ISBN 978-979-3145-63-1

Pengembangan Teknologi Produksi

berbasis pemberdayaan masyarakat
Editor: Sulistyo A. Siran; Maman Turjaman

PENGEMBANGAN TEKNOLOGI PRODUKSI GAHARU BERBASIS PEMBERDAYAAN MASYARAKAT SEKITAR HUTAN
Editor: Sulistyo A. Siran; Maman Turjaman ISBN: 978-979-3145-63-1 Penerbit: Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Kampus Balitbang Kehutanan Jl. Gunung Batu No. 5, Bogor 16110 Telp. (0251) 8633234, 7520067; Fax. (0251) 8638111 E-mail: p3hka_pp@yahoo.co.id

Petikan Undang-Undang Nomor 19 Tahun 2002 tentang Hak Cipta Ketentuan Pidana Pasal 72 (1) Barangsiapa dengan sengaja dan tanpa hak melakukan perbuatan sebagaimana dimaksud dalam Pasal 2 ayat (1) atau Pasal 49 ayat (1) dan ayat (2) dipidana dengan pidana penjara masing-masing paling singkat 1 (satu) bulan dan/atau denda paling sedikit Rp 1.000.000,00 (satu juta rupiah), atau pidana penjara paling lama 7 (tujuh) tahun dan/atau denda paling banyak Rp 5.000.000.000,00 (lima miliar rupiah). (2) Barangsiapa dengan sengaja menyiarkan, memamerkan, mengedarkan, atau menjual kepada umum suatu Ciptaan atau barang hasil pelanggaran Hak Cipta atau Hak Terkait sebagaimana dimaksud pada ayat (1) dipidana dengan pidana penjara paling lama 5 (lima) tahun dan/atau denda paling banyak Rp 500.000.000,00 (lima ratus juta rupiah).

ii

KATA PENGANTAR
Terdapat enam tantangan pembangunan kehutanan yang kita hadapi saat ini, yaitu: degradasi hutan, bencana alam dan lingkungan, pemanasan global, share sektor kehutanan terhadap pertumbuhan ekonomi nasional, desentralisasi sektor kehutanan, dan kontribusi kehutanan dalam hal food, water scarcity, energy, and medicine. Namun, kita masih melihat ada peluang yang merupakan sebuah anugerah bagi bangsa kita, yang bila dibudidayakan dan dikelola secara serius akan dapat menjawab paling tidak lima dari enam tantangan tadi. Anu-gerah yang juga merupakan peluang usaha sektor kehutanan dari jenis HHBK ini bernama “gaharu”. Ide dan gagasan membangun hutan tanaman gaharu juga menarik untuk kita kaji bersama. Kalau selama ini perusahaanperusahaan HTI telah eksis dengan komoditi-komoditi kayu seperti mangium, sengon, mahoni, dan jenis tumbuhan penghasil kayu lainnya, maka bukanlah hal yang mustahil untuk mengembangkan hutan tanaman penghasil gaharu apabila secara finansial menjajikan dan memungkinkan setelah dianalisis kelayakan usahanya. Pengembangan usaha budidaya tanaman HHBK unggulan akan berhasil dengan baik apabila didukung oleh semua stakeholder yang berkepentingan, baik Pemerintah Pusat dalam hal ini Departemen Kehutanan, Pemerintah Daerah, pengusaha, dan petani. Disampaikan terima kasih dan penghargaan yang setinggitingginya kepada semua pihak yang telah berkontribusi hingga terbitnya buku ini.
Jakarta, Nopember 2010

Kepala Badan Litbang Kehutanan

Dr. Ir. Tachrir Fathoni, MSc.

iii

iv

.............................. Erdy Santoso......................... Irnayuli R........... Aryanto..... 115 6............................... Najmulah..53 3..... Aryanto...................................................... EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp.......................... 123 7. 113 5............ PADA Aquilaria microcarpa Eka Novriyanti .......... Irnayuli R.................... Ahmad Yani........................... TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso........................ Sitepu..... Ragil S.............................. Maman Turjaman .. KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp.............35 2.................................77 4...................................................97 Aspek SILVIKULTUR .... PENGEMBANGAN GAHARU DI SUMATERA Mucharromah......................... Erdy Santoso ... Maman Turjaman .......................................... Sugeng Sentosa........................ DAN Fusarium sp.....................................33 1.............................................. Ahmad Yani...........................................iii DAFTAR ISI ............................................................................DAFTAR ISI KATA PENGANTAR............ Yasuyuki Hashidoko........................ Sitepu........ APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp................ Sugeng Santosa.. Siran . DI PERSEMAIAN Irnayuli R................... v PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A....... Sitepu.............................. 139 v ...... Ragil Setio Budi Irianto. PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman.......................... DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu ............................................ UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto.............31 Aspek PRODUKSI .......... Irianto.........................................................B.. Aryanto ............. Najmulah............................ Maman Turjaman............1 STATUS RISET GAHARU ........................................

............................. 157 9.......... Sitepu ............................ SUMATERA Titiek Setyawati..........................) DI PROVINSI LAMPUNG DAN BENGKULU............................................... POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk............................................. Irnayuli R................................................................................................. KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi ............. PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti .................. 181 11.................................................. Erdy Santoso....Daftar Isi 8.................................................. 159 10.................................................... HAMA PADA TANAMAN PENGHASIL GAHARU Ragil SB Irianto.............. THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo ..... 151 Aspek SOSIAL EKONOMI DAN KONSERVASI ................ 213 vi .............. 193 12........................ Maman Turjaman.....................

Pepatah ini mengindikasikan bahwa sebenarnya komonditi gaharu sudah dipopulerkan oleh nenek moyang kita dan menjadi bukti sejarah bahwa keharuman gaharu telah dikenal sejak ratusan tahun yang lalu.) yang telah mengalami proses perubahan fisika dan kimia akibat terinfeksi oleh sejenis jamur. Oleh sebab itu tidak semua pohon penghasil gaharu mengandung gaharu. gaharu memang sangat unik. maupun masyarakat 1 .PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A. Dalam kehidupan seharihari telah dikenal pepatah “sudah gaharu cendana pula”. Pertanyaan yang muncul. Dilihat dari wujud dan manfaatnya. Siran Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu sebuah nama komoditi hasil hutan non kayu yang saat ini menjadi perbincangan banyak kalangan. Jawaban yang sudah pasti adalah rumus umum. Dari sisi manfaat. gaharu sejak zaman dahulu kala sudah digunakan. yaitu karena pengambilan jauh lebih besar daripada produksinya. Gaharu sebenarnya sebuah produk yang berbentuk gumpalan padat berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar tanaman pohon inang (misalnya: Aquilaria sp. lantas kenapa komoditi yang telah populer tersebut sepertinya menghilang begitu lama dan saat ini muncul kembali. baik oleh kalangan elit kerajaan.

s/d Rp14. bahan kosmetik dan obat-obatan sederhana. kualitas Teri (Rp 10. baik sebagai sumber pendapatan masyarakat maupun penerimaan daerah. dan stimulan kerja syaraf dan pencernaan.000. dan Nunukan.-). Bertahun-tahun masyarakat dan pemerintah daerah Kalimantan dan Sumatera menikmati berkah dari keberadaan gaharu. Selama ini masyarakat hanya tinggal memanen gaharu yang dihasilkan oleh alam. Tarakan. kualitas Kemedangan (Rp 1. Gaharu dengan demikian mempunyai nilai sosial.per kilogram. kualitas Kacangan dengan harga rata-rata Rp15.000.000.-.000.s/d Rp 4.000. dan ekonomi yang cukup tinggi. keberadaan pohon penghasil gaharu tersebut di Indonesia tidak terkecuali di Sumatera dan Kalimantan semakin langka.000. anti mikrobia.000. Seringkali masyarakat tidak tahu pasti kapan pohon penghasil gaharu mulai membentuk gaharu dan bagaimana prosesnya. Kalimantan Timur mencapai Rp 40. Meningkatnya perdagangan gaharu sejak tiga dasawarsa terakhir ini telah menimbulkan kelangkaan produksi gubal gaharu dari alam.000. sabun. Saat ini pemanfaatan gaharu telah berkembang demikian meluas antara lain untuk parfum. pengharum tubuh dan ruangan. bahan obatobatan yang memiliki khasiat sebagai anti asmatik.. maka jenis-jenis tertentu misalnya Aquilaria dan Gyrinops saat ini sudah tergolong langka.suku pedalaman di Sumatera dan Kalimantan. harga jual yang tinggi.-. budaya. dan pola pemanenan yang berlebihan serta perdagangan yang masih mengandalkan pada alam tersebut.-). body lotion. dan Suloan (Rp75.000. Kelangkaan terjadi karena pohon penghasil gaharu ditebang tanpa memperhatikan 2 .000..000. dan masuk dalam lampiran Convention on International Trade on Endangered Spcies of Flora and Fauana (Appendix II CITES).000. disusul kualitas Tanggung dengan harga rata-rata per kilogram Rp 20. namun menurut kenyataan.. Berdasarkan informasi.000.000. Walaupun sejak 1994 Indonesia berkewajiban melindungi pohon penghasil gaharu.000. Secara tradisional gaharu dimanfaatkan antara lain dalam bentuk dupa untuk acara ritual dan keagamaan. aroma terapi.000.s/d Rp 50.000. harga gaharu dengan kualitas Super di pasaran lokal Samarinda.-).. Besarnya permintaan pasar.

Menurut hasil kajian. Kalaupun ada pohon yang mengandung gaharu. Dengan teknologi inokulasi maka produksi gaharu dapat direncanakan dan dipercepat melalui induksi jamur pembentuk gaharu pada pohon penghasil gaharu. sedangkan saat ini produksi tersebut merosot drastis hanya kira-kira puluhan ton saja dengan kualitas yang bervariasi.. mungkin puluhan atau bahkan ratusan pohon penghasil gaharu yang harus ditebang. dan LSM konservasi. Peningkatan produksi gaharu dimaksud (yang kegiatannya terdiri dari kegiatan di bagian hulu sampai hilir) selanjutnya akan berdampak pada peningkatan penerimaan oleh masyarakat petani.. di mana realisasi produksi gaharu pada dekade 80’an pernah mencapai ribuan ton dengan kualitas yang tinggi. perguruan tinggi. Siran) ada atau tidak adanya gaharu pada pohon tersebut.Perkembangan Pemanfaatan Gaharu . dari 20 pohon penghasil gaharu yang ditebang di hutan alam hanya ada satu atau sering sama sekali tidak ada yang mengandung gaharu. dan kalaupun ada usaha konservasi dan budidaya namun skalanya terbatas dan hanya dilakukan oleh lembaga penelitian. (Sulistyo A. Namun upaya tersebut tidak mudah dilaksanakan. baik in-situ (dalam habitat) maupun ek-situ (di luar habitat) dan budidaya pohon penghasil gaharu. Indikasi menurunnya pupulasi pohon penghasil gaharu ditunjukkan oleh kecenderungan produksi gaharu dari Kalimantan dan Sumatera dari tahun ke tahun. pengusaha 3 .. Oleh karena itu dapat dibayangkan kalau pencari gaharu mendapatkan gaharu kira-kira 5 kilogram. Guna menghindari agar tumbuhan jenis gaharu di alam tidak punah dan pemanfaatannya dapat lestari maka perlu diupayakan untuk konservasi. Praktek semacam inilah yang mengakibatkan jumlah pohon pengahasil gaharu di alam semakin menurun dari tahun ke tahun. maka jumlah gaharu yang ada di pohon tersebut hanya beberapa gram saja.. Sementara masyarakat secara luas enggan untuk melakukan budidaya pohon penghasil gaharu karena memang tidak memberikan keuntungan apa-apa. Prospek untuk mengembalikan gaharu menjadi komoditi andalan kembali terbuka dengan ditemukannya teknologi rekayasa produksi gaharu.

Pulau Jawa (2 jenis). berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar dari jenis tumbuhan penghasil gaharu yang telah mengalami proses perubahan kimia dan fisika akibat terinfeksi oleh sejenis jamur. tumbuhan penghasil gaharu umumnya tumbuh di Pulau Kalimantan (12 jenis) dan Pulau Sumatera (10 jenis). Kalimantan Barat. GAMBARAN UMUM TUMBUHAN PENGHASIL GAHARU Hutan hujan tropis di Indonesia semenjak tiga puluh tahun yang lalu dikenal sebagai salah satu penghasil utama kayu bulat (log) untuk bahan baku industri perkayuan.gaharu. Selain itu hutan hujan tropis Kalimantan juga sangat kaya dengan hasil hutan bukan kayu (HHBK). kemudian dalam jumlah terbatas tumbuh di Kepulauan Nusa Tenggara (3 jenis). Gaharu adalah gumpalan berbentuk padat. tumbuh tersebar secara luas di Kalimantan Timur. dan penerimaan pendapatan asli daerah serta devisa negara. Kalimantan 4 . Dari pengamatan sebaran Aquilaria spp. dan Kepulauan Maluku (1 jenis). Di lndonesia hingga saat ini diperkirakan terdapat lebih kurang 25 jenis tumbuhan penghasil gaharu yang dikelompokkan ke dalam delapan marga dan tiga suku. Berdasarkan sebaran tempat tumbuh. dan rekayasa pembentukan gaharu yang dapat mengembalikan status komoditi dari kelangkaan menjadi produk andalan. di mana salah satu di antaranya adalah gaharu yang bernilai ekonomis tinggi. Pulau Papua (2 jenis). Tulisan ini dipaparkan dengan maksud untuk memberikan gambaran secara umum mengenai pemanfaatan gaharu. Oleh sebab itu tidak semua tanaman penghasil gaharu menghasilkan gaharu. konservasi. perlunya budidaya. yang dilaksanakan pada tahun 2000 ditemukan bahwa Aquilaria spp. pemahaman mengenai pentingnya nilai gaharu. Pulau Sulawesi (2 jenis).

baik untuk kepentingan konservasi maupun ekonomi. (-agarofuran. jinkohol. kusunol. Amerika Serikat pada tahun 1994. Menyadari semakin langkanya tumbuhan penghasil gaharu. Untuk mencegah dari kepunahan maka pada pertemuan CITES (The Convention on International Trade in Endangered Species of Wild Flora and Fauna) ke-IX di Florida. Siran) Tengah. nor-ketoaaga-rofuran. seluruh jenis Aquilaria telah dimasukkan dalam Appendix II CITES. salah satu tumbuhan penghasil gaharu terpenting yang banyak tumbuh di Kalimantan telah dimasukkan ke dalam Appendix II sebagai tumbuhan yang terancam punah sehingga dalam penebangan dan perdagangannya perlu dibatasi. Walaupun realisasi produksi gaharu tidak menggambarkan besarnya potensi. Bahkan sejak tahun 2004.. (-)-10-epi-y-eudesmol. dan Kalimantan Selatan.. dihydrokaranone. (Sulistyo A.. Akibatnya. antara lain dari pergerakan pencari gaharu yang telah mengarah pada bagian utara Kalimantan Timur. baik lokal maupun pendatang untuk melakukan eksploitasi gaharu secara besar-besaran.. Aquilaria malaccensis. di hutan alam semakin menurun dan bahkan pada suatu saat menjadi punah. agarospirol. Lebih lanjut Susilo (2003) mengatakan bahwa terdapat 17 macam 5 . KANDUNGAN DAN MANFAAT GAHARU Terdapat beberapa zat penting yang terkandung dalam gubal gaharu yaitu (-agarofuran. Indikasi dari menurunnya populasi Aquilaria spp. Tingginya permintaan pasar dunia akan gaharu dan harga jual gaharu yang cukup tinggi telah menarik minat masyarakat. jinkohol II serta oxo-aga-rospirol. jinkohon-eremol. terus mengalami penurunan. di pedalaman hutan Kalimantan Barat dan Kalimanatan Tengah serta menurunnya realisasi produksi gaharu dari tahun ke tahun. beberapa instansi pemerintah dan masyarakat telah melakukan inisiatif untuk mengadakan pelestarian tumbuhan penghasil gaharu dan sekaligus membudidayakan.Perkembangan Pemanfaatan Gaharu . namun dengan semakin sulitnya mendapatkan gaharu dari waktu ke waktu menunjukkan populasi Aquilaria spp. populasi Aquilaria spp.

kosmetika. asma. Selain itu gaharu telah dipergunakan sebagai bahan baku industri parfum. antara lain: noroxoagarofuran. kanker. gubal gaharu diperdagangkan sebagai komoditi elit untuk keperluan industri parfum. membakar jenazah bagi umat hindu. bahan antibiotic. kosmetik. tasbih. dan tumor yang masih dalam proses uji klinis. hio. dan aquillochin.4 –dihydroxy-dihydro-agarufuran. dan stres. Di Cina. reumatik. gangguan ginjal. asma.senyawa yang terdapat pada gaharu. liver. TBC. Gaharu dengan aromanya yang khas digunakan masyarakat di Timur Tengah sebagai bahan wewangian. tumor. hepatitis. radang lambung dan ginjal. Karena aromanya harum. kebugaran serta bahan minuman (kopi) oleh masyarakat di Kabupaten Berau. setanggi (dupa). p-methoxybenzylaceton. agarospirol. Cara Pendugaan Kandungan Gaharu Karena tidak semua tumbuhan penghasil gaharu berisi gaharu. Selanjutnya Oiler (tanpa tahun) dalam Suhartono dan Mardiastuti (2003) menyebutkan terdapat 31 unsur kimia yang terkandung di dalam gaharu dan bahan kimia penyusun utamanya adalah 2-(2-(4 methoxyphenyl)ethil)chromone (27%) dan 2-(2-phenylethyl)chromone (15%). PEMUNGUTAN DAN PENGOLAHAN GAHARU A. kecantikan. sedangkan air suling gaharu dimanfaatkan untuk kesehatan. Limbah bekas gaharu yang telah disuling digunakan untuk dupa dan bahan untuk upacara agama. saat ini berbagai negara memanfaatkan gaharu selain sebagai bahan pengharum (parfum) dan kosmetik. 3. dan obatobatan. untuk pengobatan stres. dan pengawet berbagai jenis asesori. kanker. Di samping itu dengan perkembangan ilmu dan teknologi industri. gaharu dimanfaatkan sebagai obat sakit perut. malaria. juga telah berkembang industri pemanfaatan gaharu sebagai bahan baku industri obat herbal alami. maka pengetahuan cara pendugaan kandungan gaharu pada tumbuhan penghasil gaharu yang terinfeksi jamur pembentuk gaharu perlu diketahui terutama oleh para pemungut pemula 6 .

Bilamana terdapat alur coklat kehitaman pada batang menunjukkan adanya kandungan gaharu. B.000/tolak (1 tolak = 12 cc). Cara pemungutan gaharu semacam ini di Sumatera dan Kalimantan disebut servis.. Sistem Pemungutan Gaharu Pohon dari tumbuhan penghasil gaharu yang telah diyakini mengandung gaharu ditebang. cabang pohon banyak yang patah. Adapun ciri dari tumbuhan penghasil gaharu berisi gaharu antara lain adalah: daun berwarna kuning dan rontok. banyak terdapat benjolan dan lekukan sepanjang batang atau cabang pohon.. Setelah ditemukan ciri-ciri tersebut maka dilakukan uji pelukaan pada batang pohon dengan menggunakan kapak atau parang.Perkembangan Pemanfaatan Gaharu . Harga minyak gaharu di pasaran Jakarta Rp 750. tajuk pohon kecil dan tipis. kulit kayu kering dan rapuh serta bila ditarik mudah putus. Pengolahan Gaharu Sampai saat ini produk gaharu yang berasal dari alam umumnya dipasarkan dalam bentuk bongkahan namun ada pula dalam bentuk minyak hasil sulingan. 7 . kemudian dipotong-potong dan dibelah untuk diambil gaharunya. Untuk lebih meyakinkan biasanya serpihan kayu tadi selanjutnya dibakar untuk mengetahui apakah mengeluarkan bau/ aroma wangi khas gaharu. (Sulistyo A. puncut atau pahat. Cara penyulingan minyak gaharu dapat dilakukan dengan dua sistem yaitu sistem kukus dan tekanan uap. Potongan kayu berisi gaharu kemudian dikumpulkan dan secara perlahan bagian kayu dipisahkan dari gaharu dengan menggunakan pisau kecil atau pahat cekung. C. Cara ini disebut tubuk. Cara lain yang berlaku pada masyarakat Dayak Kenyah dan Punan di Kalimantan Timur adalah dengan mengiris dan memotong bagian kayu dari tumbuhan penghasil gaharu yang terkena infeksi penyakit hingga ke bagian tengah batang... Siran) sehingga tidak terjadi salah tebang pada pohon yang tidak berisi gaharu.

teri. Klasifikasi mutu gaharu di Kota Samarinda dan daerah sekitarnya Klasifikasi mutu No. tanggung. dan pemungut gaharu di dalam menentukan kelas mutu gaharu. 2007 8 . 1. TangKacangan isi Teri super gung isi Kacangan Teri laying Tangkosong gung kosong Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan. 4. Tabel 1.KLASIFIKASI MUTU GAHARU Klasifikasi mutu gaharu di Kalimantan Timur khususnya di Kota Samarinda dan daerah sekitarnya hingga saat ini masih belum seragam (Tabel 1) dan penentuannya dilakukan secara visual. Muara Kaman Kota Bangun Muara Wahau Super A Super B Super A Super B Kacangan isi Teri isi Kacangan Teri kulit kosong Kacangan A Kacangan B Teri A Teri B 3. kemedangan. kacangan. Pada Tabel 1 disajikan kriteria dan klasifikasi mutu gaharu. Lokasi Super Tanggung Kacangan Kacangan A Kacangan B Kacangan C Teri Teri A Teri B Teri C Teri kulit A Teri kulit B Kemedangan Kemedangan A Kemedangan B Kemedangan community Sudokan Serbuk Serbuk Cincangan Samarinda Super king Super A Super AB 2.1-1999) diharapkan standar mutu tersebut dapat segera menjadi bahan acuan para pengusaha gaharu. Secara umum klasifikasi mutu gaharu dapat dikelompokkan menjadi enam kelas mutu yaitu super. dan cincangan dan setiap kelas mutu dibedakan lagi menjadi beberapa sub kelas mutu. Dengan telah ditetapkannya standar nasional untuk mutu gaharu (SNI 01-5009. pedagang pengumpul. Keragaman dan ketidakjelasan di dalam penentuan mutu tersebut menyebabkan harga jual yang berbeda dengan kelas mutu yang sama.

padat. pasaran Samarinda. Secara visual Kacangan C 2. 2.000.100.000.000.000. tidak ada campuran dengan serat kayu. Gaharu berwarna hitam dan coklat.250. Teri C 500.2.25..71/ 09/99.dilihat pada Gambar 3.50. mengkilap dan sangat berbau. Harga jual gaharu di mencapai Rp 30.000.000.1-1999. berupa butiran-butiran sebesar biji kacang atau berdiameter sekitar 2 mm.500. Dalam 5.000. Kualitas gaharu yang paling 1.000. Kemedangan Cincangan Sumber : Balai Penelitian dan Pengembangan Kehutanan Kalimantan. Tanggung 10.500.rendah berharga sekitar Rp 25. bercampur kayu.75. keras.beberapa sampel gaharu dapat Teri B 750.000. Potongan kecil kayu dari pemisahan gaharu. kadang bercampur serat kayu dan berukuran tanggung. dan pada umumnya Super AB 15.. Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan.- 6. telah ditetapkan Standar Nasional mutu gaharu dengan judul dan nomor: Gaharu SNI 01-5009.per No..500. 6.000. disusul kualitas tanggung dengan Kalimantan Timur harga rata-rata Rp 10.000.per kg.4. Kelas mutu Harga (Rp/Kg) kg.minyak gaharu.digunakan sebagai bahan baku 3.000.000.penyulingan untuk menghasilkan Kacangan B 5. Super King 30.000. 2006 Berdasarkan informasi pasar di Samarinda (Tabel 3) harga gaharu dengan kualitas super dapat Tabel 3.000. Teri Kulit A Teri Kulit B Kemedangan A Kemedangan B Kemedangan C Suloan 300.000.000.. Tanggung 3.000.Perkembangan Pemanfaatan Gaharu . (Sulistyo A. berupa bongkahan atau butiran berukuran besar. 1386/BSN-I/HK. Siran) Tabel 2.000.. Gaharu berwarna hitam terkadang bercampur coklat.000. Kacangan 4. Kayu yang mengandung getah gaharu. bagian dalam kadang berlubang. keras.000 per kg. bercampur kayu.000. Kacangan A 7. Kriteria dan klasifikasi mutu gaharu No. Teri 5. 1. Klasifikasi Super Kriteria Gaharu berwarna hitam pekat.000 Super 20. 2006 9 . bagian dalam tidak berlubang.Berdasarkan Keputusan Kepala Badan Standarisasi Nasional (BSN) No.000.000. Teri A 1. Gaharu berwarna hitam terkadang bercampur coklat. berupa butiran-butiran lebih kecil dari biji kacang dan lebih tipis atau berdiameter sekitar 1 mm. padat.000.

Sampel gaharu (a) gaharu adalah kayu yang berasal kelas tanggung.1-1999 yang dimaksud dengan gubal Gambar 1. spesifikasi. ditandai oleh warnanya yang hitam atau kehitaman berseling coklat. Klasifikasi mutu gaharu terdiri dari gubal gaharu. cara pemungutan. Setiap kelas mutu selanjutnya dibedakan lagi menjadi beberapa sub kelas berdasarkan ukuran. (b) kacangan. berserat kasar dan kayunya yang lunak. (c) teri dan dari pohon atau bagian pohon (d) kemedangan penghasil gaharu. dan abu gaharu.standar ini diuraikan mengenai definisi gaharu. cara uji. dengan aroma yang kuat. klasifikasi. Abu gaharu adalah serbuk kayu sisa pemisahan gaharu dari kayu. bobot. kemedangan. Kemudian yang dimaksud dengan kemedangan adalah kayu yang berasal dari pohon atau bagian pohon penghasil gaharu. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia dapat dilihat pada Tabel 4. istilah. syarat lulus uji dan syarat penandaan. memiliki kandungan damar wangi dengan aroma yang lemah. warna. Menurut SNI 01-5009. kandungan damar wangi. lambang dan singkatan. pengambilan contoh. serat. dan aroma ketika dibakar. 10 . syarat mutu. ditandai oleh warnanya yang putih keabu-abuan sampai kecoklat-coklatan.

Super Super AB Sabah Super Hitam merata Hitam kecoklatan Hitam kecoklatan Tinggi Cukup Sedang Kuat Kuat Agak kuat Tanggung A Sabah I Tanggung AB Tanggung C Coklat kehitaman Coklat bergaris hitam Coklat bergaris putih tipis Kecoklatan bergaris putih tipis Kecoklatan bergaris putih lebar Putih keabuabuan garis hitam tipis Putih keabuabuan Tinggi Cukup Sedang Sedang Agak kuat Agak kuat Agak kuat Agak kuat 5. C.Perkembangan Pemanfaatan Gaharu .. 3. B. 2. 1. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia Kesetaraan dengan standar mutu di pasaran Kandungan damar wangi No Klasifikasi mutu Gubal Mutu Utama Mutu I Mutu II Kemedangan Mutu I Mutu II Mutu III Mutu IV Warna Bau/aroma (dibakar) A. 4. 11 . 3.. Mutu VII Abu gaharu Mutu Utama Mutu I Mutu II Kurang Kurang kuat Cincangan Hitam Tinggi Sedang Kurang Kuat Sedang Kurang TATA NIAGA GAHARU Proses pemasaran gaharu di berbagai tempat di Indonesia dimulai dari pemungut gaharu yang menjual gaharu yang ditemukannya kepada pedagang pengumpul di desa atau di kecamatan dan selanjutnya oleh pedagang pengumpul dijual ke pedagang besar (eksportir) di Ibukota Propinsi. 1. Siran) Tabel 4. Mutu VI Kemedangan II Kemedangan III Kurang Kurang kuat 7. 2. 3. Mutu V Kemedangan I Sedang Agak kuat 6. 2. 1.. (Sulistyo A..

bahkan untuk mendapatkan jumlah yang diinginkan mereka menanamkan modal yang disalurkan melalui 12 . Pemungut terikat adalah pemungut gaharu yang dimodali sehingga waktu pencarian dan penjualan hasil perolehannya terikat pada pemberi modal yaitu pedagang pengumpul yang merupakan perpanjangan dari pedagang besar. Pedagang besar selain memiliki modal besar juga izin usaha yang dikeluarkan oleh instansi pemerintah. Hasil pembelian dari pedagang perantara ini kemudian dikumpulkan oleh pedagang pengumpul di kecamatan untuk selanjutnya dijual kepada pedagang besar karena adanya ikatan kontrak. Pemungut gaharu terdiri dari pemungut bebas dan pemungut terikat. Contoh alur tata niaga gaharu di Kalimantan dan Sumatra Pedagang pengumpul terdiri dari pedagang perantara di desa yang langsung melakukan pembelian gaharu yang diperoleh para pemungut. Pembelian meningkat bilamana permintaan pasar terhadap gaharu tinggi. Pemungut bebas adalah pemungut gaharu dengan modal kerja sendiri sehingga bebas di dalam menentukan waktu pencarian gaharu dan menjual hasil perolehannya. Pembelian gaharu dilakukan sepanjang tahun melalui pedagang pengumpul atau pemungut bebas. baik kepada pedagang pengumpul di desa. pedagang pengumpul di kecamatan maupun langsung kepada pedagang besar (eksportir) di Kota Samarinda. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 2.Salah satu contoh alur tata niaga gaharu di Kalimantan Timur dapat diuraikan seperti pada Gambar 2.

microcarpa. pengambilan dari alam atau hasil budidaya (penangkaran).. Alur tata niaga Gaharu di daerah (Kalimantan) PEMASARAN GAHARU Dalam dunia perdagangan gaharu. Sulawesi dan Maluku lebih dikenal dengan nama Aquilaria filaria. gaharu dari Papua. yaitu: penentuan kuota. yaitu: gaharu dari Sumatera dan Kalimantan dengan jenis Aquilaria malaccensis dan A. Gaharu yang diperdagangkan di Indonesia terdiri dari tiga jenis. Oleh karena itu maka secara umum pemanfaatan gaharu harus mengikuti tahapan dan aturan-aturannya. (Sulistyo A. sedangkan jenis gaharu Gyrinops lebih banyak diproduksi dari Nusa Tenggara. Siran) pedagang pengumpul ataupun secara langsung kepada pemungut untuk modal kerja mencari gaharu.. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 3.. Pemasaran gaharu yang merupakan salah satu bentuk pemanfaatan tumbuhan dan satwa liar diatur berdasarkan Peraturan Pemerintah Nomor 8 Tahun 1999 dan Konvensi Perdagangan Internasional tentang jenis flora dan fauna liar yang terancam punah (CITES). gaharu menjadi komoditi primadona dan memiliki nilai komersial yang cukup tinggi sehingga banyak diburu oleh konsumen. Apabila diperhatikan maka perdagangan gaharu hasil alam di Indonesia dari dulu hingga saat ini lebih banyak bertumpu pada peyebaran secara ekologis jenis-jenis gaharu tersebut.Perkembangan Pemanfaatan Gaharu . pengangkutan untuk peredaran dalam negeri dan pengangkutan untuk pemasaran luar negeri. 13 .. baik di Indonesia maupun di luar negeri.

pengangkutan dan peredaran secara domestik produk sampai akhirnya ke konsumen. lotion. hio. Beberapa contoh produk dimaksud dapat dilihat pada gambar 3 dan 4 berikut. lulur. sabun. pemanfaatan untuk obat-obatan dan aroma terapi. tapi juga sudah mengarah ke produk turunannya. Karena perkembangan teknologi. makmul. obat nyamuk. antara lain: minyak. lulur dan lotion 14 . Produk turunan gaharu: sabun transparan. cream whitening. pembersih muka.A. produk gaharu yang diperdagangkan dalam negeri saat ini tidak saja terbatas pada chip atau serpihan dengan bermacam-macam kelas. Pemasaran Dalam Negeri Pemasaran dalam negeri dimulai dari aktivitas pengambilan. Bahkan saat ini sudah dikembangkan daun jenis Aquilaria dan Gyrinops untuk bahan pembuatan minuman teh karena kandungan zat anti oksidan dalam daun yang cukup tinggi. Gambar 4.

Di duga banyak gaharu yang di perdagangkan secara illegal dari sumatera lewat Riau ke Singapura dan Malaysia. Oleh karena itu bentuk pemasaran gaharu di Indonesia lebih cocok dikatakan sebagai pasar “monopsoni”. Maluku. baik sebagai individu (perorangan). Secara tradisional daerah pemasok gaharu untuk kota Surabaya adalah Kalimantan. banyak fihak yang terlibat dalam perdagangan gaharu. misalnya pencari gaharu dan pedagang pengumpul di bagian hulu (hutan atau desa sekitar hutan) lebih banyak dibandingkan dengan pedagang menengah dan besar yang berdomisili di ibukota kabupaten atau propinsi.Sirup daun gaharu Gaharu leaf tea Gambar 5. ditambah dari daerah Indonesia bagian barat. Sulawesi. Produk sirup dan teh untuk bahan minuman Dilihat dari pelaku usaha. Daerahdaerah ini walaupun letaknya di Indonesia bagian timur. maka terdapat kecenderungan untuk saling menekan harga. 15 . Karena jumlah pelaku usaha pemasaran. kelompok masyarakat maupun lembaga. NTT. namun karena akses yang mudah memasok gaharu pula ke Jakarta. termasuk Riau. Pemasaran gaharu dalam negeri terbentuk karena adanya hubungan antara daerah pemasok dengan kota/pusat penerima. baik dalam menentukan harga maupun kualitas gaharu. Papua. NTB. yaitu sumatera. yaitu pasar yang dikuasai oleh pembeli.

maka jenis Aquilaria yang ada. B. Pemasaran Luar Negeri Secara fisik. Demikian pula dari sisi warna dan aroma sangat sulit bagi orang awam atau pedagang pemula untuk dapat memilah-milahnya. standar dan kualitas serta harga yang layak sehingga menguntungkan bagi kedua belah fihak. microcarpa. filaria dan Gyrinops diatur perdagangannya oleh konvensi perdagangan internasional yaitu CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) melalui sistem quota. A. yaitu: A. . Lalu lintas perdagangan gaharu dalam negeri Beberapa permasalahan yang sering dijumpai di lapangan antara lain: sulitnya menentukan jenis gaharu. malaccensis. lalu lintas perdagangan gaharu di dalam negeri dapat dilihat pada gambar berikut.Secara garis besar. A. Oleh karena kekhawatiran salah satu species penghasil gaharu yang mungkin bisa cepat punah. produk gaharu sulit dibedakan berdasarkan asal jenis tumbuhan dan asal daerahnya. yaitu konsumen dan produsen. Kalimantan Sulawesi Papua Maluku Riau  Sumatera Sumatera Jakarta NTT NTB Surabaya Gambar 6.

Dalam beberapa tahun terakhir terdapat kecenderungan pembeli dari Taiwan untuk mengimpor gaharu dari Indonesia dalam bentuk log. ekspor lebih banyak dilakukan ke negara-negara Asia Selatan untuk digunakan sebagai bahan baku pembuatan minyak wangi dan untuk acara-acara ritual dalam bentuk hio.Menurut ASGARIN. 17 . Gaharu dalam bentuk gelondongan yang siap dikirim ke Taiwan. Kayu gaharu yang bentuknya masih gelondongan dan hanya sedikit mengandung gaharu tersebut digunakan sebagai hiasan yang dipasang di suatu ruangan dengan diberikan sedikit sentuan teknologi ukir sehingga terkesan mewah dan mempunyai nilai seni yang sangat tinggi. Pada gambar 6 berikut. super A dan AB) umumnya dipasarkan ke negaranegara Timur Tengah untuk digunakan sebagai bahan acara ritual keagamaan. Nilai keseluruhan dari gaharu tersebut tidak kurang dari Rp 600 juta. Gambar 7. Untuk gaharu yang berkualitas menengah ke bawah. makmul dan lain-lain. wewangian dan aroma terapi. produk gaharu yang diperdagangkan ke luar negeri mengikuti selera konsumen. dapat dilihat beberapa gaharu yang masih dalam bentuk gelondongan yang siap untuk diekspor. Gaharu dengan kualitas super (superking.

misalnya untuk jenis A.882(R) Gyrinops 24. Perkembangan kuota dan realisasi ekspor gaharu Indonesia Tahun 2007 2008 2009 A.250 (K) 74.000 (K) 30. filaria yang banyak terpendam di rawa-rawa di Papua. Menurut ASGARIN. lonjakan kuota yang signifikan terjadi pada jenis A. sedangkan untuk A.000(K) 326. Menurut sebuah sumber.000 (K) 65. Tabel 5.000 (K) 25.000 (R) 65.709 (R) 30. dan sebagian lagi ke Timur Tengah. filaria sebanyak tujuh kali lipat. dan bahkan untuk Gyrinops realisasi ekspornya hanya mencapai 30% dari kuota yang ditetapkan. Pada tahun 2009. filaria. seperti dapat dilihat pada gambar berikut. China. Malaccensis 30. Taiwan dan Jepang. Hongkong. hal ini terjadi karena ditemukannya potensi baru yang sebelumnya luput dari inventarisasi.000 (K) 76.000 (R) 173. pusat perdagangan gaharu dunia yang sangat penting adalah Singapura dan Riyad (Saudi Arabia). Oleh Singapura gaharu yang masuk dilakukan penyortiran dan pengemasan dan kemudian di ekspor kembali ke India. Singapura selain mendapat pasokan gaharu dari Indonesia juga dari negara Asia Tenggara.000 (R) 455. sedangkan pada A. misalnya Vietnam dan Kamboja. 18 .000 (K) - Tabel diatas memperlihatkan bahwa kuota ekspor gaharu pada tahun 2007 dari ketiga jenis yang dapat dipenuhi hanya dari jenis A. Pada tahun 2008. filaria 76. realisasi ekspor gaharu untuk ketiga jenis dapat terpenuhi 100% dari kuota yang ditetapkan. Dua negara ini pula yang menjadi daerah atau negara tujuan utama ekspor gaharu dari Indonesia.890 (R) A. malaccensis sebanyak hampir enam kali lipat.Selama 3 (tiga) tahun terakhir jumlah kuota dan realisasi gaharu yang diekspor sebagaimana dapat dilihat pada tabel berikut. Sedangkan gaharu yang masuk ke Saudi Arabia di distribusikan lagi ke negara-negara lain di sekitarnya dan sebagian lagi di ekspor ke Inggris dan perancis.000 (R) 25.000 (K) 8.000 (K) 23. malaccensis tidak dapat dipenuhi.

jamur) yang diduga mengubah pentosan atau selulosa menjadi resin atau damar... sedangkan pohon-pohon penghasil gaharu yang tumbuh secara alami perlu dikonservasi dan dipelihara dengan baik untuk dijadikan pohon induk penghasil anakan. yang dua-duanya berkaitan dengan proses patologis yang dirangsang oleh adanya luka pada batang patah cabang atau ranting.Perkembangan Pemanfaatan Gaharu .. Rekayasa produksi gaharu diarahkan untuk pohon-pohon penghasil gaharu hasil budidaya. Secara garis besar proses pembentukan gaharu terdiri dari dua. yaitu secara alami dan buatan. (Sulistyo A. pemeliharaan. virus. Teknik budidaya dimaksud meliputi kegiatan perbanyakan bibit.. pemberantasan hama dan penyakit hingga tumbuhan tersebut memiliki volume yang cukup memadai. Siran) Hongkong Prancis UK India China Japan Malaysia Taiwan Kwait Oman Qatar Saudi Arabia UAE SINGAPORE Bahrain Middle East Riyadh Indonesia Iraq Iran Afrika Gambar 8. Luka tersebut menyebabkan pohon terinfeksi oleh penyakit (bakteri. 19 . Lalu lintas perdagangan gaharu luar negeri REKAYASA PEMBENTUKAN GAHARU Teknik budidaya perlu dikuasai dengan baik untuk dapat membudidayakan pohon penghasil gaharu. penanaman.

Oleh karena itu untuk dapat mengamati secara langsung proses pembentukan gaharu dilakukan rekayasa dengan cara inokulasi (penyuntikan) jamur atau cendawan pada pohon penghasil gaharu. 20 . dengan teknik induksi yang bermacam-macam dan jenis jamur yang bervariasi. koleksi dan isolasi jamur. Tahapan rekayasa produksi gaharu meliputi banyak kegiatan. dimulai dari kegiatan laboratorium. 2. 8.Semakin lama kinerja penyakit berlangsung. kegiatan lapangan dan kombinasi keduanya. 7. 4. 5. 3. Identifikasi jamur secara molekuler Penyaringan (screening) Uji efektivitas Formulasi media Produksi inokulan (jamur) Pembangunan plot demonstrasi untuk ujicoba di lapangan Observasi dan evaluasi Alur kegiatan rekayasa produksi gaharu secara garis besar dapat dilihat sebagaimana gambar berikut: Gambar 9. Eksplorasi. Proses pembentukan gaharu di hutan alam sulit dipantau dan diamati. kegiatan di laboratorium dan kegiatan uji lapangan yaitu: 1. Kegiatan yang “berskala laboratorium” dimulai dari kegiatan lapangan. Alur kegiatan rekayasa produksi gaharu. kadar gaharu menjadi semakin tinggi. 6. Rekayasa pembentukan gaharu dengan inokulasi telah dilakukan oleh banyak fihak.

maka secara resmi ke empat jenis isolat tersebut telah di “launching” Menteri Kehutanan (lihat gambar 8) pada Pameran Indo Green yang berlangsung di Jakarta Convention Center (JCC) pada tahun 1999. Berdasarkan pengamatan sementara. Launching Inokulan Gaharu oleh Menteri Kehutanan Dengan adanya launching tersebut maka secara resmi inokulan prododuksi Puslitbang Hutan dan Konservasi Alam (P3HKA) telah dilepas di pasaran namun masih terbatas.. Gambar 10. beberapa isolat lain yang juga cocok dan memberikan hasil yang cukup bagus adalah Jambi dan Kalimantan selatan. Sumatera Barat. Ke empat isolat tersebut adalah: isolat dari Kalimantan Barat. (Sulistyo A.. Diantara isolat tersebut empat isolat sudah diujicoba pada beberapa jenis pohon penghasil gaharu di beberapa daerah dan memberikan hasil yang cukup bagus. Launching tersebut juga dimaksudkan untuk memberikan akses kepada publik agar dapat memanfaatkan isolat tersebut untuk ujicoba produksi gaharu. Berdasarkan bukti-bukti keberhasilan tersebut.Perkembangan Pemanfaatan Gaharu ... Keterbatasan tersebut dimaksudkan hanya kepada masyarakat petani gaharu atau pelaku usaha gaharu yang telah mendapatkan pelatihan dari P3HKA saja yang boleh menggunakan inokulan tersebut. Gorontalo dan Papua. Siran) Sampai saat sudah berhasil dikoleksi 23 inokulan (isolat) dari sebagian besar propinsi di Indonesia. 21 .

Penyebaran plot inokulasi dapat dilihat sebagaimana gamber berikut. 22 . jarak titik lubang dan lain sebagainya. Kalimantan Barat. Penyebaran plot inokulasi pembentukan gaharu (gambar bintang warna kuning) Evaluasi dan pengamatan terus menerus dilakukan. baik kondisi ekologis. Beberapa faktor penting yang diamati adalah: kondisi kelembaban dan suhu udara. ujicoba ke enam isolat telah dilaksanakan di 15 (lima belas) lokasi yang tersebar di beberapa propinsi di Indonesia. Kalimantan Selatan. Bali. Bogor (Jabar). Kalimantan Tengah. Ujicoba tersebut dilaksanakan di lokasi dengan kondisi yang berbeda. baik kegagalan maupun keberhasilanya. jenis asal isolat dan jenis pohon penghasil gaharu yang diinokulasi. Sijunjung dan Padang Pariaman (Sumbar). virulensi inokulan yang digunakan. Lombok (NB). keterbukaan tajuk. Bioinduction : 15 locations Gambar 11. Bangka. Menado dan Seram. Sumsel. yaitu: Bohorok (sumut). Carita (Banten). Jambi.Untuk melihat efektivitas pembentukan gaharu. Sukabumi. untuk mengetahui perkembangan inokulasi.

dengan harapan bahwa gaharu yang akan dipanen tersebut akan mempunyai kualitas` yang lebih bagus lagi dari sebelumnya. dan terus meningkat menjadi kelas teri setelah 1 tahun. Tabel 6.. Siran) Perkembangan hasil inokulasi yang dilaksanakan di salah satu lplot penelitian yaitu daerah Sukabumi dari waktu ke waktu dapat dilihat sebagaimana tabel berikut. Pada saat ini pohon yang ditebang secara bertahap tersebut masih hidup dan masih tumbuh baik di lapangan. Contoh gaharu hasil panen yang dilakukan secara bertahap adalah sebagai berikut... Menurut rencana pada tahun 2011 akan dilakukan pemanen lagi untuk melihat perkembangan kualitas gaharu. 23 . Kualitas gaharu tersebut terus meningkat menjadi kacangan setelah 2 tahun inokulasi dan secara signifikan meningkat menjadi tanggung pada 3 tahun setelah inokulasi. (Sulistyo A. maka hasil gaharu yang dipanen setelah 3 bulan inokulasi memiliki kualitas kemedangan. Perkembangan hasil inokulasi menurut waktu Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun 2 tahun 3 tahun Kualitas Kemedangan Kemedangan B Kemedangan A teri kacangan tanggung Apabila di sejajarkan dengan kualitas gaharu hasil alam yang ada di pasaran dalam negeri..Perkembangan Pemanfaatan Gaharu .

dengan kualitas kemedangan C. 24 . Gambar 13.Gambar 12. Gaharu hasil panen 9 bulan setelah penyuntikan (inokulasi) dengan kualitas kemedangan A. Gaharu hasil panen 3 bulan setelah penyuntikan.

.. Siran) Grade Kemedangan (US $ 100/kg) Gambar 14. (Sulistyo A.Perkembangan Pemanfaatan Gaharu . Gaharu hasil panen dua tahun setelah penyuntikan dengan kualitas kacangan 25 ... Gaharu hasil panen satu tahun setelah penyuntikan dengan kualitas teri Grade Gubah AB (US $ 200-250/kg) Gambar 15.

000 1.000 750.> US $ 800 Gambar 16.000 26 . Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun Harga (Rp) 50. Harga gaharu yang cenderung meningkat dengan semakin tertundanya waktu panen. Gaharu hasil panen 3 (tiga) tahun setelah penyuntikan dengan kualitas tanggung Berdasarkan survey pasar.000 200.000. referensi harga gaharu hasil alam di pasaran dalam negeri dan penawaran dari pedagang gaharu dari Riyad (gambar sudut kanan atas). estimasi harga gaharu hasil panen dari plot penelitian P3HKA dapat dilihat sebagai mana tabel berikut. Tabel 7.

waktu penundaan panen dan harga di pasaran sangan erat sekali.500. Grafik hubungan antara terbentuknya gaharu dengan waktu penundaan panen. Kualitas Hasil rekayasa Super Tanggung Kacangan Teri Kemedangan Hasil alam 1 Hasil alam 2 Hasil alam 3 Hasil alam 4 1 2 3 4 Tahun 5 6 7 8 9 10 Gambar 17. Semakin lama proses pembentukan gaharu di pohon maka akan semakin meningkat kualitas gaharu yang akan dihasilkan dan dengan sendirinya akan meningkatkan harga gaharu tersebut.500.000 US$ 800 atau 7..000 ? Hubungan antara kualitas gaharu.. Berdasarkan pemeriksaan laboratorium. gaharu hasil panen 9 bulan setelah penyuntikan mengandung zat aktif yang cukup 27 . (Sulistyo A.Perkembangan Pemanfaatan Gaharu .. Grafik hubungan antara terbentuknya gaharu dengan waktu dapat dilihat pada grafik sebagai berikut. Siran) Umur Setelah Inokulasi 2 tahun 3 tahun 4 tahun Harga (Rp) 2..

anti inflamantory Ambrettolide = wangi musk. manis buah & bunga 1 2 3 4 5 Tahun Gambar 18. teh dan daun tembakau Valerolactone = wangi herbal Ambrox = odorant tipe amber. bahan kosemtik Isolongifolen = bahan odorant & parfum Indole = wangi bunga & parfum. komponen volatile dan kokoa Dumasin = wangi mint. Pemeriksaan kandungan kimia pada gaharu hasil alam menunjukkan hasil yang sama dengan gaharu hasil rekayasa jika dua-duanya diambil dari kualitas yang sama. Azulene = komponen minyak esensial tanaman. wangi & warna biru Benzylacetone = wangi manis bunga. penguat rasa/aroma pada roti &kue Komponen Kimia Ketoisophorone = wangi manis campuran kayu.banyak. Kandungan kimia yang terdapat pada gaharu hasil rekayasa.konsituen utama dalam minyak melati Maltol = wangi caramel (manis). memiliki sifat pestisida Cadinene = konstituen minyak esensial berbagai tanaman Limonene = terpen aroma bunga & buah. insektisida botani. 28 . setidaknya terdapat 12 (dua belas) komponen kimia sebagaimana dapat dilihat pada gambar berikut.

pengangkutan. subsistem tengah (penyuntikan. (Sulistyo A.. maka seluruh sektor harus memainkan peran sesuai dengan tugas pokok dan fungsinya masing-masing. pendidikan dan pelatihan. pemasaran). pengolahan. terbukalah peluang yang besar untuk kegiatan pengusahaan gaharu yang dimulai dari subsistem hulu (penyiapan lahan. peralatan inokulasi. 29 . Hanya dengan koordinasi dan integrasi yang baik di antara seluruh komponen masyarakat dan pemerintah. skema kredit dan asuransi). riset dan pengembangan. infrastruktur. pemberantasan hama dan penyakit). subsistem pendukung (kebijakan pemerintah. Untuk dapat mewujudkan kondisi dan harapan tersebut. subsistem hilir (pemanenan.. Ketiga subsistem tersebut di atas memerlukan investasi yang cukup besar. Siran) PENUTUP Dengan ditemukannya teknologi inokulasi pembentukan gaharu. peluang penyerapan tenaga kerja yang besar dan penerimaan asli daerah yang cukup signifikan. penyiapan bibit. maka produk gaharu akan menjadi produk andalan dimasa depan.. penyediaan pupuk. tranportasi.Perkembangan Pemanfaatan Gaharu . penyediaan inokulan. dan pengamanan). penanaman..

30 .

STATUS RISET GAHARU 31 .

32 .

Aspek PRODUKSI 33 .

.

