ISBN 978-979-3145-63-1

Pengembangan Teknologi Produksi

berbasis pemberdayaan masyarakat
Editor: Sulistyo A. Siran; Maman Turjaman

PENGEMBANGAN TEKNOLOGI PRODUKSI GAHARU BERBASIS PEMBERDAYAAN MASYARAKAT SEKITAR HUTAN
Editor: Sulistyo A. Siran; Maman Turjaman ISBN: 978-979-3145-63-1 Penerbit: Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Kampus Balitbang Kehutanan Jl. Gunung Batu No. 5, Bogor 16110 Telp. (0251) 8633234, 7520067; Fax. (0251) 8638111 E-mail: p3hka_pp@yahoo.co.id

Petikan Undang-Undang Nomor 19 Tahun 2002 tentang Hak Cipta Ketentuan Pidana Pasal 72 (1) Barangsiapa dengan sengaja dan tanpa hak melakukan perbuatan sebagaimana dimaksud dalam Pasal 2 ayat (1) atau Pasal 49 ayat (1) dan ayat (2) dipidana dengan pidana penjara masing-masing paling singkat 1 (satu) bulan dan/atau denda paling sedikit Rp 1.000.000,00 (satu juta rupiah), atau pidana penjara paling lama 7 (tujuh) tahun dan/atau denda paling banyak Rp 5.000.000.000,00 (lima miliar rupiah). (2) Barangsiapa dengan sengaja menyiarkan, memamerkan, mengedarkan, atau menjual kepada umum suatu Ciptaan atau barang hasil pelanggaran Hak Cipta atau Hak Terkait sebagaimana dimaksud pada ayat (1) dipidana dengan pidana penjara paling lama 5 (lima) tahun dan/atau denda paling banyak Rp 500.000.000,00 (lima ratus juta rupiah).

ii

KATA PENGANTAR
Terdapat enam tantangan pembangunan kehutanan yang kita hadapi saat ini, yaitu: degradasi hutan, bencana alam dan lingkungan, pemanasan global, share sektor kehutanan terhadap pertumbuhan ekonomi nasional, desentralisasi sektor kehutanan, dan kontribusi kehutanan dalam hal food, water scarcity, energy, and medicine. Namun, kita masih melihat ada peluang yang merupakan sebuah anugerah bagi bangsa kita, yang bila dibudidayakan dan dikelola secara serius akan dapat menjawab paling tidak lima dari enam tantangan tadi. Anu-gerah yang juga merupakan peluang usaha sektor kehutanan dari jenis HHBK ini bernama “gaharu”. Ide dan gagasan membangun hutan tanaman gaharu juga menarik untuk kita kaji bersama. Kalau selama ini perusahaanperusahaan HTI telah eksis dengan komoditi-komoditi kayu seperti mangium, sengon, mahoni, dan jenis tumbuhan penghasil kayu lainnya, maka bukanlah hal yang mustahil untuk mengembangkan hutan tanaman penghasil gaharu apabila secara finansial menjajikan dan memungkinkan setelah dianalisis kelayakan usahanya. Pengembangan usaha budidaya tanaman HHBK unggulan akan berhasil dengan baik apabila didukung oleh semua stakeholder yang berkepentingan, baik Pemerintah Pusat dalam hal ini Departemen Kehutanan, Pemerintah Daerah, pengusaha, dan petani. Disampaikan terima kasih dan penghargaan yang setinggitingginya kepada semua pihak yang telah berkontribusi hingga terbitnya buku ini.
Jakarta, Nopember 2010

Kepala Badan Litbang Kehutanan

Dr. Ir. Tachrir Fathoni, MSc.

iii

iv

................................ v PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A.......................iii DAFTAR ISI ..... APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp............... Erdy Santoso .. Irnayuli R.... PENGEMBANGAN GAHARU DI SUMATERA Mucharromah........................ PADA Aquilaria microcarpa Eka Novriyanti ..... Sitepu.................................................... Ahmad Yani...................31 Aspek PRODUKSI ...... Aryanto ......................................................................................... Aryanto........35 2................................................................ DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu .......53 3....77 4.... Siran ............................................. 113 5.......................................... EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp....................................1 STATUS RISET GAHARU ..... Sugeng Santosa.......................... Najmulah..... 139 v ............ Ragil S..................... Sugeng Sentosa........................................ UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto................................................... KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp............................................................... DI PERSEMAIAN Irnayuli R.................................... Ragil Setio Budi Irianto....97 Aspek SILVIKULTUR ........33 1.. 115 6............... Irnayuli R.............................. PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman........................ Maman Turjaman ..................................B........................................... DAN Fusarium sp..... Irianto................... Maman Turjaman........... TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso..... Maman Turjaman ... Yasuyuki Hashidoko.... Sitepu. Ahmad Yani............. Erdy Santoso................................. Sitepu. 123 7.......................... Aryanto..................... Najmulah..................................DAFTAR ISI KATA PENGANTAR.......

............. THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo ....................... HAMA PADA TANAMAN PENGHASIL GAHARU Ragil SB Irianto........................................... 159 10.......................... PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti ................................................... 151 Aspek SOSIAL EKONOMI DAN KONSERVASI ..................................................... Maman Turjaman............................................. 157 9....................) DI PROVINSI LAMPUNG DAN BENGKULU.................................. 193 12.............. SUMATERA Titiek Setyawati.................................Daftar Isi 8............................................. POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk...................................... Sitepu ..................... Erdy Santoso. KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi ....................... 181 11... Irnayuli R......................................................................... 213 vi ....

PERKEMBANGAN PEMANFAATAN GAHARU Sulistyo A. Gaharu sebenarnya sebuah produk yang berbentuk gumpalan padat berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar tanaman pohon inang (misalnya: Aquilaria sp. gaharu sejak zaman dahulu kala sudah digunakan. gaharu memang sangat unik. Dari sisi manfaat. Siran Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu sebuah nama komoditi hasil hutan non kayu yang saat ini menjadi perbincangan banyak kalangan. yaitu karena pengambilan jauh lebih besar daripada produksinya. baik oleh kalangan elit kerajaan. Dilihat dari wujud dan manfaatnya. maupun masyarakat 1 . Jawaban yang sudah pasti adalah rumus umum. Oleh sebab itu tidak semua pohon penghasil gaharu mengandung gaharu. lantas kenapa komoditi yang telah populer tersebut sepertinya menghilang begitu lama dan saat ini muncul kembali. Pepatah ini mengindikasikan bahwa sebenarnya komonditi gaharu sudah dipopulerkan oleh nenek moyang kita dan menjadi bukti sejarah bahwa keharuman gaharu telah dikenal sejak ratusan tahun yang lalu.) yang telah mengalami proses perubahan fisika dan kimia akibat terinfeksi oleh sejenis jamur. Pertanyaan yang muncul. Dalam kehidupan seharihari telah dikenal pepatah “sudah gaharu cendana pula”.

000. kualitas Kacangan dengan harga rata-rata Rp15. Meningkatnya perdagangan gaharu sejak tiga dasawarsa terakhir ini telah menimbulkan kelangkaan produksi gubal gaharu dari alam. harga jual yang tinggi.000.000.000.000.000. Walaupun sejak 1994 Indonesia berkewajiban melindungi pohon penghasil gaharu. Secara tradisional gaharu dimanfaatkan antara lain dalam bentuk dupa untuk acara ritual dan keagamaan. harga gaharu dengan kualitas Super di pasaran lokal Samarinda.. Besarnya permintaan pasar.-). bahan obatobatan yang memiliki khasiat sebagai anti asmatik. dan Suloan (Rp75.000.suku pedalaman di Sumatera dan Kalimantan. Tarakan. maka jenis-jenis tertentu misalnya Aquilaria dan Gyrinops saat ini sudah tergolong langka. dan ekonomi yang cukup tinggi.-.000.000.s/d Rp 50. Kalimantan Timur mencapai Rp 40.s/d Rp14.s/d Rp 4. sabun.000. aroma terapi. kualitas Teri (Rp 10.. Selama ini masyarakat hanya tinggal memanen gaharu yang dihasilkan oleh alam. Berdasarkan informasi. pengharum tubuh dan ruangan. namun menurut kenyataan.000. body lotion. dan stimulan kerja syaraf dan pencernaan. kualitas Kemedangan (Rp 1. dan pola pemanenan yang berlebihan serta perdagangan yang masih mengandalkan pada alam tersebut. Kelangkaan terjadi karena pohon penghasil gaharu ditebang tanpa memperhatikan 2 . Bertahun-tahun masyarakat dan pemerintah daerah Kalimantan dan Sumatera menikmati berkah dari keberadaan gaharu. Saat ini pemanfaatan gaharu telah berkembang demikian meluas antara lain untuk parfum. bahan kosmetik dan obat-obatan sederhana. Seringkali masyarakat tidak tahu pasti kapan pohon penghasil gaharu mulai membentuk gaharu dan bagaimana prosesnya.000. dan Nunukan. keberadaan pohon penghasil gaharu tersebut di Indonesia tidak terkecuali di Sumatera dan Kalimantan semakin langka.000. baik sebagai sumber pendapatan masyarakat maupun penerimaan daerah.000. Gaharu dengan demikian mempunyai nilai sosial..-.000. disusul kualitas Tanggung dengan harga rata-rata per kilogram Rp 20. anti mikrobia.-). budaya.per kilogram.-). dan masuk dalam lampiran Convention on International Trade on Endangered Spcies of Flora and Fauana (Appendix II CITES)..000.000.

