchez. J. 2007.iff. M. Int. Hua. 1991.org/common/cop/13/raw / props/ID-Aguilaria-Gyrinops. 1987. Heravi. Hayne. Heartwood and Tree Exudates. Dumasin.html?showSynonyms=1 [ 1 November 2008: 2. hlm: 1467-1469.com/ Ingredients. Synthesis of Ambrox® from Labdanolic Acid.com/ En/xz/xz11 [3 April 2008]. Salido.. www. M. S. Yayasan Sarana Wana Jaya. Forestry Commission GIFNFC. E. Ishihara. International Flavor and Fragrance. 2008.

Barison. Sci. Konishi. M. Mechanical Methods to Stimulate Aloes Wood Formation in Aquiliria crassna Pierre ex H Lec (Kritsana) Trees. I. 2004. Acad. S. and I. L. Pharm. Baek. S. Soc. B. [22 Mei 2007]. J. E. Bogor. Jackson.com. Y. Gang. Characteristic Aromatic Constituents of Spices. 2006. S. Koeduka. Applied and Environmental Microbiology 66 (2): 684-687. gov/summary/ summary. Kim. P. Benzoic acid. Rho. T. Lewis. Vassão. and P. T. Li. S.cgi?cid=243. C. USA. Bhattacharrya.actahort. Biavatti. M. Lab. Baiga. Eugenol and Isoeugenol. [1 Desember 2008]. of Pharmacognosy 18(1): 63-69. F. Orlova.org. R. J. Pojanagaroon. M. Prema. E. Campos. Pedroso..nlm. 2007. P. 2004. S. ISHS Acta Hort 676. A. T. K. Natl. Lee. Bull. B. Shimada.. India. 2000. R. S. Korean Chem. J. Aromaticplant project. are Biosynthesized via Reduction of a Coniferyl Alcohol Ester. W. Fridman. H. Y. J. N. 1962. E. Pichersky.ncbi. Spassova. Kaewrak. H.Aspek PRODUKSI Isnaini. Six New 2-(2-Phenylethyl)chromones from Agarwood. Kish. C. 2002.. Isolation of Syringaldehyde from Mikania laevigata Medicinal: Extract and its Influence on the Fatty Acid Profile of Mice. S. http://pubchem. New 5-Hydroxy-2-(hydroxymethyl)-4H-pyran-4one Derivative has Both Tyrosinase Inhibitory and Antioxidant Properties. Chang. Nat. Azulene and Chamomile. Kiyosawa. Rosazza. H. A. NCBI PubChem.nih. 2008. S. P. Chem. Deschamps. F. A. G. Santos.. Noel. W. A. Biocatalytic Synthesis of Vanillin. Kim. N. G. Steil. Y. Lynd-Shiveley. You. 64 . J. D. [20 Juni 2008]. Dudareva. 2006. Chem. C.. Bull. Induksi Produksi Gubal Gaharu melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik (Disertasi). Program Pascasarjana Institut Pertanian Bogor. D. 50 (3): 419-422. 28 (3): 471-473. Proc. M. Brazilian Jour. D. 2008. T. www. T. Microbial Transformation of Terpenes.. Konoshima. N. D. www.

Kajian Kimia Gaharu .....(Eka Novriyanti)

Rhodes, D. 2008. Secondary Products Derived from Aromatic Amino Acids: Eugenol and Isoeugenol. www.hort.purdue.edu. [20 Juni 2008]. Rossi, P. G., L. Bao, A. Luciani, P. Panighi, J. M. Desjobert, J. Costa, J. Casanova, J. M. Bolla, and L. Berti. 2007. (E)-Methy-lisoeugenol and Elemicin: Antibacterial Components of Daucus carota L. Essential Oil Against Campylobacter jejuni. J. Agric. Food Chem. 55 (18): 7332-7336. Sengbusch, P. V. 2008. Phenolic Compounds. http://www.biologie. unihamburg. de/b-online/e20/20d.htm. [10 April 2008]. Sheikholeslam, S. N., D. P. Weeks. 1987. Acetosyringone Promotes High Efficiency Transformation of Arabidopsis thaliana Explants by Agrobacterium tumafacien. Plant Molecular Biology 8: 291198. Sumarna, Y. 2005. Budidaya Gaharu. Seri Agribusines. Penebar Swadaya. Jakarta. The Good Scent Company. 2008. Limonene; Ketoisophorone; Syringaldehyde, Tiglaldehyde. http://www.thegoodscents company.com/gca/gc1014951.html [20 Juni 2008]. Torssell, K. B. G. 1983. Natural Product Chemistry. John Wiley & Son Limited. Chichester, New Tork, brisbane, Toronto, Singapore. Trupti, C., P. Bhutada, K. Nandakumar, R. Somani, P. Miniyar, Y. Mundhada, S. Gore, K. Kain. 2007. Analgesik and Antiimflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. Pharmacologyonline 1: 288-298. Vidhyasekaran, P. 2000. Physiology of Disease Resistant in Plant. CRC Press Inc. Boca Raton, Florida. Verpoorte, R., R. van der Heijden, J. Memelink. 2000. General Strategies. In Verpoorte, R. and A. W. Alfermann (eds). Metabolic Engineering of Plant Secondary Metabolism. Kluwer Academic Publisher. Dordrecht, Boston, London. p: 31-50. Wikipedia Online. 2008. Pyrrolidine; Propargyl Alcohol; Ptalic Acid; Mesityl Oxide; Maltol; Indole; Glutanic Acid, Furanone; Elemicin; DABCO; Crotonic Acid; Cadinene; Butyric Acid; Benzylacetone; Caprylic Acid. http://en.wikipedia.org/wiki/. [1 juni 2008].

65

Aspek PRODUKSI

Yagura, T., N. Shibayama, M. Ito, F. Kiuchi, G. Honda. 2005. Three Novel Diepoxy Tetrahydrochromones from Agarwood Artificially Produced by Intentional Wounding. Tetrahedron Letters 46: 4395-4398. Yagura, T., M. Ito, F. Kiuchi, G. Honda, Y. Shimada. 2003. Four New 2-(2-Phenylethyl) Chromone Derivatives from Withered Wood of Aquilaria sinensis. Chem. Pharm. Bull. 51:560-564. Zaika, E. I., R. A. Perlow, E. Matz, S. Broyde, R. Gilboa. 2004. Sub-strate Discrimination by Formamidopyrimidine-DNA Glycosylase. The Jour. of Biol. Chem. 279 (6) issue 6: 4849-4861.

66

Kajian Kimia Gaharu .....(Eka Novriyanti)

Lampiran 1. Komponen dalam gaharu hasil inokulasi Fusarium sp. pada A. microcarpa
Konsentrasi Relatif (%) Nama senyawa 5 cm Bo 20 cm 5 cm Kt 20 cm Me 5 cm 20 cm Mu 5 cm 20 cm

A. Komponen aromatis yang sudah diidentifikasi sebagai konstituen gaharu 4-(2’-Methyl-3’-butenyl) azulene 2,5-DIMETHOXY-4ETHYLBENZALDEHYDE 2-Hydroxy-4methylbenzaldehyde 4-Ethoxy-3methoxybenzaldehyde 4-METHYL-2,5DIMETHOXYBENZALDEHYDE Benzaldehyde, 2,4-dihydroxy Benzaldehyde, 2,4-dimethoxy- (CAS) 2,4-Dimethoxybenzaldehyde Benzaldehyde, 3,4-dihydroxy- (CAS) 3,4-Dihydroxybenzaldehyde Benzaldehyde, 3-hydroxy- (CAS) m-Hydroxybenzaldehyde Benzaldehyde, 4,6-dimethoxy2,3-dimethyl- (CAS) 2,4-Dimethoxy-5,6-dimethyl Benzaldehyde, 4-[[4-(acetyloxy)-3,5dimethoxyphenyl]methoxy]3-methoxy Benzaldehyde, 4-hydroxy(CAS) p-Hydroxybenzaldehyde 1,2-benzenedicarboxylic acid, diisooctyl ester (CAS) Isooctyl phthalate 2-Butanone, 4-phenyl- (CAS) Benzylacetone 2-Butanone, 3,3-dimethyl(CAS) 3,3-Dimethyl-2butanone 0,09 0,09 4,35 0,42 0,06 0,08 0,08 2,37 0,30 0,49 3,66 0,08 0,06 0,21 1,52 0,22 0,07 4,65 0,10 1,45 0,09 4,42 0,11 4,60 0,25 -

-

-

0,32

0,29

0,26

-

0,24

0,28

-

0,37

-

-

0,39

-

-

0,29

-

-

0,36

-

-

-

-

-

-

-

0,37

-

-

0,54

0,48

-

-

0,07

-

0,12

0,43 -

0,23 -

0,44 -

-

0,24 -

0,04

-

0,41 0,04

-

0,53 -

0,05

-

67

Aspek PRODUKSI

Konsentrasi Relatif (%) Nama senyawa 5 cm 2-Butanone, 3-phenyl- (CAS) 4H-1-Benzopyran-4-one, 2-(3,4-dihydroxyphenyl)-7-(. beta.-D-glucopyranosyl) 4H-1-Benzopyran-4one, 2-methyl- (CAS) 2-Methylchromone 4H-1-Benzopyran-4-one, 5,7-dihydroxy-2-methyl- (CAS) 2-Methyl-5,7-dihydroxy 4H-1-Benzopyran-4-one, 6-dihydroxy-2-methyl- (CAS) 6-Hydroxy-2-methylchromone 2-Coumaranone .gamma.-Eudesmol Hexadecanoic acid, 2-(octadecyloxy)-, tetradecyl ester (CAS) TETRADECYL Hexadecanoic acid, methyl ester (CAS) Methyl palmitate 2,4-Hexadienedioic acid, 3,4-diethyl-, dimethyl ester, (Z,Z)- (CAS) CIS.CIS.D 2,4-Hexadienedioic acid, 3-methyl-4-propyl-, dimethyl ester, (Z,E)- (CAS) .alpha.-humulene 1-Naphthalenol, 1,2,3,4-tetrahydro- (CAS) 1-Tetralol 1-Ethynyl-3,4-dihydro-2naphthalenecarbadehyde Phenol, 2,6-dimethoxy- (CAS) 2,6-Dimethoxyphenol Phenol, 3,4-dimethoxy- (CAS) 3,4-dimethoxyphenol Benzenepropanoic acid, methyl ester (CAS) Methyl hydrocinnamate Bo 20 cm 5 cm Kt 20 cm 0,05 Me 5 cm 20 cm Mu 5 cm 0,15 20 cm -

-

-

-

0,18

-

-

-

-

-

0,06

-

0,36

-

-

0,34

-

-

-

-

0,46

-

-

-

-

-

0,04 -

-

-

-

-

0,28 -

0,03

-

-

-

-

0,69

-

0,05 0,85

-

-

0,12

-

0,16

-

0,09

0,17

-

-

-

-

-

-

0,11 0,07

-

-

2,94 0,25 -

0,08 3,37 0,33 -

2,74 0,33 -

3,67 0,40 0,25

3,11 0,24 -

3,05 0,42 -

4,22 0,40 -

2,83 0,22 -

68

58 13.66 2.30 8.96 B.44 - - 12.04 3.5dimethoxyphenyl).(CAS) Acetosyringone ACETOVANILLONE Ethanone.24 Me 5 cm 20 cm Mu 5 cm 20 cm 0.66 0.27 0.65 - - 0. 1-ACETYL-2.20 9.02 - 0.74 0.29 0.87 0.95 10.. 3-(2-propynyloxy)-.6.17 0.61 0.26 0. 3-Hydroxy-2methyl. ethyl ester (CAS) ETHYL 3-PROPARGYL Propanoic acid. METHYL Benzenepropanoic acid (CAS) Phenylpropionic acid 3.Kajian Kimia Gaharu .4.31 - 1.62 10.14 0.2-benzenediol.15 3.56 0..8A-OCTAHYDRONAPHTHALENE Jumlah Rataan untuk kedua jarak suntik Bo 20 cm 0.17 0. 5-Hydroxy2-methyl.25 0.15 4.2.8-HEXAHYDRO-2HCHROMENE 1.67 6. 1-(4-hydroxy-3.(CAS) Acetovanillone 1.28 5 cm Kt 20 cm 0.12 5.99 0.95 6.12 0.94 0.(CAS) 5-hydroxy-2methyl-4H-pyran-4-one 2-Propanone.58 3.59 8..58 0.28 69 .20 1.74 16.17 0.28 8.20 0.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm Propanoic acid.5.4.7.03 - - 0.38 0.57 0. 3-methyl(CAS) 3-methylpyrocathecol 0. ethenyl ester (CAS) vinyl propionate CYCLOPENTANEPROPANOIC ACID.18 0.19 0.(CAS) Maltol 4H-Pyran-4-one.49 - 0.83 0.27 0.14 0.5. 1-(acetyloxy)(CAS) Acetol acetate 2-Propanone.60 4.66 0. anhydride (CAS) Propionic anhydride Propanoic acid.22 0.86 1.49 2..50 4.2-Benzenediol (CAS) Pyrocathecol 1.17 5.4A.89 9. 1-(4-hydroxy3-methoxyphenyl).17 0.(CAS) Acetol Ethanone.19 0.20 0.21 0.66 0.55 0.46 1.3.30 12.2DIMETHYL-.12 - 0.84 0.6. 1-hydroxy.49 6. Komponen aromatis yang merupakan pyrolisis dari bagian kayu 4H-Pyran-4-one.79 0.

40 5 cm 1. 3-methyl.(CAS) o-Cresol Phenol. methyl ester (CAS) 3.45 2. 6-ethyltetrahydro.39 0.24 - 0.19 0.5-Trimethoxybenzoic Benzoic acid.06 - - 0.18 12.16 - - 0. 4-methyl. 4-ethyl-2-methoxy(CAS) p-Ethylguaiacol Phenol (CAS) Izal Jumlah Rataan untuk kedua jarak suntik 1.82 0.52 11.52 0. 3-methoxy.54 12.57 0. 2-methyl.71 1.89 10.27 1.35 1.24 0. 2-methoxy-4-propyl(CAS) 5-PROPYL-GUAIACOL Phenol.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 3-Methoxy-pyrocathecol 4-METHYL CATHECOL Phenol.18 1.19 0.03 - 0.70 0.11 1.47 Mu 5 cm 1.(CAS) 6-ETHYL-.01 0.82 0. 3.(CAS) Guaiacol Phenol.(CAS) p -Cresol Phenol.31 0. 2-methoxy.13 0.13 0.18 0.05 0.14 0.28 Kt 20 cm 2.15 0.4.87 11.37 0.(CAS) m-Cresol Phenol. 4-(methylamino)Benzoic acid.07 - - - - - - 70 .92 0.36 13. Komponen berkarakter odorant lainnya yang belum disebutkan sebagai konstituen gaharu Ascaridole 2H-Pyran-2-one.64 - 0.18 0. methyl ester (CAS) METHYL 4-VINYLBENZOATE 2.63 20 cm 1.35 11.43 1.11 0.07 14.14 - 0.57 2.90 0.47 C.36 0.40 0.31 11. 4-ethenyl-.46 0.4.08 0.14 0.30 1.22 0.06 0.DELTA.50 0.23 Me 5 cm 1.35 0.82 0.43 12.39 13.37 Bo 20 cm 1.40 20 cm 1.(CAS) m-Guaiacol Phenol.64 - 0.5-trimethoxy-.VALEROLACTONE Oxacycloheptadec-8-en-2-one (CAS) Ambrettolide Oxacycloheptadecan-2-one (CAS) Dihydroambrettolide Benzoic acid.34 11.69 0.12 0.23 0.

22 - - 1. 2-methoxy-4-(2propenyl).beta.(CAS) 2.78 Bo 20 cm 0..65 0..12 - 0.5.-bisabolene 2-Butanone (CAS) Mehtyl ethyl ketone Butyric acid.66 20 cm 2. 2-methoxy-4-(1propenyl)-.(CAS) Eugenol 5-BUTYL-2-VALERYLFURAN 2(3H)-Furanone.55 Mu 5 cm 1..53 0.33 - - 0.31 - 0. 3-methyl(CAS) Citraconic anhydride Citronellyl acetate . (3..67 0.45 0.76 0. 1-(2.23 20 cm 0.93 - 0.20 71 .beta..84 - 0.).33 - 6.(CAS) (E)isoeugenol Phenol.7-triol.24 - 0.28 1. dimethylhydrazone (CAS) Cyclopentanone dimethylhydrazone Cyclopropyl carbinol Cyclopentanone (CAS) Dumasin 1-Eicosanol (CAS) n-Eicosanol TRANS-ISOELEMICIN Ethanone.66 5 cm 0.32 1.6.5-furandione. beta.7.09 Me 5 cm 1.98 Kt 20 cm 0.07 0.beta.04 - 0.17 1.03 0.30 0.alpha.38 0.93 - 3.85 - - - - - 0.6.99 - 4.51 0..(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm .71 0.98 1.beta. m-nitrophenyl ester (CAS) m-Nitrophenyl butyrate Carveol. cisCholestane-3.-Cyclocitral Cyclopentanone.42 4.45 1.(CAS) 2-acetylbutyrolactone 0.Kajian Kimia Gaharu .61 - - - - - - - 0.5-dihydroxyphenyl)(CAS) Quinacetophenone Phenol.61 - 4.93 0.. 2-methoxy-4-(1propenyl). dihydro-.22 - 0. 3-acetyldihydro.95 0.14 1.(CAS) Isoeugenol Phenol. (E).25 1.70 0.38 - 4.26 0.20 - 4.

70 - 0.65 0.31 0.75 1.69 - 0.98 0.5-Dihydrodecanoic acid.48 0.30 0.03 0. 5-hexyldihydro.56 0.09 Mu 5 cm 20 cm - - - - - - 0.18 0.60 0.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 2(5H)-Furanone.59 0.51 0.21 0. tetrahydro(CAS) Tetrahydrofurfuryl alcohol 2-Heptanol.09 - 0.5-dimethyl(CAS) 4.38 0.25 - - 0.63 - 0.36 0.04 0.2dimethylindole Indolizine (CAS) Indolizin Ionol 2 3-pentanone CAS) Diethyl ketone 1-Penten-3-one (CAS) Ethyl vinyl ketone .18 Kt 20 cm Me 5 cm 20 cm 0.(CAS) 2-methylindole 6-Nitro-5-hydroxy-1. 2-methyl.26 - 0.21 0.31 - 0.28 0.03 - 0. 3-methyl. 5-methyl(identity?) (CAS) 2-Penten-4olide 2(3H)-Furanone. acetate (CAS) 2-HEPTYL ACETATE 2-Heptanone. 5.35 - 0.HEXALACTONE 3. delta.54 0.77 0.11 - 0.(CAS) 4-decanolide 2-Furancarboxaldehyde (CAS) Furfural 2-Furanmethanol (CAS) Furfuryl alcohol 2-Furanmethanol.09 - - - - - - - 0.66 - 0.64 0.39 0.65 - 0.54 - 0.76 - 0.54 - 0.55 0.23 0.06 0.GAMMA.02 - 72 .(CAS) 3-Methyl-2-heptanone Hexanoic acid.4-Dimethylbut-2enolide 2(5H)-Furanone.74 1.03 0.71 0.13 0.56 0.14 0.09 - 0. 1-methylethyl ester (CAS) Isopropyl hexanoate 3-Hexenoic acid 1H-Indole (CAS) Indole 1H-Indole.40 0.-lactone Muskolactone Bo 20 cm 5 cm 0.93 - - 0.

5-dimethoxy.57 0.5-Norbornanediol (CAS) 2.13 0.29 - 0..(CAS) NITROSOPIPERIDINE PIPERIDINE.50 5.58 0. 6-methyl-9(trimethylsilyl).3-Benzenediol.21 0.3-Benzenediol.50 - 0.7-dimethoxy-2-methylindan1-one Lineolone METHYL MALONIC ACID p-Menthane-2-one-1.57 3.Kajian Kimia Gaharu .70 0. 5-methyl(CAS) Orcinol Benzaldehyde.45 3.42 0. 1-methoxy-4-methyl(CAS) p-methylanisole NEROLIDOL ISOMER 4-Nonanol.6-TRIDEUTERIO-OMENTHONE Benzene. 4-hydroxy3.20 0.17 - 0. 4-ethyl.86 - 0. 1-nitroso.47 0.3.3-d3 (CAS) 2. 4-methyl.40 0. N-acetyl.43 0.15 0.56 - 0.6.5-DIHYDROXYNORBORNANE Piperidine.04 0.89 2.13 0.15 - 0.(CAS) 4-methyl-4-nonanol 2.52 0.21 0.19 0.01 0.50 0.11 0.22 0.04 0.65 3.93 - 0.52 0.04 5 cm 0..(CAS) 4-Ethylresorcinol 1.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm L-isoleucine.58 73 .(CAS) 6-METHYLPURINE.19 Kt 20 cm 0. 1-(1-METHYLPENTYL)3-(2..89 0.(CAS) Syringaldehyde Bo 20 cm 0.13 20 cm 0.5-DIMETHOXY-PHENYL)PROPIONIC ACID 3-PHENYL-PROPIONIC ACID ISOPROPYL ESTER 2-PROPYNOIC ACID 9H-Purine.34 - 0..21 Mu 5 cm 0.48 2.20 Me 5 cm 20 cm 0. 9-TRIMETHYLSILYL 1.(CAS) N-Acetyl-L-isoleucine 5.

36 - 1.3DIHYDROFURAN 2(3H)-Furanone.14 - 1.(CAS) 2-methoxymandelic acid Benzeneacetic acid.(CAS) 6-HYDROXYCYCLO 2(5H)-FURANONE 2.4-dimethoxy.52 Me 5 cm 0.hydroxy-2-methoxy.06 - 0.28 - 2.13 0.11 0.5-DIMETHYL-3(2H) FURANONE 2-ETHYL-4-HYDROXY-5METHYL-3(2H)FURANONE 2-HYDROXY-5-METHYL-2(5H)FURANONE 3-HYDROXY-5-METHYL-2(5H)FURANONE 0.23 - - 0.38 Bo 20 cm 0.23 - 0.17 - 2.4-dimethoxy(CAS) Vanillin methyl ether Benzaldehyde. 3. 4-hydroxy-3-methoxy. 3.Furanone 2(3H)-Furanone.96 0. 1-(2-furanyl).(CAS) Vanillin Benzeneacetic acid. .15 - 0. 5-methyl(CAS) 5-Methyl-2-oxo-2.02 - - - - - - - - 0.70 - 1.61 0.alpha.77 0.alpha.40 5 cm 0.55 0.48 0. hexahydro3-methylene.14 0.20 0.(CAS) 2-Acetyfuran 2-ACETYL FURAN 2(3H)-Furanone (CAS) .39 1.27 0.32 - - - - - - - - 0.72 0.45 0.59 20 cm 0.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm (E)-2-hydroxy-4’phenylstilbene 1-TRICOSENE Benzaldehyde.45 - - - - - 0.26 74 .(CAS) Zingerone Ethanone.12 0.12 0.01 20 cm 0.13 - 1.97 0.(CAS) Homovanillic acid ISO-VELLERAL Benzenemethanol.63 - - - - - 0.09 0.21 - - 0.04 0. 4-hydroxy-3methoxy.10 - 0.11 0.52 Mu 5 cm 0.(CAS) Veratryl alcohol 2-Butanone. 4-(4-hydroxy3-methoxyphenyl).50 Kt 20 cm 0.

(CAS) 4-allyl-2. Baker et al.02 20 cm 1.65 5 cm - Kt 20 cm 1. Hua et al.14 44.23 0. Abrishami et al.18 0.32 37. (2004). Azah et al.. 2. (2002).19 45.10 52. Inc (2008).95 2.30 45.06 Mu 5 cm 20 cm 1.30 - Me 5 cm 1.13 0. (2008).Kajian Kimia Gaharu .17 2. International flavor and fragrance..6dimethoxyphenol 9H-Xanthen-9-one.10 3.33 26.93 22.34 43. The Good Scent Company (2008). (2004).95 0. Pedroso et al. Fotouhi et al. (2005). (2002).31 17.06 - - - 18. (2008). Bunke & schatkowski (1997).65 46. Mu = maluku FAO (2008). 75 . (2007).83 43. (2006).71 21.12 24.81 - 2.86 18. Wikipedia encyclopedia Online (2008).06 2. Castro et al.33 0. Valentines et al. Me = Mentawai. (2001).52 3.01 44.80 2.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm 5-HYDROXYMETHYLDIHYDRO-FURAN-2-ONE HYDROXY DIMETHYL FURANONE 2-(Acetyloxy)-1-[2-(acetyloxy02-(3-furanyl)ethyl]-5a[(acetyloxy)methyl]hexah 2-Methoxy-4-methylphenol Phenol. ChemYQ (2008).87 - 1.23 27.62 0.33 50. 1.(CAS) 6-O-METHYLXanthosine (CAS) Xanthine riboside Jumlah Rataan untuk kedua jarak suntik Total Rataan total untuk kedua jarak suntik Keterangan: Referensi: Bo 20 cm 1..48 49. Kt = Kalimantan Tengah Tamiang Layang. Rho et al.29 26. Sheikholeslam & Weeks (1987).57 19. Zaika et al.56 Bo = Bahorok.37 25.3-dihydroxy-6-methoxy-8methyl. (2008).23 - - - - 0. (2007).70 25..05 3. Koeduka et al.34 46.6-dimethoxy-4-(2propenyl). Lynd-Shiveley (2004). Rossi et al.

76 .

Najmulah. Ragil Setio Budi Irianto. chip. aloeswood. meskipun penggunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. komoditas ini dikenal dengan berbagai nama seperti agarwood. dan minyak gaharu (Surata dan Widnyana. Komoditas berbentuk minyak biasanya diperoleh dari penyulingan atau ekstraksi chip gaharu dari kelas yang bermutu rendah. Gaharu telah diperdagangkan sejak ratusan tahun lalu. Bentuk perdagangan gaharu beragam. di mana China dilaporkan sebagai pembeli utama. dan masih banyak lagi nama lainnya. mulai dari bongkahan. Sugeng Santosa. oudh. Sitepu. 77 . Ahmad Yani. serbuk. karas. Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu yang merupakan produk komersil bernilai ekonomis tinggi. perdagangan produk ini di Indonesia pertama kali tercatat pada abad ke-5 Masehi. Maman Turjaman. kresna. 2001).3 TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso. Saat ini. jinkoh. Dalam perdagangan internasional. sebenarnya merupakan endapan resin yang terakumulasi pada jaringan kayu sebagai reaksi pohon terhadap pelukaan atau infeksi penyakit. Irnayuli R. gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut sebagai ‘scent of God’. Menurut Suhartono dan Mardiastuti (2002).

kanker. terpicu oleh faktor biotik maupun abiotik. Penelitian mengenai berbagai aspek yang terkait dengan gaharu sudah dilakukan sejak lama dan semakin berkembang dewasa ini. Penelitian-penelitian ini terutama didorong oleh berbagai hal seperti pasokan komersil untuk gaharu yang masih sangat tergantung dari produksi alam yang karena tingginya intensitas pemungutan produk ini telah menyebabkan tercantumnya genus utama tanaman penghasil gaharu. Namun pembentukan gaharu oleh faktor abiotik. 2000). oli. 2000). Barden et al. karena 78 . anti mikrobia. seperti yang telah disebutkan sebelumnya tidak menyebabkan terjadinya penyebaran mekanisme pembentukan ini ke bagian lain dari pohon yang tidak terkena efek langsung faktor abiotik tersebut. tidak semua tanaman penghasilnya mengandung gaharu yang hanya terpicu pembentukannya jika terjadi kondisi cekaman. sembahyang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. Suhartono dan Mardiastuti. stimulan kerja saraf dan pencernaan (Heyne. ginjal. Proses pembentukan gaharu juga membutuhkan waktu yang lama. cacar. dan parfum (Barden et al. 2007) dan diketahui bermanfaat untuk mengatasi berbagai penyakit seperti sakit gigi. 2000). rematik. diuretic. diare. obat kuat pada masa kehamilan dan bersalin. tumor.Aspek PRODUKSI Pada prinsipnya. Lain halnya jika pembentukan gaharu dipicu oleh faktor biotik seperti jamur atau jasad renik lainnya. mekanisme pembentukan dapat menyebar ke bagian lain pada pohon.. pemanfaatan gaharu adalah untuk pengobatan.. Gyrinops dan Aquilaria dalam Appendix II CITES. 2002). Terbentuknya gaharu pada tanaman penghasilnya. asma. pelukaan mekanis pada batang. Adelina. 2000. sebagai pengharum ruangan. 2004.. Sementara itu. Selain itu. juga memiliki sifat anti racun. malaria. liver.. dan yang lainnya dapat memicu pembentukan gaharu. 1987. di mana selama proses tersebut berlangsung dihasilkan variasi mutu dan pada akhir proses dapat diperoleh gaharu dengan mutu paling tinggi (Sumadiwangsa dan Harbagung. gula merah. In-cense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagamaan. hepatitis. pengaruh bahan-bahan kimia seperti metal jasmonat. incense. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti imflamatory (Trupti et al. Untuk menghasilkan gaharu secara artifisial.

Inokulasi jenis fungi Fusarium spp. pada A. Batang Aquilaria spp.(Erdy Santoso.Teknologi Induksi Pohon . maka kualitas dan kuantitas produk gaharu yang dihasilkan akan lebih memuaskan.. microcarpa pada kegiatan ini bahan berupa pohon A. dkk) penyebab mekanisme ini adalah mahluk yang melakukan semua aktivitas yang diperlukan untuk kehidupannya. Isolat-isolat yang diamati No 1 2 3 4 5 6 7 8 9 10 11 Kode Ga 1 Ga 2 Ga 3 Ga 4 Ga 5 Ga 6 Ga 7 Ga 8 Ga 9 Ga 10 Ga 11 Asal lokasi Kalimantan Tengah Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Sumatera Barat Gorontalo No 12 13 14 15 16 17 18 19 20 21 Kode Ga 12 Ga 13 Ga 14 Ga 15 Ga 16 Ga 17 Ga 18 Ga 19 Ga 20 Ga 21 Asal lokasi Lampung Bengkulu Bogor Mentawai Kaltim LK Kalbar Yanlapa NTB Kalsel MIC Kalteng TL Media yang digunakan untuk menambahkan fungi.. Kalimantan. yang telah menunjukkan adanya pembentukan gaharu secara alami. Tabel 1. Sumatera.. microcarpa 79 . Maluku. Isolat fungi tersebut diperoleh dari batang Aquilaria spp. NTB dan Sulawesi (Tabel 1). yaitu Potato Dekstrose Agar (PDA). Bahan Bahan yang digunakan pada kegiatan ini adalah 21 isolat Fusarium spp. diambil dari beberapa tanaman gaharu yang terdapat di Jawa. BAHAN DAN METODE A. yang diinokulasi di Laboratorium Mikrobiologi Hutan.. Dengan terjadinya penyebaran pembentukan gaharu ke jaringan lain pada batang pohon. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Bogor.

Identifikasi juga mengamati ciri makrokonidia. Sediaan kultur dibuat dengan cara memindahkan potongan kecil isolat fungi menggunakan alat pelubang gabus berdiameter lima mm. Rancangan acak lengkap dengan perlakuan daerah asal isolat (I). Kalimantan Barat (12). Sebelum penginjeksian. Sediaan kultur diinkubasi selama tujuh hari. B. yang diamati adalah ukuran diameter koloni. Jambi. yang diamati adalah bentuk dan miselium. Teknik Inokulasi 1. genset. diinkubasi dengan cara diletakkan pada ruang tertutup yang kelembabannya dijaga dengan cara memasukkan kapas yang telah dibasahi aquadesh steril. kemudian diinokulasi pada suhu kamar dan diletakkan di ruangan inokulasi selama tujuh hari. C. Inokulasi dilakukan pada semua pohon contoh. isolat diletakkan pada gelas obyek yang kemudian ditutup dengan cover glass preparat. terdiri dari bor listrik. diamati juga warna koloni dan keberadaan aerial miselium. dan lain-lain. Metode Untuk identifikasi masing-masing koloni ditumbuhkan pada media PDA dalam cawan petri. Untuk fungi pembentuk gaharu asal Gorontalo. Masing-masing isolat diinokulasikan pada 3 ulangan. semua peralatan yang digunakan disterilkan terlebih dahulu dengan alkohol 70% untuk menghindari adanya kontaminasi dari mikrobamikroba lain. yaitu Fusarium spp. mata bor ukuran 3 mm. Pengeboran dilakukan 80 . Untuk pengamatan morfologi dilakukan melalui mikroskop parameter. dan Padang (Sumatera Barat). Kalbar.Aspek PRODUKSI umur 13 tahun. Alat inokulasi. Jambi (13) dan Padang (14) serta campuran dari keempat isolat tersebut (15). asal Gorontalo (II). setelah itu koloni yang tumbuh pada gelas obyek diamati di bawah mikroskop setelah preparat diberi zat pewarna. microcarpa di Hutan Penelitian Carita. baik secara horizontal maupun vertikal. Inokulasi Pohon contoh adalah A. mikrokonidia serta bentuk konidiofor.

. Pengambilan data dilakukan secara acak pada beberapa titik injeksi inokulasi dan nilai panjang infeksi merupakan rata-rata dari panjang titiktitik infeksi tersebut dalam satu pohon. 1.. Pengamatan dan Pengambilan Contoh Gaharu Pengamatan infeksi dilakukan pada umur inokulasi 2 bulan dan 6 bulan dengan mengukur panjang infeksi vertikal dan horizontal yang terjadi pada permukaaan batang A. Keragaman Morfologi Isolat Fusarium spp. Lubang injeksi dibiarkan terbuka untuk memberi kondisi aerasi bagi mikroba yang diinokulasikan. microcarpa. dkk) dengan kedalaman mencapai 1/3 diameter batang dengan tujuan inokulum cair nantinya mencapai kambium dan bagian floem kayu. yang berasal dari berbagai daerah sangat 81 . Keragaman Isolat Fusarium spp.Teknologi Induksi Pohon . Inokulum Fusarium spp... warna koloni dan diameter koloni isolat Fusarium spp. A Gambar 1. cair selanjutnya diinjeksikan sebanyak 1 ml untuk setiap lubang bor di batang pohon. yang Berasal dari Berbagai Daerah Karakter morfologi aerial miselium. HASIL DAN PEMBAHASAN A.(Erdy Santoso. Pengeboran batang pohon contoh (A) dan injeksi isolat pada lubang bor (B) B 2.

++ Ada.++ Ada. kuning muda Putih.+ Ada.++ Ada. Tabel 2. krem No. coklat muda Putih Putih kecoklatan Putih tulang.+++ Ada. +++ Banyak a.++ Ada. yang berasal dari berbagai daerah Kode isolat Karakter morfologi Asal lokasi Diameter koloni mm/7 hari Kalteng Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Padang Gorontalo Lampung Bangka Bogor Mentawai Kaltim LK Kalbar Yanlapa Mataram Kalsel MIC Kaltel TL 61 49 48 50 45 38 59 49 59 61 58 58 59 61 56 57 59 58 52 50 69 Aerial Miselium Ada. Koloni pada 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 Kelimpahan relatif aerial miselium: + Sedikit.+ Ada.++ Ada. Keragaman morfologi Fusarium spp. kuning. ++ Cukup banyak.++ Warna Medium PDA Putih. Tabel 2.+ Ada.Aspek PRODUKSI beragam (Tabel 2).+++ Ada. kuning muda Putih Putih.+++ Ada.+++ Ada.++ Ada. coklat muda Coklat muda Putih Putih Putih Putih krem Putih Putih krem.++ Ada. merah muda Putih Putih Coklet. Keragaman karakter morfologi Fusarium spp.+++ Ada.++ Ada. disebabkan oleh perbedaan asal isolat. Keberadaan Aerial Miselium 82 . unggu Putih krem Putih. putih Putih.+++ Ada.++ Tidak ada Ada.+++ Ada. kuning muda Putih.

Namun. Ga-5. Ditemukan juga isolat yang memiliki warna koloni yang sangat berbeda dengan isolat lain. keragaman morfologi isolat Fusarium spp. dan Ga-16 merupakan isolat dengan kelimpahan aerial miselium sedikit. Ga-13. putih krem (Ga-7. yaitu warna hifa miselium didominasi 83 . Ga-6. Fusarium solani merupakan spesies yang kosmopolit dengan ciri khas kelimpahan mikrokonidianya elips. dan Ga17 memiliki kelimpahan aerial miselium relatif banyak (Tabel 2). 2006). maka perbedaan kelimpahan aerial miselium adalah disebabkan oleh karakter masing-masing isolat. dan Gambar 4). adalah warna koloni. Isolat ga-17 dan Ga-21 memiliki kemiripan warna koloni dengan isolat Fusarium yang berasal dari Riau yang telah teridentifikasi dan merupakan spesies Fusarium solani (Luciasih et al. Ga-13. sedangkan isolat Ga-3. Ga-11. Irawati (2004) melaporkan bahwa secara umum cendawan yang ditumbuhkan pada kondisi terang secara terus-menerus akan membentuk aerial miselium relatif lebih banyak. 2004). Selain warna putih. Ga-10. cokelat muda (Ga-2). Walaupun sebagian besar isolat Fusarium spp. b. Aerial miselium yang terbentuk dengan kelimpahan relatif banyak merupakan mekanisme fototropi terhadap kehadiran cahaya (Irawati. Ga-17.Karakter aerial miselium terdapat hampir pada setiap isolat Fusarium spp. Isolat Ga-10 dan Ga11 memiliki warna koloni putih dan warna cokelat muda (peach). Ga-10. karena pada penelitian semua isolat yang diuji mendapat perlakuan cahaya yang sama. Isolat yang tidak memiliki aerial miselium dijumpai pada Ga-15 asal Mentawai. dan Ga-19 (Gambar 2. beberapa isolat memiliki warna putih dan warna kuning muda pada isolat Ga-1. dan Ga-20 memiliki warna koloni putih dan kuning muda. Hasil yang diperoleh menunjukkan bahwa warna koloni putih terdapat pada isolat Ga-4. Ga8. Isolat Ga-1. Ga-9. Ga-19. Ga-14.. Gambar 3. dan Ga-21). Ga-12. Isolat Ga-18. Ga-6. Warna Koloni Selain aerial miselium. namun terdapat perbedaan antar isolat jika dilihat berdasarkan kerlimpahan relatif aerial miseliumnya. memiliki aerial miselium.

Diameter Koloni Diameter koloni Fusarium spp. Semua isolat yang diuji dapat diklasifikasikan menjadi tiga kelompok. Ga-18. Hasil pengamatan menunjukkan bahwa keragaman terlihat pada karakter jumlah septa makrokonidia. Ga-3. Keragaman Mikro dan Makrokonidia serta Konidiofor Isolat Fusarium spp. Ga-3. Ga-20. dan isolat dengan diameter lebih dari 50 mm (isolat Ga-1. berhubungan dengan kecepatan tumbuh hifa. dan Ga-21) (Tabel 2. Ga-7. maka isolat perlu diuji. percabangan konidiofor. diperoleh adanya hubungan yang erat antara kecepatan tumbuh hifa dengan kehadiran aerial miselium. Ga-12. Fusarium spp. Ga10. Keragaman yang terdapat pada warna koloni berhubungan dengan pigmen yang dikandung oleh dinding sel hifa. Ga-5. Ga-4. Ga-18. Kecepatan tumbuh yang tinggi dapat berhubungan juga dengan kemampuan virulensi. Gambar 3. Ga-5. Ga-16. Selain itu. Ga-17. Ga-19. Keragaman diameter koloni Fusarium spp. Ga-15. berkisar antara 30-69 mm. 2. kecepatan tumbuh merupakan karakter yang khas pada setiap isolat. Ga-10. Ga-11.Aspek PRODUKSI oleh warna ungu namun memiliki warna koloni putih sedikit tipis pada aerial miselium yang terletak pada bagian tepi koloni (Gambar 3). dan Gambar 4). Ga-6. misalnya terhadap inangnya. dan kelimpahan mikrokonidia. bentuk. Ga-13. Ga-9. Pada beberapa isolat Fusarium. Ga-8. Gambar 2. yaitu diameter kurang dari 40 mm (isolat Ga-6). Ga-8. Cendawan yang tidak berpigmen umumnya berwarna hialin. dari ke-10 isolat tersebut terdapat perbedaan pada 84 . Ga-14. Namun. memiliki keragaman pada karakter morfologi juga tampak adanya keragaman karakter mikrokonidia dan makrokonidia dari isolat yang diuji. dan Ga-20). Diameter koloni merupakan veriebel yang berhubungan erat dengan kecepatan tumbuh. Ga-7. Untuk mengetahui kemampuan virulensi. isolat dengan diameter antara 40-50 mm (isolat Ga-2. c. Jumlah septa makrokonidia dominan berjumlah 2-3 yang dimiliki oleh isolat Ga-1. dan Ga-21.

Ga-5. Ga-14. (isolat Ga-1. Keragaman morfologi Fusarium spp. Ga-6. dan Ga-8) umur tujuh hari pada medium PDA Gambar 3. Ga-10. Ga-12. GA-7. 85 . Ga-6. Sedangkan isolat Ga-1. Ga-2. Ga-7. Ga-11. Isolat dengan konidiofor bercabang adalah Ga-18 dan Ga-21.. Keragaman morfologi Fusarium spp. Ga-5...(Erdy Santoso. Ga-3. Ga-15. dan Ga16) umur tujuh hari pada medium PDA. dkk) percabangan konidifornya.Teknologi Induksi Pohon . dan Ga-10 memiliki konidiofor sederhana (Tabel 3). Ga-3. Ga-4. Gambar 2. Ga-8.. (isolat Ga-9. Ga-13.

dan Ga-21) umur tujuh hari pada medium PDA Tabel 3.Aspek PRODUKSI Gambar 4. oval Elips. Keragaman karakter makrokonidia Fusarium spp. oval Elips Elips. dan Ga-15 memiliki jumlah septa empat. sekat Elips. Ga-18. Keragaman morfologi Fusarium spp. sekat Elips Elips Elips Elips Elips Elips. oval Elips Isolat Ga-2. yang berasal dari berbagai daerah Karakter histologi No Kode Makrokonidia Jumlah septa 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 3 4 3 4-7 2 3 2 2 5 3 4 5 4 7 4 7 5 3 4 2 3 Konidiofor Simpel Bercabang Simpel Simpel Simpel Simpel Simpel Simpel Simpel Simpel Bercabang Simpel Simpel Simpel Bercabang Simpel Bercabang Bercabang Simpel Bercabang Bercabang Mikrokonidia Kelimpahan Banyak Banyak Banyak Banyak Sedikit Sedikit Sedikit Sedikit Sedikit Banyak Banyak Banyak Sedikit Sedikit Banyak Sedikit Sedikit Banyak Banyak Sedikit Banyak Bentuk Elips Elips. namun dari ke-3 isolat tersebut dapat dibedakan berdasarkan 86 . sekat 3 Elips Elips Elips Elips. Ga-3. (isolat Ga-17. oval Elips Elips. oval Elips. lonjong Elips. Ga-20. Ga-19.

Sedangkan F. tricinctum berdasarkan karakter bentuk makrokonidianya. Isolat Ga-12 memiliki ukuran relatif lebih besar pada makrokonidianya apabila dibandingkan dengan Ga-14 (Gambar 5 dan Gambar 6). dari 21 isolat Fusarium spp. (2006) melaporkan bahwa keragaman antar Fusarium spp. sambunicum (isolat Ga-1). Di antara ketiga spesies tersebut F. yaitu isolat Ga-12 dan Ga-14 memiliki kemiripan pada bentuk konidiofor dan bentuk mikrokonidia. Isolat Ga-14 berbeda dengan isolat Ga-16 karena pada isolat Ga-16 mikrokonidianya bersekat (Gambar 7). solani (isolat Ga-4. Dua dari tiga isolat tersebut.. yaitu berbentuk bulan sabit (fusoid) sehingga memungkinkan dapat dengan mudah dibedakan dengan genus lain yang memiliki ciri mirip Fusarium. Ga-7. Fusarium solani berbeda dengan F. beberapa isolat telah teridentifikasi sampai pada tingkat spesies. yaitu berkisar 5-7 (Tabel 3). dan Ga-5). Cowan (1999) menerangkan bahwa tanaman memiliki kemampuan yang tidak terbatas dalam mensintesis substansi 87 .Teknologi Induksi Pohon . Isolat Ga-2 memiliki konidifor bercabang. solani keberadaannya paling dominan sehingga perlu mendapat perhatian khusus..(Erdy Santoso. dan Ga9). dan F. antara lain berdasarkan karakter kelimpahan dan bentuk mikrokonidianya. solani dibedakan dari F. solani dengan mikrokonidianya berbentuk elips. Mikrokonidia pada berbagai Fusarium memiliki bentuk yang khas.. sambunicum. juga bentuk mikrokonidianya relatif lebih besar untuk F.. Luciasih et al.. tricinctum (isolat Ga-2. namun kedua isolat tersebut berbeda pada tipe makrokonidianya. namun Booth (1971) membedakan Cylindrocarpon karena karakter pangkal konidianya yang relatif tumpul dan tidak memiliki hock/foot cell yang jelas seperti pada Fusarium spp. Ga-6. Genus Fusarium memiliki kemiripan dengan Cylindrocarpon pada karakter morfologi. dan Ga-16 merupakan isolat yang memiliki jumlah septa makrokonidia relatif banyak. Ga-14. Ga-3. Ga-8. Isolat Ga-12. dkk) percabangan konidifor dan bentuk mikrokonidianya. F. bentuk mikrokonidianya elips dan oval. Isolat Ga-13 memiliki bentuk konidifor simpel dan Ga-15 bentuk konidifornya bercabang. Spesies tersebut merupakan F.

Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. Ga-5. Ga-20. Ga-14. serangga ataupun herbivora. Pada umumnya senyawa-senyawa tersebut merupakan metabolit sekunder yang seringkali berperan dalam mekanisme pertahanan tanaman terhadap serangan mikroorganisme. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp.2. Ga-15. Ga-9. Ga-17. dan Ga-21) dengan perbesaran 40x Gambar 6. Ga-11. GA-7. Ga. Ga8. (isolat Ga-4.Aspek PRODUKSI aromatis yang kebanyakan merupakan senyawa fenol atau turunan oksigen-tersubstitusinya. Ga12. (isolat Ga-1. GA-10. dan Ga-18) dengan perbesaran 40x 88 . Gambar 5.

. memainkan peranan penting (Verpoorte et al. Terdapat jalur biosintesis yang terpicu pada level gen setelah pelukaan atau infeksi dan ada yang terjadi pada level senyawa. 2000). 2000. Ga-6. Vidhyasekaran. Ga-16.Teknologi Induksi Pohon . biosintesis sesquiterpena tertentu pada solanaceae terpicu oleh infeksi mikroba. dkk) Gambar 7.. Fitoaleksin adalah senyawa aktif anti mikrobial yang diproduksi secara de novo setelah pelukaan atau infeksi. Pohon penghasil gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. kadangkala terpicu pengaktifannya saat pelukaan. 2004). ekspresi dari jalur biosintesis yang terlibat akan berbeda.. sedangkan pada tanaman lain biosintesis sesquiterpenoid 89 . Biosintesis keduanya terpicu pada level gen (Verpoorte et al. Sebagai contoh. fitoaleksin sebagai agen anti mikrobial (sesqui-. dan Ga-19) dengan per-besaran 40x Gaharu merupakan senyawa fitoaleksin dari pohon gaharu sebagai mekanisme pertahanannya terhadap infeksi patogen. Kayu beresin ini merupakan metabolit sekunder yang dibentuk tanaman sebagai respon pertahanan.. rangsangan fisiologi maupun keadaan cekaman (Goodman et al. di-. Berdasarkan berbagai fungsi tersebut.(Erdy Santoso. dalam Isnaini. 2000). di antaranya sebagai minyak esensial (monoterpenoid). di mana senyawa yang telah ada secara enzimatis dirubah menjadi senyawa aktif ketika pelukaan. Metabolit sekunder dalam sistem pertahanan tanaman. baik fitoantisipin maupun fitoaleksin. (isolat Ga-3. Fitoantisipin adalah senyawa aktif anti mikrobial yang telah terdapat pada tanaman. 2004). Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. atraktan serangga... dan triterpena). Metabolit sekunder tanaman yang diturunkan dari terpenoid memiliki berbagai fungsi dalam tanaman. Ga-13.

akar. 2000). anthraquinone biasa ditemukan di seluruh bagian tanaman (Verpoorte. Zat ekstratif yang terdiri dari bermacam-macam bahan ini memilki fungsi yang penting dalam daya tahan terhadap serangan jamur dan serangga. Kerentanan pohon dalam menghadapi infeksi jamur akan berkaitan dengan 90 . karena analog dengan komponen vital tertentu dari sistem sinyal seluler atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Comission GIFNFC. Dalam hal pembentukan gaharu tentunya diharapkan penyakitlah yang akan menang. Zat ekstratif pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. sehingga dihasilkan produk gaharu yang diinginkan. antar spesies. Jenis-jenis tropis dan sub-tropis umumnya mengandung jumlah ekstratif yang lebih banyak dibanding jenis-jenis di daerah temperet (Forestry Comission GIFNFC. Senyawa kimia yang dimiliki pohon merupakan salah satu upaya pertahanan pohon terhadap mikroorganisme penyebab penyakit. Metabolit sekunder pada kayu dapat disebut sebagai zat ekstratif. memberi bau. Gaharu sendiri telah diidentifikasi sebagai sesquiterpenoid. 2007). dan jaringan luka). Analisis Infeksi Batang Dalam kondisi menghadapi infeksi oleh jamur. 1987). pohon penghasil gaharu akan memberi respon untuk mempertahankan dan memulihkan dirinya. dan antar musim. Konsentrasi metabolit sekunder bervariasi antar spesies. Rowell (1984) menyatakan bahwa di antara fungsi zat ekstratif adalah sebagai bagian dari mekanisme sistem pertahanan pohon terhadap serangan mikroorganisme. 2007). antar jaringan (konsentrasi tertinggi berada di kulit. antar pohon dalam spesies yang sama.Aspek PRODUKSI merupakan ekspresi pembentukan yang umum. misalnya pada Morinda citrifolia. Daya tahan pohon akan menentukan pemenang antara pohon dengan penyakit yang disebabkan mikro-organisme tersebut. rasa. pangkal percabangan. B. kayu teras. dan warna pada kayu. senyawa pertahanan tipe fitoaleksin. Metabolit sekunder tanaman efektif dalam melawan hama dan agen penyakit.

223a terhadap infeksi yang terbentuk pada Kalimantan Barat batang A. microcarpa. terlihat bahwa asal isolat berpengaruh nyata terhadap panjang infeksi yang terjadi pada batang A. Hasil uji lanjut Duncan memastikan bahwa pada dua bulan sejak inokulasi. Kalbar.. microcarpa pada umur inokulasi 2 bulan dan 6 bulan. Uji lanjut Duncan untuk infeksi 2 bulan umur 2 bulan.297a halnya dengan kondisi pada umur Campuran 3. diikuti oleh isolat campuran (Tabel 4). Pada Gambar 8 terlihat panjang infeksi yang terjadi pada batang pohon A. dapat direfleksikan masing-masing oleh besar infeksi dan komponen kimianya. dkk) gaharu yang terbentuk. yaitu 4. Namun sama Padang 2.05 dan campuran. Pada saat (Isolate origin) (Mean value) ini.(Erdy Santoso. 91 . asal Gorontalo memperlihatkan nilai infeksi yang paling besar.13 cm diikuti oleh isolat campuran..857a lagi memberikan pengaruh nyata Jambi 2.Teknologi Induksi Pohon . microcarpa.193a inokulasi 2 bulan. Dari hasil analisis sidik ragam. dan yang terendah adalah infeksi yang terbentuk oleh isolat asal Jambi.. pada umur inokulasi 6 umur inokulasi bulan.133a terlihat bahwa infeksi tertinggi masih Keterangan: Nilai yang diikuti oleh huruf yang disebabkan oleh isolat asal Gorontalo sama tidak berbeda nya-ta pada 0. isolat campuran menyebabkan infeksi yang lebih tinggi dibandingkan Asal isolat Rataan isolat yang lain (Gambar 8). secara statistik asal isolat tidak 1. Pada umur inokulasi 2 bulan isolat Fusarium spp.. isolat asal Gorontalo menyebabkan infeksi yang paling besar pada batang pohon penghasil gaharu. Padang. dari Gambar 8 Gorontalo 4. Berbeda dengan kondisi pada Tabel 4.

Gorontalo terlihat tidak mengalami bulan keenam oleh isolat asal sedangkan infeksi oleh keempat asal perkembangan.05 crocarpa. tetapitidak mengalami perkembangan. Namun sama halnya dengan kondisi pada umur inokulasi 2 bulan. asal daerah isolat tidak memberikan pengaruh nyata pada laju infeksi yang terjadi (nilai signifikansi 0. sedangkan infeksi oleh keempat asal isolat yang 71 | lain menunjukkan peningkatan yang beragam. Laju infeksi pada batang A. Namun begitu. dari Gambar 8 Aspek PRODUKSI terlihat bahwa infeksi tertinggi masih disebabkan oleh isolat asal Gorontalo dan campuran. Panjang infeksi batang A. tetapi infeksi bulan keenam oleh isolat asal Gorontalo terlihat infeksi merupakan isolat yang menyebabkan infeksi terbesar. mita pada 0. microcarpa Gambar 8. Meskipun masih dua merupakan isolat yang menyebabkan infeksi terbesar. microcarpa 92 .186 pada 5%). huruf yang sama tidak berbeda nya- Gambar 8. secara statistik untuk bulan keenam inokulasi.bentuk pada batang A. Meskipun terjadi 9 menunjukkan perubahan panjang infeksi yang terjadi sejak masihbulan inokulasi hingga bulan keenam. microcarpa Gambar sejak dua bulan inokulasi hingga bulan keenam. Gambar 9 menunjukkan perubahan panjang infeksi yang Gambar 9. Panjang infeksi batang A.

asal Gorontalo menyebabkan infeksi yang paling besar. Dari perkembangan infeksi pada pohon A. dkk) Perkembangan infeksi yang terjadi hingga 6 bulan setelah inokulasi menunjukkan asal daerah isolat tidak lagi memberikan pengaruh yang nyata. jadi sebaiknya isolat ini digunakan untuk inokulasi 93 . pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masing sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. KESIMPULAN 1. namun terdapat warna koloni merah muda. 3. kuning. didominasi warna putih. Hasil inokulasi Fusarium spp. dan Ga-17 merupakan isolat yang memiliki kecepatan tumbuh tinggi apabila dibandingkan dengan isolat Fusarium yang lain. microcarpa ini dapat dikatakan bahwa isolat asal Gorontalo menyebabkan infeksi yang terbesar... kekonsistenan perkembangan infeksi sebaiknya diteliti lebih lanjut dengan mengikuti perkembangan laju infeksi oleh isolat asal Gorontalo ini hingga kurun waktu tertentu. dan ungu.(Erdy Santoso. namun ada kemungkinan hal ini masih merupakan pengaruh dari isolat asal Gorontalo tersebut. 2. Secara histologi isolat Fusarium spp.. Hal ini diduga ada kaitannya dengan pertahanan masing-masing pohon contoh. meskipun yang terbesar masih disebabkan oleh isolat campuran dan isolat asal Gorontalo. Meskipun tetap menyebabkan infeksi yang besar. Hampir semua isolat memiliki aerial miselium.. Isolat Fusarium spp. Ga-11. Meskipun isolat campuran menunjukkan panjang infeksi yang lebih tinggi saat 6 bulan setelah inokulasi. Secara morfologi isolat Fusarium spp.Teknologi Induksi Pohon . memiliki karakter makrokonidia bersepta 3-4 dan makrokonidia didominasi oleh bentuk elips. Uji perbedaan kecepatan tumbuh menunjukkan bahwa isolat Ga9. 4. yang berarti isolat ini menghasilkan kuantitas gaharu yang paling besar.

1984. Bogor. 2.cfm. Pusat Litbang Hutan dan Konservasi Alam. Barden. E.. K. 2004. 6-7. W. A. pp. dan E. 2001..Aspek PRODUKSI pada A. pp. Karakterisasi Mikoriza Rhizocstonia dari Perakaran Tanaman Vanili Sehat. Heyne.kvl. Disertasi). Forestry Commission GIFNFC. D. Induksi Produksi Gubal Gaharu Melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik. Berlin : SpringerVerlag. Clinical microbiology Review. Program Pascasarjana Institut Pertanian Bogor. The Chemistry of Solid Wood.12 (4) : 564-582. Isnaini. pp. The Genus Cylondrocarpon. (1987). [14 Juli 2007]. N.dk. Applied Microbiology 32 : 278-281. 94 . Nooranie. Hua SST. DAFTAR PUSTAKA Adelina. Magelang. Seed Leaflet : Aquilaria malaccensis Lamk. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. 120-127. Bogor Luciasih. M. Irawati.A. gov. Cowan. Chemicals from Trees. Wahyuno. 2006. Tumbuhan Berguna Indonesia. Forest and Landscape Denmark. pp. 1987. Rm. Heart of The Matter Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. Y. TRAFFIC Network. [2 Februari 2007]. microcarpa jika diinginkan hasil gaharu dalam jumlah besar. Washington : American Chemical Society. C. Jilid III. Jurnal Penelitian Hutan dan Konservasi Alam III(5):555-564. (England : Commonwealth Mycological Institute). Hills. Tesis. Keanekaragaman Jenis Jamur yang Potensial dalam Pembentukan Gaharu dari Batang Aquilaria spp. csl. 267-269. and S. 1999.SL. A. Badan Litbang Kehutanan. Heartwood and Tree Exudates. Teresia. http: // treechemicals. M. Michael (2000). Santoso. 2004. A. www.uk/review/extraction. Plant Products as Antimicrobial Agents. Booth. (1971). 2007. 2004. Jakarta. Rowell.

95 . Balai Penelitian Kehutanan Kupang. Sumadiwangsa. R.. Somani. Mardiastuti.. London. Metabolic Engineering of Plant Secondary Metabolism. In Verpoorte. Memelink.Teknologi Induksi Pohon . In : Verpoorte. Widnyana. Surata. Nagao Natural Environment Foundation.. Kluwer Academic Publisher. Teknik Budidaya Gaharu. 2000. Boca Raton. 2000. Pharmacology-online 1 : 288-298. S. Miniyar. W. 2001. Boston. General Strategies. E.. R. K. Dordrecht. 2002. p : 1-30. Nandakumar. and Alfermann. W. Aisuli 14. CITES and Implementation in Indonesia. Bhutada. Physiology of Disease Resistant in Plant. Kluwer Academic Publisher. K. Kain. Florida. CRC Press Inc. dkk) Soehartono.. Plant Secondary Metabolism. R. R.. Info Hasil Hutan 6 (1) : 1-16. Trupti.. Vidhyasekaran. 2007. (Editors). 2000. p : 31-50. A. P. A. Verpoorte. P. I M.. 2000. T. Pusat Penelitian Hasil Hutan. S. Jakarta. C. Verpoorte. and Alfermann. Analgesik and AntiImflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal.(Erdy Santoso. Laju Pertumbuhan Tegakan Gaharu (Aquilaria malaccensis) di Riau yang Ditanam dengan Intensitas Budidaya Tinggi dan Manual. Dordrecht. London. Mundhada. Metabolic Engineering of Plant Secondary Metabolism. Y. J. A. dan Harbagung. (Editors). Boston. P. R. Gore. R van der Heijden. Bogor. I K.

96 .

Proses pembentukan gubal pada pohon gaharu.. filaria) dan A. hingga saat ini masih terus diteliti. oxyporum. asal gubal gaharu pada Gyrinops verstegii (sin. crassna. FMIPA. Rahayu et al. bulbigenium. microcarpa) umur 97 . gubal gaharu diduga dapat terbentuk melalui infeksi cendawan. Selain itu. A. Institut Pertanian Bogor Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Esti Wulandari Departemen Biologi. FMIPA. Magnoliopsida. lateritium telah berhasil diisolasi oleh Santoso (1996). F. Institut Pertanian Bogor LATAR BALAKANG Gaharu merupakan salah satu komoditi hasil hutan bukan kayu (HHBK) yang dihasilkan oleh beberapa spesies pohon gaharu (Aquilaria sp. A. Beberapa spesies Fusarium seperti F. Menurut Nobuchi dan Siripatanadilok (1991). DAN Fusarium sp. DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu Departemen Biologi. A. malaccensis. dan F. Thymelaeaceae). (1999) menyatakan bahwa beberapa isolat Acremonium sp. malaccensis mampu menginduksi gejala pembentukan gubal pada pohon gaharu (A.4 EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp.

Departemen Biologi FMIPA IPB). yang berasal dari Aquilaria sp. Caruso dan Kuc (1977) menyatakan bahwa infeksi F. (2007) dan Rahayu (2008) juga menyatakan bahwa Acremonium sp. dan sebaliknya. BAHAN DAN METODE A. oxysporum. (1995) juga menemukan proses SAR dari infeksi Pseudomonas lachrymans pada timun terhadap F. larutan gula 2%. dan Fusarium sp. oxysporum f. microcarpa). hasil induksi cendawan. terhadap Fusarium sp. merangsang perubahan warna kayu dan pembentukan senyawa terpenoid. Banten. dan Acremonium sp.525 (koleksi IPBCC. Mekanisme infeksi kedua cendawan ini pada satu lokasi infeksi belum dipelajari. pada beberapa kasus infeksi cendawan pada tumbuhan. biakan Acremonium sp. cucumerinum dapat membangkitkan SAR tanaman semangka terhadap infeksi Colletotrichum lagenarium. melalui pemanfaatan kedua cendawan tersebut sebagai penginduksi ganda memerlukan informasi awal mengenai kemungkinan terbentuknya SAR yang dibangkitkan oleh Fusarium sp. Infeksi ganda Fusarium sp. Pada gubal gaharu. terhadap Acremonium sp. infeksi cendawan yang pertama dapat membangkitkan resistensi yang disebut Systemic Acquired Resistance (SAR) terhadap infeksi cendawan kedua. Sebagai contoh. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam). Bahan Bahan dan alat yang digunakan adalah pohon A. perubahan warna kayu dan adanya senyawa terpenoid dijadikan indikator efektivitas dan interaksi antara inokulan dalam pembentukan gubal. Padahal menurut Sticher et al. Acremonium sp. Padang (koleksi Laboratorium Mikrobiologi Hutan. terdeteksi senyawa oleoresin (Prema dan Bhattacharyya. IPBCC 07. Rahayu et al. microcarpa umur 13 tahun di Hutan Penelitian Carita. (1997).sp.Aspek PRODUKSI 2 tahun. 1962). seringkali diperoleh dari satu gejala gubal. Oleh sebab itu. dan Fusarium sp. Liu et al. 98 . dalam pembentukan gubal pada pohon gaharu (A. Oleh sebab itu penelitian ini bertujuan untuk mengetahui efektivitas dan interaksi antara Acremonium sp.

kemudian zona perubahan warna batang diukur secara horizontal 99 . B. Uji Efektivitas dan Interaksi Acremonium sp. Untuk inokulan berupa pelet. bor. serta batang dengan perlakuan tunggal (diberi Acremonium sp. Pasangan inokulan (FA atau AF) adalah set perlakuan. sederetan lubang dibuat di sekeliling batang utama (mulai ketinggian 0. Pertama-tama. lubang diberi larutan gula 2% sebelum pemberian inokulan. Pembuatan Inokulan Acremonium sp. Batang di sekitar lubang dikupas kulitnya. 2. Seminggu kemudian. yang dilubangi saja (B). bahan pelet. dan Fusarium sp. aquades. ditumbuhkan pada 300 ml media cair. Ke dalam deretan lubang ini dimasukkan inokulan 1 sampai lubang dipenuhi oleh inokulan. Pengamatan dilakukan setiap 1 bulan selama 4 bulan. saja (AA) atau Fusarium sp. mata bor berukuran 4 mm.5-1 m di atas permukaan tanah) dengan mata bor berdiameter 4 mm. Batang yang tidak diberi perlakuan (K). Efektivitas dan interaksi diukur melalui perkembangan pembentukan gejala gubal di sekitar daerah induksi. Fusarium sp. Jarak antar lubang dalam deretan sekitar 5 cm. Acremonium sp.alkohol. dan alat pencetaknya. kemudian dibentuk berupa pelet dengan ukuran 4 mm x 40 mm. Ke dalam lubang pada deretan kedua ini dimasukkan inokulan 2. meteran. Metode 1. saja (FF)) digunakan sebagai pembanding. ditumbuhkan pada media serbuk gergaji selama 2 minggu. dengan kedalaman lubang maksimal 1/3 diameter batang. batang yang dilubangi dan diberi larutan gula (G). dan diinkubasi selama 3 minggu menggunakan inkubator bergoyang. Jarak antar set perlakuan dalam 1 pohon ± 30 cm. Perubahan warna batang dan pembentukan wangi merupakan indikator pembentukan gubal. dan Fusarium sp. pohon dilubangi lagi pada jarak 15 cm secara vertikal dari deretan lubang yang pertama. Biakan ini akan digunakan sebagai sumber inokulum untuk pembuatan inokulan. diremajakan pada media agaragar kentang dekstrosa (Difco) dan diinkubasi pada suhu ruang selama 7 hari.

dan tingkat wangi) dianalisis dengan SAS versi 9.4 g kayu yang berubah warna direndam dalam 5 ml etanol absolut panas. Kayu di sekitar titik inokulasi dipahat. Tingkat perubahan warna kayu dinyatakan dalam rataan dari hasil pengamatan 3 responden. Wangi dinyatakan dalam tingkat wangi dan persentase titik induksi dengan kategori agak wangi dan sangat wangi. Analisis Data Data hasil pengamatan (panjang. 2 = wangi). Perubahan warna diamati pada 10 titik untuk setiap pohon. Daerah yang menunjukkan perubahan warna kayu dari putih menjadi coklat-kehitaman diambil dengan dipahat dan dibawa ke laboratorium untuk pengamatan selanjutnya. Sebanyak 5 ml etanol absolut ditambahkan ke dalam larutan. Bila terdapat pengaruh nyata dari perlakuan yang diamati maka setiap taraf perlakuan 100 . tingkat perubahan warna. Pada endapan ditambahkan 1 ml dietil eter pekat. kemudian diamati wanginya secara organoleptik ketika kayu dibakar. 3. Setelah diamati tingkat wanginya. Wangi ditetapkan berdasarkan sistem skor (0 = tidak wangi. sampelsampel dari kayu yang mengalami perubahan warna dipisahkan dari bagian yang sehat. lebar zona perubahan warna. 4. Tingkat wangi dinyatakan dalam rataan skor dari 3 responden. 1 = putih kecoklatan. ditambahkan 3 tetes asam asetat anhidrat dan 1 tetes H2SO4 pekat. Perubahan warna menjadi merah atau ungu menunjukkan adanya senyawa triterpenoid (Harbone. kemudian disaring pada cawan petri steril dan diuapkan sampai kering (sampai terbentuk endapan berwarna kuning). 1 = agak wangi.Aspek PRODUKSI dan vertikal. 1987). dihomogenisasi lalu dipindahkan ke tabung reaksi steril. 1987). 2 = coklat. Tingkat perubahan warna kayu ditetapkan berdasarkan sistem skor (0 = putih. kemudian absorbansinya diukur dengan spektrofotometer pada λ 268 nm.1 menggunakan Rancangan Acak Lengkap (RAL) satu faktor dengan waktu dan uji F pada α = 5%. Deteksi Senyawa Terpenoid Senyawa terpenoid dideteksi dengan metode LiebermanBurchard (Harborne. Sebanyak 0. 3 = coklat kehitaman).

Efektivitas Inokulan dalam Menginduksi Gejala Pembentukan Gubal Gaharu Secara umum semua perlakuan menyebabkan perubahan warna kayu dan merangsang munculnya perubahan aroma kayu (Tabel 1). Sedangkan pada parameter lainnya. HASIL A.30a Lebar (cm) 0.07 39..Efektivitas dan Interaksi .. AF lebih efektif dalam menginduksi pembentukan wangi daripada FA dan inokulan tunggal.70a 0.94a 0. Berdasarkan persentase titik induksi pada kategori wangi.39 0. AF justru lebih baik.45c 1.12 Titik induksi wangi (%) 1. inokulan ganda lebih efektif. Tabel 1.18a Wangi (skor) Titik induksi agak wangi (%) 34.20a 3.75b 2. Sebagai inokulan tunggal A dan F memiliki efektivitas yang relatif sama.62ab 0.55 20.82a 0.) dibandingkan dengan menggunakan uji lanjut Duncan pada taraf 5%.24 4.87a 0.00 6.(Gayu Rahayu..90b 1. Gejala pembentukan gubal akibat inokulan ganda juga cenderung tidak berbeda nyata dari inokulan tunggalnya.83a Warna (skor) 1.54ab 3. Di antara inokulan ganda. Pembentukan gejala gubal gaharu hasil inokulasi cendawan tunggal dan ganda Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Inokulan tunggal Inokulan ganda AA FF AF FA 2. Efektivitas inokulan tunggal maupun ganda Acremonium dan Fusarium relatif lebih tinggi dalam merangsang pembentukan gejala gubal gaharu dibandingkan dengan metode induksi lainnya.16 0.63ab 0.59ab 101 .14a 3. dkk.37 31.. Pemberian gula menyebabkan gejala pembentukan gubal gaharu menjadi tertekan.

Aspek PRODUKSI

Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Kontrol positif Kontrol negatif
*

Lebar (cm) 0,55b 0,73ab 0,00c

Warna (skor) 1,02d 1,16d 0,00e

Wangi (skor)

Titik induksi agak wangi (%) 10,41 11,11 0,00

Titik induksi wangi (%) 0,00 0,00 0,00

G B K

1,86b 2,87ab 0,00c

0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Kayu mengalami perubahan warna dari putih menjadi coklat atau coklat kehitaman (Gambar 1). Pemberian inokulan tidak berpengaruh pada panjang dan lebar zona perubahan warna. Namun panjang zona perubahan warna tertinggi terjadi berturut-turut pada kayu yang diberi perlakuan ganda FA dan AF. Sedangkan tingkat perubahan warna dipengaruhi oleh inokulan. Tingkat perubahan warna tertinggi pada FA dan berbeda nyata dari perlakuan lainnya.

Pemberian inokulan juga tidak berpengaruh nyata terhadap pembentukan wangi. Berbeda dengan perubahan warna kayu, tingkat wangi tertinggi terjadi pada kayu yang diberi inokulan ganda AF. Secara rataan nilai tingkat wangi yang terbentuk dari hasil perlakuan inokulan termasuk dalam kategori tidak wangi, Meskipun demikian, pemberian inokulan meningkatkan persentase titik induksi yang wangi. Bahkan inokulan tunggal AA dan inokulan ganda menghasilkan titik induksi pada kategori wangi (Tabel 1).

a

b

c

d

Gambar 1. Perubahan warna kayu dengan tingkat kegelapan yang berbeda dari (a) intensitas terendah sampai (d) intensitas tertinggi

102

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Periode induksi berpengaruh pada semua parameter pembentukan gubal kecuali panjang zona perubahan warna (Tabel 2). Secara umum, nilai parameter pembentukan gubal tertinggi terjadi pada bulan ke-2, kecuali tingkat perubahan warna. Pada bulan ke-2 induksi, intensitas warna cenderung naik, tapi intensitas warna kayu pada bulan ke-4 relatif sama dengan bulan ke-3.
Tabel 2. Pengaruh periode induksi pada gejala pembentukan gubal gaharu
Rataan* Perubahan warna kayu Bulan Panjang (cm) 1 2 3 4
*

Lebar (cm) 0,68a 0,71a 0,65b 0,65b

Tingkat (skor) 0,83c 1,24b 1,67a 1,65a

Wangi (skor)

Titik induksi agak wangi (%) 8,43 39,47 17,45 18,45

Titik induksi wangi (%) 0,00 0,00 0,00 6,74

2,46ab 2,58a 2,32ab 2,26b

0,32c 0,64a 0,51b 0,36c

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

B. Interaksi Inokulan 1 dan Inokulan 2
Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2 (Tabel 3). Inokulasi F sebelum inokulasi A tidak mempengaruhi pembentukan gejala gubal pada titik A termasuk pembentukan wangi. Kehadiran F justru cenderung meningkatkan respon perubahan warna kayu akibat inokulasi A. Demikian pula inokulasi A sebelum F tidak mempengaruhi pembentukan gejala gubal pada titik F, kecuali warna pada F menjadi lebih gelap dan persentase titik induksi yang wangi relatif lebih tinggi dibandingkan dengan inokulan tunggalnya. Inokulan ganda AF dan FA menghasilkan masing-masing 8,33% titik induksi pada kategori wangi. Infeksi sekunder juga tidak secara konsisten mempengaruhi infeksi primer (Tabel 4). Inokulasi F sebelum inokulasi A cenderung tidak mempengaruhi pembentukan gejala gubal termasuk tingkat

103

Aspek PRODUKSI

wangi, kecuali pada perubahan warna kayu. Intensitas warna pada titik induksi F lebih baik dibandingkan dengan perlakuan tunggalnya. Infeksi kedua oleh F juga cenderung tidak mempengaruhi gejala pembentukan gubal dan tingkat wangi. Infeksi sekunder oleh cendawan yang sama dengan cendawan tidak berpengaruh pada pembentukan gejala gubal (Tabel 5). Meskipun demikian, secara umum nilai parameter gejala gubal pada titik infeksi sekunder lebih rendah daripada pada titik infeksi primernya. Inokulan A dan F memiliki potensi yang relatif sama dalam merangsang pembentukan wangi.
Tabel 3. Pengaruh inokulan 1 terhadap inokulan 2 dalam gejala pembentukan gubal gaharu
Rataan* Perla-kuan Perubahan warna kayu Panjang (cm) FAa AAa AFf FFf GGg BBb KKk
*

Lebar (cm) 0,71bcd 0,66bcd 0,83abcd 0,75abcd 0,53d 0,65cd 0,00e

Warna (skor) 2,15ab 1,82bc 1,57cd 1,36de 1,02e 1,13e 0,00f

Wangi (skor) 0,60ab 0,63ab 0,70a 0,62ab 0,38c 0,47bc 0,00d

Titik induksi agak wangi (%) 26,37 36,11 40,27 27,78 0,00 0,00 0,00

Titik induksi wangi (%) 8,33 0,00 8,33 0,00 0,00 0,00 0,00

2,73abc 1,96bc 2,52abc 2,61abc 1,75c 2,40abc 0,00e

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 4. Pengaruh infeksi sekunder dengan cendawan yang berbeda dari cendawan penginfeksi primer
Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,68ab 3,87a Lebar (cm) 0,99ab 0,95abc Warna (skor) 1,53cd 2,22a Wangi (skor) Titik induksi agak wangi (%) 34,37 13,89 Titik induksi wangi (%) 0,00 0,00

FFF FAF

0,62ab 0,50bc

104

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,13abc 3,88a 1,98bc 3,35abc 0,00d Lebar (cm) 0,96abc 1,06a 0,56d 0,80abcd 0,00e Warna (skor) 1,98ab 1,93ab 1,01e 1,20de 0,00f Wangi (skor) Titik induksi agak wangi (%) 32,63 38,86 20,83 13,89 0,00 Titik induksi wangi (%) 2,78 4,15 0,00 0,00 0,00

AAA AFA GGG BBB KKK
*

0,63ab 0,70a 0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 5. Pengaruh infeksi sekunder cendawan yang sama dengan cendawan penginfeksi primernya
Rataan* Perlakuan Panjang (cm) 3,13abc 1,96bc 3,68ab 2,61abc Lebar (cm) 0,96abc 0,66bcd 0,99ab 0,75abcd Warna (skor) 1,98ab 1,82bc 1,53cd 1,36de Wangi (skor) 0,63ab 0,63ab 0,62ab 0,61ab Titik induksi agak wangi (%) 32,63 36,11 34,37 27,78 Titik induksi wangi (%) 2,78 0,00 0,00 0,00

AAA AAa FFF FFf
*

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

C. Pembentukan Senyawa Terpenoid
Senyawa terpenoid terdeteksi pada semua perlakuan. Pada perlakuan tunggal FF dan gandanya terbentuk warna merah, yang menunjukkan adanya senyawa triterpenoid. Warna merah pada minyak gaharu dijadikan sebagai pembanding kandungan triterpenoid perlakuan. Pada ekstrak kayu B, G, dan inokulan A terbentuk warna hijau. Warna hijau ini menunjukkan adanya senyawa sterol (Harborne, 1987). Sedangkan pada K tidak terbentuk

105

25* 0. Tabel 6.29* 0.14** 2 0 0.40* 0. Hal ini menunjukkan bahwa pemberian inokulan 2 tidak mempengaruhi besarnya nilai absorban inokulan 1.12** 0.20** 0. Begitu pula dengan nilai absorban inokulan 1 yang tidak dipengaruhi oleh inokulan 2.39* 0.813) sebagai pembandingnya.11** 0.Aspek PRODUKSI warna (bening).11* 0. nilai absorbansi ekstrak terpenoid hasil perlakuan kurang dari nilai absorbansi minyak gaharu (0. Nilai absorbasi ekstrak kayu gaharu yang berubah warna Perlakuan K G B AF A AF F FA F FA A AA FF Bulan ke1 0 0. ** Endapan berwarna merah-kecoklatan 106 . Hal ini menunjukkan bahwa inokulan ganda tidak efektif dalam meningkatkan kandungan senyawa terpenoid.15* 0.12* 0.27* 0.20** 0.14* 0.19** 0. Pada 3 bsi.21* 0. Inokulan AF maupun FA juga tidak mempengaruhi kandungan terpenoid. Secara umum.24* 0.45* 0.12** 0. Hal ini menunjukkan bahwa pada K tidak terdapat senyawa triterpenoid maupun sterol.05* 0. Hal ini menunjukkan kandungan triterpenoid yang relatif tinggi pula (Tabel 6).22* 0.06* 0.12** 0.06* 0. perlakuan tunggal FF terbentuk endapan merah dan memiliki nilai absorbansi yang relatif tinggi.20* 0.23** 0.06* 3 0 0.23* 0. secara umum nilai absorban perlakuan inokulan ganda hampir sama dengan inokulan tunggal (Tabel 6).15* * Endapan berwarna hijau.25** 4 0 0. Selain itu.34* 0. Kandungan senyawa triterpenoid pada zona perubahan warna bervariasi pada setiap perlakuan selama 4 bsi (Tabel 6).23** 0.

dkk. Penurunan kebugaran ditunjukkan oleh adanya daundaun yang mengalami klorosis pada cabang pertama dan kedua dari daerah lubang induksi dan kemudian daun-daun ini gugur.Efektivitas dan Interaksi . Secara umum inokulan tunggal mengakibatkan klorosis pada daun-daun di dua cabang dekat lubang induksi. adanya inokulan juga menjadi penyebab klorosis.... Ketersediaan hara terganggu karena jalur distribusinya ke daun terhambat akibat pengeboran. di New Zealand. Pada akhirnya. Sedangkan pada pohon yang diberi inokulan ganda klorosis terjadi pada tiga cabang dekat lubang induksi. inokulasi Acremonium sp. Efektivitas Induksi Pohon-pohon yang diberi perlakuan menurun kebugarannya mulai 1 bsi.(Gayu Rahayu. dan Fusarium sp. Menurut Braithwaite (2007) Acremonium sp. Fotosintat sebagai sumber karbon dalam pembentukan metabolit sekunder antimikrob pun terganggu.. Walker et al. Tajuk-tajuk pohon menjadi gundul. pada pohon kontrol daun-daun tidak mengalami klorosis sampai akhir pengamatan. Klorosis mungkin berhubungan dengan ketersediaan hara. Perubahan warna kayu terjadi pada semua perlakuan. Selain itu. Sebelumnya. berasosiasi dengan gejala perubahan warna kayu dan dicline pada Quercus sp. karena kemungkinan sumber karbon lebih diutamakan untuk pembentukan tunas baru. Berbeda dengan daun-daun pada pohon perlakuan. Caruso and Kuc (1977) menyatakan bahwa Colletotrichum lagenarium menyebabkan klorosis pada daun tanaman semangka dan muskmelon. Pelukaan. menyebabkan perubahan warna kayu dari putih menjadi gelap. jumlah daun yang mengalami klorosis tidak berbeda dengan 1 bsi. perkembangan gejala pembentukan gubal pun terganggu. tetapi klorosis hampir memenuhi luasan helai daun. larutan gula. Pohon semakin merana ketika diserang ulat. karena daun merupakan tempat utama berlangsungnya fotosintesis. Berkurangnya jumlah daun secara drastis dapat menghambat proses fotosintesis.) PEMBAHASAN A. (1997) juga menyatakan bahwa perubahan warna kayu menjadi warna coklat (browning) dapat disebabkan oleh serangan patogen (cendawan) 107 . Pada 2 bsi. dan Fusarium sp.