PENGEMBANGAN GAHARU DI SUMATERA Mucharromah Fakultas Pertanian Jurusan Perlindungan Tanaman Universitas Bengkulu PENDAHULUAN Gaharu merupakan produk kehutanan yang memiliki nilai ekonomi sangat tinggi dibanding produk kehutanan lainnya. Dari segi keberadaan material bibitnya lokasi sekitar hutan memiliki jumlah tegakan gaharu alam terbanyak. mengingat 35 . masyarakat di sekitar hutan merupakan sasaran ideal yang dapat melipatgandakan peran dan fungsi program tersebut. pada umumnya masyarakat yang tinggal di sekitar hutan sudah mengenal gaharu. Pengembangan gaharu ini perlu dilakukan. sehingga sangat potensial untuk dikembangkan. khususnya untuk menjaga kesinambungan produksi. Dari segi kesiapan masyarakat. sehingga pemahaman dan keterampilannya untuk mendukung pengembangan cluster industri gaharu telah sangat memadai. pengembangan gaharu di sekitar hutan juga akan membantu pengamanan keragaman hayati dan kelestarian hutan. kecuali dengan campur tangan manusia. sehingga tidak menyebar jauh. Dalam pengembangan gaharu. sebagian bahkan pernah menjadi pengumpul. mengingat buah pohon ini bersifat rekalsitran. Dari aspek keamanan lingkungan dan keragaman hayati. sekaligus untuk melindungi ragam pohon penghasil gaharu yang ada di Indonesia.

di samping pemberdayaan dan pemakmuran masyarakat di sekitar wilayah hutan. Gaharu kualitas super sudah mengeluarkan aroma harum meski tanpa dipanasi atau dibakar. termasuk dari wilayah barat Indonesia atau Sumatera dan dihargai sangat mahal. dengan tekstur yang sangat keras dan halus tidak berserat. mengingat pohon penghasil gaharu memiliki morfologi yang sangat mendukung perannya sebagai ’penjaga lingkungan’. yaitu meningkatkan kapasitas absorbsi dan retensi air tanah. pengembangan produksi gaharu tidak cukup hanya dilakukan dengan penanaman bibit pohon penghasilnya saja. bangsa. dan kekurangan oksigen. berwarna hitam mengkilat dan berat hingga tenggelam dalam air. menguatkan tanah. Dengan demikian. dan negara di samping menghindarkan dari bahaya bencana alam kekeringan. Bentuk gaharu super sangat beragam. longsor. maka pengembangan gaharu sangat berpotensi mensejahterakan masyarakat. tetapi juga perlu didukung dengan pengembangan teknik produksi dan pengembangan sistem yang akan mendukung pengembangan produksi. pengembangan gaharu tidak sama dengan pengembangan tanaman pertanian yang dapat langsung menghasilkan. Namun demikian. produksi gaharu justru tidak akan terjadi bila pohonnya tumbuh sangat baik dan tidak terganggu sedikit pun. kekurangan air bersih. khususnya yang memiliki kualitas super dan di atasnya.Aspek PRODUKSI masyarakat sudah dapat memperoleh penghasilan dari usaha pengembangan gaharu yang sangat prospektif secara ekonomi. Pada pohon penghasil gaharu. Oleh karenanya. polusi. Selain itu. paningkatan temperatur udara. khususnya yang berkaitan dengan pendanaan proses produksi yang memerlukan dana cukup besar. Gaharu alam telah dikenal sejak ribuan tahun lalu diperdagangkan ke Timur Tengah oleh para pedagang India dan Indo-China. Dengan nilai ekonomi gaharu yang sangat tinggi dan permintaan pasar dunia yang terus meningkat. Sejauh ini produksi gaharu Indonesia masih banyak diambil dari alam sehingga disebut sebagai gaharu alam. Sementara gaharu 36 . pengembangan gaharu di wilayah sekitar hutan akan memperkuat fungsi hutan tersebut. sehingga tidak mudah longsor serta menyerap CO2 dan menghasilkan O2 yang sangat penting dalam mendukung kehidupan.

B. khususnya di area yang paling potensial yaitu wilayah sekitar hutan. maka volume perdagangan gaharu makin meningkat. Proses ini sangat lambat. Kesiapan SDM Pendukung Proses Produksi Meskipun gaharu sudah sangat lama menjadi salah satu komoditi ekspor Indonesia. pembersihan. sehingga lebih mampu menjaga keamanan lingkungan dan keragaman sumberdaya alam di sekitarnya. banyak masyarakat di sekitar hutan yang terampil membersihkan gaharu sehingga cukup siap untuk mendukung pengembangan gaharu di daerahnya.. sehingga keberadaan pohon penghasil gaharu juga makin terancam akibat banyak yang ditebangi dan dicacah masyarakat untuk diambil gaharunya. KESIAPAN PENGEMBANGAN GAHARU A. namun banyak masyarakat umum yang tidak mengetahui apa yang disebut gaharu. Dengan makin meningkatnya permintaan pasar internasional. sehingga membutuhkan banyak tenaga kerja terampil. pembersihan gaharu dari sisa kayu putihnya..Pengembangan Gaharu di . Dengan pengalaman mencari gaharu alam yang sudah cukup lama. (Mucharromah) yang memiliki kualitas lebih rendah (kemedangan dan abuk) disuling untuk diambil resinnya dan ampasnya dibuat makmul atau hio untuk ritual keagamaan. dan perdagangan gaharu. kecuali masyarakat di sekitar wilayah hutan yang sudah pernah terlibat dalam pencarian. Kondisi ini tak akan dapat diatasi kecuali dengan melakukan pengembangan gaharu secara besar-besaran. Dengan upaya ini.. maka produksi gaharu Indonesia akan tetap melimpah dan masyarakat yang memproduksinya juga makin makmur dan sejahtera. khususnya pada proses pasca panen. Kesiapan Teknologi Produksi Berbeda dengan produk pepohonan lainnya yang selalu dihasilkan selama tanaman tumbuh sehat atau dengan kata lain 37 . Karenanya mereka merupakan kelompok sasaran yang sudah siap menjadi SDM untuk pengembangan gaharu. hampir seperti seni memahat..

Beberapa kelompok peneliti telah mampu melakukan inokulasi yang merangsang pembentukan gaharu (Mucharromah et al. Santoso et al.. Selain itu juga perlu dilakukan teknik pelatihan produksi inokulan sehingga proses produksi dapat berlangsung lebih efisien.d.Aspek PRODUKSI produksi merupakan fungsi dari pertumbuhan tanaman sehat. 2008. Sementara pembentukan gaharu oleh faktor biotik dapat disebabkan oleh infeksi jasad renik terhadap tanaman. maka teknik produksi inokulan dan induksi pembentukan gaharu dengan inokulasi telah siap untuk dilatihkan kepada masyarakat guna mendukung pengembangan produksi gaharu melalui pemberdayaan masyarakat di sekitar wilayah hutan. baik pelatihan teknik inokulasi maupun pelatihan teknik monitoring pembentukan gaharu. gaharu justru tidak akan didapat pada pohon yang tumbuh sehat tanpa ada gangguan apapun. Namun kejadian pembentukan gaharu oleh faktor abiotik dari alam ini sulit ditiru sehingga tidak dapat dijadikan dasar pada proses produksi dalam bentuk industri. 2008a. Temuan tentang adanya jenis jasad renik yang dapat menginduksi terjadinya akumulasi resin wangi yang selanjutnya membentuk gaharu inilah yang mendasari adanya temuan tentang teknik induksi pembentukan gaharu yang dapat digunakan untuk mendukung proses produksi gaharu dalam skala industri. C.c.. selain akibat gesekan hewan dan perilaku manusia yang tidak direncanakan. Faktor abiotik dapat berupa angin atau hujan angin dan petir. Kesiapan Kontrol Kualitas Produk Untuk keberhasilan dan kesinambungan suatu proses produksi umumnya selalu dilakukan monitoring kualitas produk. maka untuk persiapan pelaksanaannya dalam proses produksi dibutuhkan pelatihanpelatihan. Kebanyakan gaharu justru ditemukan pada pohon yang terganggu.b. Dengan dukungan operasional. Untuk itu penyiapan SDM pendukung pengembangan gaharu juga perlu mempersiapkan personil yang mampu mengenali kualitas 38 . 2006. 2009). Kadir. baik secara alami oleh faktor abiotik maupun biotik ataupun telah diinduksi oleh manusia. Namun mengingat teknik yang diterapkan belum biasa dilakukan masyarakat.

Abu gaharu yang terbagi dalam 3 kelas mutu. yaitu: a. Pada gaharu alam gradasi kualitas ditentukan berdasarkan standar mutu yang telah ditetapkan secara nasional dalam SNI 015009. mutu TGD/TK4 e. dengan 7 kelas mutu. dengan 3 tanda mutu. Kemedangan. mutu utama = mutu super b. dan tingkat kekerasan dan berat jenis berbeda. kemedangan.dan mensortasi atau mengumpulkan gaharu yang dihasilkan berdasarkan gradasi kualitas dan kegunaannya. Dalam standar ini kualitas gaharu dibedakan menjadi tiga sortimen. mutu TGB/TK2 c. mutu pertama 39 . seperti pelukaan yang disertai infeksi patogen melalui inokulasi atau proses lainnya. Gubal gaharu. Ketiga sortimen tersebut dibagi lagi dalam 13 kelas kualitas. aroma. mutu utama b. yaitu: a. yaitu gubal gaharu. gaharu merupakan jaringan kayu dari pohon jenis tertentu (penghasil gaharu) dengan kandungan resin sesuiterpenoid volatil beraroma harum gaharu yang cukup tinggi. Hal ini membuat gaharu menjadi makin mahal dan nilainya sangat ditentukan oleh kualitas kadar dan kemurnian resin yang dikandungnya. yang selanjutnya membuat jaringan kayu tersebut memiliki warna. Selain itu jaringan yang mengandung resin wangi gaharu juga hanya didapati pada bagian pohon yang mengalami proses tertentu. mutu ketujuh = setara dengan M3 3. tekstur. mutu TGC/TK3 d.1-1999. mutu pertama = mutu AB c. yaitu: a. Dari segi bentuknya. mutu TGF/TK6 g. mutu kedua = mutu sabah super 2. mutu pertama = mutu TGA/TK1 b. mutu TGE/TK5 f. yang terdiri dari: 1. Adanya aroma harum yang khas dan tahan lama inilah yang membuat gaharu sangat disukai dan dihargai dengan nilai ekonomi yang sangat tinggi. dan abu gaharu.

Pada 6 bulan setelah inokulasi telah dicapai produk kualitas kemedangan TGB dan TGA. seperti yang telah dilakukan di Kota Bengkulu dan sekitarnya. meskipun sebagian besar masih berada pada mutu TGC (Mucharromah et al. di mana pemilik barang merupakan penentu harga. Dengan demikian pengembangan gaharu siap dilaksanakan. mutu kedua.Aspek PRODUKSI c. proses pembentukan gaharu telah semakin cepat terjadi. standar kualitas gaharu dan harganya akan lebih terjamin. di samping lebih besar manfaatnya bagi pengamanan lingkungan dan pemberdayaan serta pemakmuran masyarakat. khususnya dari jenis Aquilaria dan Gyrinops. Kesiapan Modal dan Kelembagaan Indonesia merupakan negara yang sangat kaya dengan beragam jenis pohon penghasil gaharu. Hal ini merupakan anomali dari kondisi perdagangan komoditi lainnya. D. Teknik inokulasi untuk induksi pembentukan gaharu juga telah makin efisien dan murah. Namun pembedaan kelas kualitas tersebut secara detil sangat sulit dilakukan sehingga pada prakteknya hingga saat ini konsumenlah yang menentukan tingkat mutu produk dan harga gaharu. Saat ini sudah cukup banyak pohon penghasil gaharu yang telah diinokulasi. 2008). Hal ini menjadi modal utama yang membuat proses produksi gaharu menjadi jauh lebih 40 . yang biasanya baru dapat dicapai pada 12-18 bulan setelah inokulasi. Perkembangan keberhasilan teknik inokulasi ini sangat prospektif untuk mendukung pengembangan produksi gaharu yang pohon penghasilnya telah mulai banyak dibudidayakan di Sumatera dan wilayah lain di Indonesia. Pada hasil uji lanjut teknik produksi gaharu yang dilakukan beberapa bulan lalu di Provinsi Bengkulu. Namun dengan tingkat keahlian sortasi. Namun pengembangan gaharu di sekitar wilayah hutan kemungkinan akan jauh lebih efisien proses produksinya. tidak hanya di sekitar wilayah hutan tetapi bahkan hingga ke halaman rumah dan perkantoran serta sekolah. Untuk itu pelatihan SDM dalam teknik monitoring perkembangan pembentukan gaharu dan kontrol kualitasnya sangat penting dilakukan..

pelatihan monitoring pembentukan gaharu serta upaya produksi gaharu hasil inokulasi. Selain itu juga diperlukan adanya kerjasama dan komitmen semua pihak untuk membantu mengawali usaha ini berdasarkan expertise dan bidang pekerjaannya. (Mucharromah) mudah dan murah. Semakin lama maka semakin banyak resin wangi yang terakumulasi dan semakin tinggi kualitas gaharu yang dihasilkan.. Namun demikian pengembangan gaharu tetap memerlukan dukungan dana yang relatif besar meskipun rasio keuntungannya terhadap modal juga cukup besar. dan satu famili Euphorbiaceae (Wiriadinata.. proses produksi gaharu sangat ditentukan kuantitasnya oleh jumlah lubang atau luka yang diinokulasi dan kualitasnya tergantung dengan lamanya waktu sejak inokulasi hingga panen. Berdasarkan hasil analisis tersebut maka pengembangan gaharu paling efisien bila dilakukan di area sekitar hutan yang masih kaya dengan tegakan gaharu berdiameter > 20 cm yang dapat diinokulasi untuk mempercepat produksi dan menambah modal awal untuk penanaman pada area yang lebih luas untuk kesinambungan usaha pengembangan gaharu. tidak semua pohon menghasilkan gaharu. Namun dari 41 . Di alam tidak semua pohon penghasil gaharu membentuk gaharu atau hanya sedikit sekali menghasilkan gaharu.. 2002). 1998). Hal ini membuat proses produksi gaharu alam menjadi kian mahal. pelatihan inokulasi. satu famili Leguminoceae. Selain itu. Pada gaharu budidaya.. Dengan demikian.3 hingga 14 kg dan umumnya semakin banyak dengan makin besarnya diameter pohon (MacMahon. maka pengembangan gaharu hasil budidaya dan inokulasi dapat jauh lebih efisien dibandingkan produksi yang mengandalkan gaharu bentukan alam. Saat ini pembentukan gaharu di alam telah dilaporkan terjadi pada sedikitnya 16 jenis pohon dari beberapa genus famili Thymelaceae. Sejauh ini keberadaan pohon penghasil gaharu di lapangan telah banyak membantu pelaksanaan uji efektivitas inokulasi.Pengembangan Gaharu di . Jumlah gaharu yang dihasilkan per pohon di hutan alam sangat bervariasi dari 0. 2008 dan Sumarna. sebagaimana disajikan pada analisis usaha inokulasi gaharu (Lampiran 1) dan analisis budidaya gaharu (Lampiran 2). uji produksi.

000 hingga 16. justru mendegradasi kembali resin gaharu yang sudah dideposisi bahkan hingga menghancurkan selnya sehingga gaharu yang sudah mulai terbentuk menjadi hancur dan lapuk minimal sebagian dan kualitas gaharu yang dihasilkan akan menurun. maka penggunaan inokulan unggul dan teknik inokulasi yang meminimalkan kontaminasi akan dapat meningkatkan kualitas gaharu yang dihasilkan dan mengefisienkan proses produksi hingga dapat dilaksanakan dengan modal lebih rendah. tergantung intensitas atau kadar resin gaharu yang dikandungnya. Pada gaharu kualitas gubal. 2009). khususnya cendawan pelapuk kayu. sehingga mampu menutupi pembiayaan untuk pengembangan selanjutnya. sebagaimana ditunjukkan oleh data mikroskopis perkembangan deposisi resin gaharu pada area jaringan sekitar lubang yang diinokulasi atau hanya dilukai (Mucharromah dan Marantika.komunikasi pribadi. Akibatnya jaringan kayu tersebut menjadi halus seperti dilapisi agar dan berwarna coklat kemerahan atau kehitaman. akumulasi resin wangi terjadi maksimal hingga luber dan menutupi sel-sel di sekitarnya.Aspek PRODUKSI segi kualitas.000 per kg di tingkat ’end-consumer’ di luar negeri. double super. 2008 . yaitu super. Saat ini kualitas gaharu hasil inokulasi sudah jauh lebih baik dan pada beberapa hasil penelitian sudah mendekati mutu gubal kualitas kemedangan B/C (Santoso. Terbentuknya gaharu kualitas super atau yang sering disebut gubal super ini kemungkinan akan dapat dicapai seiring dengan pengembangan penelitian inokulan unggul yang terus dilakukan. Bila kualitas seperti ini dapat dihasilkan dari inokulasi pohon pada awal proses pengembangan. Dengan demikian. yaitu USD 2. Secara teoritis keunggulan inokulan dalam menginduksi pembentukan gaharu berkaitan dengan jenis dan kemurnian mikroorganisme yang digunakan. 42 . dan lebih tinggi. maka produksi gaharu selanjutnya tidak banyak memerlukan bantuan modal lagi. karena kualitas seperti gaharu alam tersebut bernilai sangat tinggi. Sementara kehadiran jenis cendawan lainnya. 2008. Mucharromah dan Surya. gaharu hasil inokulasi hingga kini belum dapat mencapai kualitas tertinggi gaharu alam. 2006) atau bahkan B (Surya.

. (Mucharromah) Mucharromah et al. microcarpa. kemungkinan karena kemurnian resin yang dikandungnya. hirta. 2002).. 2008).b. agallocha yang banyak dijumpai di Sumatera. Oleh karenanya pengembangan gaharu di wilayah sekitar hutan dengan cara memperbanyak pohon-pohon jenis Aquilaria yang ada di lokasi tersebut dan menginokulasi pohon yang sudah tua untuk membiayai peremajaannya akan dapat mengembalikan potensi produksi gaharu yang dahulu dimiliki Sumatera dan wilayah Indonesia lainnya. Oleh karena itu dalam proses produksi gaharu dengan inokulasi perlu diterapkan prinsip-prinsip aseptik yang akan membatasi peluang terjadinya kontaminasi (Mucharromah et al. A. Santoso et al. Jenisjenis pohon penghasil gaharu dari spesies Aquilaria malaccensis.. 43 . A.c.Pengembangan Gaharu di . 2009) menunjukkan bahwa pada jaringan yang terkontaminasi resin gaharu yang awalnya berwarna coklat bening kemerahan berubah menjadi berwarna kehitaman dan menghilang sebelum akhirnya selnya menjadi hancur. dikenal menghasilkan gaharu yang disukai konsumen mancanegara sejak jaman dahulu. MODEL PENGEMBANGAN GAHARU DI SUMATERA Secara teoritis akumulasi resin wangi gaharu telah dilaporkan distimulasi oleh infeksi cendawan dari jenis tertentu (Mucharromah dan Surya. Dengan teknik inokulasi dan jenis isolat yang lebih murni dan potensial serta waktu antara inokulasi dan panen yang lebih panjang.. dan A. Sejauh ini aroma gaharu alam lebih lembut dibanding hasil inokulasi. 2006. Selain itu kekhasan aroma gaharu juga dipengaruhi oleh jenis pohon penghasilnya dan kemungkinan juga jenis mikro organisme inokulannya. A. 2008).. 2006.. Selain karena kandungan resinnya yang jauh lebih tinggi. Sumarna. Pada pengamatan mikroskopis (Mucharromah dan Marantika... maka kualitas gubal super mungkin akan dapat dicapai. beccariana. aroma resin gaharu juga sangat menentukan kualitas. sehingga aroma gubal gaharu kualitas terbaik dari berbagai wilayah dapat berbeda (Mucharromah et al. 2007). 2008a.

pengembangan gaharu memerlukan modal yang cukup besar karena prosesnya cukup kompleks. anakan alam atau bibit harus ditanam dan dipelihara. Oleh karenanya pengembangan gaharu tidak dapat dilakukan secara mandiri. Selain itu. setelah didapat inokulan efektif dan hasil inokulasi yang cukup menjanjikan.Aspek PRODUKSI Kemampuan cendawan inokulan dalam menstimulir produksi resin juga sangat terkait dengan tingkat akumulasi resin yang merupakan hasil netto dari proses sintesis dikurangi dengan degradasinya serta jenis resin dan kemurniannya (Agrios. 2005. Selanjutnya pohon yang sudah cukup besar (diameter > 44 . Mucharromah. Meskipun gaharu yang dipanen akan menghasilkan produk yang dapat dijual. dan keterampilan pekerja akan sangat mempengaruhi proses produksi dan kualitas produk. Sejauh ini telah dilakukan pengembangan gaharu sebanyak > 10. namun untuk pelaksanaan proses panen dan pembersihan tersebut diperlukan modal yang cukup besar.000 batang yang ditanam di sekitar pohon induk yang diinokulasi. 2004). ketepatan teknik inokulasi. karena masih harus melakukan panen dan proses pembersihan gaharu yang bersifat padat karya. Langenhein. maka kepada masyarakat pemilik tegakan gaharu yang diameternya telah mencapai > 20 cm ditawarkan kerjasama pengembangan gaharu dengan penanaman kembali dan inokulasi. Kerjasama ini meliputi pemeliharaan dan penanaman kembali anakan alam yang ada di sekitar tegakan induk hingga mencapai populasi minimal 10-100 batang tanaman muda per pohon induk diinokulasi untuk produksi gaharu. Oleh karenanya di Bengkulu pengembangan gaharu diawali dengan pengujian efektivitas berbagai isolat cendawan yang berpotensi menginduksi pembentukan gaharu dan diikuti dengan pengembangan inokulan unggul yang masih terus dilakukan untuk peningkatan kualitas. 2004. Dengan demikian maka penggunaan jenis inokulan tertentu dan kemurniannya serta penerapan teknik aseptik dalam penyiapan dan aplikasi inokulan. Pertama. Oleh karenanya campur tangan pemerintah sangat diharapkan. khususnya pada masyarakat yang tidak memiliki modal dan hanya mengandalkan sumberdaya alam dan keterampilan. Namun kerjasama ini masih membutuhkan cukup banyak modal untuk menjadi usaha pengembangan gaharu yang mandiri. Sebagaimana diuraikan sebelumnya.

. tetapi dari segi keamanan pekerja dan lingkungan. Proses ini dilakukan secara manual dengan melibatkan sejumlah besar tenaga kerja.000-68.Pengembangan Gaharu di . sehingga untuk menghasilkan gaharu sebanyak 270 ton sebagaimana jumlah yang diekspor pada tahun 2000-an akan mampu menyerap tenaga kerja sebanyak 56. untuk membersihkan 1 kg gaharu umumnya diperlukan 4-5 orang hari kerja. Dengan peningkatan permintaan dan kapasitas produksi. pengembangan gaharu hasil budidaya dan inokulasi makin lama makin memberikan keuntungan melimpah dan makin ’sustainable’. Proses inokulasi ini selain memerlukan keterampilan. Jumlah ini cukup besar dan akan mampu mempekerjakan masyarakat sekitar hutan sebanyak 280 hingga 340 orang/tahun dengan 200 hari kerja/tahun. mengingat proses produksi gaharu jauh lebih rumit dibandingkan proses produksi komoditi hasil hutan dan perkebunan atau pertanian lainnya. Selanjutnya pohon yang telah diinokulasi dimonitor hingga waktu panen. Kelembagaan tersebut dapat sangat sederhana 45 .. Dari segi jumlah tenaga kerja yang menangani proses pembersihan produk ini kemungkinan tidak banyak berbeda antara produksi gaharu alam dengan gaharu budidaya. Setelah dipanen secara total. (Mucharromah) 20 cm) perlu diinduksi dengan inokulasi jasad renik atau perlakuan lainnya agar membentuk gaharu. Pada gaharu hasil inokulasi. Oleh karenanya pengembangan gaharu harus dilakukan secara serius. Selain itu. dilakukan proses pembersihan untuk memisahkan gaharu dari jaringan kayu yang lebih sedikit kandungan resin wanginya. maka jumlah tenaga kerja yang dikaryakan juga akan semakin meningkat.. sehingga upaya-upaya yang dilakukan akan memberi hasil yang berkelanjutan. sehingga tidak berkelanjutan.. sementara gaharu alam akan makin habis. maka perlu ada suatu kelembagaan yang bertugas untuk membantu penyiapan dan pelaksanaan proses produksinya hingga berhasil berkembang menjadi industri gaharu yang mandiri. juga keberanian dan ketersediaan personil dengan kondisi fisik yang mendukung pelaksanaan pekerjaan.000 orang/hari. Proses induksi pembentukan gaharu dilakukan dengan memberikan inokulan pada sejumlah besar lubang yang dibuat spiral dengan jarak 7-10 cm horisontal dan 12-20 cm vertikal dari pangkal batang hingga ujung pucuk yang masih bisa dipanjat.

Peran tersebut dapat dilakukan melalui kegiatan penelitian dan pengabdian pada masyarakat yang sudah secara 46 . Hal ini dikarenakan upaya pengembangan yang dilakukan masih belum mencapai tahap produksi gaharu yang siap diperdagangkan. pelibatan banyak pihak ini bila tidak dipayungi dengan deskripsi tugas yang mendetil dan tidak saling tumpang-tindih. Namun bila perdagangan gaharu masih diatur oleh kuota yang dalam proses perdagangannya melibatkan banyak pihak.Aspek PRODUKSI bila pengembangan gaharu dapat diberlakukan seperti komoditi pertanian atau perkebunan hasil budidaya. maka dengan adanya aturan kuota. Mengingat pohon yang diinokulasi atau bibit yang ditanam berada di lahan pribadi. Sejauh ini pengembangan gaharu yang dilakukan di Provinsi Bengkulu. maka proses pengembangan gaharu yang telah dilakukan sejauh ini berjalan aman. Dalam hal pengembangan gaharu. Hal ini mungkin perlu disederhanakan dalam upaya pengembangan gaharu yang dilakukan. baik oleh pihak swasta maupun perguruan tinggi dan kelompok masyarakat. pengembangan inokulan unggul untuk peningkatan mutu serta pengembangan teknik pengawasan kualitas produk. sehingga cukup menyulitkan meskipun prosesnya sederhana. penjualan gaharu hingga kini masih memerlukan adanya sertifikasi jumlah untuk memastikan bahwa batas kuota belum terlewati. dibuat secara sangat sederhana dengan kontrak kerjasama antara pemilik pohon/lahan dengan pelaksana yaitu perguruan tinggi. mengingat wilayah sekitar hutan yang menjadi area pengembangan gaharu umumnya cukup jauh dari lokasi institusi yang mensertifikasi produknya. baik halaman maupun kebun. tidak hanya dengan pihak yang dapat membantu pengembangannya. Bila sudah mencapai tahap produksi. perguruan tinggi dapat memainkan peran yang dapat menguntungkan semua pihak. Dalam hal ini peran perguruan tinggi yang mengembangkan penelitian gaharu dapat dilakukan dalam bentuk pembinaan kelompok produksi gaharu di sekitar wilayah hutan serta penelitian untuk pemutakhiran teknik produksi. maka pengembangan gaharu perlu dilakukan dengan melibatkan berbagai pihak yang terkait dengan perdagangannya. justru akan dapat menghambat pengembangan gaharu yang dituju. swasta atau kelompok masyarakat. Dalam pelaksanaannya.

2. Makalah Dipresentasikan pada Temu Pertama Pakar Gaharu. PENUTUP 1. Pengembangan gaharu merupakan suatu program yang sangat besar. Oleh karenanya pengembangan gaharu perlu dilaksanakan dengan perencanaan yang sangat matang dari setiap tahapan prosesnya sehingga dapat berjalan dan meningkatkan kemandirian masyarakat di wilayah sekitar hutan. tidak hanya karena menghasilkan produk bernilai ekonomi yang sangat tinggi. Jakarta. Hal ini sangat penting dilakukan. Hal ini sangat penting untuk diperhatikan mengingat proses pembentukan gaharu tidak berjalan secara otomatis pada tanaman yang tumbuh sehat.... tetapi juga untuk melindungi hutan dan keragaman hayati yang ada di sekitarnya serta meningkatkan kapasitas hutan dalam menanggulangi potensi bahaya bencana alam yang disebabkan oleh longsor. (Mucharromah) rutin dilakukan perguruan tinggi dengan dukungan pendanaan dari instansi pemerintah maupun swasta. Analisa Penyebab Terjadinya Gubal dan Kemedangan pada Pohon Gaharu. Plant Pathology. tidak hanya untuk menjamin peningkatan dan kesinambungan produksi gaharu. DAFTAR PUSTAKA Agrios. 20 Oktober1995. tetapi juga karena upaya ini memerlukan investasi teknologi dan modal yang cukup besar bagi keberhasilannya. Academic Press. sebagaimana produk pertanian atau perkebunan dan kehutanan lainnya. kekeringan. yang berpotensi sangat besar untuk pemberdayaan masyarakat di sekitar wilayah hutan. 1995.Pengembangan Gaharu di .N. Untuk lebih mengefisienkan proses produksi dan menekan pembiayaan maka program pengembangan gaharu perlu dilakukan dengan mengadopsi model yang paling efisien dan praktis. 1988. dan beragam kerusakan lingkungan lainnya. sehingga keberhasilannya akan lebih terjamin. banjir. polusi.. Anonim. 47 . New York. G.

Tingkat Akumulasi Resin Gaharu Akibat Inokulasi Fusarium sp. Makalah Semirata Bidang MIPA. Asal Gaharu terhadap Alginate dan CaCl2. Misnawaty. Accessed 16 April 2006. Fenomena Pembentukan Gubal Gaharu pada Aquilaria malaccensis (Lamk. Universitas Mataram. Respon Acremonium sp. 1998. Lombok. http://members.). Mucharromah. Nusa Tenggara Barat. Bogor. DIKTI. ”http://en.). Mucharromah. 2008. Rahayu dan E. Hipotesa Mekanisme Pembentukan Gubal Gaharu. Seameo-Biotrop. Santoso.. Studi Mekanisme Akumulasi Resin Wangi Aquilaria malaccensis (Lamk. 2008. 14-16 Mei 2008. Hartal. Agarwood. MacMahon. dan Hartal. BKS-PTN Wilayah Barat. 48 . dalam Menginduksi Akumulasi Resin Wangi Gaharu pada Batang Aquilaria malaccensis (Lamk. FAPERTA UNIB.aol. Makalah Seminar Nasional Pengembangan Produksi Gaharu Provinsi Bengkulu untuk Mendukung Peningkatan Ekspor Gaharu Indonesia. 14-16 Mei 2008. 1-2 Desember 2005.) Merespon Pelukaan dan Infeksi Cendawan. 2006. Fakultas Pertanian Universitas Mataram Bekerjasama dengan Balai Pengelolaan Daerah Aliran Sungai Dodokan Moyosari Nusa Tenggara Barat (BP DAS Dodokan Moyosari NTB). C. Terakhir dimodifikasi 11:11. Universitas Bengkulu. Bengkulu. Updated April 16th. G. pada Berbagai Waktu Setelah Pengeboran Batang Aquilaria malaccensis (Lamk. Makalah Semirata Bidang MIPA. html. Teknologi Budidaya dan Produksi Gubal Gaharu di Provinsi Bengkulu.wikipedia. 2008. Prosiding Seminar Nasional Gaharu.). 2001. Universitas Bengkulu. Mucharromah. 2008. N.org/wiki /Agarwood”. (unpublished). BKS-PTN Wilayah Barat. White Lotus Aromatics. 12 Agustus 2008. 2006. 2005. 31 Oktober 2006. Hartal. Maryani. Santoso.Aspek PRODUKSI Anonim. Mucharromah. com/ratrani/ Agarwood. dan Surani. Mucharromah. 18 November 2006. Potensi Tiga Isolat Fusarium sp. Laporan Penelitian Fundamental. Indonesia. 2006a. dan U. Makalah Seminar. Mucharromah.

Database Entry For Aquilaria agallocha. Austin. Surabaya 11-13 September 2006. Kanwil Dephut Propinsi NTB. Inc. Y. Makalah Workshop Gaharu Tingkat Nasional. Azizil. Skripsi Fakultas Pertanian Universitas Bengkulu. 2005. (Mucharromah) Mucharromah dan J. Purba. Kerjasama Dirjen PHKA dan ASGARIN.S.. Wahyuno. Sites : hhtp//www. Turjaman. Makalah Workshop Gaharu Tingkat Nasional. Makalah Temu Pakar Gaharu.B.S.. M.rain-tree. 2007. SEAMEO BIOTROP. Irianto.) dan Gubal Gaharu Hasil Inokulasi serta Potensinya untuk Menginfeksi Bibit Gaharu. Teknologi Budidaya Tanaman Gaharu untuk Menuju Sistem Produksi Gubal Gaharu secara Berkelanjutan. Raintree. Y. Parman dan T. L. Ng. Sumarna.htm. 1-2 Desember 2005. E.A.. Surya. D. 2005. Bogor. dan Y. 11-13 September 2006. Date 3/3/06. A Review on Agar (Gaharu) Producing Aquilaria Species. Strategi Budidaya dan Pengembangan Produksi Gaharu. Mulyaningsih. 2006. 2006. Studi Etiologi Gubal Gaharu pada Tanaman Ketimunan. Surabaya 12 September 2006. Journal of Tropical Forest Products 2 : 272-285. Prosiding Seminar Nasional Gaharu “Peluang dan Tantangan Pengembangan Gaharu di Indonesia”. Rahman. 1-2 Desember 2005.K. L. Santoso.com/ aquilaria. 1997. 11-12 April 1996. Texas. Bogor. Mulyaningsih. 2001. Prosiding Seminar Nasional Gaharu. 1996. Mataram.T. Raintree Nutrition. Chang and A. Kerjasama Dirjen PHKA dan ASGARIN.. Uji Coba Pembentukan Gaharu dengan Cara Inokulasi. Surabaya. Y. Makalah disampaikan pada Workshop Gaharu Tingkat Nasional. J. 49 .. Identifikasi Genus Cendawan yang Berasosiasi dengan Pohon Aquilaria malaccensis (Lamk. Sumarna.Pengembangan Gaharu di . R.. Parman. Ngatiman dan Armansyah. Seameo-Biotrop. Biodiversitas dan Karakterisasi Jamur Potensial Penginduksi Resin Gaharu. T. Teknik Inokulasi dan Produksi Gaharu. 2006b... Agustini.N.

500 200 600 12 300 100 5. 2006 50 .450 1 1 1 1 1 1 3 1 Btg Btg Set Btg Btg Btg Thn Btg 100 5.5 250 500 250 6 25 1. Uraian Beban operasional Pembelian batang/tanah Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga ahli inokulasi Tenaga kerja Pemeliharaan/perawatan Operasi lainnya Total A.000 90 1.2.000 5 120. Proyeksi penghasilan Penjualan kelas BC Penjualan powder Total proyeksi penghasilan C.Aspek PRODUKSI Lampiran 1. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Pengurusan surat-surat Umum lainnya Total Total beban operasi B.826 QTY Unit Harga/unit (Rp’000) Total cost (Rp’000) Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.000 90 1. 30 kg/batang (Kemedangan) Total proyeksi hasil : 50 kg/batang Penjualan kelas BC per batang : 60 kg Penjualan powder : 100 kg/batang No A.307 1 1 50 50 Btg Btg Kg Kg 50 50 25 2 50 50 1.031 10.500 200 600 36 300 7.025 104.000 500 120. Beban panen dan pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total A.500 6.168 50 50 50 1 50 Kg Kg Kg Btg Kg 5 10 5 6 0.1. Beban zakat/pajak Proyeksi keuntungan 5% % 60 100 Kg Kg 2. D. Analisis usaha inokulasi gaharu Waktu inokulasi Jumlah tegakan gaharu Proyeksi hasil : 3 tahun : 1 batang : 20 kg/batang (Kelas BC).250 100 1.

Biaya pra operasi (start-up cost) Sarana & prasarana TBM Rumah jaga Sarana penerangan (PLN) Sarana komunikasi Sarana lainnya Total 1 1 1 1 Total biaya (direkapitulasi) Beban operasi Penanaman pohon baru Land clearing Pembelian bibit Pembuatan lubang Penanaman pohon gaharu Pemupukan Perawatan dan pengamanan Total 1 1.000 Total cost (Rp’000) 15.000 1. Uraian Biaya akuisisi lahan Pembelian lahan Perizinan/sertifikat/notariat Total QTY Unit 1 1 ha Surat* B.000 24.000 1.000 4.000 1 1.000 No A.000 49.000 1.000 1.000 2. (Mucharromah) Lampiran 2.1.5 5 24.000 5.000 1.000 1.000 1..000 10.000 1 ha Btg Btg Btg Btg ha 1.000 500 5. Analisis usaha budidaya gaharu Waktu budidaya Luas lahan Populasi tegakan Rasio jumlah suntikan Jumlah lubang Proyeksi hasil panen per batang Exchange rate IDR : 7 tahun : 1 ha : 1.000 4.000 Total Btg Set Btg Btg Btg Btg 20 3.000 10 5 10 1 20.000 Harga/ unit (Rp’000) 15.500 1.000 5.Pengembangan Gaharu di .000 2.000 19.2.000 1.000/ha : 80 lubang/kg : 160/batang : 160/80 = 2 kg : 9.000 25.000 1..000 6...000 2.000 1. C.000 5 1 0.000 36.000 1.000 10.000 Unit Unit Unit 2.000 1.000 3. Beban inokulasi Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga kerja Pemelihaaan/perawatan Operasi lainnya 51 .000 1.000 A+B C C.

000 4. 2006 52 .000 1. Uraian Beban panen & pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total QTY Unit Harga/ unit (Rp’000) 5 5 10 2 Total cost (Rp’000) 5.000 71.000 4.000 190.609.500 D Proyeksi penghasilan Penjualan kelas C 2.000 3.000 Total proyeksi penghasilan 5% Proyeksi keuntungan E F Beban zakat /pajak Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.000 5.000 20.000 2. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Umum lainnya Total Total beban operasi 2.000 2.000 34.000 Btg Btg Kg Kg C.5 10.000 2.500 Kg % 2.000 2.000.Aspek PRODUKSI No C.000 1.3.000.4.000 2.000 20.000 4.000 200.000 40.000 1.000 Kg Kg Kg Kg 5 10 20 0.

Pada prinsipnya.Kajian Kimia Gaharu . yaitu 27 spesies dari 8 genus dan 3 famili yang tersebar di Sumatera. pemanfaatan gaharu adalah untuk pengobatan. 2000).. Gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut memiliki scent of God’. Maluku.(Eka Novriyanti) 2 KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp. incense. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti 53 . dan parfum (Barden et al. Sementara itu. PADA Aquilaria microcarpa Eka Novriyanti Balai Penelitian Hutan Penghasil Serat Kuok PENDAHULUAN Gaharu adalah komoditas hasil hutan non-kayu yang bernilai ekonomi tinggi dengan harga pasar bervariasi tergantung kualitasnya... Produk ini dihasilkan beberapa spesies penghasil gaharu dalam famili Thymeleaceae. Indonesia yang merupakan salah satu pemasok gaharu terbesar memiliki kekayaan jenis penghasil gaharu tertinggi di dunia. meskipun pengunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja.. Incense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagaman.. dan Irian (Sumarna.. 2005). sebagai pengharum ruangan sembayang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. Kalimantan. 2000). mulai dari 300 ribu rupiah hingga 25 juta rupiah untuk kualitas double super.

stimulan kerja saraf dan pencernaan. 2007). rematik. tumor. liver. dan lain-lain pengembangan yang masih sangat luas untuk dilakukan. antar jaringan (konsentrasi tertinggi berada di kulit. 2004.. Adelina.Aspek PRODUKSI inflamatory (Trupti et al. Arah pemanfaatan informasi kimia gaharu di antaranya adalah penyusunan standar produk berdasarkan komposisi kimia yang dikandungnya sehingga lebih seragam dalam praktek penentuan kualitas produk. 2000. 1987. antar pohon dalam spesies yang sama. kanker. hal ini 54 . pengembangan senyawa-senyawa dalam gaharu dengan bio-teknologi. (Hayne. 2004). dan antar musim (Forestry Commission GIFNFC. obat kuat pada masa kehamilan dan bersalin. 2007). informasi jalur biosintetis gaharu itu sendiri sehingga mungkin dapat dibuat sintetis senyawa. atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Commission GIFNFC. 1987). anti mikrobia. dan bermanfaat untuk mengatasi berbagai panyakit seperti sakit gigi. malaria. Informasi mengenai bahan-bahan kimia yang terkandung dalam gaharu penting untuk pemanfaatan produk ini. Namun begitu. anti serangga. maupun keadaan cekaman (Goodman et al. Metabolit sekunder atau zat ekstraktif tanaman dapat efektif dalam melawan hama dan agen penyakit karena analog dengan komponen vital tertentu dari sistem sinyal seluler. dalam Isnaini. akar. hepatitis. diuretic. dan jaringan luka). Konsentrasi metabolit sekunder ini bervariasi antar spesies. cacar. Metabolit sekunder pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills.. rangsangan fisiologi. Barden et al. 2002). asma. pengembangan pemanfaatan lain dengan terbukanya kemungkinan diidentifikasinya senyawa-senyawa baru dengan manfaat yang baru pula. kayu teras. Suhartono dan Mardiastuti. juga memiliki sifat anti racun. pangkal percabangan. antar spesies. Pohon gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. diare. ginjal. 2007). Gaharu adalah senyawa fitoaleksin yang merupakan metabolit sekunder dari pohon gaharu sebagai mekanisme pertahanannya. 2004). Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu.

Tidak signifikannya pengaruh asal isolat terhadap luas infeksi diduga disebabkan karena isolat yang diinokulasikan sama-sama Fusarium sp. namun setelah sekian waktu ternyata pengaruhnya terhadap luasan infeksi menjadi tidak signifikan lagi.. asal Bahorok. sedangkan analisis kimia dilakukan untuk sampel berumur ± 1 tahun. Helium digunakan sebagai gas pembawa (carrier) (0.. daerah asal isolat tidak berpengaruh nyata terhadap luasan infeksi yang terjadi pada batang pohon penghasil gaharu ini.(Eka Novriyanti) masih memerlukan pemikiran dan terus melakukan penelitianpenelitian lanjutan yang akan membuka satu demi satu kebenaran yang saat ini masih belum terungkap. ketebalan film 0. Pengukuran luasan infeksi dilakukan pada umur inokulasi 6 bulan.. pada batang A. Gambar 1 menyajikan luasan infeksi Fusarium sp.Kajian Kimia Gaharu .8 ml/min) yang dilengkapi dengan kolom kapiler DB-5 MS (60 mm x 0. 55 . Analisis komponen kimia dilakukan untuk gaharu rekayasa hasil inokulasi isolat Fusarium sp. Injeksi dilakukan dalam mode split. dan Maluku. Kalimantan Tengah Tamiang Layang. Identifikasi senyawa dilakukan berdasarkan waktu retensi dan analisis MS. ANALISIS KIMIA GAHARU HASIL INOKULASI ISOLAT DARI BEBERAPA DAERAH ASAL Dalam tulisan ini. Kondisi kromatografi adalah sebagai berikut: suhu oven kolom 500C. Meskipun secara deskriptif isolat asal Bahorok sepertinya menyebabkan infeksi yang paling besar. suhu injeksi 2800C. microcarpa. dan ditahan pada suhu ini hingga menit ke-60. analisis kimia gaharu dilakukan dengan analisis GCMS pirolisis menggunakan aparatus Shimadzu GCMSQP2010. yaitu isothermal 500C selama 5 menit.25 mm. Mentawai. namun secara statistik. dioperasikan dengan electron impact (EI) mode pada 70 eV dan suhu ion source 2000C.. Meskipun di awal inokulasi masing-masing isolat memperlihatkan kecepatan pembentukan infeksi yang berbeda sesuai virulensinya.25 μm). kemudian increased mencapai 2800C hingga 30 menit. dan perlu dicatat tidak satupun isolat yang origin dari lokasi di mana penelitian dilakukan yaitu asal Carita..

Lampiran 1 dibagi menjadi 3 kelompok. 2003. Alkhathlan et al. Burfield. Lampiran 1 menyajikan komponen kimia hasil analisis py-GCMS terhadap sampel gaharu inokulasi umur satu tahun. namun analisis komponen kimia dari gaharu hasil rekayasa ini menunjukkan adanya perbedaan. 2005. 2002. 2005. Sampel yang dianalisi adalah sampel masing-masing dari titik-titik inokulasi dengan jarak suntik 5 cm dan 20 cm. 2005. yaitu: 1. Kelompok A pada Lampiran 1. Panjang infeksi pada umur inokulasi 6 bulan di batang A. microcarpa dengan pembeda daerah asal isolat Meskipun secara luasan infeksi tidak menunjukkan pengaruh yang nyata... Kelompok C: senyawa yang belum dikonfirmasi merupakan konstituen gaharu namun memiliki karakter odorant. Bhuiyan et al. Kelompok B: senyawa berkarakter odorant namun merupakan hasil pirolisis komponen kayu seperti selulosa dan lignin 3.. Konishi.Aspek PRODUKSI Gambar 1. Pojanagaroon dan Kaewrak. kelompok A: konstituen gaharu yang sudah diidentifikasi pada pekerjaan beberapa peneliti sebelumnya 2. 56 . Nor Azhah et al. dengan tanpa membedakan jarak suntik menunjukkan bahwa akumulasi konsentrasi relatif tertinggi untuk konstituen terkonfirmasi (Yagura et al.. 2009. 2006. Tamuli.

konsentrasi relatif tertinggi justru dihasilkan oleh isolat asal Maluku (12.(Eka Novriyanti) 2008) terjadi pada isolat asal Kalimantan Tengah Tamiang Layang sebesar 12.Kajian Kimia Gaharu . diikuti Mentawai.31%). dan Mentawai (11. Maluku.. Bahorok (22.47%). Keberadaan senyawasenyawa odorant hasil pirolisis komponen kayu ini kemungkinan memiliki peran pada kesatuan wangi yang dihasilkan incense gaharu yang dibakar.71%).23%)... Ditampilkannya fakta tersebut karena penggunaan gaharu pada umumnya sebagai incense yang menghasilkan wangi hanya jika kayu yang mengandung resinnya dibakar.14%).40%). Untuk kelompok odorant yang merupakan pirolisis komponen kayu ini.61%). Secara kuantitas maupun kualitas (komponen kimia terkonfirmasi). karena digunakan sebagai incense yang mengumbar wangi saat dibakar. Mentawai (24. Pengaruh kontribusi senyawa dalam kelompok ini pada wangi gaharu memerlukan investigasi lebih lanjut.27%). Bahorok (10.. Kalimantan Tengah Tamiang Layang (12.89%.96%). dan Mentawai (8. Untuk Kelompok C. isolat asal Kalimantan Tengah Tamiang Layang memberikan hasil gaharu artifisial yang relatif terbaik yang ditunjukan oleh relatif lebih besarnya infeksi yang terjadi dan akumulasi senyawa gaharu terkonfirmasi tertinggi. akumulasi konsentrasi relatif tertinggi dihasilkan oleh isolat asal Maluku (26. Namun kontribusi komponen-komponen berkarakter odorant tersebut terhadap wangi gaharu masih memerlukan observasi yang lebih dalam lagi. 57 . diikuti masing-masing Maluku (10. maka keberadaan senyawa dalam kelompok B tidak bisa dikesampingkan walaupun bukan merupakan konstituen resin gaharu yang sebenarnya. dan Kalimantan Tengah Tamiang Layang. Pola urutan konsentrasi yang sama juga terjadi untuk total konsentrasi relatif komponen berkarakter odorant.37%). Perbedaan konsentrasi ini kemungkinan sangat dipengaruhi oleh konsentrasi selulosa dan lignin dari bagian batang yang dijadikan sampel. Bahorok. Kelompok B pada Lampiran 1 merupakan kelompok senyawa berkarakter odorant yang merupakan hasil pirolisis selulosa dan lignin. Dengan kata lain.47%). dan terakhir Kalimantan Tengah Tamiang Layang (18. diikuti Bahorok (12.

Angka-angka ini tidak jauh berbeda karena diduga konsentrasi komponen kayu yang relatif sama pada pohon-pohon sampel yang relatif berumur sama dan tumbuh pada kondisi yang relatif sama. manis buah. Indole merupakan konstituen utama dalam minyak melati dan karena minyak melati ini berharga mahal.11% untuk jarak suntik 5 cm dan 20 cm. Ketoisophorone mengumbar wangi manis campuran kayu. dan. jarak suntik 5 cm dan 20 cm menghasilkan akumulasi konsentrasi relatif masing-masing sebesar 11.25% dan 10. produk ini dibuat sintetisnya dengan menggunakan indole (Wikipedia Online. Komponen dalam gaharu hasil inokulasi berbagai daerah asal isolat Fusarium sp. Isolongifolene merupakan bahan yang sangat berguna sebagai odorant dan minyak parfum (Bunke dan Schatkowski. Inc. Valerolactone Ketoisophorone Maltol Indole Isolongifolen 58 . Tabel 1. Komponen ini menyajikan wangi caramel dan digunakan untuk menghasilkan wangi yang manis pada fragrance.Aspek PRODUKSI Untuk komponen gaharu terkonfirmasi (Kelompok A). 1997). dihasilkan akumulasi masing-masing sebesar 12. 2002). microcarpa yang memiliki karakterisitik odorant penting Komponen Ambrettolide Ambrox Keterangan Senyawa ini memiliki karakter wangi musk. 2008) Ambrox memiliki karakter odorant tipe amber dan juga merupakan anti-inflamatory yang potensial untuk bidang pengobatan (Castro et al. secara umum jarak suntik 5 cm menghasilkan akumulasi konsentrasi yang lebih tinggi. teh. biasanya dimanfaatkan sebagai penguat rasa dan aroma (flavor enhancer) pada roti dan kue (Wikipedia Online. Untuk kelompok B. Senyawa ini memiliki wangi herbal yang dimanfaatkan dalam industri parfum dan pewangi (Wikipedia Online. 2008). kecuali untuk isolat asal Kalimantan Tengah Tamiang Layang yang justru lebih tinggi akumulasi konsentrasinya pada jarak suntik 20 cm (Tabel 1). pada A. dan bunga (International Flavor and Fragrance. 2008).11%. Senyawa ini pada konsentrasi rendah menyajikan wangi bunga dan merupakan konstituen dalam berbagai wangi bunga dan parfum. daun tembakau (The Good Scent Company. 2008). Secara umum untuk kelompok A.17% dan 12... 2008).

(Eka Novriyanti) Komponen Limonene Keterangan Limonene merupakan terpen yang memiliki aroma bunga dan buah. dengan spasi injeksi yang lebih kecil di mana infeksi terjadi lebih cepat dan lebih besar. yang ditunjukan oleh infeksi yang lebih kecil. Cadinene Dumasin Benzylacetone Azulene Akumulasi total untuk komponen berkarakter odorant menunjukkan bahwa jarak suntik 20 cm (52. 2008). 2008. juga merupakan komponen volatil pada kokoa (Wikipedia Online. The Good Scent Company. 2004).. Kajian lebih dalam lagi diperlukan untuk mengetahui perkembangan atau perubahan yang terjadi dengan semakin lamanya waktu inokulasi. Azulene sangat sering ditemukan sebagai komponen dalam minyak esensial tanaman dalam family Asteraceae dan memiliki wangi dan warna biru pada minyak dan ekstraknya (LyndShiveley. Di pihak lain. 59 . Mann et al. proses yang lambat ini kemungkinan memberi waktu dan kesempatan bagi senyawa tertentu untuk disintesis atau diakumulasikan hingga diperoleh konsentrasi yang relatif lebih tinggi.59%) yang menghasilkan konsentrasi relatif lebih tinggi dibandingkan jarak suntik 5 cm (50. 2008. Dengan besarnya spasi injeksi akan menyebabkan proses pembentukan senyawa yang terjadi berlangsung relatif lebih lambat. 2004).. Limonen merupakan monoterpeneoid yang digunakan sebagai insektisida botani. Pola yang sama juga terlihat untuk akumulasi konsentrasi relatif pada kelompok senyawa C. Dikenal juga sebagai cyclopentanone yang memiliki wangi mint.. 2008).96% untuk jarak suntik 20 cm dan 5 cm. selain sebagai bahan kosmetik dan flavouring karena memberi wangi sitrus. Blake.Kajian Kimia Gaharu . Geraniol dan limonen juga dimanfaatkan dalam pengobatan herbal dan konstituen dalam berbagai tanaman obat (Wikipedia Online. masing-masing 24. Namun.. Senyawa ini muncul sebagai konstituen minyak esensial berbagai tanaman (Wikipedia Online.23%). Benzylacetone memiliki wangi manis bunga yang merupakan komponen atraktan yang melimpah pada bunga. 2008). ada kemungkinan proses sintesis terjadi lebih cepat dibandingkan jarak injeksi yang lebih besar sehingga dihasilkan senyawa-senyawa baru yang lain yang berkarakter odorant namun akumulasinya belum cukup tinggi saat observasi dilakukan. 1994.81% dan 20. Merupakan material wewangian dan untuk pengobatan serta memiliki sifat pestisida (ChemYQ..