perguruan tinggi. Peningkatan produksi gaharu dimaksud (yang kegiatannya terdiri dari kegiatan di bagian hulu sampai hilir) selanjutnya akan berdampak pada peningkatan penerimaan oleh masyarakat petani. dan LSM konservasi. Indikasi menurunnya pupulasi pohon penghasil gaharu ditunjukkan oleh kecenderungan produksi gaharu dari Kalimantan dan Sumatera dari tahun ke tahun. dari 20 pohon penghasil gaharu yang ditebang di hutan alam hanya ada satu atau sering sama sekali tidak ada yang mengandung gaharu. Sementara masyarakat secara luas enggan untuk melakukan budidaya pohon penghasil gaharu karena memang tidak memberikan keuntungan apa-apa. Dengan teknologi inokulasi maka produksi gaharu dapat direncanakan dan dipercepat melalui induksi jamur pembentuk gaharu pada pohon penghasil gaharu. Namun upaya tersebut tidak mudah dilaksanakan. maka jumlah gaharu yang ada di pohon tersebut hanya beberapa gram saja. Guna menghindari agar tumbuhan jenis gaharu di alam tidak punah dan pemanfaatannya dapat lestari maka perlu diupayakan untuk konservasi. Kalaupun ada pohon yang mengandung gaharu. pengusaha 3 .. baik in-situ (dalam habitat) maupun ek-situ (di luar habitat) dan budidaya pohon penghasil gaharu. Praktek semacam inilah yang mengakibatkan jumlah pohon pengahasil gaharu di alam semakin menurun dari tahun ke tahun. mungkin puluhan atau bahkan ratusan pohon penghasil gaharu yang harus ditebang. di mana realisasi produksi gaharu pada dekade 80’an pernah mencapai ribuan ton dengan kualitas yang tinggi. Menurut hasil kajian. sedangkan saat ini produksi tersebut merosot drastis hanya kira-kira puluhan ton saja dengan kualitas yang bervariasi.. Prospek untuk mengembalikan gaharu menjadi komoditi andalan kembali terbuka dengan ditemukannya teknologi rekayasa produksi gaharu..Perkembangan Pemanfaatan Gaharu . Oleh karena itu dapat dibayangkan kalau pencari gaharu mendapatkan gaharu kira-kira 5 kilogram. dan kalaupun ada usaha konservasi dan budidaya namun skalanya terbatas dan hanya dilakukan oleh lembaga penelitian. Siran) ada atau tidak adanya gaharu pada pohon tersebut. (Sulistyo A..