Berdasarkan persentase titik induksi yang wangi. bahwa perubahan warna dari putih menjadi coklat-kehitaman merupakan gejala awal terbentuknya senyawa gaharu. Sedangkan pada parameter lainnya. Periode inkubasi cenderung mempengaruhi semua parameter gejala gubal gaharu. Hal ini didukung oleh pernyataan Rahayu dan Situmorang (2006). Semakin lama periode induksi semakin gelap warna kayu. Pemberian larutan gula (G) menekan perkembangan gejala pembentukan gubal gaharu. Senyawa wangi merupakan senyawa yang mudah menguap sehingga kemungkinan besar tergolong senyawa seskuiterpenoid. nilai tertinggi diperoleh pada bulan ke-2 induksi. Hal ini menunjukkan bahwa metabolisme terpenoid dapat berlangsung terus dan berakhir pada produk selain seskuiterpenoid ketika dipanen.Aspek PRODUKSI dan kerusakan fisik. Hal ini membuktikan bahwa wangi merupakan respon spesifik terhadap bentuk gangguan (Rahayu et al. 2007). inokulan ganda lebih baik dari inokulan tunggal maupun cara induksi lainnya.. 2007). Pada penelitian ini senyawa triterpenoid dan sterol juga terdeteksi. intensitas warna kayu lebih rendah dibandingkan 108 .. Namun. Aroma wangi merupakan bagian dari senyawa gaharu (Rahayu et al. Hal ini disebabkan karena gula tersebut segera dipergunakan pohon untuk proses penyembuhan daripada dimanfaatkan oleh cendawan. Aroma wangi mulai terdeteksi pada bulan ke-2 dan menurun pada bulan berikutnya. perubahan warna kayu menjadi coklat muncul setelah sel-sel kehilangan pati akibat pelukaan. Namun demikian metabolisme isopentenil pirofosfat sebagai pekursor pembentukan terpenoid (McGarvey and Croteau. Menurut Nobuchi and Siripatanadilok (1991). Aroma wangi dan frekuensi wangi pada pemberian inokulan ganda AF relatif lebih tinggi dibandingkan dengan perlakuan lainnya. 1995) mungkin tidak berhenti pada produk seskuiterpenoid tetapi dapat masuk dalam jalur metabolisme selanjutnya. Kemungkinan besar fenomena ini berhubungan dengan kebugaran pohon yang menurun mulai bulan ke-2. Perubahan warna kayu pada gaharu mungkin dapat mengindikasi adanya senyawa gaharu.

. Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2. Pada penelitian ini triterpenoid mulai terdeteksi pada 1 bsi. crassna terbukti dapat merangsang pembentukan senyawa terpenoid. Heterobasidion juga menyebabkan busuk batang tetapi C. Heterobasidion mungkin merangsang pohon membentuk senyawa fitoaleksin yang bersifat anti C. polonica terbentuk SAR setelah 3 minggu infeksi H. (1999) menyatakan bahwa pada Norway spruce (P.. polonica. Hal ini berbeda dari hasil penelitian Krokene et al. (1997) menyatakan bahwa serangan cendawan pada pohon Pinus akan merangsang pohon untuk membentuk senyawa terpenoid sebagai pertahanan pohon. Selain itu penelitian sebelumnya. (1999) yang membuktikan bahwa inokulasi Heterobasidion annosum yang diikuti oleh Ceratocystis polonica menekan pembentukan gejala bluestain pada pohon Norway spruce (Picea abies).(Gayu Rahayu.. Acremonium dan Fusarium dikenal sebagai penyebab busuk batang atau kanker batang pada pohon berkayu. dkk. Putri (2007) juga menyatakan bahwa pemberian Acremonium sp. Pembentukan Senyawa Gaharu Acremonium sp.) dengan pemberian inokulan ganda FA. dan inokulan tunggal AA terbentuk warna hijau. G. Paine et al. dalam bentuk inokulan tunggal atau inokulan ganda dapat merangsang pohon gaharu membentuk senyawa terpenoid. abies) terhadap C. annosum.. B. Sedangkan pada perlakuan B. polonica adalah penyebab bluestain saja dan tidak menyebabkan busuk batang. Hal ini menunjukkan bahwa aroma wangi yang dihasilkan tidak selalu sebanding dengan intensitas warna kayu. Triterpenoid terdeteksi pada pemberian inokulan tunggal FF dan inokulan ganda yang ditunjukkan dengan terbentuknya endapan berwarna merah pada pengujian Lieberman-Burchard. Kemungkinan besar hal ini disebabkan aktivitas patologis yang berbeda. Krokene et al. dan Fusarium sp. (1999) bahwa terjadinya pembentukan wangi gaharu tidak selalu diikuti oleh perubahan warna kayu. 109 . Kemungkinan lain adalah periode inokulasi antara inokulan 1 dan inokulan 2 yang hanya berselang 1 minggu. pada A. Sesuai dengan pernyataan Rahayu et al.Efektivitas dan Interaksi .

Inokulan ganda terutama AF lebih efektif daripada inokulan tunggal dalam merangsang pembentukan wangi. Beever.A. 2007. 90(1): 45-56. P. DAFTAR PUSTAKA Benhamou. Bandung Terjemahan dari: Phytochem Methods.B. Ramsfield. Institut Teknologi Bandung. L.R. J. V. Solheim..L. kecuali inokulan tunggal A merangsang pohon membentuk triterpenoid. N. N. 1987. Soc. Dehbi.A. 67: 1285-1289. Gagné. 121: 565-569. Berryman. S. Induksi dengan inokulan 1 yang hanya berselang 1 minggu dari pemberian inokulan 2 tidak membangkitkan resistensi pohon terhadap inokulan 2. C.D. Phytopathol. Christiansen. BacterialMediated Induced Resistance in Cucumber: Beneficial Effect of the Endophytic Bacterium Serratia plymuthica on the Protection Against Infection by Pythium ultimum. 1977.. E. Quéré.. M. Waipara. D. Pay and C. 2000. M.. New Zealand Plant Protection 60:297-303 Caruso. Kuc. Phytopathol. F. Hill.M. Metode Fitokimia.Aspek PRODUKSI Warna hijau ini mengindikasikan yang terbentuk adalah senyawa sterol. Amer. A. SIMPULAN Semua pohon yag diinokulasi menurun kebugarannya sejak 1 bulan setelah inokulasi. J. Investigation of Oak Tree Decline In Theauckland Region.F. Inglis. Plant Physiol. H. 110 . Protection of Watermelon and Muskmelon Against Colletotrichum lagenarium by Colletotrichum lagenarium. Franceschi. Semua inokulan. Braithwaite. Dick.E. Krokene.L. T. 1999. Induced Resistance to Phatogenic Fungi in Norway Spruce. R. Harborne (1987) menyatakan bahwa sterol merupakan salah satu senyawa yang tergolong ke dalam senyawa terpenoid. Padmawinata K dan I Sudiro (penerjemah). Harbone. J.W.

Increasing Fragrance and Terpenoid Production in Aquilaria crassna by Multi-Application of MethylJasmonate Comparing to Single Induction of Acremonium sp.Efektivitas dan Interaksi .. M. 42:179-206. McGarvey. Makalah Diskusi Hasil Penelitian dalam Menunjang Pemanfaatan Hutan yang Lestari. Nobuchi. S.. Sticher. T. 11-12 Maret 1996. Hlm 1-3. Purwokerto. Perhimpunan Fitopatologi Indonesia.D.. Pembentukan Gaharu dengan Cara Inokulasi.) Liu. Preliminary Observation of Aquilaria crassna Wood Associated with the Formation of Aloeswood. L. Plant Cell 7:1015-1026.. 1991. Potensi Hifomiset dalam Menginduksi Pembentukan Gubal Gaharu. 22-24 August 2007.W. Rahayu.F. and F. Putri dan Juliarni. 11-12 November 2008. Institute de Biologie Végétale. Acremonium and MethylJasmonate Induce Terpenoid Formation in Agarwood Tree (Aquilaria crassna).P. T. Kloepper. Paine. Bull. Siripatanadilok. Pusat Litbang Hutan dan Konservasi Alam.C. Rahayu. Santoso. 2007.J. K. hlm 573-581. Entomol. Jakarta. Raffa. 1995. Terpenoid Metabolism. J. Interactions Among Scolytid Bark Beetles. T. S. Harrington.I. 1997.. 1700 Fribourg.. Université de Fribourg. 1997. G. Switzerland. Isnaini. Purwokerto. Kyoto Univ. G. A. Phytopathol. Mauch-Mani. 1995. Systemic Acquired Resistance. Umboh. 2008. 16-18 September 1999. their Associated Fungi. 85:1064-1068.(Gayu Rahayu.L. Yogyakarta. Annu. Y.. Rev. G.. Forest 63:226-235.J. 1996. B. dkk. 3 route A Gockel. Induction of Systemic Resistance in Cucumber by Plant Growth-Promoting Rhizobacteria: Duration of Protection and Effect of Host Resistance on Protection and Root Colonization. and Host Conifers. E. Bogor. Métraux. Tuzun. Rahayu. J. Makalah dipresentasikan dalam 3rd Asian Conference on Crop Protection.. Makalah dipresentasikan dalam International Conference on Microbiology and Biotechnology.. D. Croteau. 111 . 1999. L. Prosiding Kongres Nasional XV dan Seminar Perhimpunan Fitopatologi Indonesia.

112 .

Aspek SILVIKULTUR 113 .

114 .

Namun gaharu alam dapat mencapai kualitas tertinggi (kelas super) yang harganya bisa mencapai Rp 30 juta/kg. (Santoso et al.. Daijo and Oller. khususnya jamur Fusarium sp. eksploitasi gaharu alam dilakukan tanpa mengindahkan kelestariannya.. sehingga jenis ini dimasukkan dalam Appendix II CITES (Santoso et al. kurang dari 5% gaharu terbentuk dari populasi pohon dan bila terbentuk biasanya kurang dari 10% biomas kayu pada pohon yang terinfeksi... Akibatnya populasi jenis-jenis gaharu menyusut tajam.. Phialophora sp. dan Popullaria sp. 2001. Konsekuensinya. Erdy Santoso. Karena potensi harga yang sangat tinggi. 2007. bukan dari alam. 1987). Parman et al. Di alam. Sidiyasa dan Suharti.. Budidaya gaharu memerlukan input iptek agar pertumbuhan dan produksi resin gaharu dapat optimal. Trichoderma sp. Dukungan iptek dimaksud 115 . Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Pengembangan tanaman gaharu umumnya tidak bertujuan untuk menghasilkan kayu. 2007). melainkan ditujukan untuk menghasilkan resin gaharu yang terbentuk dari respon tanaman atas infeksi mikroba. 1996.5 UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto. Cylindrocarpon sp. Pythium sp. dalam perdagangan resmi.. gaharu harus dihasilkan dari pohon hasil budidaya..

dan 3 hari penyimpanan) serta kondisi penyapihan (dalam sungkup dan tanpa sungkup).Aspek SILVIKULTUR berkaitan dengan aspek pembibitan dan penyuntikan stimulan gaharu. 6. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. Bibit cabutan yang digunakan dalam uji waktu simpan cabutan adalah campuran Aquilaria microcarpa dan A. Pembahasan makalah ini difokuskan pada aspek pembibitan atau perbanyakan bibit pohon penghasil gaharu.5oC). 1980). dan 8 minggu) dan temperatur penyimpanan (25. Biji pohon penghasil gaharu tergolong rekalsitran (Hou. Perlakuan pada uji penyimpanan benih adalah waktu (0. Penerapan perbanyakan vegetatif dan pemuliaan pohon berpotensi untuk menghasilkan bibit klon gaharu yang memiliki keunggulan. Benih pohon penghasil gaharu yang digunakan pada uji penyimpanan dan daya kecambah benih adalah campuran Aquilaria microcarpa dan A. baik secara generatif maupun vegetatif. Biji rekalsitran umumnya cepat berkecambah dan tidak dapat disimpan dalam jangka panjang (Roberts and King. Perbanyakan bibit pohon penghasil gaharu dapat dilakukan. 4. 116 .4-26.1oC dan 4. 2. Perlakuan pada uji waktu simpan bibit cabutan adalah tiga waktu simpan (1.9-6. Makalah ini menyajikan hasil penelitian berkaitan dengan aspek perbenihan dan perbanyakan stek gaharu. malacensis. 2. Perbanyakan Generatif Pengujian pada perbanyakan generatif dilakukan pada benih (biji) dan cabutan (anakan alam). baik pertumbuhan maupun produktivitas resin gaharunya. 1960). Proyek ITTO PD 425/06 berupaya untuk mengembangkan dan menerapkan iptek pada penanaman pohon penghasil gaharu agar pertumbuhan dan produktivitas resin gaharunya tinggi. malacensis asal Sukabumi. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. Namun informasi iptek mengenai teknik perbenihan dan teknik perbanyakan vegetatif gaharu masih sangat terbatas. METODE A.

. Uji produksi bibit stek gaharu dilakukan dalam tiga tahap. HASIL DAN PEMBAHASAN A. periode penyimpenyimpanan biji panan mempengaruhi persen Periode Kondisi Refrigerator kecam-bah benih (P Anova = < simpan ruang (%) (%) 0. 2007.0001). Penelitian dilakukan pada rumah kaca yang menggunakan sistem pendingin kabut KOFFCO system (Sakai dan Subiakto. yaitu media campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 2:1. media tabur dapat menggunakan arang sekam Langsung 2 minggu 4 minggu 6 minggu 8 minggu 82 69 77 56 48 69 69 61 24 117 . Pada pengujian ketiga. Perbanyakan Vegetatif Teknik perbanyakan vegetatif yang digunakan pada penelitian ini adalah teknik stek pucuk. sehingga harus secepatnya dikecambahkan.) B. Subiakto dan Sakai.(Atok Subiakto. dkk.Uji Produksi Bibit . Uji penyimpanan benih dilakukan untuk mengetahui seberapa lama benih gaharu dapat disimpan. media menggunakan campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 1:1 dan intensitas penyiraman 1 kali pada bulan pertama. Bahan stek yang digunakan pada pengujian ini adalah A. Perlakuan pada pengujian pertama menggunakan prosedur rutin. Pada pengujian kedua perlakuan intensitas penyiraman dikurangi menjadi sekali seminggu dengan media arang sekam. Hasil uji pengecambahan biji dari dua kondisi penyimpanan disajikan pada Tabel 1 dan Tabel 2.. malacensis.0993). Penyiraman 2 kali seminggu.. Persen kecambah dari hasil uji lain pihak. Kondisi penyimpanan (kondisi ruang dan dalam re-frigerator) tidak secara nyata mempengaruhi perkecambahan benih (P Anova = 0. Secara teknis pengecambahan biji gaharu mudah dilakukan. Perbanyakan Generatif Biji gaharu tergolong rekalsitran. dan 3 kali pada bulan ketiga. 2 kali pada bulan kedua.. Di Tabel 1. 2007).

Persen jadi bibit (6 minggu setelah penaburan) dari hasil uji dimulai pada minggu kedua penyim-panan biji dan persen jadi bibit dihitung pada minggu keenam setelah Periode Kondisi Refrigerator penaburan.0001). kotiledonnya telah luruh. Pada jenis-jenis biji rekalsitran seperti meranti. Pada Tabel 2 simpan ruang (%) (%) tampak ada penurunan antara Langsung 74 persen berkecambah dan 2 minggu 50 54 persen jadi bibit. Penurun. Oleh sebab itu untuk mendapatkan persen jadi bibit yang tinggi. 118 . Umumnya bibit cabutan yang masih memiliki kotiledon dapat langsung ditanam dalam kantong plastik tanpa penyungkupan. Perkecambahan umumnya Tabel 2. Pasimpan sungkup (%) sungkup (%) (hari) da pengujian penanaman 0 80 40 cabutan digunakan bibit 1 76 46 gaharu berukuran tinggi 2 87 24 7 cm. Pada jenis gaharu penyimpanan pada kondisi ruang selama 2 bulan masih dapat menghasilkan kecambah dengan tingkat keberhasilan 48%. Penggunaan sungkup meningkatkan secara nyata persen tumbuh bibit cabutan (P Anova = < 0. Perbanyakan generatif Tabel 3. penaburan biji dilakukan segera setelah buah yang masak dan jatuh. Persen tumbuh bibit cabutan dari uji penyimpanan dan dapat pula dilakukan dengan kondisi tanam bibit menggunakan bibit yang diperoleh dari cabutan di Periode Dalam Tanpa bawah pohon induknya.Aspek SILVIKULTUR atau zeolit. Hasil uji penanaman 3 76 38 cabutan disajikan pada Tabel 3. Dalam pengujian ini media kecambah yang digunakan adalah arang sekam padi.4 minggu 64 58 annya cenderung lebih besar 6 minggu 37 48 bila bibit disimpan dalam 8 minggu 29 9 jangka waktu yang lebih lama. pengecambahan harus dilakukan segera setelah pengunduhan buah.

namun persen berakar masih di bawah 70%. penyungkupan harus rapat agar kelembaban dalam sungkup dapat dijaga pada level di atas 95%. pasir. Teknologi ini mengatur kondisi lingkungan. Perlakuannya adalah jenis dan wadah tanam (tabur) stek.. penyiraman dikurangi menjadi satu kali seminggu.) Namun bila kotiledon telah luruh. Zeolit merupakan media dengan porositas yang baik dan tidak ditumbuhi oleh cendawan 119 . Demikian pula perlakuan wadah tanam tidak menunjukkan perbedaan nyata (P Anova = 0. 2002). kelembaban. Subiakto dan Sakai.. Perbanyakan Vegetatif Uji produksi stek gaharu dilakukan dengan menggunakan teknologi KOFFCO system yang dikembangkan oleh Badan Litbang Kehutanan dan Komatsu (Sakai dan Subiakto. B.. Media terbaik adalah zeolit. Sungkup dapat dibuat dari plastik PVC transparan. temperatur. 2007). maka dilakukan pengujian lebih lanjut. Hasil pengujian menunjukkan media berpengaruh secara nyata (P Anova = 0.. 2007. maka penanaman bibit cabutan harus melalui tahap penyungkupan.6600) dalam persen jadi stek.Uji Produksi Bibit . dan zeolit). Hasil pengujian ini membuktikan bahwa kelembaban tinggi di dalam sungkup mempengaruhi keberhasilan penanaman bibit cabutan. dkk. Mengingat persen jadi stek masih di bawah 70%. adapun perlakuan yang diuji adalah tiga jenis media (arang sekam padi. dan media pada tingkat optimal bagi pertumbuhan (Sakai et al. Pada pengujian tahap kedua.0083) terhadap persen jadi stek.. Ratarata persen jadi stek pada uji tahap pertama berkisar antara 4047%. 2007).8276) dalam persen jadi stek. Uji produksi stek dilakukan dalam tiga tahap penelitian. Penyimpanan bibit cabutan selama tiga hari masih memberikan hasil yang cukup baik (76%) bila penanamannya menggunakan sungkup. yaitu cahaya. Pembuatan stek dinilai dapat diusahakan secara ekonomis bila persen jadi mencapai 70% (Subiakto dan Sakai. Perlakuan jenis tidak menunjukkan perbedaan nyata (P Anova = 0. Pada tahap pertama digunakan prosedur baku pembuatan stek.(Atok Subiakto. Hasil uji produksi stek gaharu disajikan pada Tabel 4.

crassna dan A. Tabel 4. siram 3 kali seminggu. microcarpa Campuran A. siram 2 kali seminggu Media cocopeat : sekam = 1:1. Efek dari penyiraman adalah menyebabkan jenuhnya media dan meningkatkan pertumbuhan cendawan. microcarpa Campuran A. siram 1 kali seminggu Media pasir. microcarpa Perlakuan Tanpa pot-tray. Penyiraman terbaik adalah dua kali seminggu dengan persen berakar 69%.Aspek SILVIKULTUR ataupun alga. dan 3 kali seminggu). media coco-peat : sekam = 2:1 Media sekam bakar.0210). Persen berakar stek dari rangkaian uji produksi stek Tahapan riset 1 1 1 1 2 2 2 3 3 3 Spesies A. termasuk cendawan pembusuk. media coco-peat : sekam = 2:1 Dengan pot-tray. crassna dan A. penyiraman berpengaruh secara nyata terhadap persen berakar stek (P Anova = 0. microcarpa A. media coco-peat : sekam = 2:1 Tanpa pot-tray. 2 kali seminggu. microcarpa Campuran A. Perlakuan yang diuji adalah tingkat penyiraman (1 kali seminggu. Hasil pengujian menunjukkan bahwa pada tingkat kepercayaan 5%. siram 1 kali seminggu Media cocopeat : sekam = 1:1. siram 1 kali seminggu Media cocopeat : sekam = 1:1. microcarpa Campuran A. crassna dan A. microcarpa Campuran A. maka perlu dicoba media lain yang memiliki tingkat porositas relatif sama dengan zeolit. crassna dan A. media coco-peat : sekam = 2:1 Dengan pot-tray. siram 3 kali seminggu. Karena zeolit adalah media yang berat dan relatif lebih mahal. Pada pengujian ketiga digunakan media campuran cocopeat dan sekam padi yang telah disteril. siram 3 kali seminggu. siram 3 kali seminggu Persen berakar (%) 40 42 44 47 17 31 55 53 69 49 120 . crassna A. crassna A. microcarpa Campuran A. siram 1 kali seminggu Media zeolit. siram 3 kali seminggu. crassna dan A. crassna dan A.

2002. and A. Htn & KA. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil Gaharu Aquilaria microcarpa.. Vol. ed). Mataram.(Atok Subiakto. IV-5 : 499-509. Turjaman. Pedoman Pembuatan Stek Jenisjenis Dipterokarpa dengan KOFFCO System. Kamata. Santoso. Subiakto. Bogor. W. 121 . dan N. DAFTAR PUSTAKA Daijo. benih masih dapat disimpan selama dua bulan.J. 1996. Scent of Earth.. J. Walter-Noodhoff. Gunawan. Oller. Makalah Temu Pakar Gaharu di Kanwil Dephut Propinsi NTB. 1960... A. p. A. Penyiraman terbaik dilakukan dua kali dalam seminggu. 2007. 2007. V. A. dan Y. Thymelaceae.G. 2. J.yahoo. Media terbaik untuk penyetekan gaharu adalah campuran antara serbuk kulit kelapa (cocopeat) dan sekam padi dengan perbandingan 1:1. 1-15..html (diakses : 5 Febuari 2001).. C. cukup disimpan pada suhu ruangan. Studi Etiologi Gubal Gaharu Pada Tanaman Ketimunan. Series I. Groningen. Benih gaharu tidak perlu disimpan dalam refrigerator. Res.G. D. JICA. Persen kecambah terbaik diperoleh dari benih yang langsung dikecambahkan setelah pengunduhan. Nuroniah. H. 2001.Uji Produksi Bibit . S. In : Flora Malesiana (Van Steenis. Sakai. Mulyaningsih. Penanaman bibit cabutan menggunakan sungkup menghasilkan persen tumbuh lebih baik dibandingkan bila tidak menggunakan sungkup. 7:73-80. 6. Parman. E. C. Hou.. Sakai. com/scent-of-earth/alag. Pen. dan D. C. Pembuatan stek gaharu tersebut dilaksanakan pada rumah kaca dengan KOFFCO system. Subiakto. dkk. dan M. Rahman.) KESIMPULAN 1. For. Komatsu. Badan Litbang Kehutanan.. Namun dengan mengantisipasi penurunan daya kecambah. The Netherland. URL:http://store. T. Mass Propagation Method from The Cutting of Three Dipterocarps Species.

dan M. H. In : Recalcitran Crop Seeds (Chin. K. Manajemen Persemaian KOFFCO System... A. Badan Litbang Kehutanan. King. and M. 1-5. Komatsu. Turjaman. Kuala Lumpur. 2006. Bogor. 122 . JICA. and Roberts. H. F. dan C. Tropical Press SDN. W. 1987. Malaysia. eds). Bogor. Santoso. Jenis-Jenis Tumbuhan Penghasil Gaharu. and E. E. Cisarua. The Characteristic of Recalcitrant Seeds. Roberts. M. Sakai. E. Suharti. Tamai. Makalah Utama Diskusi Pemanfaatan Kayu Kurang Dikenal.. Mycorrhiza 16 : 459-464. Y. Arbuscular Mycorrhizal Fungi Increased Early Growth of Two Timber Forest Product Species Dyera polyphylla and Aquilaria filaria Under Greenhouse Conditions. 1980. BHD. Subiakto.Aspek SILVIKULTUR Sidiyasa. 2007. H.

Pohon penghasil gaharu yang ditemukan dengan ciri-ciri adanya lubang kecil yang disebut lubang semut. budaya. dan minyak esensial untuk kegiatan keagaman. ditebang dan dipanen gaharunya. perburuan gaharu dilakukan secara agresif dan tidak bijaksana. Cara perburuan ini mengancam kelestarian gaharu di habitat alaminya.6 APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp. Sitepu Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Yasuyuki Hashidoko Lab. of Ecological Chemistry. Aquilaria 123 . Graduate School of Agriculture. sejak November 1994. Di alam. sehingga untuk mencegah punahnya pohon penghasil gaharu. bahkan kegiatan sehari-hari. bahan aditif minyak wangi. Division of Applied Bioscience. Hokkaido University Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu (dalam Bahasa Inggris dikenal dengan agarwood atau eaglewood) adalah kayu resin yang bernilai komersial tinggi karena digunakan sebagai dupa. DI PERSEMAIAN Irnayuli R.

49 (2004) mencatat ada 24 spesies yang termasuk genus Aquilaria dan tujuh spesies termasuk ke dalam genus Gyrinops. Vietnam. 2004). Gonystylus. Keberadaan gaharu semakin menipis di alam. Myanmar.. Gaharu terjadi melalui proses patogenisitas di mana jenis patogen fungi tertentu menginfeksi jenis pohon tertentu dan sebagai respon terhadap serangan patogen. Kedua genus ini ditemukan tumbuh alami di paling tidak 12 negara. Kegiatan budidaya pohon penghasil gaharu tidak terlepas dari penyediaan bibit yang berkualitas tinggi. Budidaya merupakan kunci utama dalam meningkatkan produksi gaharu yang semakin menipis. termasuk Bangladesh. Lain halnya dengan komoditas pertanian yang langsung ditanam di lapangan. Appendix II TRAFFIC-CITES-CoP13 Prop. Gaharu hasil budidaya diharapkan akan dapat memenuhi kebutuhan pasokan gaharu untuk ekspor ke negara-negara pemakai. perlu upaya budidaya pohon penghasil gaharu. Agar ketersediaan produk gaharu dan pohon penghasil gaharu tidak punah dan untuk menjaga kesinambungan produksi gaharu yang lestari. Istilah RPPT digunakan untuk bakteri yang dapat membantu pertumbuhan tanaman melalui 124 . produk unik ini juga dapat terjadi pada beberapa genus tanaman lainnya. pohon menghasilkan metabolit sekunder atau senyawa resin yang menyebabkan bau wangi ketika dibakar. dua genus pohon penghasil gaharu terpenting yang termasuk ke dalam famili Thymelaeaceae (Ordo: Myrtales dan Kelas: Magnoliopsida) telah masuk ke dalam daftar CITES (the Convention on the International Trade in Endangered Species of Wild Flora and Fauna). dan Papua New Guinea (Barden et al. penggunaan biji yang bermutu baik dan inokulasi mikroba yang dapat memacu pertumbuhan. Kamboja. Enkleia. Phaleria. Lao PRD. Selain ditemukan pada kedua genus di atas. Indonesia. dalam Gunn et al.Aspek SILVIKULTUR dan Gyrinops. Upaya peningkatan mutu bibit di persemaian dapat dilakukan dengan pemupukan. Filipina. persiapan bibit kehutanan dilakukan mulai di persemaian. Butan. yaitu Aetoxylon. Malaysia. Thailand. seperti bakteri penghuni perakaran yang disebut rhizobakteri pemacu pertumbuhan tanaman (RPPT atau plant growth promoting rhizobacteria). Wikstroemia.

yaitu asam indol asetat (AIA/auksin). membantu proses terbentuknya mikoriza. penambatan nitrogen. Namun. Azospirillum sp.(Irna R. sequestration besi oleh siderofor. Kokalis-Burelle et al. baik secara langsung maupun tidak langsung (Glick. misalnya dapat memproduksi tiga jenis fitohormon.. Sedangkan Azospirillum chroococcum diketahui dapat memproduksi AIA. 1995. 2004). 2006). maka dilakukan penelitian uji aplikasi bakteri penghasil AIA/auksin dalam memacu pertumbuhan bibit penghasil gaharu Aquilaria sp. dkk) mekanisme yang beragam. Narula et al. dan sitokinin (berbagai sumber dalam Narula et al. sampai saat ini informasi penelitian tentang pemanfaatan bakteri fitohormon untuk tanaman kehutanan di daerah tropis masih terbatas. (2005) melaporkan bahwa Azospirilum brazilance meningkatkan jumlah dan panjang akar lateral.. dan kinetin. AG. 2006). Glick. 2006).. 1995. solubilisasi atau mineralisasi fosfat. Di antara mekanisme ini. Sitepu.. (2006) mengatakan bahwa dalam studi pemanfaatan bakteri penambat nitrogen untuk meningkatkan produksi tanaman. yang dikenal sebagai bakteri penambat nitrogen. giberelin (AG).. Sedangkan Pseudomonas putida GR12-2 pada bibit canola meningkatkan panjang akar sampai tiga kali lipat. di persemaian. bakteri terlebih dahulu diseleksi secara in vitro untuk 125 . 1994. Lucy et al. Mekanisme ini meliputi produksi fitohormon. Barbieri et al. Untuk menguji hipotesa ini. dan pencegahan terjadinya serangan patogen tular tanah (Garbaye. (1986) dalam Ahmad et al. Dikatakan bahwa bakteri penghasil hormon pertumbuhan diduga memegang peranan penting dalam memacu pertumbuhan tanaman. sehingga respon peningkatan pertumbuhan tanaman disebabkan oleh mekanisme lain dan bukan nitrogen... dan diduga adalah produksi fitohormon oleh bakteri penambat nitrogen tersebut. Mikroorganisme yang menghuni rhizosfir berbagai macam tanaman umumnya memproduksi auksin sebagai metabolit sekunder sebagai respon terhadap suplai eksudat akar yang berlimpah di zona perakaran. kandungan nitrogen pada tanaman yang diinokulasi tidak meningkat secara myata. Dalam penelitian ini. fitohormon mendapatkan perhatian penelitian karena aplikasi bakteri penghasil fitohormon dilaporkan meningkatkan produksi tanaman inang secara berkesinambungan (Narula et al.Aplikasi Rhizobakteri Penghasil ..

926F (5 AAACTCAAAGGAATTGACGG 3). Katakterisasi kualitatif menggunakan metode colorimetric Brick et al. 518R (5 GTATTACCGCGGCTGCTGG 3). Setelah inkubasi selama 3 hari. 126 . USA) dengan empat pilihan primer. membran dipindahkan dan ditumpuk pada kertas saring berdiameter 55 mm No. Karakterisasi in vitro dan Persiapan Inokulum Rhizobakteri diisolasi dari rhizosfir dan rhizoplan bibit atau sapling menggunakan media campuran mineral Winogradsky’s bebas N dengan pH 5. 2002). Rhizobakteri ini kemudian diidentifikasi secara molekuler mengikuti metode Weisburg et al. media ditumpuk dengan membran nitrocellulose berukuran pori 0. Bakteri Penghasil Fitohormon: Identifikasi. Segera setelah agar diinokulasi rhizobakteri. dan diinkubasi dalam gelap pada suhu 28°C. dan/atau 1080RM (5 ACGAGCTGACGACA 3)... Foste City. 1112F (5 GTCCCGCAACGAGCGCAAC 3).1 cycle (Applied Biosystems. (1991). Toyo Roshi Kaisha Ltd. (1991) yang dimodifikasi sebagai berikut: Rhizobakteri ditumbuhkan dalam media agar Winogradsky’s yang dimodifikasi (AWM) yang diberi 100 mg/L L-tryptophan (C 11H 12N 2O 2). 3.6-6.45mm. Seleksi awal rhizobakteri secara in vitro dilakukan untuk mengetahui kemampuannya dalam memproduksi fitohormon (asam indol asetat-AIA) melalui karakterisasi kualitatif dan kuantitatif.3% gellan gum sebagai bahan pemadat (Hashidoko et al. yaitu: 1. BAHAN DAN METODE A. 2 (Advantec. Homologi sekuens ditelusuri dengan menggunakan BLASTN online DNA database in National Center for Bio-technology Information (NCBI). 4. Analisa sekuens DNA menggunakan BigDye Terminator v3. 2.Aspek SILVIKULTUR mengetahui kapasitasnya sebagai bakteri penghasil fitohormon AIA/auksin. diameter 47 mm.2 yang mengandung 1% sukrosa sebagai sumber karbon dan 0.

diketahui berasosiasi dengan fungi mikoriza arbuskula. untuk mengetahui kemampuan bakteri dalam membantu terbentuknya asosiasi mikoriza pada bibit Aquilaria sp. kemudian dikelompokkan menjadi merah muda. CK8 karena Aquilaria sp. Strain rhizobakteri yang bereaksi positif dengan larutan Salkowski kemudian diuji untuk mengetahui kemampuannya dalam memacu pertumbuhan akar Vigna radiata sebagai tanaman uji. Setelah 0. Sitepu. Namun demikian. Rhizobakteri dikulturkan pada media MW cair yang ditambah dengan 100mg/L L-tryptophan dan diinkubasikan pada suhu 28°C dalam kondisi statis di dalam gelap selama 7 hari. pembentukan warna dibaca pada A665nm. digunakan juga satu isolat bakteri pemacu asosiasi mikoriza.. Rhizobakteri yang mampu memproduksi AIA akan membentuk cincin halo warna merah di sekitar koloni.Aplikasi Rhizobakteri Penghasil . Selain itu. Tidak adanya korelasi yang spesifik ini mengindikasikan bahwa kepekatan warna merah bukan merupakan indikasi tingginya kuantitas IAA yang dihasilkan.5 jam. uji lanjutan pada V. melainkan diduga merupakan indikasi perbedaan/variasi derifat dari senyawa indol yang dikonversi dari L-triptophan. Kemudian larutan Salkowski ditambahkan pada supernatant kultur rhizobakteri. Glickmann dan Dessaux (1995) menyatakan bahwa larutan Salkowsky memberikan respon positif tidak hanya terhadap auksin (IAA) melainkan juga terhadap asam indolpirufat dan indoleacetamide. dan merah tua. Dari ketiga uji pendahuluan untuk mendapatkan bakteri penghasil AIA. yaitu Chromobacterium sp. Intensitas warna yang terbentuk..(Irna R. 127 . maka dipilih sembilan bakteri (Tabel 1).. radiata tidak menunjukkan adanya korelasi yang positif antara intensitas kepekatan warna merah dengan laju pertumbuhan tanaman (tinggi dan total panjang akar).. dkk) Tokyo. Rhizobakteri yang membentuk cincin halo berwarna merah muda sampai merah pekat digunakan untuk uji kuantitatif AIA. Perubahan warna diamati setelah 30 menit kemudian. merah. Japan) yang telah direndam sebelumnya dalam larutan Salkowski. Sedangkan karakterisasi AIA secara kuantitatif dilakukan mengikuti metode Narula (2004).