60 . 2004). Asetosiringon merupakan bioaktif dalam interaksi tanamanmikroba yang mempercepat pendeteksian kehadiran patogen oleh tanaman di mana konsentrasi senyawa ini meningkat dalam tanaman seiring dengan meningkatnya konsentrasi mikroba (Baker et al. 2008). senyawa 4H-pyran-4-one dan derivatnya (Abrishami et a. 2008. Rhodes. 2008). Senyawa asetosiringon juga tercatat pada semua gaharu hasil inokulasi kelima daerah asal isolat dalam penelitian ini.. Beberapa di antara komponen ini bahkan juga memiliki karakter wangi yang diketahui merupakan konstituen minyak esensial dan digunakan secara komersil dalam industri parfum dan pengharum seperti vanillin. Eugenol. eugenol (Cowan. derivat cyclopentane (Wikipedia Onlie. benzoic acid (NBCI.. Rho et al. di mana senyawa ini merupakan fenolik yang dihasilkan tanaman sebagai respon alami terhadap pelukaan (Sheikholeslam dan Weeks. dumasin (ChemYQ. Koeduka et al. 2002. Fotouhi et al. 2008).. 2008). 2007. PubChem Compound.. Dalam Hua (2001) disebutkan bahwa konsentrasi asetosiringon meningkat 10 kali lipat ketika suatu jaringan aktif tanaman dilukai. 2000). Eugenol serta isoeugenol digunakan dalam produksi vanilin yang merupakan bahan penting dalam industri wewangian (Cowan.Aspek PRODUKSI Hasil analisis py-GCMS juga menunjukkan adanya senyawasenyawa yang pada beberapa hasil penelitian lain disebutkan sebagai senyawa pertahananan. 1999. 2008). 1999). dan isometileugenol merupakan empat senyawa fenilpropanoid dari 12 senyawa volatil yang diketahui menyebabkan wangi yang manis pada Clarkia breweri (Rhodes... metileugenol. Sedangkan koniferil alkohol merupakan intermediet dalam biosintetis eugenol dan isoeugenol (Cowan. 2007). dan guaiakol merupakan intermediet dalam pembuatan eugenol dan vanilin (Li dan Rosazza. isoeugenol. 1986).. 1999). dan elimicin (Rossi et al. 2006). 2008). syringal-dehyde (Pedroso et al.

2000). dan obat-obatan.. yaitu asam ferulat ataupun koniferil alkohol (Rhodes.(Eka Novriyanti) Tabel 2.. 2008).. Merupakan senyawa pertahanan tipe fitoaleksin yang termasuk dalam grup fenilpropanoid. Merupakan intermediet dalam pembuatan eugenol dan vanilin. Eugenol dan isoeugenol diturunkan dari prekursor lignin. Adalah fenol terhidroksilasi yang bersifat toksik pada mikroorganisme. Hasil inokulasi Fusarium sp. memiliki sifat antimikrobial (Torssel. yang juga digunakan sebagai antiseptik dan parasitisida (Li dan Rosazza. 1983. 2008). 1999). 61 . 2. Merupakan dimetil eter dari pirokatekol. deodoran.Kajian Kimia Gaharu . 1999). p:144). di mana daya racun akan semakin meningkat dengan semakin tingginya hidroksilasi (Cowan. Pada gaharu rekayasa hasil inokulasi Fusarium sp. Letak dan jumlah grup hidroksil pada grup fenol diduga berkaitan dengan daya racun relative-nya terhadap mikroorganisme. Eugenol digunakan dalam pembuatan parfum. sedatif. dan parasitisida (Wikipedia. Konstituen resveratrol yang diturunkan dari asam p-hidroksisinamat dan 3 unit malonat. pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masinng sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. 2008a). pada A. Kedua senyawa ini dan turunannya digunakan sebagai antiseptik. contohnya adalah yang terdapat pada Linum usitiltissimum (Sengbusch. Koniferil alkohol Guaiakol Katekol dan pirogalol Veratrol KESIMPULAN 1. microcarpa ditemukan beberapa komponen senyawa yang sudah diidentifikasi merupakan konstituen gaharu dan beberapa senyawa lain yang memiliki karakter odorant dan secara komersil digunakan dalam industri perfumery dan flavoring.. Senyawa-senyawa yang berdasarkan beberapa referensi diketahui merupakan pertahanan pada tanaman tertentu dan terdeteksi pada gaharu hasil inokulasi Senyawa Eugenol Keterangan Bersifat bakteriostatik terhadap jamur dan bakteri (Cowan. minyak esensial. ekspektoran. Senyawa ini digunakan untuk menghasilkan isoeugenol yang diperlukan untuk membuat vanilin yang juga merupakan bahan yang penting dalam obat-obatan dan industri parfum dan pengharum.

2002. Mulliken.3. asal Kalimantan Tengah menunjukkan konsentrasi senyawa konstituen gaharu terkonfirmasi yang lebih tinggi. C. A. Averyanov. S. A. R.. J. http://www. E.traffic. The Malaysian Journal of Analytical Sciences 12 (2): 338-340. http://www. DAFTAR PUSTAKA Abrishami. 2000. Sustainable Agarwood Production in Aquilaria Trees.pdf. Rice. . Teimuri-Mofrad. Secara umum. A. C. [22 Mei 2007]. A. com/MedicinalPlantConstituents. Mailina. Schatkowski. N. Y. A.therainforestproject. Said. A. P. [21 Juni 2008]. N. Majid.com [31 Desember 2008]. United State Patent. Deahl. 2008. [2 Februari 2007]. their Production and their Use. F. www. Barden. Song. Whitaker. T. Yasmin. 2006. 2004 Medicinal Plant Constituents. htm.usda. S. M. Molecules 7: 239–244. H. Stimulatory Effect of Acetosyringone on Plant/Pathogen Recognition. B. L. J. Robert. Anak. 2004. D. A. Husni. Blanchette. Y.. K. Shahrisa. R. A. www. D. N. S. Isolongifolanol Derivates. gov/research/publications/publications. A. Meskipun secara statistik tidak memperlihatkan perbedaan yang signifikan terhadap luasan infeksi yang terbentuk setelah 6 bulan inokulasi..ars.net. namun isolat asal Maluku menunjukkan konsentrasi yang relatif lebih tinggi untuk total senyawa dengan karakter odoran. inokulasi Fusarium sp. Hasnida. M. Mock. Comparison of Chemical Profiles of Selected Gaharu Oils from Peninsular Malayia. freepatentsonline. D. N. Y. Bunke.org. Blake. J. Chang. daerah asal isolat menunjukkan perbedaan dalam konsentrasi senyawa-senyawa gaharu yang terbentuk. Baker. J. Azah. S. naturalhealthwizards. M. 1997. [20 Juni 2008]. N. Synthesis of Some Aldoxime Derivatives of 4H-Pyran-4-ones. http://www. Bayat. A. Heart of the Matter: Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis.

M.cites. International Flavor and Fragrance. csl.. 2008. 1991. Clinical Microbiology Review 12 (4): 564-582. A. http: // treechemicals. L. Phytochemistry 30 (2): 563566. http://www.cfm. 2007. Hua. Inc.fao. Investigation of Electrooxidation Reaction of Some Tetrahydrobenzo[b]pyran Derivatives. http://www.pdf.uk/review/extraction. Plant Products as Antimicrobial Agents.. Hills. 2001.gov. M. S.Burfield. Badan Litbang Kehutanan Jakarta. Berlin: SpringerVerlag. M. and K.chemyq. T. S. Nogueras. S. T. Hayne. Shiga. Food safety and Quality: Flavoruing Index.31 pm]. hlm: 1467-1469. Applied Microbiology 32: 278-281. Altarejos. 63 . FAO.cropwatch. Cowan. W. 1999. Convention on International Trade in endangered Species of Wild Fauna and flora: Amendments to Appendices I and II of CITES. J. Ishihara. Heartwood and Tree Exudates. Fatehi. Salido. K. Tsuneya. Succinaldehyde. Electrochem. 2008.. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. [2 Februari 2007].iff.org/ ag/agn/jecfa-flav/index. Uneyama.nsf/0/45BD7B214C6F661E8025699000 5D79C2 [31 Desember 2008]. Tetrahedron 58 (29): 5941-5949. CITES. E. http://www. Chemicals from Trees. [14 Juli 2007]. M. 1987. Thymelaceae. M. Agarwood Chemistry. 3: 721-726. ChemYQ. Synthesis of Ambrox® from Labdanolic Acid. T.org. Dumasin. J. Int. M. Sánchez.com/ En/xz/xz11 [3 April 2008]. M. Castro. 2005a. Terjemahan dari: Nuttige Planten Van Indonesie. 2002. 2008. 1987. 2004. Forestry Commission GIFNFC. J.org/common/cop/13/raw / props/ID-Aguilaria-Gyrinops.html?showSynonyms=1 [ 1 November 2008: 2. Heravi. Three Sesquiterpenes from Agarwood. Sci. Fotouhi. Tumbuhan Berguna Indonesia Jilid III. http://www. A. www. Yayasan Sarana Wana Jaya.com/ Ingredients.

Shimada. H.. G. P. M. 2006. S. Gang. Eugenol and Isoeugenol. 1962. S. S. J. J. Y. Campos. Deschamps. E. M. 2008. Orlova. Baek. [1 Desember 2008]. Pichersky. M. Y. Acad. 2004. W. G. C. Rho. S. Characteristic Aromatic Constituents of Spices. F. Baiga. Noel. Kim. Chang. Kish. gov/summary/ summary. K. S. Dudareva. Chem. Lab. H.. S. www.nih. A. NCBI PubChem. Nat. D. Biavatti. Benzoic acid. ISHS Acta Hort 676. Y. and P. I. Barison. R. http://pubchem. 2006. J. D. Vassão. Prema. Proc. T. C. Li.cgi?cid=243.actahort. Mechanical Methods to Stimulate Aloes Wood Formation in Aquiliria crassna Pierre ex H Lec (Kritsana) Trees. Lynd-Shiveley. H. N. Bull. D. A. Bull. A. India. Korean Chem. Induksi Produksi Gubal Gaharu melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik (Disertasi). Pedroso. 2007. T. J. C.org. Biocatalytic Synthesis of Vanillin.. Pojanagaroon. Kim. T. E. Microbial Transformation of Terpenes. M. T. Kaewrak. Sci. Chem. 2004. R. L. USA. 64 . Lee. S. Koeduka. Six New 2-(2-Phenylethyl)chromones from Agarwood. Spassova. and I. Brazilian Jour. [22 Mei 2007]. A. Isolation of Syringaldehyde from Mikania laevigata Medicinal: Extract and its Influence on the Fatty Acid Profile of Mice. J. Natl.. Bogor. Soc. B. W. 50 (3): 419-422.. D. You. Program Pascasarjana Institut Pertanian Bogor. Rosazza. New 5-Hydroxy-2-(hydroxymethyl)-4H-pyran-4one Derivative has Both Tyrosinase Inhibitory and Antioxidant Properties. F. Konishi. P. B. Jackson. www. Santos. Azulene and Chamomile.ncbi. 2002. T. 2008. S. are Biosynthesized via Reduction of a Coniferyl Alcohol Ester. Kiyosawa. Aromaticplant project. Fridman. N. Applied and Environmental Microbiology 66 (2): 684-687.com. Steil. 28 (3): 471-473. E. Konoshima. 2000. Lewis. P.. Pharm. N.nlm. of Pharmacognosy 18(1): 63-69. Bhattacharrya.Aspek PRODUKSI Isnaini. [20 Juni 2008].

Kajian Kimia Gaharu .....(Eka Novriyanti)

Rhodes, D. 2008. Secondary Products Derived from Aromatic Amino Acids: Eugenol and Isoeugenol. www.hort.purdue.edu. [20 Juni 2008]. Rossi, P. G., L. Bao, A. Luciani, P. Panighi, J. M. Desjobert, J. Costa, J. Casanova, J. M. Bolla, and L. Berti. 2007. (E)-Methy-lisoeugenol and Elemicin: Antibacterial Components of Daucus carota L. Essential Oil Against Campylobacter jejuni. J. Agric. Food Chem. 55 (18): 7332-7336. Sengbusch, P. V. 2008. Phenolic Compounds. http://www.biologie. unihamburg. de/b-online/e20/20d.htm. [10 April 2008]. Sheikholeslam, S. N., D. P. Weeks. 1987. Acetosyringone Promotes High Efficiency Transformation of Arabidopsis thaliana Explants by Agrobacterium tumafacien. Plant Molecular Biology 8: 291198. Sumarna, Y. 2005. Budidaya Gaharu. Seri Agribusines. Penebar Swadaya. Jakarta. The Good Scent Company. 2008. Limonene; Ketoisophorone; Syringaldehyde, Tiglaldehyde. http://www.thegoodscents company.com/gca/gc1014951.html [20 Juni 2008]. Torssell, K. B. G. 1983. Natural Product Chemistry. John Wiley & Son Limited. Chichester, New Tork, brisbane, Toronto, Singapore. Trupti, C., P. Bhutada, K. Nandakumar, R. Somani, P. Miniyar, Y. Mundhada, S. Gore, K. Kain. 2007. Analgesik and Antiimflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. Pharmacologyonline 1: 288-298. Vidhyasekaran, P. 2000. Physiology of Disease Resistant in Plant. CRC Press Inc. Boca Raton, Florida. Verpoorte, R., R. van der Heijden, J. Memelink. 2000. General Strategies. In Verpoorte, R. and A. W. Alfermann (eds). Metabolic Engineering of Plant Secondary Metabolism. Kluwer Academic Publisher. Dordrecht, Boston, London. p: 31-50. Wikipedia Online. 2008. Pyrrolidine; Propargyl Alcohol; Ptalic Acid; Mesityl Oxide; Maltol; Indole; Glutanic Acid, Furanone; Elemicin; DABCO; Crotonic Acid; Cadinene; Butyric Acid; Benzylacetone; Caprylic Acid. http://en.wikipedia.org/wiki/. [1 juni 2008].

65

Aspek PRODUKSI

Yagura, T., N. Shibayama, M. Ito, F. Kiuchi, G. Honda. 2005. Three Novel Diepoxy Tetrahydrochromones from Agarwood Artificially Produced by Intentional Wounding. Tetrahedron Letters 46: 4395-4398. Yagura, T., M. Ito, F. Kiuchi, G. Honda, Y. Shimada. 2003. Four New 2-(2-Phenylethyl) Chromone Derivatives from Withered Wood of Aquilaria sinensis. Chem. Pharm. Bull. 51:560-564. Zaika, E. I., R. A. Perlow, E. Matz, S. Broyde, R. Gilboa. 2004. Sub-strate Discrimination by Formamidopyrimidine-DNA Glycosylase. The Jour. of Biol. Chem. 279 (6) issue 6: 4849-4861.

66

Kajian Kimia Gaharu .....(Eka Novriyanti)

Lampiran 1. Komponen dalam gaharu hasil inokulasi Fusarium sp. pada A. microcarpa
Konsentrasi Relatif (%) Nama senyawa 5 cm Bo 20 cm 5 cm Kt 20 cm Me 5 cm 20 cm Mu 5 cm 20 cm

A. Komponen aromatis yang sudah diidentifikasi sebagai konstituen gaharu 4-(2’-Methyl-3’-butenyl) azulene 2,5-DIMETHOXY-4ETHYLBENZALDEHYDE 2-Hydroxy-4methylbenzaldehyde 4-Ethoxy-3methoxybenzaldehyde 4-METHYL-2,5DIMETHOXYBENZALDEHYDE Benzaldehyde, 2,4-dihydroxy Benzaldehyde, 2,4-dimethoxy- (CAS) 2,4-Dimethoxybenzaldehyde Benzaldehyde, 3,4-dihydroxy- (CAS) 3,4-Dihydroxybenzaldehyde Benzaldehyde, 3-hydroxy- (CAS) m-Hydroxybenzaldehyde Benzaldehyde, 4,6-dimethoxy2,3-dimethyl- (CAS) 2,4-Dimethoxy-5,6-dimethyl Benzaldehyde, 4-[[4-(acetyloxy)-3,5dimethoxyphenyl]methoxy]3-methoxy Benzaldehyde, 4-hydroxy(CAS) p-Hydroxybenzaldehyde 1,2-benzenedicarboxylic acid, diisooctyl ester (CAS) Isooctyl phthalate 2-Butanone, 4-phenyl- (CAS) Benzylacetone 2-Butanone, 3,3-dimethyl(CAS) 3,3-Dimethyl-2butanone 0,09 0,09 4,35 0,42 0,06 0,08 0,08 2,37 0,30 0,49 3,66 0,08 0,06 0,21 1,52 0,22 0,07 4,65 0,10 1,45 0,09 4,42 0,11 4,60 0,25 -

-

-

0,32

0,29

0,26

-

0,24

0,28

-

0,37

-

-

0,39

-

-

0,29

-

-

0,36

-

-

-

-

-

-

-

0,37

-

-

0,54

0,48

-

-

0,07

-

0,12

0,43 -

0,23 -

0,44 -

-

0,24 -

0,04

-

0,41 0,04

-

0,53 -

0,05

-

67

Aspek PRODUKSI

Konsentrasi Relatif (%) Nama senyawa 5 cm 2-Butanone, 3-phenyl- (CAS) 4H-1-Benzopyran-4-one, 2-(3,4-dihydroxyphenyl)-7-(. beta.-D-glucopyranosyl) 4H-1-Benzopyran-4one, 2-methyl- (CAS) 2-Methylchromone 4H-1-Benzopyran-4-one, 5,7-dihydroxy-2-methyl- (CAS) 2-Methyl-5,7-dihydroxy 4H-1-Benzopyran-4-one, 6-dihydroxy-2-methyl- (CAS) 6-Hydroxy-2-methylchromone 2-Coumaranone .gamma.-Eudesmol Hexadecanoic acid, 2-(octadecyloxy)-, tetradecyl ester (CAS) TETRADECYL Hexadecanoic acid, methyl ester (CAS) Methyl palmitate 2,4-Hexadienedioic acid, 3,4-diethyl-, dimethyl ester, (Z,Z)- (CAS) CIS.CIS.D 2,4-Hexadienedioic acid, 3-methyl-4-propyl-, dimethyl ester, (Z,E)- (CAS) .alpha.-humulene 1-Naphthalenol, 1,2,3,4-tetrahydro- (CAS) 1-Tetralol 1-Ethynyl-3,4-dihydro-2naphthalenecarbadehyde Phenol, 2,6-dimethoxy- (CAS) 2,6-Dimethoxyphenol Phenol, 3,4-dimethoxy- (CAS) 3,4-dimethoxyphenol Benzenepropanoic acid, methyl ester (CAS) Methyl hydrocinnamate Bo 20 cm 5 cm Kt 20 cm 0,05 Me 5 cm 20 cm Mu 5 cm 0,15 20 cm -

-

-

-

0,18

-

-

-

-

-

0,06

-

0,36

-

-

0,34

-

-

-

-

0,46

-

-

-

-

-

0,04 -

-

-

-

-

0,28 -

0,03

-

-

-

-

0,69

-

0,05 0,85

-

-

0,12

-

0,16

-

0,09

0,17

-

-

-

-

-

-

0,11 0,07

-

-

2,94 0,25 -

0,08 3,37 0,33 -

2,74 0,33 -

3,67 0,40 0,25

3,11 0,24 -

3,05 0,42 -

4,22 0,40 -

2,83 0,22 -

68

96 B.66 0.55 0.31 - 1.4.21 0.18 0.(CAS) Acetosyringone ACETOVANILLONE Ethanone..17 5.17 0.03 - - 0.19 0.6.28 5 cm Kt 20 cm 0.26 0.86 1.65 - - 0. 5-Hydroxy2-methyl.79 0.50 4.2-benzenediol.49 6. 1-ACETYL-2.6. 3-(2-propynyloxy)-.15 4.2DIMETHYL-.5.30 12.12 - 0.89 9.5.58 0.25 0.27 0. 1-(4-hydroxy3-methoxyphenyl).38 0.56 0. 1-hydroxy.15 3..(CAS) Acetovanillone 1.84 0.14 0.17 0.12 5.3.74 16.95 10.02 - 0.30 8.(CAS) 5-hydroxy-2methyl-4H-pyran-4-one 2-Propanone.44 - - 12.95 6.28 8.28 69 .(CAS) Maltol 4H-Pyran-4-one. Komponen aromatis yang merupakan pyrolisis dari bagian kayu 4H-Pyran-4-one.20 0.(CAS) Acetol Ethanone. ethenyl ester (CAS) vinyl propionate CYCLOPENTANEPROPANOIC ACID.12 0.94 0.59 8.20 9.49 2. ethyl ester (CAS) ETHYL 3-PROPARGYL Propanoic acid.61 0.83 0.27 0.Kajian Kimia Gaharu .17 0.7.29 0.4.4A..66 2.8A-OCTAHYDRONAPHTHALENE Jumlah Rataan untuk kedua jarak suntik Bo 20 cm 0. METHYL Benzenepropanoic acid (CAS) Phenylpropionic acid 3.57 0..46 1.8-HEXAHYDRO-2HCHROMENE 1.66 0.14 0.24 Me 5 cm 20 cm Mu 5 cm 20 cm 0.04 3.74 0.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm Propanoic acid.20 0.49 - 0.58 3.2.87 0.62 10. 1-(acetyloxy)(CAS) Acetol acetate 2-Propanone.20 1. 3-Hydroxy-2methyl.58 13. 1-(4-hydroxy-3. 3-methyl(CAS) 3-methylpyrocathecol 0.22 0.67 6.60 4.2-Benzenediol (CAS) Pyrocathecol 1.99 0.66 0.5dimethoxyphenyl).17 0. anhydride (CAS) Propionic anhydride Propanoic acid.19 0.

63 20 cm 1. 4-ethenyl-.23 0.06 0. 4-(methylamino)Benzoic acid. methyl ester (CAS) METHYL 4-VINYLBENZOATE 2.23 Me 5 cm 1.40 0.36 0. 4-methyl.89 10.70 0.18 0.50 0.64 - 0.08 0.52 0.22 0. 2-methoxy-4-propyl(CAS) 5-PROPYL-GUAIACOL Phenol.30 1.64 - 0. 3-methoxy.15 0.27 1.34 11.13 0.82 0.87 11.14 0.06 - - 0.4. 2-methoxy.24 - 0.18 12.54 12.18 0.(CAS) Guaiacol Phenol.05 0.12 0.57 2.43 12.31 11.46 0.37 Bo 20 cm 1.24 0.(CAS) p -Cresol Phenol.07 - - - - - - 70 . 4-ethyl-2-methoxy(CAS) p-Ethylguaiacol Phenol (CAS) Izal Jumlah Rataan untuk kedua jarak suntik 1.90 0.11 1.VALEROLACTONE Oxacycloheptadec-8-en-2-one (CAS) Ambrettolide Oxacycloheptadecan-2-one (CAS) Dihydroambrettolide Benzoic acid.45 2.(CAS) 6-ETHYL-. 3.14 - 0.35 1.4.07 14.82 0.(CAS) o-Cresol Phenol.47 Mu 5 cm 1.37 0.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 3-Methoxy-pyrocathecol 4-METHYL CATHECOL Phenol.92 0.5-Trimethoxybenzoic Benzoic acid.39 0.28 Kt 20 cm 2.14 0.82 0.39 13.19 0. 3-methyl.57 0.40 20 cm 1. Komponen berkarakter odorant lainnya yang belum disebutkan sebagai konstituen gaharu Ascaridole 2H-Pyran-2-one.19 0.71 1.69 0.13 0.03 - 0.35 11.47 C.43 1.01 0.18 1.11 0.36 13.5-trimethoxy-.40 5 cm 1.31 0. methyl ester (CAS) 3.52 11.35 0.(CAS) m-Guaiacol Phenol. 6-ethyltetrahydro.DELTA.(CAS) m-Cresol Phenol.16 - - 0. 2-methyl.

3-acetyldihydro.98 1.. 1-(2.beta.22 - - 1..17 1.07 0.85 - - - - - 0.Kajian Kimia Gaharu .98 Kt 20 cm 0.. (3.).-bisabolene 2-Butanone (CAS) Mehtyl ethyl ketone Butyric acid..22 - 0. m-nitrophenyl ester (CAS) m-Nitrophenyl butyrate Carveol.12 - 0.32 1.26 0.5-furandione.04 - 0.5-dihydroxyphenyl)(CAS) Quinacetophenone Phenol.99 - 4. 2-methoxy-4-(1propenyl)-.14 1.(CAS) Eugenol 5-BUTYL-2-VALERYLFURAN 2(3H)-Furanone.23 20 cm 0.51 0.28 1.(CAS) 2.31 - 0.7. (E).70 0.(CAS) 2-acetylbutyrolactone 0.61 - - - - - - - 0.09 Me 5 cm 1.67 0. cisCholestane-3.03 0.33 - - 0. dihydro-.beta. 2-methoxy-4-(1propenyl).(CAS) Isoeugenol Phenol.66 20 cm 2.76 0.93 0.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm .84 - 0. 2-methoxy-4-(2propenyl).33 - 6.24 - 0.(CAS) (E)isoeugenol Phenol.38 0. dimethylhydrazone (CAS) Cyclopentanone dimethylhydrazone Cyclopropyl carbinol Cyclopentanone (CAS) Dumasin 1-Eicosanol (CAS) n-Eicosanol TRANS-ISOELEMICIN Ethanone.6.66 5 cm 0. 3-methyl(CAS) Citraconic anhydride Citronellyl acetate .45 1.20 - 4.53 0.42 4.38 - 4.93 - 3.6. beta.55 Mu 5 cm 1.71 0.93 - 0.7-triol..25 1.30 0.20 71 .65 0.beta.45 0..95 0..beta.61 - 4.78 Bo 20 cm 0.-Cyclocitral Cyclopentanone.5.alpha.

delta.56 0.04 0. 5-hexyldihydro.66 - 0. 1-methylethyl ester (CAS) Isopropyl hexanoate 3-Hexenoic acid 1H-Indole (CAS) Indole 1H-Indole.(CAS) 3-Methyl-2-heptanone Hexanoic acid.51 0. 3-methyl. acetate (CAS) 2-HEPTYL ACETATE 2-Heptanone.30 0.21 0.31 - 0.03 0.74 1.56 0.18 Kt 20 cm Me 5 cm 20 cm 0.39 0.21 0. 5-methyl(identity?) (CAS) 2-Penten-4olide 2(3H)-Furanone.77 0.09 Mu 5 cm 20 cm - - - - - - 0.28 0.(CAS) 2-methylindole 6-Nitro-5-hydroxy-1.26 - 0.40 0.64 0.59 0.38 0.65 0.75 1.60 0.02 - 72 .4-Dimethylbut-2enolide 2(5H)-Furanone.09 - 0.93 - - 0.54 - 0.5-Dihydrodecanoic acid.48 0.36 0.31 0.GAMMA.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 2(5H)-Furanone.13 0.03 0.63 - 0.-lactone Muskolactone Bo 20 cm 5 cm 0.18 0.69 - 0.09 - - - - - - - 0.HEXALACTONE 3.65 - 0.5-dimethyl(CAS) 4. 5.14 0.54 - 0.71 0.35 - 0.98 0.54 0.70 - 0. 2-methyl.23 0.25 - - 0.55 0.11 - 0.(CAS) 4-decanolide 2-Furancarboxaldehyde (CAS) Furfural 2-Furanmethanol (CAS) Furfuryl alcohol 2-Furanmethanol.09 - 0.06 0.2dimethylindole Indolizine (CAS) Indolizin Ionol 2 3-pentanone CAS) Diethyl ketone 1-Penten-3-one (CAS) Ethyl vinyl ketone . tetrahydro(CAS) Tetrahydrofurfuryl alcohol 2-Heptanol.76 - 0.03 - 0.

(CAS) N-Acetyl-L-isoleucine 5.01 0.93 - 0.19 0.89 2.58 0.6.(CAS) 4-methyl-4-nonanol 2.56 - 0.89 0.86 - 0. 4-hydroxy3.3-Benzenediol. 5-methyl(CAS) Orcinol Benzaldehyde.Kajian Kimia Gaharu .19 Kt 20 cm 0.21 Mu 5 cm 0.57 0..(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm L-isoleucine.(CAS) 4-Ethylresorcinol 1. 4-ethyl.43 0.50 5.40 0.. 1-(1-METHYLPENTYL)3-(2.5-DIHYDROXYNORBORNANE Piperidine.(CAS) Syringaldehyde Bo 20 cm 0..50 0.50 - 0.11 0.6-TRIDEUTERIO-OMENTHONE Benzene.65 3.5-dimethoxy.15 0.5-DIMETHOXY-PHENYL)PROPIONIC ACID 3-PHENYL-PROPIONIC ACID ISOPROPYL ESTER 2-PROPYNOIC ACID 9H-Purine.58 73 .57 3.15 - 0.45 3.17 - 0.04 0. 1-methoxy-4-methyl(CAS) p-methylanisole NEROLIDOL ISOMER 4-Nonanol.5-Norbornanediol (CAS) 2.22 0.21 0.34 - 0.21 0.52 0.13 20 cm 0.04 5 cm 0. 9-TRIMETHYLSILYL 1.3-Benzenediol.04 0.3. N-acetyl.52 0.(CAS) 6-METHYLPURINE. 6-methyl-9(trimethylsilyl).13 0.70 0.3-d3 (CAS) 2. 1-nitroso.48 2.20 0.13 0.20 Me 5 cm 20 cm 0.42 0.47 0.29 - 0..7-dimethoxy-2-methylindan1-one Lineolone METHYL MALONIC ACID p-Menthane-2-one-1. 4-methyl.(CAS) NITROSOPIPERIDINE PIPERIDINE.

23 - 0.50 Kt 20 cm 0. .40 5 cm 0. 4-(4-hydroxy3-methoxyphenyl).48 0.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm (E)-2-hydroxy-4’phenylstilbene 1-TRICOSENE Benzaldehyde.17 - 2.5-DIMETHYL-3(2H) FURANONE 2-ETHYL-4-HYDROXY-5METHYL-3(2H)FURANONE 2-HYDROXY-5-METHYL-2(5H)FURANONE 3-HYDROXY-5-METHYL-2(5H)FURANONE 0.21 - - 0.97 0.(CAS) Zingerone Ethanone.55 0.15 - 0. 3. 3.10 - 0.72 0.(CAS) 6-HYDROXYCYCLO 2(5H)-FURANONE 2.20 0.06 - 0.70 - 1.alpha.14 0.12 0.09 0.(CAS) Veratryl alcohol 2-Butanone.(CAS) Homovanillic acid ISO-VELLERAL Benzenemethanol.Furanone 2(3H)-Furanone.3DIHYDROFURAN 2(3H)-Furanone.alpha. 4-hydroxy-3-methoxy. 1-(2-furanyl).45 - - - - - 0.14 - 1.4-dimethoxy(CAS) Vanillin methyl ether Benzaldehyde.11 0.52 Mu 5 cm 0.12 0.52 Me 5 cm 0. 5-methyl(CAS) 5-Methyl-2-oxo-2.23 - - 0.26 74 .02 - - - - - - - - 0. 4-hydroxy-3methoxy.01 20 cm 0.(CAS) Vanillin Benzeneacetic acid.38 Bo 20 cm 0.11 0.36 - 1.4-dimethoxy.13 - 1.(CAS) 2-methoxymandelic acid Benzeneacetic acid.39 1.hydroxy-2-methoxy. hexahydro3-methylene.61 0.77 0.63 - - - - - 0.96 0.27 0.13 0.59 20 cm 0.(CAS) 2-Acetyfuran 2-ACETYL FURAN 2(3H)-Furanone (CAS) .04 0.28 - 2.45 0.32 - - - - - - - - 0.

30 45. (2008).(CAS) 4-allyl-2.65 5 cm - Kt 20 cm 1.57 19.18 0.10 52.95 2. Castro et al.65 46. Rho et al.83 43. Pedroso et al. (2002). Fotouhi et al. Valentines et al.6-dimethoxy-4-(2propenyl).10 3.19 45.34 46.71 21. Sheikholeslam & Weeks (1987). Baker et al.14 44.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm 5-HYDROXYMETHYLDIHYDRO-FURAN-2-ONE HYDROXY DIMETHYL FURANONE 2-(Acetyloxy)-1-[2-(acetyloxy02-(3-furanyl)ethyl]-5a[(acetyloxy)methyl]hexah 2-Methoxy-4-methylphenol Phenol. Koeduka et al.56 Bo = Bahorok.86 18.06 Mu 5 cm 20 cm 1. 2. (2001). Hua et al.48 49.3-dihydroxy-6-methoxy-8methyl. (2005).31 17.81 - 2. (2004).33 26. (2007).29 26. Kt = Kalimantan Tengah Tamiang Layang. (2006). (2008).Kajian Kimia Gaharu . (2008). Lynd-Shiveley (2004). Inc (2008).17 2.70 25. ChemYQ (2008).33 0. Zaika et al.12 24.6dimethoxyphenol 9H-Xanthen-9-one. (2007). (2004).80 2.. Wikipedia encyclopedia Online (2008).93 22.52 3. 75 . Bunke & schatkowski (1997). Mu = maluku FAO (2008). Rossi et al. (2002)..01 44.06 2.32 37.87 - 1.30 - Me 5 cm 1. 1.13 0.37 25.06 - - - 18.(CAS) 6-O-METHYLXanthosine (CAS) Xanthine riboside Jumlah Rataan untuk kedua jarak suntik Total Rataan total untuk kedua jarak suntik Keterangan: Referensi: Bo 20 cm 1.23 0. Abrishami et al.33 50..23 - - - - 0.34 43.62 0. Azah et al.95 0.23 27. International flavor and fragrance. Me = Mentawai.. The Good Scent Company (2008).02 20 cm 1.05 3.

76 .

aloeswood. Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu yang merupakan produk komersil bernilai ekonomis tinggi. 2001). di mana China dilaporkan sebagai pembeli utama.3 TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso. dan minyak gaharu (Surata dan Widnyana. Bentuk perdagangan gaharu beragam. Ahmad Yani. sebenarnya merupakan endapan resin yang terakumulasi pada jaringan kayu sebagai reaksi pohon terhadap pelukaan atau infeksi penyakit. meskipun penggunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. Menurut Suhartono dan Mardiastuti (2002). Komoditas berbentuk minyak biasanya diperoleh dari penyulingan atau ekstraksi chip gaharu dari kelas yang bermutu rendah. 77 . Dalam perdagangan internasional. Irnayuli R. Najmulah. komoditas ini dikenal dengan berbagai nama seperti agarwood. mulai dari bongkahan. Sugeng Santosa. dan masih banyak lagi nama lainnya. karas. Saat ini. gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut sebagai ‘scent of God’. kresna. perdagangan produk ini di Indonesia pertama kali tercatat pada abad ke-5 Masehi. chip. jinkoh. oudh. Maman Turjaman. Ragil Setio Budi Irianto. Gaharu telah diperdagangkan sejak ratusan tahun lalu. serbuk. Sitepu.

Penelitian-penelitian ini terutama didorong oleh berbagai hal seperti pasokan komersil untuk gaharu yang masih sangat tergantung dari produksi alam yang karena tingginya intensitas pemungutan produk ini telah menyebabkan tercantumnya genus utama tanaman penghasil gaharu. anti mikrobia. asma. obat kuat pada masa kehamilan dan bersalin. Penelitian mengenai berbagai aspek yang terkait dengan gaharu sudah dilakukan sejak lama dan semakin berkembang dewasa ini. juga memiliki sifat anti racun. liver. mekanisme pembentukan dapat menyebar ke bagian lain pada pohon. pelukaan mekanis pada batang. 2000). Suhartono dan Mardiastuti. pengaruh bahan-bahan kimia seperti metal jasmonat.. oli. sebagai pengharum ruangan. Adelina. Proses pembentukan gaharu juga membutuhkan waktu yang lama. kanker. sembahyang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. seperti yang telah disebutkan sebelumnya tidak menyebabkan terjadinya penyebaran mekanisme pembentukan ini ke bagian lain dari pohon yang tidak terkena efek langsung faktor abiotik tersebut. Lain halnya jika pembentukan gaharu dipicu oleh faktor biotik seperti jamur atau jasad renik lainnya. Terbentuknya gaharu pada tanaman penghasilnya. 2002). diuretic. 1987. incense. dan parfum (Barden et al. malaria. 2000). 2000). karena 78 . cacar. rematik. ginjal. gula merah. Selain itu.. stimulan kerja saraf dan pencernaan (Heyne. terpicu oleh faktor biotik maupun abiotik. tidak semua tanaman penghasilnya mengandung gaharu yang hanya terpicu pembentukannya jika terjadi kondisi cekaman. 2007) dan diketahui bermanfaat untuk mengatasi berbagai penyakit seperti sakit gigi. di mana selama proses tersebut berlangsung dihasilkan variasi mutu dan pada akhir proses dapat diperoleh gaharu dengan mutu paling tinggi (Sumadiwangsa dan Harbagung. Barden et al. Untuk menghasilkan gaharu secara artifisial. pemanfaatan gaharu adalah untuk pengobatan... dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti imflamatory (Trupti et al. Sementara itu. tumor. 2004. Namun pembentukan gaharu oleh faktor abiotik. In-cense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagamaan.Aspek PRODUKSI Pada prinsipnya. Gyrinops dan Aquilaria dalam Appendix II CITES. dan yang lainnya dapat memicu pembentukan gaharu. hepatitis. 2000. diare.

Bahan Bahan yang digunakan pada kegiatan ini adalah 21 isolat Fusarium spp. Kalimantan. maka kualitas dan kuantitas produk gaharu yang dihasilkan akan lebih memuaskan. Sumatera. yang diinokulasi di Laboratorium Mikrobiologi Hutan..Teknologi Induksi Pohon . Maluku. dkk) penyebab mekanisme ini adalah mahluk yang melakukan semua aktivitas yang diperlukan untuk kehidupannya. Inokulasi jenis fungi Fusarium spp... Batang Aquilaria spp.(Erdy Santoso. Dengan terjadinya penyebaran pembentukan gaharu ke jaringan lain pada batang pohon. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Bogor. NTB dan Sulawesi (Tabel 1). microcarpa pada kegiatan ini bahan berupa pohon A. Tabel 1. yang telah menunjukkan adanya pembentukan gaharu secara alami. microcarpa 79 . Isolat-isolat yang diamati No 1 2 3 4 5 6 7 8 9 10 11 Kode Ga 1 Ga 2 Ga 3 Ga 4 Ga 5 Ga 6 Ga 7 Ga 8 Ga 9 Ga 10 Ga 11 Asal lokasi Kalimantan Tengah Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Sumatera Barat Gorontalo No 12 13 14 15 16 17 18 19 20 21 Kode Ga 12 Ga 13 Ga 14 Ga 15 Ga 16 Ga 17 Ga 18 Ga 19 Ga 20 Ga 21 Asal lokasi Lampung Bengkulu Bogor Mentawai Kaltim LK Kalbar Yanlapa NTB Kalsel MIC Kalteng TL Media yang digunakan untuk menambahkan fungi. BAHAN DAN METODE A. Isolat fungi tersebut diperoleh dari batang Aquilaria spp. pada A. yaitu Potato Dekstrose Agar (PDA).. diambil dari beberapa tanaman gaharu yang terdapat di Jawa.

Inokulasi Pohon contoh adalah A. genset. Untuk fungi pembentuk gaharu asal Gorontalo. Inokulasi dilakukan pada semua pohon contoh. Pengeboran dilakukan 80 . Sebelum penginjeksian. Masing-masing isolat diinokulasikan pada 3 ulangan. terdiri dari bor listrik. Rancangan acak lengkap dengan perlakuan daerah asal isolat (I). isolat diletakkan pada gelas obyek yang kemudian ditutup dengan cover glass preparat. B. semua peralatan yang digunakan disterilkan terlebih dahulu dengan alkohol 70% untuk menghindari adanya kontaminasi dari mikrobamikroba lain. Sediaan kultur diinkubasi selama tujuh hari. yaitu Fusarium spp. Alat inokulasi. Untuk pengamatan morfologi dilakukan melalui mikroskop parameter. yang diamati adalah bentuk dan miselium. Kalimantan Barat (12). Teknik Inokulasi 1. baik secara horizontal maupun vertikal. Kalbar. diamati juga warna koloni dan keberadaan aerial miselium. dan lain-lain. Jambi (13) dan Padang (14) serta campuran dari keempat isolat tersebut (15). Identifikasi juga mengamati ciri makrokonidia. diinkubasi dengan cara diletakkan pada ruang tertutup yang kelembabannya dijaga dengan cara memasukkan kapas yang telah dibasahi aquadesh steril. microcarpa di Hutan Penelitian Carita. Jambi. kemudian diinokulasi pada suhu kamar dan diletakkan di ruangan inokulasi selama tujuh hari. asal Gorontalo (II). mata bor ukuran 3 mm.Aspek PRODUKSI umur 13 tahun. setelah itu koloni yang tumbuh pada gelas obyek diamati di bawah mikroskop setelah preparat diberi zat pewarna. Metode Untuk identifikasi masing-masing koloni ditumbuhkan pada media PDA dalam cawan petri. C. yang diamati adalah ukuran diameter koloni. Sediaan kultur dibuat dengan cara memindahkan potongan kecil isolat fungi menggunakan alat pelubang gabus berdiameter lima mm. mikrokonidia serta bentuk konidiofor. dan Padang (Sumatera Barat).

Keragaman Morfologi Isolat Fusarium spp.. Inokulum Fusarium spp. yang Berasal dari Berbagai Daerah Karakter morfologi aerial miselium. HASIL DAN PEMBAHASAN A. dkk) dengan kedalaman mencapai 1/3 diameter batang dengan tujuan inokulum cair nantinya mencapai kambium dan bagian floem kayu. yang berasal dari berbagai daerah sangat 81 . Pengamatan dan Pengambilan Contoh Gaharu Pengamatan infeksi dilakukan pada umur inokulasi 2 bulan dan 6 bulan dengan mengukur panjang infeksi vertikal dan horizontal yang terjadi pada permukaaan batang A.Teknologi Induksi Pohon . A Gambar 1. Pengeboran batang pohon contoh (A) dan injeksi isolat pada lubang bor (B) B 2. Pengambilan data dilakukan secara acak pada beberapa titik injeksi inokulasi dan nilai panjang infeksi merupakan rata-rata dari panjang titiktitik infeksi tersebut dalam satu pohon... Keragaman Isolat Fusarium spp.(Erdy Santoso. warna koloni dan diameter koloni isolat Fusarium spp. microcarpa. 1. cair selanjutnya diinjeksikan sebanyak 1 ml untuk setiap lubang bor di batang pohon.. Lubang injeksi dibiarkan terbuka untuk memberi kondisi aerasi bagi mikroba yang diinokulasikan.

coklat muda Coklat muda Putih Putih Putih Putih krem Putih Putih krem.+++ Ada.++ Ada.+ Ada.++ Ada. krem No.+ Ada.+++ Ada. Tabel 2. disebabkan oleh perbedaan asal isolat. ++ Cukup banyak. kuning muda Putih. putih Putih.++ Ada.+ Ada.+++ Ada. coklat muda Putih Putih kecoklatan Putih tulang.++ Ada. Keragaman morfologi Fusarium spp. kuning.+++ Ada. Koloni pada 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 Kelimpahan relatif aerial miselium: + Sedikit.++ Ada.++ Warna Medium PDA Putih. kuning muda Putih Putih.+++ Ada. yang berasal dari berbagai daerah Kode isolat Karakter morfologi Asal lokasi Diameter koloni mm/7 hari Kalteng Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Padang Gorontalo Lampung Bangka Bogor Mentawai Kaltim LK Kalbar Yanlapa Mataram Kalsel MIC Kaltel TL 61 49 48 50 45 38 59 49 59 61 58 58 59 61 56 57 59 58 52 50 69 Aerial Miselium Ada.++ Ada. unggu Putih krem Putih. merah muda Putih Putih Coklet.++ Ada. +++ Banyak a.+++ Ada. Tabel 2. kuning muda Putih. Keberadaan Aerial Miselium 82 .++ Tidak ada Ada.+++ Ada. Keragaman karakter morfologi Fusarium spp.++ Ada.Aspek PRODUKSI beragam (Tabel 2).

maka perbedaan kelimpahan aerial miselium adalah disebabkan oleh karakter masing-masing isolat. Ga-10. Isolat Ga-1. adalah warna koloni. Walaupun sebagian besar isolat Fusarium spp.Karakter aerial miselium terdapat hampir pada setiap isolat Fusarium spp. Hasil yang diperoleh menunjukkan bahwa warna koloni putih terdapat pada isolat Ga-4. sedangkan isolat Ga-3. Ga-13.. Ga-5. Aerial miselium yang terbentuk dengan kelimpahan relatif banyak merupakan mekanisme fototropi terhadap kehadiran cahaya (Irawati. Ga-12. Isolat yang tidak memiliki aerial miselium dijumpai pada Ga-15 asal Mentawai. karena pada penelitian semua isolat yang diuji mendapat perlakuan cahaya yang sama. Ga-6. Ga-14. dan Ga-20 memiliki warna koloni putih dan kuning muda. Ga-11. Isolat ga-17 dan Ga-21 memiliki kemiripan warna koloni dengan isolat Fusarium yang berasal dari Riau yang telah teridentifikasi dan merupakan spesies Fusarium solani (Luciasih et al. Namun. memiliki aerial miselium. dan Ga17 memiliki kelimpahan aerial miselium relatif banyak (Tabel 2). namun terdapat perbedaan antar isolat jika dilihat berdasarkan kerlimpahan relatif aerial miseliumnya. Fusarium solani merupakan spesies yang kosmopolit dengan ciri khas kelimpahan mikrokonidianya elips. Isolat Ga-18. 2006). yaitu warna hifa miselium didominasi 83 . cokelat muda (Ga-2). 2004). dan Ga-21). Irawati (2004) melaporkan bahwa secara umum cendawan yang ditumbuhkan pada kondisi terang secara terus-menerus akan membentuk aerial miselium relatif lebih banyak. b. dan Ga-19 (Gambar 2. Isolat Ga-10 dan Ga11 memiliki warna koloni putih dan warna cokelat muda (peach). Selain warna putih. Ga-19. Ga-6. Warna Koloni Selain aerial miselium. dan Gambar 4). Ditemukan juga isolat yang memiliki warna koloni yang sangat berbeda dengan isolat lain. Ga-10. Ga-17. beberapa isolat memiliki warna putih dan warna kuning muda pada isolat Ga-1. putih krem (Ga-7. Ga8. dan Ga-16 merupakan isolat dengan kelimpahan aerial miselium sedikit. keragaman morfologi isolat Fusarium spp. Gambar 3. Ga-9. Ga-13.

percabangan konidiofor. dan kelimpahan mikrokonidia. kecepatan tumbuh merupakan karakter yang khas pada setiap isolat. Ga-18. isolat dengan diameter antara 40-50 mm (isolat Ga-2. Diameter Koloni Diameter koloni Fusarium spp. Ga-17. misalnya terhadap inangnya. Ga-11. dan isolat dengan diameter lebih dari 50 mm (isolat Ga-1. dan Ga-21. Ga10. Ga-8. Namun. Ga-18. berkisar antara 30-69 mm. Ga-5. Ga-3. Ga-7. dan Ga-21) (Tabel 2. dari ke-10 isolat tersebut terdapat perbedaan pada 84 . Semua isolat yang diuji dapat diklasifikasikan menjadi tiga kelompok. Untuk mengetahui kemampuan virulensi. dan Ga-20). Cendawan yang tidak berpigmen umumnya berwarna hialin. Gambar 3. Ga-4. memiliki keragaman pada karakter morfologi juga tampak adanya keragaman karakter mikrokonidia dan makrokonidia dari isolat yang diuji. Ga-15. Ga-9. diperoleh adanya hubungan yang erat antara kecepatan tumbuh hifa dengan kehadiran aerial miselium. Diameter koloni merupakan veriebel yang berhubungan erat dengan kecepatan tumbuh. Ga-10. Jumlah septa makrokonidia dominan berjumlah 2-3 yang dimiliki oleh isolat Ga-1. Ga-6. Keragaman Mikro dan Makrokonidia serta Konidiofor Isolat Fusarium spp. Keragaman diameter koloni Fusarium spp. Selain itu. bentuk. Pada beberapa isolat Fusarium. berhubungan dengan kecepatan tumbuh hifa. Kecepatan tumbuh yang tinggi dapat berhubungan juga dengan kemampuan virulensi. Hasil pengamatan menunjukkan bahwa keragaman terlihat pada karakter jumlah septa makrokonidia. Fusarium spp. yaitu diameter kurang dari 40 mm (isolat Ga-6). Ga-5. Ga-13. Ga-20. Keragaman yang terdapat pada warna koloni berhubungan dengan pigmen yang dikandung oleh dinding sel hifa. Gambar 2. c. Ga-19. Ga-7. 2. Ga-3. Ga-14. Ga-8. dan Gambar 4). Ga-12. maka isolat perlu diuji. Ga-16.Aspek PRODUKSI oleh warna ungu namun memiliki warna koloni putih sedikit tipis pada aerial miselium yang terletak pada bagian tepi koloni (Gambar 3).

(Erdy Santoso. Ga-14. dan Ga-8) umur tujuh hari pada medium PDA Gambar 3. Ga-8. dan Ga-10 memiliki konidiofor sederhana (Tabel 3).Teknologi Induksi Pohon . Ga-11. GA-7.. Ga-13. Ga-6.. Keragaman morfologi Fusarium spp. Gambar 2.. Ga-6. dan Ga16) umur tujuh hari pada medium PDA. Ga-4. Ga-5. (isolat Ga-1. 85 . Sedangkan isolat Ga-1. dkk) percabangan konidifornya. Ga-3. Ga-7. Ga-3. (isolat Ga-9. Ga-15. Ga-5. Isolat dengan konidiofor bercabang adalah Ga-18 dan Ga-21. Ga-10.. Ga-2. Ga-12. Keragaman morfologi Fusarium spp.

sekat Elips Elips Elips Elips Elips Elips. namun dari ke-3 isolat tersebut dapat dibedakan berdasarkan 86 . Keragaman morfologi Fusarium spp. oval Elips. oval Elips Elips. oval Elips Isolat Ga-2. Ga-20. Keragaman karakter makrokonidia Fusarium spp. sekat 3 Elips Elips Elips Elips. yang berasal dari berbagai daerah Karakter histologi No Kode Makrokonidia Jumlah septa 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 3 4 3 4-7 2 3 2 2 5 3 4 5 4 7 4 7 5 3 4 2 3 Konidiofor Simpel Bercabang Simpel Simpel Simpel Simpel Simpel Simpel Simpel Simpel Bercabang Simpel Simpel Simpel Bercabang Simpel Bercabang Bercabang Simpel Bercabang Bercabang Mikrokonidia Kelimpahan Banyak Banyak Banyak Banyak Sedikit Sedikit Sedikit Sedikit Sedikit Banyak Banyak Banyak Sedikit Sedikit Banyak Sedikit Sedikit Banyak Banyak Sedikit Banyak Bentuk Elips Elips. Ga-3. dan Ga-15 memiliki jumlah septa empat. sekat Elips. dan Ga-21) umur tujuh hari pada medium PDA Tabel 3. lonjong Elips. oval Elips. Ga-19. (isolat Ga-17. Ga-18.Aspek PRODUKSI Gambar 4. oval Elips Elips.

Mikrokonidia pada berbagai Fusarium memiliki bentuk yang khas. yaitu isolat Ga-12 dan Ga-14 memiliki kemiripan pada bentuk konidiofor dan bentuk mikrokonidia. dan Ga-5). juga bentuk mikrokonidianya relatif lebih besar untuk F. Fusarium solani berbeda dengan F. dari 21 isolat Fusarium spp. antara lain berdasarkan karakter kelimpahan dan bentuk mikrokonidianya. Genus Fusarium memiliki kemiripan dengan Cylindrocarpon pada karakter morfologi. dkk) percabangan konidifor dan bentuk mikrokonidianya. sambunicum (isolat Ga-1). tricinctum (isolat Ga-2. namun Booth (1971) membedakan Cylindrocarpon karena karakter pangkal konidianya yang relatif tumpul dan tidak memiliki hock/foot cell yang jelas seperti pada Fusarium spp. Ga-8. solani dengan mikrokonidianya berbentuk elips. Isolat Ga-2 memiliki konidifor bercabang. Ga-14. namun kedua isolat tersebut berbeda pada tipe makrokonidianya. Isolat Ga-12 memiliki ukuran relatif lebih besar pada makrokonidianya apabila dibandingkan dengan Ga-14 (Gambar 5 dan Gambar 6). Dua dari tiga isolat tersebut. Isolat Ga-13 memiliki bentuk konidifor simpel dan Ga-15 bentuk konidifornya bercabang. Ga-3. (2006) melaporkan bahwa keragaman antar Fusarium spp.. Ga-6. dan Ga9). solani dibedakan dari F. tricinctum berdasarkan karakter bentuk makrokonidianya. yaitu berkisar 5-7 (Tabel 3). Spesies tersebut merupakan F.. Ga-7. Isolat Ga-14 berbeda dengan isolat Ga-16 karena pada isolat Ga-16 mikrokonidianya bersekat (Gambar 7).Teknologi Induksi Pohon . Isolat Ga-12.(Erdy Santoso. beberapa isolat telah teridentifikasi sampai pada tingkat spesies. dan F. dan Ga-16 merupakan isolat yang memiliki jumlah septa makrokonidia relatif banyak. F. yaitu berbentuk bulan sabit (fusoid) sehingga memungkinkan dapat dengan mudah dibedakan dengan genus lain yang memiliki ciri mirip Fusarium. Sedangkan F... Cowan (1999) menerangkan bahwa tanaman memiliki kemampuan yang tidak terbatas dalam mensintesis substansi 87 . Di antara ketiga spesies tersebut F. bentuk mikrokonidianya elips dan oval. Luciasih et al.. solani keberadaannya paling dominan sehingga perlu mendapat perhatian khusus. solani (isolat Ga-4. sambunicum.