Pulau Sulawesi (2 jenis). Oleh sebab itu tidak semua tanaman penghasil gaharu menghasilkan gaharu. konservasi. Selain itu hutan hujan tropis Kalimantan juga sangat kaya dengan hasil hutan bukan kayu (HHBK). dan Kepulauan Maluku (1 jenis). Kalimantan Barat. perlunya budidaya. dan penerimaan pendapatan asli daerah serta devisa negara. Tulisan ini dipaparkan dengan maksud untuk memberikan gambaran secara umum mengenai pemanfaatan gaharu. Pulau Papua (2 jenis). GAMBARAN UMUM TUMBUHAN PENGHASIL GAHARU Hutan hujan tropis di Indonesia semenjak tiga puluh tahun yang lalu dikenal sebagai salah satu penghasil utama kayu bulat (log) untuk bahan baku industri perkayuan. dan rekayasa pembentukan gaharu yang dapat mengembalikan status komoditi dari kelangkaan menjadi produk andalan. tumbuh tersebar secara luas di Kalimantan Timur. Gaharu adalah gumpalan berbentuk padat.gaharu. Kalimantan 4 . yang dilaksanakan pada tahun 2000 ditemukan bahwa Aquilaria spp. Di lndonesia hingga saat ini diperkirakan terdapat lebih kurang 25 jenis tumbuhan penghasil gaharu yang dikelompokkan ke dalam delapan marga dan tiga suku. Dari pengamatan sebaran Aquilaria spp. pemahaman mengenai pentingnya nilai gaharu. Berdasarkan sebaran tempat tumbuh. berwarna coklat kehitaman sampai hitam dan berbau harum yang terdapat pada bagian kayu atau akar dari jenis tumbuhan penghasil gaharu yang telah mengalami proses perubahan kimia dan fisika akibat terinfeksi oleh sejenis jamur. tumbuhan penghasil gaharu umumnya tumbuh di Pulau Kalimantan (12 jenis) dan Pulau Sumatera (10 jenis). Pulau Jawa (2 jenis). kemudian dalam jumlah terbatas tumbuh di Kepulauan Nusa Tenggara (3 jenis). di mana salah satu di antaranya adalah gaharu yang bernilai ekonomis tinggi.

nor-ketoaaga-rofuran.Perkembangan Pemanfaatan Gaharu . Lebih lanjut Susilo (2003) mengatakan bahwa terdapat 17 macam 5 . dan Kalimantan Selatan. di hutan alam semakin menurun dan bahkan pada suatu saat menjadi punah. KANDUNGAN DAN MANFAAT GAHARU Terdapat beberapa zat penting yang terkandung dalam gubal gaharu yaitu (-agarofuran. Untuk mencegah dari kepunahan maka pada pertemuan CITES (The Convention on International Trade in Endangered Species of Wild Flora and Fauna) ke-IX di Florida. Indikasi dari menurunnya populasi Aquilaria spp. Menyadari semakin langkanya tumbuhan penghasil gaharu. jinkohol II serta oxo-aga-rospirol. seluruh jenis Aquilaria telah dimasukkan dalam Appendix II CITES. salah satu tumbuhan penghasil gaharu terpenting yang banyak tumbuh di Kalimantan telah dimasukkan ke dalam Appendix II sebagai tumbuhan yang terancam punah sehingga dalam penebangan dan perdagangannya perlu dibatasi. Amerika Serikat pada tahun 1994. kusunol. (-)-10-epi-y-eudesmol. baik lokal maupun pendatang untuk melakukan eksploitasi gaharu secara besar-besaran. populasi Aquilaria spp. agarospirol. baik untuk kepentingan konservasi maupun ekonomi. di pedalaman hutan Kalimantan Barat dan Kalimanatan Tengah serta menurunnya realisasi produksi gaharu dari tahun ke tahun. (-agarofuran. terus mengalami penurunan. beberapa instansi pemerintah dan masyarakat telah melakukan inisiatif untuk mengadakan pelestarian tumbuhan penghasil gaharu dan sekaligus membudidayakan. Bahkan sejak tahun 2004... Siran) Tengah. antara lain dari pergerakan pencari gaharu yang telah mengarah pada bagian utara Kalimantan Timur. (Sulistyo A.. Walaupun realisasi produksi gaharu tidak menggambarkan besarnya potensi.. namun dengan semakin sulitnya mendapatkan gaharu dari waktu ke waktu menunjukkan populasi Aquilaria spp. dihydrokaranone. Tingginya permintaan pasar dunia akan gaharu dan harga jual gaharu yang cukup tinggi telah menarik minat masyarakat. jinkohon-eremol. Aquilaria malaccensis. jinkohol. Akibatnya.