Rizoplan Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Hopea sp. CK34 Bacillus sp. CK26 Sub kelas Proteobacteria Bacilli Proteobacteria Hasil analisa colorimetric AIA Merah Inang Substrat Sta-dium Asal lokasi Dipterocarpus sp. diameter. CK8 (DQ195926) Proteobacteria * Catatan: S: Shorea. CK28 bacteria (DQ195889) Burkholderia Proteosp. 1 ml larutan bakteri juga disebarkan di daerah perakaran. Pengamatan dilakukan terhadap tinggi. * isolat mycorrhization helper bacteria. teysmanniana Rizoplan Rizoplan Rizoplan Merah muda Merah muda Merah muda pupus Merah muda pupus Merah muda pupus Merah tua Merah tua Merah muda Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Burkholderia Proteosp.Aspek SILVIKULTUR B. setelah itu kultur bakteri agak dikentalkan dengan menambahkan 0. parviflora Rizoplan Rizoplan Sapling ~1 bln Sapling ~1. Inokulasi dilakukan pada bibit yang berumur 4 minggu dengan cara merendam bibit dalam larutan bakteri selama 30 menit.5 th NI CK 61 Chromobacterium sp. Rizoplan S. Tabel 1. Pada saat penanaman. Informasi bakteri PGPR penghasil fitohormon yang digunakan sebagai inokulum Strain bakteri Stenotrophomonas sp. CK59 bacteria (DQ195914) Dipterocarpus sp. UP: Universitas Palangkaraya. Inokulasi Bakteri Fitohormon pada Bibit Aquilaria sp. S.5% gellan gum selama 30 menit. CK67 NI CK53 NI CK54 Proteobacteria S. teysmanniana Rizoplan Sapling ~1th Bibit~ 6 bln Nyaru Menteng Nyaru Menteng Pembi-bitan UP Nyaru Menteng Serratia sp. dan bobot kering biomassa. H: Hopea. AIA: asam indol asetat 128 . CK41 Azospirillum sp. teysmanniana S. NI: bakteri yang belum teridentifikasi. kemudian ditanam dalam polybag yang berisi 500 g media tanah yang tidak steril. balangeran S. Sel bakteri yang ditumbuhkan pada media cair MW + 100 mg/L L-tryptophan diinkubasi dengan menggoyang selama 3 hari pada suhu 28ºC. Bibit ditumbuhkan di rumah kaca dan disiram setiap hari dengan air keran.

yaitu 10 isolat bakteri. Analisa persentase peningkatan pertumbuhan dilakukan sebagai berikut: %Peningkatan = Bibit yang diinokulasi bibit kontrol Bibit kontrol x 100% 129 . berat kering total. USA). Data dianalisa secara statistik dengan analisa sidik ragam menggunakan program SPSS®version 10... Chicago. Rancangan Percobaan dan Analisa Data Penelitian menggunakan rancangan acak lengkap dengan faktor tunggal. Data yang berbeda nyata diuji lanjut dengan Least Significant Difference untuk mengelompokkan perlakuan yang tidak berbeda nyata. (b): Pembentukan warna pada media cair. Parameter yang diukur untuk mengetahui respon bibit terhadap inokulasi. yang masing-masing diulang sebanyak 10 bibit per perlakuan. dkk) a b Gambar 1. Bakteri NICK53 yang membentuk warna merah tua dibanding dengan kontrol media tanpa bakteri C. Warna merah yang terbentuk di sekitar koloni setelah direaksikan dengan reagen Salkowski (a): Pembentukan warna pada membrane nitroselulose 3 hari setelah inkubasi. diameter.Aplikasi Rhizobakteri Penghasil . indeks mutu bibit.(Irna R.0 (SPSS Inc.. dan persentase peningkatan pertumbuhan.. Sitepu.. yaitu tinggi.

netral atau negatif terhadap pertumbuhan tanaman jika dibandingkan dengan tanaman yang tidak diinokulasi (kontrol negatif ). bibit yang tumbuh di lantai hutan perlu memiliki kemampuan untuk segera tumbuh tinggi bersaing dengan bibit di sekitarnya untuk mendapatkan cahaya agar dapat tumbuh baik. (2007) bahwa respon diameter bibit Shorea selanica terhadap inokulasi RPPT tidak konsisten.Aspek SILVIKULTUR HASIL DAN PEMBAHASAN Bibit Aquilaria sp. yaitu Burkholderia sp. CK8 (DQ195926. Kedua bakteri ini berasal dari rhizoplan S. Dijelaskan bahwa tanaman hutan pertumbuhannya jauh lebih lambat dari tanaman pertanian sehingga untuk pertumbuhan stadium awal di persemaian. β Proteobacteria) merupakan isolat yang paling konsisten dalam memberikan pengaruh paling efektif dalam meningkatkan pertumbuhan tinggi selama lima bulan setelah inokulasi (Gambar 2).5 tahun dari arboretum Nyaru Menteng. CK28 (DQ195889. 130 . Pertumbuhan diameter tidak menunjukkan respon yang konsisten terhadap inokulasi (Tabel 2).7% dibandingkan dengan bibit yang tidak diinokulasi pada lima bulan setelah inokulasi. β Proteobacteria) dan Chromobacterium sp. Bakteri fitohormon memberikan pengaruh nyata terhadap tinggi tanaman mulai 1-5 bulan setelah inokulasi (P < 0. menunjukkan respon beragam terhadap inokulasi bakteri fitohormon (Gambar 2). Dua isolat bakteri. parviflora umur kurang lebih 1. Peningkatan pertumbuhan tinggi bibit Aquilaria sp. Semua bibit yang diinokulasi secara signifikan memiliki pertumbuhan tinggi yang lebih baik daripada tanaman kontrol melalui analisa Least Significant Difference (LSD). Respon tanaman diamati melalui pertumbuhan tinggi dan diameter setiap bulannya. Pada habitat hutan yang rimbun dengan kanopi yang bertingkat. berkisar antara 12. tinggi merupakan parameter yang reliable untuk mengamati respon bibit terhadap inokulasi mikroba pemacu pertumbuhan. Bakteri fitohormon memberikan pengaruh positif. teysmanniana umur kurang lebih 1 tahun dan S.2-38. Respon yang serupa juga telah dilaporkan oleh Sitepu et al. Kalimantan Tengah.05).

Bibit Aquilaria sp. Turjaman et al. dkk) Gambar 2.. tidak disterilisasi pada saat inokulasi bakteri sehingga mikroba alami yang terdapat dalam tanah. sampai 5 bulan setelah inokulasi. ditumbuhkan di bawah tegakan meranti di Hutan Penelitian Dramaga. 1990. dan indeks mutu bibit (Gambar 3 dan Gambar 4).. Inokulasi juga tidak berpengaruh terhadap pertumbuhan setelah bibit dipindah ke lapangan.(Irna R. Tidak responnya bibit terhadap bakteri. juga terhadap berat kering total. kemudian bebas untuk berinteraksi dengan bakteri yang diinokulasikan... dapat dijelaskan sebagai berikut: Tanah sebagai media tumbuh dan bibit Aquilaria sp. 2005). enam bulan setelah inokulasi. rasio pucuk terhadap akar. dan Shorea pinanga (Lee. Yazid et al. Pengaruh bakteri PGPR terhadap pertumbuhan tinggi bibit Aquilaria sp. Hopea odorata. yaitu Shorea leprosula. bibit cenderung tumbuh lambat (Tabel 2). Angka di atas notasi adalah peningkatan pertumbuhan dibanding kontrol Inokulasi tidak memberikan pengaruh nyata terhadap pertumbuhan tinggi. Shorea acuminata. enam bulan setelah inokulasi. Sitepu. 1994.Aplikasi Rhizobakteri Penghasil . Fungi mikoriza dilaporkan baru berperan efektif tujuh bulan setelah inokulasi pada tanaman dipterokarpa.. Diduga tidak adanya respon bibit yang nyata pada bulan keenam dan selanjutnya disebabkan karena bibit telah terinfeksi oleh fungi mikoriza secara alami yang dapat berasal dari tanah maupun air yang dipakai untuk menyiram tanaman walaupun analisa infeksi mikoriza alami tidak dilakukan.. 131 .

P/A: Pucuk/akar Gambar 3. yang diinokulasi bakteri 132 .Aspek SILVIKULTUR Tabel 2.05.05 *: nyata pada taraf 0. Berat kering total bibit Aquilaria sp. Analisa sidik ragam pada parameter pertumbuhan yang diukur Parameter Diameter (mm) Tinggi (cm) Berat Kering Pucuk (g) Berat Kering akar (g) Berat Kering Total (g) Rasio P/A Indeks Mutu Bibit tn * tn * Analisa sidik ragam * * tn tn tn tn tn * * tn * tn tn Catatan: tn: tidak nyata pada taraf 0. Tabel 1.

yaitu Chromobacterium sp.. Sitepu. Salah satu dari kedua inokulan yang paling efektif. Gambar 4. (2001) menyatakan bahwa bakteri Paenibacillus sp. CK8 adalah bakteri yang telah diuji secara in vitro dapat membantu pertumbuhan miselia fungi ektomikoriza Laccaria sp.. monteilii meningkatkan biomassa fungi di dalam tanah (Founoune et al. Brule et al. pengaruh mikoriza dimulai lebih awal. Indeks mutu bibit Aquilaria sp. Pengaruh tidak langsung dari inokulasi RPPT berupa pembentukan asosiasi mikoriza (disebut sebagai mycorrhizal helper bacteria. dkk) Gambar 4. 133 .(Irna R.. Sedangkan Paenibacillus monteilii dan Paenibacillus resinovorans memacu simbiosis antara Pisolithus alba dengan Acacia holosericea di mana P. Penelitian yang dilakukan oleh Enebak et al. Bakteri tertentu dapat berperan dalam merangsang terbentuknya asosiasi mikoriza antara fungi mikoriza dan tanaman inangnya. merangsang infeksi ektomikoriza pada tahapan pembentukan akar lateral antara Laccaria rufus dan Pinus sylvestris.. 2001). Burkholderia sp. dalam penelitian ini. 1994. 2002).. dan Rhodococcus sp.Aplikasi Rhizobakteri Penghasil . Pseudomonas fluorescense BBc6R8 memacu simbiosis antara Laccaria bicolor S238N-Douglas fir (Pseudotsuga menziesii) dan efek dari bakteri MHB ini paling efektif pada saat fungi mikoriza tumbuh berada pada kondisi yang tidak optimal (Garbaye. yaitu pada enam bulan setelah inokulasi. Penelitian yang dilakukan oleh Poole et al. yang diinokulasi bakteri Pada bibit Aquiliaria sp.. (1998) pada bibit loblolly dan slash pine melaporkan bahwa inokulasi RPPT meningkatkan biomassa tegakan. MHB) juga telah dilaporkan...

134 . terhadap inokulasi menghasilkan satu bakteri penghasil indol yang efektif. (2004) menunjukkan bahwa inokulasi ganda fungi mikoriza arbuskula dan bakteri Azotobacter dengan tambahan asam indol butirat secara nyata meningkatkan survival rate sapling Morus alba (Moraceae) yang ditanam pada kondisi yang bergaram tinggi dari 25-50%. Respon pertumbuhan bibit Aquilaria sp. menunjukkan respon beragam terhadap inokulasi bakteri penghasil fitohormon.2-38. maka perlu uji lebih lanjut untuk mengetahui pengaruh inokulasi ganda antara bakteri dan fungi mikoriza arbuskula dalam memacu pertumbuhan bibit. Dalam hal ini bibit bermikroba dapat meningkatkan ketahanan tumbuh tanaman pada kondisi ekstrim. Dua isolat Burkholderia sp. segera setelah inokulasi berturut-turut selama lima bulan.Aspek SILVIKULTUR Untuk mengetahui apakah fenomena MHB ini juga berlaku untuk Aquilaria sp. Uji lanjutan inokulasi ganda dengan fungi mikoriza arbuskula perlu dilakukan untuk mengetahui mikroba yang berperan dalam memacu pertumbuhan bibit pada stadia lanjut di persemaian sebelum dipindah ke lapangan. baik di persemaian maupun di lapangan. Inokulasi bakteri penghasil fitohormon dapat meningkatkan tinggi bibit Aquilaria sp. Uji in vitro merupakan metode yang praktis. Dalam penelitian ini. CK28 yang menghasilkan warna pink muda pada uji colorimetric. terutama dalam menyeleksi isolat dalam jumlah besar sebelum dilakukan uji selanjutnya. dan apakah hipotesa di atas benar. Penelitian yang dilakukan oleh Kashyap et al. CK8 adalah dua bakteri yang secara konsisten memacu pertumbuhan tinggi. Peningkatan pertumbuhan tinggi bervariasi dari 12. Dari hasil in vitro didapat sembilan bakteri penghasil indol yang kemudian diuji lanjut pada bibit Aquilaria sp.7% dibandingkan dengan bibit yang tidak diinokulasi. KESIMPULAN Bibit Aquilaria sp. CK28 dan Chromobacterium sp. pendekatan yang dilakukan adalah menyeleksi bakteri secara in vitro terlebih dahulu sebelum dilakukan uji pada tanaman target di persemaian. yaitu Burkholderia sp.

. A. R. Mycorrhiza Helper Bacteria stimulate ectomycorrhizal symbiosis of Acacia holosericea with Pisolithus alba.M.L. Pierrat. Ahmad.. H. C. The enhancement of plant growth by free-living bacteria. Courrier. Gerard.M. A critical examination of the specificity of the Salkowski reagent for indolic compounds produced by phytopathogenic bacteria. Brulé. Glickmann. Duponnois. Rousselet. Garbaye. 135 . New Phytologist 153: 81-89. Survival in the soil of the ectomycorrhizal fungus Laccaria bicolor and the effects of mycorrhiza helper Pseudomonas fluorescens. Sall. Lemoine.. Neyra. Helper bacteria: a new dimension to the mycorrhizal symbiosis. Glick.. Sitepu.S. I. Enebak. Soil Biology and Bio-chemistry 33: 1683-1694. Khan. 1994. G. Founoune. 2002. Brick. 1991. S. 1998. Frey-Klett. E. Applied and Environmental Microbiology 57: 535-538. J. R. P.M.R. Kloepper. I. DAFTAR PUSTAKA Ahmad. Canadian Journal of Microbiology 41: 109-117. Indole acetic acid production by the indigenous isolates of Azotobacter and fluorescent Pseudomonas in the presence and absence of tryptophan. G. B.. Applied Environmental Microbiology 61: 793-796.. Effect of plant growthpromoting rhizobacteria on loblolly and slash pine seedlings.E. J.C. M. Turkish Journal of Biology 29: 29-34. and J. Chotte. 2005. F. J. and S. Rapid in situ assay for indoleacetic acid production by bacteria immobilized on a nitrocellulose membrane. F. and J. Forest Science 44: 139-144. 1995. New Phytologist 128: 197-210.. M.A.(Irna R.L.. Wei. S. and Y.W. Garbaye.. dan M. J.C. J. Sommer.Aplikasi Rhizobakteri Penghasil . Bostock. S. 1995. dkk) Ucapan Terimakasih Para penulis mengucapkan terimakasih kepada Bapak Ahmad Yani dan Bapak Zaenal yang telah membantu pengukuran dan perawatan tanaman di Hutan Penelitian Dramaga. Silverstone. Lorquin. and J. Dessaux. 2001. Ba. Branget.

Y. Whipps. Bending. Singadan. S. L. 2006. M..M. Glick. E. Hashidoko. M. 2004. Reddy. New Phytologist 151: 743-751. Merbach. J. PhD Dissertation. Lee. W. Turjaman.51. Hokkaido University. Applied Soil Ecology 31: 91-100. R. Gans. CCS Haryana Agricultural University. Chatterton. S. M. Reed. 2004. and D.S. Resource Management in Asia-Pacific Working Paper No.. 2002. Bio-science Biotechnology Biochemistry 66: 2259–2263.J. M. and K.D. E. Plant growth-promoting rhizobacteria as transplants amendments and their effects on indigenous rhizo-sphere microorganisms. N. Read.67. Hisar. and S. Tamai. I. Tada. and P. Lucy. Kokalis-Burelle. free-living nitrogen-fixing bacteria inhabiting the rhizoplane of plants.Y. Bacteria associated with Pinus sylvestris-Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro. M. P. J. Osaki. Canberra. and W.R. 2001. 2005. Inoculation with the ectomycorrhizal fungi 136 . 91 pp. H. Narula.Aspek SILVIKULTUR Gunn. A.V. AMBIO 19: 383-385.R. Screening of plant-growth promoting rhizobacteria from Dipterocarpaceae plants growing in Indonesian tropical rain forests. Biofertilizer technology-A manual. N. Plant Soil Environment 52:119-129. Applications of free living plant growth-promoting rhizobacteria. Kloepper. 2004. Antonie van Leeuwenhoek 86: 1-25. Deubel.K. Soft gel medium solidified with gellan gum for preliminary screening for rootassociating. Limin... 2006. 1990. Stevens. 18 pp. Segah. Paranodules and colonization of wheat roots by phytohormone producing bacteria in soil.. 2007. pp.W. Narula. Sitepu. Department of Microbiology. Cha. G.J. Eaglewood in Papua New Guinea. Osaki. Poole. Tawaraya. Y. B. and M. The Australian National University. India.H.S. J. and investigations of their functions on seedling growth. Tahara. Sunari. N.. M. The mycorrhizal association of the Dipterocarpaceae in the tropical rain forests of Malaysia.. Behl. and B.

S. S.Aplikasi Rhizobakteri Penghasil . New Forest 30: 67-73. S. 137 . dkk) Pisolithus arhizus and Scleroderma sp. Sitepu. 1994. 1991.S. Journal of Bacteriology 173: 697-707.M.A. 16S ribosomal DNA amplification for phylogenic study. G. and D.J. Lapeyrie. W.M. Lane. Weisburg... Forest Ecology Management 67: 339-343. and F. D. Lee. Barns. Yazid. (Dipterocarpaceae) seedlings following ectomycorrhizal inoculation with an exotic strain of Pisolithus tinctorius.. Pelletier. Growth stimulition of Hopea spp... improves early growth of Shorea pinanga nursery seedlings.(Irna R..

138 .

Vietnam. India. Karena disebabkan tingginya nilai produk gaharu. Malaysia. Cambodia. Irianto. Gonystylus. Aryanto. Ragil S. Sitepu. 2001). Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Salah satu famili pohon tropika yang sekarang menjadi perhatian dunia internasional adalah Thymelaeaceae. 1999). dan Gonystylus dimasukkan ke dalam CITES (Convention on the International Trade in Endangered Species) Appendix II (CITES 2005). Ahmad Yani. Bangladesh. Oyen dan Dung.7 PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman. 1960).B. maka jenisjenis ini mengalami kelebihan pemanenan di seluruh kawasan Asia selama 20 tahun terakhir (Paoli et al. Wikstroemia. 1998. Jenis-jenis ini merupakan sumber utama dari kayu gaharu (semacam kayu yang 139 . Gyrinops. Phaleria. Pada saat ini Aquilaria. Thailand. Myanmar. China. Sugeng Sentosa. Najmulah. Famili pohon ini sangat penting karena menghasilkan produk gaharu dan kayu mewah untuk masyarakat di sekitar kawasan hutan di kawasan Asia (Lemmens et al. dan Aquilaria yang memproduksi gaharu (Ding Hou. Bhutan.. Thymeleaceae terdiri dari 50 genera dengan Aetoxylon. Irnayuli R. dan Filipina. Enkleia. Jenis-jenis Aquilaria pada umumnya banyak dijumpai pada hutan-hutan primer dan sekunder dataran rendah di Indonesia.. Papua Nugini. Gyrinops.

Tujuan dari penelitian ini adalah menentukan tingkat pengaruh fungi mikoriza arbuskula pada jenis-jenis Aquilaria. 11 jenis Eucalyptus (Adjoud et al. Tectona grandis (Rajan et al. Dari hasil studi literatur. Produk gaharu biasanya digunakan sebagai bahan dasar parfum. 2004). jenis Aquilaria berkurang populasinya di alam. dan produk komersial lainnya (Eurling dan Gravendeel. 2005). Fungi mikoriza arbuskula (FMA) telah diuji dengan hasil yang signifikan pertumbuhannya pada jenis Leucaena leucocephala (Michelsen dan Rosendahl. sebab pada umumnya kondisi lahan hutan tropika di Indonesia kahat unsur hara terutama N dan P. incence. 2002).Aspek SILVIKULTUR mempunyai resin wangi) yang termasuk dalam urutan teratas dari kelompok hasil hutan bukan kayu bernilai sangat tinggi yang berasal dari hutan tropika. 1996). 2000). Pada kenyataannya ketersediaan bibit biasanya cenderung dibuat dengan kualitas rendah dan mengalami defisiensi unsur hara dan pada akhirnya mengalami kematian yang tinggi pada saat telah ditanam di tingkat lapang. Penggunaan bibit tanaman hutan yang vigor sangat diperlukan dalam kegiatan reforestasi. Ketersediaan nutrisi tanah merupakan salah satu faktor pembatas untuk pertumbuhan awal dalam kegiatan penanaman bibit-bibit tanaman hutan pada kondisi lahan hutan yang terdegradasi (Santiago et al... Zizyphus mauritiana (Guissou et al. belum dilaporkan adanya uji inokulasi fungi mikoriza arbuskula pada jenis-jenis Aquilaria. Pada saat ini kegiatan reforestasi memproduksi ratusan juta bibit tanaman hutan setiap tahunnya. baik di tingkat persemaian maupun di lapangan. Pada tahap awal pertumbuhan jenis Aquilaria sering mengalami pertumbuhan yang lambat. sulit sekali untuk melakukan pengaturan perlindungan genus ini dan termasuk juga dalam pengaturan kelestarian produksi gaharu alami. 140 . grandiflora (Giri and Mukerji. Namun demikian.. Sesbania aegyptiaca dan S. Parkia biglobosa. Tamarindus indica. Telah banyak dilaporkan dalam beberapa jurnal internasional pentingnya pemanfaatan fungi mikoriza arbuskula dari beberapa jenis tanaman hutan yang berbeda untuk membantu kegiatan reforestasi. 1990). 1998). obat tradisional.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

BAHAN DAN METODE
A. Perbenihan dan Perkecambahan
Benih Aquilaria crassna diperoleh dari Dramaga (Bogor), A. malaccensis dikoleksi dari Desa Gudang (Pulau Bangka), A. microcarpa dari Desa Mianas (Kalimantan Barat), A. beccariana berasal dari Sanggau (Kalimantan Barat). Semua benih Aquilaria spp. direndam selama dua jam, kemudian disterilisasi dengan sodium hypochlorit (5%) selama lima menit. Setelah disterilisasi, benih tersebut dicuci beberapa kali dengan air sampai bersih. Benih Aquilaria spp. dikecambahkan pada bak plastik yang berisi media zeolite. Benih Aquilaria spp. mulai berkecambah 21 hari setelah ditaburkan.

B. Media Semai
Jenis tanah ultisol diambil dari Hutan Penelitian Haurbentes, Jasinga dan kemudian disimpan di rumah kaca. Media semai tersebut disaring dengan diameter saringan lima mm. pH media adalah 4,7; P tersedia (Bray-1) adalah 0,17 mg kg-1, dan N total (Kjeldahl) was 1.7 mg kg-1. Kemudian media semai disterilisasi pada temperatur 121oC selama 30 menit.

C. Inokulum Mikoriza Arbuskula
Fungi mikoriza arbuskula, G. decipiens, G. clarum, Glomus sp. ZEA, dan Glomus sp. ACA diisolasi dari Desa Kalampangan, Palangkaraya, Kalimantan Tengah melalui teknik pot kultur. Teknik pot kultur dimulai dengan cara spora tunggal. Inang yang digunakan untuk mempropagasi FMA adalah Pueraria javanica. Pot plastik diisi dengan zeolite steril dan ditambahkan 5 g dari masingmasing jenis FMA. Kemudian ditanam benih P. javanica yang telah berumur enam hari pada pot plastik tersebut. Pot-pot disusun pada rak-rak besi di rumah kaca dan dipelihara selama 90 hari. Spora, hifa eksternal, dan akar yang terkolonisasi dari masing-masing jenis FMA diamati di bawah mikroskop.

141

Aspek SILVIKULTUR

D. Inokulasi FMA
Polybag (ukuran 15 cm x 10 cm) diisi tanah steril 500 g. Inokulasi FMA diberikan 5 g untuk setiap pot dan diletakkan dekat akar semai Aquilaria spp. Semai empat jenis Aquilaria yang tidak diinokulasi sebagai kontrol. Dari hasil penelitian pendahuluan, penggunaan inokulum steril tidak memberikan pengaruh pertumbuhan pada Aquilaria spp. Semai dipelihara dan disiram setiap hari pada kondisi rumah kaca dan diamati selama 6 bulan. Temperatur di rumah kacar berkisar antara 26-35oC dan kelembaban udara 8090%. Gulma dan hama yang mengganggu semai dimonitor setiap hari.

E. Parameter Pertumbuhan
Percobaan inokulasi pada jenis-jenis Aquilaria terdiri atas (a) kontrol (tanpa inokulum); (b) Entrophospora sp.; (c) G. decipiens; (d) G. clarum; (e) Glomus sp. ZEA; dan (f) Glomus sp. ACA. Desain penelitian dilakukan dengan rancangan acak lengkap (RAL) dengan 30 ulangan. Parameter yang diukur adalah tinggi, diameter, dan daya hidup semai. Setelah berumur enam bulan, dilakukan pemanenan pucuk dan akar semai Aquilaria. Semua sampel di-oven pada suhu 70oC selama tiga hari. Analisis N dan P jaringan semai dilakukan dengan metode semi-micro Kjeldahl dan vanadomolybdate-yellow assay (Olsen and Sommers, 1982). Pada tingkat lapang, percobaan yang dilakukan hanya pada jenis A. beccariana dengan desain RAL yang sama. Percobaan dilakukan di Kawasan Hutan Dengan Tujuan Khusus (KHDTK) Dramaga di bawah naungan tegakan Gmelina arborea. Paramater yang diamati pada tingkat lapang ini adalah tinggi dan diameter A. beccariana yang telah dilakukan selama dua tahun.

F. Kolonisasi Mikoriza Arbuskula
Akar dari masing-masing jenis Aquilaria dicuci untuk membersihkan partikel-partikel tanah yang masih menempel. Akar dibersihkan dalam 100 g l-1 KOH selama satu jam, diasamkan dalam larutan HCl dan diberi warna dengan 500 mg l -1 tryphan blue dalam lactoglycerol (Brundrett et al., 1996). Kemudian akar

142

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

dicuci dalam 50% glycerol dan 100 potong akar berukuran satu cm diamati di bawah mikroskop compound dengan perbesaran 200x. Penghitungan kolonisasi mikoriza dilakukan dengan sistem skoring keberadaan dan tidak adanya struktur FMA (McGonigle et al., 1990).

G. Analisis Statistik
Analisis statistik menggunakan ANOVA dengan software StatView 5.0 (Abacus Concepts). Sedangkan analisis statistik lanjutan menggunakan uji beda nyata terkecil (LSD) apabila nilai F signifikan.

HASIL DAN PEMBAHASAN
Lima jenis fungi mikoriza arbuskula (FMA) sangat efektif mengkolonisasi sistem perakaran dari A. crassna, A. malaccensis, A. Microcarpa, dan A. beccariana setelah enam bulan diinokulasi pada kondisi rumah kaca. Dari hasil penelitian sebelumnya Santoso et al. (2008), kolonisasi FMA yang terjadi pada akar bibit A. microcarpa dimulai sebelum minggu ke-7 setelah inokulasi. Tidak ada perbedaan nyata antara lima jenis FMA dalam mengkolonisasi perakaran empat jenis Aquilaria. Kolonisasi FMA dapat meningkatkan parameter pertumbuhan tinggi, diameter batang, berat kering, berat basah, dan daya hidup semai Aquilaria di persemaian (Tabel 1). Pada jenis A. crassna, A. Malaccensis, dan A. microcarpa, penggunaan FMA Entrophospora sp. lebih efektif meningkatkan parameter pertumbuhan dibandingkan jenis FMA lainnya. Khusus FMA G. clarum sangat efektif meningkatkan parameter pertumbuhan pada jenis A. beccariana. Semai yang tidak diinokulasi terkolonisasi oleh FMA yang tidak teridentifikasi (110%), tetapi tidak dapat mempengaruhi pertumbuhan empat jenis Aquilaria. Kolonisasi FMA mampu meningkatkan serapan N dan P pada jaringan empat jenis Aquilaria dibandingkan semai yang tidak diinokulasi (Tabel 2). Peningkatan serapan N dan P ini memberikan pengaruh pada peningkatan dari parameter pertumbuhan empat jenis Aquilaria. Pada tingkat lapang, dilakukan kegiatan penanaman hanya pada jenis A. beccariana dua tahun setelah diinokulasi oleh FMA. Hasil penelitian pada tingkat lapang menunjukkan bahwa

143

Aspek SILVIKULTUR

jenis G. clarum lebih efektif dalam meningkatkan pertumbuhan A. beccariana dibandingkan dengan kontrol dan jenis FMA lain yang telah diujicobakan. Dari hasil penelitian ini memberikan informasi yang sangat penting dalam memanfaatkan inokulum FMA pada jenis-jenis Aquilaria spp. Regenerasi jenis-jenis Aquilaria yang berkelanjutan dapat dibantu dengan adanya pemanfaatan teknologi FMA dimulai pada saat di persemaian. Penggunaan FMA yang efektif dapat meningkatkan pertumbuhan Aquilaria yang sangat signifikan, sehingga biomassa pohon penghasil gaharu yang akan dipanen akan meningkat, artinya produk gaharu hasil induksi yang akan dipanen lebih meningkat produksinya. Penelitian ini sejalan dengan penelitian yang terdahulu, yaitu tentang pemanfaatan FMA pada 11 jenis Eucalyptus spp. (Adjoud et al., 1996), 17 jenis tanaman legume (Duponnois et al., 2001), Sesbania aegyptiaca dan S. grandiflora (Giri dan Mukerji, 2004). Penelitian pemanfaatan FMA pada jenis-jenis pohon tropika (Muthukumar et al., 2001) dan khususnya jenis-jenis Aquilaria menunjukkan bahwa ada kemungkinan inokulum FMA dapat menurunkan penggunaan pupuk kimia di persemaian. Meskipun perhitungan tentang keuntungan dan biaya penggunaan FMA belum diuji dalam penelitian ini, hasilnya tidak diragukan lagi menunjukkan FMA dapat menurunkan penggunaan pupuk kimia dalam penyediaan semai tanaman penghasil gaharu. Selanjutnya mekanisme penggunaan FMA sebagai pemacu pertumbuhan jenisjenis Aquilaria pada tanah masam dan pada tanah yang populasi FMA sangat rendah harus menjadi perhatian dan pertimbangan untuk mengetahui keberadaan FMA alami. Pola penanaman jenis-jenis Aquilaria dengan pola agroforestry sangat membantu mempercepat ketersediaan pohon-pohon penghasil gaharu di Indonesia. Pada prinsipnya, pencampuran dilakukan untuk melindungi pertumbuhan semai Aquilaria pada tahun pertama dan kedua dari sengatan sinar matahari. Jenis-jenis Aquilaria yang telah dikolonisasi oleh FMA akan dapat mempunyai hubungan antara sistem perakaran pohon jenis-jenis lain, sehingga kebutuhan nutrisi untuk pertumbuhan gaharu dapat terpenuhi.

144

melinjo.. G. beccariana lebih memilih jenis FMA G. microcarpa. 2. malaccensis.Aca = Glomus sp. G. Khusus jenis pohon penghasil gaharu A. Penggunaan FMA pada jenis-jenis Aquilaria sangat signifikan dalam memacu pertumbuhan awal di persemaian dan lapangan. sengon. Direkomendasikan untuk menggunakan jenis FMA efektif untuk mempercepat pertumbuhan jenis-jenis Aquilaria mulai di tingkat persemaian. Pertumbuhan tinggi dan diameter pohon penghasil gaharu Aquilaria beccariana setelah dua tahun ditanam di tingkat lapang. KESIMPULAN DAN REKOMENDASI 1. Gambar 1. Gg = G. dkk.(Maman Turjaman. gmelina. Gc = G.. Ent = Entrophospora sp. kelapa. dan A. Ketersediaan inokulum FMA di tingkat 145 . K = Kontrol. clarum untuk memacu pertumbuhan tanaman dan serapan nutrisinya. Jenis FMA Entrophospora sp. kelapa sawit. jengkol.) Jenis-jenis pohon yang direkomendasikan sebagai pohon pencampur dengan pohon penghasil gaharu adalah pohon karet. sangat efektif dalam memacu pertumbuhan tanaman dan serapan nurtisi pada jenis A. baik di tingkat semaian maupun lapangan. crassna..ZEA = Glomus sp. ACA.. dan beberapa jenis lain pohon buah-buahan.clarum.. A. decipiens.Penggunaan Fungsi Mikoriza . ZEA.

Guisso. H. Ding Hou. ACIAR Monograph 32. Eurlings. J-M. 2005. II and III of CITES. Duponnois. B. Pontanier (2005). Masse and R. Thymelaeaceae. and Zizyphus mauritiana Lam.M.. Malajczuk. Mycorrhizal Inoculant Alleviates Salt Stress in Sesbania aegyptiaca and Sesbania grandiflora Under Field Conditions : Evidence for Reduced Sodium and Improved Magnesium Uptake. M. Groningen. 2005.Aspek SILVIKULTUR pengguna dan sosialisasi penggunaanya perlu dilakukan.) Benth. Giri. Convention on International Trade in Endangered Species of Wild Fauna and Flora. D. Dell. D.G. Canberra. Forest Ecology and Management 207 : 351-362. Tamarindus indica L. Working with Mycorrhizas in Forestry and Agriculture. Wolters-Noordhoff. Mukerji. The Netherlands. M. 6. S. Appendices I... TrnL-TrnF Sequence Data Imply Paraphyly of Aquilaria and Gyrinops (Thymelaeaceae) and Provide New Perspectives for Agarwood Identification. Series I. Guinko and R. N. to Arbuscular Mycorrhizal Fungi in a Phosphorus-Deficient Sandy Soil. Gravendeel. B. UNEP. and B.G. Responses of Parkia biglobosa (Jacq.G. 48 pp. 1998. 146 .M. Mycorrhiza 6 : 129-135. agar penggunaan FMA menjadi efektif dan efisien. Mycorrhiza 14 : 307-312. Lapeyrie. R. p. 2004..C. Founoune. (ed) Flora Malesiana. Inoculation of Acacia holosericea with Ectomycorrhizal Fungi in a Semiarid Site in Senegal : Growth Response and Influences on The Mycorrhizal Soil Infectivity After 2 Years Plantation. R. C. Brundrett.J. CITES. 1996. and K. Plenchette. Bâ. Vol. T.Ouadba. Grove and N. DAFTAR PUSTAKA Adjoud. Duponnois. 1996. C. 1960. Plant Systematics and Evolution 254 : 1-12. T. Response of 11 Eucalyptus Species to Inoculation with Three Arbuscular Mycorrhizal Fungi. Halli-Hargas and F. Biology and Fertility Soils 26 : 194-198. In : Van Steenis. Bougher. 1-15. A.

in Two Tropical Soils. 1998. Conservation Biology 15 : 1721-1732.... 5 (2). 2000.Penggunaan Fungsi Mikoriza . Bagyaraj. Prosea. T. Indonesia.E. p 403-430. 1982. dkk. M. Phosphorus and Drought Stress on The Growth of Acacia nilotica and Leucaena leucocephala Seedlings. Indonesia. Q. 2001.D. Evans..M. Oyen. Santiago.X.) Lemmens.G.H.A.J. Swan.C.. Dung (Eds.). Phosphate-Solubilizing and Asymbiotic Nitrogen-Fixing Bacteria Under Tropical Nursery Conditions. Miller. 1990. Prosea.) Methods of Soil Analysis Part 2 Chemical and Micro-biological Properties. Fairchild and J.R. Biology and Fertility Soils 34 : 417-426 Olsen. McGonigle. S. Samsoedin. G. 2008.A. Leighton and I. Plant and Soil 124 : 7-13. Bogor. G.R.J.. Plant Resources of South-East Asia No. Michelsen. Turjaman. Timber Trees : Minor Commercial Timbers. New Phytologist 115 : 495-501. Screening of Arbuscular Mycorrhizal Fungi for Their Symbiotic Efficiency with Tectona grandis. West Kalimantan. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil 147 . S. Soerianegara and W. Madison.D. Ex Benth. Essential-Oil Plants. Phosphorus.K..(Maman Turjaman. and N. R. 19. Reddy and D. An Ecological and Economic Assessment of The Nontimber Forest Product Gaharu Wood in Gunung Palung National Park. and S. M.L. Muthukumar.P. Rosendhal. E. 1990. Plant Resources of South-East Asia No. The Effect of VA Mycorrhizal Fungi.. Paoli. New Forests 24 : 15-25. 1999.M. D. T. Sommers.J. American Society of Agronomy. D. Juss) to Indigenous Arbuscular Mycorrhizal Fungi.W. In : Page AL (ed. Forest Ecology and Management 126: 91-95. L.. Rajeshkannan.P.. A. Indonesia. Santoso. Peart. K.). Response of Neem (Azadirachta indica A. Wong (Eds. Bogor. G. and L. Garcia and M. B. A. Gunawan dan M.. 2002. Udaiyan and V. Effect of Post-Planting Inoculation with Bradyrhizobium sp.R. A New Method Which Gives an Objective Measure of Colonization of Roots by Vesicular-Arbuscular Mycorrhizal Fungi. I. Scotti. and Mycorrhizal Fungi on The Growth Brazilian Rosewood. Dalbergia nigra Allem..H. 2001. Rajan.