Ga-9. Ga-15. Pada umumnya senyawa-senyawa tersebut merupakan metabolit sekunder yang seringkali berperan dalam mekanisme pertahanan tanaman terhadap serangan mikroorganisme. Ga-20. Ga-14. GA-10. (isolat Ga-1. Gambar 5.2. Ga-11. Ga. dan Ga-18) dengan perbesaran 40x 88 . Ga-17. serangga ataupun herbivora.Aspek PRODUKSI aromatis yang kebanyakan merupakan senyawa fenol atau turunan oksigen-tersubstitusinya. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. (isolat Ga-4. Ga-5. Ga8. Ga12. dan Ga-21) dengan perbesaran 40x Gambar 6. GA-7.

2000). Metabolit sekunder tanaman yang diturunkan dari terpenoid memiliki berbagai fungsi dalam tanaman. Fitoaleksin adalah senyawa aktif anti mikrobial yang diproduksi secara de novo setelah pelukaan atau infeksi.(Erdy Santoso. dan Ga-19) dengan per-besaran 40x Gaharu merupakan senyawa fitoaleksin dari pohon gaharu sebagai mekanisme pertahanannya terhadap infeksi patogen. fitoaleksin sebagai agen anti mikrobial (sesqui-. Sebagai contoh.. Ga-6. atraktan serangga. Biosintesis keduanya terpicu pada level gen (Verpoorte et al. Ga-16.. ekspresi dari jalur biosintesis yang terlibat akan berbeda. baik fitoantisipin maupun fitoaleksin. biosintesis sesquiterpena tertentu pada solanaceae terpicu oleh infeksi mikroba. dalam Isnaini. Terdapat jalur biosintesis yang terpicu pada level gen setelah pelukaan atau infeksi dan ada yang terjadi pada level senyawa. memainkan peranan penting (Verpoorte et al. dan triterpena). Vidhyasekaran. rangsangan fisiologi maupun keadaan cekaman (Goodman et al. Kayu beresin ini merupakan metabolit sekunder yang dibentuk tanaman sebagai respon pertahanan.. Ga-13.. Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. 2004). di antaranya sebagai minyak esensial (monoterpenoid). dkk) Gambar 7.Teknologi Induksi Pohon . kadangkala terpicu pengaktifannya saat pelukaan. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp.. Metabolit sekunder dalam sistem pertahanan tanaman. di-. 2004). (isolat Ga-3.. 2000. Fitoantisipin adalah senyawa aktif anti mikrobial yang telah terdapat pada tanaman. Pohon penghasil gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. Berdasarkan berbagai fungsi tersebut. 2000). sedangkan pada tanaman lain biosintesis sesquiterpenoid 89 . di mana senyawa yang telah ada secara enzimatis dirubah menjadi senyawa aktif ketika pelukaan.

sehingga dihasilkan produk gaharu yang diinginkan. 1987). pangkal percabangan. Zat ekstratif pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. Konsentrasi metabolit sekunder bervariasi antar spesies. Analisis Infeksi Batang Dalam kondisi menghadapi infeksi oleh jamur. memberi bau. Dalam hal pembentukan gaharu tentunya diharapkan penyakitlah yang akan menang. Daya tahan pohon akan menentukan pemenang antara pohon dengan penyakit yang disebabkan mikro-organisme tersebut. dan jaringan luka). antar pohon dalam spesies yang sama. kayu teras. 2000). antar jaringan (konsentrasi tertinggi berada di kulit. dan antar musim. Metabolit sekunder tanaman efektif dalam melawan hama dan agen penyakit. misalnya pada Morinda citrifolia. Rowell (1984) menyatakan bahwa di antara fungsi zat ekstratif adalah sebagai bagian dari mekanisme sistem pertahanan pohon terhadap serangan mikroorganisme. rasa. Gaharu sendiri telah diidentifikasi sebagai sesquiterpenoid. Jenis-jenis tropis dan sub-tropis umumnya mengandung jumlah ekstratif yang lebih banyak dibanding jenis-jenis di daerah temperet (Forestry Comission GIFNFC. Metabolit sekunder pada kayu dapat disebut sebagai zat ekstratif. dan warna pada kayu. 2007). senyawa pertahanan tipe fitoaleksin. antar spesies. karena analog dengan komponen vital tertentu dari sistem sinyal seluler atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Comission GIFNFC. akar. Kerentanan pohon dalam menghadapi infeksi jamur akan berkaitan dengan 90 . Senyawa kimia yang dimiliki pohon merupakan salah satu upaya pertahanan pohon terhadap mikroorganisme penyebab penyakit. anthraquinone biasa ditemukan di seluruh bagian tanaman (Verpoorte. Zat ekstratif yang terdiri dari bermacam-macam bahan ini memilki fungsi yang penting dalam daya tahan terhadap serangan jamur dan serangga. 2007). pohon penghasil gaharu akan memberi respon untuk mempertahankan dan memulihkan dirinya.Aspek PRODUKSI merupakan ekspresi pembentukan yang umum. B.

..(Erdy Santoso.857a lagi memberikan pengaruh nyata Jambi 2. microcarpa pada umur inokulasi 2 bulan dan 6 bulan. diikuti oleh isolat campuran (Tabel 4). yaitu 4. dkk) gaharu yang terbentuk.133a terlihat bahwa infeksi tertinggi masih Keterangan: Nilai yang diikuti oleh huruf yang disebabkan oleh isolat asal Gorontalo sama tidak berbeda nya-ta pada 0. microcarpa.Teknologi Induksi Pohon .13 cm diikuti oleh isolat campuran.193a inokulasi 2 bulan.223a terhadap infeksi yang terbentuk pada Kalimantan Barat batang A. Padang. dan yang terendah adalah infeksi yang terbentuk oleh isolat asal Jambi. pada umur inokulasi 6 umur inokulasi bulan. dapat direfleksikan masing-masing oleh besar infeksi dan komponen kimianya. microcarpa.. Kalbar.297a halnya dengan kondisi pada umur Campuran 3.05 dan campuran. asal Gorontalo memperlihatkan nilai infeksi yang paling besar. Pada Gambar 8 terlihat panjang infeksi yang terjadi pada batang pohon A. isolat asal Gorontalo menyebabkan infeksi yang paling besar pada batang pohon penghasil gaharu. 91 . secara statistik asal isolat tidak 1. Pada umur inokulasi 2 bulan isolat Fusarium spp.. dari Gambar 8 Gorontalo 4. isolat campuran menyebabkan infeksi yang lebih tinggi dibandingkan Asal isolat Rataan isolat yang lain (Gambar 8). terlihat bahwa asal isolat berpengaruh nyata terhadap panjang infeksi yang terjadi pada batang A. Uji lanjut Duncan untuk infeksi 2 bulan umur 2 bulan. Pada saat (Isolate origin) (Mean value) ini. Berbeda dengan kondisi pada Tabel 4. Namun sama Padang 2. Dari hasil analisis sidik ragam. Hasil uji lanjut Duncan memastikan bahwa pada dua bulan sejak inokulasi.

Laju infeksi pada batang A. Meskipun terjadi 9 menunjukkan perubahan panjang infeksi yang terjadi sejak masihbulan inokulasi hingga bulan keenam. dari Gambar 8 Aspek PRODUKSI terlihat bahwa infeksi tertinggi masih disebabkan oleh isolat asal Gorontalo dan campuran. microcarpa Gambar 8. Meskipun masih dua merupakan isolat yang menyebabkan infeksi terbesar. Panjang infeksi batang A. microcarpa 92 .186 pada 5%). tetapitidak mengalami perkembangan. microcarpa Gambar sejak dua bulan inokulasi hingga bulan keenam. Panjang infeksi batang A. Gorontalo terlihat tidak mengalami bulan keenam oleh isolat asal sedangkan infeksi oleh keempat asal perkembangan. huruf yang sama tidak berbeda nya- Gambar 8. Gambar 9 menunjukkan perubahan panjang infeksi yang Gambar 9. Namun begitu.bentuk pada batang A. asal daerah isolat tidak memberikan pengaruh nyata pada laju infeksi yang terjadi (nilai signifikansi 0. tetapi infeksi bulan keenam oleh isolat asal Gorontalo terlihat infeksi merupakan isolat yang menyebabkan infeksi terbesar. secara statistik untuk bulan keenam inokulasi. Namun sama halnya dengan kondisi pada umur inokulasi 2 bulan. mita pada 0.05 crocarpa. sedangkan infeksi oleh keempat asal isolat yang 71 | lain menunjukkan peningkatan yang beragam.

Secara histologi isolat Fusarium spp. kuning. Meskipun isolat campuran menunjukkan panjang infeksi yang lebih tinggi saat 6 bulan setelah inokulasi. 3. 4. didominasi warna putih. jadi sebaiknya isolat ini digunakan untuk inokulasi 93 . dan Ga-17 merupakan isolat yang memiliki kecepatan tumbuh tinggi apabila dibandingkan dengan isolat Fusarium yang lain... asal Gorontalo menyebabkan infeksi yang paling besar. namun ada kemungkinan hal ini masih merupakan pengaruh dari isolat asal Gorontalo tersebut.(Erdy Santoso. meskipun yang terbesar masih disebabkan oleh isolat campuran dan isolat asal Gorontalo. dan ungu. Hasil inokulasi Fusarium spp. Uji perbedaan kecepatan tumbuh menunjukkan bahwa isolat Ga9. 2. Ga-11. namun terdapat warna koloni merah muda. Meskipun tetap menyebabkan infeksi yang besar.. Isolat Fusarium spp. Dari perkembangan infeksi pada pohon A. Hampir semua isolat memiliki aerial miselium. microcarpa ini dapat dikatakan bahwa isolat asal Gorontalo menyebabkan infeksi yang terbesar. kekonsistenan perkembangan infeksi sebaiknya diteliti lebih lanjut dengan mengikuti perkembangan laju infeksi oleh isolat asal Gorontalo ini hingga kurun waktu tertentu. Hal ini diduga ada kaitannya dengan pertahanan masing-masing pohon contoh. KESIMPULAN 1. dkk) Perkembangan infeksi yang terjadi hingga 6 bulan setelah inokulasi menunjukkan asal daerah isolat tidak lagi memberikan pengaruh yang nyata. yang berarti isolat ini menghasilkan kuantitas gaharu yang paling besar. pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masing sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. memiliki karakter makrokonidia bersepta 3-4 dan makrokonidia didominasi oleh bentuk elips..Teknologi Induksi Pohon . Secara morfologi isolat Fusarium spp.

A.kvl. TRAFFIC Network. A.Aspek PRODUKSI pada A. Irawati. D. Bogor. Booth. Chemicals from Trees. 267-269. Cowan. Isnaini. 1999. gov. Hills. Heartwood and Tree Exudates.12 (4) : 564-582. Michael (2000). The Chemistry of Solid Wood. Jurnal Penelitian Hutan dan Konservasi Alam III(5):555-564.uk/review/extraction. The Genus Cylondrocarpon. Forest and Landscape Denmark. E. Magelang. pp. (England : Commonwealth Mycological Institute). http: // treechemicals. Program Pascasarjana Institut Pertanian Bogor. Teresia. [2 Februari 2007]. 2. Hua SST. Forestry Commission GIFNFC. 2006. Seed Leaflet : Aquilaria malaccensis Lamk. 2007. Badan Litbang Kehutanan. www. 2004. 1987. DAFTAR PUSTAKA Adelina. Bogor Luciasih. 2004. Berlin : SpringerVerlag. Barden. C. Rm. Nooranie. 2001. Heart of The Matter Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. Santoso. dan E. csl.dk. Tumbuhan Berguna Indonesia. pp. M. Wahyuno. 2004. 120-127. Applied Microbiology 32 : 278-281. Rowell. Pusat Litbang Hutan dan Konservasi Alam. Y. W. Jakarta. Karakterisasi Mikoriza Rhizocstonia dari Perakaran Tanaman Vanili Sehat. pp.cfm. Heyne. microcarpa jika diinginkan hasil gaharu dalam jumlah besar. Jilid III. K. (1987). 94 . 6-7. A.SL. N. (1971). [14 Juli 2007]. and S. 1984. pp. M. Washington : American Chemical Society.. Keanekaragaman Jenis Jamur yang Potensial dalam Pembentukan Gaharu dari Batang Aquilaria spp. Induksi Produksi Gubal Gaharu Melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik. Disertasi). Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. Plant Products as Antimicrobial Agents.. Clinical microbiology Review.A. Tesis.

A. R. (Editors). Jakarta. Aisuli 14. Metabolic Engineering of Plant Secondary Metabolism. Mundhada. I M. A. Info Hasil Hutan 6 (1) : 1-16.. P. Nandakumar. Physiology of Disease Resistant in Plant.. P. (Editors). W. 2000. C. and Alfermann. Trupti. Boston. R. p : 31-50. Teknik Budidaya Gaharu. dan Harbagung. P.. Boca Raton. 2000. Gore. Dordrecht. R. S. Miniyar. Dordrecht. Verpoorte. London..Teknologi Induksi Pohon ... Boston. K. Florida. Balai Penelitian Kehutanan Kupang. CITES and Implementation in Indonesia. 2000. R van der Heijden. 95 . Analgesik and AntiImflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. Surata. Bhutada. A. Memelink. dkk) Soehartono. London. Plant Secondary Metabolism. R. T. Sumadiwangsa. Kluwer Academic Publisher.. W. S.(Erdy Santoso. Widnyana. Pusat Penelitian Hasil Hutan. Somani. R. Laju Pertumbuhan Tegakan Gaharu (Aquilaria malaccensis) di Riau yang Ditanam dengan Intensitas Budidaya Tinggi dan Manual. Vidhyasekaran. Kain. In Verpoorte. Kluwer Academic Publisher. Bogor. K. Pharmacology-online 1 : 288-298. General Strategies. p : 1-30. and Alfermann. Nagao Natural Environment Foundation. Metabolic Engineering of Plant Secondary Metabolism. 2007. E. Verpoorte. Mardiastuti. J. CRC Press Inc. 2002. In : Verpoorte. I K. 2001. 2000. Y..

96 .

Proses pembentukan gubal pada pohon gaharu. oxyporum. Magnoliopsida. Selain itu. DAN Fusarium sp. (1999) menyatakan bahwa beberapa isolat Acremonium sp. malaccensis mampu menginduksi gejala pembentukan gubal pada pohon gaharu (A. hingga saat ini masih terus diteliti. malaccensis. DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu Departemen Biologi. Thymelaeaceae). F. Beberapa spesies Fusarium seperti F. gubal gaharu diduga dapat terbentuk melalui infeksi cendawan. bulbigenium. A. Menurut Nobuchi dan Siripatanadilok (1991). Institut Pertanian Bogor Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Esti Wulandari Departemen Biologi.4 EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp. crassna. filaria) dan A. FMIPA. A. microcarpa) umur 97 . Institut Pertanian Bogor LATAR BALAKANG Gaharu merupakan salah satu komoditi hasil hutan bukan kayu (HHBK) yang dihasilkan oleh beberapa spesies pohon gaharu (Aquilaria sp. lateritium telah berhasil diisolasi oleh Santoso (1996). A. dan F. Rahayu et al. FMIPA. asal gubal gaharu pada Gyrinops verstegii (sin..

dan sebaliknya. oxysporum. IPBCC 07. Acremonium sp. terdeteksi senyawa oleoresin (Prema dan Bhattacharyya. BAHAN DAN METODE A. Mekanisme infeksi kedua cendawan ini pada satu lokasi infeksi belum dipelajari. biakan Acremonium sp. infeksi cendawan yang pertama dapat membangkitkan resistensi yang disebut Systemic Acquired Resistance (SAR) terhadap infeksi cendawan kedua. dan Fusarium sp. Infeksi ganda Fusarium sp. Padahal menurut Sticher et al. oxysporum f. larutan gula 2%. pada beberapa kasus infeksi cendawan pada tumbuhan. Oleh sebab itu penelitian ini bertujuan untuk mengetahui efektivitas dan interaksi antara Acremonium sp. (1997). Rahayu et al. merangsang perubahan warna kayu dan pembentukan senyawa terpenoid. cucumerinum dapat membangkitkan SAR tanaman semangka terhadap infeksi Colletotrichum lagenarium. hasil induksi cendawan. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam). yang berasal dari Aquilaria sp. terhadap Acremonium sp. 1962). seringkali diperoleh dari satu gejala gubal. terhadap Fusarium sp.525 (koleksi IPBCC. dalam pembentukan gubal pada pohon gaharu (A. melalui pemanfaatan kedua cendawan tersebut sebagai penginduksi ganda memerlukan informasi awal mengenai kemungkinan terbentuknya SAR yang dibangkitkan oleh Fusarium sp. Caruso dan Kuc (1977) menyatakan bahwa infeksi F. (1995) juga menemukan proses SAR dari infeksi Pseudomonas lachrymans pada timun terhadap F. Liu et al.sp. Padang (koleksi Laboratorium Mikrobiologi Hutan. Oleh sebab itu. microcarpa umur 13 tahun di Hutan Penelitian Carita. Sebagai contoh. Banten. dan Acremonium sp. microcarpa). Departemen Biologi FMIPA IPB). Pada gubal gaharu. 98 . Bahan Bahan dan alat yang digunakan adalah pohon A. (2007) dan Rahayu (2008) juga menyatakan bahwa Acremonium sp. perubahan warna kayu dan adanya senyawa terpenoid dijadikan indikator efektivitas dan interaksi antara inokulan dalam pembentukan gubal.Aspek PRODUKSI 2 tahun. dan Fusarium sp.

2. Pasangan inokulan (FA atau AF) adalah set perlakuan. pohon dilubangi lagi pada jarak 15 cm secara vertikal dari deretan lubang yang pertama. Untuk inokulan berupa pelet. aquades. Pembuatan Inokulan Acremonium sp. sederetan lubang dibuat di sekeliling batang utama (mulai ketinggian 0. dan diinkubasi selama 3 minggu menggunakan inkubator bergoyang.5-1 m di atas permukaan tanah) dengan mata bor berdiameter 4 mm. Metode 1. saja (FF)) digunakan sebagai pembanding. Batang yang tidak diberi perlakuan (K). yang dilubangi saja (B). Ke dalam lubang pada deretan kedua ini dimasukkan inokulan 2. meteran. bor. Acremonium sp. ditumbuhkan pada media serbuk gergaji selama 2 minggu.alkohol. kemudian dibentuk berupa pelet dengan ukuran 4 mm x 40 mm. Biakan ini akan digunakan sebagai sumber inokulum untuk pembuatan inokulan. mata bor berukuran 4 mm. dan Fusarium sp. Seminggu kemudian. dan alat pencetaknya. Ke dalam deretan lubang ini dimasukkan inokulan 1 sampai lubang dipenuhi oleh inokulan. kemudian zona perubahan warna batang diukur secara horizontal 99 . Fusarium sp. Jarak antar lubang dalam deretan sekitar 5 cm. serta batang dengan perlakuan tunggal (diberi Acremonium sp. bahan pelet. Jarak antar set perlakuan dalam 1 pohon ± 30 cm. diremajakan pada media agaragar kentang dekstrosa (Difco) dan diinkubasi pada suhu ruang selama 7 hari. Pengamatan dilakukan setiap 1 bulan selama 4 bulan. Pertama-tama. Uji Efektivitas dan Interaksi Acremonium sp. dengan kedalaman lubang maksimal 1/3 diameter batang. lubang diberi larutan gula 2% sebelum pemberian inokulan. Batang di sekitar lubang dikupas kulitnya. saja (AA) atau Fusarium sp. dan Fusarium sp. Perubahan warna batang dan pembentukan wangi merupakan indikator pembentukan gubal. ditumbuhkan pada 300 ml media cair. Efektivitas dan interaksi diukur melalui perkembangan pembentukan gejala gubal di sekitar daerah induksi. B. batang yang dilubangi dan diberi larutan gula (G).

3. Deteksi Senyawa Terpenoid Senyawa terpenoid dideteksi dengan metode LiebermanBurchard (Harborne.4 g kayu yang berubah warna direndam dalam 5 ml etanol absolut panas. 4. 2 = wangi). dihomogenisasi lalu dipindahkan ke tabung reaksi steril. 1987). kemudian disaring pada cawan petri steril dan diuapkan sampai kering (sampai terbentuk endapan berwarna kuning).Aspek PRODUKSI dan vertikal.1 menggunakan Rancangan Acak Lengkap (RAL) satu faktor dengan waktu dan uji F pada α = 5%. Tingkat wangi dinyatakan dalam rataan skor dari 3 responden. Analisis Data Data hasil pengamatan (panjang. ditambahkan 3 tetes asam asetat anhidrat dan 1 tetes H2SO4 pekat. tingkat perubahan warna. kemudian diamati wanginya secara organoleptik ketika kayu dibakar. lebar zona perubahan warna. Tingkat perubahan warna kayu dinyatakan dalam rataan dari hasil pengamatan 3 responden. Sebanyak 0. Setelah diamati tingkat wanginya. 1 = putih kecoklatan. sampelsampel dari kayu yang mengalami perubahan warna dipisahkan dari bagian yang sehat. 3 = coklat kehitaman). Wangi ditetapkan berdasarkan sistem skor (0 = tidak wangi. Perubahan warna diamati pada 10 titik untuk setiap pohon. Wangi dinyatakan dalam tingkat wangi dan persentase titik induksi dengan kategori agak wangi dan sangat wangi. kemudian absorbansinya diukur dengan spektrofotometer pada λ 268 nm. dan tingkat wangi) dianalisis dengan SAS versi 9. Sebanyak 5 ml etanol absolut ditambahkan ke dalam larutan. Perubahan warna menjadi merah atau ungu menunjukkan adanya senyawa triterpenoid (Harbone. 2 = coklat. Tingkat perubahan warna kayu ditetapkan berdasarkan sistem skor (0 = putih. Bila terdapat pengaruh nyata dari perlakuan yang diamati maka setiap taraf perlakuan 100 . Kayu di sekitar titik inokulasi dipahat. 1 = agak wangi. 1987). Pada endapan ditambahkan 1 ml dietil eter pekat. Daerah yang menunjukkan perubahan warna kayu dari putih menjadi coklat-kehitaman diambil dengan dipahat dan dibawa ke laboratorium untuk pengamatan selanjutnya.

Efektivitas Inokulan dalam Menginduksi Gejala Pembentukan Gubal Gaharu Secara umum semua perlakuan menyebabkan perubahan warna kayu dan merangsang munculnya perubahan aroma kayu (Tabel 1).39 0.90b 1.14a 3. Pemberian gula menyebabkan gejala pembentukan gubal gaharu menjadi tertekan... Efektivitas inokulan tunggal maupun ganda Acremonium dan Fusarium relatif lebih tinggi dalam merangsang pembentukan gejala gubal gaharu dibandingkan dengan metode induksi lainnya. Tabel 1.12 Titik induksi wangi (%) 1.Efektivitas dan Interaksi .. AF lebih efektif dalam menginduksi pembentukan wangi daripada FA dan inokulan tunggal.00 6.18a Wangi (skor) Titik induksi agak wangi (%) 34.75b 2.70a 0.54ab 3.63ab 0.16 0.83a Warna (skor) 1..94a 0.59ab 101 . inokulan ganda lebih efektif. Gejala pembentukan gubal akibat inokulan ganda juga cenderung tidak berbeda nyata dari inokulan tunggalnya.82a 0.87a 0. Pembentukan gejala gubal gaharu hasil inokulasi cendawan tunggal dan ganda Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Inokulan tunggal Inokulan ganda AA FF AF FA 2. dkk.62ab 0.20a 3. HASIL A. Sedangkan pada parameter lainnya.(Gayu Rahayu.55 20.07 39.45c 1. AF justru lebih baik. Di antara inokulan ganda.37 31. Berdasarkan persentase titik induksi pada kategori wangi. Sebagai inokulan tunggal A dan F memiliki efektivitas yang relatif sama.) dibandingkan dengan menggunakan uji lanjut Duncan pada taraf 5%.30a Lebar (cm) 0.24 4.

Aspek PRODUKSI

Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Kontrol positif Kontrol negatif
*

Lebar (cm) 0,55b 0,73ab 0,00c

Warna (skor) 1,02d 1,16d 0,00e

Wangi (skor)

Titik induksi agak wangi (%) 10,41 11,11 0,00

Titik induksi wangi (%) 0,00 0,00 0,00

G B K

1,86b 2,87ab 0,00c

0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Kayu mengalami perubahan warna dari putih menjadi coklat atau coklat kehitaman (Gambar 1). Pemberian inokulan tidak berpengaruh pada panjang dan lebar zona perubahan warna. Namun panjang zona perubahan warna tertinggi terjadi berturut-turut pada kayu yang diberi perlakuan ganda FA dan AF. Sedangkan tingkat perubahan warna dipengaruhi oleh inokulan. Tingkat perubahan warna tertinggi pada FA dan berbeda nyata dari perlakuan lainnya.

Pemberian inokulan juga tidak berpengaruh nyata terhadap pembentukan wangi. Berbeda dengan perubahan warna kayu, tingkat wangi tertinggi terjadi pada kayu yang diberi inokulan ganda AF. Secara rataan nilai tingkat wangi yang terbentuk dari hasil perlakuan inokulan termasuk dalam kategori tidak wangi, Meskipun demikian, pemberian inokulan meningkatkan persentase titik induksi yang wangi. Bahkan inokulan tunggal AA dan inokulan ganda menghasilkan titik induksi pada kategori wangi (Tabel 1).

a

b

c

d

Gambar 1. Perubahan warna kayu dengan tingkat kegelapan yang berbeda dari (a) intensitas terendah sampai (d) intensitas tertinggi

102

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Periode induksi berpengaruh pada semua parameter pembentukan gubal kecuali panjang zona perubahan warna (Tabel 2). Secara umum, nilai parameter pembentukan gubal tertinggi terjadi pada bulan ke-2, kecuali tingkat perubahan warna. Pada bulan ke-2 induksi, intensitas warna cenderung naik, tapi intensitas warna kayu pada bulan ke-4 relatif sama dengan bulan ke-3.
Tabel 2. Pengaruh periode induksi pada gejala pembentukan gubal gaharu
Rataan* Perubahan warna kayu Bulan Panjang (cm) 1 2 3 4
*

Lebar (cm) 0,68a 0,71a 0,65b 0,65b

Tingkat (skor) 0,83c 1,24b 1,67a 1,65a

Wangi (skor)

Titik induksi agak wangi (%) 8,43 39,47 17,45 18,45

Titik induksi wangi (%) 0,00 0,00 0,00 6,74

2,46ab 2,58a 2,32ab 2,26b

0,32c 0,64a 0,51b 0,36c

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

B. Interaksi Inokulan 1 dan Inokulan 2
Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2 (Tabel 3). Inokulasi F sebelum inokulasi A tidak mempengaruhi pembentukan gejala gubal pada titik A termasuk pembentukan wangi. Kehadiran F justru cenderung meningkatkan respon perubahan warna kayu akibat inokulasi A. Demikian pula inokulasi A sebelum F tidak mempengaruhi pembentukan gejala gubal pada titik F, kecuali warna pada F menjadi lebih gelap dan persentase titik induksi yang wangi relatif lebih tinggi dibandingkan dengan inokulan tunggalnya. Inokulan ganda AF dan FA menghasilkan masing-masing 8,33% titik induksi pada kategori wangi. Infeksi sekunder juga tidak secara konsisten mempengaruhi infeksi primer (Tabel 4). Inokulasi F sebelum inokulasi A cenderung tidak mempengaruhi pembentukan gejala gubal termasuk tingkat

103

Aspek PRODUKSI

wangi, kecuali pada perubahan warna kayu. Intensitas warna pada titik induksi F lebih baik dibandingkan dengan perlakuan tunggalnya. Infeksi kedua oleh F juga cenderung tidak mempengaruhi gejala pembentukan gubal dan tingkat wangi. Infeksi sekunder oleh cendawan yang sama dengan cendawan tidak berpengaruh pada pembentukan gejala gubal (Tabel 5). Meskipun demikian, secara umum nilai parameter gejala gubal pada titik infeksi sekunder lebih rendah daripada pada titik infeksi primernya. Inokulan A dan F memiliki potensi yang relatif sama dalam merangsang pembentukan wangi.
Tabel 3. Pengaruh inokulan 1 terhadap inokulan 2 dalam gejala pembentukan gubal gaharu
Rataan* Perla-kuan Perubahan warna kayu Panjang (cm) FAa AAa AFf FFf GGg BBb KKk
*

Lebar (cm) 0,71bcd 0,66bcd 0,83abcd 0,75abcd 0,53d 0,65cd 0,00e

Warna (skor) 2,15ab 1,82bc 1,57cd 1,36de 1,02e 1,13e 0,00f

Wangi (skor) 0,60ab 0,63ab 0,70a 0,62ab 0,38c 0,47bc 0,00d

Titik induksi agak wangi (%) 26,37 36,11 40,27 27,78 0,00 0,00 0,00

Titik induksi wangi (%) 8,33 0,00 8,33 0,00 0,00 0,00 0,00

2,73abc 1,96bc 2,52abc 2,61abc 1,75c 2,40abc 0,00e

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 4. Pengaruh infeksi sekunder dengan cendawan yang berbeda dari cendawan penginfeksi primer
Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,68ab 3,87a Lebar (cm) 0,99ab 0,95abc Warna (skor) 1,53cd 2,22a Wangi (skor) Titik induksi agak wangi (%) 34,37 13,89 Titik induksi wangi (%) 0,00 0,00

FFF FAF

0,62ab 0,50bc

104

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,13abc 3,88a 1,98bc 3,35abc 0,00d Lebar (cm) 0,96abc 1,06a 0,56d 0,80abcd 0,00e Warna (skor) 1,98ab 1,93ab 1,01e 1,20de 0,00f Wangi (skor) Titik induksi agak wangi (%) 32,63 38,86 20,83 13,89 0,00 Titik induksi wangi (%) 2,78 4,15 0,00 0,00 0,00

AAA AFA GGG BBB KKK
*

0,63ab 0,70a 0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 5. Pengaruh infeksi sekunder cendawan yang sama dengan cendawan penginfeksi primernya
Rataan* Perlakuan Panjang (cm) 3,13abc 1,96bc 3,68ab 2,61abc Lebar (cm) 0,96abc 0,66bcd 0,99ab 0,75abcd Warna (skor) 1,98ab 1,82bc 1,53cd 1,36de Wangi (skor) 0,63ab 0,63ab 0,62ab 0,61ab Titik induksi agak wangi (%) 32,63 36,11 34,37 27,78 Titik induksi wangi (%) 2,78 0,00 0,00 0,00

AAA AAa FFF FFf
*

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

C. Pembentukan Senyawa Terpenoid
Senyawa terpenoid terdeteksi pada semua perlakuan. Pada perlakuan tunggal FF dan gandanya terbentuk warna merah, yang menunjukkan adanya senyawa triterpenoid. Warna merah pada minyak gaharu dijadikan sebagai pembanding kandungan triterpenoid perlakuan. Pada ekstrak kayu B, G, dan inokulan A terbentuk warna hijau. Warna hijau ini menunjukkan adanya senyawa sterol (Harborne, 1987). Sedangkan pada K tidak terbentuk

105

06* 0. Tabel 6.06* 0.15* 0.14* 0. Hal ini menunjukkan bahwa pemberian inokulan 2 tidak mempengaruhi besarnya nilai absorban inokulan 1.45* 0. perlakuan tunggal FF terbentuk endapan merah dan memiliki nilai absorbansi yang relatif tinggi.12* 0. ** Endapan berwarna merah-kecoklatan 106 .27* 0.12** 0.11** 0. secara umum nilai absorban perlakuan inokulan ganda hampir sama dengan inokulan tunggal (Tabel 6).14** 2 0 0.22* 0. Pada 3 bsi. nilai absorbansi ekstrak terpenoid hasil perlakuan kurang dari nilai absorbansi minyak gaharu (0.Aspek PRODUKSI warna (bening).23** 0.11* 0.813) sebagai pembandingnya.25* 0. Selain itu.12** 0.23** 0.34* 0. Hal ini menunjukkan bahwa pada K tidak terdapat senyawa triterpenoid maupun sterol.39* 0.25** 4 0 0. Hal ini menunjukkan bahwa inokulan ganda tidak efektif dalam meningkatkan kandungan senyawa terpenoid.21* 0.20** 0. Nilai absorbasi ekstrak kayu gaharu yang berubah warna Perlakuan K G B AF A AF F FA F FA A AA FF Bulan ke1 0 0.29* 0.19** 0.23* 0.15* * Endapan berwarna hijau. Kandungan senyawa triterpenoid pada zona perubahan warna bervariasi pada setiap perlakuan selama 4 bsi (Tabel 6). Hal ini menunjukkan kandungan triterpenoid yang relatif tinggi pula (Tabel 6). Secara umum.06* 3 0 0. Inokulan AF maupun FA juga tidak mempengaruhi kandungan terpenoid.24* 0. Begitu pula dengan nilai absorban inokulan 1 yang tidak dipengaruhi oleh inokulan 2.20** 0.20* 0.12** 0.40* 0.05* 0.

(Gayu Rahayu. Fotosintat sebagai sumber karbon dalam pembentukan metabolit sekunder antimikrob pun terganggu. larutan gula. dan Fusarium sp. Selain itu. karena kemungkinan sumber karbon lebih diutamakan untuk pembentukan tunas baru.Efektivitas dan Interaksi . Tajuk-tajuk pohon menjadi gundul.. menyebabkan perubahan warna kayu dari putih menjadi gelap. Efektivitas Induksi Pohon-pohon yang diberi perlakuan menurun kebugarannya mulai 1 bsi. Pada akhirnya. Caruso and Kuc (1977) menyatakan bahwa Colletotrichum lagenarium menyebabkan klorosis pada daun tanaman semangka dan muskmelon. tetapi klorosis hampir memenuhi luasan helai daun. Sebelumnya. jumlah daun yang mengalami klorosis tidak berbeda dengan 1 bsi. Pelukaan. di New Zealand. berasosiasi dengan gejala perubahan warna kayu dan dicline pada Quercus sp. (1997) juga menyatakan bahwa perubahan warna kayu menjadi warna coklat (browning) dapat disebabkan oleh serangan patogen (cendawan) 107 . adanya inokulan juga menjadi penyebab klorosis. Menurut Braithwaite (2007) Acremonium sp. Pohon semakin merana ketika diserang ulat. karena daun merupakan tempat utama berlangsungnya fotosintesis. Secara umum inokulan tunggal mengakibatkan klorosis pada daun-daun di dua cabang dekat lubang induksi. pada pohon kontrol daun-daun tidak mengalami klorosis sampai akhir pengamatan. Klorosis mungkin berhubungan dengan ketersediaan hara. Penurunan kebugaran ditunjukkan oleh adanya daundaun yang mengalami klorosis pada cabang pertama dan kedua dari daerah lubang induksi dan kemudian daun-daun ini gugur.) PEMBAHASAN A. Perubahan warna kayu terjadi pada semua perlakuan.. Walker et al. Sedangkan pada pohon yang diberi inokulan ganda klorosis terjadi pada tiga cabang dekat lubang induksi. Berkurangnya jumlah daun secara drastis dapat menghambat proses fotosintesis. Ketersediaan hara terganggu karena jalur distribusinya ke daun terhambat akibat pengeboran. dkk. Berbeda dengan daun-daun pada pohon perlakuan. perkembangan gejala pembentukan gubal pun terganggu. Pada 2 bsi. inokulasi Acremonium sp. dan Fusarium sp...

Periode inkubasi cenderung mempengaruhi semua parameter gejala gubal gaharu. Senyawa wangi merupakan senyawa yang mudah menguap sehingga kemungkinan besar tergolong senyawa seskuiterpenoid. Aroma wangi dan frekuensi wangi pada pemberian inokulan ganda AF relatif lebih tinggi dibandingkan dengan perlakuan lainnya. Pada penelitian ini senyawa triterpenoid dan sterol juga terdeteksi. Perubahan warna kayu pada gaharu mungkin dapat mengindikasi adanya senyawa gaharu. Namun. Namun demikian metabolisme isopentenil pirofosfat sebagai pekursor pembentukan terpenoid (McGarvey and Croteau. Sedangkan pada parameter lainnya. perubahan warna kayu menjadi coklat muncul setelah sel-sel kehilangan pati akibat pelukaan. Hal ini didukung oleh pernyataan Rahayu dan Situmorang (2006). Hal ini disebabkan karena gula tersebut segera dipergunakan pohon untuk proses penyembuhan daripada dimanfaatkan oleh cendawan.Aspek PRODUKSI dan kerusakan fisik. Aroma wangi merupakan bagian dari senyawa gaharu (Rahayu et al. 2007). nilai tertinggi diperoleh pada bulan ke-2 induksi. Semakin lama periode induksi semakin gelap warna kayu. Pemberian larutan gula (G) menekan perkembangan gejala pembentukan gubal gaharu. Berdasarkan persentase titik induksi yang wangi. Hal ini menunjukkan bahwa metabolisme terpenoid dapat berlangsung terus dan berakhir pada produk selain seskuiterpenoid ketika dipanen. inokulan ganda lebih baik dari inokulan tunggal maupun cara induksi lainnya. Kemungkinan besar fenomena ini berhubungan dengan kebugaran pohon yang menurun mulai bulan ke-2. 2007). Hal ini membuktikan bahwa wangi merupakan respon spesifik terhadap bentuk gangguan (Rahayu et al. intensitas warna kayu lebih rendah dibandingkan 108 .. bahwa perubahan warna dari putih menjadi coklat-kehitaman merupakan gejala awal terbentuknya senyawa gaharu. 1995) mungkin tidak berhenti pada produk seskuiterpenoid tetapi dapat masuk dalam jalur metabolisme selanjutnya. Menurut Nobuchi and Siripatanadilok (1991). Aroma wangi mulai terdeteksi pada bulan ke-2 dan menurun pada bulan berikutnya..

dan inokulan tunggal AA terbentuk warna hijau. Kemungkinan besar hal ini disebabkan aktivitas patologis yang berbeda. Putri (2007) juga menyatakan bahwa pemberian Acremonium sp. Kemungkinan lain adalah periode inokulasi antara inokulan 1 dan inokulan 2 yang hanya berselang 1 minggu. Hal ini berbeda dari hasil penelitian Krokene et al. crassna terbukti dapat merangsang pembentukan senyawa terpenoid. Acremonium dan Fusarium dikenal sebagai penyebab busuk batang atau kanker batang pada pohon berkayu. Pada penelitian ini triterpenoid mulai terdeteksi pada 1 bsi.. Triterpenoid terdeteksi pada pemberian inokulan tunggal FF dan inokulan ganda yang ditunjukkan dengan terbentuknya endapan berwarna merah pada pengujian Lieberman-Burchard. pada A. (1997) menyatakan bahwa serangan cendawan pada pohon Pinus akan merangsang pohon untuk membentuk senyawa terpenoid sebagai pertahanan pohon. polonica terbentuk SAR setelah 3 minggu infeksi H. G. polonica. Hal ini menunjukkan bahwa aroma wangi yang dihasilkan tidak selalu sebanding dengan intensitas warna kayu. Heterobasidion juga menyebabkan busuk batang tetapi C. dalam bentuk inokulan tunggal atau inokulan ganda dapat merangsang pohon gaharu membentuk senyawa terpenoid. Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2.(Gayu Rahayu.Efektivitas dan Interaksi . Krokene et al. (1999) yang membuktikan bahwa inokulasi Heterobasidion annosum yang diikuti oleh Ceratocystis polonica menekan pembentukan gejala bluestain pada pohon Norway spruce (Picea abies). Paine et al.. Pembentukan Senyawa Gaharu Acremonium sp. (1999) bahwa terjadinya pembentukan wangi gaharu tidak selalu diikuti oleh perubahan warna kayu. B. Sedangkan pada perlakuan B. abies) terhadap C. polonica adalah penyebab bluestain saja dan tidak menyebabkan busuk batang. Selain itu penelitian sebelumnya.) dengan pemberian inokulan ganda FA. (1999) menyatakan bahwa pada Norway spruce (P. dkk. Sesuai dengan pernyataan Rahayu et al. annosum. dan Fusarium sp.. Heterobasidion mungkin merangsang pohon membentuk senyawa fitoaleksin yang bersifat anti C.. 109 .

kecuali inokulan tunggal A merangsang pohon membentuk triterpenoid. Soc. L. 110 . Bandung Terjemahan dari: Phytochem Methods.Aspek PRODUKSI Warna hijau ini mengindikasikan yang terbentuk adalah senyawa sterol.. R. Padmawinata K dan I Sudiro (penerjemah).D. Waipara. M.A.. E. Franceschi. Protection of Watermelon and Muskmelon Against Colletotrichum lagenarium by Colletotrichum lagenarium. P. D. SIMPULAN Semua pohon yag diinokulasi menurun kebugarannya sejak 1 bulan setelah inokulasi. J. 1987.L. Phytopathol. DAFTAR PUSTAKA Benhamou. A. Metode Fitokimia. Semua inokulan.A. Inglis. Berryman. 67: 1285-1289. Amer. Dick. Kuc. Induced Resistance to Phatogenic Fungi in Norway Spruce.L. Quéré. M. Investigation of Oak Tree Decline In Theauckland Region. Beever. BacterialMediated Induced Resistance in Cucumber: Beneficial Effect of the Endophytic Bacterium Serratia plymuthica on the Protection Against Infection by Pythium ultimum. N. Inokulan ganda terutama AF lebih efektif daripada inokulan tunggal dalam merangsang pembentukan wangi. T.F. V.W. 1999. Ramsfield. N. F.R. Plant Physiol. New Zealand Plant Protection 60:297-303 Caruso. Christiansen. Dehbi. Solheim... Braithwaite. Pay and C. Harborne (1987) menyatakan bahwa sterol merupakan salah satu senyawa yang tergolong ke dalam senyawa terpenoid. 2000.B. Institut Teknologi Bandung. 2007. Induksi dengan inokulan 1 yang hanya berselang 1 minggu dari pemberian inokulan 2 tidak membangkitkan resistensi pohon terhadap inokulan 2. 121: 565-569. J. Harbone. Phytopathol. Gagné. 90(1): 45-56. 1977. C. S. H.M. J.E. Hill. Krokene.

Purwokerto. McGarvey. Pembentukan Gaharu dengan Cara Inokulasi. Rahayu. 11-12 Maret 1996.. 42:179-206. S. Paine.C. L.. Bogor.L. Phytopathol. Forest 63:226-235. J. Institute de Biologie Végétale. 1997. T. 85:1064-1068. 1991. T. 111 . Nobuchi. S. dkk.) Liu. Systemic Acquired Resistance. 2008.. Université de Fribourg. Rev. 3 route A Gockel. Increasing Fragrance and Terpenoid Production in Aquilaria crassna by Multi-Application of MethylJasmonate Comparing to Single Induction of Acremonium sp. Acremonium and MethylJasmonate Induce Terpenoid Formation in Agarwood Tree (Aquilaria crassna). 22-24 August 2007. 16-18 September 1999.P.. 1996.W. Potensi Hifomiset dalam Menginduksi Pembentukan Gubal Gaharu.. 1995. Entomol. Santoso.J. L. 1999. 1995. Prosiding Kongres Nasional XV dan Seminar Perhimpunan Fitopatologi Indonesia. D. Induction of Systemic Resistance in Cucumber by Plant Growth-Promoting Rhizobacteria: Duration of Protection and Effect of Host Resistance on Protection and Root Colonization. Métraux. their Associated Fungi. Purwokerto. Sticher. Umboh. Pusat Litbang Hutan dan Konservasi Alam. Putri dan Juliarni.F. and Host Conifers. Bull.D. Makalah dipresentasikan dalam 3rd Asian Conference on Crop Protection.(Gayu Rahayu. hlm 573-581.. Rahayu. 1997. and F..I. J. Hlm 1-3. K. Rahayu. Kloepper. Annu. Croteau. G. Kyoto Univ. 1700 Fribourg. T. Siripatanadilok. Tuzun. Raffa. Harrington. Preliminary Observation of Aquilaria crassna Wood Associated with the Formation of Aloeswood.. G.J. E. G. Perhimpunan Fitopatologi Indonesia. B. Switzerland.Efektivitas dan Interaksi . Yogyakarta. Interactions Among Scolytid Bark Beetles. M. 2007. Jakarta.. Plant Cell 7:1015-1026. Mauch-Mani. 11-12 November 2008. Y.. A. Makalah Diskusi Hasil Penelitian dalam Menunjang Pemanfaatan Hutan yang Lestari. Makalah dipresentasikan dalam International Conference on Microbiology and Biotechnology. Isnaini. Terpenoid Metabolism.

112 .

Aspek SILVIKULTUR 113 .

114 .

Konsekuensinya. 2001. gaharu harus dihasilkan dari pohon hasil budidaya. Akibatnya populasi jenis-jenis gaharu menyusut tajam. kurang dari 5% gaharu terbentuk dari populasi pohon dan bila terbentuk biasanya kurang dari 10% biomas kayu pada pohon yang terinfeksi. Cylindrocarpon sp. 1987). Namun gaharu alam dapat mencapai kualitas tertinggi (kelas super) yang harganya bisa mencapai Rp 30 juta/kg.5 UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto.. Erdy Santoso.. Trichoderma sp. Pythium sp. sehingga jenis ini dimasukkan dalam Appendix II CITES (Santoso et al. Di alam... Parman et al. 1996. 2007.. (Santoso et al. 2007).. Budidaya gaharu memerlukan input iptek agar pertumbuhan dan produksi resin gaharu dapat optimal. melainkan ditujukan untuk menghasilkan resin gaharu yang terbentuk dari respon tanaman atas infeksi mikroba. Karena potensi harga yang sangat tinggi. dan Popullaria sp. bukan dari alam. Sidiyasa dan Suharti... dalam perdagangan resmi. Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Pengembangan tanaman gaharu umumnya tidak bertujuan untuk menghasilkan kayu. Dukungan iptek dimaksud 115 . Phialophora sp. eksploitasi gaharu alam dilakukan tanpa mengindahkan kelestariannya. khususnya jamur Fusarium sp. Daijo and Oller.

Perlakuan pada uji penyimpanan benih adalah waktu (0. METODE A. malacensis. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. Benih pohon penghasil gaharu yang digunakan pada uji penyimpanan dan daya kecambah benih adalah campuran Aquilaria microcarpa dan A. Perlakuan pada uji waktu simpan bibit cabutan adalah tiga waktu simpan (1. 4. Pembahasan makalah ini difokuskan pada aspek pembibitan atau perbanyakan bibit pohon penghasil gaharu. Penerapan perbanyakan vegetatif dan pemuliaan pohon berpotensi untuk menghasilkan bibit klon gaharu yang memiliki keunggulan. Proyek ITTO PD 425/06 berupaya untuk mengembangkan dan menerapkan iptek pada penanaman pohon penghasil gaharu agar pertumbuhan dan produktivitas resin gaharunya tinggi. Perbanyakan bibit pohon penghasil gaharu dapat dilakukan. malacensis asal Sukabumi. 1980).Aspek SILVIKULTUR berkaitan dengan aspek pembibitan dan penyuntikan stimulan gaharu. baik pertumbuhan maupun produktivitas resin gaharunya. dan 8 minggu) dan temperatur penyimpanan (25.1oC dan 4. Namun informasi iptek mengenai teknik perbenihan dan teknik perbanyakan vegetatif gaharu masih sangat terbatas. dan 3 hari penyimpanan) serta kondisi penyapihan (dalam sungkup dan tanpa sungkup). Biji rekalsitran umumnya cepat berkecambah dan tidak dapat disimpan dalam jangka panjang (Roberts and King. 1960). Bibit cabutan yang digunakan dalam uji waktu simpan cabutan adalah campuran Aquilaria microcarpa dan A. 2. baik secara generatif maupun vegetatif. 116 . 2.4-26.9-6.5oC). 6. Perbanyakan Generatif Pengujian pada perbanyakan generatif dilakukan pada benih (biji) dan cabutan (anakan alam). Makalah ini menyajikan hasil penelitian berkaitan dengan aspek perbenihan dan perbanyakan stek gaharu. Biji pohon penghasil gaharu tergolong rekalsitran (Hou.

2007).) B. Uji produksi bibit stek gaharu dilakukan dalam tiga tahap. sehingga harus secepatnya dikecambahkan. media menggunakan campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 1:1 dan intensitas penyiraman 1 kali pada bulan pertama.. yaitu media campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 2:1. dan 3 kali pada bulan ketiga. Perbanyakan Generatif Biji gaharu tergolong rekalsitran.0993).(Atok Subiakto. Penelitian dilakukan pada rumah kaca yang menggunakan sistem pendingin kabut KOFFCO system (Sakai dan Subiakto. Bahan stek yang digunakan pada pengujian ini adalah A. Uji penyimpanan benih dilakukan untuk mengetahui seberapa lama benih gaharu dapat disimpan.. Secara teknis pengecambahan biji gaharu mudah dilakukan. Subiakto dan Sakai. Persen kecambah dari hasil uji lain pihak. HASIL DAN PEMBAHASAN A. Perlakuan pada pengujian pertama menggunakan prosedur rutin. Hasil uji pengecambahan biji dari dua kondisi penyimpanan disajikan pada Tabel 1 dan Tabel 2. Di Tabel 1.. Kondisi penyimpanan (kondisi ruang dan dalam re-frigerator) tidak secara nyata mempengaruhi perkecambahan benih (P Anova = 0. Pada pengujian kedua perlakuan intensitas penyiraman dikurangi menjadi sekali seminggu dengan media arang sekam. Pada pengujian ketiga. media tabur dapat menggunakan arang sekam Langsung 2 minggu 4 minggu 6 minggu 8 minggu 82 69 77 56 48 69 69 61 24 117 .. malacensis.0001). periode penyimpenyimpanan biji panan mempengaruhi persen Periode Kondisi Refrigerator kecam-bah benih (P Anova = < simpan ruang (%) (%) 0. 2 kali pada bulan kedua. dkk. Perbanyakan Vegetatif Teknik perbanyakan vegetatif yang digunakan pada penelitian ini adalah teknik stek pucuk. Penyiraman 2 kali seminggu.Uji Produksi Bibit . 2007.

Pada jenis gaharu penyimpanan pada kondisi ruang selama 2 bulan masih dapat menghasilkan kecambah dengan tingkat keberhasilan 48%. Persen jadi bibit (6 minggu setelah penaburan) dari hasil uji dimulai pada minggu kedua penyim-panan biji dan persen jadi bibit dihitung pada minggu keenam setelah Periode Kondisi Refrigerator penaburan. Dalam pengujian ini media kecambah yang digunakan adalah arang sekam padi. Hasil uji penanaman 3 76 38 cabutan disajikan pada Tabel 3.4 minggu 64 58 annya cenderung lebih besar 6 minggu 37 48 bila bibit disimpan dalam 8 minggu 29 9 jangka waktu yang lebih lama. Penurun. Pada Tabel 2 simpan ruang (%) (%) tampak ada penurunan antara Langsung 74 persen berkecambah dan 2 minggu 50 54 persen jadi bibit. Oleh sebab itu untuk mendapatkan persen jadi bibit yang tinggi. Umumnya bibit cabutan yang masih memiliki kotiledon dapat langsung ditanam dalam kantong plastik tanpa penyungkupan. Perbanyakan generatif Tabel 3. 118 .0001). Pada jenis-jenis biji rekalsitran seperti meranti. Persen tumbuh bibit cabutan dari uji penyimpanan dan dapat pula dilakukan dengan kondisi tanam bibit menggunakan bibit yang diperoleh dari cabutan di Periode Dalam Tanpa bawah pohon induknya. Penggunaan sungkup meningkatkan secara nyata persen tumbuh bibit cabutan (P Anova = < 0. pengecambahan harus dilakukan segera setelah pengunduhan buah. Pasimpan sungkup (%) sungkup (%) (hari) da pengujian penanaman 0 80 40 cabutan digunakan bibit 1 76 46 gaharu berukuran tinggi 2 87 24 7 cm. Perkecambahan umumnya Tabel 2.Aspek SILVIKULTUR atau zeolit. penaburan biji dilakukan segera setelah buah yang masak dan jatuh. kotiledonnya telah luruh.