Selain itu gaharu telah dipergunakan sebagai bahan baku industri parfum. maka pengetahuan cara pendugaan kandungan gaharu pada tumbuhan penghasil gaharu yang terinfeksi jamur pembentuk gaharu perlu diketahui terutama oleh para pemungut pemula 6 . gaharu dimanfaatkan sebagai obat sakit perut. dan obatobatan. antara lain: noroxoagarofuran. Limbah bekas gaharu yang telah disuling digunakan untuk dupa dan bahan untuk upacara agama. agarospirol. tasbih. radang lambung dan ginjal. sedangkan air suling gaharu dimanfaatkan untuk kesehatan. kecantikan. malaria. asma. kanker. membakar jenazah bagi umat hindu. Di Cina. kebugaran serta bahan minuman (kopi) oleh masyarakat di Kabupaten Berau. p-methoxybenzylaceton. kanker. Selanjutnya Oiler (tanpa tahun) dalam Suhartono dan Mardiastuti (2003) menyebutkan terdapat 31 unsur kimia yang terkandung di dalam gaharu dan bahan kimia penyusun utamanya adalah 2-(2-(4 methoxyphenyl)ethil)chromone (27%) dan 2-(2-phenylethyl)chromone (15%). gubal gaharu diperdagangkan sebagai komoditi elit untuk keperluan industri parfum. Karena aromanya harum. dan stres. gangguan ginjal. untuk pengobatan stres. tumor. kosmetika. PEMUNGUTAN DAN PENGOLAHAN GAHARU A. dan tumor yang masih dalam proses uji klinis. 3.4 –dihydroxy-dihydro-agarufuran. dan pengawet berbagai jenis asesori. Cara Pendugaan Kandungan Gaharu Karena tidak semua tumbuhan penghasil gaharu berisi gaharu. hio. setanggi (dupa). kosmetik. Gaharu dengan aromanya yang khas digunakan masyarakat di Timur Tengah sebagai bahan wewangian. hepatitis. dan aquillochin. TBC. bahan antibiotic. asma. liver. Di samping itu dengan perkembangan ilmu dan teknologi industri. juga telah berkembang industri pemanfaatan gaharu sebagai bahan baku industri obat herbal alami. reumatik.senyawa yang terdapat pada gaharu. saat ini berbagai negara memanfaatkan gaharu selain sebagai bahan pengharum (parfum) dan kosmetik.

Cara ini disebut tubuk.. Potongan kayu berisi gaharu kemudian dikumpulkan dan secara perlahan bagian kayu dipisahkan dari gaharu dengan menggunakan pisau kecil atau pahat cekung. kulit kayu kering dan rapuh serta bila ditarik mudah putus. Adapun ciri dari tumbuhan penghasil gaharu berisi gaharu antara lain adalah: daun berwarna kuning dan rontok. 7 . puncut atau pahat... (Sulistyo A. tajuk pohon kecil dan tipis.000/tolak (1 tolak = 12 cc). C. Harga minyak gaharu di pasaran Jakarta Rp 750. Sistem Pemungutan Gaharu Pohon dari tumbuhan penghasil gaharu yang telah diyakini mengandung gaharu ditebang. banyak terdapat benjolan dan lekukan sepanjang batang atau cabang pohon. Siran) sehingga tidak terjadi salah tebang pada pohon yang tidak berisi gaharu. Untuk lebih meyakinkan biasanya serpihan kayu tadi selanjutnya dibakar untuk mengetahui apakah mengeluarkan bau/ aroma wangi khas gaharu.. cabang pohon banyak yang patah. Bilamana terdapat alur coklat kehitaman pada batang menunjukkan adanya kandungan gaharu. Cara penyulingan minyak gaharu dapat dilakukan dengan dua sistem yaitu sistem kukus dan tekanan uap. Cara lain yang berlaku pada masyarakat Dayak Kenyah dan Punan di Kalimantan Timur adalah dengan mengiris dan memotong bagian kayu dari tumbuhan penghasil gaharu yang terkena infeksi penyakit hingga ke bagian tengah batang. kemudian dipotong-potong dan dibelah untuk diambil gaharunya.Perkembangan Pemanfaatan Gaharu . B. Pengolahan Gaharu Sampai saat ini produk gaharu yang berasal dari alam umumnya dipasarkan dalam bentuk bongkahan namun ada pula dalam bentuk minyak hasil sulingan. Cara pemungutan gaharu semacam ini di Sumatera dan Kalimantan disebut servis. Setelah ditemukan ciri-ciri tersebut maka dilakukan uji pelukaan pada batang pohon dengan menggunakan kapak atau parang.