148 . Bogor.Aspek SILVIKULTUR Gaharu. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam. Jurnal Penelitian Hutan dan Konservasi Alam IV (5): 499-509.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

Lampiran 1. Kolonisasi mikoriza arbuskula dan pertumbuhan pada jenisjenis Aquilaria setelah enam bulan pada kondisi di rumah kaca
Kolonisasi AM Tinggi (cm) Diameter (mm) Berat basah Pucuk (g) Akar (g) Berat kering Pucuk (g) Akar (g) Daya hidup (%)

Perlakuan

A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA 10a 85b 71b 79b 61b 84b 15,40a 19,20b 32,18d 45,30e 32,03d 26,24c 1,90a 2,37b 3,94c 5,02d 3,75c 3,53c 0,30a 5,46e 4,74d 6,74f 3,14b 3,84c 0,10a 2,54c 1,64b 2,82d 1,38c 1,20b 0,09a 1,76c 1,59c 2,30d 0,97b 1,19b 0,02a 0,78c 0,41b 0,91d 0,36b 0,28b 73 100 100 100 100 100 2a 97b 88b 83b 85b 87b 13,39a 24,74d 21,99c 20,28c 17,24b 18,09b 2,23a 3,89c 3,67c 3,58c 2,84b 2,98b 0,75a 4,32c 3,87c 3,46c 2,24b 2,70b 0,34a 2,29c 3,41d 1,55b 1,08b 1,23b 0,23a 1,31c 1,44c 0,95b 0,64b 0,76b 0,09a 0,37b 0,57c 0,30b 0,24b 0,28b 67 100 97 93 87 90 1a 97b 88b 83b 84b 86b 16,43a 25,97c 21,91b 19,96b 22,33b 21,30b 2,28a 3,88c 3,02b 2,94b 3,26b 3,12b 1,46a 4,68c 2,92b 2,90b 2,62b 2,74b 0,52a 2,24c 1,20b 1,28b 1,38b 1,22b 0,41a 1,44c 0,88b 1,95c 0,79b 0,89b 0,18a 0,48c 0,27b 0,78c 0,27b 0,26b 73 100 100 97 90 93 4a* 73b 63b 78b 78b 59b 20,90 a 46,14 c 29,58 b 32,43 b 38,94 c 24,60 a 2,9 a 5,4 c 4,1 b 4,4 b 4,7 b 3,7 a 0,68a 1,06a 0,33a 3,82b 3,26b 0,86a 2,99b 4,19b 0,13a 1,35b 1,56b 0,27a 1,01b 1,52b 70 100 100 100 87 100

12,58b 5,72b 11,64b 7,36b 8,82b 9,92b 4,3b 4,54b

13,46b 6,94b

149

Aspek SILVIKULTUR

Lampiran 2. Kandungan N dan P pada jenis-jenis Aquilaria setelah enam bulan diinokulasi oleh beberapa jenis fungi mikoriza arbuskula (FMA)
N Concentrations (mg/g) N Content (mg/plant) P Concentrations (mg/g) P Content (mg/plant)

Perlakuan A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA

7,9 ± 0,1a* 9,8 ± 0,1c 8,2 ± 0,2a 8,7 ± 0,2b 8,7 ± 0,1b 10,8 ± 0,2d

2,6 ± 0,6a 37,7 ± 4,3d 26,7 ± 4,1c 7,4 ± 1,0b 25,8 ± 3,6c 45,9 ± 9,6d

0,78 ± 0,02a 1,42 ± 0,03e 0,85 ± 0,02b 0,95 ± 0,02c 0,96 ± 0,03c 1,22 ± 0,02d

0,26 ± 0,06a 5,4 ± 0,6d 2,8 ± 0,5c 0,82 ± 0,14b 2,85 ± 0,41c 5,14 ± 1,0d

8,6 ± 0,2a 12,1 ± 0,1d 10,7 ± 0,1c 10,4 ± 0,1b 11,1 ± 0,2c 10,9 ± 0,2c

3,49 ± 0,5a 17,28 ± 2,0c 9,02 ± 0,7b 20,5 ± 3,3c 8,8 ± 0,9b 9,7 ± 1,8b

0,65 ± 0,02a 0,73 ± 0,01b 0,85 ± 0,01c 0,72 ± 0,02b 0,77 ± 0,03b 1,04 ± 0,03d

0,26 ± 0,04a 1,06 ± 0,15d 0,75 ± 0,07c 1,60 ± 0,20e 0,6 ± 0,07b 0,92 ± 0,17c

7,8 ± 0,1a 9,6 ± 0,2c 9,6 ± 0,1c 9,3 ± 0,1c 9,4 ± 0,1c 8,9 ± 0,2b

1,02 ± 0,07a 16,9 ± 1,5d 11,7 ± 0,9c 8,3 ± 0,4b 9,17 ± 1,35b 8,28 ± 0,40b

0,65 ± 0,02a 1,12 ± 0,03d 0,86 ± 0,01c 0,78 ± 0,02b 0,77 ± 0,03b 0,77 ± 0,02b

0,08 ± 0,01a 1,97 ± 0,18d 1,20 ± 0,18c 0,70 ± 0,03b 0,75 ± 0,12b 0,9 ± 0,1b

6,0 ± 0,1a 9,9 ± 0,2c 10,6 ± 0,1c 11,3 ± 0,d 9,4 ± 0,1b 8,8 ± 0,2b

5,02 ± 0,07a 10,2 ± 1,0c 11,8 ± 0,8c 12,5 ± 0,4d 9,17 ± 1,35b 9,28 ± 0,40b

0,40 ± 0,02a 0,98 ± 0,02d 0,89 ± 0,03c 1,11 ± 0,02e 0,77 ± 0,03b 0,97 ± 0,02d

0,10 ± 0,01a 0,87 ± 0,20d 1,25 ± 0,21c 1,95 ± 0,03e 0,75 ± 0,12b 1,04 ± 0,1c

*Nilai-nilai dengan huruf yang sama adalah tidak berbeda nyata (P<0.05).

150

8
HAMA PADA TANAMAN PENGHASIL GAHARU
Ragil SB Irianto, Erdy Santoso, Maman Turjaman, Irnayuli R. Sitepu
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Tanaman penghasil gaharu yang ada di Indonesia sekitar 27 jenis, beberapa di antaranya yang cukup potensial menghasilkan gaharu yaitu Aquilaria spp., Aetoxylontallum spp., Gyrinops spp., dan Gonystylus spp. Pemanfaatan gaharu di Indonesia oleh masyarakat terutama di pedalaman Pulau Sumatera dan Kalimantan telah berlangsung ratusan tahun yang lalu. Secara tradisional gaharu dimanfaatkan, antara lain dalam bentuk dupa untuk upacara keagamaan, pengharum tubuh dan ruangan, bahan kosmetik dan obat-obatan sederhana. Produk gaharu saat ini sangat dicari oleh para pencari gaharu, karena harganya yang cukup mahal, dimana harga gaharu super dapat mencapai sekitar Rp 40 juta/kg. Akibat dari harga yang cukup tinggi tersebut, maka para pencari gaharu semakin intensif untuk mendapatkannya, saat ini para pencari gaharu mulai memfokuskan mencari gaharu di Pulau Papua yang potensi alamnya (gaharu) masih cukup tinggi dibandingkan dengan di Pulau Kalimantan atau Sumatera.

151

Aspek SILVIKULTUR

Dengan semakin langkanya tanaman penghasil gaharu di lapang dan harganya yang cukup tinggi tersebut, maka para peneliti kehutanan, rimbawan, dan masyarakat awam mulai mendomestikasi atau menanam tanaman penghasil gaharu di luar habitat aslinya. Saat ini banyak sekali para petani maupun orang kota yang mulai menanam tanaman penghasil gaharu dalam skala kecil dari beberapa pohon sampai dengan ribuan pohon. Penanaman tanaman penghasil gaharu yang monokultur dan di luar habitat aslinya pada umumnya akan rentan terhadap serangan hama dan penyakit. Dimulai dua tahun yang lalu banyak sekali sentra penanaman tanaman penghasil gaharu yang terserang hama daun Heortia vitessoides Moore. Sentra penanaman tanaman penghasil gaharu yang terserang hama dan telah dilaporkan terdapat di KHDTK Carita (2008), Sanggau (2007), Mataram (2009), dan lain-lain.

HAMA Heortio vitessoides
A. Gejala Serangan
Gejala serangan tingkat awal adalah permukaan daun yang muda dimakan oleh larva instar pertama dan daun tersebut hanya meninggalkan tulang-tulang daunnya. Pada stadia lebih lanjut ulatulat tersebut mulai menyerang daun-daun pada bagian cabang lebih atasnya dan menyebabkan tanaman menjadi gundul. Ngengat meletakkan telurnya pada bagian bawah permukaan daun yang muda pada cabang tanaman yang dekat dengan permukaan tanah.

B. Siklus Hidup
1. Telur
Ngengat meletakkan telurnya yang berwarna putih kekuningkuningan yang akan segera berubah menjadi kuning kehijauhijauan dalam bentuk kluster pada bagian bawah permukaan daun

152

Larva instar terakhir pada saat akan berkepompong mulai berhenti makan dan ulat turun ke permukaan tanah untuk berkepompong.. vitessoides pada instar pertama berwarna kuning pucat dan pada instar selanjutnya menjadi hijau kekuning-kuningan. 4. Pupa Larva instar terakhir sebelum berkepompong akan berhenti makan dan turun ke permukaan tanah dengan bantuan benang sutera yang dihasilkannya. Ngengat Serangga dewasa berbentuk ngengat yang aktif pada waktu malam.Hama pada Tanaman .(Ragil SB Irianto. Ulat akan membungkus dirinya dengan butiran-butiran tanah atau serpihan-serpihan serasah yang ada di permukaan dengan bantuan benang-benang suteranya.. Stadium ngengat berkisar sekitar 4 hari. ulat ini terdiri dari 5 instar dan berlangsung selama 23 hari.) yang muda pada cabang tanaman yang dekat dengan permukaan tanah. dkk. vitessoides 153 . Larva/Ulat Ulat H.. Stadium pupa berkisar 8 hari. Ngengat (4 Hari) Kepompong (8 Hari) Telur (10 Hari) Larva (23 Hari) Gambar 1. Siklus hidup hama daun tanaman penghasil gaharu H.. 2. 3. jumlah telur yang dihasilkan per imago betina berkisar antara 350-500. Telur akan menetas sekitar 10 hari. Ngengat betina dapat meletakkan telur sebanyak 350-500.

3. yaitu dengan cara mengambil ulat atau telur yang ada di tanaman tersebut. growmore. rambutan. Karena hama ini memakan daun dan pada serangan berat umumnya tanaman gundul. Predator Rangrang Semut rangrang (Oecophylla smaradigna) merupakan serangga yang mudah ditemukan di kampung-kampung pada tanamantanaman yang banyak mengeluarkan nektar. B. Jangka Pendek 1. seperti tanaman nangka. maka disarankan pada saat penyemprotan dikombinasikan dengan pemupukan lewat daun dengan pupuk daun seperti gandasil. Pengendalian dengan cara ini mudah diaplikasikan terutama pada pesemaian atau bibit yang baru dua tahun. melinjo.Aspek SILVIKULTUR STRATEGI PENGENDALIAN A. seperti Beauveria bassiana atau Bacillus thuringiensis. durian. Mekanis Pengendalian mekanis merupakan pengendalian yang sangat sederhana. dan lain-lain untuk merangsang tumbuhnya tunas-tunas baru. sudah populer di tingkat petani. dan lain-lain. 2. sistemik atau dengan insektisida yang berbahan aktif mikroorganisme. Kimiawi Pengendalian kimiawi dapat dilakukan dengan insektisida kontak. Jangka Menengah 1. dimana tanaman masih bisa dijangkau oleh orang dengan berdiri tanpa bantuan alat. Nabati Pengendalian nabati merupakan pengendalian yang cukup sederhana dan dapat dilakukan oleh petani sendiri dengan mengambil bahan-bahan yang ada di sekitar lokasi penanaman tanaman gaharu. Pencarian sarang semut rangrang yang memiliki ratu merupakan salah satu faktor 154 .

(Ragil SB Irianto. Cuc. 2. Nath. Mele. Jangka Panjang 1. C. Semut Sahabat Petani: Meningkatkan Hasil Buah-Buahan dan Menjaga Kelestarian Lingkungan Bersama Semut Rangrang. Geobios 29: 13-16.Hama pada Tanaman . 155 .) keberhasilan dalam perkembangan populasi serangga tersebut dalam jangka panjang. dan N. DAFTAR PUSTAKA Kalita. T.. Mele. P. 2004. R. V. Bhattacharyya. 2008. dkk. Musuh Alami Musuh alami. J. A Historical Review of Research on The Weaver Ant Oecophylla in Biological Control.... ICRAF. V. Agricultural and Forest Entomology 10: 13-22. and S. vitessoides merupakan suatu cara pengendalian yang sangat diharapkan dalam jangka panjang. 2002. Heortia vitessoides Moore A Serious Pest of Agarwod Plant (Aquilaria malaccensis Lamk).. Teknik Silvikultur Pengendalian dengan cara teknik silvikultur merupakan salah satu cara pengendalian yang sudah menyatu dengan penanaman suatu tanaman dan termasuk pengendalian yang sudah cukup dikenal oleh petani. C. T. P. P. 59 p. baik parasit maupun predator dari serangga perusak daun tanaman penghasil gaharu H.

156 .

Aspek SOSIAL EKONOMI DAN KONSERVASI 157 .

158 .

akan menghasilkan resin/substansi aromatik berupa gumpalan atau padatan berwarna coklat muda sampai coklat kehitaman yang terbentuk pada lapisan dalam dari jenis kayu tertentu sebagai reaksi dari infeksi/ luka tersebut. gaharu (Indonesia).9 PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti Pusat Litbang Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu tanaman hutan yang mempunyai nilai ekonomi tinggi karena kayunya mengandung resin yang harum. bois d’aigle (Perancis). Jika tanaman ini terluka. 2008). oodh (Arab). dan Gonystylus. aloeswood. Gyrinops. chenxiang (China). rusak atau terinfeksi. baik disebabkan penyakit atau serangan serangga. Aquilaria yang merupakan tanaman penghasil gaharu saat ini menjadi jenis yang dilindungi 159 . Sejenis resin beraroma ini berasal dari tanaman jenis Aquilaria. Beberapa nama diberikan pada gaharu seperti agarwood. oudh. dan adlerholz (Jerman). pau d’aquila (Portugis). ood. Resin ini sebetulnya dapat melindungi tanaman dari infeksi yang lebih besar sehingga dapat dianggap sebagai sistim imun yang dihasilkan (Squidoo. Tanaman penghasil gaharu secara alami tumbuh di wilayah Asia Selatan dan Asia Tenggara.

Salah satu bentuk kemitraan yang dapat dikembangkan adalah pola PHBM (Pengelolaan Hutan Berbasis Masyarakat). permintaan akan gaharu jauh melebihi supply yang ada. Jambi. Kesepakatan internasional seperti CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) yang disepakati oleh 169 negara ditetapkan untuk menjamin bahwa perdagangan gaharu tidak mengganggu survival dari Aquilaria. Pengembangan budidaya gaharu dengan pola PHBM (sistem bagi hasil) merupakan salah satu alternatif bentuk usahatani produktif yang selain bertujuan untuk mengembangkan budidaya gaharu secara luas juga sekaligus dapat meningkatkan pendapatan masyarakat serta mengurangi tekanan masyarakat terhadap hutan yang tingkat ketergantungannya terhadap hutan tinggi.Aspek SOSIAL EKONOMI DAN KONSERVASI di banyak negara dan eksploitasi gaharu dari hutan alam dianggap sebagai kegiatan ilegal. perlu dikembangkan suatu skema kerjasama antara pemilik modal dengan masyarakat. Sampai saat ini. tingginya harga gaharu dan makin langkanya tanaman gaharu di hutan alam juga mendorong masyarakat di berbagai daerah untuk melakukan budidaya gaharu seperti yang terjadi di Riau. Untuk mengembangkan budidaya gaharu secara lebih luas. Sebagai akibatnya pada beberapa tahun terakhir ada kecenderungan besar-besaran untuk mambudidayakan gaharu terutama di wilayah Asia Tenggara (Squidoo. Namun karena pengusahaan gaharu memerlukan modal yang tidak sedikit. Upaya pembudidayaan tersebut makin berkembang karena ditunjang oleh kemajuan hasil penelitian yang menunjukkan bahwa budidaya gaharu memberikan keuntungan yang layak bagi pelakunya. Sumatera Utara. eksploitasi gaharu secara ilegal ternyata tetap berlangsung dan konsumen yang kurang memahami hal ini secara tidak sadar justru menciptakan permintaan yang tinggi yang dapat membahayakan keberadaan tanaman Aquilaria (Blanchette. maka masyarakat yang mampu membudidayakan gaharu adalah kelompok yang memiliki permodalan yang kuat. PHBM diharapkan menjadi suatu cara yang efektif karena melibatkan masyarakat sekitar hutan dan parapihak pemangku 160 . 2006). dan Kalimantan Selatan. Di Indonesia. Meskipun demikian. 2008).

. dan data statistik yang tersedia.............(Sri Suharti) kepentingan lainnya untuk bekerjasama dan berbagi (ruang. BPS...... Khusus untuk perhitungan analisis finansial usahatani gaharu digunakan kriteria kelayakan Net Present Value (NPV). hak dan kewajiban) dengan prinsip saling menguntungkan.... saling memperkuat.. Asosiasi Gaharu Indonesia (Asgarin).. diolah dan Dianalisis secara deskriptif.. tingkat diskonto atau potongan (=bunga bank yang berlaku). Suatu kegiatan usaha dinyatakan layak secara finansial bila nilai NPV > 0... umur ekonomi proyek (cakrawala waktu)....... CITES.... biaya pada tahun t..... dan Benefit Cost Ratio (B/C ).. METODOLOGI Tulisan ini merupakan hasil desk study dari berbagai pustaka... Data dan informasi yang berhasil dihimpun........... laporan hasil penelitian. Data dan informasi serta literatur tersebut dihimpun dari berbagai sumber antara lain....... Internal Rate of Return (IRR)...... dan saling mendukung........ NPV atau nilai kini bersih dirumuskan sebagai berikut: n Bt − Ct NPV = ∑ t =0 (1 + i)t . IRR atau tingkat pengembalian internal dirumuskan sebagai berut: 161 ... (1) dimana: NPV Bt Ct i n = = = = = Net Present Value (Nilai Kini Bersih). Tulisan ini bertujuan untuk memberikan gambaran tentang prospek pengusahaan gaharu oleh masyarakat melalui pola pengelolaan hutan berbasis masyarakat (PHBM). Departemen Kehutanan....... serta berbagai terbitan lainnya... waktu...Prospek Pengusahaan Gaharu .. benefit atau penerimaan pada tahun t...

................... tingkat diskonto. biaya pada tahun t.......................Aspek SOSIAL EKONOMI DAN KONSERVASI IRR = i1 + NPV1 NPV1 − NPV2 (i2 − i1) .. PROSPEK PENGUSAHAAN GAHARU A.... NPV2 = nilai NPV negatif mendekati nol.. tingkat diskonto untuk menghasilkan NPV1 mendekati nol......... Suatu bisnis dinyatakan layak secara finansial bilai nilai IRR lebih besar dari tingkat suku pinjaman di bank yang berlaku saat ini...... (3) dimana: B/C Bt Ct i n = = = = = Benefit Cost Ratio ( Rasio penerimaan-biaya). benefit atau penerimaan pada tahun t........... tingkat diskonto untuk menghasilkan NVP2 negatif mendekati nol....... nilai NPV mendekati nol positif....... nilai B/C dirumuskan sebagai beikut: n Bt ∑ t =0 (1 + i)t B/C = n Ct ∑ t =0 (1 + i)t ............ Kegiatan usaha dikatakan layak apabila B/C > 1.. umur ekonomis proyek......................... (2) dimana: IRR = i1 = NPV1 = i2 = Internal Rate of Raturn (tingkat keuntungan internal)............. Prospek Pasar Gaharu Indonesia adalah produsen gaharu terbesar di dunia dan menjadi tempat tumbuh endemik beberapa spesies gaharu komersial dari 162 ...... Selanjutnya........

beccariana.. Selanjutnya. karena sulitnya memperoleh bahan 163 .. malaccensis. 2004). Semakin sulitnya mendapatkan gaharu di hutan alam telah mengakibatkan semua pohon gaharu (Aquilaria spp. A. penghasil gaharu terbaik ke dalam daftar Ap-pendix II dan sejak saat itu ekspor gaharu dibatasi oleh kuota yaitu hanya 250 ton/tahun (Anonim. gaharu tidak hanya digunakan sebagai bahan wangi-wangian (industri parfum). 2005). Seiring dengan kemajuan ilmu pengetahuan dan teknologi industri. total ekspor gaharu dari Indonesia terus menurun hingga jauh di bawah ambang kuota CITES. tetapi juga digunakan sebagai bahan baku obat-obatan. tidak hanya dengan cara memungut dari pohon gaharu yang mati alami melainkan juga dengan menebang pohon hidup. malaccensis. jumlah ekspor gaharu Indonesia mencapai sekitar 1. Perkembangan yang terjadi selanjutnya ternyata kurang begitu bagus. beberapa agama di dunia mensyaratkan wangi gaharu yang dibakar sebagai sarana peribadatan (untuk keperluan kegiatan religi).400 kg tahun 2006. microcarpa. Namun dari sisi negara pengekspor. dan pengawet berbagai jenis asesoris. A.(Sri Suharti) marga Aquilaria seperti A. tingginya permintaan gaharu belum dapat dipenuhi karena kekurangan bahan baku bermutu tinggi untuk ekspor.. maka sejak tahun 2005 Departemen Kehutanan kembali menurunkan kuota ekspor menjadi hanya 125 ton/tahun (Anonim. namun eksploitasi hutan alam tropis dan perburuan gaharu yang tidak terkendali telah mengakibatkan spesies-spesies gaharu menjadi langka. 2005). Oleh karena itu pada tahun 1995 CITES memasukkan A. karena adanya kekhawatiran akan punahnya spesies gaharu di Indonesia. Selain itu. Permintaan terhadap gaharu terus meningkat karena banyaknya manfaat gaharu. Tingginya harga jual gaharu mendorong masyarakat untuk memburu gaharu. dan Gyrinops spp. Ekspor untuk pasar Timur Tengah sebagai contoh menurun dari 67.. dan lain-lain. filarial. kosmetika.245 kg pada tahun 2005 menjadi 39. Pada tahun 1985. Bahkan sejak tahun 2000. A. A.) dimasukkan dalam Apendix II pada konvensi CITES tanggal 2-14 Oktober 2004 di Bangkok (Gun et al.. hirta. Hal ini banyak dikeluhkan oleh beberapa eksportir gaharu Indonesia.487 ton.Prospek Pengusahaan Gaharu . dupa.

pada tahun 2006 hanya mampu mengekspor 2-3 ton/bulan (Adijaya.245 n/a Tahun 1995 1996 1997 1998 1999 2000 2001 2002 2003 *): CITES Management Authority of Indonesia.772 175. **): CITES Annual Report Data Compiled by UNEP-WCMC.000/kg untuk kualitas super. ≠): the reason for the unavailability of data for 1995 1nd 1998 is not known 164 . baik di pasar dunia maupun di tingkat pengumpul.826 70.000 225.000 75.000-50.000 75. Sebagai gambaran.577 293.000 150.002 n/a ≠) 313. Penurunan kemampuan ekspor Indonesia tersebut sudah diprediksi oleh berbagai pihak karena eksploitasi hutan dan perburuan gaharu yang tidak terkendali.826 n/a n/a Total ekspor gaharu (semua spesies)*) n/a≠ 299.000 225. Pada awalnya kenaikan harga gaharu relatif lambat. CV Ama Ina Rua.212 76. Tabel 1. Keluhan kekurangan bahan baku gaharu untuk ekspor juga dialami oleh pemasok pasar Singapura.546 n/a Net ekspor laporan CITES **) 323. filarial dan jenis lain 287.000/kg pada tahun 1993.000 70.000 kg) 148. harga gaharu di tingkat pengumpul berkisar antara Rp 30.377 74. Hasil pemanenan dan ekspor gaharu jenis Aquilqria spp.523 (termasuk A. Penurunan kemampuan ekspor Indonesia tersebut sangat berpengaruh terhadap perkembangan harga gaharu.079 81.002 (termasuk A.000 50. yaitu hanya naik menjadi Rp100.649 245.000 68.150 219.593 287.483 147.000 180.377 74.238 81. Pada tahun 1980.Aspek SOSIAL EKONOMI DAN KONSERVASI baku gubal super yang diminta.000 120.000 300. dari Indonesia tahun 1995 .000 Kuota hasil aktual*) n/a 160. Sebagai contoh.2003 Kuota hasil panen resmi*) n/a 300. Kenaikan pesat terjadi pada saat krisis ekonomi melanda Indonesia tahun 1997. eksportir di Jakarta yang pada tahun 2005 bisa mengekspor 5-6 ton/bulan.000/ kg untuk kualitas rendah dan Rp 80. pada Tabel 1 disajikan data hasil kajian tentang perdagangan gaharu di Indonesia yang diterbitkan CITES pada tahun 2003.401 81.593 305. 2009).000 Aktual ekspor berdasar CITES Indonesia*) n/a≠)) 299.filarial 180.000 150.000 300.000 50.

. dan Taman Buru 0. A.. Potensi dan Peluang Usaha Sebagaimana diuraikan sebelumnya.. malaccensis. dihasilkan gaharu sebagai salah satu hasil hutan bukan kayu yang bernilai ekonomi tinggi.31 juta ha. Indonesia memiliki potensi yang sangat besar untuk menghasilkan gaharu. dan Gonystilus yang keseluruhannya termasuk dalam famili Thymelaeaceae. terdiri dari Kawasan Suaka Alam dan Pelestarian Alam 23. 2009. Lao PDR. Kenaikan harga gaharu terus berlanjut dan makin tajam hingga mencapai Rp10 juta/ kg pada tahun 2000 dan meningkat lagi hingga mencapai Rp 15 juta/ kg pada tahun 2009 (Adijaya. Dari kawasan hutan tersebut khususnya dari kawasan hutan produksi alam. Philipina. Kondisi tersebut menggambarkan bahwa gaharu sangat prospektif untuk dikembangkan.(Sri Suharti) di mana harga gaharu mencapai Rp 3-5 juta/kg. namun potensi yang tersedia tersebut sampai saat ini belum dimanfaatkan secara optimal dan produksi gaharu lebih banyak berasal dari proses alami. Gaharu dihasilkan oleh pohon-pohon terinfeksi yang tumbuh di daerah tropika dan memiliki marga Aquilaria. sehingga produksi gaharu Indonesia terus menurun. 165 . A. 2007).65 juta ha. A.8 juta ha. Kamboja. Hutan Lindung 31. Gyrinops. A.23 juta ha (Departemen Kehutanan. Hutan Produksi Terbatas 22.6 juta ha. khususnya bagi Indonesia yang memiliki potensi biologis yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. hirta. Myanmar. 2006). Marga Aquilaria terdiri dari 15 spesies. B. cumingiana.5 juta ha. microcarpa. Malaysia. beccariana. Thailand. tersebar di daerah tropis Asia mulai dari India.Prospek Pengusahaan Gaharu . Hutan Produksi yang Dapat Dikonversi 22.09 juta ha. dan Indonesia. Pada saat ini luas kawasan hutan dan perairan Indonesia berdasarkan Keputusan Menteri Kehutanan tentang Penunjukkan Kawasan Hutan dan Perairan serta Tata Guna Hutan Kesepakatan (TGHK) tercatat seluas 137. Hutan Produksi Tetap 36. Enam di antaranya ditemukan di Indonesia (A. China Selatan. Pakistan.. Wiguna.

Pemanenan dapat dilakukan pada kondisi pohon belum mati. Serawak. Sabah. kecuali Jawa. Sembilan spesies di antaranya terdapat di Indonesia yaitu di Sumatera. 2007). Bali. Pembudidayaan tanaman penghasil gaharu dapat dilakukan secara monokultur maupun tumpangsari dengan tanaman lainnya. Philipina. Indonesia. sawit. Marga Gyrinops memiliki tujuh spesies. 2009) atau di bawah tegakan pohon hutan seperti meranti. sawit. dan Nusa Tenggara. Jika ditanam secara monokultur dan tanpa naungan resiko kegagalan penanaman (tanaman muda) lebih tinggi. Peninsula. dan Irian Jaya. HTI. kemedangan. durian (Rizlani dan Aswandi. Persyaratan tumbuh serta pemeliharaan tanaman penghasil gaharu relatif tidak terlalu rumit. Karena sifat permudaan gaharu yang toleran terhadap cahaya (butuh naungan). rekayasa produksi untuk menghasilkan gaharu sudah dapat mulai dilakukan dengan cara teknik induksi/inokulasi penyakit pembentuk gaharu yang sesuai dengan jenis pohon. pulai seperti yang dikembangkan di KHDTK Carita. Hutan Rakyat juga dapat ditanam pada areal tanaman perkebunan (karet. Papua New Guinea. Maluku. Enam di antaranya tersebar di Indonesia bagian timur serta satu spesies terdapat di Srilanka (Anonim. Beberapa alternatif pengembangan budidaya pohon penghasil gaharu selain pada hutan produksi (LOA).Aspek SOSIAL EKONOMI DAN KONSERVASI dan A. 2002). kelapa. Keberhasilan berbagai hasil penelitian 166 . tetapi idealnya dipanen setelah pohon mati dengan variasi mutu produksi akan terdiri dari kelas gubal. dan abu/ bubuk (Sumarna. Keenam jenis tersebut terdapat hampir di seluruh kepulauan Indonesia. dan kepulauan Solomon serta kepulauan Nicobar. mahoni. Kalimantan. Setelah tanaman penghasil gaharu berumur 5 tahun dengan diameter 15 cm. filarial). penanaman pohon gaharu sebaiknya dilakukan secara tumpangsari atau berada di bawah naungan tegakan lain seperti karet. Hasil rekayasa tersebut dapat dipanen satu atau dua tahun kemudian. Marga Gonystilus memiliki 20 spesies. Berbagai hasil penelitian tentang tanaman gaharu memberikan hasil yang sangat menggembirakan karena berbagai jenis tanaman gaharu dari hutan alam ternyata dapat dibudidayakan dan produksi gaharu dapat direkayasa. tersebar di Asia Tenggara mulai dari Malaysia. Bali. dan lain-lain).

.. Analisis finansial tersebut menggunakan beberapa batasan dan asumsi sebagai berikut: 1. 2008). Selanjutnya pada tahun 2001-2002 beberapa individu atau kelompok tani juga mulai tertarik untuk membudidayakan jenis pohon penghasil gaharu. sehingga kerapatan 400 pohon per hektar. kelas kemedangan II sebesar 40%.(Sri Suharti) tersebut makin mendorong dan menggugah pemburu gaharu untuk melakukan budidaya tanaman gaharu. PT Budidaya Perkasa di Riau dengan menanam A. Tanaman yang bertahan hidup dan menghasilkan gaharu diasumsikan 60% dengan tingkat produksi 2 kg per pohon. C. 167 . dan kelas kemedangan III sebesar 50%. berikut ini dilakukan contoh analisis finansial budidaya gaharu dengan asumsi tingkat keberhasilan mencapai 60%. Kelayakan Pengusahaan Gaharu Untuk memperoleh gambaran bagaimana kelayakan pengusahaan gaharu melalui budidaya dan rekayasa produksi gaharu. sehingga total produksi 480 kg/ha dengan 3 kualitas masingmasing kelas kemedangan I sebesar 10%. Di desa tersebut. Sebagai contoh usaha yang dilakukan oleh para petani di Desa Pulau Aro. sampai akhir tahun 2002 terdapat sekitar 116 petani yang tergabung dalam Kelompok Tani Penghijauan Indah Jaya yang telah mengembangkan lebih dari seratus ribu bibit gaharu (Anonim. Selain itu. Kecamatan Tabir Ulu.. microcarpa. malacensis dan A. Jambi.. 2. Kabupaten Merangin.Prospek Pengusahaan Gaharu . yang menanam gaharu dari jenis A. malaccensis seluas lebih dari 10 hektar. 2007). BP DAS Batanghari bekerjasama dengan Badan Litbang Kehutanan pada 2004/2005 membuat demplot budidaya gaharu di antara tegakan tanaman karet rakyat seluas 50 ha (Sumarna. Selain itu Dinas Kehutanan Riau juga menanam jenis yang sama seluas 10 hektar di Taman Hutan Raya Syarif Hasyim. Pengusahaan gaharu dilakukan pada luasan satu ha dengan jarak tanam 5 m x 5 m. Upaya pembudidayaan gaharu sudah mulai dirintis sejak tahun 1994/1995 oleh sebuah perusahaan pengekspor gaharu.

biaya bahan dan peralatan Rp 40. Analisis finansial menggunakan tingkat diskonto sebesar 15%. sedangkan upah tenaga kerja untuk inokulasi Rp 30. 4.350 juta. 2009).350 juta. 5. dan kelas kemedangan III = Rp 500 ribu/kg. Biaya tersebut meliputi biaya pra-investasi dan persiapan lahan serta penanaman sebesar Rp 26. Harga jual produksi gaharu hasil inokulasi untuk kelas kemedangan I = Rp 5 juta/kg. IRR sebesar 48.50 juta.50 juta. tenaga kerja untuk inokulasi. 6. Kalau diperhatikan lebih seksama. dan tenaga kerja untuk pemungutan hasil (panen) yang besarnya mencapai Rp 77 juta atau sekitar 54. kegagalan dalam melakukan inokulasi.74 juta/ ha. sehingga total biaya inokulan Rp 20 juta/ha.000/HK. Berdasarkan asumsi dan batasan tersebut ternyata untuk pengusahaan satu hektar gaharu dibutuhkan biaya sebesar Rp 141.000/pohon.32 (Lampiran 1).000/pohon. PROSPEK PENGUSAHAAN GAHARU DENGAN POLA PHBM A. Harga inokulan diasumsikan Rp 50. dan adanya pencurian pohon di kebun gaharu (Duryatmo.53%.47% dari total biaya. Peluang Pengembangan Gaharu dengan Pola PHBM Pembudidayaan tanaman penghasil gaharu akhir-akhir ini makin marak karena sebagian masyarakat sudah dapat menikmati hasilnya. dan B/C = 3. Upah tenaga kerja. Hasil analisis finansial menunjukkan bahwa pengusahaan gaharu tersebut layak untuk dilaksanakan karena dapat menghasilkan keuntungan bersih nilai kini (NPV) sebesar Rp 147. Namun di sisi lain juga dijumpai beberapa kasus ketidakberhasilan pengusahaan gaharu yang disebabkan antara lain oleh kegagalan dalam pemeliharaan. beban biaya yang relatif besar adalah untuk pembelian bahan inokulan. baik tenaga kerja keluarga maupun luar keluarga diasumsikan sebesar Rp 50. dan biaya tenaga kerja Rp 74. 168 .Aspek SOSIAL EKONOMI DAN KONSERVASI 3. kelas kemedangan II = Rp 2 juta/ kg.

pemeliharan. 169 .. Dengan pola ini diharapkan areal tanam dan juga kualitas dan kuantitas produksi gaharu akan dapat ditingkatkan. 2007). input produksi. keterampilan. sarana prasarana. Karena bentuk kerjasamanya adalah kemitraan. Masyarakat dengan keterbatasan sumberdaya yang dimiliki (lahan. dan di sisi lain. maka parapihak yang terlibat dalam kegiatan ini dapat memperoleh bagian/ sharing manfaat sesuai kontribusi masing-masing. masyarakat diharapkan melakukan penanaman gaharu pada lahannya sendiri terutama pada lahan kosong (tidak produktif ) secara swadaya. akses pasar.. Melalui pola PHBM. Pengembangan gaharu melalui pola PHBM merupakan salah satu alternatif peningkatan produksi gaharu melalui pelibatan masyarakat dalam budidaya gaharu. masyarakat) dapat berbagi peran dan tanggung jawab untuk mengembangkan tanaman gaharu. Pada areal hutan milik. baik di lahan milik di luar kawasan hutan maupun di kawasan hutan. dan pengelolaan hutan (Hayat. dan lain-lain) dapat ikut berperan dalam pengusahaan tanaman gaharu. Di satu sisi masyarakat dapat mendayagunakan potensi-potensi kehutanan untuk kesejahteraan mereka. masyarakat di dalam dan di sekitar kawasan hutan dapat menjadi aset bagi usaha-usaha penjagaan. perlu dikembangkan suatu pola kemitraan dalam budidaya tanaman penghasil gaharu.. meningkatkan peluang keberhasilan serta mengurangi resiko kerugian yang diderita. PHBM merupakan salah satu jawaban dari pergeseran paradigma dalam pengelolaan sumberdaya hutan dari yang berbasis negara (state based) ke arah yang berbasis komunitas/masyarakat (community based) (Indradi. baik dalam areal hutan milik (hutan rakyat) maupun dalam kawasan hutan Negara.(Sri Suharti) Untuk lebih membudayakan penanaman gaharu secara luas. pengusaha/investor.Prospek Pengusahaan Gaharu . parapihak yang tertarik (pemerintah. Perubahan paradigma ke arah PHBM menjadi momentum penting bagi masyarakat desa hutan.. kelompok usaha bersama/koperasi. Salah satu bentuk kemitraan yang dapat dikembangkan adalah melalui pola pengelolaan hutan berbasis masyarakat (PHBM). 2009). Pengembangan gaharu dengan pola PHBM dapat dilakukan.

sosial maupun ekologi. produktivitas meningkat serta kesejahteraan masyarakat akan meningkat pula. Pengadaan bibit dan inokulasi dapat difasilitasi oleh mitra kerjasama yang disalurkan kepada petani. Hal ini sesuai dengan paradigma pembangunan kehutanan yang lebih menitikberatkan pada peningkatan partisipasi masyarakat dalam pengelolaan hutan dan menempatkan masyarakat desa hutan sebagai patner/mitra menuju pengelolaan hutan lestari.Aspek SOSIAL EKONOMI DAN KONSERVASI Agar masyarakat bersedia menanam gaharu. Dalam prakteknya pengembangan hutan rakyat gaharu umumnya dikombinasikan dengan tanaman semusim atau tahunan lainnya yang sudah ada (tanaman sisipan). Berbagai hasil penelitian menunjukkan bahwa pola kerjasama kemitraan pengelolaan hutan dengan masyarakat desa hutan memberikan dampak positif. Dampak positif yang terjadi selanjutnya adalah sumberdaya hutan akan lebih terjaga dan terpelihara. maka pola tanam yang dikembangkan adalah pola tumpangsari (sisipan atau tanaman sela di antara tegakan yang sudah ada). Adanya peningkatan kesejahteraan dari budidaya gaharu selanjutnya akan mengurangi tekanan masyarakat terhadap sumberdaya hutan dalam bentuk illegal logging dan perambahan lahan bahkan masyarakat secara sadar akan mempertahankan 170 . baik dalam bentuk bantuan/hibah maupun melalui sistim kredit yang akan dibayar jika tanaman gaharu telah menghasilkan nantinya. Pengembangan tanaman gaharu dalam kawasan hutan dapat dilakukan melalui pelibatan masyarakat sekitar hutan dalam pengelolaan hutan. biaya inokulasi tanaman maupun informasi tentang peluang dan teknik pengembangan gaharu. Oleh karena kawasan hutan umumnya sudah ditumbuhi dengan berbagai jenis tumbuhan. proporsi tanaman gaharu yang ditanam disesuaikan dengan luasan dan kondisi areal hutan milik yang ada. maka perlu diberikan berbagai bentuk insentif. baik secara ekonomi. Keterlibatan masyarakat dalam pengelolaan hutan meningkatkan posisi tawar serta rasa memiliki masyarakat terhadap sumberdaya hutan yang ada. baik berupa pengadaan bibit. biaya tanam. Oleh karena lahan milik rakyat umumnya tidak begitu luas dan sudah ditumbuhi berbagai jenis tanaman.