Media terbaik adalah zeolit. Subiakto dan Sakai.(Atok Subiakto. 2002). Teknologi ini mengatur kondisi lingkungan. Pada tahap pertama digunakan prosedur baku pembuatan stek. yaitu cahaya. pasir. Ratarata persen jadi stek pada uji tahap pertama berkisar antara 4047%. dkk. Perbanyakan Vegetatif Uji produksi stek gaharu dilakukan dengan menggunakan teknologi KOFFCO system yang dikembangkan oleh Badan Litbang Kehutanan dan Komatsu (Sakai dan Subiakto. Pada pengujian tahap kedua. dan media pada tingkat optimal bagi pertumbuhan (Sakai et al. 2007). maka penanaman bibit cabutan harus melalui tahap penyungkupan. Pembuatan stek dinilai dapat diusahakan secara ekonomis bila persen jadi mencapai 70% (Subiakto dan Sakai. Hasil uji produksi stek gaharu disajikan pada Tabel 4.8276) dalam persen jadi stek. Penyimpanan bibit cabutan selama tiga hari masih memberikan hasil yang cukup baik (76%) bila penanamannya menggunakan sungkup.. penyungkupan harus rapat agar kelembaban dalam sungkup dapat dijaga pada level di atas 95%. Zeolit merupakan media dengan porositas yang baik dan tidak ditumbuhi oleh cendawan 119 . 2007. maka dilakukan pengujian lebih lanjut. Demikian pula perlakuan wadah tanam tidak menunjukkan perbedaan nyata (P Anova = 0.. adapun perlakuan yang diuji adalah tiga jenis media (arang sekam padi. Sungkup dapat dibuat dari plastik PVC transparan. temperatur..) Namun bila kotiledon telah luruh. namun persen berakar masih di bawah 70%. Perlakuannya adalah jenis dan wadah tanam (tabur) stek..Uji Produksi Bibit . Uji produksi stek dilakukan dalam tiga tahap penelitian. penyiraman dikurangi menjadi satu kali seminggu. 2007). Mengingat persen jadi stek masih di bawah 70%. Perlakuan jenis tidak menunjukkan perbedaan nyata (P Anova = 0. kelembaban. B. Hasil pengujian ini membuktikan bahwa kelembaban tinggi di dalam sungkup mempengaruhi keberhasilan penanaman bibit cabutan. dan zeolit).6600) dalam persen jadi stek.0083) terhadap persen jadi stek.. Hasil pengujian menunjukkan media berpengaruh secara nyata (P Anova = 0.

crassna A. Tabel 4. dan 3 kali seminggu). 2 kali seminggu. Perlakuan yang diuji adalah tingkat penyiraman (1 kali seminggu. microcarpa Campuran A. siram 1 kali seminggu Media zeolit. siram 3 kali seminggu. media coco-peat : sekam = 2:1 Media sekam bakar. siram 3 kali seminggu. siram 1 kali seminggu Media cocopeat : sekam = 1:1. microcarpa Campuran A. microcarpa Campuran A. Penyiraman terbaik adalah dua kali seminggu dengan persen berakar 69%. penyiraman berpengaruh secara nyata terhadap persen berakar stek (P Anova = 0. siram 1 kali seminggu Media cocopeat : sekam = 1:1. crassna A. maka perlu dicoba media lain yang memiliki tingkat porositas relatif sama dengan zeolit. siram 3 kali seminggu Persen berakar (%) 40 42 44 47 17 31 55 53 69 49 120 . Karena zeolit adalah media yang berat dan relatif lebih mahal. Hasil pengujian menunjukkan bahwa pada tingkat kepercayaan 5%. siram 2 kali seminggu Media cocopeat : sekam = 1:1. crassna dan A. siram 1 kali seminggu Media pasir. Pada pengujian ketiga digunakan media campuran cocopeat dan sekam padi yang telah disteril. microcarpa Campuran A. crassna dan A. crassna dan A. microcarpa Campuran A.0210). crassna dan A. microcarpa Perlakuan Tanpa pot-tray. media coco-peat : sekam = 2:1 Dengan pot-tray. siram 3 kali seminggu. microcarpa Campuran A. crassna dan A. media coco-peat : sekam = 2:1 Dengan pot-tray. crassna dan A.Aspek SILVIKULTUR ataupun alga. microcarpa A. termasuk cendawan pembusuk. Persen berakar stek dari rangkaian uji produksi stek Tahapan riset 1 1 1 1 2 2 2 3 3 3 Spesies A. media coco-peat : sekam = 2:1 Tanpa pot-tray. Efek dari penyiraman adalah menyebabkan jenuhnya media dan meningkatkan pertumbuhan cendawan. siram 3 kali seminggu.

H. Walter-Noodhoff. C. Subiakto. Pedoman Pembuatan Stek Jenisjenis Dipterokarpa dengan KOFFCO System.J. ed). Mataram. Turjaman. and A. dan M. 6. Subiakto. Hou. IV-5 : 499-509. Oller. Santoso. Benih gaharu tidak perlu disimpan dalam refrigerator. DAFTAR PUSTAKA Daijo. Sakai. C. E.. dkk. Penanaman bibit cabutan menggunakan sungkup menghasilkan persen tumbuh lebih baik dibandingkan bila tidak menggunakan sungkup. A. Nuroniah. A. Badan Litbang Kehutanan. J. 1-15. Mass Propagation Method from The Cutting of Three Dipterocarps Species. S.html (diakses : 5 Febuari 2001). Series I. Thymelaceae. Rahman. dan N. Studi Etiologi Gubal Gaharu Pada Tanaman Ketimunan. Gunawan.. 2001. Mulyaningsih.yahoo... dan Y. Pen. 121 . J. D. Groningen. Komatsu. 7:73-80. Parman. Penyiraman terbaik dilakukan dua kali dalam seminggu.G. T. com/scent-of-earth/alag. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil Gaharu Aquilaria microcarpa. cukup disimpan pada suhu ruangan. 2002. V.(Atok Subiakto. The Netherland. Res.. W. 2007. In : Flora Malesiana (Van Steenis. Pembuatan stek gaharu tersebut dilaksanakan pada rumah kaca dengan KOFFCO system. Kamata.Uji Produksi Bibit . A. 2007. Media terbaik untuk penyetekan gaharu adalah campuran antara serbuk kulit kelapa (cocopeat) dan sekam padi dengan perbandingan 1:1. 2. For. Scent of Earth. 1996.) KESIMPULAN 1. benih masih dapat disimpan selama dua bulan.G. Makalah Temu Pakar Gaharu di Kanwil Dephut Propinsi NTB. Namun dengan mengantisipasi penurunan daya kecambah. Sakai. C. 1960. Persen kecambah terbaik diperoleh dari benih yang langsung dikecambahkan setelah pengunduhan. Htn & KA... JICA.. Vol. p. dan D. Bogor. URL:http://store.

and Roberts. M. A. Tropical Press SDN. Suharti. The Characteristic of Recalcitrant Seeds. E. and E. Makalah Utama Diskusi Pemanfaatan Kayu Kurang Dikenal. Sakai. and M. Jenis-Jenis Tumbuhan Penghasil Gaharu. H. Bogor. Bogor. Malaysia. Mycorrhiza 16 : 459-464. W. 1-5. Subiakto. dan M. eds). dan C. E. 122 . 2006. H. Badan Litbang Kehutanan. Tamai. 1980. Kuala Lumpur. H. 2007.Aspek SILVIKULTUR Sidiyasa. Manajemen Persemaian KOFFCO System. 1987. BHD.. K. Cisarua. Turjaman. King.. Santoso. Y. In : Recalcitran Crop Seeds (Chin. Roberts. F. Komatsu. JICA. Arbuscular Mycorrhizal Fungi Increased Early Growth of Two Timber Forest Product Species Dyera polyphylla and Aquilaria filaria Under Greenhouse Conditions..

sejak November 1994. Di alam. Cara perburuan ini mengancam kelestarian gaharu di habitat alaminya. perburuan gaharu dilakukan secara agresif dan tidak bijaksana. dan minyak esensial untuk kegiatan keagaman. sehingga untuk mencegah punahnya pohon penghasil gaharu. budaya. bahkan kegiatan sehari-hari. bahan aditif minyak wangi. Division of Applied Bioscience. of Ecological Chemistry. Aquilaria 123 . ditebang dan dipanen gaharunya. Pohon penghasil gaharu yang ditemukan dengan ciri-ciri adanya lubang kecil yang disebut lubang semut. DI PERSEMAIAN Irnayuli R. Sitepu Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Yasuyuki Hashidoko Lab. Graduate School of Agriculture.6 APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp. Hokkaido University Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu (dalam Bahasa Inggris dikenal dengan agarwood atau eaglewood) adalah kayu resin yang bernilai komersial tinggi karena digunakan sebagai dupa.

dua genus pohon penghasil gaharu terpenting yang termasuk ke dalam famili Thymelaeaceae (Ordo: Myrtales dan Kelas: Magnoliopsida) telah masuk ke dalam daftar CITES (the Convention on the International Trade in Endangered Species of Wild Flora and Fauna). Gonystylus. Gaharu terjadi melalui proses patogenisitas di mana jenis patogen fungi tertentu menginfeksi jenis pohon tertentu dan sebagai respon terhadap serangan patogen. Upaya peningkatan mutu bibit di persemaian dapat dilakukan dengan pemupukan. Kamboja. yaitu Aetoxylon. pohon menghasilkan metabolit sekunder atau senyawa resin yang menyebabkan bau wangi ketika dibakar. Lain halnya dengan komoditas pertanian yang langsung ditanam di lapangan. dalam Gunn et al. Malaysia. Keberadaan gaharu semakin menipis di alam. Enkleia. Agar ketersediaan produk gaharu dan pohon penghasil gaharu tidak punah dan untuk menjaga kesinambungan produksi gaharu yang lestari. Kedua genus ini ditemukan tumbuh alami di paling tidak 12 negara. produk unik ini juga dapat terjadi pada beberapa genus tanaman lainnya. Filipina. Kegiatan budidaya pohon penghasil gaharu tidak terlepas dari penyediaan bibit yang berkualitas tinggi. Vietnam. perlu upaya budidaya pohon penghasil gaharu.. Appendix II TRAFFIC-CITES-CoP13 Prop. Istilah RPPT digunakan untuk bakteri yang dapat membantu pertumbuhan tanaman melalui 124 .Aspek SILVIKULTUR dan Gyrinops. Thailand. Lao PRD. Myanmar. Budidaya merupakan kunci utama dalam meningkatkan produksi gaharu yang semakin menipis. Butan.49 (2004) mencatat ada 24 spesies yang termasuk genus Aquilaria dan tujuh spesies termasuk ke dalam genus Gyrinops. Indonesia. termasuk Bangladesh. dan Papua New Guinea (Barden et al. seperti bakteri penghuni perakaran yang disebut rhizobakteri pemacu pertumbuhan tanaman (RPPT atau plant growth promoting rhizobacteria). penggunaan biji yang bermutu baik dan inokulasi mikroba yang dapat memacu pertumbuhan. Gaharu hasil budidaya diharapkan akan dapat memenuhi kebutuhan pasokan gaharu untuk ekspor ke negara-negara pemakai. Phaleria. persiapan bibit kehutanan dilakukan mulai di persemaian. Selain ditemukan pada kedua genus di atas. Wikstroemia. 2004).

1995. solubilisasi atau mineralisasi fosfat. Glick. AG. bakteri terlebih dahulu diseleksi secara in vitro untuk 125 . (1986) dalam Ahmad et al. (2006) mengatakan bahwa dalam studi pemanfaatan bakteri penambat nitrogen untuk meningkatkan produksi tanaman. 2006).. dan kinetin. Narula et al.. maka dilakukan penelitian uji aplikasi bakteri penghasil AIA/auksin dalam memacu pertumbuhan bibit penghasil gaharu Aquilaria sp. 1995. kandungan nitrogen pada tanaman yang diinokulasi tidak meningkat secara myata. Lucy et al.. Dalam penelitian ini. Dikatakan bahwa bakteri penghasil hormon pertumbuhan diduga memegang peranan penting dalam memacu pertumbuhan tanaman. giberelin (AG). (2005) melaporkan bahwa Azospirilum brazilance meningkatkan jumlah dan panjang akar lateral. dan sitokinin (berbagai sumber dalam Narula et al. baik secara langsung maupun tidak langsung (Glick. Azospirillum sp. 2006). Di antara mekanisme ini.(Irna R. Sitepu. fitohormon mendapatkan perhatian penelitian karena aplikasi bakteri penghasil fitohormon dilaporkan meningkatkan produksi tanaman inang secara berkesinambungan (Narula et al. dan pencegahan terjadinya serangan patogen tular tanah (Garbaye.Aplikasi Rhizobakteri Penghasil . yaitu asam indol asetat (AIA/auksin). Barbieri et al. sehingga respon peningkatan pertumbuhan tanaman disebabkan oleh mekanisme lain dan bukan nitrogen. Sedangkan Azospirillum chroococcum diketahui dapat memproduksi AIA. 1994. dan diduga adalah produksi fitohormon oleh bakteri penambat nitrogen tersebut.. yang dikenal sebagai bakteri penambat nitrogen. Kokalis-Burelle et al. Sedangkan Pseudomonas putida GR12-2 pada bibit canola meningkatkan panjang akar sampai tiga kali lipat.. Untuk menguji hipotesa ini. Mikroorganisme yang menghuni rhizosfir berbagai macam tanaman umumnya memproduksi auksin sebagai metabolit sekunder sebagai respon terhadap suplai eksudat akar yang berlimpah di zona perakaran. sequestration besi oleh siderofor. sampai saat ini informasi penelitian tentang pemanfaatan bakteri fitohormon untuk tanaman kehutanan di daerah tropis masih terbatas. 2004).. penambatan nitrogen. Mekanisme ini meliputi produksi fitohormon. Namun. misalnya dapat memproduksi tiga jenis fitohormon. di persemaian. membantu proses terbentuknya mikoriza... dkk) mekanisme yang beragam. 2006).

(1991) yang dimodifikasi sebagai berikut: Rhizobakteri ditumbuhkan dalam media agar Winogradsky’s yang dimodifikasi (AWM) yang diberi 100 mg/L L-tryptophan (C 11H 12N 2O 2). Seleksi awal rhizobakteri secara in vitro dilakukan untuk mengetahui kemampuannya dalam memproduksi fitohormon (asam indol asetat-AIA) melalui karakterisasi kualitatif dan kuantitatif. 926F (5 AAACTCAAAGGAATTGACGG 3). dan/atau 1080RM (5 ACGAGCTGACGACA 3). Setelah inkubasi selama 3 hari. dan diinkubasi dalam gelap pada suhu 28°C. 2 (Advantec. (1991)..Aspek SILVIKULTUR mengetahui kapasitasnya sebagai bakteri penghasil fitohormon AIA/auksin. 4. USA) dengan empat pilihan primer. 2. Foste City. Analisa sekuens DNA menggunakan BigDye Terminator v3. yaitu: 1. BAHAN DAN METODE A.2 yang mengandung 1% sukrosa sebagai sumber karbon dan 0.1 cycle (Applied Biosystems. membran dipindahkan dan ditumpuk pada kertas saring berdiameter 55 mm No.3% gellan gum sebagai bahan pemadat (Hashidoko et al. diameter 47 mm. 126 ..45mm. Bakteri Penghasil Fitohormon: Identifikasi. Homologi sekuens ditelusuri dengan menggunakan BLASTN online DNA database in National Center for Bio-technology Information (NCBI). Katakterisasi kualitatif menggunakan metode colorimetric Brick et al. 1112F (5 GTCCCGCAACGAGCGCAAC 3). Karakterisasi in vitro dan Persiapan Inokulum Rhizobakteri diisolasi dari rhizosfir dan rhizoplan bibit atau sapling menggunakan media campuran mineral Winogradsky’s bebas N dengan pH 5. 3. 518R (5 GTATTACCGCGGCTGCTGG 3).6-6. Segera setelah agar diinokulasi rhizobakteri. Toyo Roshi Kaisha Ltd. media ditumpuk dengan membran nitrocellulose berukuran pori 0. Rhizobakteri ini kemudian diidentifikasi secara molekuler mengikuti metode Weisburg et al. 2002).

dan merah tua. Rhizobakteri dikulturkan pada media MW cair yang ditambah dengan 100mg/L L-tryptophan dan diinkubasikan pada suhu 28°C dalam kondisi statis di dalam gelap selama 7 hari. Rhizobakteri yang mampu memproduksi AIA akan membentuk cincin halo warna merah di sekitar koloni. uji lanjutan pada V. Glickmann dan Dessaux (1995) menyatakan bahwa larutan Salkowsky memberikan respon positif tidak hanya terhadap auksin (IAA) melainkan juga terhadap asam indolpirufat dan indoleacetamide. pembentukan warna dibaca pada A665nm. radiata tidak menunjukkan adanya korelasi yang positif antara intensitas kepekatan warna merah dengan laju pertumbuhan tanaman (tinggi dan total panjang akar). Sedangkan karakterisasi AIA secara kuantitatif dilakukan mengikuti metode Narula (2004). Tidak adanya korelasi yang spesifik ini mengindikasikan bahwa kepekatan warna merah bukan merupakan indikasi tingginya kuantitas IAA yang dihasilkan. Namun demikian. Perubahan warna diamati setelah 30 menit kemudian. digunakan juga satu isolat bakteri pemacu asosiasi mikoriza. Kemudian larutan Salkowski ditambahkan pada supernatant kultur rhizobakteri.. Rhizobakteri yang membentuk cincin halo berwarna merah muda sampai merah pekat digunakan untuk uji kuantitatif AIA.. Japan) yang telah direndam sebelumnya dalam larutan Salkowski. 127 . Intensitas warna yang terbentuk. Sitepu. Selain itu. CK8 karena Aquilaria sp. dkk) Tokyo. merah. kemudian dikelompokkan menjadi merah muda.(Irna R. untuk mengetahui kemampuan bakteri dalam membantu terbentuknya asosiasi mikoriza pada bibit Aquilaria sp. diketahui berasosiasi dengan fungi mikoriza arbuskula.5 jam. melainkan diduga merupakan indikasi perbedaan/variasi derifat dari senyawa indol yang dikonversi dari L-triptophan. yaitu Chromobacterium sp. Strain rhizobakteri yang bereaksi positif dengan larutan Salkowski kemudian diuji untuk mengetahui kemampuannya dalam memacu pertumbuhan akar Vigna radiata sebagai tanaman uji. Dari ketiga uji pendahuluan untuk mendapatkan bakteri penghasil AIA. maka dipilih sembilan bakteri (Tabel 1).Aplikasi Rhizobakteri Penghasil .. Setelah 0..

CK26 Sub kelas Proteobacteria Bacilli Proteobacteria Hasil analisa colorimetric AIA Merah Inang Substrat Sta-dium Asal lokasi Dipterocarpus sp. teysmanniana S. dan bobot kering biomassa. setelah itu kultur bakteri agak dikentalkan dengan menambahkan 0. NI: bakteri yang belum teridentifikasi. CK59 bacteria (DQ195914) Dipterocarpus sp. Rizoplan S. CK67 NI CK53 NI CK54 Proteobacteria S. AIA: asam indol asetat 128 . kemudian ditanam dalam polybag yang berisi 500 g media tanah yang tidak steril. teysmanniana Rizoplan Sapling ~1th Bibit~ 6 bln Nyaru Menteng Nyaru Menteng Pembi-bitan UP Nyaru Menteng Serratia sp.5 th NI CK 61 Chromobacterium sp. balangeran S. Bibit ditumbuhkan di rumah kaca dan disiram setiap hari dengan air keran. 1 ml larutan bakteri juga disebarkan di daerah perakaran.5% gellan gum selama 30 menit. Pengamatan dilakukan terhadap tinggi. UP: Universitas Palangkaraya. * isolat mycorrhization helper bacteria. Rizoplan Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Hopea sp. S. Inokulasi Bakteri Fitohormon pada Bibit Aquilaria sp. Informasi bakteri PGPR penghasil fitohormon yang digunakan sebagai inokulum Strain bakteri Stenotrophomonas sp. teysmanniana Rizoplan Rizoplan Rizoplan Merah muda Merah muda Merah muda pupus Merah muda pupus Merah muda pupus Merah tua Merah tua Merah muda Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Burkholderia Proteosp. CK8 (DQ195926) Proteobacteria * Catatan: S: Shorea. H: Hopea. diameter. CK41 Azospirillum sp. CK34 Bacillus sp. Inokulasi dilakukan pada bibit yang berumur 4 minggu dengan cara merendam bibit dalam larutan bakteri selama 30 menit. parviflora Rizoplan Rizoplan Sapling ~1 bln Sapling ~1. Tabel 1. Sel bakteri yang ditumbuhkan pada media cair MW + 100 mg/L L-tryptophan diinkubasi dengan menggoyang selama 3 hari pada suhu 28ºC.Aspek SILVIKULTUR B. CK28 bacteria (DQ195889) Burkholderia Proteosp. Pada saat penanaman.

Warna merah yang terbentuk di sekitar koloni setelah direaksikan dengan reagen Salkowski (a): Pembentukan warna pada membrane nitroselulose 3 hari setelah inkubasi.. USA). Data dianalisa secara statistik dengan analisa sidik ragam menggunakan program SPSS®version 10. indeks mutu bibit. Sitepu. Data yang berbeda nyata diuji lanjut dengan Least Significant Difference untuk mengelompokkan perlakuan yang tidak berbeda nyata. berat kering total.. dan persentase peningkatan pertumbuhan. dkk) a b Gambar 1. Parameter yang diukur untuk mengetahui respon bibit terhadap inokulasi. yaitu tinggi... Chicago. Rancangan Percobaan dan Analisa Data Penelitian menggunakan rancangan acak lengkap dengan faktor tunggal.Aplikasi Rhizobakteri Penghasil . Analisa persentase peningkatan pertumbuhan dilakukan sebagai berikut: %Peningkatan = Bibit yang diinokulasi bibit kontrol Bibit kontrol x 100% 129 . (b): Pembentukan warna pada media cair. yaitu 10 isolat bakteri. diameter. yang masing-masing diulang sebanyak 10 bibit per perlakuan.. Bakteri NICK53 yang membentuk warna merah tua dibanding dengan kontrol media tanpa bakteri C.0 (SPSS Inc.(Irna R.

130 . berkisar antara 12. yaitu Burkholderia sp. Respon yang serupa juga telah dilaporkan oleh Sitepu et al.Aspek SILVIKULTUR HASIL DAN PEMBAHASAN Bibit Aquilaria sp.5 tahun dari arboretum Nyaru Menteng. Dijelaskan bahwa tanaman hutan pertumbuhannya jauh lebih lambat dari tanaman pertanian sehingga untuk pertumbuhan stadium awal di persemaian. netral atau negatif terhadap pertumbuhan tanaman jika dibandingkan dengan tanaman yang tidak diinokulasi (kontrol negatif ).05). (2007) bahwa respon diameter bibit Shorea selanica terhadap inokulasi RPPT tidak konsisten. Kedua bakteri ini berasal dari rhizoplan S. Dua isolat bakteri. teysmanniana umur kurang lebih 1 tahun dan S. Pada habitat hutan yang rimbun dengan kanopi yang bertingkat. CK8 (DQ195926. Semua bibit yang diinokulasi secara signifikan memiliki pertumbuhan tinggi yang lebih baik daripada tanaman kontrol melalui analisa Least Significant Difference (LSD). Kalimantan Tengah.7% dibandingkan dengan bibit yang tidak diinokulasi pada lima bulan setelah inokulasi. tinggi merupakan parameter yang reliable untuk mengamati respon bibit terhadap inokulasi mikroba pemacu pertumbuhan. parviflora umur kurang lebih 1. menunjukkan respon beragam terhadap inokulasi bakteri fitohormon (Gambar 2). bibit yang tumbuh di lantai hutan perlu memiliki kemampuan untuk segera tumbuh tinggi bersaing dengan bibit di sekitarnya untuk mendapatkan cahaya agar dapat tumbuh baik.2-38. β Proteobacteria) dan Chromobacterium sp. Bakteri fitohormon memberikan pengaruh positif. Peningkatan pertumbuhan tinggi bibit Aquilaria sp. Bakteri fitohormon memberikan pengaruh nyata terhadap tinggi tanaman mulai 1-5 bulan setelah inokulasi (P < 0. Respon tanaman diamati melalui pertumbuhan tinggi dan diameter setiap bulannya. β Proteobacteria) merupakan isolat yang paling konsisten dalam memberikan pengaruh paling efektif dalam meningkatkan pertumbuhan tinggi selama lima bulan setelah inokulasi (Gambar 2). Pertumbuhan diameter tidak menunjukkan respon yang konsisten terhadap inokulasi (Tabel 2). CK28 (DQ195889.

131 .(Irna R. dan indeks mutu bibit (Gambar 3 dan Gambar 4). enam bulan setelah inokulasi. yaitu Shorea leprosula. Angka di atas notasi adalah peningkatan pertumbuhan dibanding kontrol Inokulasi tidak memberikan pengaruh nyata terhadap pertumbuhan tinggi. sampai 5 bulan setelah inokulasi..Aplikasi Rhizobakteri Penghasil . bibit cenderung tumbuh lambat (Tabel 2). Fungi mikoriza dilaporkan baru berperan efektif tujuh bulan setelah inokulasi pada tanaman dipterokarpa. 1994. dkk) Gambar 2. Sitepu. Shorea acuminata.. 2005). Tidak responnya bibit terhadap bakteri. 1990. tidak disterilisasi pada saat inokulasi bakteri sehingga mikroba alami yang terdapat dalam tanah. Hopea odorata. Yazid et al. rasio pucuk terhadap akar.. Turjaman et al. Bibit Aquilaria sp. enam bulan setelah inokulasi. kemudian bebas untuk berinteraksi dengan bakteri yang diinokulasikan. Pengaruh bakteri PGPR terhadap pertumbuhan tinggi bibit Aquilaria sp. Diduga tidak adanya respon bibit yang nyata pada bulan keenam dan selanjutnya disebabkan karena bibit telah terinfeksi oleh fungi mikoriza secara alami yang dapat berasal dari tanah maupun air yang dipakai untuk menyiram tanaman walaupun analisa infeksi mikoriza alami tidak dilakukan. dan Shorea pinanga (Lee... Inokulasi juga tidak berpengaruh terhadap pertumbuhan setelah bibit dipindah ke lapangan. juga terhadap berat kering total. dapat dijelaskan sebagai berikut: Tanah sebagai media tumbuh dan bibit Aquilaria sp. ditumbuhkan di bawah tegakan meranti di Hutan Penelitian Dramaga..

yang diinokulasi bakteri 132 .Aspek SILVIKULTUR Tabel 2. Berat kering total bibit Aquilaria sp. Tabel 1. Analisa sidik ragam pada parameter pertumbuhan yang diukur Parameter Diameter (mm) Tinggi (cm) Berat Kering Pucuk (g) Berat Kering akar (g) Berat Kering Total (g) Rasio P/A Indeks Mutu Bibit tn * tn * Analisa sidik ragam * * tn tn tn tn tn * * tn * tn tn Catatan: tn: tidak nyata pada taraf 0.05 *: nyata pada taraf 0. P/A: Pucuk/akar Gambar 3.05.

Sitepu. pengaruh mikoriza dimulai lebih awal. yang diinokulasi bakteri Pada bibit Aquiliaria sp.. (1998) pada bibit loblolly dan slash pine melaporkan bahwa inokulasi RPPT meningkatkan biomassa tegakan. Salah satu dari kedua inokulan yang paling efektif. yaitu pada enam bulan setelah inokulasi. Pengaruh tidak langsung dari inokulasi RPPT berupa pembentukan asosiasi mikoriza (disebut sebagai mycorrhizal helper bacteria. Penelitian yang dilakukan oleh Poole et al. 2002). 133 . dalam penelitian ini. Bakteri tertentu dapat berperan dalam merangsang terbentuknya asosiasi mikoriza antara fungi mikoriza dan tanaman inangnya. dkk) Gambar 4.(Irna R. (2001) menyatakan bahwa bakteri Paenibacillus sp.. Pseudomonas fluorescense BBc6R8 memacu simbiosis antara Laccaria bicolor S238N-Douglas fir (Pseudotsuga menziesii) dan efek dari bakteri MHB ini paling efektif pada saat fungi mikoriza tumbuh berada pada kondisi yang tidak optimal (Garbaye.. 1994. dan Rhodococcus sp. Brule et al. merangsang infeksi ektomikoriza pada tahapan pembentukan akar lateral antara Laccaria rufus dan Pinus sylvestris.. yaitu Chromobacterium sp...Aplikasi Rhizobakteri Penghasil . CK8 adalah bakteri yang telah diuji secara in vitro dapat membantu pertumbuhan miselia fungi ektomikoriza Laccaria sp. Penelitian yang dilakukan oleh Enebak et al... 2001). Indeks mutu bibit Aquilaria sp. MHB) juga telah dilaporkan. Burkholderia sp. monteilii meningkatkan biomassa fungi di dalam tanah (Founoune et al. Sedangkan Paenibacillus monteilii dan Paenibacillus resinovorans memacu simbiosis antara Pisolithus alba dengan Acacia holosericea di mana P. Gambar 4.

menunjukkan respon beragam terhadap inokulasi bakteri penghasil fitohormon. dan apakah hipotesa di atas benar.Aspek SILVIKULTUR Untuk mengetahui apakah fenomena MHB ini juga berlaku untuk Aquilaria sp. Uji lanjutan inokulasi ganda dengan fungi mikoriza arbuskula perlu dilakukan untuk mengetahui mikroba yang berperan dalam memacu pertumbuhan bibit pada stadia lanjut di persemaian sebelum dipindah ke lapangan. Peningkatan pertumbuhan tinggi bervariasi dari 12. Penelitian yang dilakukan oleh Kashyap et al. Uji in vitro merupakan metode yang praktis.7% dibandingkan dengan bibit yang tidak diinokulasi. CK28 dan Chromobacterium sp. Dalam penelitian ini. terhadap inokulasi menghasilkan satu bakteri penghasil indol yang efektif. Dari hasil in vitro didapat sembilan bakteri penghasil indol yang kemudian diuji lanjut pada bibit Aquilaria sp. segera setelah inokulasi berturut-turut selama lima bulan. yaitu Burkholderia sp. baik di persemaian maupun di lapangan. KESIMPULAN Bibit Aquilaria sp. Dalam hal ini bibit bermikroba dapat meningkatkan ketahanan tumbuh tanaman pada kondisi ekstrim. CK8 adalah dua bakteri yang secara konsisten memacu pertumbuhan tinggi. Inokulasi bakteri penghasil fitohormon dapat meningkatkan tinggi bibit Aquilaria sp.2-38. Dua isolat Burkholderia sp. maka perlu uji lebih lanjut untuk mengetahui pengaruh inokulasi ganda antara bakteri dan fungi mikoriza arbuskula dalam memacu pertumbuhan bibit. CK28 yang menghasilkan warna pink muda pada uji colorimetric. Respon pertumbuhan bibit Aquilaria sp. terutama dalam menyeleksi isolat dalam jumlah besar sebelum dilakukan uji selanjutnya. 134 . (2004) menunjukkan bahwa inokulasi ganda fungi mikoriza arbuskula dan bakteri Azotobacter dengan tambahan asam indol butirat secara nyata meningkatkan survival rate sapling Morus alba (Moraceae) yang ditanam pada kondisi yang bergaram tinggi dari 25-50%. pendekatan yang dilakukan adalah menyeleksi bakteri secara in vitro terlebih dahulu sebelum dilakukan uji pada tanaman target di persemaian.

and J. F. and J. Duponnois. J.. Ba. Silverstone. Sall. 2002.C. E. dan M. Wei. Mycorrhiza Helper Bacteria stimulate ectomycorrhizal symbiosis of Acacia holosericea with Pisolithus alba.M. Glick.A.M.. Helper bacteria: a new dimension to the mycorrhizal symbiosis. S. Soil Biology and Bio-chemistry 33: 1683-1694.L. Brulé. I. Applied Environmental Microbiology 61: 793-796. Sommer. and J.W. A critical examination of the specificity of the Salkowski reagent for indolic compounds produced by phytopathogenic bacteria. 2005. Garbaye. dkk) Ucapan Terimakasih Para penulis mengucapkan terimakasih kepada Bapak Ahmad Yani dan Bapak Zaenal yang telah membantu pengukuran dan perawatan tanaman di Hutan Penelitian Dramaga. Gerard. The enhancement of plant growth by free-living bacteria. S. P.. 1995.E. F. Survival in the soil of the ectomycorrhizal fungus Laccaria bicolor and the effects of mycorrhiza helper Pseudomonas fluorescens. R. Chotte. G. and S. Enebak. G. and Y. Turkish Journal of Biology 29: 29-34. Branget. New Phytologist 128: 197-210. Frey-Klett.. Garbaye. J. Pierrat. C.. New Phytologist 153: 81-89. 135 .C. Rousselet. B. Lemoine.. Glickmann. Kloepper. 1991. I. Indole acetic acid production by the indigenous isolates of Azotobacter and fluorescent Pseudomonas in the presence and absence of tryptophan. Applied and Environmental Microbiology 57: 535-538. S. Courrier. A. J. 1995. Sitepu. M. Founoune.(Irna R. Neyra. Bostock. J. 2001. Ahmad. 1994.R. 1998. H. Rapid in situ assay for indoleacetic acid production by bacteria immobilized on a nitrocellulose membrane.S. Effect of plant growthpromoting rhizobacteria on loblolly and slash pine seedlings. Khan.L. DAFTAR PUSTAKA Ahmad. Forest Science 44: 139-144.. Lorquin..M. Dessaux.. M. J. Canadian Journal of Microbiology 41: 109-117.Aplikasi Rhizobakteri Penghasil . Brick. R.

and M. Tahara. Turjaman. Narula. Lee. Screening of plant-growth promoting rhizobacteria from Dipterocarpaceae plants growing in Indonesian tropical rain forests.D.51. M. Osaki. and P. B. 1990.Aspek SILVIKULTUR Gunn. Read. Sitepu. A. The Australian National University. Hokkaido University. R.V. Chatterton.J.J. 2004.K...H. Antonie van Leeuwenhoek 86: 1-25. AMBIO 19: 383-385.W. Department of Microbiology. W. 2004. Glick.. Behl. Singadan. Reed. 18 pp. 2004. 2006. Tada. Y. Resource Management in Asia-Pacific Working Paper No.. J. Lucy. M. Inoculation with the ectomycorrhizal fungi 136 . S. Plant growth-promoting rhizobacteria as transplants amendments and their effects on indigenous rhizo-sphere microorganisms. 2006. G. M. free-living nitrogen-fixing bacteria inhabiting the rhizoplane of plants. Eaglewood in Papua New Guinea. Stevens.R. and W. 2005. Y.67. Biofertilizer technology-A manual. 91 pp. N. Tawaraya. Bacteria associated with Pinus sylvestris-Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro. Limin. CCS Haryana Agricultural University. Kloepper. and D. E. PhD Dissertation. Bending. pp. N. J. Reddy.. Merbach. M. Plant Soil Environment 52:119-129. Deubel. Cha. Canberra. and K. 2001.. M. and B. Gans. Tamai. Segah.S.Y. 2007. Applied Soil Ecology 31: 91-100. and S.. New Phytologist 151: 743-751. J. Sunari. N. Osaki. Hisar. Applications of free living plant growth-promoting rhizobacteria. Hashidoko. Whipps.R. India. P. Kokalis-Burelle. L. I. Bio-science Biotechnology Biochemistry 66: 2259–2263. E. S. M. H. 2002. Paranodules and colonization of wheat roots by phytohormone producing bacteria in soil. and investigations of their functions on seedling growth. Narula. The mycorrhizal association of the Dipterocarpaceae in the tropical rain forests of Malaysia.S. Soft gel medium solidified with gellan gum for preliminary screening for rootassociating.M. Poole.

. New Forest 30: 67-73. Lee. dkk) Pisolithus arhizus and Scleroderma sp.M.. Yazid. 1991. S.(Irna R. and F. Journal of Bacteriology 173: 697-707. Pelletier.A. S.J..S. D. and D. improves early growth of Shorea pinanga nursery seedlings.. Barns. S. Growth stimulition of Hopea spp. Lapeyrie. 137 . Lane. 16S ribosomal DNA amplification for phylogenic study. 1994.Aplikasi Rhizobakteri Penghasil . G.M. Forest Ecology Management 67: 339-343. (Dipterocarpaceae) seedlings following ectomycorrhizal inoculation with an exotic strain of Pisolithus tinctorius. W. Weisburg.. Sitepu..

138 .

. 2001). Jenis-jenis ini merupakan sumber utama dari kayu gaharu (semacam kayu yang 139 . 1999). 1998. Najmulah. dan Gonystylus dimasukkan ke dalam CITES (Convention on the International Trade in Endangered Species) Appendix II (CITES 2005). Gonystylus. Myanmar. Gyrinops.. Thymeleaceae terdiri dari 50 genera dengan Aetoxylon. Vietnam. Bangladesh. Bhutan. dan Aquilaria yang memproduksi gaharu (Ding Hou. Malaysia. 1960).7 PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman. maka jenisjenis ini mengalami kelebihan pemanenan di seluruh kawasan Asia selama 20 tahun terakhir (Paoli et al. Irnayuli R. China.B. Jenis-jenis Aquilaria pada umumnya banyak dijumpai pada hutan-hutan primer dan sekunder dataran rendah di Indonesia. Wikstroemia. Ahmad Yani. Thailand. Pada saat ini Aquilaria. Phaleria. dan Filipina. Ragil S. Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Salah satu famili pohon tropika yang sekarang menjadi perhatian dunia internasional adalah Thymelaeaceae. Oyen dan Dung. Karena disebabkan tingginya nilai produk gaharu. Papua Nugini. India. Sitepu. Aryanto. Cambodia. Enkleia. Famili pohon ini sangat penting karena menghasilkan produk gaharu dan kayu mewah untuk masyarakat di sekitar kawasan hutan di kawasan Asia (Lemmens et al. Gyrinops. Sugeng Sentosa. Irianto.

obat tradisional. Tamarindus indica. 1996). belum dilaporkan adanya uji inokulasi fungi mikoriza arbuskula pada jenis-jenis Aquilaria. Dari hasil studi literatur. baik di tingkat persemaian maupun di lapangan. 2000). Tujuan dari penelitian ini adalah menentukan tingkat pengaruh fungi mikoriza arbuskula pada jenis-jenis Aquilaria.. Pada kenyataannya ketersediaan bibit biasanya cenderung dibuat dengan kualitas rendah dan mengalami defisiensi unsur hara dan pada akhirnya mengalami kematian yang tinggi pada saat telah ditanam di tingkat lapang. 1998). Fungi mikoriza arbuskula (FMA) telah diuji dengan hasil yang signifikan pertumbuhannya pada jenis Leucaena leucocephala (Michelsen dan Rosendahl. Tectona grandis (Rajan et al. Namun demikian. 140 . Telah banyak dilaporkan dalam beberapa jurnal internasional pentingnya pemanfaatan fungi mikoriza arbuskula dari beberapa jenis tanaman hutan yang berbeda untuk membantu kegiatan reforestasi. Pada saat ini kegiatan reforestasi memproduksi ratusan juta bibit tanaman hutan setiap tahunnya.. Parkia biglobosa. 11 jenis Eucalyptus (Adjoud et al. jenis Aquilaria berkurang populasinya di alam. Produk gaharu biasanya digunakan sebagai bahan dasar parfum. sulit sekali untuk melakukan pengaturan perlindungan genus ini dan termasuk juga dalam pengaturan kelestarian produksi gaharu alami.. sebab pada umumnya kondisi lahan hutan tropika di Indonesia kahat unsur hara terutama N dan P. 2002). 2004). Ketersediaan nutrisi tanah merupakan salah satu faktor pembatas untuk pertumbuhan awal dalam kegiatan penanaman bibit-bibit tanaman hutan pada kondisi lahan hutan yang terdegradasi (Santiago et al. 1990). Sesbania aegyptiaca dan S. Penggunaan bibit tanaman hutan yang vigor sangat diperlukan dalam kegiatan reforestasi. grandiflora (Giri and Mukerji. incence. dan produk komersial lainnya (Eurling dan Gravendeel. Zizyphus mauritiana (Guissou et al. 2005).Aspek SILVIKULTUR mempunyai resin wangi) yang termasuk dalam urutan teratas dari kelompok hasil hutan bukan kayu bernilai sangat tinggi yang berasal dari hutan tropika. Pada tahap awal pertumbuhan jenis Aquilaria sering mengalami pertumbuhan yang lambat.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

BAHAN DAN METODE
A. Perbenihan dan Perkecambahan
Benih Aquilaria crassna diperoleh dari Dramaga (Bogor), A. malaccensis dikoleksi dari Desa Gudang (Pulau Bangka), A. microcarpa dari Desa Mianas (Kalimantan Barat), A. beccariana berasal dari Sanggau (Kalimantan Barat). Semua benih Aquilaria spp. direndam selama dua jam, kemudian disterilisasi dengan sodium hypochlorit (5%) selama lima menit. Setelah disterilisasi, benih tersebut dicuci beberapa kali dengan air sampai bersih. Benih Aquilaria spp. dikecambahkan pada bak plastik yang berisi media zeolite. Benih Aquilaria spp. mulai berkecambah 21 hari setelah ditaburkan.

B. Media Semai
Jenis tanah ultisol diambil dari Hutan Penelitian Haurbentes, Jasinga dan kemudian disimpan di rumah kaca. Media semai tersebut disaring dengan diameter saringan lima mm. pH media adalah 4,7; P tersedia (Bray-1) adalah 0,17 mg kg-1, dan N total (Kjeldahl) was 1.7 mg kg-1. Kemudian media semai disterilisasi pada temperatur 121oC selama 30 menit.

C. Inokulum Mikoriza Arbuskula
Fungi mikoriza arbuskula, G. decipiens, G. clarum, Glomus sp. ZEA, dan Glomus sp. ACA diisolasi dari Desa Kalampangan, Palangkaraya, Kalimantan Tengah melalui teknik pot kultur. Teknik pot kultur dimulai dengan cara spora tunggal. Inang yang digunakan untuk mempropagasi FMA adalah Pueraria javanica. Pot plastik diisi dengan zeolite steril dan ditambahkan 5 g dari masingmasing jenis FMA. Kemudian ditanam benih P. javanica yang telah berumur enam hari pada pot plastik tersebut. Pot-pot disusun pada rak-rak besi di rumah kaca dan dipelihara selama 90 hari. Spora, hifa eksternal, dan akar yang terkolonisasi dari masing-masing jenis FMA diamati di bawah mikroskop.

141

Aspek SILVIKULTUR

D. Inokulasi FMA
Polybag (ukuran 15 cm x 10 cm) diisi tanah steril 500 g. Inokulasi FMA diberikan 5 g untuk setiap pot dan diletakkan dekat akar semai Aquilaria spp. Semai empat jenis Aquilaria yang tidak diinokulasi sebagai kontrol. Dari hasil penelitian pendahuluan, penggunaan inokulum steril tidak memberikan pengaruh pertumbuhan pada Aquilaria spp. Semai dipelihara dan disiram setiap hari pada kondisi rumah kaca dan diamati selama 6 bulan. Temperatur di rumah kacar berkisar antara 26-35oC dan kelembaban udara 8090%. Gulma dan hama yang mengganggu semai dimonitor setiap hari.

E. Parameter Pertumbuhan
Percobaan inokulasi pada jenis-jenis Aquilaria terdiri atas (a) kontrol (tanpa inokulum); (b) Entrophospora sp.; (c) G. decipiens; (d) G. clarum; (e) Glomus sp. ZEA; dan (f) Glomus sp. ACA. Desain penelitian dilakukan dengan rancangan acak lengkap (RAL) dengan 30 ulangan. Parameter yang diukur adalah tinggi, diameter, dan daya hidup semai. Setelah berumur enam bulan, dilakukan pemanenan pucuk dan akar semai Aquilaria. Semua sampel di-oven pada suhu 70oC selama tiga hari. Analisis N dan P jaringan semai dilakukan dengan metode semi-micro Kjeldahl dan vanadomolybdate-yellow assay (Olsen and Sommers, 1982). Pada tingkat lapang, percobaan yang dilakukan hanya pada jenis A. beccariana dengan desain RAL yang sama. Percobaan dilakukan di Kawasan Hutan Dengan Tujuan Khusus (KHDTK) Dramaga di bawah naungan tegakan Gmelina arborea. Paramater yang diamati pada tingkat lapang ini adalah tinggi dan diameter A. beccariana yang telah dilakukan selama dua tahun.

F. Kolonisasi Mikoriza Arbuskula
Akar dari masing-masing jenis Aquilaria dicuci untuk membersihkan partikel-partikel tanah yang masih menempel. Akar dibersihkan dalam 100 g l-1 KOH selama satu jam, diasamkan dalam larutan HCl dan diberi warna dengan 500 mg l -1 tryphan blue dalam lactoglycerol (Brundrett et al., 1996). Kemudian akar

142

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

dicuci dalam 50% glycerol dan 100 potong akar berukuran satu cm diamati di bawah mikroskop compound dengan perbesaran 200x. Penghitungan kolonisasi mikoriza dilakukan dengan sistem skoring keberadaan dan tidak adanya struktur FMA (McGonigle et al., 1990).

G. Analisis Statistik
Analisis statistik menggunakan ANOVA dengan software StatView 5.0 (Abacus Concepts). Sedangkan analisis statistik lanjutan menggunakan uji beda nyata terkecil (LSD) apabila nilai F signifikan.

HASIL DAN PEMBAHASAN
Lima jenis fungi mikoriza arbuskula (FMA) sangat efektif mengkolonisasi sistem perakaran dari A. crassna, A. malaccensis, A. Microcarpa, dan A. beccariana setelah enam bulan diinokulasi pada kondisi rumah kaca. Dari hasil penelitian sebelumnya Santoso et al. (2008), kolonisasi FMA yang terjadi pada akar bibit A. microcarpa dimulai sebelum minggu ke-7 setelah inokulasi. Tidak ada perbedaan nyata antara lima jenis FMA dalam mengkolonisasi perakaran empat jenis Aquilaria. Kolonisasi FMA dapat meningkatkan parameter pertumbuhan tinggi, diameter batang, berat kering, berat basah, dan daya hidup semai Aquilaria di persemaian (Tabel 1). Pada jenis A. crassna, A. Malaccensis, dan A. microcarpa, penggunaan FMA Entrophospora sp. lebih efektif meningkatkan parameter pertumbuhan dibandingkan jenis FMA lainnya. Khusus FMA G. clarum sangat efektif meningkatkan parameter pertumbuhan pada jenis A. beccariana. Semai yang tidak diinokulasi terkolonisasi oleh FMA yang tidak teridentifikasi (110%), tetapi tidak dapat mempengaruhi pertumbuhan empat jenis Aquilaria. Kolonisasi FMA mampu meningkatkan serapan N dan P pada jaringan empat jenis Aquilaria dibandingkan semai yang tidak diinokulasi (Tabel 2). Peningkatan serapan N dan P ini memberikan pengaruh pada peningkatan dari parameter pertumbuhan empat jenis Aquilaria. Pada tingkat lapang, dilakukan kegiatan penanaman hanya pada jenis A. beccariana dua tahun setelah diinokulasi oleh FMA. Hasil penelitian pada tingkat lapang menunjukkan bahwa

143

Aspek SILVIKULTUR

jenis G. clarum lebih efektif dalam meningkatkan pertumbuhan A. beccariana dibandingkan dengan kontrol dan jenis FMA lain yang telah diujicobakan. Dari hasil penelitian ini memberikan informasi yang sangat penting dalam memanfaatkan inokulum FMA pada jenis-jenis Aquilaria spp. Regenerasi jenis-jenis Aquilaria yang berkelanjutan dapat dibantu dengan adanya pemanfaatan teknologi FMA dimulai pada saat di persemaian. Penggunaan FMA yang efektif dapat meningkatkan pertumbuhan Aquilaria yang sangat signifikan, sehingga biomassa pohon penghasil gaharu yang akan dipanen akan meningkat, artinya produk gaharu hasil induksi yang akan dipanen lebih meningkat produksinya. Penelitian ini sejalan dengan penelitian yang terdahulu, yaitu tentang pemanfaatan FMA pada 11 jenis Eucalyptus spp. (Adjoud et al., 1996), 17 jenis tanaman legume (Duponnois et al., 2001), Sesbania aegyptiaca dan S. grandiflora (Giri dan Mukerji, 2004). Penelitian pemanfaatan FMA pada jenis-jenis pohon tropika (Muthukumar et al., 2001) dan khususnya jenis-jenis Aquilaria menunjukkan bahwa ada kemungkinan inokulum FMA dapat menurunkan penggunaan pupuk kimia di persemaian. Meskipun perhitungan tentang keuntungan dan biaya penggunaan FMA belum diuji dalam penelitian ini, hasilnya tidak diragukan lagi menunjukkan FMA dapat menurunkan penggunaan pupuk kimia dalam penyediaan semai tanaman penghasil gaharu. Selanjutnya mekanisme penggunaan FMA sebagai pemacu pertumbuhan jenisjenis Aquilaria pada tanah masam dan pada tanah yang populasi FMA sangat rendah harus menjadi perhatian dan pertimbangan untuk mengetahui keberadaan FMA alami. Pola penanaman jenis-jenis Aquilaria dengan pola agroforestry sangat membantu mempercepat ketersediaan pohon-pohon penghasil gaharu di Indonesia. Pada prinsipnya, pencampuran dilakukan untuk melindungi pertumbuhan semai Aquilaria pada tahun pertama dan kedua dari sengatan sinar matahari. Jenis-jenis Aquilaria yang telah dikolonisasi oleh FMA akan dapat mempunyai hubungan antara sistem perakaran pohon jenis-jenis lain, sehingga kebutuhan nutrisi untuk pertumbuhan gaharu dapat terpenuhi.

144

gmelina.. G. kelapa. 2. Ketersediaan inokulum FMA di tingkat 145 . crassna. Pertumbuhan tinggi dan diameter pohon penghasil gaharu Aquilaria beccariana setelah dua tahun ditanam di tingkat lapang. sengon. baik di tingkat semaian maupun lapangan.Penggunaan Fungsi Mikoriza . sangat efektif dalam memacu pertumbuhan tanaman dan serapan nurtisi pada jenis A. Gc = G..Aca = Glomus sp. dan A. clarum untuk memacu pertumbuhan tanaman dan serapan nutrisinya.ZEA = Glomus sp. jengkol. G. Khusus jenis pohon penghasil gaharu A. dan beberapa jenis lain pohon buah-buahan. decipiens. A.) Jenis-jenis pohon yang direkomendasikan sebagai pohon pencampur dengan pohon penghasil gaharu adalah pohon karet. kelapa sawit. KESIMPULAN DAN REKOMENDASI 1. Gambar 1. dkk... Gg = G.clarum. Jenis FMA Entrophospora sp. Penggunaan FMA pada jenis-jenis Aquilaria sangat signifikan dalam memacu pertumbuhan awal di persemaian dan lapangan. malaccensis. Direkomendasikan untuk menggunakan jenis FMA efektif untuk mempercepat pertumbuhan jenis-jenis Aquilaria mulai di tingkat persemaian. Ent = Entrophospora sp.(Maman Turjaman.. ZEA. microcarpa. beccariana lebih memilih jenis FMA G. ACA. K = Kontrol. melinjo.

The Netherlands. Pontanier (2005). C.. D. T. Dell. Appendices I. 1996. Responses of Parkia biglobosa (Jacq. p.G.C. 48 pp. 6. Duponnois. Bougher. Masse and R. Mycorrhiza 14 : 307-312.Aspek SILVIKULTUR pengguna dan sosialisasi penggunaanya perlu dilakukan. R. 2005. Malajczuk. Duponnois. Guinko and R. TrnL-TrnF Sequence Data Imply Paraphyly of Aquilaria and Gyrinops (Thymelaeaceae) and Provide New Perspectives for Agarwood Identification. M. Wolters-Noordhoff. Founoune. Forest Ecology and Management 207 : 351-362. 1960. 1998. 1-15. UNEP. (ed) Flora Malesiana.Ouadba. N. Giri. R. 146 . Vol.M. DAFTAR PUSTAKA Adjoud. Eurlings. Biology and Fertility Soils 26 : 194-198. Inoculation of Acacia holosericea with Ectomycorrhizal Fungi in a Semiarid Site in Senegal : Growth Response and Influences on The Mycorrhizal Soil Infectivity After 2 Years Plantation.. Plenchette. 2004. Tamarindus indica L. Lapeyrie. 1996. Halli-Hargas and F. Thymelaeaceae. Plant Systematics and Evolution 254 : 1-12. Groningen.. Mycorrhizal Inoculant Alleviates Salt Stress in Sesbania aegyptiaca and Sesbania grandiflora Under Field Conditions : Evidence for Reduced Sodium and Improved Magnesium Uptake. and K. B. Series I. Grove and N. II and III of CITES. Working with Mycorrhizas in Forestry and Agriculture. B. C.G. Response of 11 Eucalyptus Species to Inoculation with Three Arbuscular Mycorrhizal Fungi. S. D. Convention on International Trade in Endangered Species of Wild Fauna and Flora. Mycorrhiza 6 : 129-135. to Arbuscular Mycorrhizal Fungi in a Phosphorus-Deficient Sandy Soil.) Benth. In : Van Steenis. T. A. and B. Guisso. Brundrett. Mukerji. J-M. Ding Hou. ACIAR Monograph 32.G. CITES. Canberra.J. agar penggunaan FMA menjadi efektif dan efisien. Bâ..M. and Zizyphus mauritiana Lam. Gravendeel. 2005. H. M.

West Kalimantan. Plant Resources of South-East Asia No. R..K. S.E. 2001. 2002.) Methods of Soil Analysis Part 2 Chemical and Micro-biological Properties. dkk. Juss) to Indigenous Arbuscular Mycorrhizal Fungi. Swan. in Two Tropical Soils. Forest Ecology and Management 126: 91-95. Oyen. New Phytologist 115 : 495-501. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil 147 . E. Bogor.X. Phosphorus and Drought Stress on The Growth of Acacia nilotica and Leucaena leucocephala Seedlings. I. Madison. Indonesia.C.H. Peart.J. 2000. Santoso.).P. McGonigle. Fairchild and J. Response of Neem (Azadirachta indica A. Garcia and M.) Lemmens. Rosendhal..L.W..R. D. B. In : Page AL (ed. Plant Resources of South-East Asia No. Prosea. Leighton and I...D. 1990. L. S. G.M. 1990. 1998. Wong (Eds.. and Mycorrhizal Fungi on The Growth Brazilian Rosewood. Samsoedin.R. Timber Trees : Minor Commercial Timbers. and S. Effect of Post-Planting Inoculation with Bradyrhizobium sp. Bogor. Screening of Arbuscular Mycorrhizal Fungi for Their Symbiotic Efficiency with Tectona grandis.D. Scotti. 1999. Rajan. Indonesia. Michelsen. 5 (2). T. Turjaman.G. 1982. 2001. American Society of Agronomy. Dalbergia nigra Allem. Prosea. Evans. Reddy and D. T. Sommers. and L.A. An Ecological and Economic Assessment of The Nontimber Forest Product Gaharu Wood in Gunung Palung National Park. Phosphorus. A New Method Which Gives an Objective Measure of Colonization of Roots by Vesicular-Arbuscular Mycorrhizal Fungi.M. D. Soerianegara and W.P.H.. The Effect of VA Mycorrhizal Fungi. Udaiyan and V..A. Gunawan dan M. Bagyaraj. Muthukumar.. Indonesia..). M. 19. Ex Benth.. Santiago. Dung (Eds. Paoli. A. Essential-Oil Plants.Penggunaan Fungsi Mikoriza . G. Rajeshkannan.R. Miller.J. G. p 403-430. Q. Plant and Soil 124 : 7-13. Biology and Fertility Soils 34 : 417-426 Olsen. K.J. 2008. A..(Maman Turjaman. and N. Phosphate-Solubilizing and Asymbiotic Nitrogen-Fixing Bacteria Under Tropical Nursery Conditions. M. New Forests 24 : 15-25. Conservation Biology 15 : 1721-1732.

Jurnal Penelitian Hutan dan Konservasi Alam IV (5): 499-509. 148 . Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam.Aspek SILVIKULTUR Gaharu. Bogor.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

Lampiran 1. Kolonisasi mikoriza arbuskula dan pertumbuhan pada jenisjenis Aquilaria setelah enam bulan pada kondisi di rumah kaca
Kolonisasi AM Tinggi (cm) Diameter (mm) Berat basah Pucuk (g) Akar (g) Berat kering Pucuk (g) Akar (g) Daya hidup (%)

Perlakuan

A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA 10a 85b 71b 79b 61b 84b 15,40a 19,20b 32,18d 45,30e 32,03d 26,24c 1,90a 2,37b 3,94c 5,02d 3,75c 3,53c 0,30a 5,46e 4,74d 6,74f 3,14b 3,84c 0,10a 2,54c 1,64b 2,82d 1,38c 1,20b 0,09a 1,76c 1,59c 2,30d 0,97b 1,19b 0,02a 0,78c 0,41b 0,91d 0,36b 0,28b 73 100 100 100 100 100 2a 97b 88b 83b 85b 87b 13,39a 24,74d 21,99c 20,28c 17,24b 18,09b 2,23a 3,89c 3,67c 3,58c 2,84b 2,98b 0,75a 4,32c 3,87c 3,46c 2,24b 2,70b 0,34a 2,29c 3,41d 1,55b 1,08b 1,23b 0,23a 1,31c 1,44c 0,95b 0,64b 0,76b 0,09a 0,37b 0,57c 0,30b 0,24b 0,28b 67 100 97 93 87 90 1a 97b 88b 83b 84b 86b 16,43a 25,97c 21,91b 19,96b 22,33b 21,30b 2,28a 3,88c 3,02b 2,94b 3,26b 3,12b 1,46a 4,68c 2,92b 2,90b 2,62b 2,74b 0,52a 2,24c 1,20b 1,28b 1,38b 1,22b 0,41a 1,44c 0,88b 1,95c 0,79b 0,89b 0,18a 0,48c 0,27b 0,78c 0,27b 0,26b 73 100 100 97 90 93 4a* 73b 63b 78b 78b 59b 20,90 a 46,14 c 29,58 b 32,43 b 38,94 c 24,60 a 2,9 a 5,4 c 4,1 b 4,4 b 4,7 b 3,7 a 0,68a 1,06a 0,33a 3,82b 3,26b 0,86a 2,99b 4,19b 0,13a 1,35b 1,56b 0,27a 1,01b 1,52b 70 100 100 100 87 100

12,58b 5,72b 11,64b 7,36b 8,82b 9,92b 4,3b 4,54b

13,46b 6,94b

149

Aspek SILVIKULTUR

Lampiran 2. Kandungan N dan P pada jenis-jenis Aquilaria setelah enam bulan diinokulasi oleh beberapa jenis fungi mikoriza arbuskula (FMA)
N Concentrations (mg/g) N Content (mg/plant) P Concentrations (mg/g) P Content (mg/plant)

Perlakuan A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA

7,9 ± 0,1a* 9,8 ± 0,1c 8,2 ± 0,2a 8,7 ± 0,2b 8,7 ± 0,1b 10,8 ± 0,2d

2,6 ± 0,6a 37,7 ± 4,3d 26,7 ± 4,1c 7,4 ± 1,0b 25,8 ± 3,6c 45,9 ± 9,6d

0,78 ± 0,02a 1,42 ± 0,03e 0,85 ± 0,02b 0,95 ± 0,02c 0,96 ± 0,03c 1,22 ± 0,02d

0,26 ± 0,06a 5,4 ± 0,6d 2,8 ± 0,5c 0,82 ± 0,14b 2,85 ± 0,41c 5,14 ± 1,0d

8,6 ± 0,2a 12,1 ± 0,1d 10,7 ± 0,1c 10,4 ± 0,1b 11,1 ± 0,2c 10,9 ± 0,2c

3,49 ± 0,5a 17,28 ± 2,0c 9,02 ± 0,7b 20,5 ± 3,3c 8,8 ± 0,9b 9,7 ± 1,8b

0,65 ± 0,02a 0,73 ± 0,01b 0,85 ± 0,01c 0,72 ± 0,02b 0,77 ± 0,03b 1,04 ± 0,03d

0,26 ± 0,04a 1,06 ± 0,15d 0,75 ± 0,07c 1,60 ± 0,20e 0,6 ± 0,07b 0,92 ± 0,17c

7,8 ± 0,1a 9,6 ± 0,2c 9,6 ± 0,1c 9,3 ± 0,1c 9,4 ± 0,1c 8,9 ± 0,2b

1,02 ± 0,07a 16,9 ± 1,5d 11,7 ± 0,9c 8,3 ± 0,4b 9,17 ± 1,35b 8,28 ± 0,40b

0,65 ± 0,02a 1,12 ± 0,03d 0,86 ± 0,01c 0,78 ± 0,02b 0,77 ± 0,03b 0,77 ± 0,02b

0,08 ± 0,01a 1,97 ± 0,18d 1,20 ± 0,18c 0,70 ± 0,03b 0,75 ± 0,12b 0,9 ± 0,1b

6,0 ± 0,1a 9,9 ± 0,2c 10,6 ± 0,1c 11,3 ± 0,d 9,4 ± 0,1b 8,8 ± 0,2b

5,02 ± 0,07a 10,2 ± 1,0c 11,8 ± 0,8c 12,5 ± 0,4d 9,17 ± 1,35b 9,28 ± 0,40b

0,40 ± 0,02a 0,98 ± 0,02d 0,89 ± 0,03c 1,11 ± 0,02e 0,77 ± 0,03b 0,97 ± 0,02d

0,10 ± 0,01a 0,87 ± 0,20d 1,25 ± 0,21c 1,95 ± 0,03e 0,75 ± 0,12b 1,04 ± 0,1c

*Nilai-nilai dengan huruf yang sama adalah tidak berbeda nyata (P<0.05).

150

8
HAMA PADA TANAMAN PENGHASIL GAHARU
Ragil SB Irianto, Erdy Santoso, Maman Turjaman, Irnayuli R. Sitepu
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Tanaman penghasil gaharu yang ada di Indonesia sekitar 27 jenis, beberapa di antaranya yang cukup potensial menghasilkan gaharu yaitu Aquilaria spp., Aetoxylontallum spp., Gyrinops spp., dan Gonystylus spp. Pemanfaatan gaharu di Indonesia oleh masyarakat terutama di pedalaman Pulau Sumatera dan Kalimantan telah berlangsung ratusan tahun yang lalu. Secara tradisional gaharu dimanfaatkan, antara lain dalam bentuk dupa untuk upacara keagamaan, pengharum tubuh dan ruangan, bahan kosmetik dan obat-obatan sederhana. Produk gaharu saat ini sangat dicari oleh para pencari gaharu, karena harganya yang cukup mahal, dimana harga gaharu super dapat mencapai sekitar Rp 40 juta/kg. Akibat dari harga yang cukup tinggi tersebut, maka para pencari gaharu semakin intensif untuk mendapatkannya, saat ini para pencari gaharu mulai memfokuskan mencari gaharu di Pulau Papua yang potensi alamnya (gaharu) masih cukup tinggi dibandingkan dengan di Pulau Kalimantan atau Sumatera.

151

Aspek SILVIKULTUR

Dengan semakin langkanya tanaman penghasil gaharu di lapang dan harganya yang cukup tinggi tersebut, maka para peneliti kehutanan, rimbawan, dan masyarakat awam mulai mendomestikasi atau menanam tanaman penghasil gaharu di luar habitat aslinya. Saat ini banyak sekali para petani maupun orang kota yang mulai menanam tanaman penghasil gaharu dalam skala kecil dari beberapa pohon sampai dengan ribuan pohon. Penanaman tanaman penghasil gaharu yang monokultur dan di luar habitat aslinya pada umumnya akan rentan terhadap serangan hama dan penyakit. Dimulai dua tahun yang lalu banyak sekali sentra penanaman tanaman penghasil gaharu yang terserang hama daun Heortia vitessoides Moore. Sentra penanaman tanaman penghasil gaharu yang terserang hama dan telah dilaporkan terdapat di KHDTK Carita (2008), Sanggau (2007), Mataram (2009), dan lain-lain.

HAMA Heortio vitessoides
A. Gejala Serangan
Gejala serangan tingkat awal adalah permukaan daun yang muda dimakan oleh larva instar pertama dan daun tersebut hanya meninggalkan tulang-tulang daunnya. Pada stadia lebih lanjut ulatulat tersebut mulai menyerang daun-daun pada bagian cabang lebih atasnya dan menyebabkan tanaman menjadi gundul. Ngengat meletakkan telurnya pada bagian bawah permukaan daun yang muda pada cabang tanaman yang dekat dengan permukaan tanah.

B. Siklus Hidup
1. Telur
Ngengat meletakkan telurnya yang berwarna putih kekuningkuningan yang akan segera berubah menjadi kuning kehijauhijauan dalam bentuk kluster pada bagian bawah permukaan daun

152

Hama pada Tanaman . Larva instar terakhir pada saat akan berkepompong mulai berhenti makan dan ulat turun ke permukaan tanah untuk berkepompong. Stadium ngengat berkisar sekitar 4 hari..) yang muda pada cabang tanaman yang dekat dengan permukaan tanah. Siklus hidup hama daun tanaman penghasil gaharu H. vitessoides 153 . Ngengat Serangga dewasa berbentuk ngengat yang aktif pada waktu malam. dkk.. 3. Ngengat (4 Hari) Kepompong (8 Hari) Telur (10 Hari) Larva (23 Hari) Gambar 1. Telur akan menetas sekitar 10 hari.. Stadium pupa berkisar 8 hari.(Ragil SB Irianto. Pupa Larva instar terakhir sebelum berkepompong akan berhenti makan dan turun ke permukaan tanah dengan bantuan benang sutera yang dihasilkannya. Ulat akan membungkus dirinya dengan butiran-butiran tanah atau serpihan-serpihan serasah yang ada di permukaan dengan bantuan benang-benang suteranya. Ngengat betina dapat meletakkan telur sebanyak 350-500. ulat ini terdiri dari 5 instar dan berlangsung selama 23 hari. 4.. jumlah telur yang dihasilkan per imago betina berkisar antara 350-500. vitessoides pada instar pertama berwarna kuning pucat dan pada instar selanjutnya menjadi hijau kekuning-kuningan. Larva/Ulat Ulat H. 2.

dimana tanaman masih bisa dijangkau oleh orang dengan berdiri tanpa bantuan alat. Pencarian sarang semut rangrang yang memiliki ratu merupakan salah satu faktor 154 . Predator Rangrang Semut rangrang (Oecophylla smaradigna) merupakan serangga yang mudah ditemukan di kampung-kampung pada tanamantanaman yang banyak mengeluarkan nektar. Kimiawi Pengendalian kimiawi dapat dilakukan dengan insektisida kontak. sudah populer di tingkat petani. Jangka Pendek 1. yaitu dengan cara mengambil ulat atau telur yang ada di tanaman tersebut. Mekanis Pengendalian mekanis merupakan pengendalian yang sangat sederhana. B. Karena hama ini memakan daun dan pada serangan berat umumnya tanaman gundul. growmore. sistemik atau dengan insektisida yang berbahan aktif mikroorganisme. Pengendalian dengan cara ini mudah diaplikasikan terutama pada pesemaian atau bibit yang baru dua tahun. dan lain-lain untuk merangsang tumbuhnya tunas-tunas baru.Aspek SILVIKULTUR STRATEGI PENGENDALIAN A. rambutan. Nabati Pengendalian nabati merupakan pengendalian yang cukup sederhana dan dapat dilakukan oleh petani sendiri dengan mengambil bahan-bahan yang ada di sekitar lokasi penanaman tanaman gaharu. seperti Beauveria bassiana atau Bacillus thuringiensis. melinjo. durian. seperti tanaman nangka. 2. maka disarankan pada saat penyemprotan dikombinasikan dengan pemupukan lewat daun dengan pupuk daun seperti gandasil. dan lain-lain. Jangka Menengah 1. 3.

. Mele. 2008. C. baik parasit maupun predator dari serangga perusak daun tanaman penghasil gaharu H. 155 . T. Bhattacharyya. and S. Mele. V.(Ragil SB Irianto.. Teknik Silvikultur Pengendalian dengan cara teknik silvikultur merupakan salah satu cara pengendalian yang sudah menyatu dengan penanaman suatu tanaman dan termasuk pengendalian yang sudah cukup dikenal oleh petani. V. 2. Musuh Alami Musuh alami. Cuc. DAFTAR PUSTAKA Kalita. 59 p. P. ICRAF. Heortia vitessoides Moore A Serious Pest of Agarwod Plant (Aquilaria malaccensis Lamk). P. dkk. R...Hama pada Tanaman ..) keberhasilan dalam perkembangan populasi serangga tersebut dalam jangka panjang. P. Agricultural and Forest Entomology 10: 13-22. J. vitessoides merupakan suatu cara pengendalian yang sangat diharapkan dalam jangka panjang. 2002. Semut Sahabat Petani: Meningkatkan Hasil Buah-Buahan dan Menjaga Kelestarian Lingkungan Bersama Semut Rangrang. Geobios 29: 13-16. A Historical Review of Research on The Weaver Ant Oecophylla in Biological Control. T. Jangka Panjang 1. Nath. dan N. C. 2004.

156 .

Aspek SOSIAL EKONOMI DAN KONSERVASI 157 .

158 .

Jika tanaman ini terluka. dan Gonystylus. baik disebabkan penyakit atau serangan serangga. Aquilaria yang merupakan tanaman penghasil gaharu saat ini menjadi jenis yang dilindungi 159 . pau d’aquila (Portugis).9 PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti Pusat Litbang Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu tanaman hutan yang mempunyai nilai ekonomi tinggi karena kayunya mengandung resin yang harum. rusak atau terinfeksi. Resin ini sebetulnya dapat melindungi tanaman dari infeksi yang lebih besar sehingga dapat dianggap sebagai sistim imun yang dihasilkan (Squidoo. oudh. aloeswood. Tanaman penghasil gaharu secara alami tumbuh di wilayah Asia Selatan dan Asia Tenggara. oodh (Arab). ood. 2008). gaharu (Indonesia). Sejenis resin beraroma ini berasal dari tanaman jenis Aquilaria. Gyrinops. dan adlerholz (Jerman). Beberapa nama diberikan pada gaharu seperti agarwood. bois d’aigle (Perancis). akan menghasilkan resin/substansi aromatik berupa gumpalan atau padatan berwarna coklat muda sampai coklat kehitaman yang terbentuk pada lapisan dalam dari jenis kayu tertentu sebagai reaksi dari infeksi/ luka tersebut. chenxiang (China).

Meskipun demikian.Aspek SOSIAL EKONOMI DAN KONSERVASI di banyak negara dan eksploitasi gaharu dari hutan alam dianggap sebagai kegiatan ilegal. PHBM diharapkan menjadi suatu cara yang efektif karena melibatkan masyarakat sekitar hutan dan parapihak pemangku 160 . Salah satu bentuk kemitraan yang dapat dikembangkan adalah pola PHBM (Pengelolaan Hutan Berbasis Masyarakat). perlu dikembangkan suatu skema kerjasama antara pemilik modal dengan masyarakat. maka masyarakat yang mampu membudidayakan gaharu adalah kelompok yang memiliki permodalan yang kuat. Pengembangan budidaya gaharu dengan pola PHBM (sistem bagi hasil) merupakan salah satu alternatif bentuk usahatani produktif yang selain bertujuan untuk mengembangkan budidaya gaharu secara luas juga sekaligus dapat meningkatkan pendapatan masyarakat serta mengurangi tekanan masyarakat terhadap hutan yang tingkat ketergantungannya terhadap hutan tinggi. 2006). Namun karena pengusahaan gaharu memerlukan modal yang tidak sedikit. Upaya pembudidayaan tersebut makin berkembang karena ditunjang oleh kemajuan hasil penelitian yang menunjukkan bahwa budidaya gaharu memberikan keuntungan yang layak bagi pelakunya. permintaan akan gaharu jauh melebihi supply yang ada. Kesepakatan internasional seperti CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) yang disepakati oleh 169 negara ditetapkan untuk menjamin bahwa perdagangan gaharu tidak mengganggu survival dari Aquilaria. 2008). Sumatera Utara. Sebagai akibatnya pada beberapa tahun terakhir ada kecenderungan besar-besaran untuk mambudidayakan gaharu terutama di wilayah Asia Tenggara (Squidoo. Jambi. dan Kalimantan Selatan. Di Indonesia. eksploitasi gaharu secara ilegal ternyata tetap berlangsung dan konsumen yang kurang memahami hal ini secara tidak sadar justru menciptakan permintaan yang tinggi yang dapat membahayakan keberadaan tanaman Aquilaria (Blanchette. Untuk mengembangkan budidaya gaharu secara lebih luas. Sampai saat ini. tingginya harga gaharu dan makin langkanya tanaman gaharu di hutan alam juga mendorong masyarakat di berbagai daerah untuk melakukan budidaya gaharu seperti yang terjadi di Riau.

CITES.. Departemen Kehutanan...... saling memperkuat.. IRR atau tingkat pengembalian internal dirumuskan sebagai berut: 161 ...... laporan hasil penelitian...... NPV atau nilai kini bersih dirumuskan sebagai berikut: n Bt − Ct NPV = ∑ t =0 (1 + i)t ... (1) dimana: NPV Bt Ct i n = = = = = Net Present Value (Nilai Kini Bersih).. serta berbagai terbitan lainnya.. waktu..(Sri Suharti) kepentingan lainnya untuk bekerjasama dan berbagi (ruang.... biaya pada tahun t. dan data statistik yang tersedia... dan Benefit Cost Ratio (B/C )....... Tulisan ini bertujuan untuk memberikan gambaran tentang prospek pengusahaan gaharu oleh masyarakat melalui pola pengelolaan hutan berbasis masyarakat (PHBM)..... Internal Rate of Return (IRR). dan saling mendukung. Khusus untuk perhitungan analisis finansial usahatani gaharu digunakan kriteria kelayakan Net Present Value (NPV)..... diolah dan Dianalisis secara deskriptif... hak dan kewajiban) dengan prinsip saling menguntungkan.....Prospek Pengusahaan Gaharu .... Data dan informasi yang berhasil dihimpun. benefit atau penerimaan pada tahun t....... Suatu kegiatan usaha dinyatakan layak secara finansial bila nilai NPV > 0.. Asosiasi Gaharu Indonesia (Asgarin)............. METODOLOGI Tulisan ini merupakan hasil desk study dari berbagai pustaka... BPS.... tingkat diskonto atau potongan (=bunga bank yang berlaku).... umur ekonomi proyek (cakrawala waktu).. Data dan informasi serta literatur tersebut dihimpun dari berbagai sumber antara lain........

...... (2) dimana: IRR = i1 = NPV1 = i2 = Internal Rate of Raturn (tingkat keuntungan internal)......................... tingkat diskonto untuk menghasilkan NVP2 negatif mendekati nol........................... (3) dimana: B/C Bt Ct i n = = = = = Benefit Cost Ratio ( Rasio penerimaan-biaya).. PROSPEK PENGUSAHAAN GAHARU A......... Selanjutnya. benefit atau penerimaan pada tahun t. biaya pada tahun t. Suatu bisnis dinyatakan layak secara finansial bilai nilai IRR lebih besar dari tingkat suku pinjaman di bank yang berlaku saat ini... Prospek Pasar Gaharu Indonesia adalah produsen gaharu terbesar di dunia dan menjadi tempat tumbuh endemik beberapa spesies gaharu komersial dari 162 ... Kegiatan usaha dikatakan layak apabila B/C > 1. NPV2 = nilai NPV negatif mendekati nol........Aspek SOSIAL EKONOMI DAN KONSERVASI IRR = i1 + NPV1 NPV1 − NPV2 (i2 − i1) .......................... nilai B/C dirumuskan sebagai beikut: n Bt ∑ t =0 (1 + i)t B/C = n Ct ∑ t =0 (1 + i)t . tingkat diskonto......... umur ekonomis proyek.. tingkat diskonto untuk menghasilkan NPV1 mendekati nol................... nilai NPV mendekati nol positif..............

. beccariana. Hal ini banyak dikeluhkan oleh beberapa eksportir gaharu Indonesia. dan lain-lain. Semakin sulitnya mendapatkan gaharu di hutan alam telah mengakibatkan semua pohon gaharu (Aquilaria spp. Selanjutnya. karena sulitnya memperoleh bahan 163 . Pada tahun 1985.400 kg tahun 2006. total ekspor gaharu dari Indonesia terus menurun hingga jauh di bawah ambang kuota CITES.. 2004).245 kg pada tahun 2005 menjadi 39.(Sri Suharti) marga Aquilaria seperti A. malaccensis. Bahkan sejak tahun 2000..Prospek Pengusahaan Gaharu . Ekspor untuk pasar Timur Tengah sebagai contoh menurun dari 67. Oleh karena itu pada tahun 1995 CITES memasukkan A. microcarpa. tetapi juga digunakan sebagai bahan baku obat-obatan. dupa. maka sejak tahun 2005 Departemen Kehutanan kembali menurunkan kuota ekspor menjadi hanya 125 ton/tahun (Anonim. namun eksploitasi hutan alam tropis dan perburuan gaharu yang tidak terkendali telah mengakibatkan spesies-spesies gaharu menjadi langka. Perkembangan yang terjadi selanjutnya ternyata kurang begitu bagus. 2005). Permintaan terhadap gaharu terus meningkat karena banyaknya manfaat gaharu. A. malaccensis. dan pengawet berbagai jenis asesoris.. gaharu tidak hanya digunakan sebagai bahan wangi-wangian (industri parfum). beberapa agama di dunia mensyaratkan wangi gaharu yang dibakar sebagai sarana peribadatan (untuk keperluan kegiatan religi). Seiring dengan kemajuan ilmu pengetahuan dan teknologi industri. Namun dari sisi negara pengekspor. A. penghasil gaharu terbaik ke dalam daftar Ap-pendix II dan sejak saat itu ekspor gaharu dibatasi oleh kuota yaitu hanya 250 ton/tahun (Anonim. jumlah ekspor gaharu Indonesia mencapai sekitar 1.) dimasukkan dalam Apendix II pada konvensi CITES tanggal 2-14 Oktober 2004 di Bangkok (Gun et al. 2005). Tingginya harga jual gaharu mendorong masyarakat untuk memburu gaharu. A. tingginya permintaan gaharu belum dapat dipenuhi karena kekurangan bahan baku bermutu tinggi untuk ekspor. kosmetika. Selain itu.487 ton.. tidak hanya dengan cara memungut dari pohon gaharu yang mati alami melainkan juga dengan menebang pohon hidup. hirta. dan Gyrinops spp. filarial. A. karena adanya kekhawatiran akan punahnya spesies gaharu di Indonesia.

000 kg) 148.000 75.593 305.filarial 180.000 150.000/ kg untuk kualitas rendah dan Rp 80.523 (termasuk A.000 225. filarial dan jenis lain 287. 2009). harga gaharu di tingkat pengumpul berkisar antara Rp 30. **): CITES Annual Report Data Compiled by UNEP-WCMC. Sebagai contoh.000/kg pada tahun 1993.826 n/a n/a Total ekspor gaharu (semua spesies)*) n/a≠ 299.000 150.000 68.000 Kuota hasil aktual*) n/a 160.245 n/a Tahun 1995 1996 1997 1998 1999 2000 2001 2002 2003 *): CITES Management Authority of Indonesia.000 50. ≠): the reason for the unavailability of data for 1995 1nd 1998 is not known 164 .577 293.000 225.150 219.826 70. pada tahun 2006 hanya mampu mengekspor 2-3 ton/bulan (Adijaya.002 n/a ≠) 313.000 120. Pada awalnya kenaikan harga gaharu relatif lambat.593 287.2003 Kuota hasil panen resmi*) n/a 300. yaitu hanya naik menjadi Rp100.000 75. pada Tabel 1 disajikan data hasil kajian tentang perdagangan gaharu di Indonesia yang diterbitkan CITES pada tahun 2003.079 81. Pada tahun 1980.483 147. Kenaikan pesat terjadi pada saat krisis ekonomi melanda Indonesia tahun 1997. Penurunan kemampuan ekspor Indonesia tersebut sangat berpengaruh terhadap perkembangan harga gaharu.Aspek SOSIAL EKONOMI DAN KONSERVASI baku gubal super yang diminta.000 70.377 74. Keluhan kekurangan bahan baku gaharu untuk ekspor juga dialami oleh pemasok pasar Singapura.000/kg untuk kualitas super. Penurunan kemampuan ekspor Indonesia tersebut sudah diprediksi oleh berbagai pihak karena eksploitasi hutan dan perburuan gaharu yang tidak terkendali.212 76.377 74.000 300.000-50. Sebagai gambaran. baik di pasar dunia maupun di tingkat pengumpul.238 81. CV Ama Ina Rua.772 175.401 81.000 300.002 (termasuk A. Tabel 1. dari Indonesia tahun 1995 .649 245.000 180.000 50. eksportir di Jakarta yang pada tahun 2005 bisa mengekspor 5-6 ton/bulan.000 Aktual ekspor berdasar CITES Indonesia*) n/a≠)) 299.546 n/a Net ekspor laporan CITES **) 323. Hasil pemanenan dan ekspor gaharu jenis Aquilqria spp.

Philipina.Prospek Pengusahaan Gaharu . Gyrinops. Wiguna. A. Malaysia. Potensi dan Peluang Usaha Sebagaimana diuraikan sebelumnya. Dari kawasan hutan tersebut khususnya dari kawasan hutan produksi alam. Kenaikan harga gaharu terus berlanjut dan makin tajam hingga mencapai Rp10 juta/ kg pada tahun 2000 dan meningkat lagi hingga mencapai Rp 15 juta/ kg pada tahun 2009 (Adijaya.23 juta ha (Departemen Kehutanan. Kamboja.. hirta. microcarpa..(Sri Suharti) di mana harga gaharu mencapai Rp 3-5 juta/kg. A. Hutan Produksi Terbatas 22. khususnya bagi Indonesia yang memiliki potensi biologis yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. Enam di antaranya ditemukan di Indonesia (A. beccariana. Pada saat ini luas kawasan hutan dan perairan Indonesia berdasarkan Keputusan Menteri Kehutanan tentang Penunjukkan Kawasan Hutan dan Perairan serta Tata Guna Hutan Kesepakatan (TGHK) tercatat seluas 137. Lao PDR.31 juta ha. terdiri dari Kawasan Suaka Alam dan Pelestarian Alam 23.6 juta ha. dan Gonystilus yang keseluruhannya termasuk dalam famili Thymelaeaceae. Marga Aquilaria terdiri dari 15 spesies. China Selatan. 2009.09 juta ha. malaccensis. 2007). tersebar di daerah tropis Asia mulai dari India. sehingga produksi gaharu Indonesia terus menurun. dan Taman Buru 0. Indonesia memiliki potensi yang sangat besar untuk menghasilkan gaharu. dihasilkan gaharu sebagai salah satu hasil hutan bukan kayu yang bernilai ekonomi tinggi. A. 2006).8 juta ha. B. Kondisi tersebut menggambarkan bahwa gaharu sangat prospektif untuk dikembangkan. Thailand. namun potensi yang tersedia tersebut sampai saat ini belum dimanfaatkan secara optimal dan produksi gaharu lebih banyak berasal dari proses alami. Hutan Produksi yang Dapat Dikonversi 22. A.. dan Indonesia.. 165 . Hutan Lindung 31. Gaharu dihasilkan oleh pohon-pohon terinfeksi yang tumbuh di daerah tropika dan memiliki marga Aquilaria. cumingiana.5 juta ha. Myanmar. Pakistan. Hutan Produksi Tetap 36.65 juta ha.

Bali. Pemanenan dapat dilakukan pada kondisi pohon belum mati. tersebar di Asia Tenggara mulai dari Malaysia. dan Irian Jaya. Marga Gyrinops memiliki tujuh spesies. Persyaratan tumbuh serta pemeliharaan tanaman penghasil gaharu relatif tidak terlalu rumit. kemedangan. 2007).Aspek SOSIAL EKONOMI DAN KONSERVASI dan A. Berbagai hasil penelitian tentang tanaman gaharu memberikan hasil yang sangat menggembirakan karena berbagai jenis tanaman gaharu dari hutan alam ternyata dapat dibudidayakan dan produksi gaharu dapat direkayasa. Kalimantan. kelapa. Bali. Peninsula. Pembudidayaan tanaman penghasil gaharu dapat dilakukan secara monokultur maupun tumpangsari dengan tanaman lainnya. dan Nusa Tenggara. rekayasa produksi untuk menghasilkan gaharu sudah dapat mulai dilakukan dengan cara teknik induksi/inokulasi penyakit pembentuk gaharu yang sesuai dengan jenis pohon. Philipina. Marga Gonystilus memiliki 20 spesies. Karena sifat permudaan gaharu yang toleran terhadap cahaya (butuh naungan). mahoni. Papua New Guinea. HTI. kecuali Jawa. Hutan Rakyat juga dapat ditanam pada areal tanaman perkebunan (karet. Serawak. Sembilan spesies di antaranya terdapat di Indonesia yaitu di Sumatera. Keberhasilan berbagai hasil penelitian 166 . dan kepulauan Solomon serta kepulauan Nicobar. sawit. dan lain-lain). tetapi idealnya dipanen setelah pohon mati dengan variasi mutu produksi akan terdiri dari kelas gubal. Maluku. Enam di antaranya tersebar di Indonesia bagian timur serta satu spesies terdapat di Srilanka (Anonim. Jika ditanam secara monokultur dan tanpa naungan resiko kegagalan penanaman (tanaman muda) lebih tinggi. Setelah tanaman penghasil gaharu berumur 5 tahun dengan diameter 15 cm. Indonesia. sawit. 2009) atau di bawah tegakan pohon hutan seperti meranti. Hasil rekayasa tersebut dapat dipanen satu atau dua tahun kemudian. 2002). filarial). Keenam jenis tersebut terdapat hampir di seluruh kepulauan Indonesia. Beberapa alternatif pengembangan budidaya pohon penghasil gaharu selain pada hutan produksi (LOA). penanaman pohon gaharu sebaiknya dilakukan secara tumpangsari atau berada di bawah naungan tegakan lain seperti karet. pulai seperti yang dikembangkan di KHDTK Carita. dan abu/ bubuk (Sumarna. durian (Rizlani dan Aswandi. Sabah.

berikut ini dilakukan contoh analisis finansial budidaya gaharu dengan asumsi tingkat keberhasilan mencapai 60%..(Sri Suharti) tersebut makin mendorong dan menggugah pemburu gaharu untuk melakukan budidaya tanaman gaharu.Prospek Pengusahaan Gaharu . sampai akhir tahun 2002 terdapat sekitar 116 petani yang tergabung dalam Kelompok Tani Penghijauan Indah Jaya yang telah mengembangkan lebih dari seratus ribu bibit gaharu (Anonim. 2007). malacensis dan A. sehingga total produksi 480 kg/ha dengan 3 kualitas masingmasing kelas kemedangan I sebesar 10%. Analisis finansial tersebut menggunakan beberapa batasan dan asumsi sebagai berikut: 1. Tanaman yang bertahan hidup dan menghasilkan gaharu diasumsikan 60% dengan tingkat produksi 2 kg per pohon. Kabupaten Merangin.. Di desa tersebut. Pengusahaan gaharu dilakukan pada luasan satu ha dengan jarak tanam 5 m x 5 m. Upaya pembudidayaan gaharu sudah mulai dirintis sejak tahun 1994/1995 oleh sebuah perusahaan pengekspor gaharu. Sebagai contoh usaha yang dilakukan oleh para petani di Desa Pulau Aro. Kelayakan Pengusahaan Gaharu Untuk memperoleh gambaran bagaimana kelayakan pengusahaan gaharu melalui budidaya dan rekayasa produksi gaharu. microcarpa. 2. sehingga kerapatan 400 pohon per hektar. BP DAS Batanghari bekerjasama dengan Badan Litbang Kehutanan pada 2004/2005 membuat demplot budidaya gaharu di antara tegakan tanaman karet rakyat seluas 50 ha (Sumarna. 2008). PT Budidaya Perkasa di Riau dengan menanam A. kelas kemedangan II sebesar 40%. dan kelas kemedangan III sebesar 50%.. C. Selain itu Dinas Kehutanan Riau juga menanam jenis yang sama seluas 10 hektar di Taman Hutan Raya Syarif Hasyim. 167 . Selanjutnya pada tahun 2001-2002 beberapa individu atau kelompok tani juga mulai tertarik untuk membudidayakan jenis pohon penghasil gaharu. Kecamatan Tabir Ulu. Jambi. Selain itu.. malaccensis seluas lebih dari 10 hektar. yang menanam gaharu dari jenis A.

Analisis finansial menggunakan tingkat diskonto sebesar 15%. dan adanya pencurian pohon di kebun gaharu (Duryatmo. dan biaya tenaga kerja Rp 74.50 juta. kegagalan dalam melakukan inokulasi. dan kelas kemedangan III = Rp 500 ribu/kg. 6.47% dari total biaya. Hasil analisis finansial menunjukkan bahwa pengusahaan gaharu tersebut layak untuk dilaksanakan karena dapat menghasilkan keuntungan bersih nilai kini (NPV) sebesar Rp 147. Kalau diperhatikan lebih seksama. IRR sebesar 48. 2009).50 juta.53%. baik tenaga kerja keluarga maupun luar keluarga diasumsikan sebesar Rp 50. Upah tenaga kerja. beban biaya yang relatif besar adalah untuk pembelian bahan inokulan. kelas kemedangan II = Rp 2 juta/ kg. Namun di sisi lain juga dijumpai beberapa kasus ketidakberhasilan pengusahaan gaharu yang disebabkan antara lain oleh kegagalan dalam pemeliharaan. Harga jual produksi gaharu hasil inokulasi untuk kelas kemedangan I = Rp 5 juta/kg. Berdasarkan asumsi dan batasan tersebut ternyata untuk pengusahaan satu hektar gaharu dibutuhkan biaya sebesar Rp 141. Harga inokulan diasumsikan Rp 50. dan B/C = 3. sehingga total biaya inokulan Rp 20 juta/ha.350 juta. tenaga kerja untuk inokulasi. 4. PROSPEK PENGUSAHAAN GAHARU DENGAN POLA PHBM A.Aspek SOSIAL EKONOMI DAN KONSERVASI 3.74 juta/ ha. sedangkan upah tenaga kerja untuk inokulasi Rp 30. Peluang Pengembangan Gaharu dengan Pola PHBM Pembudidayaan tanaman penghasil gaharu akhir-akhir ini makin marak karena sebagian masyarakat sudah dapat menikmati hasilnya. dan tenaga kerja untuk pemungutan hasil (panen) yang besarnya mencapai Rp 77 juta atau sekitar 54. Biaya tersebut meliputi biaya pra-investasi dan persiapan lahan serta penanaman sebesar Rp 26.000/HK. biaya bahan dan peralatan Rp 40.000/pohon. 5. 168 .000/pohon.32 (Lampiran 1).350 juta.

parapihak yang tertarik (pemerintah. keterampilan. Perubahan paradigma ke arah PHBM menjadi momentum penting bagi masyarakat desa hutan. masyarakat diharapkan melakukan penanaman gaharu pada lahannya sendiri terutama pada lahan kosong (tidak produktif ) secara swadaya.Prospek Pengusahaan Gaharu ... Pengembangan gaharu melalui pola PHBM merupakan salah satu alternatif peningkatan produksi gaharu melalui pelibatan masyarakat dalam budidaya gaharu. 2009). sarana prasarana. meningkatkan peluang keberhasilan serta mengurangi resiko kerugian yang diderita. Di satu sisi masyarakat dapat mendayagunakan potensi-potensi kehutanan untuk kesejahteraan mereka.(Sri Suharti) Untuk lebih membudayakan penanaman gaharu secara luas. PHBM merupakan salah satu jawaban dari pergeseran paradigma dalam pengelolaan sumberdaya hutan dari yang berbasis negara (state based) ke arah yang berbasis komunitas/masyarakat (community based) (Indradi. baik dalam areal hutan milik (hutan rakyat) maupun dalam kawasan hutan Negara. Melalui pola PHBM. Salah satu bentuk kemitraan yang dapat dikembangkan adalah melalui pola pengelolaan hutan berbasis masyarakat (PHBM). dan pengelolaan hutan (Hayat. input produksi.. pengusaha/investor. dan di sisi lain. perlu dikembangkan suatu pola kemitraan dalam budidaya tanaman penghasil gaharu. Karena bentuk kerjasamanya adalah kemitraan. kelompok usaha bersama/koperasi. pemeliharan. masyarakat di dalam dan di sekitar kawasan hutan dapat menjadi aset bagi usaha-usaha penjagaan. Masyarakat dengan keterbatasan sumberdaya yang dimiliki (lahan. Pada areal hutan milik. 169 .. 2007). dan lain-lain) dapat ikut berperan dalam pengusahaan tanaman gaharu. baik di lahan milik di luar kawasan hutan maupun di kawasan hutan. Dengan pola ini diharapkan areal tanam dan juga kualitas dan kuantitas produksi gaharu akan dapat ditingkatkan. maka parapihak yang terlibat dalam kegiatan ini dapat memperoleh bagian/ sharing manfaat sesuai kontribusi masing-masing. akses pasar. masyarakat) dapat berbagi peran dan tanggung jawab untuk mengembangkan tanaman gaharu. Pengembangan gaharu dengan pola PHBM dapat dilakukan.

Oleh karena lahan milik rakyat umumnya tidak begitu luas dan sudah ditumbuhi berbagai jenis tanaman. produktivitas meningkat serta kesejahteraan masyarakat akan meningkat pula.Aspek SOSIAL EKONOMI DAN KONSERVASI Agar masyarakat bersedia menanam gaharu. sosial maupun ekologi. Berbagai hasil penelitian menunjukkan bahwa pola kerjasama kemitraan pengelolaan hutan dengan masyarakat desa hutan memberikan dampak positif. Dalam prakteknya pengembangan hutan rakyat gaharu umumnya dikombinasikan dengan tanaman semusim atau tahunan lainnya yang sudah ada (tanaman sisipan). Pengembangan tanaman gaharu dalam kawasan hutan dapat dilakukan melalui pelibatan masyarakat sekitar hutan dalam pengelolaan hutan. baik secara ekonomi. Pengadaan bibit dan inokulasi dapat difasilitasi oleh mitra kerjasama yang disalurkan kepada petani. maka pola tanam yang dikembangkan adalah pola tumpangsari (sisipan atau tanaman sela di antara tegakan yang sudah ada). Adanya peningkatan kesejahteraan dari budidaya gaharu selanjutnya akan mengurangi tekanan masyarakat terhadap sumberdaya hutan dalam bentuk illegal logging dan perambahan lahan bahkan masyarakat secara sadar akan mempertahankan 170 . biaya tanam. Keterlibatan masyarakat dalam pengelolaan hutan meningkatkan posisi tawar serta rasa memiliki masyarakat terhadap sumberdaya hutan yang ada. maka perlu diberikan berbagai bentuk insentif. Oleh karena kawasan hutan umumnya sudah ditumbuhi dengan berbagai jenis tumbuhan. baik berupa pengadaan bibit. proporsi tanaman gaharu yang ditanam disesuaikan dengan luasan dan kondisi areal hutan milik yang ada. Hal ini sesuai dengan paradigma pembangunan kehutanan yang lebih menitikberatkan pada peningkatan partisipasi masyarakat dalam pengelolaan hutan dan menempatkan masyarakat desa hutan sebagai patner/mitra menuju pengelolaan hutan lestari. baik dalam bentuk bantuan/hibah maupun melalui sistim kredit yang akan dibayar jika tanaman gaharu telah menghasilkan nantinya. Dampak positif yang terjadi selanjutnya adalah sumberdaya hutan akan lebih terjaga dan terpelihara. biaya inokulasi tanaman maupun informasi tentang peluang dan teknik pengembangan gaharu.

. Pengembangan kerjasama memang layak secara ekonomi dalam jangka panjang (sesuai jangka waktu kontrak perjanjian kerjasama). Menempatkan masyarakat sebagai mitra dalam pengelolaan hutan secara tidak langsung juga telah memposisikan masyarakat sebagai garda terdepan dalam pengamanan sumberdaya hutan. 4. pemeliharaannya relatif mudah dan bernilai ekonomi tinggi. Dari sisi masyarakat.. B. 171 . apapun penyebabnya (Aswandi. Adanya tujuan bersama yang ingin dicapai. Beberapa prinsip utama yang dipegang dalam pengembangan gaharu dengan pola PHBM adalah: 1. Adanya pengaturan kerjasama yang saling menguntungkan dan adil sesuai dengan kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan bersama. 2..Prospek Pengusahaan Gaharu . Adanya kesepahaman tentang resiko dan konsekuensi dari adanya perjanjian kerjasama tersebut. Sistim Bagi Hasil dalam PHBM Pengembangan gaharu dengan pola PHBM merupakan salah satu alternatif usaha yang dapat mengakomodasikan kepentingan ekologi di satu sisi dan pertimbangan ekonomi di sisi lain. 3. Tanaman gaharu dipilih karena tanaman ini dapat tumbuh di dalam areal hutan yang sudah banyak ditumbuhi tegakan pohon dengan intensitas cahaya < 70%.. pengembangan gaharu dengan pola PHBM memberikan peluang kepada masyarakat untuk memperoleh manfaat ganda yaitu dari hasil tanaman gaharu jika telah menghasilkan nantinya serta kesempatan untuk memanfaatkan lahan di antara tanaman untuk usahatani tanaman semusim.(Sri Suharti) setiap jengkal hutan dari kerusakan. 2009). Beberapa skenario sebagai alternatif bentuk kemitraan yang dapat dikembangkan antara lain sebagaimana disajikan dalam Tabel 2.

pengembangan gaharu dengan pola PHBM dapat dilakukan di areal hutan milik maupun di dalam kawasan hutan sepanjang persyaratan tumbuhnya terpenuhi. Dengan pola PHBM. Pemda/Pihak lain Sebagaimana diuraikan sebelumnya. Berbeda dengan pengusahaan gaharu skala besar yang dilakukan oleh para investor. Sebagaimana sifat usahatani skala kecil oleh masyarakat yang ketergantungannya terhadap lahan usahatani yang dimiliki/digarap sangat tinggi. Besarnya bagi hasil yang diperoleh oleh masingmasing pihak yang terlibat dalam PHBM disesuaikan dengan kontribusi masing-masing pihak dan merupakan hasil kesepakatan bersama. tergantung luas lahan garapan dan kepadatan tanaman yang ada.Aspek SOSIAL EKONOMI DAN KONSERVASI Tabel 2. Dengan demikian meskipun investor/penyandang dana 172 . Alternatif bentuk kemitraan yang dapat dikembangkan Jenis input Skenario I 1 Lahan Saprodi Tenaga kerja Bahan inokulan Biaya inokulasi Pengolahan hasil Pemasaran √ √ √ √ √ √ √ 2 3 Skenario II 1 √ √ √ √ √ √ √ 2 3 Skenario III 1 √ √ √ √ √ √ √ √ √ √ √ √ 2 3 Skenario IV 1 2 3 √ √ Keterangan: 1. 2. baik dari segi permodalan. Gaharu diusahakan sebagai investasi jangka panjang. Konsekuensinya. maka gaharu bukan merupakan komoditi utama yang diusahakan. teknologi serta akses terhadap pasar dapat ikut berpartisipasi dalam budidaya tanaman gaharu. diharapkan masyarakat yang memiliki banyak keterbatasan. Investor/Pengusaha. Petani. budidaya gaharu oleh masyarakat umumnya dilakukan dalam skala kecil dengan pola campuran. sepanjang modal yang dimiliki mencukupi untuk biaya budidaya tanaman berikut biaya inokulasinya yang cukup besar. populasi tanaman gaharu dalam setiap garapan petani berjumlah relatif sedikit serta tidak seragam. 3.

pulai. Oleh karena areal kerjasama sudah ditumbuhi berbagi jenis tumbuhan. Uji coba ini merupakan kerjasama antara Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam dengan masyarakat sekitar areal KHDTK Carita. petai. Gaharu ditanam dengan jarak ± 5 m x 5 m. belum tentu bagian hasil/sharing yang diperolehnya akan paling besar pula. cengkeh. dan Cilaban sebanyak 49 orang (anggota Kelompok Tani Hutan Giri Wisata Lestari yang dipimpin Ustad Jafar sebanyak 40 orang dan Kelompok Tani Hutan Carita Lestari pimpinan Pak Rembang sebanyak 19 orang). di areal tersebut juga terdapat berbagi pohon hutan seperti meranti. dan nangka.. C.(Sri Suharti) memberikan kontribusi input dengan porsi terbesar. khaya. Kegiatan dilaksanakan dengan melibatkan masyarakat yang telah berusahatani di areal tersebut untuk ikut mengembangkan tanaman penghasil gaharu di lahan garapan mereka. dan hawuan. jengkol. maka pola tanam yang diterapkan adalah pola tumpangsari (sisipan di antara tanaman yang ada). Selain tanaman JPSG milik masyarakat. durian. Kegiatan dilaksanakan pada sebagian Petak 21 di areal KHDTK Carita dengan luas ± 40 hektar. Selama ini masyarakat ikut menggarap lahan di Petak 21 dengan budidaya berbagai tanaman jenis pohon serbaguna (JPSG) dan buah-buahan seperti melinjo.. Apalagi jika pengembangan kemitraan dengan pola PHBM bertujuan untuk meningkatkan kelestarian sumberdaya hutan (dalam hal ini tanaman gaharu yang sudah langka) dan meningkatkan kesejahteraan masyarakat desa hutan dan bukan semata-mata untuk tujuan komersial (mendapat profit terbesar). Uji Coba Pengembangan Gaharu dengan Pola PHBM di KHDTK Carita Di areal KHDTK Carita. Banten. Kelompok masyarakat yang terlibat dalam kegiatan penelitian ini berasal dari Desa Sindang Laut dan Desa Suka Jadi tepatnya dari Kampung Longok. Cangkara. Banten pada tahun 2008 telah dikembangkan uji coba skema kemitraan budidaya tanaman penghasil gaharu dengan pola PHBM..Prospek Pengusahaan Gaharu . mahoni. Dengan demikian jumlah 173 ..

Beberapa prinsip utama yang disepakati antara pihak pertama (Puslitbang Hutan dan Konservasi Alam) dengan pihak kedua (kelompok masyarakat peserta uji coba) dalam pola kemitraan di areal KHDTK carita adalah: 1. 4.Aspek SOSIAL EKONOMI DAN KONSERVASI tanaman gaharu yang ditanam di areal kerjasama sebanyak 15. Pihak pertama akan memberikan pelatihan budidaya gaharu serta pemanenan gaharu (paket training gaharu) kepada pihak kedua. Dengan pendekatan yang lebih intensif ini diharapkan masyarakat akan lebih memahami tujuan kerjasama penelitian serta dapat lebih aktif berpartisipasi dalam budidaya tanaman plot uji coba. 3.000 pohon (± 400 pohon/ha). 174 . 2. Pihak pertama memberikan pembinaan teknis budidaya tanaman gaharu secara rutin kepada pihak kedua. Sebelum penanaman. Pihak pertama akan membantu mencarikan investor untuk bekerjasama menyediakan produksi jamur pembentuk gaharu untuk kegiatan inokulasi untuk 75% tanaman gaharu lainnya. 5. dan masyarakat calon peserta untuk mempelajari prospek partisipasi masyarakat dalam kegiatan dan pemeliharaan tanaman. Pihak pertama menyediakan jamur pembentuk gaharu untuk kegiatan inokulasi sebanyak 25% dari jumlah tanaman gaharu pada masing-masing penggarap setelah tanaman gaharu berumur ≥ 5 tahun. Pemda. Setelah diperoleh gambaran prospek partisipasi masyarakat dalam pembangunan demplot uji coba ini dilanjutkan dengan penyusunan rancangan teknis kerjasama penelitian dan penyusunan draft perjanjian kerjasama. kegiatan pembangunan demplot uji coba tanaman penghasil gaharu di KHDTK Carita diawali dengan pendekatan yang lebih intensif kepada berbagai pihak yang terkait pengembangan gaharu di areal tersebut seperti Perhutani. Pihak pertama menyediakan biaya bagi pihak kedua untuk melakukan kegiatan budidaya penanaman pohon gaharu yang meliputi biaya upah dan bibit tanaman.