Beberapa prinsip utama yang dipegang dalam pengembangan gaharu dengan pola PHBM adalah: 1. Sistim Bagi Hasil dalam PHBM Pengembangan gaharu dengan pola PHBM merupakan salah satu alternatif usaha yang dapat mengakomodasikan kepentingan ekologi di satu sisi dan pertimbangan ekonomi di sisi lain. Tanaman gaharu dipilih karena tanaman ini dapat tumbuh di dalam areal hutan yang sudah banyak ditumbuhi tegakan pohon dengan intensitas cahaya < 70%. Adanya tujuan bersama yang ingin dicapai. Beberapa skenario sebagai alternatif bentuk kemitraan yang dapat dikembangkan antara lain sebagaimana disajikan dalam Tabel 2. Menempatkan masyarakat sebagai mitra dalam pengelolaan hutan secara tidak langsung juga telah memposisikan masyarakat sebagai garda terdepan dalam pengamanan sumberdaya hutan. 2. Dari sisi masyarakat...(Sri Suharti) setiap jengkal hutan dari kerusakan. pemeliharaannya relatif mudah dan bernilai ekonomi tinggi. 2009).Prospek Pengusahaan Gaharu . 4.. apapun penyebabnya (Aswandi. pengembangan gaharu dengan pola PHBM memberikan peluang kepada masyarakat untuk memperoleh manfaat ganda yaitu dari hasil tanaman gaharu jika telah menghasilkan nantinya serta kesempatan untuk memanfaatkan lahan di antara tanaman untuk usahatani tanaman semusim. 3. Adanya pengaturan kerjasama yang saling menguntungkan dan adil sesuai dengan kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan bersama. B. Pengembangan kerjasama memang layak secara ekonomi dalam jangka panjang (sesuai jangka waktu kontrak perjanjian kerjasama).. Adanya kesepahaman tentang resiko dan konsekuensi dari adanya perjanjian kerjasama tersebut. 171 .

Petani. populasi tanaman gaharu dalam setiap garapan petani berjumlah relatif sedikit serta tidak seragam. 3. diharapkan masyarakat yang memiliki banyak keterbatasan. Besarnya bagi hasil yang diperoleh oleh masingmasing pihak yang terlibat dalam PHBM disesuaikan dengan kontribusi masing-masing pihak dan merupakan hasil kesepakatan bersama. Konsekuensinya. maka gaharu bukan merupakan komoditi utama yang diusahakan. teknologi serta akses terhadap pasar dapat ikut berpartisipasi dalam budidaya tanaman gaharu. Sebagaimana sifat usahatani skala kecil oleh masyarakat yang ketergantungannya terhadap lahan usahatani yang dimiliki/digarap sangat tinggi. Dengan demikian meskipun investor/penyandang dana 172 . 2. Gaharu diusahakan sebagai investasi jangka panjang. sepanjang modal yang dimiliki mencukupi untuk biaya budidaya tanaman berikut biaya inokulasinya yang cukup besar. Investor/Pengusaha. tergantung luas lahan garapan dan kepadatan tanaman yang ada.Aspek SOSIAL EKONOMI DAN KONSERVASI Tabel 2. baik dari segi permodalan. Alternatif bentuk kemitraan yang dapat dikembangkan Jenis input Skenario I 1 Lahan Saprodi Tenaga kerja Bahan inokulan Biaya inokulasi Pengolahan hasil Pemasaran √ √ √ √ √ √ √ 2 3 Skenario II 1 √ √ √ √ √ √ √ 2 3 Skenario III 1 √ √ √ √ √ √ √ √ √ √ √ √ 2 3 Skenario IV 1 2 3 √ √ Keterangan: 1. Berbeda dengan pengusahaan gaharu skala besar yang dilakukan oleh para investor. budidaya gaharu oleh masyarakat umumnya dilakukan dalam skala kecil dengan pola campuran. pengembangan gaharu dengan pola PHBM dapat dilakukan di areal hutan milik maupun di dalam kawasan hutan sepanjang persyaratan tumbuhnya terpenuhi. Dengan pola PHBM. Pemda/Pihak lain Sebagaimana diuraikan sebelumnya.

jengkol. Apalagi jika pengembangan kemitraan dengan pola PHBM bertujuan untuk meningkatkan kelestarian sumberdaya hutan (dalam hal ini tanaman gaharu yang sudah langka) dan meningkatkan kesejahteraan masyarakat desa hutan dan bukan semata-mata untuk tujuan komersial (mendapat profit terbesar).. belum tentu bagian hasil/sharing yang diperolehnya akan paling besar pula. Uji Coba Pengembangan Gaharu dengan Pola PHBM di KHDTK Carita Di areal KHDTK Carita. Banten. durian. cengkeh. Cangkara. dan hawuan. Kelompok masyarakat yang terlibat dalam kegiatan penelitian ini berasal dari Desa Sindang Laut dan Desa Suka Jadi tepatnya dari Kampung Longok. pulai. Kegiatan dilaksanakan dengan melibatkan masyarakat yang telah berusahatani di areal tersebut untuk ikut mengembangkan tanaman penghasil gaharu di lahan garapan mereka.Prospek Pengusahaan Gaharu .. Oleh karena areal kerjasama sudah ditumbuhi berbagi jenis tumbuhan. khaya. Uji coba ini merupakan kerjasama antara Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam dengan masyarakat sekitar areal KHDTK Carita. di areal tersebut juga terdapat berbagi pohon hutan seperti meranti.. dan nangka. Gaharu ditanam dengan jarak ± 5 m x 5 m. mahoni. C. Selain tanaman JPSG milik masyarakat. Banten pada tahun 2008 telah dikembangkan uji coba skema kemitraan budidaya tanaman penghasil gaharu dengan pola PHBM. Selama ini masyarakat ikut menggarap lahan di Petak 21 dengan budidaya berbagai tanaman jenis pohon serbaguna (JPSG) dan buah-buahan seperti melinjo. Dengan demikian jumlah 173 .(Sri Suharti) memberikan kontribusi input dengan porsi terbesar. Kegiatan dilaksanakan pada sebagian Petak 21 di areal KHDTK Carita dengan luas ± 40 hektar. petai. dan Cilaban sebanyak 49 orang (anggota Kelompok Tani Hutan Giri Wisata Lestari yang dipimpin Ustad Jafar sebanyak 40 orang dan Kelompok Tani Hutan Carita Lestari pimpinan Pak Rembang sebanyak 19 orang). maka pola tanam yang diterapkan adalah pola tumpangsari (sisipan di antara tanaman yang ada)..

Pihak pertama menyediakan jamur pembentuk gaharu untuk kegiatan inokulasi sebanyak 25% dari jumlah tanaman gaharu pada masing-masing penggarap setelah tanaman gaharu berumur ≥ 5 tahun. Pemda. Setelah diperoleh gambaran prospek partisipasi masyarakat dalam pembangunan demplot uji coba ini dilanjutkan dengan penyusunan rancangan teknis kerjasama penelitian dan penyusunan draft perjanjian kerjasama.000 pohon (± 400 pohon/ha). Pihak pertama menyediakan biaya bagi pihak kedua untuk melakukan kegiatan budidaya penanaman pohon gaharu yang meliputi biaya upah dan bibit tanaman. Pihak pertama akan memberikan pelatihan budidaya gaharu serta pemanenan gaharu (paket training gaharu) kepada pihak kedua. 174 . kegiatan pembangunan demplot uji coba tanaman penghasil gaharu di KHDTK Carita diawali dengan pendekatan yang lebih intensif kepada berbagai pihak yang terkait pengembangan gaharu di areal tersebut seperti Perhutani.Aspek SOSIAL EKONOMI DAN KONSERVASI tanaman gaharu yang ditanam di areal kerjasama sebanyak 15. dan masyarakat calon peserta untuk mempelajari prospek partisipasi masyarakat dalam kegiatan dan pemeliharaan tanaman. 5. 3. Beberapa prinsip utama yang disepakati antara pihak pertama (Puslitbang Hutan dan Konservasi Alam) dengan pihak kedua (kelompok masyarakat peserta uji coba) dalam pola kemitraan di areal KHDTK carita adalah: 1. 4. Pihak pertama memberikan pembinaan teknis budidaya tanaman gaharu secara rutin kepada pihak kedua. Sebelum penanaman. Dengan pendekatan yang lebih intensif ini diharapkan masyarakat akan lebih memahami tujuan kerjasama penelitian serta dapat lebih aktif berpartisipasi dalam budidaya tanaman plot uji coba. 2. Pihak pertama akan membantu mencarikan investor untuk bekerjasama menyediakan produksi jamur pembentuk gaharu untuk kegiatan inokulasi untuk 75% tanaman gaharu lainnya.

. Pihak kedua berkewajiban melaporkan setiap kejadian seperti serangan hama/penyakit tanaman.. baik pada tanaman gaharu atau tanaman lainnya di areal kerjasama.(Sri Suharti) 6.. Jika pada saat pemanenan tanaman gaharu ternyata ada tanaman yang mati/hilang/tidak/belum menghasilkan. kebakaran atau bencana lain yang mengakibatkan kerusakan sumberdaya hutan.5% dan LMDH (kelompok) 2. Selain pihak pertama dan pihak kedua. pihak pertama dan pihak kedua memperoleh hasil tanaman gaharu yang ditanam dan dipelihara di lokasi kerjasama dengan proporsi masing-masing 35% untuk pihak pertama dan 60% untuk pihak kedua. Pihak kedua berkewajiban memelihara dan menjaga keamanan tanaman gaharu dan tanaman hutan lainnya. Jika sudah menghasilkan. 10. 175 . sebagian hasil tanaman gaharu akan diberikan pada Desa Sindang Laut sebesar 2. 7. Pihak kedua berkewajiban mengikuti aturan teknis dan kaidah konservasi yang berlaku di dalam areal KHDTK Carita.Prospek Pengusahaan Gaharu . maka resiko akan ditanggung bersama sehingga perhitungan bagi hasil pada saat panen ditentukan dengan rumus sebagai berikut: = P akhir ∑ tan total − ∑ tan mati x P awal ∑ tan total Keterangan: Pakhir = Proporsi bagi hasil tanaman gaharu yang diterima masingmasing pihak jika ada tanaman yang mati/hilang/tidak/ belum menghasilkan = Proporsi bagi hasil tanaman gaharu sesuai kesepakatan yang tertuang dalam perjanjian kerjasama ini Pawal Butir-butir kesepakatan tersebut tertuang dalam naskah perjanjian kerjasama yang disusun berdasarkan hasil kesepakatan/ negosiasi antara pihak pertama dan pihak kedua.5%.. 9. 8.

DAFTAR PUSTAKA Adijaya. Info Pusat Standardisasi dan Lingkungan Departemen Kehutanan. Budidaya gaharu layak untuk dilaksanakan karena secara finansial akan memberikan keuntungan bersih nilai kini (NPV) sebesar Rp 147. GAHARU: HHBK yang Menjadi Primadona.53%. 3.co. Kerjasama kemitraan pengembangan tanaman penghasil gaharu dengan pola PHBM merupakan salah satu alternatif solusi untuk menjaga kelestarian hutan. 4. Anonim.go. Diakses 16 Februari 2009.id/ Halaman/STANDARDISASI_& _LINGUNGAN_ KEHUTANAN/INFO_V02/VI_V02. Gaharu sangat prospektif untuk dikembangkan. D. http:// www.dephut.online. Diakses 20 Januari 2009. khususnya bagi Indonesia yang memiliki potensi biologi yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. meningkatkan produktivitas lahan serta meningkatkan pendapatan masyarakat sekitar hutan.trubus. 2009. http:// www. 2002. 2. IRR sebesar 48. Gaharu: Harta di Kebun.Aspek SOSIAL EKONOMI DAN KONSERVASI KESIMPULAN DAN SARAN 1.32.74 juta/ha.id/mod. dan ekologi. ekonomi. 176 . Skema kemitraan dengan pola PHBM memberikan kesempatan kepada para-pihak yang berminat mengembangkan tanaman gaharu untuk bekerjasama sesuai dengan input/sumberdaya yang dimiliki dan memperoleh bagian hasil/sharing sesuai dengan kontribusi serta kesepakatan parapihak yang terlibat. dan B/C = 3.php?mod=publisher&op =viewarticle&cid=8 &artid=290. Prinsip utama yang dipegang dalam pengembangan kerjasama kemitraan dengan pola PHBM adalah prinsip kelestarian dan kelayakan secara ekonomi dalam jangka panjang sesuai jangka waktu kontrak serta saling menguntungkan berdasarkan nilai kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan sosial. Trubus online.htm. 5.

(Sri Suharti) Anonim. Eaglewood in Papua New Guinea. P. B. Blanchette.id.cites.edu/ agarwood. M. Anonim.ffi.html. Di akses 4 Maret 2009. Hayat.com/2009/01/ prospek-budidaya-gaharu-secara ringkas. Y. http://forestpathology. http://www. dan Aswandi. Sungadan. Jakarta. Gun.htm. Pelatihan Nasional: BUDIDAYA DAN PENGOLAHAN GAHARU. Chatteron. 2007.umn. 2005. 2009. 2008. 2009. Diakses 16 Februari 2009. L. Z. Diakses 16 Februari 2009. http://bpk-aeknauli. com/gaharu. http:// forestry-senu57. Perkembangan Gaharu dan Prospeknya di Indonesia.blogspot. http://laksmananursery.blogspot.id/id/news /1/tahun/2007/bulan/11/tanggal/17/id/ 60/. 177 . Perjalanan Panjang Pengelolaan Hutan Berbasis Masyarakat di Indonesia. 12 Februari. Indradi. 2009. Prospek Budidaya Gaharu Secara Ringkas. or. Mencari Solusi PHBM di Geumpang. Diakses 13 Januari. Rizlani.pdf. A. http:// www. 2007. Working paper No.org/eng /com/PC/14/EPC14-09-02-02-A2.trubus-online.com/2008/01 /perkembangangaharu-dan-prospeknya-di. R. Departemen Kehutanan. Review of Significant Trade Aquilaria malaccensis. http:// www.. Steven.cfans. Trubus online. 2009.. Sumari and P.html..bticnet. Access November. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES)..php?mod=publisher &op=viewarticle&cid=1& artid=1618. Sustainable Agarwood Production in Aquilaria Trees. 51. BUDIDAYA GAHARU : Alternatif Pemberdayaan Masyarakat Desa Hutan. Vietnam. http://fwi. Diakses 4 Maret 2009.org/index.or. Diakses 16 Februari 2009. Duryatmo. Tersandung Wangi Gaharu.php ?option=com_content&task= view&id= 74&Itemid=1. http://www. Depatemen Kehutanan. BIOTROP Training and Information Centre. Tropical Rain Fo rest Project. S... C.co. (2004). Diakses. Statistik Kehutanan Indonesia 2006. Aswandi. htm. 2003. 2009.Prospek Pengusahaan Gaharu .id/mod. Diakses 16 Februari 2009. Anonim.. 2009. 3 2008. 2006.

Sumarna. . Squidoo. Squidoo. Tinggi Permintaan Terganjal Pasokan. squidoo. Wiguna. http://www.php?mod =publisher&op=viewarticle& cid=8 &artid=290.trubus. http://www.com/agarwood Copyright © 2008. Trubus online.co. Jakarta. Direktorat Jenderal RLPS. 2008. Production and marketing of cultivated agarwood. Y.online. I.3 2008. Diakses 16 Februari 2009. Access November. Budidaya dan Rekayasa Produksi Gaharu.id/mod. LLC and respective copyright owners. 2007. Temu Pakar Pengembangan Gaharu. 2006.

dan pupuk kandang Rp 150/kg Harga inokulan Rp 50. KCl Rp 6000/kg. TSP Rp 7000/kg.3176 2500 1000 0 3500 16425 -16425 -21675 2500 1000 0 3500 7075 -7075 -28750 2000 500 0 2500 6850 -6850 -35600 1500 500 0 2000 6600 -6600 -42200 1500 500 12000 14000 39125 -39125 -81325 1500 500 0 2000 7125 -7125 -88450 1500 500 0 2000 6650 -6650 -95100 20000 25000 0 45000 46250 697750 602650 33000 29500 12000 74500 141350 602650 179 Catatan: Produksi gaharu 480 kg/ha dengan harga rata-rata Rp 1. Peralatan pertanian 7. Lain-lain Biaya pra investasi b. 744000 II.742 48. Lampiran 1. IV. IRR. Biaya bahan & peralatan 1. Keterangan I. 500 3000 1250 250 5000 0 0 0 0 0 250 0 250 6750 125 350 300 150 0 0 7675 0 125 350 300 300 0 0 1075 0 250 700 600 300 0 0 1850 0 250 700 600 300 250 0 2100 0 375 1050 900 300 0 20000 22625 0 2500 2500 250 5250 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 500 5500 20000 500 26500 6750 1750 4900 4200 1950 800 20000 40350 III. Harga bibit Rp 15. Sewa lahan 4. Pupuk TSP/SP-36 4. Nilai output Gaharu kemedangan I (10%) Gaharu kemedangan II (40%) Gaharu kemedangan III (50%) Cash outflow (Rp 1000) a. Cash inflow (Rp 1000) a.000/kg Harga gaharu K1= Rp 5 juta/kg.000/kg. Persiapan lahan & tanam 3. Bibit tanaman gaharu 2.000/tanaman . Tenaga kerja keluarga 2. B/C 0 0 0 0 5250 -5250 -5250 147. Tenaga kerja inokulasi Biaya tenaga kerja Total biaya Cash flow Cash flow komulatif a.53% 3. Bahan inokulan Biaya bahan & peralatan c. Tenaga kerja upahan 3. dan B/C dari Pengusahaan tanaman gaharu per hektar 0 0 0 0 0 0 0 0 0 480 744000 240000 384000 120000 0 0 1250 0 1250 0 375 1050 900 300 0 0 2625 0 250 700 600 300 300 0 2150 0 0 0 0 0 0 0 0 1 2 3 4 5 Tahun ke6 7 8 Total No. jumlah tanaman 400 phn/ha dibutuhkan 450 phn dg sulaman. K2= Rp 2 juta/kg dan K3=Rp 500. NPV (DF 15%) b.Lampiran 1.550. Pupuk Urea 3. Output (kg) b. Biaya tenaga kerja 1. Pra investasi 1. Harga pupuk urea Rp 2500/kg. Pupuk KCl 5. Analisis NPV. Pra-investasi 2.000/phn. Pupuk kandang 6. IRR (%) c.

Aspek SOSIAL EKONOMI DAN KONSERVASI 180 .

181 . Therefore there is a big opportunity for the Indonesian farmers to establish eaglewood plantation. the gaharu production may be considered low.10 THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo Lambung Mangkurat University. Only small group of farmers using introduced inoculants. There is a lack of information on factors influencing the success of gaharu formation.and in-side the forest in Indonesia. South Kalimantan INTRODUCTION Eaglewood (gaharu) may play an important role in gaining foreign exchange and as a source of income for people living in out. namely. soil properties and plant diversity surrounding the newly grown and existing gaharu stands in South Kalimantan Province. the gaharu export market remains open. Most of the gaharu formation usually relays on natural infection. The success of gaharu formation may not be only due to inoculants but may also be influenced by environmental characteristics (climate. climate. The present work focused on characterizing the environment. In South Kalimantan. soil properties and plant species). This is because.

0 2.6 2. air temperature and relative humidity. South Kalimantan.5 Layuh (2.4 oE 115.0 oS 3.1 115. The climatic data for all sites were represented by Kandangan weather station.6 22.8 3. Climatic Characters The climate parameters collected were rainfall. The data were supplied by the Weather Bureau in Banjarbaru. Location-wise.4 3. HST) Aluan (3) (HST) Bawan (HST) Gading (HST) Batung (HST) Layuh (HKK) (HST) Rasau (HST) Kambat (2. The sites located in Banjar. The selected study sites B.Aspek SOSIAL EKONOMI DAN KONSERVASI METHODS A. Site Distribution of selected sites for the project can be seen in Figure 1. 115.3 North 115. The data obtained were for the last 9 years observation.8 km 115. 14 sites would be used for newly planted eaglewood trees and 9 sites for inoculation trial. HST) Kalaka (HST) Kandangan (HSS) Madang (HSS) 115.6 Figure 1.2 Belanti (3) (HSS) Rejo (Banjar) 115. Hulu Sungai Selatan (HSS) and Hulu Sungai Tengah (HST). 182 .2 3.7 Wawai (HST) 115. The selected site were used for growing eagle wood and inoculation.4 2.

. The rainfall distribution can be observed in Figure 2a.. total nitrogen (N).The Environmental Characteristics . In each site. air temperature and relative humidity for the last 9 years are shown in Figure 2. Climatic Characters The average rainfall. RESULTS A. soil pH. cation exchange capacity (CEC). the content of total carbon (C).. plant species grown under gaharu tree were collected plant within area of 6x6 m2.(Erry Purnomo) C. The average annual rainfall in the study area was 2361. The pattern of air temperature and relative humidity are shown in Figure 2b and 2c. 183 . and CO2 evolution. Plant Diversity The diversity of plant species was determined to show its association with the success of inoculation. D.72 mm. electric conductivity (EC).. total potassium (K) and total phosphorus (P). Method used for particle fraction analysis was described in Klute (1986) and the methods for other soil properties were described in Page et al. (1982). The rainy season commenced in October and ended in July each year. respectively. Soil Properties Soil properties measured were particle fraction analysis. A significant low rainfall occurred in the period of July-September.

followed by clay and sand fractions. total potassium (K) and total phosphorus (P). the content of total carbon (C). Soil properties measures were particle fraction analysis. 184 . (1994). The particle fraction analysis (Figure 3) shows that all soil samples dominated by slit fraction. Bars indicate the standard error mean 9 years observation B. cation exchange capacity (CEC). Total nitrogen (N).Aspek SOSIAL EKONOMI DAN KONSERVASI 500 [a] 400 30 [b] 29 Air temperature (oC) 30 [b] 29 Rainfall (mm) 300 200 100 28 27 26 25 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month Air temperature (oC) 28 27 26 25 0 l t r r r r ary ary rch pri May June July gus mbe tobe mbe mbe nu ru Ma A Au pte Oc ove ece Ja Feb N D Se Month Figure 2. soil pH. and CO2 evolution. air temperature [b] and relative humidity [c] for the last 9 years. electric conductivity (EC). Soil Properties The soil properties of each site are presented in Figures 3-11. level of status of each soil property will be made available as categorized by Djaenuddin et al. The rainfall [a]. If applicable.

Particle fraction analysis of each soil 2.(Erry Purnomo) The category range of total C total content was very low to low (Figure 4). The total C of soil for each site 185 . Two sites. respectively.5 Moderate 2.The Environmental Characteristics .5 Total C content (%) 1.0 Low 1.. The N content of the soils (Figure 5) was generally low. It was found that Wawai and Belanti 13 sites had very low and moderate levels of N content. The low level of C and N content confirms the low level of organic matter content of the soil.. only 5 sites had low C.0 0.5 0.16 angsa andala awai dingin awa au (10 Kate g Hig adin (2 & 3 lanti 1 ng Lo gkinkin W as M W Man uh an aur G bat da Han Be TL R Lay Mad H Ma Kam Site Figure 3..0 Very low Be ti lan t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin . The K and P contents of the soils from all sites are demonstrated in Figures 6. Most of the soil classified as very low to low level of K concentration.. namely. Most of the selected sites contained very low C.16 gsa da i H i 15 T Lan Man Waw and Waasauyuh K ang ur Gaat (2Belandang angk M R La Mad Ha mb H Ma Ka Site Figure 4. 100 80 60 Sand Silt Clay % 40 20 0 n Bela 5 ti 1 t ) ) i s 3 g h 3 w . Mandala and Madang Low had K content of moderate level.

20 Total N content (%) Low 0. C.Aspek SOSIAL EKONOMI DAN KONSERVASI 0. there were 3-5 plant species. Only one site (Belanti 13) had a slightly acidic value (Figure 8). Only one site (Rasau 10) was categorized as very high (Figure 7).25 Moderate 0. Most of total P content of the soils was categorized as very low to low. Number of Plant Species It was observed that the number of plant species was varied from site to site (Figure 12). except for Hangkinkin site. all soils had EC below 1 mS cm-1 (Figure 9). The CEC of the soils were commonly low (Figure 10). Almost all the soil pH of the selected soils was categorized into very acidic to acidic category. respectively. The low CEC indicates a low storage cation capacity and results in prone to cation leaching. The total N of soil for each site One site (Rasau 10) had a very high K level. At 5 sites. The low EC readings may be associated with the far distance from the shore. There were 3 sites and 2 sites had CEC of moderate and high. The CO2 evolution as an indication microbial activity was similar site-wise (Figure 11).15 0. For EC reading. at Madang Low.10 0. it was observed that the microbial was lower than the other sites. The low EC readings indicate the absence of salinity problem.05 0. Except.00 Very low la n Be 16 ngsat dalawai 3 inginawai (10) ates High ding & 3) ti 13 Low inkin n a d W sau h K ng r Ga t (2 elan ang ngk 5ti 1 T La Ma W Man B ad Ha Ra Layu ada Hau mba M M Ka Site Figure 5. 186 .

.16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 7.. Total P content of soil for each site 187 . 1200 1000 Total K content (%) 800 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s i ...(Erry Purnomo) The other 8 sites had 5-14 plant species and one site had 22 plant species.16 gsa dalawai 3inginawa u (10 ate High ding & 3nti 13 Lowinkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2Belaadangangk M H L M d Ha am b a M K Site Figure 6.The Environmental Characteristics . Total K content of soil for each site 2600 2400 Total P content (%) 2200 2000 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s .

Electrical conductivity readings for soil each site Cation exchnage capacity (cmol[+]kg-1) 40 30 High 20 Moderate 10 Low Very low ) ) t s i g a 3 3 h n n . Soil pH for each site 130 Electric conductivity (mScm-1) 120 110 100 2 1 0 nt Bela ) ) t s .1 angs anda awanding aw au (uh Katng Hr Gadi (2 & lantiang Lngkink WRas y W Ma M BeMad Ha n ti 1 T L L a Ma d a H a u m b a t a Bela K Site 0 Figure 8.Aspek SOSIAL EKONOMI DAN KONSERVASI 7 Neutral Slightly acidic 6 Soil pH H2O 5 Acidic 4 Very acidic la i 3 6 in in ai 10) 3) 13 ow at es igh ng 5 .16 gsa dal ai ngi wa (10 ate Hig din & 3 ti 1 Low nki 15 T Lan Man Waw andi Wa asau yuh K ang ur Gaat (2Belan dang angki R La n ti a M H ad Ha m b a M M Bel Ka Site 0 Gambar 10. Cation exchange capacity of soil for each site 188 .16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 9.

June and October the rainfall ranged 132-151 mm.. 25 Number of plant species each site 20 15 10 5 t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin . The schedule of inoculation may have to consider the climatic condition throughout the year. The number of plant species found in each site 189 ..16 gsa da H i i 15 T Lan Man W aw and W a asau yuh Kdang ur Ga at (2 Belan dang angk M nti R La Ma H Ha amb Ma ela B K 0 Sites Gambar 12. The lowest rainfall was observed in the period of July-September ranging 54-84 mm.(Erry Purnomo) 2000 1600 1200 CO2 evolution (mg C kg-1) 800 400 0 an t Bel ) ) t s i g a 3 .The Environmental Characteristics .. In May.. CO2 evolution from soil from each site DISCUSSION The rainfall pattern was typical the study area.16 gsa dal wai 3 inginawa u (10 ate High din & 3nti 1 g Low inkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2BelaadanHangk M L M d Ha am b a M K Site Gambar 11. The highest rainfall occurred in the period of November-April ranging 215-358 mm.

It seems that there was a shading affect on the gaharu trees growth. Presto Janu Saputra and Storus for supporting the field work. It is too early to gain any conclusion on the effect of environmental characters on gaharu production. From field observation. Hulu Sungai Selatan and Hulu Sungai Tengah. This may result in the failure of gaharu formation. (1994) leads the need to amend to improve the soil fertility status. Mrs. Therefore. The annual total rainfall in the area under study was 2361 mm. However. Dr. improving the fertility status may results in healthier eaglewood trees. In general. namely. CONCLUSION The selected sites were distributed in regencies.Aspek SOSIAL EKONOMI DAN KONSERVASI The low fertility status according to Djaenuddin et al. I also acknowledge the anonymous reviewer who critically commented on the manuscript. 190 . Plants grown under the gaharu was quite divers from site to site. it was found that there was gaharu trees growth variation under different plan species grown surrounding the gaharu trees. The rainy season began in October and ease in June. M Yani. Maman Turjaman for the invitation to be involved in the project. ACKNOWLEDGEMENT I would like to thank ITTO for funding the work. Banjar. The healthy trees may immune to the infection. further study is still needed to investigate the relationship between soil properties or plant diversity on eaglewood growth or the success of inoculants application. the soil in each site was considered very poor. The number plant species were varied from site to site.

N.. Ds. Miller.. 191 .. D. Hakim. Versi 1.1188 Page. Bogor. Part 1 Physical and mineralogy methods.. 2nd Edition. Madison. Suwandi. and Jordens.. A. Subagjo. D.L.. J. Madison. and Keeney... Chemical and microbiological properties. ASA. Marsudi. A. 7. R. Land Suitability for Agricultural and Silviculture Plants. Suharta.R. Basuni.H. V. Bachri. S.. Klute. Center for Soil and Agroclimate Research. ASA. SSSA.. Laporan Teknis No. 2nd Edition.. (1982) Methods of soil Analysis. S. L. SSSA. Ismangun.0. (In Indonesian). M. E. H. Pp 1159.R. Sukardi.REFERENCE Djaenuddin. Hardjowigeno. Widagdo. April 1994. (1986) Methods of soil Analysis. Dai. Pp.

Aspek SOSIAL EKONOMI DAN KONSERVASI 192 .

.... Salah satu upaya yang dapat dilakukan adalah dengan mengembangkan tanaman gaharu dalam hutan tanaman di beberapa area. Wikstromeae spp. Enkleia spp.. (Chakrabarty et al.. microcarpa.. Dalam kegiatan penelitian ini difokuskan pada jenis-jenis pohon dari genus Aquilaria. maka keberadaan jenis ini perlu dipertahankan. seperti Aquilaria spp. dan Gyrinops spp. malaccensis dan A.(Pratiwi) 11 KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu hasil hutan non kayu yang mempunyai nilai penting..Karakteristik Lahan Habitat . 1986). 1994.. Oleh karena itu beberapa 193 . Aetoxylon spp.. Gaharu merupakan salah satu kayu aromatik penting. Awalnya gaharu berasal dari pohon tropika yang terinfeksi jamur. Genus ini termasuk dalam famili Thymelaeaceae.. Karena jenis pohon ini mempunyai nilai ekonomi tinggi. Ada beberapa jenis tumbuhan yang dapat menghasilkan gaharu. yaitu A. Sidiyasa et al. sehingga hasil hutan non kayu ini menjadi subjek pemanenan yang cukup tinggi. karena secara ekonomis jenis ini dapat meningkatkan devisa negara dan sumber penghasilan bagi masyarakat yang hidup di dalam maupun sekitar hutan. Gonystylus spp.

Diharapkan informasi ini dapat mendukung pengembangan hutan tanaman pohon penghasil gaharu. Dramaga. sebagaimana juga diharapkan dapat meningkatkan pendapatan dan kesejahteraan masyarakat. organisme. termasuk sifat-sifat tanahnya dan komposisi vegetasi tumbuhan bawah yang ada di sekitarnya. Tanah sebagai bagian dari suatu ekosistem merupakan salah satu komponen penyangga kehidupan. di samping air. dan Sukabumi. Secara administrasi pemerintahan. Pratiwi dan Mulyanto (2000) serta Jenny (1941) menyebutkan bahwa tanah merupakan hasil proses pelapukan batuan yang dipengaruhi oleh faktor-faktor iklim. Carita terletak di Kabupaten Pandeglang. dan waktu. maka penelitian ini bertujuan untuk mendapatkan informasi tentang sifat-sifat habitat pohon penghasil gaharu di hutan tanaman gaharu di daerah Carita. dan energi matahari. Tanah yang berbeda dengan sistem lingkungan yang bervariasi akan menentukan vegetasi yang ada di atasnya. Lokasi dan Waktu Penelitian Penelitian dilakukan pada bulan September 2008 di Carita. dan Sukabumi. maka tanah dan karakteristiknya akan berbeda-beda dari satu tempat ke tempat lain. Provinsi Banten sedangkan 194 . udara. Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah dan topografi serta vegetasi. agar kemampuan lahannya dapat diketahui. 1991). Sehubungan dengan hal tersebut di atas.Aspek SOSIAL EKONOMI DAN KONSERVASI informasi sehubungan dengan habitat pohon penghasil gaharu perlu diinventarisasi. dan iklim (termasuk iklim mikro) harus dipertimbangkan sebagai bagian dari ekosistem yang terintegrasi. jenis tanah. Selanjutnya Pratiwi dan Mulyanto (2000) menyatakan bahwa penyebaran tumbuhan. Sifat-sifat tanah yang spesifik mempengaruhi komposisi vegetasi yang ada di atasnya (Pratiwi. Dramaga. Sepanjang komponen tanah bervariasi. METODOLOGI A. sehingga keberadaan jenis ini dapat dilestarikan. topografi.

Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. 1951) dan curah hujan tahunan sekitar 3. Bahan lain adalah berupa data hasil analisis vegetasi untuk tingkat semai (termasuk tumbuhan bawah).959 mm. Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Pengamatan terhadap sifat-sifat tanah dan topografi dilakukan di dalam plot yang sama dengan pengamatan vegetasi. Kelembaban udara rata-rata berkisar antara 80% sampai 90%. Pengambilan Contoh Tanah Plot dibuat di area yang telah dipilih berdasarkan peta tanah Jawa dan Madura pada skala 1:500.. 1.Karakteristik Lahan Habitat . cangkul. dan vegetasi. C.. Bahan dan Alat Penelitian Sebagai bahan penelitian adalah contoh tanah yang diambil dalam plot penelitian di Carita. dan meteran. alat-alat survei lapangan seperti bor tanah. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. topografi. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. Dramaga. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. Kelembaban udara ratarata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. Temperatur udara bervariasi antara 24ºC sampai 30ºC.000 (Lembaga Penelitian 195 . Sedangkan alat yang dipakai dalam penelitian lapangan adalah alat-alat tulis. 2005). 1951) dan curah hujan sekitar 3.. Jawa Barat serta Sukabumi di Provinsi Jawa Barat. dan Sukabumi. Metode Penelitian Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah.600 mm per tahun. Munsell Color Chart. Jumlah contoh tanah yang diambil di masing-masing lokasi adalah sebanyak 6 buah.(Pratiwi) Dramaga terletak di Kabupaten Bogor..000 mm per tahun. B. 1951) dan curah hujan sekitar 3.

K. meliputi: a) sifat fisik yaitu tekstur.Aspek SOSIAL EKONOMI DAN KONSERVASI Tanah. Contoh tanah komposit diambil pada kedalaman 0-30 cm.3 m)>10 cm. dan semai. KTK. ketersediaan P. Mg. 1976). Contoh tanah diambil dari setiap horizon yang telah diidentifikasi untuk dianalisis di laboratorium. Kriteria pohon adalah tumbuhan dengan diameter setinggi dada (1.3 m) antara 2 cm sampai < 10 cm dan semai merupakan permudaan dari kecambah sampai tinggi < 1. Sedangkan tingkat semai dan tumbuhan bawah diamati dengan cara membuat petak 1 m x 1 m di dalam jalur pengamatan pohon dan belta. 2. Total tanah komposit yang dikumpulkan dari masing-masing lokasi adalah enam contoh (tiga untuk analisis sifat fisik tanah dan tiga untuk analisis sifat kimia tanah). Kemudian contoh tanah dicampur sesuai kedalamannya.5 m (Kartawinata et al. dan sifat kimia yaitu pH H2O. permeabilitas. Dengan demikian ada 18 contoh tanah yang dikumpulkan. Sifat-sifat tanah yang dianalisis. Seluruh semai dan tumbuhan bawah yang ada dicatat dan dihitung jumlahnya. belta. porositas. Seluruh jenis pohon dan belta dihitung dan diukur diameternya. Pengamatan vegetasi dilakukan terhadap semai dan tumbuhan bawah yang ada di bawah tegakan/pohon penghasil gaharu. Dua macam contoh tanah yang diambil adalah contoh tanah terganggu untuk analisis sifat-sifat fisik dan kimia tanah serta contoh tanah tidak terganggu untuk pengamatan sifat fisik tanah (porositas dan berat jenis tanah). Ca. Corg. berat jenis. 1981). 30-60 cm. Na. Pengamatan Vegetasi Pengamatan vegetasi dilakukan terhadap seluruh vegetasi yang ada dalam plot. contoh tanah diambil pada 20 titik yang tersebar di masing-masing horizon. KB. 1962). yaitu pada tingkat pohon. Ntotal. Plot-plot contoh berukuran 20 m x 20 m dibuat untuk pengamatan pohon dengan interval 20 m pada jalur sepanjang satu km. Pada setiap kedalaman tanah. Kriteria 196 . dan H+ (sifat kimia) (Blackmore et al. Sedangkan belta merupakan tumbuhan dengan diameter setinggi dada (1.. dan > 60 cm di setiap lokasi penelitian.. Sedangkan untuk pengamatan belta dilakukan dengan membuat petak berukuran 10 m x 10 m di sepanjang jalur tersebut dengan interval 10 m. Al.

. Pada masingmasing lokasi..5 m (Kartawinata et al. yaitu: SI = Dimana : 2w a+b SI = Similarity Index w = Jumlah dari nilai penting terkecil untuk jenis yang sama yang ditemukan pada dua komunitas yang dibandingkan (A dan B) a = Jumlah nilai penting dari semua jenis yang ada di komunitas A b = Jumlah nilai penting dari semua jenis yang ada di komunitas B 197 .. 1976). Analisis Data Sifat-sifat fisik dan kimia tanah dihitung sesuai dengan formula pada standar prosedur dari setiap karakteristik tanah kemudian ditabulasi untuk setiap horizon. Bogor. jalur dibuat sebanyak tiga buah masing-masing sepanjang 100 m. 1974). Indeks kesamaan jenis dihitung dengan menggunakan rumus Sorensen (Mueller-Dum-bois and Ellenberg. (1976). D. data yang diperoleh ditentukan spesies dominannya dengan menghitung nilai penting sesuai dengan rumus yang dikemukakan oleh Kartawinata et al. Plot-plot berukuran 1 m x 1 m diletakkan di jalur pengamatan vegetasi di dalam tegakan/pohon penghasil gaharu. Jenis yang diperoleh kemudian dibuat spesimen herbariumnya untuk diidentifikasi di laboratorium Botani dan Ekologi Hutan. dan dihitung jumlahnya serta diukur luas penutupan tajuknya.(Pratiwi) semai adalah permudaan jenis tumbuhan berkayu dari kecambah sampai tinggi < 1. Spesies dominan merupakan spesies yang mempunyai nilai penting tertinggi di dalam tipe vegetasi yang bersangkutan..Karakteristik Lahan Habitat . P3HKA. Seluruh semai dan tumbuhan bawah yang ada dalam plot dicatat nama daerahnya.. Untuk vegetasi.

1. Tipe mineral-mineral ini sangat dipengaruhi oleh sifat-sifat tanah. 198 . Kelembaban udara rata-rata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam.959 mm. Karakteristik Tanah di Daerah Penelitian Karakteristik tanah sangat dipengaruhi oleh faktor-faktor pembentukan tanah dan sifat-sifat tanah. Lokasi penelitian Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Topograpfi di daerah Carita bergelombang sampai bergunung sedangkan di Dramaga datar sampai bergelombang dan di Sukabumi bergelombang sampai berbukit. Kelembaban udara rata-rata berkisar antara 80% sampai 90%. Dramaga. khususnya sifat fisik dan kimia. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson.600 mm per tahun.Aspek SOSIAL EKONOMI DAN KONSERVASI HASIL DAN PEMBAHASAN A.000 mm per tahun. dan Sukabumi. Vulkanik material dari lokasi-lokasi ini memiliki sifat andesitik. yaitu Carita. 1951) dan curah hujan sekitar 3. 2005). Temperatur udara bervariasi antara 24ºC sampai 30ºC. Ini berarti bahan induk daerah ini kaya akan mineral-mineral ferro-magnesium dan beberapa mineral sebagai sumber elemen basa. 1951) dan curah hujan tahunan sekitar 3. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. 1951) dan curah hujan sekitar 3. Bahan induk tanah Carita adalah dari Gunung Danau sedangkan Dramaga dan Sukabumi masing-masing dari Gunung Salak dan Gede Pangrango. Faktor-Faktor yang Mempengaruhi Pembentukan Tanah di Lokasi Penelitian Penelitian dilakukan di tiga lokasi. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC.

2.. antara lain berkaitan dengan tekstur. Dari data tekstur tanah dapat dilihat juga bahwa tanah di dalam profil menunjukkan adanya akumulasi liat. gaharu ditanam secara monokultur dan ditanam masing-masing tahun 1993 dan 1999. Ketinggian daerah ini sekitar 100 meter di atas permukaan laut. nangka (Artocarpus integra). durian (Durio zibethinus) dan sebagainya. Hal ini mengindikasikan bahwa partikel tanah yang dominan adalah fraksi liat. melinjo (Gnetum gnemon). Sifat Fisik Tanah Sifat fisik tanah. microcarpa di Sukabumi.. microcarpa di Darmaga dan A. Spesies yang ditanam adalah Aquilaria crassna dan A. berat jenis. Oleh karena itu tanah ini diklasifikasikan sebagai ultisol. Tanah yang memiliki horizon argilik dapat diklasifikasikan sebagai alfisol atau ultisol tergantung kejenuhan basanya (KB). Data analisis tekstur tanah menunjukkan bahwa tanah di semua lokasi penelitian memiliki kelas tekstur liat. dan Tabel 6). Sedangkan di Dramaga dan Sukabumi. dan permeabilitas. Hasil penelitian sifat-sifat fisik tanah disajikan pada Tabel 1. dengan areal sekitar 5 ha dan dibangun pada tahun 1998 dengan total 346 pohon..Karakteristik Lahan Habitat . Pada tabel tersebut terlihat bahwa ketiga lokasi penelitian memiliki sifat-sifat fisik tanah yang relatif sama. umumnya pohon serbaguna seperti pete (Parkia speciosa). Berat jenis (BD) tanah di semua lokasi penelitian kurang dari 1 tetapi lebih dari 0. 199 . dan Tabel 3. Tabel 5. porositas. Sedangkan tanah di lokasi penelitian Sukabumi memiliki KB lebih dari 50% sehingga diklasifikan sebagai alfisol.8. Tabel 2.(Pratiwi) Penggunaan lahan di ketiga lokasi penelitian adalah hutan tanaman pohon penghasil gaharu. Ini berarti seluruh tanah di lokasi penelitian memiliki sub horizon argilik. Hal ini menunjukkan bahwa tanah di lokasi penelitian berkembang dari material vulkanik tuff. jenis yang ditanam adalah Aquilaria microcarpa. Sifat-Sifat Tanah a. Tanah di Carita dan Dramaga memiliki KB kurang dari 50% (Tabel 4. Pohon penghasil gaharu ditanam bersama dengan tanaman lain. Di Carita. Implikasi dari kelas tekstur ini adalah retensi air dan hara pada tanah ini relatif bagus..

55 6.13 Debu (%) 12.98 9.01 Tekstur Debu (%) 25.93 0.33 6.48 Kelas tekstur Liat Liat Liat 0. Sifat-sifat fisik tanah di lokasi penelitian Carita Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 8.35 57.57 69. Sedangkan berat jenis tanah di tiga kedalaman kurang dari satu.10 22.33 5.99 68.10 36.90 0.84 0. Sifat-sifat fisik tanah di lokasi penelitian Dramaga Sifat fisik Kedalaman (cm) Pasir (%) 0-30 30-60 > 60 0 30 60 8. Informasi ini menunjukkan bahwa terjadi fenomena pemadatan tanah (soil compaction) karena adanya injakan (trampling) dan mungkin adanya jatuhan butir-butir hujan dari batang pohon (stem fall).90 64. 1994).51 Liat (%) 66. Tabel 1.09 Liat (%) 79. sehingga tanah di lokasi penelitian termasuk dalam ordo andisol dalam sistem taksonomi tanah (Soil Survey Staff.45 66.85 Berat Jenis Porositas (%) Tabel 2.69 85.78 Kelas tekstur Liat Liat Liat 0.59 11.86 66.21 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 200 . porositas tanah di horizon permukaan lebih rendah daripada di bagian bawahnya.Aspek SOSIAL EKONOMI DAN KONSERVASI Data porositas tanah menunjukkan bahwa di semua lokasi penelitian.99 63.08 81. Hal ini menunjukkan bahwa tanah ini mempunyai sifat andik.87 0.33 8.96 65.

maka akan mengakibatkan kapasitas tanah menampung air dan udara menurun.86 0.49 84. Hal ini menunjukkan semakin ke dalam jumlah pori-pori semakin kecil yang diakibatkan antara lain oleh adanya pemadatan tanah. C. Zn. Namun demikian Bullock et al.73 5. dan Tabel 6. meliputi pH H2O. Mg. Cu. Namun demikian tanah-tanah di lokasi 201 .59 68. umumnya diikuti dengan penurunan persentase ruang pori atau porositas dan juga penurunan nilai permeabilitas tanah. di mana lokasi-lokasi ini merupakan hutan tanaman..54 Debu (%) 18. Hal ini terlihat pada lokasi penelitian..90 26. (1985) menyatakan bahwa nilai ini tergantung bukan saja oleh jumlah pori tetapi juga tingkat kontinuitas pori. Hal ini terjadi juga di ketiga lokasi penelitian. Fe. b.09 Kelas tekstur Liat Liat Liat 0. Nilai permeabilitas tanah menunjukkan laju pergerakan air.15 62. K.78 9. kecuali Sukabumi. Sifat-sifat fisik tanah di lokasi penelitian Sukabumi Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 12. Tabel 5. Sifat Kimia Tanah Sifat-sifat kimia tanah.97 0. kapasitas tukar kation (KTK).43 67.95 11. Keterangan yang lebih lengkap dapat dilihat pada Tabel 4. pH H 2O di semua lokasi penelitian umumnya kurang dari lima. N.37 Liat (%) 68.. Na. dan Mn..(Pratiwi) Tabel 3.75 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 Sedangkan porositas di lokasi penelitian menunjukkan bahwa semakin ke bawah porositasnya semakin kecil. Adanya pori-pori yang menurun jumlahnya. kejenuhan basa (KB).83 63.Karakteristik Lahan Habitat . Pratiwi dan Garsetiasih (2003) menyatakan bahwa pemadatan tanah dapat diakibatkan oleh karena injakan manusia. Ca. P tersedia. Peningkatan berat jenis tanah. Al.

Menurut Sutanto (1988). Unsur-unsur ini dikategorikan sebagai unsur hara makro (C. Walaupun tanah-tanah di lokasi penelitian berkembang dari bahan vulkanik andesitik yang kaya akan material-material basa. khususnya di horizon bagian atas. Di areal penelitian Dramaga. dan S) dan unsur hara mikro (Fe. Mo. Kandungan P di semua lokasi penelitian tergolong sangat rendah (< 2). K tergolong medium sedangkan di Carita dan Sukabumi masing-masing tergolong rendah dan tinggi dan Al+3 dan H+ rendah sampai sangat rendah di semua lokasi. B. Cu. Cl. carbon organik lebih tinggi daripada Sukabumi dan Dramaga. Ca. Carbon organik dan nitrogen total di lokasi penelitian menurun semakin ke bawah. tetapi di Carita. dan Co). Elemen penting lainnya adalah K. 202 . Hal ini dapat dimengerti karena di lokasi penelitian Carita. Hal ini menunjukkan bahwa dekomposisi bahan organik tidak terlalu kuat. Reaksi ini mempengaruhi ketersediaan unsur hara esensial. namun karena adanya proses pelapukan yang intensif dan juga adanya pencucian (leaching). Mn. Tanah dengan kandungan Al yang tinggi memiliki sifat toksik. Jumlah carbon organik relatif rendah di semua horizon. N.Aspek SOSIAL EKONOMI DAN KONSERVASI penelitian masih dikategorikan asam. Tumbuhan bawah merupakan sumber bahan organik. Mg. Pratiwi (2004 dan 2005) menyatakan bahwa unsur ini khususnya di lapisan atas mempunyai fungsi yang sangat penting dalam perkecambahan biji. dijumpai banyak tumbuhan bawah jika dibandingkan dengan lokasi penelitian Sukabumi dan Dramaga. ketersediaan dari unsur-unsur esensial ditentukan oleh bahan organik dan proses-proses dinamis yang ada di dalam profil tanah. bahan organik juga menyebabkan meningkatnya KTK dengan meningkatnya muatan negatif. Zn. P. K. Unsur hara esensial merupakan unsur yang diperlukan oleh tanaman dan fungsinya tidak dapat digantikan oleh unsur lain (Pratiwi. maka reaksinya asam dan kejenuhan basanya kurang dari 100%. Perbandingan C/N di semua horizon tergolong tinggi. O. Oleh karena itu di ketiga lokasi penelitian tidak ada bahaya keracunan Al. H. Rendahnya carbon organik dan nitrogen total berhubungan dengan rendahnya bahan organik. 2004 dan 2005). Al+3. Di samping pH. dan H+.

Kondisi ini relatif sesuai untuk pertumbuhan tanaman.12 (Rendah) Horizon 3 (>60 cm) 4.Karakteristik Lahan Habitat . Zn. Tanah dengan pH lebih tinggi umumnya memiliki KTK yang lebih tinggi. Tabel 5.07) sedangkan di Dramaga medium (16.(Pratiwi) Unsur hara mikro juga mempengaruhi pertumbuhan tanaman. dan Mn. Dari Tabel 4. Kandungan kation basa di Sukabumi termasuk tinggi sedangkan di Dramaga medium dan Carita termasuk rendah.. Kecenderungan ini terjadi di areal penelitian.43 (Rendah) 0.77). Hal ini disebabkan karena Sukabumi memiliki pH H 2O tertinggi. Jumlah kation tertinggi di areal penelitian terdapat di Sukabumi dan yang terendah di Carita. Tabel 4. Tanah dengan KTK tinggi dapat menyerap unsur hara. Unsur-unsur Fe.35-41. di mana pH daerah Sukabumi lebih tinggi daripada Carita dan Dramaga.70 (Rendah) 1. Unsur-unsur tersebut adalah Fe. Kapasitas tukar kation (KTK) menunjukkan tingkat kesuburan tanah.75) dan yang terendah adalah di Carita (13.. sehingga ketersediaan hara akan lebih bagus pada areal dengan KTK rendah. Cu. Tabel 4.11(Rendah) 203 .01-17. dan Tabel 6 mengindikasikan bahwa tanah di Sukabumi memiliki KB tinggi (39. KTK tanah dianalisis dengan larutan buffer NH4Oact pH 7 dan KTK sum of cation.60 (Rendah) 1. Tabel 5.0515. Ada kecenderungan bahwa daerah dengan pH yang tinggi memiliki kejenuhan basa yang tinggi pula.15 (Rendah) Horizon 2 (30-60 cm) 4. dan Zn relatif rendah sementara kandungan Mn sedang sampai relatif cukup.50 (Rendah) 1. kation basa didominasi oleh calcium dan magnesium. KTK tinggi berarti areal tersebut cukup subur. Sifat-sifat kimia tanah di lokasi penelitian Dramaga Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) Horizon 1 (0-30 cm) 4. Cu.. Di semua horizon dari tiga lokasi penelitian ini.. tetapi diperlukan dalam jumlah sangat sedikit.03 (Rendah) 0.03 (Rendah) 0. dan Tabel 6 menunjukkan secara jelas bahwa KTK NH4Oact pH 7 dari seluruh profil sangat tinggi daripada KTK sum of cation.

7 (Sangat rendah) 5.28 79.68 (Medium) 4.32 ( Medium) 1.17 (Rendah) 1.61 (Medium) 35. Sifat-sifat kimia tanah di lokasi penelitian Carita Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K 1.75 (Rendah) 0.50 (Rendah) 1.36 4.44 (Medium) 0.41 2.88 (Medium) 5.58 (Tinggi) 0.70(Medium) 0.01 1.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 1.70 (Sangat rendah) Horizon 2 (30-60 cm) 4.09 (Medium) 0.53 (Rendah) 0.26 (Medium) 3.7 (Sangat rendah) Horizon 2 (30-60 cm) 1.00 (Sangat rendah) 0.60 (Rendah) 0.30 (Rendah) 17.99 (Medium) 46.88 88.26 (Rendah) 16.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): Al H 0.24 85.64 4.44 (Medium) 0.31 (Medium) 0.40 5.60 1.14 (Rendah) 1.17 (Rendah) 1.26 (Rendah) 16.71 (Sangat rendah) 0.16 (Sangat rendah) 0.80 2.08 (Sangat rendah) 1.04 3.01 (Sangat rendah) 0.52 (Rendah) 0.20 (Sangat rendah) 204 .90 (Sangat rendah) 0.75 (Medium) 40.19 ( Medium) 0.20 Tabel 5.48 2.3 (Sangat rendah) Horizon 3 (>60 cm) 1.20 (Sangat rendah) Horizon 3 (>60 cm) 4.33 4.51 (Rendah) 0.29 (Medium) 1.49 (Sangat rendah) 0.60 (Rendah) 2.44 5.72 (Sangat rendah) 0.13 (Rendah) Horizon 1 (0-30 cm) 4.14 (Rendah) 1.16 (Rendah) 1.

04 1.01 (Rendah) 0.72 1.00 1.36 (Rendah) 0.43 (Medium) 36..84 (Rendah) 0.94 (Sangat tinggi) 0.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 0.60 (Rendah) 1.90 (Sangat rendah) Horizon 2 (30-60 cm) 5.49 7.22 (Rendah) 0.48 (Tinggi) 78.36 (Medium) 41.64 3.40 (Medium) 0.53 6.35 (Tinggi) 63.56 (Tinggi) 16..52 2.99 (Tinggi) 10.27 (Sangat rendah) 5.21 (Rendah) 13.07 (Medium) 0.71 (Tinggi) 0.20 (Rendah) 15.40 (Sangat rendah) 205 .11 (Rendah) 14.03 (Rendah) 14.Karakteristik Lahan Habitat ..80 16.08 1.64 (Tinggi) 10.05 (Sangat tinggi) 0.00 28.(Pratiwi) Sifat-sifat kimia Na KTK KB (%) KCl (me/100 gr): Al H 0.11 (Rendah) 3.40 Tabel 6.98 (Tinggi) 10.49 (Sangat rendah) Horizon 3 (>60 cm) 0.70 (Sangat rendah) Horizon 3 (>60 cm) 4.18 (Rendah) 3..68 2.60 (Rendah) 0.52 (Sangat tinggi) 0.07 (Sangat tinggi) 69.22 (Rendah) 13.22 (Rendah) 39.48 1.10 (Rendah) 2.60 17.86 (Tinggi) Horizon 1 (0-30 cm) 5.84 (Sangat tinggi) 14.10 (Rendah) 1.15 (Rendah) 3. Sifat-sifat kimia tanah di lokasi penelitian Sukabumi Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): 16.77 (Rendah) 16.49 (Sangat rendah) Horizon 2 (30-60 cm) 0.45 1.40 (Rendah) 0.

Dengan demikian untuk tingkat pohon.20 1. dan Sukabumi.30 Horizon 3 (>60 cm) 6. sapling serta tiang didominasi oleh gaharu. Tabel 7.36 B. Di Carita pohon Sukabumi 6 3 penghasil gaharu ditanam dengan sistem campuran dengan jenis tanaman serba guna sedangkan di Sukabumi dan Dramaga ditanam dengan sistem monokultur.76 (Sangat rendah) 0. Sistem penanaman di Carita yang multikultur. Dramaga. Areal ini merupakan hutan tanaman pohon penghasil gaharu. Komposisi Tumbuhan Bawah Hasil pengamatan menunjukkan bahwa komposisi jenis tumbuhan bawah di Carita lebih tinggi dibandingkan di Sukabumi dan Dramaga (Tabel 7).12 1.32 1.52 1.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 2.56 22. Oleh karena itu analisis vegetasi ditekankan pada tumbuhan bawah. Jumlah jenis tumbuhan bawah dan familinya di lokasi penelitian Lokasi penelitian Jumlah jenis Jumlah famili Ko n d i s i i n i a g a k nya k a r e n a Carita 30 18 perbedaan sistem penanaman dalam Dramaga 8 16 hutan tanaman tersebut.12 0.32 (Sangat rendah) 0.00 0. 2. Komposisi Vegetasi dan Spesies Dominan 1.36 1.40 17. mendukung beberapa anakan muncul dari jenis-jenis lain selain jenis tanaman penghasil gaharu. 206 .Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia Al H 0.44 1.40 (Rendah) 0.25 Horizon 2 (30-60 cm) 2.42 0. Umum Analisis vegetasi dilakukan terhadap vegetasi/tumbuhan bawah di Carita.56 26.

Indeks similaritas (%) dari dengan lainnya. yaitu material volkanik yang bersifat andesitik. Di Carita jenis dominan dan kodominan dari tumbuhan bawah yang ditemui adalah jampang (Panicum disachyum) dan selaginela (Selaginella plana) sedangkan di Dramaga adalah pakis (Dictyopteris iregularis) dan seuseureuhan (Piper aduncum) serta di Sukabumi adalah jampang (Panicum disachyum) dan rumput pait (Panicum barbatum) (Lampiran 1. 207 . Hal ini diindikomuni-tas tumbuhan di lokasi penelitian kasikan dengan nilai indeks similaritas yang rendah (<50%) Lokasi Carita Dramaga Sukabumi (Tabel 8). Carita - 9 - 35 9 - Darmaga Sukabumi - KESIMPULAN 1..(Pratiwi) 3. 4. nilai vegetasi ditentukan oleh peran dari jenis dominan. 1974) komposisi jenis tumbuhan bawah di tiap lokasi penelitian berbeda satu Tabel 8. Nilai ini merupakan hasil dari interaksi di antara jenis dengan kondisikondisi lingkungan.Karakteristik Lahan Habitat . topografi. Jenis dominan merupakan jenis yang mempunyai nilai penting tertinggi di dalam komunitas yang bersangkutan... Jenis Tumbuhan Bawah Dominan Secara ekologis. dan karakteristik tanah. Data ini mengindikasikan bahwa habitat dari masing-masing lokasi penelitian secara ekologis memiliki karakteristik yang berbeda-beda. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor lingkungan seperti iklim.. Hasil pengamatan menunjukkan bahwa jenis dominan dan kodominan masing-masing areal penelitian berbeda. Tanah di tiga lokasi penelitian memiliki bahan induk yang relatif sama. Indeks Kesamaan Jenis Tumbuhan Bawah Berdasarkan indeks kesamaan jenis menurut Sorensen (MuellerDumbois and Ellenberg. dan Lampiran 3). Lampiran 2.

Chakrabarty. New York. Di Carita tumbuhan bawah yang dominan adalah jampang (Panicum disachyum) dan jenis kodominan adalah selaginela (Selaginella plana). Trade in Agarwood. dan sifat-sifat tanah. LPT. A. Sehubungan dengan tingkat pelapukan. Tingkat kesuburan ini berhubungan dengan tingkat dari proses pelapukan. Factors of Soil Formation.A. topografi. Peta Tanah Tinjau Jawa dan Madura. Sedangkan di Dramaga jenis dominan dan kodominan masing-masing adalah pakis (Dictyopteris irregularis) dan seuseureuhan (Piper aduncum). 4. DAFTAR PUSTAKA Allison. Organic Matter by Walkey and Black methods. 6. Sifat-sifat fisik dan kimia tanah di areal penelitian mendukung pertumbuhan pohon penghasil gaharu. H. Jenny.E. Jenis dominan dan kodominan di masing-masing areal penelitian berbeda. serta di Sukabumi masing-masing jampang (Panicum disachyum) dan rumput pait (Panicum barbatum). Bogor. 5. 3. tanah Carita kurang subur dibandingkan dengan Dramaga dan Sukabumi. 208 . Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor-faktor lingkungan seperti iklim. McGrawhill. Black (ed. 1962. 1941. K. Perbedaan sifat-sifat fisik dan kimia tanah di lokasi penelitian disebabkan perbedaan tingkat proses pelapukan yang berhubungan dengan kondisi lingkungan dari proses pelapukan tersebut. Part II.Aspek SOSIAL EKONOMI DAN KONSERVASI 2. 1965. WWF-Traffic India. L. In C. Kumar and V. Menon.. 280 p. Soil Analyses. Lembaga Penelitian Tanah. Komposisi jenis tumbuhan bawah juga berbeda di tiap lokasi penelitian sebagaimana diindikasikan dengan nilai SI < 50%.). 1994.

Six Edition. Kementrian Perhubungan. John Willey and Son. 233 p. Rainfall Based on Wet and Dry Period Ratios for Indonesia with Western New Guinea. Revised ed. Buletin Penelitian Hutan 474: 59-66. Ciri dan Sifat Lahan Habitat Mahoni (Swietenia macrophylla King. Belgium. Indonesia. Jakarta. Forestry and Estate Crops Research Journal 1(1): 27-33. F. 42. Ellenberg. Prawira. Pusat Litbang Hutan dan Konservasi Alam. Soil Conservation Service. 1974. 1951. 21 p. Verhand.H. Report No. Soil Conservation Service. Schmidt. 306 p. 1984. Kalimantan Timur. S. A.(Pratiwi) Mueller-Dumbois.. Hutan Penelitian Carita. East Kalimantan.A.S. Minerlogy. Hubungan Antara Sifat-Sifat Tanah dan Komposisi Vegetasi di Daerah Tabalar.Karakteristik Lahan Habitat . dan R. International Training Center For Post Graduate Soil Scientists.. Gakuryoku XI(2):127-131. Sidiyasa. Indonesia. 2005. Djawatan Meteorologi dan Geofisika. PhD Thesis. Gent. Eksplorasi dan Studi Permudaan Jenis-Jenis Penghasil Gaharu di Wilayah Hutan Kintap.) di Beberapa Hutan Tanaman di Pulau Jawa. I. Pratiwi and B.. 68 p. Key to Soil Taxonomy.. and J. 2000. Sutanto. K. Pratiwi. ITC-RUG. Mulyanto.H. Sutomo. Ferguson. Pratiwi. S. Buletin Penelitian Hutan 644: 63-76. 209 . 2004. Kabupaten Berau.Agric. Kalimantan Selatan. 1994. 1986. United Stated Department of Agriculture. New York. D. 1991.U. Aims and Methods of Vegetation Ecology. Procedure for Collecting Samples and Methods of Analyses for Soil Survey. Dept. Charge Properties and Classification of Soils on Volcanic Materials and Limestone in Central Java. Universiteit Gent. Bogor. R. Pusat Litbang Hutan dan Konservasi Alam.. The Relationship Between Soil Characteristics with Vegetation Diversity in Tanjung Redep. West Java. Soil Survey Staff. MSc. 2005. Thesis. and H. 1988. Pratiwi.. Soil Characteristics and Vegetation Composition Along a Topotransect in The Gunung Gede Pangrango National Park.

43 1.29 5.05 2.43 2.36 6. Tapeinochilus teysmannianus K.25 0. Compositae 100.80 1.70 16.75 0.43 1.62 0. Graminae Curculigo latifolia Dryand. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Nama daerah Jampang Selaginella Harendong merah Cingcau Rumput pait Ilat Parasi Terongan Hatta Peletok Paku anam Pakis Sasahan Harendong Kokopian Mahoni Cacabean Alang-alang Hawuan Kakacangan Pacing Nama botani Famili Kr (%) Fr (%) Dr (%) NP (%) 47.09 2. Melastoma malabathricum L.25 21.43 25.80 Panicum disachyum Linn.71 1.10 0.23 0.43 1.93 1. Coniograma intermedia Hieron. Bridelia monoica L.91 2.49 1. Cyperus difformis Linn.66 8.80 1.00 100. Cecropia peltata L. Amaryllidiaceae Elaeocarpus glaber Blume Elaeocarpaceae Seuseureuhan Piper aduncum L.37 0.25 0.00 Keterangan: Kr Fr Dr NP : Kerapatan relatif : Frekuensi relatif : Dominansi relatif : Nilai penting 210 .25 0.25 0.82 3.72 4. Graminae Ageratum conizoides Linn.43 1. Selaginellaceae Melastomataceae Meraispermaceae Cyperaceae Solanaceae Polypodiaceae Moraceae Schizophyllaceae Polypodiaceae Dilleniaceae Melastomaceae Rubiaceae Meliaceae Rubiaceae Graminae Verbenaceae Zingiberaceae Piperaceae Rubiaceae Polypodiaceae Thymelaeaceae Leguminosae Euphorbiaceae Rubiaceae Panicum barbatum Lamk.98 0.43 1.25 0.93 1.25 0. Swietenia macrophylla King Morinda bracteosa Hort.43 1.25 0.99 10.12 0.50 0.30 2.50 0.93 1.48 0.99 3. Ixora sp.18 2. Imperata cylindrica Linn.43 1. Morinda bracteosa Hort.00 5.18 6. Dictyopteris irregularis Presl.25 0.75 1.62 0.45 0.39 3.17 7.05 2. Cyclea barbata Miers.25 0.58 10.Sch. Stachystarpheta jamaisensis Vahl.88 7.97 6.00 5.25 0.70 32.62 1.Chr.39 9.43 2.69 2.71 5.23 0.71 0.09 1.00 100.86 1.43 1.85 4.02 4.25 0.85 2. Tetracera indica L.00 14. Total Panicum montanum Roxb.43 1.52 5.81 10. Lygodium circinatum Sw.11 0.62 0.57 4.49 0.98 0.25 0.09 3. Clidenia hirta Don.83 9.50 0. Solanum jamaicence Mill.57 4.43 1.71 4. Parkia speciosa Hassk.12 0. Gagajahan Ki koneng Babadotan Pakis anjing Gaharu Pete Kanyere Cingcanan Plectronia sp.43 2.29 1.37 0. Dryopteris dentata C.28 57.25 0.25 0.00 300.28 22.30 2.25 0.23 0. Gramínea Selaginella plana Hiern.85 1.25 8.43 2.43 1.47 2.05 1.43 1.73 3.43 1. Aquilaria malaccensis Lamk. Nilai penting jenis tumbuhan bawah di Carita No.12 0.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 1.76 7.17 2.12 81.00 9.75 0.

72 16. Piper aduncum Linn.53 100.76 5.55 3.89 100.78 30.72 11. Ageratum conizoides Linn.00 NP (%) 74. Micania scandens Willd. 1 2 3 4 5 6 7 8 Nama daerah Pakis Seuseureuhan Tales Nama botani Dictyopteris irregularis Presl.00 Dr (%) 28.16 37.19 22.08 34.04 43.00 16.06 19.64 11.(Pratiwi) Lampiran 2.89 11.03 5..00 Fr (%) 16. Nilai penting jenis tumbuhan bawah di Dramaga No. Total Zingiberaceae Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 211 . Compositae Tapeinochilus teysmannianus K.Sch.21 57.72 16.52 5.00 Rumput pait Panicum barbatum Lamk.03 16.25 20.14 100. Alocasia sp..Karakteristik Lahan Habitat .71 5.41 11.72 11.56 300.76 5.71 5.89 17.76 5.14 1.42 1... Famili Polypodaceae Piperaceae Araceae Graminae Gramínea Compositae Kr (%) 29. Rumput padi Areu Babadotan Pacine Oryza grandulata Nees.

74 2.00 NP (%) 139.35 22.67 16.16 100.33 100.00 Fr (%) 33.71 14.00 Dr (%) 50. Euphatorium pallascens DC.28 3.24 4. Total Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 212 . Nilai penting jenis tumbuhan bawah di Sukabumi No. Famili Gramínea Graminae Melastomaceae Compositae Kr (%) 56. Compositae Graminae Alang-alang Imperata cilíndrica Linn.56 24.33 16.57 100.38 4.14 30.9 58.62 16.34 16.67 8. 1 2 3 4 5 6 Nama daerah Jampang Nama botani Panicum distachyum Linn.06 300.94 32. Ageratum conizoides Linn.67 8.00 Rumput pait Panicum barbatum Lamk.00 17.Lampiran 3.57 3. Harendong Babadotan Kirinyuh Clidenia hirta Don.87 10.76 7.

Jenis pohon penghasil gaharu menghasilkan resin yang memiliki aroma wangi dan jenis-jenis yang menghasilkan gaharu dengan 213 . 2002). dengan nama perdagangan “agarwood/aloe-wood/ eaglewood”. 2001. SUMATERA Titiek Setyawati Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu. A. Gaharu banyak diproduksi di Indonesia. microcarpa.12 POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk. A. filaria. negara penghasil gaharu terbesar di dunia. Gaharu merupakan komoditi hasil hutan bukan kayu yang banyak diminati oleh pasar luar negeri (Soehartono dan Newton. hirta. malaccensis Lamk. 2000). seperti A. beccariana. Indonesia juga merupakan habitat endemik beberapa jenis gaharu komersial dari marga Aquilaria.2 milyar rupiah ke kas negara pada tahun 1995.. Bagi Suku Dayak Punan di Kalimantan Timur. Heyne. bahan obat serta juga kulitnya dapat dibuat untuk bahan tali atau kain (Puri. gaharu merupakan komoditi hasil hutan non-kayu penting. karena merupakan sumber pendapatan terbesar yang memiliki nilai pasar tinggi (Kaskija. selama ini banyak dikenal sebagai bahan untuk membuat wangi-wangian. A.) DI PROVINSI LAMPUNG DAN BENGKULU. dan lain-lain. Zuhud 1994). 1987. A. Indonesia merupakan salah satu eksportir terbesar produk gaharu dan sudah menyumbangkan sekitar 6.

Berdasarkan hasil pengamatan di lapangan. kedelapan jenis tersebut masuk dalam marga Aetoxylon (1 jenis). Pada umumnya gaharu diperdagangkan dalam tiga kelompok sortimen. baik batang maupun akar pohon secara kimiawi oleh beberapa jenis jamur.000. keberadaan serta potensi pohon penghasil gaharu yang ada di Indonesia sampai saat ini masih belum terkoleksi dengan baik. dan abu gaharu. dan 4. sejak tahun 1994 gaharu masuk dalam Appendix II daftar CITES (Soehartono dan Newton. dan Wikstroemia (2 jenis). Karena eksploitasi yang intensif sehingga mengancam keberadaanya di alam. Resin yang dihasilkan memiliki aroma wangi yang merupakan ciri khas dalam menentukan kualitas gaharu. Gaharu dihasilkan dari proses pembusukan atau infeksi. 2007). Jenis yang saat ini banyak dipanen di Irian Jaya sudah sangat terancam keberadaannya.Aspek SOSIAL EKONOMI DAN KONSERVASI kualitas tinggi banyak diperdagangkan ke luar negeri. gaharu ternyata dihasilkan tidak dari satu jenis pohon saja melainkan dari berbagai macam jenis.87 pohon/ha (Sumatera). Satu pohon biasanya dapat menghasilkan 0. Aquilaria (2 jenis). Meskipun jumlah ekspor gaharu saat ini mengalami penurunan pesat dibandingkan dengan tahun-tahun sebelumnya. Menurut Sidiyasa (1986) dalam Mai dan Suripatty (1996). 2001).5 sampai 4 kg gaharu dengan harga di tingkat pencari Rp 700.37 pohon/ha (Kalimantan).33 pohon/ha (Irian Jaya) (Anonim. kemedangan. Usaha budidaya jenis pohon penghasil gaharu juga belum banyak mengalami perkembangan yang nyata dan produk gaharu masih lebih banyak dipanen dari hutan alam. Potensi yang diperkirakan ada saat ini yaitu 1. Nusa Tenggara Barat. 3. jenis pohon penghasil gaharu dari marga Aquilaria dan Wiekstroemia memiliki lebih dari 2 jenis (Sellato. Dalam proses selanjutnya. Sumatera. Nusa Tenggara Timur. karena eksploitasi yang berlebihan (Zich dan Compton. 2001) dan bahkan semua jenis penghasil gaharu (Aquilaria spp. 2001) yang tumbuh tersebar di Indonesia. serta Irian Jaya. yaitu gubal gaharu. Enkleia (1 jenis). Hampir sebagian besar jenis dapat ditemukan di Kalimantan. Dari beberapa pustaka yang ada. Bahkan beberapa jenis sudah menjadi langka akibat perburuan jenis-jenis tertentu yang tidak terkendali.untuk kualitas super. masingmasing sortimen akan dibedakan lagi berdasarkan kelas mutunya. informasi mengenai jenis. dan Gyrinops 214 . Gonystylus (2 jenis).

Harga gaharu saat ini sangat bervariasi tergantung dari kualitasnya. Dengan usia tanam dari 6 hingga 8 tahun gaharu mampu menghasilkan getah sekitar dua kilogram. 2000) dan sudah memberikan sumbangan kepada pemasukan negara sejumlah 6. Mengingat harga gaharu yang demikian tinggi. Makalah ini bertujuan untuk memberikan informasi menyangkut aspek potensi dan persebaran gaharu (A. karena berbagai macam alasan yang menyangkut status konservasinya.) di Provinsi Lampung dan Bengkulu. maka diperlukan upaya serius dari berbagai macam pihak yang berkepentingan agar keberadaan jenis-jenis tersebut di Indonesia dapat dipantau. 1997 dalam Soehartono dan Newton. Untuk jenis gaharu yang terbaik di kelasnya harganya bisa melebihi 20 juta rupiah per kilogram tergantung kualitasnya (Anonim. malaccencis Lamk.. Masyarakat di lokasi hutan di Sumatera pada umumnya mengumpulkan gaharu dalam kelompok yang masing-masing terdiri dari 3 sampai 5 orang. Harga gaharu saat ini bervariasi mulai dari 5 juta hingga 20 juta rupiah per kilogramnya. diperlukan upaya eksplorasi dan konservasi. Mengingat keberadaan jenis-jenis pohon penghasil gaharu yang mulai langka dan terancam punah. Indonesia dikenal sebagai negara penghasil gaharu terbesar (Direktorat Jenderal PHPA.Potensi dan Kondisi .2 milyar rupiah di tahun 1995.) masuk dalam Appendix II CITES sejak tahun 2004.. Selama beberapa dekade ini. Mengingat semakin terancamnya keberdaan jenis pohon penghasil gaharu yang ada di habitat alaminya.(Titiek Setyawati) spp. maka diharapkan tersedia bukti yang kuat menyangkut status jenis-jenis pohon penghasil gaharu di Indonesia. Dengan tersedianya informasi yang memadai. maka tidaklah heran jika gaharu sangat dicari oleh para pedagang sedangkan pemanenan masih mengandalkan gaharu yang tumbuh di alam dan pencarian dilakukan oleh masyarakat lokal yang memiliki akses masuk ke dalam hutan. Sumatera. baik dari sisi potensi dan persebarannya. Kelompok tersebut biasanya akan tinggal di hutan selama lebih kurang seminggu untuk mencari 215 . 2009). baik ek-situ maupun in-situ... diharapkan jenis ini dapat keluar dari daftar CITES sebagai jenis yang harus dilindungi.