Selain pihak pertama dan pihak kedua. Pihak kedua berkewajiban mengikuti aturan teknis dan kaidah konservasi yang berlaku di dalam areal KHDTK Carita. pihak pertama dan pihak kedua memperoleh hasil tanaman gaharu yang ditanam dan dipelihara di lokasi kerjasama dengan proporsi masing-masing 35% untuk pihak pertama dan 60% untuk pihak kedua.5%. Jika pada saat pemanenan tanaman gaharu ternyata ada tanaman yang mati/hilang/tidak/belum menghasilkan. kebakaran atau bencana lain yang mengakibatkan kerusakan sumberdaya hutan. 9. Pihak kedua berkewajiban memelihara dan menjaga keamanan tanaman gaharu dan tanaman hutan lainnya. sebagian hasil tanaman gaharu akan diberikan pada Desa Sindang Laut sebesar 2..5% dan LMDH (kelompok) 2. 7. Pihak kedua berkewajiban melaporkan setiap kejadian seperti serangan hama/penyakit tanaman. 10.(Sri Suharti) 6. 175 . 8. Jika sudah menghasilkan. maka resiko akan ditanggung bersama sehingga perhitungan bagi hasil pada saat panen ditentukan dengan rumus sebagai berikut: = P akhir ∑ tan total − ∑ tan mati x P awal ∑ tan total Keterangan: Pakhir = Proporsi bagi hasil tanaman gaharu yang diterima masingmasing pihak jika ada tanaman yang mati/hilang/tidak/ belum menghasilkan = Proporsi bagi hasil tanaman gaharu sesuai kesepakatan yang tertuang dalam perjanjian kerjasama ini Pawal Butir-butir kesepakatan tersebut tertuang dalam naskah perjanjian kerjasama yang disusun berdasarkan hasil kesepakatan/ negosiasi antara pihak pertama dan pihak kedua.Prospek Pengusahaan Gaharu ... baik pada tanaman gaharu atau tanaman lainnya di areal kerjasama..

http:// www.dephut.53%. 4. Prinsip utama yang dipegang dalam pengembangan kerjasama kemitraan dengan pola PHBM adalah prinsip kelestarian dan kelayakan secara ekonomi dalam jangka panjang sesuai jangka waktu kontrak serta saling menguntungkan berdasarkan nilai kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan sosial. 2009. Skema kemitraan dengan pola PHBM memberikan kesempatan kepada para-pihak yang berminat mengembangkan tanaman gaharu untuk bekerjasama sesuai dengan input/sumberdaya yang dimiliki dan memperoleh bagian hasil/sharing sesuai dengan kontribusi serta kesepakatan parapihak yang terlibat.Aspek SOSIAL EKONOMI DAN KONSERVASI KESIMPULAN DAN SARAN 1.php?mod=publisher&op =viewarticle&cid=8 &artid=290. ekonomi. Diakses 20 Januari 2009. DAFTAR PUSTAKA Adijaya. dan ekologi. Gaharu sangat prospektif untuk dikembangkan.id/ Halaman/STANDARDISASI_& _LINGUNGAN_ KEHUTANAN/INFO_V02/VI_V02. http:// www. 5. Info Pusat Standardisasi dan Lingkungan Departemen Kehutanan.htm.co. IRR sebesar 48. Anonim. GAHARU: HHBK yang Menjadi Primadona. khususnya bagi Indonesia yang memiliki potensi biologi yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. 2. Budidaya gaharu layak untuk dilaksanakan karena secara finansial akan memberikan keuntungan bersih nilai kini (NPV) sebesar Rp 147.id/mod. Kerjasama kemitraan pengembangan tanaman penghasil gaharu dengan pola PHBM merupakan salah satu alternatif solusi untuk menjaga kelestarian hutan.74 juta/ha. 3. dan B/C = 3. D.trubus. Gaharu: Harta di Kebun. meningkatkan produktivitas lahan serta meningkatkan pendapatan masyarakat sekitar hutan.go. Trubus online. 2002.32. 176 .online. Diakses 16 Februari 2009.

2008.blogspot. Z. 2009. http://www.umn. 2009.com/2009/01/ prospek-budidaya-gaharu-secara ringkas. Rizlani.. Diakses. Pelatihan Nasional: BUDIDAYA DAN PENGOLAHAN GAHARU. R.. Sumari and P. com/gaharu. BUDIDAYA GAHARU : Alternatif Pemberdayaan Masyarakat Desa Hutan. Eaglewood in Papua New Guinea. 12 Februari.pdf. Anonim. A. Tersandung Wangi Gaharu.id/mod. 2003. 2007. S. or. Anonim. L. Chatteron. http:// www.. Di akses 4 Maret 2009. B.html..cites. http://www.com/2008/01 /perkembangangaharu-dan-prospeknya-di. http://laksmananursery.co. Vietnam. Perkembangan Gaharu dan Prospeknya di Indonesia. dan Aswandi. C. Diakses 13 Januari.. Diakses 16 Februari 2009. http:// forestry-senu57. 2009.ffi. Trubus online.id.(Sri Suharti) Anonim.edu/ agarwood. Sungadan. 2009. http://fwi.trubus-online.or. http://forestpathology. Duryatmo.id/id/news /1/tahun/2007/bulan/11/tanggal/17/id/ 60/. Depatemen Kehutanan. Steven. Diakses 16 Februari 2009. 2009. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). 3 2008. Gun. http://bpk-aeknauli. Diakses 16 Februari 2009. htm. Indradi.html.. 2007.Prospek Pengusahaan Gaharu ..php?mod=publisher &op=viewarticle&cid=1& artid=1618.org/index. 2009. M. http:// www. Prospek Budidaya Gaharu Secara Ringkas. Aswandi. Hayat. 2005. Statistik Kehutanan Indonesia 2006. Tropical Rain Fo rest Project. 177 . Jakarta. 51.org/eng /com/PC/14/EPC14-09-02-02-A2. P. BIOTROP Training and Information Centre. Access November. Blanchette. Sustainable Agarwood Production in Aquilaria Trees.blogspot. Diakses 16 Februari 2009. Y. (2004). Working paper No. Review of Significant Trade Aquilaria malaccensis.php ?option=com_content&task= view&id= 74&Itemid=1.htm. 2006. Diakses 4 Maret 2009. Departemen Kehutanan. Perjalanan Panjang Pengelolaan Hutan Berbasis Masyarakat di Indonesia.cfans.bticnet. Mencari Solusi PHBM di Geumpang.

Temu Pakar Pengembangan Gaharu. I.php?mod =publisher&op=viewarticle& cid=8 &artid=290. Squidoo. Wiguna. Direktorat Jenderal RLPS. 2007. Diakses 16 Februari 2009.Sumarna. LLC and respective copyright owners.id/mod. .co. squidoo.com/agarwood Copyright © 2008.trubus. Trubus online. 2006. Tinggi Permintaan Terganjal Pasokan. Squidoo. 2008. Access November.3 2008. Production and marketing of cultivated agarwood. http://www.online. Jakarta. Y. http://www. Budidaya dan Rekayasa Produksi Gaharu.

Tenaga kerja inokulasi Biaya tenaga kerja Total biaya Cash flow Cash flow komulatif a. Harga bibit Rp 15. Tenaga kerja keluarga 2. IRR. Keterangan I. Pupuk TSP/SP-36 4. Lampiran 1. Biaya tenaga kerja 1.3176 2500 1000 0 3500 16425 -16425 -21675 2500 1000 0 3500 7075 -7075 -28750 2000 500 0 2500 6850 -6850 -35600 1500 500 0 2000 6600 -6600 -42200 1500 500 12000 14000 39125 -39125 -81325 1500 500 0 2000 7125 -7125 -88450 1500 500 0 2000 6650 -6650 -95100 20000 25000 0 45000 46250 697750 602650 33000 29500 12000 74500 141350 602650 179 Catatan: Produksi gaharu 480 kg/ha dengan harga rata-rata Rp 1. 500 3000 1250 250 5000 0 0 0 0 0 250 0 250 6750 125 350 300 150 0 0 7675 0 125 350 300 300 0 0 1075 0 250 700 600 300 0 0 1850 0 250 700 600 300 250 0 2100 0 375 1050 900 300 0 20000 22625 0 2500 2500 250 5250 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 500 5500 20000 500 26500 6750 1750 4900 4200 1950 800 20000 40350 III.550. IV. Lain-lain Biaya pra investasi b.53% 3. Harga pupuk urea Rp 2500/kg. Pra investasi 1. dan pupuk kandang Rp 150/kg Harga inokulan Rp 50. Pupuk kandang 6. 744000 II. Biaya bahan & peralatan 1.000/phn.000/kg Harga gaharu K1= Rp 5 juta/kg.000/tanaman .000/kg. Bahan inokulan Biaya bahan & peralatan c. B/C 0 0 0 0 5250 -5250 -5250 147. Sewa lahan 4. Pupuk Urea 3. IRR (%) c. Cash inflow (Rp 1000) a. dan B/C dari Pengusahaan tanaman gaharu per hektar 0 0 0 0 0 0 0 0 0 480 744000 240000 384000 120000 0 0 1250 0 1250 0 375 1050 900 300 0 0 2625 0 250 700 600 300 300 0 2150 0 0 0 0 0 0 0 0 1 2 3 4 5 Tahun ke6 7 8 Total No. NPV (DF 15%) b. Persiapan lahan & tanam 3. K2= Rp 2 juta/kg dan K3=Rp 500. Peralatan pertanian 7. Nilai output Gaharu kemedangan I (10%) Gaharu kemedangan II (40%) Gaharu kemedangan III (50%) Cash outflow (Rp 1000) a. Pra-investasi 2.742 48. Output (kg) b. jumlah tanaman 400 phn/ha dibutuhkan 450 phn dg sulaman.Lampiran 1. Analisis NPV. Bibit tanaman gaharu 2. KCl Rp 6000/kg. Tenaga kerja upahan 3. Pupuk KCl 5. TSP Rp 7000/kg.

Aspek SOSIAL EKONOMI DAN KONSERVASI 180 .

Most of the gaharu formation usually relays on natural infection. namely. The success of gaharu formation may not be only due to inoculants but may also be influenced by environmental characteristics (climate.and in-side the forest in Indonesia. the gaharu production may be considered low. 181 . In South Kalimantan. Only small group of farmers using introduced inoculants. The present work focused on characterizing the environment. soil properties and plant diversity surrounding the newly grown and existing gaharu stands in South Kalimantan Province. South Kalimantan INTRODUCTION Eaglewood (gaharu) may play an important role in gaining foreign exchange and as a source of income for people living in out. This is because. climate. There is a lack of information on factors influencing the success of gaharu formation. soil properties and plant species). the gaharu export market remains open. Therefore there is a big opportunity for the Indonesian farmers to establish eaglewood plantation.10 THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo Lambung Mangkurat University.

2 Belanti (3) (HSS) Rejo (Banjar) 115. The data obtained were for the last 9 years observation. 115. The selected site were used for growing eagle wood and inoculation.5 Layuh (2. HST) Kalaka (HST) Kandangan (HSS) Madang (HSS) 115. South Kalimantan. 182 . Hulu Sungai Selatan (HSS) and Hulu Sungai Tengah (HST).8 3. 14 sites would be used for newly planted eaglewood trees and 9 sites for inoculation trial.4 3. The sites located in Banjar.4 2. The climatic data for all sites were represented by Kandangan weather station.0 2.2 3. The selected study sites B.4 oE 115.1 115.6 Figure 1. air temperature and relative humidity.7 Wawai (HST) 115.3 North 115.Aspek SOSIAL EKONOMI DAN KONSERVASI METHODS A. Climatic Characters The climate parameters collected were rainfall.6 2. The data were supplied by the Weather Bureau in Banjarbaru. Site Distribution of selected sites for the project can be seen in Figure 1.8 km 115.6 22. Location-wise.0 oS 3. HST) Aluan (3) (HST) Bawan (HST) Gading (HST) Batung (HST) Layuh (HKK) (HST) Rasau (HST) Kambat (2.

The pattern of air temperature and relative humidity are shown in Figure 2b and 2c.. total nitrogen (N). the content of total carbon (C). 183 . and CO2 evolution. RESULTS A. electric conductivity (EC). cation exchange capacity (CEC).. The average annual rainfall in the study area was 2361. D.. air temperature and relative humidity for the last 9 years are shown in Figure 2.. Method used for particle fraction analysis was described in Klute (1986) and the methods for other soil properties were described in Page et al. total potassium (K) and total phosphorus (P). In each site. The rainy season commenced in October and ended in July each year. A significant low rainfall occurred in the period of July-September. plant species grown under gaharu tree were collected plant within area of 6x6 m2. Soil Properties Soil properties measured were particle fraction analysis.72 mm. The rainfall distribution can be observed in Figure 2a. soil pH.(Erry Purnomo) C. Plant Diversity The diversity of plant species was determined to show its association with the success of inoculation. (1982).The Environmental Characteristics . respectively. Climatic Characters The average rainfall.

total potassium (K) and total phosphorus (P). Bars indicate the standard error mean 9 years observation B. (1994). 184 . followed by clay and sand fractions. level of status of each soil property will be made available as categorized by Djaenuddin et al. cation exchange capacity (CEC).Aspek SOSIAL EKONOMI DAN KONSERVASI 500 [a] 400 30 [b] 29 Air temperature (oC) 30 [b] 29 Rainfall (mm) 300 200 100 28 27 26 25 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month Air temperature (oC) 28 27 26 25 0 l t r r r r ary ary rch pri May June July gus mbe tobe mbe mbe nu ru Ma A Au pte Oc ove ece Ja Feb N D Se Month Figure 2. and CO2 evolution. Soil properties measures were particle fraction analysis. the content of total carbon (C). soil pH. Soil Properties The soil properties of each site are presented in Figures 3-11. air temperature [b] and relative humidity [c] for the last 9 years. If applicable. The particle fraction analysis (Figure 3) shows that all soil samples dominated by slit fraction. Total nitrogen (N). The rainfall [a]. electric conductivity (EC).

100 80 60 Sand Silt Clay % 40 20 0 n Bela 5 ti 1 t ) ) i s 3 g h 3 w . namely. The N content of the soils (Figure 5) was generally low. The total C of soil for each site 185 . The K and P contents of the soils from all sites are demonstrated in Figures 6.. Most of the selected sites contained very low C.0 Very low Be ti lan t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin ..16 angsa andala awai dingin awa au (10 Kate g Hig adin (2 & 3 lanti 1 ng Lo gkinkin W as M W Man uh an aur G bat da Han Be TL R Lay Mad H Ma Kam Site Figure 3.5 Total C content (%) 1.0 0.16 gsa da i H i 15 T Lan Man Waw and Waasauyuh K ang ur Gaat (2Belandang angk M R La Mad Ha mb H Ma Ka Site Figure 4.5 0. Mandala and Madang Low had K content of moderate level.(Erry Purnomo) The category range of total C total content was very low to low (Figure 4).. Two sites..The Environmental Characteristics . Most of the soil classified as very low to low level of K concentration. only 5 sites had low C.0 Low 1. Particle fraction analysis of each soil 2. It was found that Wawai and Belanti 13 sites had very low and moderate levels of N content. respectively. The low level of C and N content confirms the low level of organic matter content of the soil.5 Moderate 2.

10 0. Number of Plant Species It was observed that the number of plant species was varied from site to site (Figure 12).20 Total N content (%) Low 0.00 Very low la n Be 16 ngsat dalawai 3 inginawai (10) ates High ding & 3) ti 13 Low inkin n a d W sau h K ng r Ga t (2 elan ang ngk 5ti 1 T La Ma W Man B ad Ha Ra Layu ada Hau mba M M Ka Site Figure 5. The low EC readings indicate the absence of salinity problem. For EC reading. except for Hangkinkin site. The low CEC indicates a low storage cation capacity and results in prone to cation leaching. at Madang Low. The low EC readings may be associated with the far distance from the shore.Aspek SOSIAL EKONOMI DAN KONSERVASI 0. all soils had EC below 1 mS cm-1 (Figure 9). there were 3-5 plant species.25 Moderate 0. Only one site (Rasau 10) was categorized as very high (Figure 7). There were 3 sites and 2 sites had CEC of moderate and high. it was observed that the microbial was lower than the other sites. Except. respectively. Only one site (Belanti 13) had a slightly acidic value (Figure 8). 186 . At 5 sites. The CEC of the soils were commonly low (Figure 10).15 0. Almost all the soil pH of the selected soils was categorized into very acidic to acidic category.05 0. The total N of soil for each site One site (Rasau 10) had a very high K level. Most of total P content of the soils was categorized as very low to low. The CO2 evolution as an indication microbial activity was similar site-wise (Figure 11). C.

Total K content of soil for each site 2600 2400 Total P content (%) 2200 2000 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s . Total P content of soil for each site 187 .16 gsa dalawai 3inginawa u (10 ate High ding & 3nti 13 Lowinkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2Belaadangangk M H L M d Ha am b a M K Site Figure 6..The Environmental Characteristics . 1200 1000 Total K content (%) 800 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s i ...16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 7.(Erry Purnomo) The other 8 sites had 5-14 plant species and one site had 22 plant species..

16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 9. Electrical conductivity readings for soil each site Cation exchnage capacity (cmol[+]kg-1) 40 30 High 20 Moderate 10 Low Very low ) ) t s i g a 3 3 h n n .16 gsa dal ai ngi wa (10 ate Hig din & 3 ti 1 Low nki 15 T Lan Man Waw andi Wa asau yuh K ang ur Gaat (2Belan dang angki R La n ti a M H ad Ha m b a M M Bel Ka Site 0 Gambar 10.Aspek SOSIAL EKONOMI DAN KONSERVASI 7 Neutral Slightly acidic 6 Soil pH H2O 5 Acidic 4 Very acidic la i 3 6 in in ai 10) 3) 13 ow at es igh ng 5 .1 angs anda awanding aw au (uh Katng Hr Gadi (2 & lantiang Lngkink WRas y W Ma M BeMad Ha n ti 1 T L L a Ma d a H a u m b a t a Bela K Site 0 Figure 8. Soil pH for each site 130 Electric conductivity (mScm-1) 120 110 100 2 1 0 nt Bela ) ) t s . Cation exchange capacity of soil for each site 188 .

16 gsa dal wai 3 inginawa u (10 ate High din & 3nti 1 g Low inkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2BelaadanHangk M L M d Ha am b a M K Site Gambar 11. The number of plant species found in each site 189 . CO2 evolution from soil from each site DISCUSSION The rainfall pattern was typical the study area.The Environmental Characteristics . The schedule of inoculation may have to consider the climatic condition throughout the year.16 gsa da H i i 15 T Lan Man W aw and W a asau yuh Kdang ur Ga at (2 Belan dang angk M nti R La Ma H Ha amb Ma ela B K 0 Sites Gambar 12. The highest rainfall occurred in the period of November-April ranging 215-358 mm.(Erry Purnomo) 2000 1600 1200 CO2 evolution (mg C kg-1) 800 400 0 an t Bel ) ) t s i g a 3 .... In May.. The lowest rainfall was observed in the period of July-September ranging 54-84 mm. June and October the rainfall ranged 132-151 mm. 25 Number of plant species each site 20 15 10 5 t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin .

namely. further study is still needed to investigate the relationship between soil properties or plant diversity on eaglewood growth or the success of inoculants application.Aspek SOSIAL EKONOMI DAN KONSERVASI The low fertility status according to Djaenuddin et al. Dr. M Yani. I also acknowledge the anonymous reviewer who critically commented on the manuscript. Plants grown under the gaharu was quite divers from site to site. Banjar. (1994) leads the need to amend to improve the soil fertility status. The annual total rainfall in the area under study was 2361 mm. In general. Maman Turjaman for the invitation to be involved in the project. improving the fertility status may results in healthier eaglewood trees. 190 . Therefore. Mrs. ACKNOWLEDGEMENT I would like to thank ITTO for funding the work. the soil in each site was considered very poor. It is too early to gain any conclusion on the effect of environmental characters on gaharu production. CONCLUSION The selected sites were distributed in regencies. From field observation. However. This may result in the failure of gaharu formation. it was found that there was gaharu trees growth variation under different plan species grown surrounding the gaharu trees. It seems that there was a shading affect on the gaharu trees growth. Hulu Sungai Selatan and Hulu Sungai Tengah. Presto Janu Saputra and Storus for supporting the field work. The number plant species were varied from site to site. The healthy trees may immune to the infection. The rainy season began in October and ease in June.

Subagjo. A. Chemical and microbiological properties... 2nd Edition.H..R. Pp. S. Versi 1. Bachri. Part 1 Physical and mineralogy methods.. Miller. April 1994. ASA. Laporan Teknis No. Basuni. and Keeney. E. Center for Soil and Agroclimate Research. 191 . Madison. R.L. Land Suitability for Agricultural and Silviculture Plants.1188 Page. 2nd Edition. Ds.. H... Marsudi. and Jordens. Klute. SSSA. 7. Ismangun. L. Madison. Dai. D. (In Indonesian). ASA. Hardjowigeno.REFERENCE Djaenuddin. (1986) Methods of soil Analysis.R. Sukardi. V. Pp 1159.. Suwandi.. Hakim. D. SSSA. Suharta. Widagdo. S. Bogor. A. J. (1982) Methods of soil Analysis.. M..0. N.

Aspek SOSIAL EKONOMI DAN KONSERVASI 192 .

. microcarpa..... Gonystylus spp. Wikstromeae spp. Genus ini termasuk dalam famili Thymelaeaceae. Aetoxylon spp. Oleh karena itu beberapa 193 . Awalnya gaharu berasal dari pohon tropika yang terinfeksi jamur. yaitu A. Enkleia spp.. (Chakrabarty et al.(Pratiwi) 11 KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu hasil hutan non kayu yang mempunyai nilai penting. seperti Aquilaria spp. malaccensis dan A. Sidiyasa et al. sehingga hasil hutan non kayu ini menjadi subjek pemanenan yang cukup tinggi. Dalam kegiatan penelitian ini difokuskan pada jenis-jenis pohon dari genus Aquilaria. Karena jenis pohon ini mempunyai nilai ekonomi tinggi. Salah satu upaya yang dapat dilakukan adalah dengan mengembangkan tanaman gaharu dalam hutan tanaman di beberapa area. 1994.. Ada beberapa jenis tumbuhan yang dapat menghasilkan gaharu. dan Gyrinops spp.. 1986).Karakteristik Lahan Habitat .. maka keberadaan jenis ini perlu dipertahankan. karena secara ekonomis jenis ini dapat meningkatkan devisa negara dan sumber penghasilan bagi masyarakat yang hidup di dalam maupun sekitar hutan. Gaharu merupakan salah satu kayu aromatik penting...

Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah dan topografi serta vegetasi. jenis tanah. di samping air. udara. Diharapkan informasi ini dapat mendukung pengembangan hutan tanaman pohon penghasil gaharu. organisme. Sehubungan dengan hal tersebut di atas. dan Sukabumi. topografi. 1991). Provinsi Banten sedangkan 194 . Sifat-sifat tanah yang spesifik mempengaruhi komposisi vegetasi yang ada di atasnya (Pratiwi. Pratiwi dan Mulyanto (2000) serta Jenny (1941) menyebutkan bahwa tanah merupakan hasil proses pelapukan batuan yang dipengaruhi oleh faktor-faktor iklim. Dramaga. Tanah yang berbeda dengan sistem lingkungan yang bervariasi akan menentukan vegetasi yang ada di atasnya. sebagaimana juga diharapkan dapat meningkatkan pendapatan dan kesejahteraan masyarakat. Selanjutnya Pratiwi dan Mulyanto (2000) menyatakan bahwa penyebaran tumbuhan. dan Sukabumi. Secara administrasi pemerintahan. sehingga keberadaan jenis ini dapat dilestarikan. Tanah sebagai bagian dari suatu ekosistem merupakan salah satu komponen penyangga kehidupan. dan iklim (termasuk iklim mikro) harus dipertimbangkan sebagai bagian dari ekosistem yang terintegrasi. termasuk sifat-sifat tanahnya dan komposisi vegetasi tumbuhan bawah yang ada di sekitarnya. Carita terletak di Kabupaten Pandeglang. Sepanjang komponen tanah bervariasi. dan energi matahari. Dramaga. maka penelitian ini bertujuan untuk mendapatkan informasi tentang sifat-sifat habitat pohon penghasil gaharu di hutan tanaman gaharu di daerah Carita. agar kemampuan lahannya dapat diketahui.Aspek SOSIAL EKONOMI DAN KONSERVASI informasi sehubungan dengan habitat pohon penghasil gaharu perlu diinventarisasi. METODOLOGI A. dan waktu. Lokasi dan Waktu Penelitian Penelitian dilakukan pada bulan September 2008 di Carita. maka tanah dan karakteristiknya akan berbeda-beda dari satu tempat ke tempat lain.

dan Sukabumi. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. Jumlah contoh tanah yang diambil di masing-masing lokasi adalah sebanyak 6 buah.000 mm per tahun. Munsell Color Chart. Kelembaban udara ratarata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam.000 (Lembaga Penelitian 195 . 1951) dan curah hujan sekitar 3.(Pratiwi) Dramaga terletak di Kabupaten Bogor. 1951) dan curah hujan tahunan sekitar 3. topografi.. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. C.600 mm per tahun. Pengambilan Contoh Tanah Plot dibuat di area yang telah dipilih berdasarkan peta tanah Jawa dan Madura pada skala 1:500. Kelembaban udara rata-rata berkisar antara 80% sampai 90%. Sedangkan alat yang dipakai dalam penelitian lapangan adalah alat-alat tulis. Pengamatan terhadap sifat-sifat tanah dan topografi dilakukan di dalam plot yang sama dengan pengamatan vegetasi.. Temperatur udara bervariasi antara 24ºC sampai 30ºC. Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Bahan lain adalah berupa data hasil analisis vegetasi untuk tingkat semai (termasuk tumbuhan bawah).Karakteristik Lahan Habitat . Dramaga. Jawa Barat serta Sukabumi di Provinsi Jawa Barat. 1951) dan curah hujan sekitar 3. Metode Penelitian Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. 2005).. B. 1.. dan meteran. alat-alat survei lapangan seperti bor tanah. cangkul.959 mm. Bahan dan Alat Penelitian Sebagai bahan penelitian adalah contoh tanah yang diambil dalam plot penelitian di Carita. dan vegetasi.

. dan sifat kimia yaitu pH H2O. KTK. dan semai. Sedangkan tingkat semai dan tumbuhan bawah diamati dengan cara membuat petak 1 m x 1 m di dalam jalur pengamatan pohon dan belta. Kriteria 196 . Pengamatan Vegetasi Pengamatan vegetasi dilakukan terhadap seluruh vegetasi yang ada dalam plot. contoh tanah diambil pada 20 titik yang tersebar di masing-masing horizon. Pengamatan vegetasi dilakukan terhadap semai dan tumbuhan bawah yang ada di bawah tegakan/pohon penghasil gaharu. Mg.. Seluruh jenis pohon dan belta dihitung dan diukur diameternya. Kemudian contoh tanah dicampur sesuai kedalamannya. permeabilitas. Ca. K. 1962). Contoh tanah diambil dari setiap horizon yang telah diidentifikasi untuk dianalisis di laboratorium.5 m (Kartawinata et al. berat jenis. Plot-plot contoh berukuran 20 m x 20 m dibuat untuk pengamatan pohon dengan interval 20 m pada jalur sepanjang satu km. Dengan demikian ada 18 contoh tanah yang dikumpulkan. Corg. 1976).Aspek SOSIAL EKONOMI DAN KONSERVASI Tanah. dan > 60 cm di setiap lokasi penelitian. meliputi: a) sifat fisik yaitu tekstur. 30-60 cm. Sedangkan belta merupakan tumbuhan dengan diameter setinggi dada (1. ketersediaan P. dan H+ (sifat kimia) (Blackmore et al. yaitu pada tingkat pohon. Al. Pada setiap kedalaman tanah. Sedangkan untuk pengamatan belta dilakukan dengan membuat petak berukuran 10 m x 10 m di sepanjang jalur tersebut dengan interval 10 m. porositas. Contoh tanah komposit diambil pada kedalaman 0-30 cm. 2.3 m) antara 2 cm sampai < 10 cm dan semai merupakan permudaan dari kecambah sampai tinggi < 1. Kriteria pohon adalah tumbuhan dengan diameter setinggi dada (1. 1981). Na. KB. Dua macam contoh tanah yang diambil adalah contoh tanah terganggu untuk analisis sifat-sifat fisik dan kimia tanah serta contoh tanah tidak terganggu untuk pengamatan sifat fisik tanah (porositas dan berat jenis tanah). Sifat-sifat tanah yang dianalisis.3 m)>10 cm. Seluruh semai dan tumbuhan bawah yang ada dicatat dan dihitung jumlahnya. belta. Ntotal. Total tanah komposit yang dikumpulkan dari masing-masing lokasi adalah enam contoh (tiga untuk analisis sifat fisik tanah dan tiga untuk analisis sifat kimia tanah).

Untuk vegetasi. Jenis yang diperoleh kemudian dibuat spesimen herbariumnya untuk diidentifikasi di laboratorium Botani dan Ekologi Hutan. 1974). data yang diperoleh ditentukan spesies dominannya dengan menghitung nilai penting sesuai dengan rumus yang dikemukakan oleh Kartawinata et al. jalur dibuat sebanyak tiga buah masing-masing sepanjang 100 m.5 m (Kartawinata et al.Karakteristik Lahan Habitat . Pada masingmasing lokasi. Plot-plot berukuran 1 m x 1 m diletakkan di jalur pengamatan vegetasi di dalam tegakan/pohon penghasil gaharu... D. yaitu: SI = Dimana : 2w a+b SI = Similarity Index w = Jumlah dari nilai penting terkecil untuk jenis yang sama yang ditemukan pada dua komunitas yang dibandingkan (A dan B) a = Jumlah nilai penting dari semua jenis yang ada di komunitas A b = Jumlah nilai penting dari semua jenis yang ada di komunitas B 197 . dan dihitung jumlahnya serta diukur luas penutupan tajuknya. (1976). Bogor..(Pratiwi) semai adalah permudaan jenis tumbuhan berkayu dari kecambah sampai tinggi < 1. Analisis Data Sifat-sifat fisik dan kimia tanah dihitung sesuai dengan formula pada standar prosedur dari setiap karakteristik tanah kemudian ditabulasi untuk setiap horizon. Seluruh semai dan tumbuhan bawah yang ada dalam plot dicatat nama daerahnya. P3HKA. Spesies dominan merupakan spesies yang mempunyai nilai penting tertinggi di dalam tipe vegetasi yang bersangkutan. Indeks kesamaan jenis dihitung dengan menggunakan rumus Sorensen (Mueller-Dum-bois and Ellenberg... 1976).

Kelembaban udara rata-rata berkisar antara 80% sampai 90%. Lokasi penelitian Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. 1951) dan curah hujan sekitar 3. Ini berarti bahan induk daerah ini kaya akan mineral-mineral ferro-magnesium dan beberapa mineral sebagai sumber elemen basa. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. Faktor-Faktor yang Mempengaruhi Pembentukan Tanah di Lokasi Penelitian Penelitian dilakukan di tiga lokasi. 1. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson.Aspek SOSIAL EKONOMI DAN KONSERVASI HASIL DAN PEMBAHASAN A. Temperatur udara bervariasi antara 24ºC sampai 30ºC.000 mm per tahun.959 mm. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC.600 mm per tahun. Topograpfi di daerah Carita bergelombang sampai bergunung sedangkan di Dramaga datar sampai bergelombang dan di Sukabumi bergelombang sampai berbukit. khususnya sifat fisik dan kimia. 1951) dan curah hujan tahunan sekitar 3. 1951) dan curah hujan sekitar 3. Kelembaban udara rata-rata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. Bahan induk tanah Carita adalah dari Gunung Danau sedangkan Dramaga dan Sukabumi masing-masing dari Gunung Salak dan Gede Pangrango. 198 . Dramaga. Tipe mineral-mineral ini sangat dipengaruhi oleh sifat-sifat tanah. Vulkanik material dari lokasi-lokasi ini memiliki sifat andesitik. 2005). Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. dan Sukabumi. Karakteristik Tanah di Daerah Penelitian Karakteristik tanah sangat dipengaruhi oleh faktor-faktor pembentukan tanah dan sifat-sifat tanah. yaitu Carita.

Dari data tekstur tanah dapat dilihat juga bahwa tanah di dalam profil menunjukkan adanya akumulasi liat. Sifat-Sifat Tanah a. 199 .8.Karakteristik Lahan Habitat . Di Carita. Ini berarti seluruh tanah di lokasi penelitian memiliki sub horizon argilik. Hal ini menunjukkan bahwa tanah di lokasi penelitian berkembang dari material vulkanik tuff. gaharu ditanam secara monokultur dan ditanam masing-masing tahun 1993 dan 1999. durian (Durio zibethinus) dan sebagainya.. Tanah di Carita dan Dramaga memiliki KB kurang dari 50% (Tabel 4. Data analisis tekstur tanah menunjukkan bahwa tanah di semua lokasi penelitian memiliki kelas tekstur liat. dan Tabel 6). microcarpa di Sukabumi. Implikasi dari kelas tekstur ini adalah retensi air dan hara pada tanah ini relatif bagus. porositas. jenis yang ditanam adalah Aquilaria microcarpa. 2. microcarpa di Darmaga dan A. Spesies yang ditanam adalah Aquilaria crassna dan A. Pada tabel tersebut terlihat bahwa ketiga lokasi penelitian memiliki sifat-sifat fisik tanah yang relatif sama. Hasil penelitian sifat-sifat fisik tanah disajikan pada Tabel 1. Sedangkan di Dramaga dan Sukabumi. dengan areal sekitar 5 ha dan dibangun pada tahun 1998 dengan total 346 pohon. Tabel 2. Sedangkan tanah di lokasi penelitian Sukabumi memiliki KB lebih dari 50% sehingga diklasifikan sebagai alfisol. nangka (Artocarpus integra).. dan Tabel 3.. Ketinggian daerah ini sekitar 100 meter di atas permukaan laut. melinjo (Gnetum gnemon). berat jenis.. Oleh karena itu tanah ini diklasifikasikan sebagai ultisol. Hal ini mengindikasikan bahwa partikel tanah yang dominan adalah fraksi liat. antara lain berkaitan dengan tekstur. Pohon penghasil gaharu ditanam bersama dengan tanaman lain. Sifat Fisik Tanah Sifat fisik tanah. Tabel 5.(Pratiwi) Penggunaan lahan di ketiga lokasi penelitian adalah hutan tanaman pohon penghasil gaharu. umumnya pohon serbaguna seperti pete (Parkia speciosa). dan permeabilitas. Berat jenis (BD) tanah di semua lokasi penelitian kurang dari 1 tetapi lebih dari 0. Tanah yang memiliki horizon argilik dapat diklasifikasikan sebagai alfisol atau ultisol tergantung kejenuhan basanya (KB).

Sifat-sifat fisik tanah di lokasi penelitian Carita Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 8.10 22.55 6.59 11.78 Kelas tekstur Liat Liat Liat 0.33 5.93 0.85 Berat Jenis Porositas (%) Tabel 2.33 8.08 81.96 65.13 Debu (%) 12.84 0. Sedangkan berat jenis tanah di tiga kedalaman kurang dari satu.86 66.33 6.35 57.90 0.99 63.57 69.01 Tekstur Debu (%) 25.98 9.45 66. Informasi ini menunjukkan bahwa terjadi fenomena pemadatan tanah (soil compaction) karena adanya injakan (trampling) dan mungkin adanya jatuhan butir-butir hujan dari batang pohon (stem fall).69 85.21 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 200 . Hal ini menunjukkan bahwa tanah ini mempunyai sifat andik.10 36.51 Liat (%) 66.09 Liat (%) 79.87 0.99 68. sehingga tanah di lokasi penelitian termasuk dalam ordo andisol dalam sistem taksonomi tanah (Soil Survey Staff.48 Kelas tekstur Liat Liat Liat 0. Sifat-sifat fisik tanah di lokasi penelitian Dramaga Sifat fisik Kedalaman (cm) Pasir (%) 0-30 30-60 > 60 0 30 60 8. porositas tanah di horizon permukaan lebih rendah daripada di bagian bawahnya. Tabel 1.90 64.Aspek SOSIAL EKONOMI DAN KONSERVASI Data porositas tanah menunjukkan bahwa di semua lokasi penelitian. 1994).

78 9. umumnya diikuti dengan penurunan persentase ruang pori atau porositas dan juga penurunan nilai permeabilitas tanah.. Mg.95 11.37 Liat (%) 68.73 5. P tersedia.43 67. Nilai permeabilitas tanah menunjukkan laju pergerakan air.54 Debu (%) 18.59 68. Adanya pori-pori yang menurun jumlahnya. Peningkatan berat jenis tanah..83 63.. Zn.97 0. Sifat Kimia Tanah Sifat-sifat kimia tanah. kecuali Sukabumi.90 26. Tabel 5. di mana lokasi-lokasi ini merupakan hutan tanaman.49 84. Ca. Hal ini terjadi juga di ketiga lokasi penelitian. kejenuhan basa (KB).. Fe. pH H 2O di semua lokasi penelitian umumnya kurang dari lima. (1985) menyatakan bahwa nilai ini tergantung bukan saja oleh jumlah pori tetapi juga tingkat kontinuitas pori.Karakteristik Lahan Habitat . kapasitas tukar kation (KTK). b.09 Kelas tekstur Liat Liat Liat 0.15 62.86 0. Cu. dan Mn. K. N. Na. Pratiwi dan Garsetiasih (2003) menyatakan bahwa pemadatan tanah dapat diakibatkan oleh karena injakan manusia. meliputi pH H2O. Sifat-sifat fisik tanah di lokasi penelitian Sukabumi Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 12. dan Tabel 6. Al. Namun demikian tanah-tanah di lokasi 201 . Hal ini menunjukkan semakin ke dalam jumlah pori-pori semakin kecil yang diakibatkan antara lain oleh adanya pemadatan tanah. C. Hal ini terlihat pada lokasi penelitian. maka akan mengakibatkan kapasitas tanah menampung air dan udara menurun.(Pratiwi) Tabel 3. Keterangan yang lebih lengkap dapat dilihat pada Tabel 4. Namun demikian Bullock et al.75 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 Sedangkan porositas di lokasi penelitian menunjukkan bahwa semakin ke bawah porositasnya semakin kecil.

Hal ini dapat dimengerti karena di lokasi penelitian Carita. tetapi di Carita. O. K. khususnya di horizon bagian atas. Reaksi ini mempengaruhi ketersediaan unsur hara esensial. Cu. Unsur-unsur ini dikategorikan sebagai unsur hara makro (C. dan S) dan unsur hara mikro (Fe. B. dan Co). dan H+. Zn. bahan organik juga menyebabkan meningkatnya KTK dengan meningkatnya muatan negatif. Hal ini menunjukkan bahwa dekomposisi bahan organik tidak terlalu kuat. Elemen penting lainnya adalah K. Menurut Sutanto (1988). dijumpai banyak tumbuhan bawah jika dibandingkan dengan lokasi penelitian Sukabumi dan Dramaga. P. Ca. Al+3. Carbon organik dan nitrogen total di lokasi penelitian menurun semakin ke bawah. Perbandingan C/N di semua horizon tergolong tinggi. ketersediaan dari unsur-unsur esensial ditentukan oleh bahan organik dan proses-proses dinamis yang ada di dalam profil tanah. maka reaksinya asam dan kejenuhan basanya kurang dari 100%.Aspek SOSIAL EKONOMI DAN KONSERVASI penelitian masih dikategorikan asam. Mo. namun karena adanya proses pelapukan yang intensif dan juga adanya pencucian (leaching). carbon organik lebih tinggi daripada Sukabumi dan Dramaga. Oleh karena itu di ketiga lokasi penelitian tidak ada bahaya keracunan Al. Di areal penelitian Dramaga. 202 . Walaupun tanah-tanah di lokasi penelitian berkembang dari bahan vulkanik andesitik yang kaya akan material-material basa. Pratiwi (2004 dan 2005) menyatakan bahwa unsur ini khususnya di lapisan atas mempunyai fungsi yang sangat penting dalam perkecambahan biji. N. 2004 dan 2005). Mn. H. Kandungan P di semua lokasi penelitian tergolong sangat rendah (< 2). Cl. Jumlah carbon organik relatif rendah di semua horizon. Tanah dengan kandungan Al yang tinggi memiliki sifat toksik. Rendahnya carbon organik dan nitrogen total berhubungan dengan rendahnya bahan organik. K tergolong medium sedangkan di Carita dan Sukabumi masing-masing tergolong rendah dan tinggi dan Al+3 dan H+ rendah sampai sangat rendah di semua lokasi. Tumbuhan bawah merupakan sumber bahan organik. Di samping pH. Mg. Unsur hara esensial merupakan unsur yang diperlukan oleh tanaman dan fungsinya tidak dapat digantikan oleh unsur lain (Pratiwi.

Zn.77).07) sedangkan di Dramaga medium (16.(Pratiwi) Unsur hara mikro juga mempengaruhi pertumbuhan tanaman. dan Mn. Tabel 5.11(Rendah) 203 .03 (Rendah) 0. Kapasitas tukar kation (KTK) menunjukkan tingkat kesuburan tanah. KTK tinggi berarti areal tersebut cukup subur. Kandungan kation basa di Sukabumi termasuk tinggi sedangkan di Dramaga medium dan Carita termasuk rendah. kation basa didominasi oleh calcium dan magnesium. dan Tabel 6 menunjukkan secara jelas bahwa KTK NH4Oact pH 7 dari seluruh profil sangat tinggi daripada KTK sum of cation. Tabel 5.01-17.. dan Zn relatif rendah sementara kandungan Mn sedang sampai relatif cukup.. Tabel 4.Karakteristik Lahan Habitat .43 (Rendah) 0. Di semua horizon dari tiga lokasi penelitian ini. tetapi diperlukan dalam jumlah sangat sedikit. Tanah dengan pH lebih tinggi umumnya memiliki KTK yang lebih tinggi. Sifat-sifat kimia tanah di lokasi penelitian Dramaga Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) Horizon 1 (0-30 cm) 4.60 (Rendah) 1.. Ada kecenderungan bahwa daerah dengan pH yang tinggi memiliki kejenuhan basa yang tinggi pula. Kecenderungan ini terjadi di areal penelitian. di mana pH daerah Sukabumi lebih tinggi daripada Carita dan Dramaga. Tanah dengan KTK tinggi dapat menyerap unsur hara. Cu. Unsur-unsur tersebut adalah Fe. sehingga ketersediaan hara akan lebih bagus pada areal dengan KTK rendah.. Hal ini disebabkan karena Sukabumi memiliki pH H 2O tertinggi. Dari Tabel 4.15 (Rendah) Horizon 2 (30-60 cm) 4.70 (Rendah) 1.03 (Rendah) 0. Tabel 4. Jumlah kation tertinggi di areal penelitian terdapat di Sukabumi dan yang terendah di Carita. Cu. Unsur-unsur Fe.12 (Rendah) Horizon 3 (>60 cm) 4. Kondisi ini relatif sesuai untuk pertumbuhan tanaman.50 (Rendah) 1.75) dan yang terendah adalah di Carita (13. KTK tanah dianalisis dengan larutan buffer NH4Oact pH 7 dan KTK sum of cation.35-41. dan Tabel 6 mengindikasikan bahwa tanah di Sukabumi memiliki KB tinggi (39.0515.

7 (Sangat rendah) 5.26 (Medium) 3.70 (Sangat rendah) Horizon 2 (30-60 cm) 4.17 (Rendah) 1.49 (Sangat rendah) 0.7 (Sangat rendah) Horizon 2 (30-60 cm) 1.16 (Rendah) 1.52 (Rendah) 0.33 4.13 (Rendah) Horizon 1 (0-30 cm) 4.30 (Rendah) 17.70(Medium) 0.60 (Rendah) 0.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): Al H 0.08 (Sangat rendah) 1.48 2.58 (Tinggi) 0.61 (Medium) 35.75 (Medium) 40.75 (Rendah) 0.26 (Rendah) 16.3 (Sangat rendah) Horizon 3 (>60 cm) 1.60 (Rendah) 2.16 (Sangat rendah) 0.01 (Sangat rendah) 0.44 5.17 (Rendah) 1.19 ( Medium) 0.31 (Medium) 0.20 Tabel 5.32 ( Medium) 1. Sifat-sifat kimia tanah di lokasi penelitian Carita Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K 1.40 5.72 (Sangat rendah) 0.26 (Rendah) 16.01 1.60 1.53 (Rendah) 0.68 (Medium) 4.71 (Sangat rendah) 0.99 (Medium) 46.36 4.88 88.90 (Sangat rendah) 0.14 (Rendah) 1.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 1.29 (Medium) 1.88 (Medium) 5.41 2.04 3.14 (Rendah) 1.80 2.28 79.51 (Rendah) 0.50 (Rendah) 1.20 (Sangat rendah) Horizon 3 (>60 cm) 4.24 85.20 (Sangat rendah) 204 .44 (Medium) 0.64 4.09 (Medium) 0.00 (Sangat rendah) 0.44 (Medium) 0.

05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 0.70 (Sangat rendah) Horizon 3 (>60 cm) 4.71 (Tinggi) 0.52 2.00 28.22 (Rendah) 13.52 (Sangat tinggi) 0..05 (Sangat tinggi) 0.48 1.22 (Rendah) 0.56 (Tinggi) 16.27 (Sangat rendah) 5.84 (Sangat tinggi) 14.43 (Medium) 36.35 (Tinggi) 63.48 (Tinggi) 78.10 (Rendah) 1.68 2.99 (Tinggi) 10.21 (Rendah) 13..40 Tabel 6.11 (Rendah) 14.64 (Tinggi) 10.40 (Medium) 0.10 (Rendah) 2.04 1..36 (Rendah) 0.60 17.40 (Rendah) 0.(Pratiwi) Sifat-sifat kimia Na KTK KB (%) KCl (me/100 gr): Al H 0.49 7.07 (Sangat tinggi) 69.86 (Tinggi) Horizon 1 (0-30 cm) 5. Sifat-sifat kimia tanah di lokasi penelitian Sukabumi Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): 16.53 6.40 (Sangat rendah) 205 .98 (Tinggi) 10.11 (Rendah) 3.03 (Rendah) 14.Karakteristik Lahan Habitat .15 (Rendah) 3.80 16.45 1.00 1.49 (Sangat rendah) Horizon 3 (>60 cm) 0.72 1.90 (Sangat rendah) Horizon 2 (30-60 cm) 5.08 1.22 (Rendah) 39.01 (Rendah) 0.64 3.20 (Rendah) 15.94 (Sangat tinggi) 0.84 (Rendah) 0.49 (Sangat rendah) Horizon 2 (30-60 cm) 0.77 (Rendah) 16.18 (Rendah) 3.60 (Rendah) 1.07 (Medium) 0.60 (Rendah) 0.36 (Medium) 41..

Oleh karena itu analisis vegetasi ditekankan pada tumbuhan bawah. Dramaga.44 1. Komposisi Tumbuhan Bawah Hasil pengamatan menunjukkan bahwa komposisi jenis tumbuhan bawah di Carita lebih tinggi dibandingkan di Sukabumi dan Dramaga (Tabel 7).52 1.20 1. Dengan demikian untuk tingkat pohon.40 17. Komposisi Vegetasi dan Spesies Dominan 1. Sistem penanaman di Carita yang multikultur.56 26.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 2.42 0.30 Horizon 3 (>60 cm) 6.76 (Sangat rendah) 0.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia Al H 0. 206 .25 Horizon 2 (30-60 cm) 2.36 1. dan Sukabumi. mendukung beberapa anakan muncul dari jenis-jenis lain selain jenis tanaman penghasil gaharu.36 B.32 (Sangat rendah) 0. 2.56 22. Umum Analisis vegetasi dilakukan terhadap vegetasi/tumbuhan bawah di Carita.00 0.12 0. Jumlah jenis tumbuhan bawah dan familinya di lokasi penelitian Lokasi penelitian Jumlah jenis Jumlah famili Ko n d i s i i n i a g a k nya k a r e n a Carita 30 18 perbedaan sistem penanaman dalam Dramaga 8 16 hutan tanaman tersebut. sapling serta tiang didominasi oleh gaharu.12 1.32 1.40 (Rendah) 0. Areal ini merupakan hutan tanaman pohon penghasil gaharu. Di Carita pohon Sukabumi 6 3 penghasil gaharu ditanam dengan sistem campuran dengan jenis tanaman serba guna sedangkan di Sukabumi dan Dramaga ditanam dengan sistem monokultur. Tabel 7.

Lampiran 2. topografi. Di Carita jenis dominan dan kodominan dari tumbuhan bawah yang ditemui adalah jampang (Panicum disachyum) dan selaginela (Selaginella plana) sedangkan di Dramaga adalah pakis (Dictyopteris iregularis) dan seuseureuhan (Piper aduncum) serta di Sukabumi adalah jampang (Panicum disachyum) dan rumput pait (Panicum barbatum) (Lampiran 1. Jenis dominan merupakan jenis yang mempunyai nilai penting tertinggi di dalam komunitas yang bersangkutan.. Data ini mengindikasikan bahwa habitat dari masing-masing lokasi penelitian secara ekologis memiliki karakteristik yang berbeda-beda. 1974) komposisi jenis tumbuhan bawah di tiap lokasi penelitian berbeda satu Tabel 8... Indeks similaritas (%) dari dengan lainnya.(Pratiwi) 3.Karakteristik Lahan Habitat .. 4. Indeks Kesamaan Jenis Tumbuhan Bawah Berdasarkan indeks kesamaan jenis menurut Sorensen (MuellerDumbois and Ellenberg. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor lingkungan seperti iklim. Tanah di tiga lokasi penelitian memiliki bahan induk yang relatif sama. Hasil pengamatan menunjukkan bahwa jenis dominan dan kodominan masing-masing areal penelitian berbeda. dan karakteristik tanah. dan Lampiran 3). Hal ini diindikomuni-tas tumbuhan di lokasi penelitian kasikan dengan nilai indeks similaritas yang rendah (<50%) Lokasi Carita Dramaga Sukabumi (Tabel 8). yaitu material volkanik yang bersifat andesitik. nilai vegetasi ditentukan oleh peran dari jenis dominan. Nilai ini merupakan hasil dari interaksi di antara jenis dengan kondisikondisi lingkungan. 207 . Carita - 9 - 35 9 - Darmaga Sukabumi - KESIMPULAN 1. Jenis Tumbuhan Bawah Dominan Secara ekologis.

1962. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor-faktor lingkungan seperti iklim. Part II. Trade in Agarwood. DAFTAR PUSTAKA Allison. Jenis dominan dan kodominan di masing-masing areal penelitian berbeda. K. 3. Bogor. Jenny. L. Soil Analyses. Komposisi jenis tumbuhan bawah juga berbeda di tiap lokasi penelitian sebagaimana diindikasikan dengan nilai SI < 50%. Sifat-sifat fisik dan kimia tanah di areal penelitian mendukung pertumbuhan pohon penghasil gaharu. Black (ed.Aspek SOSIAL EKONOMI DAN KONSERVASI 2. 1994. 4. H. 5. New York. Perbedaan sifat-sifat fisik dan kimia tanah di lokasi penelitian disebabkan perbedaan tingkat proses pelapukan yang berhubungan dengan kondisi lingkungan dari proses pelapukan tersebut. Lembaga Penelitian Tanah. McGrawhill. Menon. LPT. serta di Sukabumi masing-masing jampang (Panicum disachyum) dan rumput pait (Panicum barbatum). topografi. Sehubungan dengan tingkat pelapukan. 6.). Chakrabarty. Organic Matter by Walkey and Black methods.E. tanah Carita kurang subur dibandingkan dengan Dramaga dan Sukabumi. 1941. 208 .A. Tingkat kesuburan ini berhubungan dengan tingkat dari proses pelapukan. dan sifat-sifat tanah. Kumar and V. 280 p. Factors of Soil Formation. In C.. 1965. Sedangkan di Dramaga jenis dominan dan kodominan masing-masing adalah pakis (Dictyopteris irregularis) dan seuseureuhan (Piper aduncum). A. Peta Tanah Tinjau Jawa dan Madura. Di Carita tumbuhan bawah yang dominan adalah jampang (Panicum disachyum) dan jenis kodominan adalah selaginela (Selaginella plana). WWF-Traffic India.