Aspek SOSIAL EKONOMI DAN KONSERVASI gaharu di pedalaman hutan. Namun demikian masih ada beberapa lokasi hutan alam. METODE PENELITIAN A. Lokasi Penelitian 1. Pada saat ini. Kecamatan Pesisir Selatan. Kabupaten Lampung Barat. Seksi Krui. Kondisi hutan sebagian sudah dialihfungsikan menjadi lahan perkebunan dan ladang masyarakat. Seringkali terjadi bahwa kualitas gaharu tidak seperti yang mereka inginkan dan pada akhirnya pohon yang sudah terlanjur ditebang ditinggalkan begitu saja di hutan. Areal penelitian masuk dalam Seksi Konservasi Wilayah II Krui dengan luas kawasan ± 96. Resort Biha. Kecamatan Pubian. Kawasan Hutan Biha masuk dalam Blok Hutan Podomoro. Pugung 216 . pencarian gaharu makin sulit akibat potensinya yang mulai menurun. Kabupaten Lampung Tengah. sehingga orang harus tinggal lebih dari 2 minggu atau bahkan sebulan hanya untuk mendapatkan gaharu. Lampung Survei jenis-jenis pohon penghasil gaharu di Provinsi Lampung dilakukan di satu lokasi yang ada di dalam kawasan Taman Nasional Bukit Barisan Selatan (Hutan Biha) dan dua lokasi di luar kawasan TNBBS. Kondisi topografi di hutan alam ini sedikit berbukit dengan beberapa lokasi memiliki kelerengan hingga 35 derajat.884 ha dengan cakupan wilayah meliputi Resort Merpas. yaitu di Hutan Bukit Rupi dan Hutan Gunung Sugih. Kawasan Hutan Bukit Rupi berada di Desa Segala Midar. Kawasan Hutan Bukit Rupi berada di luar kawasan TNBBS namun demikian merupakan kawasan hutan lindung yang dikelola oleh Dinas Kehutanan Provinsi Lampung Tengah. tepatnya di Kabupaten Lampung Tengah. dimana ditemukan tegakan gaharu yang masih utuh. Lokasi survei berada di Desa Sumur Jaya. maka mereka akan menebang pohonnya secara manual menggunakan kampak. Jika gaharu ditemukan.

Kawasan hutan TNBBS ini terletak di ujung selatan dari rangkaian pegunungan Bukit Barisan dan secara geografis berada pada 4031’5057’ LS dan 103024’1 0 4 0 BT s e d a n g k a n secara administratif p e n ge l o l a a n te r b a g i d a l a m t i g a w i l aya h pengelolaan. Bengkulu Lokasi kedua kawasan hutan sangat berdekatan dengan Tahura Rojolelo yang terletak di antara 03 42’-03 44’LS sampai 102 21’BT dan berada di ketinggian 10-30 m dpl. yaitu Seksi Konservasi Wilayah I Liwa. Topografi kawasan ini bergelombang dan berbukit-bukit dengan ketinggian berkisar antara 0-1.964 m dpl. S e k s i Ko n s e r va s i jenis-jenis pohon penghasil gaharu Wilayah Krui. Gambar 1. dan Seksi di Provinsi Lampung Konservasi Wilayah III Sukaraja.. Lokasi penelitian secara detil tertera pada Gambar 1.000-3. Krui.500-3.. Peta lokasi survei dan pengamatan 2. Waktu tempuh dari pusat kota Bengkulu sekitar 30 menit dengan jarak sekitar 20 km (Gambar 2).(Titiek Setyawati) Tampak..000 mm/ th. Curah hujan ratarata di bagian barat adalah 3.Potensi dan Kondisi ..500 mm/th sedangkan di bagian timur 2. dan Biha. 217 .

antara lain alkohol 96%. kelapa sawit. Talang Empat) dan Pungguk Gambo (Kec. dan tali rafia. B. kompas. GPS Garmin 12 satelit. pisang. Alat yang digunakan untuk pengambilan data di lapangan. larutan sub-limat. Bahan dan Alat Bahan yang dijadikan sebagai obyek kegiatan ekologi. dan tanaman palawija lainnya. pena/alat gambar. Tanaman yang umum ditanam antara lain padi. kertas koran. tambang nilon. kertas gambar spesial. tinta gambar spesial. jeruk. Bengkulu Utara Kawasan hutan dekat Desa Tanjung Terdana sebagian besar sudah dikonversi menjadi areal persawahan dan perkebunan masyarakat. Pondok Kelapa). BAHAN DAN ALAT A. jati. Prosedur Kerja Kajian lapangan di Kabupaten Lampung Tengah dan Lampung Barat dilakukan pada bulan Oktober dan Desember 2007 sedangan 218 . karet. karung plastik. kamera digital. kantung plastik. kertas plak herbarium. Lokasi penelitian di Kawasan Hutan Binjai Temula (Kec. dan potensi sebaran jenis pohon penghasil gaharu ini adalah semua jenis pohon yang diduga menghasilkan gaharu yang terdapat di kawasan hutan lindung. baik primer dan sekunder. alat plak herbarium. fenologi.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 2.

200-500 m. data kondisi lingkungan tempat tumbuh. Pengamatan pertama di Bengkulu dilaksanakan di Hutan Lindung Kelompok Hutan Binjai Temula. yaitu antara 0-200 m. Koleksi data primer di lapangan mencakup keanekaragaman jenis pohon penghasil gaharu dan kondisi lingkungan tempat tumbuhnya dengan menggunakan metode eksplorasi dalam jalur-jalur yang sistematik. Kuesioner dipersiapkan sebelum kegiatan lapangan dilakukan. yaitu pada bulan Oktober dan Desember 2008. Ketinggian tempat di lahan kering ada 3 macam. Desa Tanjung Terdana. antara lain: 2. yakni topografi datar (kemiringan lereng kurang dari 10%) dan bergelombang berat (kemiringan 25% atau lebih). Untuk itu digunakan blanko isian mencakup data pohon. Eksplorasi dilakukan di berbagai kondisi hutan. 1. Kecamatan Talang Empat dan yang kedua di Hutan Lindung Kelompok Hutan Pungguk Gambo. dan 5 orang tenaga teknis lapangan. Provinsi Bengkulu dilaksanakan dua kali. Kegiatan pengamatan dan pengukuran di lapangan dikerjakan oleh seorang peneliti. Waktu pengamatan lapangan masing-masing selama 8 dan 10 hari.. 3 orang teknisi. dan data penggunaan tradisional penduduk setempat. Beberapa contoh pohon akan diambil untuk keperluan identifikasi dan koleksi herbarium. Di samping itu dibuat juga blangko isian tersendiri yang digunakan untuk bahan wawancara dengan penduduk yang berisi pertanyaan-pertanyaan menyangkut berbagai macam informasi tentang karakter jenis-jenis pohon penghasil gaharu yang dikenal oleh penduduk setempat. Panjang tiap jalur eksplorasi yaitu 1 km dengan jarak antar jalur 500 m.(Titiek Setyawati) Kabupaten Bengkulu Utara. 219 .. Pengamatan dan analisis gaharu meliputi beberapa macam kegiatan. Kecamatan Pondok Kelapa. 3..Potensi dan Kondisi . baik di lahan kering maupun lahan basah. Pengumpulan data lapangan.. baik secara langsung melalui wawancara dengan masyarakat yang tinggal di dekat dan sekitar hutan maupun tidak langsung dengan cara melakukan kajian pustaka. dan lebih dari 500 m dpl dengan topografi yang berbeda. Desa Dusun Baru.

Aspek SOSIAL EKONOMI DAN KONSERVASI 4. Estimasi regenerasi jenis-jenis pohon penghasil gaharu yang terdapat di kawasan hutan dengan cara menghitung permudaan tingkat semai (tinggi kurang dari 150 cm). Pengolahan data hasil wawancara dengan masyarakat lokal. maka dibuat risalah anakan menggunakan metoda jalur transek sepanjang 1 km dari titik anakan pertama ditemukan. Pada tiap titik pusat kuadran dilakukan perisalahan 4 individu pohon penghasil gaharu atau pohon lainnya yang terdekat dengan titik pusat atau 1 individu pohon pada tiap kuadran. Mengadakan pendugaan potensi dan sebarannya dengan menggunakan metode titik pusat kuadran (quadrant center point method) sepanjang jalur eksplorasi dengan jarak antara titik pertama dan titik berikutnya 50 m. 7. Selanjutnya dibuat petak 10 m x 10 m di setiap selang 200 m dari jalur transek. Pengolahan data potensi keberadaan jenis pohon penghasil gaharu dan wilayah sebarannya yang terdapat di dalam kawasan hutan alam. Individu pohon tersebut yang dirisalah dibatasi jarak terjauh 25 m dari titik pusat kuadran dan diameter batangnya 20 cm atau lebih. Pembuatan tally sheet untuk mengisi data tentang masa berbunga dan berbuah jenis-jenis pohon penghasil gaharu. Penduduk yang tinggal di dekat kawasan diminta untuk mengisi blanko kosong yang harus diisi dengan informasi kapan masa 220 . Pendataan pohon meliputi nama jenis. 6. 11. 8. Penggambaran lukisan spesimen herbarium jenis pohon penghasil gaharu. 10. diameter batang. Jarak anakan pertama dengan pohon induk diukur. 5. Pengidentifikasian jenis-jenis pohon penghasil gaharu dan proses koleksi herbarium dari kegiatan eksplorasi. tingkat pancang (tinggi lebih dari 150 cm dengan diameter kurang dari 10 cm) dan tingkat tiang (diameter 10-20 cm) di sekitar titik pusat kuadran. 9. dan tinggi pohon. Jika anakan yang pertama ditemukan berada jauh dari pohon induk. Penulisan deskripsi jenis-jenis pohon penghasil gaharu yang disertai gambar lukisan spesimen herbarium.

. C. Hasil Pengamatan di Lampung Hasil pengamatan yang diperoleh dalam rangka melakukan kajian potensi sebaran jenis A. 1992. Beberapa definisi dan kalkulasi yang digunakan dalam analisis vegetasi. dan Frekuensi Relatif (FR) dari jenis tertentu. di mana jenis ditemukan. 1992). kering. Kepadatan: jumlah individu per plot (100 m2). HASIL DAN PEMBAHASAN A. Luas bidang dasar untuk tiap plot dijumlah untuk memperoleh LBD tiap pohon dengan menggunakan rumus: LBD (m2) = pi x d (diameter dalam m)2/4 (Kent dan Coker. antara lain: 2.Potensi dan Kondisi . 1994). 5. 1999. dan sebagainya) dan mengisi data curah hujan. panas. Nilai NP ini diperoleh dengan cara menjumlahkan Dominansi Relatif (DoR). jumlah pohon yang berbuah dan berbunga. 3. malaccensis Lamk. KR merupakan rasio jumlah individu dari suatu jenis terhadap jumlah total jenis di dalam plot dan FR merupakan rasio frekuensi dari suatu jenis terhadap total frekuensi seluruh jenis di dalam plot (Kent dan Coker. kondisi iklim atau cuaca pada saat berbunga atau berbuah (hujan.. Frekuensi: jumlah unit contoh (10 m x 10 m). jumlah buah dan bunga (persentase). Analisis Data 1. 4.. Krebs. di Provinsi Lampung ini menunjukkan bahwa di beberapa lokasi di dalam kawasan Taman Nasional Bukit Barisan Selatan ini masih terdapat 221 . DR merupakan rasio total luas bidang dasar dari suatu jenis terhadap jumlah total luas bidang dasar dari seluruh jenis yang ada.. Nilai Penting (NP): perkiraan secara keseluruhan pentingnya suatu jenis pohon di dalam komunitas lokalnya. Kelimpahan Relatif (KR).(Titiek Setyawati) berbunga. Luas Bidang Dasar (LBD): luasan bagian melintang dari batang >20 cm sebatas dada (diameter of breast height (dbh)).

belum ada laporan bahwa pohon tersebut pernah menghasilkan gaharu atau terinfeksi oleh patogen. dan anakan yang ditemukan pada enam plot sampel tampak cukup banyak. Lampung Tengah tertera pada Tabel 1. jumlah tegakan pohon. sapling.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan alam pohon gaharu meskipun jumlah dan potensi regenerasi alamnya tampak mengalami penurunan seperti yang ada di Kawasan Hutan Biha. Anakan gaharu yang ditemukan tumbuh secara besar di wilayah perkebunan alami di Kawasan Hutan Bukit milik masyarakat (Gambar Rupi. Jumlah pohon gaharu yang dapat ditemukan di Bukit Rupi. Tegakan dapat dikatakan alami. Lampung Tengah menunjukkan 222 . Tampaknya tidak banyak gangguan seperti pengambilan gubal gaharu di kawasan ini. Di lokasi ini juga dijumpai tegakan pohon penghasil gaharu alami yang tumbuh Gambar 3. Gunung Sugih. Khusus di Bukit Rupi. Namun demikian. karena berdasarkan wawancara dengan pemilik kebun. Nampak bahwa kondisi batang tegakan pohon sangat halus dan tidak ditemukan cacat pohon. Tampak pada Gambar 3 kecambah gaharu yang tumbuh melimpah menyerupai permadani di bawah tegakan induknya yang ditemukan di Kawasan Hutan Bukit Rupi. Hasil pengamatan regenerasi alam jenis gaharu di Kawasan Hutan Way Waya. Kemungkinan hal ini disebabkan akses ke dalam kawasan hutan yang relatif sulit dibandingkan dengan Kawasan Hutan Biha. Lampung Tengah 4). Di beberapa tempat juga tampak tandatanda bekas perambahan hutan yang tentunya sebagian besar untuk mengambil kayu gaharu. mereka tidak merasa menanam pohon penghasil gaharu dan menemukan pohon tersebut tumbuh di halaman kebun mereka. Kemungkinan besar biji gaharu terbang dan menemukan media yang baik untuk tumbuh besar di kebun milik penduduk tersebut. Lampung Tengah.

(Titiek Setyawati) perkembangan yang sedikit berbeda dengan yang ada di Bukit Rupi. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Biha tertera pada Tabel 3. Tegakan pohon A.. malaccensis Lamk. sehingga kemungkinan sejak dahulu sudah banyak masyarakat yang memanfaatkan gaharu yang tumbuh alami namun hal ini tidak dibarengi dengan upaya budidayanya. Gambar 4.. menemukan jenis gaharu tersebut. Lampung Tengah. Lampung Tengah 223 . Nampak pula bahwa sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu. Tampak bahwa tidak satu pun jenis penghasil gaharu ditemukan di petak sampel (Tabel 2) di antara 13 jenis pohon hutan yang berhasil diidentifikasi di laboratorium Botani Hutan. meskipun lokasinya sama-sama di satu kabupaten. yang ditemukan tumbuh secara alami di perkebunan milik masyarakat yang lokasinya berbatasan dengan Kawasan Hutan Bukit Rupi.. sehingga pemungut kayu gaharu setiap saat dapat secara kebetulan maupun ada juga yang dengan niat keras.Potensi dan Kondisi . Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Hutan Biha sangat sedikit. Kurangnya jumlah pohon ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung.. namun bukan sama sekali tidak ditemukan seperti di Kawasan Hutan Gunung Sugi.

Gunung Sugih. Jumlah pohon. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Rupi. Lampung Tengah Tabel 1. Lampung Tengah Pohon No 1 2 3 Nama jenis Artocarpus elasticus Ganophyllum falcatum Bombax valetonii Plot 15 5 4 Batang 45 10 5 Tiang Plot 2 0 0 Batang 6 0 0 Pancang Plot 0 4 2 Batang 0 15 4 Semai Plot 0 0 0 Batang 0 0 0 224 . 5. 3. pancang.) di kebun miliknya di Kawasan Hutan Gunung Sugih. pancang. Jumlah pohon (> 10 cm) 26 9 8 14 16 8 Jumlah pancang 34 15 21 16 19 17 Jumlah anakan 14 21 30 14 11 9 Tabel 2. 4. plot 1. Jumlah pohon. 6. Lampung Tengah No. Penduduk setempat yang sudah melakukan upaya bu-didaya penanaman pohon gaharu (A.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 5. malaccensis Lamk. dan anakan A. anakan dan semai beberapa jenis pohon alami yang ada dalam 50 plots penelitian di Kawasan Hutan Way Waya. malaccensis Lamk. 2.

Lampung Barat No. Desa Sendang Baru. Ficus sp.. 2. plot 1. Jumlah pohon.Potensi dan Kondisi . oleh karena itu pembuatan plot dilakukan di hutan belukar tersebut. malaccensis Lamk.. dan anakan A. Namun demikian masih terdapat beberapa pohon penghasil gaharu alami yang tersisa di daerah hutan belukar.. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Biha. pancang.(Titiek Setyawati) Pohon No 4 5 6 7 8 9 10 11 12 13 Nama jenis Pterospermum diversifolium Laportea stimulans Vitex sp. 3. Kecamatan Sendang Agung. Alstonia angustifolia Pometia pinnata Cananga odorata Litsea sp. 4. Kabupaten 225 . Artocarpus sp. Pohon gaharu yang masih ada di Kawasan Hutan Register 22 Way Waya. Jumlah pohon (> 10 cm) 2 Jumlah pancang 1 2 4 Jumlah anakan 3 8 5 12 Berdasarkan informasi penduduk yang tinggal di Kawasan Hutan Lindung Bukit Sugih (Register 22 Way Waya) bahwa jenis pohon gaharu sudah sulit dijumpai karena adanya pembalakan hutan maupun adanya pencari gaharu di masa lampau. Hibiscus macrophyllus Plot 4 0 3 3 2 4 2 3 2 1 Batang 5 0 7 5 3 5 3 5 3 1 Tiang Plot 4 1 5 4 1 2 5 5 4 4 Batang 8 4 12 8 2 5 8 6 5 5 Pancang Plot 6 5 0 2 0 3 0 2 0 2 Batang 18 17 0 7 0 10 0 7 0 3 Semai Plot 4 12 11 10 0 6 12 5 13 0 Batang 8 20 23 15 0 12 23 12 20 0 Tabel 3..

(kiri) dan anakan yang tumbuh di bawahnya (kanan) di lokasi Kawasan Hutan Biha. 28 cm. itu pun terbagi tempatnya menjadi tiga titik dengan jarak tempuh yang berbeda.Aspek SOSIAL EKONOMI DAN KONSERVASI Gunung Sugih. dan 102 batang. 85. dan tingkat anakan terdapat 3 plot dengan jumlah masing-masing 30. 30 cm. Titik yang terdekat berjarak sekitar 5 km dengan jarak tempuh sekitar 1 jam berjalan kaki. sedangkan tingkat tiang tidak dijumpai. dan 34 cm. tingkat pancang hanya satu batang. Adapun jenis pohon penghasil gaharu yang ditemui hanya satu jenis yaitu A. Tegakan pohon A. hanya tinggal sekitar 5 pohon. Lampung Tengah. Dari 50 plot yang dibuat terdapat 5 plot yang dijumpai pohon penghasil gaharu. 25 cm. malaccensis Lamk. (Thymelaeaceae). masing-masing satu batang pohon yang berdiameter 20 cm. Gambar 6. malaccensis Lamk. Lampung Barat 226 .

sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu.. Kecamatan Talang Empat dan Kelompok Hutan Pungguk Gambo.86% (urutan kedua setelah Cinnamomum porectum (Roxb. Tegakan gaharu pada tingkat tiang dan pancang tidak ditemukan pada plot sampel namun mendominasi pada tiangkat seedling (38. Hal ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung dan kemungkinan besar juga adalah tingkat reproduksi tegakan yang mulai berkurang. A.. Hal ini terjadi terutama di Kawasan Lindung Kelompok Hutan Pungguk Gambo. Berdasarkan hasil analisis vegetasi di Kelompok Hutan Binjai Temula.72%). yaitu 39. Sampai saat ini masih terdapat perburuan gaharu di hutan alam dan bahkan masyarakat atau penduduk lokal mengumpulkan anakan pohon gaharu (semai dan pancang) dari hutan alam untuk diperdagangkan. Tampak bahwa jumlah pohon sangat sedikit dan menurut informasi yang diperoleh dari masyarakat sekitar. memiliki indeks nilai penting yang cukup tinggi pada tingkat pohon. pada Kawasan Lindung Kelompok Hutan 227 . malaccensis Lamk.. Jumlah pohon penghasil gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Binjai Temula tertera pada Tabel 4.Potensi dan Kondisi . sehingga sejak dahulu sudah banyak memanfaatkan gaharu yang tumbuh alami. yaitu di Kelompok Hutan Binjai Temula. merupakan jenis yang ditemukan di kedua lokasi penelitian di Bengkulu Utara. Desa Dusun Baru. Kecamatan Pondok Kelapa. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Pungguk Gambo tertera pada Tabel 5. Kondisi regenerasi di kawasan ini hampir sama dengan kawasan yang sebelumnya. Desa Tanjung Terdana.20%). Berdasarkan angka nilai pentingnya.) Kostm. yaitu Binjai Temula. Hasil Pengamatan di Kawasan Hutan di Provinsi Bengkulu Hasil menunjukkan bahwa A. malaccensis Lamk.(Titiek Setyawati) B. Kedua lokasi berada di Provinsi Bengkulu dan kedua kawasan juga masuk dalam kawasan hutan lindung. Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Kawasan Binjai Temula ini sangat sedikit. (57..

3. dan anakan A. porectum (Roxb.20%) setelah Vitex pubescens Vahl. dan Garcinia diocia Blume (56. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Binjai Temula. Pada plot sampel di lokasi Pungguk Gambo. 6.82%). plot 1. Bengkulu Utara No. pohon penghasil gaharu (>20 cm) menduduki urutan keempat (43. (67. malaccensis Lamk. C.Aspek SOSIAL EKONOMI DAN KONSERVASI Pungguk Gambo.59% pada tingkat pancang dan berada di urutan keempat (19. 5. Gambar 7. (90. 4. Jumlah pohon. Jumlah pohon (> 10 cm) 1 1 0 1 1 0 Jumlah pancang 0 0 0 0 0 0 Jumlah anakan 0 3 1 2 3 2 228 . pancang. Kecambah atau biji yang mulai tumbuh (kiri) dan beberapa anakan mulai tinggi (kanan) di areal Kelompok Hutan Pungguk Gambo Tabel 4.) Kostm.48%) untuk tingkat seedling atau semai. Tegakan tidak ditemukan di tingkat tiang dan hanya memiliki nilai penting 3. banyak ditemukan kecambah atau biji-biji yang mulai berkecambah di bawah pohon induknya serta beberapa anakan dengan pertumbuhan yang cukup sehat (Gambar 7).55%).30%). 2.

5 6 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 1 0 1 0 0 0 0 0 Jumlah pancang 0 0 2 0 0 0 0 0 0 0 Jumlah anakan 0 0 0 0 0 3 0 4 0 0 Biji yang mulai berkecambah tersebut tumbuh sangat rapat dan pada umumnya hanya bertahan beberapa hari saja. 4. karena akan dipungut oleh penduduk untuk diperdagangkan.5 kg pada musim yang baik. Tegakan pada tingkat pohon terlihat sangat rapat (Gambar 8) dan pada sebagian petak sampel terdapat pohon dengan ukuran diameter yang cukup besar namun belum menampakkan tandatanda terjadinya pembusukan yang mengakibatkan terbentuknya gaharu (Gambar 9).. malaccensis Lamk.. 2.. Namun demikian semai/seedling berukuran tinggi di atas 10 cm saja dihitung dalam petak pengamatan (2 m x 2 m) untuk memperoleh angka nilai penting. Pada umumnya pohon mulai berbunga dan berbuah pada umur 5 sampai 6 tahun bahkan pohon berukuran sedang bisa menghasilkan biji kurang lebih 1. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Pungguk Gambo No. Jumlah pohon.. 3.(Titiek Setyawati) No. plot 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 0 1 Jumlah pancang 0 0 0 0 Jumlah anakan 2 1 3 3 Tabel 5. plot 1. pancang dan anakan A. Masa 229 .Potensi dan Kondisi .

Gambar 8. 2000. Perkecambahan biji dan anakan yang muda sangat rentan terhadap penyakit damping off yang disebabkan oleh jamur (Kundu dan Ka-chari. Tegakan gaharu yang rapat Gambar 9.Aspek SOSIAL EKONOMI DAN KONSERVASI berbunga dan berbuah biasanya terjadi pada bulan-bulan kering. Pohon gaharu dengan diameter ≥ 50 cm Pohon berbunga pada bulan Juli dan Agustus dan menghasilkan buah matang pada bulan November-Desember. Petani menggunakan pestisida jika perlu untuk membasmi serangga ini. 2001). masa berbunga dan berbuah 2 kali dalam setahun. menghisap cairan daun dan menyebabkan helai pucuk daun bergulung dan mengakibatkan anakan menjadi kerdil. Buah yang matang berwarna coklat kehitamhitaman. Penyakit seperti ini tidak ditemukan di lokasi penelitian di Bengkulu Utara. Pembungaan pada bulan Maret-April akan menghasilkan buah di bulan Juli-Agustus (Adelina. 2004). Masalah utama di lapangan adalah penyakit pada anakan yang disebabkan oleh serangga kecil yang hinggap di ujung daun anakan. Meskipun ada. 230 . Di Sumatera.. Buah ini harus langsung dipanen dari pohonnya. Sumarna et al.

Demikian pula dengan potensi regenerasinya yang ditunjukkan dengan sedikitnya jumlah semai maupun anakan yang ada di bawah tegakan alam. 2007. 2001). KESIMPULAN DAN SARAN A. Bisanya petani akan membuang anakan yang sakit. Tampak bahwa stock di kawasan hutan di Sumatera lebih rendah dibandingkan dengan kawasan hutan yang ada di Kalimantan dan Papua. Beberapa peneliti menduga bahwa hanya 10% dari pohon Aquilaria yang mengandung gaharu. maka banyak kolektor yang tidak berpengalaman pada akhirnya ikut mengeksploitasi gaharu di alam. Indonesia merupakan eksportir utama produk gaharu dan dengan tingginya permintaan pasar akhir-akhir ini serta tingginya harga yang ditawarkan di pasar dunia. malaccensis Lamk. 3. Hasil pengamatan di dua lokasi contoh di Kabupaten Bengkulu Utara. Soehartono dan Newton.. Saat ini gaharu sudah masuk dalam Appendix II CITES.(Titiek Setyawati) dilaporkan hanya sedikit di beberapa tempat saja. Estimasi potensi stock kayu gaharu di Indonesia yaitu 1. Berdasarkan hasil pengamatan lapangan dan estimasi potensi regenerasi alam jenis-jenis pohon penghasil gaharu yang tumbuh di hutan alam di beberapa lokasi contoh di Kabupaten Lampung Tengah dan Lampung Barat... masih banyak namun demikian kondisinya saat ini menghadapi ancaman penurunan populasi di berbagai tingkatan umur 231 . 2. tampak bahwa potensi tegakan alam A. Kesimpulan 1. Meskipun tampak bahwa di kawasan Bengkulu Utara di sebagian tempat tampak rapat namun keberadaan pohon penghasil gaharu sendiri tidak menjamin adanya resin gaharu. sudah mengalami penurunan populasi. malaccensis Lamk.37 pohon/ha di Kalimantan. dan 4. Namun hal ini tidak mengurangi kerusakan dan berkurangnya populasi gaharu di alam (Anonim.33 pohon/ha di Papua. Sebagai akibatnya populasinya di alam makin lama makin berkurang. tampak bahwa potensi tegakan alam A..87 pohon/ha di Sumatera.Potensi dan Kondisi .

Meskipun ada beberapa lokasi sampel dengan kondisi tegakan pohon dewasa yang sangat kurang. tidak hanya pohonnya namun juga anakan alaminya. kawasan hutan di Provinsi Bengkulu. khususnya Kabupaten Lampung Tengah dan Lampung Barat memiliki potensi tegakan alam gaharu yang cukup merata meskipun di beberapa lokasi jumlah sampelnya tidak memadai. mengingat potensi jenis gaharu yang masih tampak baik. sehingga diperlukan penyuluhan bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan Taman Nasional Bukit Barisan Selatan dan kawasan hutan lindung. malaccensis Lamk. sehingga potensi regenerasi alami akan mengalami hambatan karena ketidakseimbangan pertumbuhan di setiap tingkatan terutama tidak terjadinya pertumbuhan mencapai tingkat tiang. terutama di tingkat seedling dan sapling. akibat pemanenan gaharu yang kurang memperhatikan aspek kelestarian. Akibatnya bagi proses regenerasi alaminya terjadi kekosongan tegakan pada tingkat tiang. Meskipun demikian jenis pohon ini mengalami ancaman serius akibat perburuan. Untuk data masa pembungaan dan berbuah sampai saat penelitian belum dapat diperoleh mengingat masa pengamatan tidak bertepatan dengan masa berbunga dan berbuah.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan. Sedikit lebih baik dari kondisi gaharu di Provinsi Lampung. Sebagian besar penduduk memperjualbelikan anakan alami untuk 232 . khususnya Kabupaten Bengkulu Utara memiliki potensi tegakan alam gaharu yang juga cukup baik dilihat dari sisi populasi tegakan alaminya. 3. di Bengkulu ditemukan adanya laporan serangan serangga yang menyebabkan pertumbuhan tegakan gaharu menjadi kerdil. Tampak pula terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. Berlainan dengan temuan yang ada di Provinsi Lampung. Saran Provinsi Lampung. B. Kawasan hutan di Provinsi Lampung dan Bengkulu memiliki potensi yang cukup baik untuk dijadikan areal sumberdaya genetik untuk jenis A.

Forest & Landscape Denmark. 1992. Seed Leaflet No. C. J. Ko m p a s o n l i n e : h t t p : / / r e g i o n a l . CRC Press. maka diperlukan penyuluhan atau pendidikan konservasi bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan hutan lindung yang merupakan habitat alami jenis pohon penghasil gaharu ini. Jakarta. C. Kachari.(Titiek Setyawati) dikembangkan lebih lanjut atau ditanam di kebun masyarakat ataupun dijual ke luar daerah Bengkulu. Coker. k o m p a s . J. Punan Local Histories and Recent Developments in Bulungan. Kaskija. K. M. CIFOR. dan IV. N. I. Kent. December 2004. 2004. Indonesia.masa.. Jim Green. Krebs. II. terutama gangguan terhadap proses regenerasi alaminya. M.Potensi dan Kondisi . 2002. Seed Science and Technology.. 233 .. Vol. Yayasan Sarana Wana Jaya.c o m / r e a d / xml/2009/07/24/1300220/siapkan. Ayo Tanam Gaharu. gaharu Anonim. Harper Collins College Publishers. Media on line : http// www. East Kalimantan. Gaharu (Aquilaria). Ecology : The Experimental Analysis of Distribution and Abundance. Mengingat masih terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian.depan. Krebs.. Downloaded: 24 Januari 2007. wwf. Kundu. Aquilaria malaccensis Lamk. Anonim. 2009. dan J.id/index. Heyne.tanam.or.ayo. Claiming the Forest. III. Siapkan Masa Depan. DAFTAR PUSTAKA Adelina. 103. Tumbuhan Berguna Indonesia. Desiccation Sensitivity and Recalcitrant Behaviour of Seeds of Aquilaria agallocha Roxb. Badan Penelitian dan Pengembangan Kehutanan. 2007. 1987. L.php?fuseactian=whatwedo. Behalven Press. Vegetation Description and Analysis : A Practical Approach. 1994. dan P. 1999.species_gaharu. Ecological Methodology. 2000.

B. Bogor. 2001.113 Regarding Aquilaria spp. Irian Jaya. Y. Sumarna. An information Document Prepared by TRAFFIC Oceania for the Eleventh Meeting of the CITES Plants Committee. Canberra. East West Center-Prosea. Soehartono. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria II. Soehartono.C. 1880-2000. T. Elements for a History of Settlement. 2001. Pengaruh Wadah Penyimpanan dan Kelas Diameter Terhadap Pertumbuhan Stump Wikstroemia polyantha. Forest. Newton. dan B. with reference to CITES Decisions 11. Latin. Mindawati. 1994. Syaffari. Balai Penelitian Kehutanan Manokwari. F. Sellato. CIFOR. Biological Conservation No.R. Australia. 2001. Bogor. CIFOR. Agarwood (Gaharu) Harvest and Trade in Papua New Guinea : A Preliminary Assessment. 2001. Puri. Bulungan Ethnobiology Handbook. Biological Conservation No 97. Resources and People in Bulungan. T. Pelestarian dan Pemanfaatan Keanekaragaman Tumbuhan Obat Hutan Tropika Indonesia. Pembibitan Jenis Pohon Penghasil Gaharu (Aquilaria malaccensis Lamk). R. Centre for Plant Biodiversity Research. dan J.C. R.M.Aspek SOSIAL EKONOMI DAN KONSERVASI Mai. A. Zich. E. 234 .A. Indonesia. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria I.A. Buletin Penelitian Kehutanan 1(1). dan A.CIFOR. The Impact of Gaharu Harvesting in Indonesia. Trade and Social Dynamics in Borneo. 96. 1996. CSIRO Plant Industry. Indonesia. Suripatty. Status and Use in Indonesia. 2001.112 and 11. 2000. Newton.. Zuhud.K. dan N. Compton. dan A.

Antidesma tetandrum Blume Peronema canescens Jack Famili Thymelaeaceae Verbenaceae Myrtaceae Rubiacea Lecythidiaceae Moraceae Moraceae Lauraceae Dilleniaceae Moraceae Rhizophoraceae Dilleniaceae Selaginelaceae Dilleniaceae Rutaceae Rutaceae Apocynaceae Sterculiaceae Lauraceae Melastomataceae Melastomataceae Hypericaceae Theaceae Guttiferae Ulmaceae Mimosaceae Olacaceae Guttiferae Lauraceae Celasteraceae Theaceae Euphorbiaceae Verbenaceae 235 . Comersonia bartamia Merr Dehaasia caesia Blume Clidenia hirta don Kibessia azurea DC.. Vitex pubescens Vahl.) Kosterm. Parkia speciosa Hassk. Evodia aromatica Blume Alstonia angustiloba Miq. Dillenia sumatrana Miq. Carallia brachiata Merr Tetracera indica L. Eugenia grandis Wight Neonauclea calycina Merr Barringtonia sp.(Titiek Setyawati) Lampiran 1. Cinnanmomum porectum (Roxb. Ficus variegata Bl.. Cinnamomum iners Blume Peltophorum grande prain Eurya acuminata APDC. Dillenia excelsa Gieg. Garcinia dioica Bl. Parasponia parvifolia Miq. Artocarpus elasticus Reinw. Schima wallichii Korth.. Artocarpus anisophyllus Reinw. Selaginella plana Hiern.. Lampung Tengah No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Nama lokal Kayu alim Leban Kelat Kelepu Putat Lahu Ketaran Kilada Simpur Terap Sepat Rempelas Lingkem Ranggung Ancau Cempaka Pulai Lupang Medang Kedukduk Gio Kemutul Seru Asam Kandis Nerung Petai Sebasah Beruas Tepa Sago Sidi Nyari Sungkai Nama botanis Aqualaria malaccensis Lamk. Cratoxylum formosum Dyer.Potensi dan Kondisi . Clausena excavata Burm. Strombosia javanica Blume Garcinia celebica L. Daftar jenis pohon yang di survei dalam plot pengamatan gaharu di Bukit Rupi.

f Eugenia glomerata K et V Timonius sericanthus Boerl Tarenna sp. Bengkulu Utara No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Nama lokal Karas Gadis Leban Marapuyan Petai Berawas Sipo Terap Jering Tetak Tunjuk Semipis Kademe Semuting Seubo-ubo Kemutun K. Aporusa aurita Miq Cratoxylum sumatranum (Jack) Blume Elaeocarpus stipularis Blume Ixonanthes petiolaris Blume Litsea firma Hook. Tarenna confusa K et V.Br Bridelia monoica Merr Symplocos cochinchinense Lour Horsfieldia glabularis Warb Garcinia dioica Blume Aporusa sp.Beras Salung Gajah Salung Urat Use Nyaran Ingitdare Nama botanis Aquilaria malaccensis Lamk Cinnamomum porectum (Roxb. Kecamatan Talang Empat.) Kostrm Vitex pubescens Vahl Rhodamnia cinerea Jack Parkia speciosa Hassk Litsea odorifera T et B Dillenia exelsa Gilg Artocarpus elasticus Reinw Archidendron jiringa (Jack) Nielsen Canarium dichotonum Miq Baccaurea racemosa Muell Arg Croton argyratus Blume Neonauclea calycina Merr Glochidion zeylanicum Juss Cratoxylum formosum (jack) Dyer Styrax benzoind Dryand Vernonia arborea Ham.Angit Jungjung bukit Sugi Sipunan Kenidai Kendung Naran Kandis Kbg Saka/ Seketut Pelangas Lulus Gamat Marabikang Kemalau Gelam Abang K. Daftar jenis pohon yang ada di dalam Kelompok Hutan Binjai Temula. Ganophyllum falcatum Blume Lucuma maingayi Dub Carallia brachiata Merr Famili Thymelaceae Lauraceae Verbenaceae Myrtaceae Leguminosae Lauraceae Dilleniaceae Moraceae Leguminosae Burseraceae Euphorbiaceae Euphorbiaceae Rubiaceae Euphorbiaceae Hyperiaceae Styraxaceae Compositae Rutaceae Lauraceae Annonaceae Liliaceae Euphorbiaceae Symplocaceae Myristicaceae Guttiferae Euphorbiaceae Euphorbiaceae Hyperiaceae Elaeocarpaceae Linnaceae Lauraceae Myrtaceae Rubiaceae Rubiaceae Rubiaceae Sapotaceae Sapotaceae Rhizophoraceae 236 .Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 2.Gambir Ketepung K. Desa Dusun Baru. Clausena exavata Actinodaphne glabra Blume Orophea sp Pleomele elliptica H.