. Hutan Penelitian Carita. Indonesia. Pratiwi and B. 1994. Djawatan Meteorologi dan Geofisika. Charge Properties and Classification of Soils on Volcanic Materials and Limestone in Central Java. Pusat Litbang Hutan dan Konservasi Alam. Pratiwi.H. 42. dan R. 2000. Buletin Penelitian Hutan 644: 63-76. Soil Conservation Service. Gent.) di Beberapa Hutan Tanaman di Pulau Jawa. Kalimantan Selatan. Minerlogy. Soil Survey Staff. K. 1986. Jakarta. Prawira. 1984. 1951. ITC-RUG. International Training Center For Post Graduate Soil Scientists.. A. D. Dept. 21 p. Ciri dan Sifat Lahan Habitat Mahoni (Swietenia macrophylla King. 2005. John Willey and Son. United Stated Department of Agriculture. West Java.A. Forestry and Estate Crops Research Journal 1(1): 27-33. Pusat Litbang Hutan dan Konservasi Alam. Rainfall Based on Wet and Dry Period Ratios for Indonesia with Western New Guinea. Aims and Methods of Vegetation Ecology. Hubungan Antara Sifat-Sifat Tanah dan Komposisi Vegetasi di Daerah Tabalar. 2004. Sutanto. Kementrian Perhubungan. Indonesia. New York.U. 1991. Ferguson. East Kalimantan. Sidiyasa. S.. Gakuryoku XI(2):127-131. Key to Soil Taxonomy. Procedure for Collecting Samples and Methods of Analyses for Soil Survey.Agric. 233 p. The Relationship Between Soil Characteristics with Vegetation Diversity in Tanjung Redep. Kabupaten Berau.. I. 1988.(Pratiwi) Mueller-Dumbois. Soil Conservation Service. F. Mulyanto. Sutomo. Bogor. Ellenberg. and J. PhD Thesis. and H.S. Revised ed. 1974. R. Schmidt. Pratiwi. MSc.. 306 p. Buletin Penelitian Hutan 474: 59-66. Verhand. 209 .. Soil Characteristics and Vegetation Composition Along a Topotransect in The Gunung Gede Pangrango National Park. 2005. Six Edition. Report No.H. Belgium. Thesis. S. Kalimantan Timur.Karakteristik Lahan Habitat . Pratiwi. Eksplorasi dan Studi Permudaan Jenis-Jenis Penghasil Gaharu di Wilayah Hutan Kintap. 68 p. Universiteit Gent.

25 0.12 81.25 0. Cyclea barbata Miers.73 3. Dictyopteris irregularis Presl.00 100.83 9.12 0.18 6. Swietenia macrophylla King Morinda bracteosa Hort.18 2.99 3.49 1.23 0.93 1.85 4.25 0.62 1.43 1.99 10.25 0.25 0.43 1.00 5.58 10.75 0.47 2. Solanum jamaicence Mill.25 0.98 0. Melastoma malabathricum L.69 2.43 2.Sch.85 2. Nilai penting jenis tumbuhan bawah di Carita No.09 2.43 2.12 0.25 0.80 1. Gagajahan Ki koneng Babadotan Pakis anjing Gaharu Pete Kanyere Cingcanan Plectronia sp.29 5.62 0. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Nama daerah Jampang Selaginella Harendong merah Cingcau Rumput pait Ilat Parasi Terongan Hatta Peletok Paku anam Pakis Sasahan Harendong Kokopian Mahoni Cacabean Alang-alang Hawuan Kakacangan Pacing Nama botani Famili Kr (%) Fr (%) Dr (%) NP (%) 47.25 0.25 0. Cecropia peltata L.71 0.62 0.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 1.80 1.82 3.12 0. Selaginellaceae Melastomataceae Meraispermaceae Cyperaceae Solanaceae Polypodiaceae Moraceae Schizophyllaceae Polypodiaceae Dilleniaceae Melastomaceae Rubiaceae Meliaceae Rubiaceae Graminae Verbenaceae Zingiberaceae Piperaceae Rubiaceae Polypodiaceae Thymelaeaceae Leguminosae Euphorbiaceae Rubiaceae Panicum barbatum Lamk. Compositae 100. Tetracera indica L.11 0.93 1.39 9. Clidenia hirta Don.23 0.88 7.23 0.70 16.43 1.30 2.43 2. Graminae Ageratum conizoides Linn.50 0.09 1.43 1. Amaryllidiaceae Elaeocarpus glaber Blume Elaeocarpaceae Seuseureuhan Piper aduncum L.57 4.00 5.43 25.37 0.02 4.43 1.37 0.75 0.36 6.25 21.Chr.09 3.00 14.25 0.43 1.17 2.49 0.00 9.71 1. Aquilaria malaccensis Lamk.43 1. Coniograma intermedia Hieron.00 Keterangan: Kr Fr Dr NP : Kerapatan relatif : Frekuensi relatif : Dominansi relatif : Nilai penting 210 .10 0.57 4. Parkia speciosa Hassk.72 4. Stachystarpheta jamaisensis Vahl. Morinda bracteosa Hort. Imperata cylindrica Linn.05 2.71 5. Cyperus difformis Linn.00 100. Dryopteris dentata C.25 8.43 1. Ixora sp.28 57.30 2.05 2.25 0.48 0.43 1. Graminae Curculigo latifolia Dryand.39 3.81 10. Lygodium circinatum Sw.25 0.25 0.43 1.85 1.71 4.62 0.50 0.86 1.50 0.43 1.80 Panicum disachyum Linn.05 1.66 8.76 7.93 1. Gramínea Selaginella plana Hiern.97 6.45 0.52 5.75 1. Total Panicum montanum Roxb. Bridelia monoica L.25 0.25 0.43 1.29 1.43 2.91 2.70 32.28 22. Tapeinochilus teysmannianus K.43 1.17 7.00 300.98 0.

Alocasia sp.53 100.08 34.14 1.00 Rumput pait Panicum barbatum Lamk.00 NP (%) 74.64 11. Rumput padi Areu Babadotan Pacine Oryza grandulata Nees.06 19.21 57.76 5.71 5.72 11.89 17.42 1.72 16.41 11.00 Fr (%) 16..78 30.55 3.Karakteristik Lahan Habitat . Nilai penting jenis tumbuhan bawah di Dramaga No.00 16.72 16. 1 2 3 4 5 6 7 8 Nama daerah Pakis Seuseureuhan Tales Nama botani Dictyopteris irregularis Presl.25 20..14 100. Piper aduncum Linn. Total Zingiberaceae Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 211 .03 5.89 100.89 11..56 300.19 22.00 Dr (%) 28. Micania scandens Willd.71 5.76 5.Sch.(Pratiwi) Lampiran 2.03 16. Compositae Tapeinochilus teysmannianus K.76 5. Ageratum conizoides Linn. Famili Polypodaceae Piperaceae Araceae Graminae Gramínea Compositae Kr (%) 29.72 11.52 5.04 43.16 37..

00 Dr (%) 50.33 100.76 7. Nilai penting jenis tumbuhan bawah di Sukabumi No.Lampiran 3.9 58.00 17.74 2.62 16. Famili Gramínea Graminae Melastomaceae Compositae Kr (%) 56.33 16. 1 2 3 4 5 6 Nama daerah Jampang Nama botani Panicum distachyum Linn.14 30.67 8.00 Rumput pait Panicum barbatum Lamk.16 100.57 100.94 32.56 24.38 4.34 16.87 10. Euphatorium pallascens DC. Compositae Graminae Alang-alang Imperata cilíndrica Linn.06 300.71 14. Ageratum conizoides Linn.35 22.00 Fr (%) 33. Total Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 212 .67 8.24 4.67 16.00 NP (%) 139.28 3. Harendong Babadotan Kirinyuh Clidenia hirta Don.57 3.

karena merupakan sumber pendapatan terbesar yang memiliki nilai pasar tinggi (Kaskija. hirta. Jenis pohon penghasil gaharu menghasilkan resin yang memiliki aroma wangi dan jenis-jenis yang menghasilkan gaharu dengan 213 . beccariana. malaccensis Lamk. 1987.) DI PROVINSI LAMPUNG DAN BENGKULU. Gaharu banyak diproduksi di Indonesia. selama ini banyak dikenal sebagai bahan untuk membuat wangi-wangian. dengan nama perdagangan “agarwood/aloe-wood/ eaglewood”. A. filaria. A. dan lain-lain.12 POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk. 2001. Indonesia merupakan salah satu eksportir terbesar produk gaharu dan sudah menyumbangkan sekitar 6. microcarpa. 2002). negara penghasil gaharu terbesar di dunia. A. Zuhud 1994). 2000).. bahan obat serta juga kulitnya dapat dibuat untuk bahan tali atau kain (Puri. A. gaharu merupakan komoditi hasil hutan non-kayu penting. seperti A. SUMATERA Titiek Setyawati Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu. Gaharu merupakan komoditi hasil hutan bukan kayu yang banyak diminati oleh pasar luar negeri (Soehartono dan Newton. Bagi Suku Dayak Punan di Kalimantan Timur. Indonesia juga merupakan habitat endemik beberapa jenis gaharu komersial dari marga Aquilaria. Heyne.2 milyar rupiah ke kas negara pada tahun 1995.

dan Wikstroemia (2 jenis). Berdasarkan hasil pengamatan di lapangan. 2007). Sumatera.87 pohon/ha (Sumatera). Potensi yang diperkirakan ada saat ini yaitu 1.37 pohon/ha (Kalimantan). dan abu gaharu.33 pohon/ha (Irian Jaya) (Anonim.untuk kualitas super. Aquilaria (2 jenis). 2001) dan bahkan semua jenis penghasil gaharu (Aquilaria spp. Gaharu dihasilkan dari proses pembusukan atau infeksi. 3. Meskipun jumlah ekspor gaharu saat ini mengalami penurunan pesat dibandingkan dengan tahun-tahun sebelumnya. Nusa Tenggara Timur. keberadaan serta potensi pohon penghasil gaharu yang ada di Indonesia sampai saat ini masih belum terkoleksi dengan baik.000. Enkleia (1 jenis). Pada umumnya gaharu diperdagangkan dalam tiga kelompok sortimen. Nusa Tenggara Barat. sejak tahun 1994 gaharu masuk dalam Appendix II daftar CITES (Soehartono dan Newton. Gonystylus (2 jenis). Usaha budidaya jenis pohon penghasil gaharu juga belum banyak mengalami perkembangan yang nyata dan produk gaharu masih lebih banyak dipanen dari hutan alam. serta Irian Jaya. Dalam proses selanjutnya. kemedangan. baik batang maupun akar pohon secara kimiawi oleh beberapa jenis jamur. Satu pohon biasanya dapat menghasilkan 0.5 sampai 4 kg gaharu dengan harga di tingkat pencari Rp 700. Jenis yang saat ini banyak dipanen di Irian Jaya sudah sangat terancam keberadaannya. Menurut Sidiyasa (1986) dalam Mai dan Suripatty (1996). Resin yang dihasilkan memiliki aroma wangi yang merupakan ciri khas dalam menentukan kualitas gaharu. gaharu ternyata dihasilkan tidak dari satu jenis pohon saja melainkan dari berbagai macam jenis. masingmasing sortimen akan dibedakan lagi berdasarkan kelas mutunya. kedelapan jenis tersebut masuk dalam marga Aetoxylon (1 jenis). Dari beberapa pustaka yang ada. yaitu gubal gaharu. Karena eksploitasi yang intensif sehingga mengancam keberadaanya di alam. informasi mengenai jenis.Aspek SOSIAL EKONOMI DAN KONSERVASI kualitas tinggi banyak diperdagangkan ke luar negeri. Bahkan beberapa jenis sudah menjadi langka akibat perburuan jenis-jenis tertentu yang tidak terkendali. karena eksploitasi yang berlebihan (Zich dan Compton. jenis pohon penghasil gaharu dari marga Aquilaria dan Wiekstroemia memiliki lebih dari 2 jenis (Sellato. Hampir sebagian besar jenis dapat ditemukan di Kalimantan. dan 4. 2001). dan Gyrinops 214 . 2001) yang tumbuh tersebar di Indonesia.

malaccencis Lamk. maka diharapkan tersedia bukti yang kuat menyangkut status jenis-jenis pohon penghasil gaharu di Indonesia. Selama beberapa dekade ini. karena berbagai macam alasan yang menyangkut status konservasinya. Sumatera. 2009). Kelompok tersebut biasanya akan tinggal di hutan selama lebih kurang seminggu untuk mencari 215 . diharapkan jenis ini dapat keluar dari daftar CITES sebagai jenis yang harus dilindungi. Harga gaharu saat ini bervariasi mulai dari 5 juta hingga 20 juta rupiah per kilogramnya.(Titiek Setyawati) spp..Potensi dan Kondisi . Dengan usia tanam dari 6 hingga 8 tahun gaharu mampu menghasilkan getah sekitar dua kilogram. 2000) dan sudah memberikan sumbangan kepada pemasukan negara sejumlah 6. Mengingat harga gaharu yang demikian tinggi. Makalah ini bertujuan untuk memberikan informasi menyangkut aspek potensi dan persebaran gaharu (A.. 1997 dalam Soehartono dan Newton. Mengingat keberadaan jenis-jenis pohon penghasil gaharu yang mulai langka dan terancam punah. diperlukan upaya eksplorasi dan konservasi.) masuk dalam Appendix II CITES sejak tahun 2004. Harga gaharu saat ini sangat bervariasi tergantung dari kualitasnya. Dengan tersedianya informasi yang memadai. Mengingat semakin terancamnya keberdaan jenis pohon penghasil gaharu yang ada di habitat alaminya. maka tidaklah heran jika gaharu sangat dicari oleh para pedagang sedangkan pemanenan masih mengandalkan gaharu yang tumbuh di alam dan pencarian dilakukan oleh masyarakat lokal yang memiliki akses masuk ke dalam hutan. Masyarakat di lokasi hutan di Sumatera pada umumnya mengumpulkan gaharu dalam kelompok yang masing-masing terdiri dari 3 sampai 5 orang. baik dari sisi potensi dan persebarannya. maka diperlukan upaya serius dari berbagai macam pihak yang berkepentingan agar keberadaan jenis-jenis tersebut di Indonesia dapat dipantau. Indonesia dikenal sebagai negara penghasil gaharu terbesar (Direktorat Jenderal PHPA... Untuk jenis gaharu yang terbaik di kelasnya harganya bisa melebihi 20 juta rupiah per kilogram tergantung kualitasnya (Anonim.2 milyar rupiah di tahun 1995.) di Provinsi Lampung dan Bengkulu. baik ek-situ maupun in-situ.

tepatnya di Kabupaten Lampung Tengah. Kawasan Hutan Bukit Rupi berada di luar kawasan TNBBS namun demikian merupakan kawasan hutan lindung yang dikelola oleh Dinas Kehutanan Provinsi Lampung Tengah. Jika gaharu ditemukan. Kabupaten Lampung Barat.884 ha dengan cakupan wilayah meliputi Resort Merpas. yaitu di Hutan Bukit Rupi dan Hutan Gunung Sugih. Namun demikian masih ada beberapa lokasi hutan alam. pencarian gaharu makin sulit akibat potensinya yang mulai menurun. Lampung Survei jenis-jenis pohon penghasil gaharu di Provinsi Lampung dilakukan di satu lokasi yang ada di dalam kawasan Taman Nasional Bukit Barisan Selatan (Hutan Biha) dan dua lokasi di luar kawasan TNBBS. maka mereka akan menebang pohonnya secara manual menggunakan kampak. Kondisi hutan sebagian sudah dialihfungsikan menjadi lahan perkebunan dan ladang masyarakat. Areal penelitian masuk dalam Seksi Konservasi Wilayah II Krui dengan luas kawasan ± 96. Seringkali terjadi bahwa kualitas gaharu tidak seperti yang mereka inginkan dan pada akhirnya pohon yang sudah terlanjur ditebang ditinggalkan begitu saja di hutan. Pada saat ini. sehingga orang harus tinggal lebih dari 2 minggu atau bahkan sebulan hanya untuk mendapatkan gaharu. Resort Biha. Pugung 216 . Kondisi topografi di hutan alam ini sedikit berbukit dengan beberapa lokasi memiliki kelerengan hingga 35 derajat. Lokasi survei berada di Desa Sumur Jaya. Kecamatan Pesisir Selatan. Kabupaten Lampung Tengah. METODE PENELITIAN A. Lokasi Penelitian 1. Kecamatan Pubian.Aspek SOSIAL EKONOMI DAN KONSERVASI gaharu di pedalaman hutan. Seksi Krui. Kawasan Hutan Biha masuk dalam Blok Hutan Podomoro. Kawasan Hutan Bukit Rupi berada di Desa Segala Midar. dimana ditemukan tegakan gaharu yang masih utuh.

. Gambar 1.500 mm/th sedangkan di bagian timur 2. Kawasan hutan TNBBS ini terletak di ujung selatan dari rangkaian pegunungan Bukit Barisan dan secara geografis berada pada 4031’5057’ LS dan 103024’1 0 4 0 BT s e d a n g k a n secara administratif p e n ge l o l a a n te r b a g i d a l a m t i g a w i l aya h pengelolaan. Waktu tempuh dari pusat kota Bengkulu sekitar 30 menit dengan jarak sekitar 20 km (Gambar 2).500-3. yaitu Seksi Konservasi Wilayah I Liwa. Topografi kawasan ini bergelombang dan berbukit-bukit dengan ketinggian berkisar antara 0-1.. Peta lokasi survei dan pengamatan 2. Curah hujan ratarata di bagian barat adalah 3. 217 . dan Seksi di Provinsi Lampung Konservasi Wilayah III Sukaraja. Krui.000 mm/ th. dan Biha. S e k s i Ko n s e r va s i jenis-jenis pohon penghasil gaharu Wilayah Krui.Potensi dan Kondisi . Bengkulu Lokasi kedua kawasan hutan sangat berdekatan dengan Tahura Rojolelo yang terletak di antara 03 42’-03 44’LS sampai 102 21’BT dan berada di ketinggian 10-30 m dpl.(Titiek Setyawati) Tampak.000-3. Lokasi penelitian secara detil tertera pada Gambar 1..964 m dpl..

kertas koran. kertas plak herbarium. kelapa sawit. alat plak herbarium. Alat yang digunakan untuk pengambilan data di lapangan. Prosedur Kerja Kajian lapangan di Kabupaten Lampung Tengah dan Lampung Barat dilakukan pada bulan Oktober dan Desember 2007 sedangan 218 . kompas. antara lain alkohol 96%. larutan sub-limat. Bahan dan Alat Bahan yang dijadikan sebagai obyek kegiatan ekologi. BAHAN DAN ALAT A. B. karet. pena/alat gambar.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 2. Tanaman yang umum ditanam antara lain padi. dan potensi sebaran jenis pohon penghasil gaharu ini adalah semua jenis pohon yang diduga menghasilkan gaharu yang terdapat di kawasan hutan lindung. tinta gambar spesial. kamera digital. pisang. Talang Empat) dan Pungguk Gambo (Kec. Pondok Kelapa). Lokasi penelitian di Kawasan Hutan Binjai Temula (Kec. kantung plastik. karung plastik. kertas gambar spesial. fenologi. dan tanaman palawija lainnya. dan tali rafia. jeruk. baik primer dan sekunder. Bengkulu Utara Kawasan hutan dekat Desa Tanjung Terdana sebagian besar sudah dikonversi menjadi areal persawahan dan perkebunan masyarakat. jati. GPS Garmin 12 satelit. tambang nilon.

Desa Tanjung Terdana.. Kecamatan Talang Empat dan yang kedua di Hutan Lindung Kelompok Hutan Pungguk Gambo. Eksplorasi dilakukan di berbagai kondisi hutan. Pengumpulan data lapangan.Potensi dan Kondisi . Beberapa contoh pohon akan diambil untuk keperluan identifikasi dan koleksi herbarium. 219 . Pengamatan dan analisis gaharu meliputi beberapa macam kegiatan. Panjang tiap jalur eksplorasi yaitu 1 km dengan jarak antar jalur 500 m. dan 5 orang tenaga teknis lapangan. dan data penggunaan tradisional penduduk setempat.. Desa Dusun Baru.. baik di lahan kering maupun lahan basah. Pengamatan pertama di Bengkulu dilaksanakan di Hutan Lindung Kelompok Hutan Binjai Temula.. yaitu antara 0-200 m. antara lain: 2. Koleksi data primer di lapangan mencakup keanekaragaman jenis pohon penghasil gaharu dan kondisi lingkungan tempat tumbuhnya dengan menggunakan metode eksplorasi dalam jalur-jalur yang sistematik. Waktu pengamatan lapangan masing-masing selama 8 dan 10 hari. 3. 200-500 m. Kuesioner dipersiapkan sebelum kegiatan lapangan dilakukan. yaitu pada bulan Oktober dan Desember 2008. Provinsi Bengkulu dilaksanakan dua kali. Ketinggian tempat di lahan kering ada 3 macam. 1. baik secara langsung melalui wawancara dengan masyarakat yang tinggal di dekat dan sekitar hutan maupun tidak langsung dengan cara melakukan kajian pustaka. data kondisi lingkungan tempat tumbuh. Kegiatan pengamatan dan pengukuran di lapangan dikerjakan oleh seorang peneliti. Di samping itu dibuat juga blangko isian tersendiri yang digunakan untuk bahan wawancara dengan penduduk yang berisi pertanyaan-pertanyaan menyangkut berbagai macam informasi tentang karakter jenis-jenis pohon penghasil gaharu yang dikenal oleh penduduk setempat.(Titiek Setyawati) Kabupaten Bengkulu Utara. Kecamatan Pondok Kelapa. dan lebih dari 500 m dpl dengan topografi yang berbeda. 3 orang teknisi. yakni topografi datar (kemiringan lereng kurang dari 10%) dan bergelombang berat (kemiringan 25% atau lebih). Untuk itu digunakan blanko isian mencakup data pohon.

5. 7. Pengolahan data hasil wawancara dengan masyarakat lokal. Pada tiap titik pusat kuadran dilakukan perisalahan 4 individu pohon penghasil gaharu atau pohon lainnya yang terdekat dengan titik pusat atau 1 individu pohon pada tiap kuadran. 6. tingkat pancang (tinggi lebih dari 150 cm dengan diameter kurang dari 10 cm) dan tingkat tiang (diameter 10-20 cm) di sekitar titik pusat kuadran. Jarak anakan pertama dengan pohon induk diukur.Aspek SOSIAL EKONOMI DAN KONSERVASI 4. Jika anakan yang pertama ditemukan berada jauh dari pohon induk. 10. maka dibuat risalah anakan menggunakan metoda jalur transek sepanjang 1 km dari titik anakan pertama ditemukan. Pembuatan tally sheet untuk mengisi data tentang masa berbunga dan berbuah jenis-jenis pohon penghasil gaharu. Estimasi regenerasi jenis-jenis pohon penghasil gaharu yang terdapat di kawasan hutan dengan cara menghitung permudaan tingkat semai (tinggi kurang dari 150 cm). Penggambaran lukisan spesimen herbarium jenis pohon penghasil gaharu. Pendataan pohon meliputi nama jenis. dan tinggi pohon. Penulisan deskripsi jenis-jenis pohon penghasil gaharu yang disertai gambar lukisan spesimen herbarium. 9. Penduduk yang tinggal di dekat kawasan diminta untuk mengisi blanko kosong yang harus diisi dengan informasi kapan masa 220 . 11. Pengidentifikasian jenis-jenis pohon penghasil gaharu dan proses koleksi herbarium dari kegiatan eksplorasi. diameter batang. 8. Pengolahan data potensi keberadaan jenis pohon penghasil gaharu dan wilayah sebarannya yang terdapat di dalam kawasan hutan alam. Individu pohon tersebut yang dirisalah dibatasi jarak terjauh 25 m dari titik pusat kuadran dan diameter batangnya 20 cm atau lebih. Selanjutnya dibuat petak 10 m x 10 m di setiap selang 200 m dari jalur transek. Mengadakan pendugaan potensi dan sebarannya dengan menggunakan metode titik pusat kuadran (quadrant center point method) sepanjang jalur eksplorasi dengan jarak antara titik pertama dan titik berikutnya 50 m.

Nilai Penting (NP): perkiraan secara keseluruhan pentingnya suatu jenis pohon di dalam komunitas lokalnya. kondisi iklim atau cuaca pada saat berbunga atau berbuah (hujan. 1992. jumlah buah dan bunga (persentase). Analisis Data 1. 1992). 5. di mana jenis ditemukan. di Provinsi Lampung ini menunjukkan bahwa di beberapa lokasi di dalam kawasan Taman Nasional Bukit Barisan Selatan ini masih terdapat 221 .Potensi dan Kondisi . kering. malaccensis Lamk. jumlah pohon yang berbuah dan berbunga. DR merupakan rasio total luas bidang dasar dari suatu jenis terhadap jumlah total luas bidang dasar dari seluruh jenis yang ada. Hasil Pengamatan di Lampung Hasil pengamatan yang diperoleh dalam rangka melakukan kajian potensi sebaran jenis A. antara lain: 2. 1999. dan Frekuensi Relatif (FR) dari jenis tertentu. C.. 4. HASIL DAN PEMBAHASAN A. 3. Beberapa definisi dan kalkulasi yang digunakan dalam analisis vegetasi. Nilai NP ini diperoleh dengan cara menjumlahkan Dominansi Relatif (DoR). Luas Bidang Dasar (LBD): luasan bagian melintang dari batang >20 cm sebatas dada (diameter of breast height (dbh)). Kepadatan: jumlah individu per plot (100 m2). panas.(Titiek Setyawati) berbunga. dan sebagainya) dan mengisi data curah hujan. Luas bidang dasar untuk tiap plot dijumlah untuk memperoleh LBD tiap pohon dengan menggunakan rumus: LBD (m2) = pi x d (diameter dalam m)2/4 (Kent dan Coker. 1994). Frekuensi: jumlah unit contoh (10 m x 10 m).. Krebs.. KR merupakan rasio jumlah individu dari suatu jenis terhadap jumlah total jenis di dalam plot dan FR merupakan rasio frekuensi dari suatu jenis terhadap total frekuensi seluruh jenis di dalam plot (Kent dan Coker.. Kelimpahan Relatif (KR).

dan anakan yang ditemukan pada enam plot sampel tampak cukup banyak. Khusus di Bukit Rupi. Gunung Sugih. Lampung Tengah menunjukkan 222 . Tampak pada Gambar 3 kecambah gaharu yang tumbuh melimpah menyerupai permadani di bawah tegakan induknya yang ditemukan di Kawasan Hutan Bukit Rupi. Di lokasi ini juga dijumpai tegakan pohon penghasil gaharu alami yang tumbuh Gambar 3. Anakan gaharu yang ditemukan tumbuh secara besar di wilayah perkebunan alami di Kawasan Hutan Bukit milik masyarakat (Gambar Rupi. Nampak bahwa kondisi batang tegakan pohon sangat halus dan tidak ditemukan cacat pohon. Kemungkinan hal ini disebabkan akses ke dalam kawasan hutan yang relatif sulit dibandingkan dengan Kawasan Hutan Biha. jumlah tegakan pohon. Kemungkinan besar biji gaharu terbang dan menemukan media yang baik untuk tumbuh besar di kebun milik penduduk tersebut. mereka tidak merasa menanam pohon penghasil gaharu dan menemukan pohon tersebut tumbuh di halaman kebun mereka. Tegakan dapat dikatakan alami. Lampung Tengah 4). sapling. Hasil pengamatan regenerasi alam jenis gaharu di Kawasan Hutan Way Waya. belum ada laporan bahwa pohon tersebut pernah menghasilkan gaharu atau terinfeksi oleh patogen. Namun demikian. Lampung Tengah tertera pada Tabel 1. Jumlah pohon gaharu yang dapat ditemukan di Bukit Rupi. Di beberapa tempat juga tampak tandatanda bekas perambahan hutan yang tentunya sebagian besar untuk mengambil kayu gaharu. karena berdasarkan wawancara dengan pemilik kebun. Lampung Tengah. Tampaknya tidak banyak gangguan seperti pengambilan gubal gaharu di kawasan ini.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan alam pohon gaharu meskipun jumlah dan potensi regenerasi alamnya tampak mengalami penurunan seperti yang ada di Kawasan Hutan Biha.

Lampung Tengah 223 . namun bukan sama sekali tidak ditemukan seperti di Kawasan Hutan Gunung Sugi.. Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Hutan Biha sangat sedikit. sehingga kemungkinan sejak dahulu sudah banyak masyarakat yang memanfaatkan gaharu yang tumbuh alami namun hal ini tidak dibarengi dengan upaya budidayanya.(Titiek Setyawati) perkembangan yang sedikit berbeda dengan yang ada di Bukit Rupi.Potensi dan Kondisi .. malaccensis Lamk. Kurangnya jumlah pohon ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung.. Tegakan pohon A.. Lampung Tengah. Gambar 4. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Biha tertera pada Tabel 3. sehingga pemungut kayu gaharu setiap saat dapat secara kebetulan maupun ada juga yang dengan niat keras. menemukan jenis gaharu tersebut. Nampak pula bahwa sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu. yang ditemukan tumbuh secara alami di perkebunan milik masyarakat yang lokasinya berbatasan dengan Kawasan Hutan Bukit Rupi. meskipun lokasinya sama-sama di satu kabupaten. Tampak bahwa tidak satu pun jenis penghasil gaharu ditemukan di petak sampel (Tabel 2) di antara 13 jenis pohon hutan yang berhasil diidentifikasi di laboratorium Botani Hutan.

Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 5. Gunung Sugih. malaccensis Lamk. 5. Penduduk setempat yang sudah melakukan upaya bu-didaya penanaman pohon gaharu (A. 4. Jumlah pohon. Jumlah pohon. pancang. malaccensis Lamk. Lampung Tengah Pohon No 1 2 3 Nama jenis Artocarpus elasticus Ganophyllum falcatum Bombax valetonii Plot 15 5 4 Batang 45 10 5 Tiang Plot 2 0 0 Batang 6 0 0 Pancang Plot 0 4 2 Batang 0 15 4 Semai Plot 0 0 0 Batang 0 0 0 224 . yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Rupi. anakan dan semai beberapa jenis pohon alami yang ada dalam 50 plots penelitian di Kawasan Hutan Way Waya. Lampung Tengah Tabel 1. 2. Lampung Tengah No. Jumlah pohon (> 10 cm) 26 9 8 14 16 8 Jumlah pancang 34 15 21 16 19 17 Jumlah anakan 14 21 30 14 11 9 Tabel 2. pancang. 3. 6. dan anakan A. plot 1.) di kebun miliknya di Kawasan Hutan Gunung Sugih.

2. Lampung Barat No. oleh karena itu pembuatan plot dilakukan di hutan belukar tersebut. 4. pancang. Jumlah pohon. Artocarpus sp. malaccensis Lamk.Potensi dan Kondisi . Jumlah pohon (> 10 cm) 2 Jumlah pancang 1 2 4 Jumlah anakan 3 8 5 12 Berdasarkan informasi penduduk yang tinggal di Kawasan Hutan Lindung Bukit Sugih (Register 22 Way Waya) bahwa jenis pohon gaharu sudah sulit dijumpai karena adanya pembalakan hutan maupun adanya pencari gaharu di masa lampau. Desa Sendang Baru. plot 1. Kabupaten 225 . 3.. Alstonia angustifolia Pometia pinnata Cananga odorata Litsea sp. Ficus sp. Pohon gaharu yang masih ada di Kawasan Hutan Register 22 Way Waya.(Titiek Setyawati) Pohon No 4 5 6 7 8 9 10 11 12 13 Nama jenis Pterospermum diversifolium Laportea stimulans Vitex sp. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Biha. dan anakan A.. Kecamatan Sendang Agung. Hibiscus macrophyllus Plot 4 0 3 3 2 4 2 3 2 1 Batang 5 0 7 5 3 5 3 5 3 1 Tiang Plot 4 1 5 4 1 2 5 5 4 4 Batang 8 4 12 8 2 5 8 6 5 5 Pancang Plot 6 5 0 2 0 3 0 2 0 2 Batang 18 17 0 7 0 10 0 7 0 3 Semai Plot 4 12 11 10 0 6 12 5 13 0 Batang 8 20 23 15 0 12 23 12 20 0 Tabel 3... Namun demikian masih terdapat beberapa pohon penghasil gaharu alami yang tersisa di daerah hutan belukar.

malaccensis Lamk.Aspek SOSIAL EKONOMI DAN KONSERVASI Gunung Sugih. sedangkan tingkat tiang tidak dijumpai. malaccensis Lamk. Titik yang terdekat berjarak sekitar 5 km dengan jarak tempuh sekitar 1 jam berjalan kaki. Lampung Tengah. dan tingkat anakan terdapat 3 plot dengan jumlah masing-masing 30. (kiri) dan anakan yang tumbuh di bawahnya (kanan) di lokasi Kawasan Hutan Biha. Dari 50 plot yang dibuat terdapat 5 plot yang dijumpai pohon penghasil gaharu. 30 cm. itu pun terbagi tempatnya menjadi tiga titik dengan jarak tempuh yang berbeda. Gambar 6. 28 cm. Tegakan pohon A. dan 34 cm. Lampung Barat 226 . dan 102 batang. tingkat pancang hanya satu batang. 25 cm. hanya tinggal sekitar 5 pohon. (Thymelaeaceae). masing-masing satu batang pohon yang berdiameter 20 cm. Adapun jenis pohon penghasil gaharu yang ditemui hanya satu jenis yaitu A. 85.

Kondisi regenerasi di kawasan ini hampir sama dengan kawasan yang sebelumnya.(Titiek Setyawati) B. yaitu Binjai Temula. Tampak bahwa jumlah pohon sangat sedikit dan menurut informasi yang diperoleh dari masyarakat sekitar. yaitu di Kelompok Hutan Binjai Temula. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Pungguk Gambo tertera pada Tabel 5.86% (urutan kedua setelah Cinnamomum porectum (Roxb.. pada Kawasan Lindung Kelompok Hutan 227 . sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu.Potensi dan Kondisi . Jumlah pohon penghasil gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Binjai Temula tertera pada Tabel 4.. memiliki indeks nilai penting yang cukup tinggi pada tingkat pohon. malaccensis Lamk. A.) Kostm. Kecamatan Pondok Kelapa. Sampai saat ini masih terdapat perburuan gaharu di hutan alam dan bahkan masyarakat atau penduduk lokal mengumpulkan anakan pohon gaharu (semai dan pancang) dari hutan alam untuk diperdagangkan.20%). Kedua lokasi berada di Provinsi Bengkulu dan kedua kawasan juga masuk dalam kawasan hutan lindung. sehingga sejak dahulu sudah banyak memanfaatkan gaharu yang tumbuh alami. yaitu 39.72%). Kecamatan Talang Empat dan Kelompok Hutan Pungguk Gambo.. Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Kawasan Binjai Temula ini sangat sedikit. Hal ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung dan kemungkinan besar juga adalah tingkat reproduksi tegakan yang mulai berkurang. Tegakan gaharu pada tingkat tiang dan pancang tidak ditemukan pada plot sampel namun mendominasi pada tiangkat seedling (38. Hasil Pengamatan di Kawasan Hutan di Provinsi Bengkulu Hasil menunjukkan bahwa A. Desa Tanjung Terdana. (57. Desa Dusun Baru. Hal ini terjadi terutama di Kawasan Lindung Kelompok Hutan Pungguk Gambo. merupakan jenis yang ditemukan di kedua lokasi penelitian di Bengkulu Utara.. Berdasarkan angka nilai pentingnya. malaccensis Lamk. Berdasarkan hasil analisis vegetasi di Kelompok Hutan Binjai Temula.

Aspek SOSIAL EKONOMI DAN KONSERVASI Pungguk Gambo. pohon penghasil gaharu (>20 cm) menduduki urutan keempat (43.30%). porectum (Roxb.82%).20%) setelah Vitex pubescens Vahl. dan Garcinia diocia Blume (56. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Binjai Temula.55%). malaccensis Lamk. Kecambah atau biji yang mulai tumbuh (kiri) dan beberapa anakan mulai tinggi (kanan) di areal Kelompok Hutan Pungguk Gambo Tabel 4. Pada plot sampel di lokasi Pungguk Gambo. banyak ditemukan kecambah atau biji-biji yang mulai berkecambah di bawah pohon induknya serta beberapa anakan dengan pertumbuhan yang cukup sehat (Gambar 7). plot 1. (67. (90. 3. pancang.48%) untuk tingkat seedling atau semai. 5. Tegakan tidak ditemukan di tingkat tiang dan hanya memiliki nilai penting 3. Jumlah pohon. C. 2. dan anakan A.) Kostm. 4. Bengkulu Utara No. Jumlah pohon (> 10 cm) 1 1 0 1 1 0 Jumlah pancang 0 0 0 0 0 0 Jumlah anakan 0 3 1 2 3 2 228 . 6. Gambar 7.59% pada tingkat pancang dan berada di urutan keempat (19.

.5 kg pada musim yang baik. plot 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 0 1 Jumlah pancang 0 0 0 0 Jumlah anakan 2 1 3 3 Tabel 5. pancang dan anakan A. 5 6 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 1 0 1 0 0 0 0 0 Jumlah pancang 0 0 2 0 0 0 0 0 0 0 Jumlah anakan 0 0 0 0 0 3 0 4 0 0 Biji yang mulai berkecambah tersebut tumbuh sangat rapat dan pada umumnya hanya bertahan beberapa hari saja... 2.Potensi dan Kondisi . malaccensis Lamk. plot 1. Namun demikian semai/seedling berukuran tinggi di atas 10 cm saja dihitung dalam petak pengamatan (2 m x 2 m) untuk memperoleh angka nilai penting. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Pungguk Gambo No. Masa 229 .. Tegakan pada tingkat pohon terlihat sangat rapat (Gambar 8) dan pada sebagian petak sampel terdapat pohon dengan ukuran diameter yang cukup besar namun belum menampakkan tandatanda terjadinya pembusukan yang mengakibatkan terbentuknya gaharu (Gambar 9). karena akan dipungut oleh penduduk untuk diperdagangkan. 3.(Titiek Setyawati) No. 4. Jumlah pohon. Pada umumnya pohon mulai berbunga dan berbuah pada umur 5 sampai 6 tahun bahkan pohon berukuran sedang bisa menghasilkan biji kurang lebih 1.

Buah ini harus langsung dipanen dari pohonnya. Sumarna et al. 2001). Perkecambahan biji dan anakan yang muda sangat rentan terhadap penyakit damping off yang disebabkan oleh jamur (Kundu dan Ka-chari. Petani menggunakan pestisida jika perlu untuk membasmi serangga ini. Meskipun ada. Penyakit seperti ini tidak ditemukan di lokasi penelitian di Bengkulu Utara. menghisap cairan daun dan menyebabkan helai pucuk daun bergulung dan mengakibatkan anakan menjadi kerdil. Buah yang matang berwarna coklat kehitamhitaman. Di Sumatera. Masalah utama di lapangan adalah penyakit pada anakan yang disebabkan oleh serangga kecil yang hinggap di ujung daun anakan. Gambar 8. 230 . Pohon gaharu dengan diameter ≥ 50 cm Pohon berbunga pada bulan Juli dan Agustus dan menghasilkan buah matang pada bulan November-Desember. 2004). Pembungaan pada bulan Maret-April akan menghasilkan buah di bulan Juli-Agustus (Adelina..Aspek SOSIAL EKONOMI DAN KONSERVASI berbunga dan berbuah biasanya terjadi pada bulan-bulan kering. masa berbunga dan berbuah 2 kali dalam setahun. Tegakan gaharu yang rapat Gambar 9. 2000.

Hasil pengamatan di dua lokasi contoh di Kabupaten Bengkulu Utara..33 pohon/ha di Papua. Demikian pula dengan potensi regenerasinya yang ditunjukkan dengan sedikitnya jumlah semai maupun anakan yang ada di bawah tegakan alam. tampak bahwa potensi tegakan alam A. Estimasi potensi stock kayu gaharu di Indonesia yaitu 1. 2001). malaccensis Lamk. Bisanya petani akan membuang anakan yang sakit. Saat ini gaharu sudah masuk dalam Appendix II CITES. KESIMPULAN DAN SARAN A. Tampak bahwa stock di kawasan hutan di Sumatera lebih rendah dibandingkan dengan kawasan hutan yang ada di Kalimantan dan Papua.. Soehartono dan Newton.37 pohon/ha di Kalimantan. tampak bahwa potensi tegakan alam A. 2. Kesimpulan 1. 2007.(Titiek Setyawati) dilaporkan hanya sedikit di beberapa tempat saja. 3. Beberapa peneliti menduga bahwa hanya 10% dari pohon Aquilaria yang mengandung gaharu.. maka banyak kolektor yang tidak berpengalaman pada akhirnya ikut mengeksploitasi gaharu di alam. malaccensis Lamk. Berdasarkan hasil pengamatan lapangan dan estimasi potensi regenerasi alam jenis-jenis pohon penghasil gaharu yang tumbuh di hutan alam di beberapa lokasi contoh di Kabupaten Lampung Tengah dan Lampung Barat. Sebagai akibatnya populasinya di alam makin lama makin berkurang. masih banyak namun demikian kondisinya saat ini menghadapi ancaman penurunan populasi di berbagai tingkatan umur 231 .. sudah mengalami penurunan populasi.87 pohon/ha di Sumatera.Potensi dan Kondisi . dan 4. Namun hal ini tidak mengurangi kerusakan dan berkurangnya populasi gaharu di alam (Anonim. Meskipun tampak bahwa di kawasan Bengkulu Utara di sebagian tempat tampak rapat namun keberadaan pohon penghasil gaharu sendiri tidak menjamin adanya resin gaharu. Indonesia merupakan eksportir utama produk gaharu dan dengan tingginya permintaan pasar akhir-akhir ini serta tingginya harga yang ditawarkan di pasar dunia.

B. Berlainan dengan temuan yang ada di Provinsi Lampung. malaccensis Lamk. Meskipun demikian jenis pohon ini mengalami ancaman serius akibat perburuan. Untuk data masa pembungaan dan berbuah sampai saat penelitian belum dapat diperoleh mengingat masa pengamatan tidak bertepatan dengan masa berbunga dan berbuah. kawasan hutan di Provinsi Bengkulu. mengingat potensi jenis gaharu yang masih tampak baik. Meskipun ada beberapa lokasi sampel dengan kondisi tegakan pohon dewasa yang sangat kurang. sehingga potensi regenerasi alami akan mengalami hambatan karena ketidakseimbangan pertumbuhan di setiap tingkatan terutama tidak terjadinya pertumbuhan mencapai tingkat tiang. khususnya Kabupaten Bengkulu Utara memiliki potensi tegakan alam gaharu yang juga cukup baik dilihat dari sisi populasi tegakan alaminya. khususnya Kabupaten Lampung Tengah dan Lampung Barat memiliki potensi tegakan alam gaharu yang cukup merata meskipun di beberapa lokasi jumlah sampelnya tidak memadai. sehingga diperlukan penyuluhan bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan Taman Nasional Bukit Barisan Selatan dan kawasan hutan lindung. Kawasan hutan di Provinsi Lampung dan Bengkulu memiliki potensi yang cukup baik untuk dijadikan areal sumberdaya genetik untuk jenis A. Sedikit lebih baik dari kondisi gaharu di Provinsi Lampung. tidak hanya pohonnya namun juga anakan alaminya.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan. terutama di tingkat seedling dan sapling. Akibatnya bagi proses regenerasi alaminya terjadi kekosongan tegakan pada tingkat tiang. akibat pemanenan gaharu yang kurang memperhatikan aspek kelestarian. Tampak pula terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. 3. Sebagian besar penduduk memperjualbelikan anakan alami untuk 232 . Saran Provinsi Lampung. di Bengkulu ditemukan adanya laporan serangan serangga yang menyebabkan pertumbuhan tegakan gaharu menjadi kerdil.

L. Kachari. 2004. C. December 2004. II. Kent.. C. Siapkan Masa Depan. Desiccation Sensitivity and Recalcitrant Behaviour of Seeds of Aquilaria agallocha Roxb.species_gaharu. 2007. wwf. 1994. M. Krebs. Claiming the Forest.id/index. 2002. 103. Jim Green. Aquilaria malaccensis Lamk.. Media on line : http// www. Kaskija. DAFTAR PUSTAKA Adelina. Vol.Potensi dan Kondisi .tanam.(Titiek Setyawati) dikembangkan lebih lanjut atau ditanam di kebun masyarakat ataupun dijual ke luar daerah Bengkulu. k o m p a s . 233 .ayo.c o m / r e a d / xml/2009/07/24/1300220/siapkan. Ecological Methodology. Mengingat masih terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. Harper Collins College Publishers. terutama gangguan terhadap proses regenerasi alaminya.masa. I. Behalven Press..depan. 2000. N. Ko m p a s o n l i n e : h t t p : / / r e g i o n a l . Seed Leaflet No. CIFOR. East Kalimantan. Heyne. Coker. Yayasan Sarana Wana Jaya. Krebs. dan IV. Anonim. dan J. Jakarta. Downloaded: 24 Januari 2007. dan P. M.php?fuseactian=whatwedo.. Vegetation Description and Analysis : A Practical Approach. Punan Local Histories and Recent Developments in Bulungan. 2009. Tumbuhan Berguna Indonesia.or. 1992. CRC Press. 1999. Gaharu (Aquilaria). Badan Penelitian dan Pengembangan Kehutanan. J. Ayo Tanam Gaharu. Forest & Landscape Denmark. Seed Science and Technology. III. 1987. Ecology : The Experimental Analysis of Distribution and Abundance. Indonesia. gaharu Anonim. maka diperlukan penyuluhan atau pendidikan konservasi bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan hutan lindung yang merupakan habitat alami jenis pohon penghasil gaharu ini. J. K. Kundu.

2001. Balai Penelitian Kehutanan Manokwari.C. dan N. Pengaruh Wadah Penyimpanan dan Kelas Diameter Terhadap Pertumbuhan Stump Wikstroemia polyantha. Resources and People in Bulungan. Elements for a History of Settlement. Australia. Biological Conservation No. 1996. Soehartono. with reference to CITES Decisions 11. dan A. Indonesia.A.113 Regarding Aquilaria spp. 2000. R. dan B. A. The Impact of Gaharu Harvesting in Indonesia. dan A. Newton. 234 . 2001. Bogor. Pelestarian dan Pemanfaatan Keanekaragaman Tumbuhan Obat Hutan Tropika Indonesia.K. Canberra. CSIRO Plant Industry. Suripatty. Sellato. B.. Biological Conservation No 97. Buletin Penelitian Kehutanan 1(1). dan J. 2001. Zich. An information Document Prepared by TRAFFIC Oceania for the Eleventh Meeting of the CITES Plants Committee. 96. T. Bulungan Ethnobiology Handbook.Aspek SOSIAL EKONOMI DAN KONSERVASI Mai.A. F. Status and Use in Indonesia. 2001. CIFOR.M. Zuhud. T. Pembibitan Jenis Pohon Penghasil Gaharu (Aquilaria malaccensis Lamk). Syaffari. 1994. Irian Jaya. Agarwood (Gaharu) Harvest and Trade in Papua New Guinea : A Preliminary Assessment. 1880-2000. Soehartono. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria II. Compton. Centre for Plant Biodiversity Research.CIFOR.R. Puri. Forest. Latin. Y. R. Bogor. Sumarna.112 and 11. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria I. CIFOR. E. 2001. Newton. East West Center-Prosea.C. Trade and Social Dynamics in Borneo. Indonesia. Mindawati.

. Comersonia bartamia Merr Dehaasia caesia Blume Clidenia hirta don Kibessia azurea DC. Clausena excavata Burm. Eugenia grandis Wight Neonauclea calycina Merr Barringtonia sp.. Garcinia dioica Bl.) Kosterm.(Titiek Setyawati) Lampiran 1. Strombosia javanica Blume Garcinia celebica L. Daftar jenis pohon yang di survei dalam plot pengamatan gaharu di Bukit Rupi. Antidesma tetandrum Blume Peronema canescens Jack Famili Thymelaeaceae Verbenaceae Myrtaceae Rubiacea Lecythidiaceae Moraceae Moraceae Lauraceae Dilleniaceae Moraceae Rhizophoraceae Dilleniaceae Selaginelaceae Dilleniaceae Rutaceae Rutaceae Apocynaceae Sterculiaceae Lauraceae Melastomataceae Melastomataceae Hypericaceae Theaceae Guttiferae Ulmaceae Mimosaceae Olacaceae Guttiferae Lauraceae Celasteraceae Theaceae Euphorbiaceae Verbenaceae 235 . Dillenia sumatrana Miq. Parkia speciosa Hassk. Cinnanmomum porectum (Roxb. Dillenia excelsa Gieg..Potensi dan Kondisi . Artocarpus elasticus Reinw. Ficus variegata Bl. Selaginella plana Hiern. Cinnamomum iners Blume Peltophorum grande prain Eurya acuminata APDC. Carallia brachiata Merr Tetracera indica L. Vitex pubescens Vahl. Evodia aromatica Blume Alstonia angustiloba Miq. Lampung Tengah No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Nama lokal Kayu alim Leban Kelat Kelepu Putat Lahu Ketaran Kilada Simpur Terap Sepat Rempelas Lingkem Ranggung Ancau Cempaka Pulai Lupang Medang Kedukduk Gio Kemutul Seru Asam Kandis Nerung Petai Sebasah Beruas Tepa Sago Sidi Nyari Sungkai Nama botanis Aqualaria malaccensis Lamk. Schima wallichii Korth. Parasponia parvifolia Miq. Artocarpus anisophyllus Reinw. Cratoxylum formosum Dyer..

Ganophyllum falcatum Blume Lucuma maingayi Dub Carallia brachiata Merr Famili Thymelaceae Lauraceae Verbenaceae Myrtaceae Leguminosae Lauraceae Dilleniaceae Moraceae Leguminosae Burseraceae Euphorbiaceae Euphorbiaceae Rubiaceae Euphorbiaceae Hyperiaceae Styraxaceae Compositae Rutaceae Lauraceae Annonaceae Liliaceae Euphorbiaceae Symplocaceae Myristicaceae Guttiferae Euphorbiaceae Euphorbiaceae Hyperiaceae Elaeocarpaceae Linnaceae Lauraceae Myrtaceae Rubiaceae Rubiaceae Rubiaceae Sapotaceae Sapotaceae Rhizophoraceae 236 .Angit Jungjung bukit Sugi Sipunan Kenidai Kendung Naran Kandis Kbg Saka/ Seketut Pelangas Lulus Gamat Marabikang Kemalau Gelam Abang K.Gambir Ketepung K. Desa Dusun Baru. Aporusa aurita Miq Cratoxylum sumatranum (Jack) Blume Elaeocarpus stipularis Blume Ixonanthes petiolaris Blume Litsea firma Hook. Clausena exavata Actinodaphne glabra Blume Orophea sp Pleomele elliptica H.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 2.) Kostrm Vitex pubescens Vahl Rhodamnia cinerea Jack Parkia speciosa Hassk Litsea odorifera T et B Dillenia exelsa Gilg Artocarpus elasticus Reinw Archidendron jiringa (Jack) Nielsen Canarium dichotonum Miq Baccaurea racemosa Muell Arg Croton argyratus Blume Neonauclea calycina Merr Glochidion zeylanicum Juss Cratoxylum formosum (jack) Dyer Styrax benzoind Dryand Vernonia arborea Ham.f Eugenia glomerata K et V Timonius sericanthus Boerl Tarenna sp. Kecamatan Talang Empat.Beras Salung Gajah Salung Urat Use Nyaran Ingitdare Nama botanis Aquilaria malaccensis Lamk Cinnamomum porectum (Roxb. Bengkulu Utara No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Nama lokal Karas Gadis Leban Marapuyan Petai Berawas Sipo Terap Jering Tetak Tunjuk Semipis Kademe Semuting Seubo-ubo Kemutun K. Daftar jenis pohon yang ada di dalam Kelompok Hutan Binjai Temula.Br Bridelia monoica Merr Symplocos cochinchinense Lour Horsfieldia glabularis Warb Garcinia dioica Blume Aporusa sp. Tarenna confusa K et V.

Sign up to vote on this title
UsefulNot useful