pedagang pengumpul. Klasifikasi mutu gaharu di Kota Samarinda dan daerah sekitarnya Klasifikasi mutu No. tanggung. 2007 8 . Pada Tabel 1 disajikan kriteria dan klasifikasi mutu gaharu. Secara umum klasifikasi mutu gaharu dapat dikelompokkan menjadi enam kelas mutu yaitu super. dan cincangan dan setiap kelas mutu dibedakan lagi menjadi beberapa sub kelas mutu. Lokasi Super Tanggung Kacangan Kacangan A Kacangan B Kacangan C Teri Teri A Teri B Teri C Teri kulit A Teri kulit B Kemedangan Kemedangan A Kemedangan B Kemedangan community Sudokan Serbuk Serbuk Cincangan Samarinda Super king Super A Super AB 2. Dengan telah ditetapkannya standar nasional untuk mutu gaharu (SNI 01-5009. kemedangan. TangKacangan isi Teri super gung isi Kacangan Teri laying Tangkosong gung kosong Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan. Tabel 1. dan pemungut gaharu di dalam menentukan kelas mutu gaharu. kacangan. teri.KLASIFIKASI MUTU GAHARU Klasifikasi mutu gaharu di Kalimantan Timur khususnya di Kota Samarinda dan daerah sekitarnya hingga saat ini masih belum seragam (Tabel 1) dan penentuannya dilakukan secara visual.1-1999) diharapkan standar mutu tersebut dapat segera menjadi bahan acuan para pengusaha gaharu. 4. 1. Keragaman dan ketidakjelasan di dalam penentuan mutu tersebut menyebabkan harga jual yang berbeda dengan kelas mutu yang sama. Muara Kaman Kota Bangun Muara Wahau Super A Super B Super A Super B Kacangan isi Teri isi Kacangan Teri kulit kosong Kacangan A Kacangan B Teri A Teri B 3.

Secara visual Kacangan C 2.. Dalam 5. tidak ada campuran dengan serat kayu. Tanggung 10. Kualitas gaharu yang paling 1. berupa bongkahan atau butiran berukuran besar.beberapa sampel gaharu dapat Teri B 750.75. 2006 Berdasarkan informasi pasar di Samarinda (Tabel 3) harga gaharu dengan kualitas super dapat Tabel 3. keras.000. Teri Kulit A Teri Kulit B Kemedangan A Kemedangan B Kemedangan C Suloan 300. bagian dalam kadang berlubang.. Gaharu berwarna hitam terkadang bercampur coklat. Teri A 1. kadang bercampur serat kayu dan berukuran tanggung. Kayu yang mengandung getah gaharu. Kelas mutu Harga (Rp/Kg) kg. 6.000. (Sulistyo A.2.digunakan sebagai bahan baku 3.000. Tanggung 3.25.100.penyulingan untuk menghasilkan Kacangan B 5. Kacangan 4.minyak gaharu.500.000.- 6.rendah berharga sekitar Rp 25.000 Super 20. bercampur kayu.000. mengkilap dan sangat berbau.000.000.per kg. bercampur kayu. 2.000.000. padat.000. Kemedangan Cincangan Sumber : Balai Penelitian dan Pengembangan Kehutanan Kalimantan..000. pasaran Samarinda. padat. Super King 30. telah ditetapkan Standar Nasional mutu gaharu dengan judul dan nomor: Gaharu SNI 01-5009.000. 2006 9 . bagian dalam tidak berlubang. Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan. Siran) Tabel 2.. Gaharu berwarna hitam terkadang bercampur coklat.000.500. Teri 5.1-1999.000. berupa butiran-butiran sebesar biji kacang atau berdiameter sekitar 2 mm. Kacangan A 7.000.000. keras.250.000 per kg.4. 1. Potongan kecil kayu dari pemisahan gaharu..per No. dan pada umumnya Super AB 15.000. berupa butiran-butiran lebih kecil dari biji kacang dan lebih tipis atau berdiameter sekitar 1 mm.Berdasarkan Keputusan Kepala Badan Standarisasi Nasional (BSN) No.71/ 09/99.dilihat pada Gambar 3.000. disusul kualitas tanggung dengan Kalimantan Timur harga rata-rata Rp 10. Kriteria dan klasifikasi mutu gaharu No. Klasifikasi Super Kriteria Gaharu berwarna hitam pekat. 1386/BSN-I/HK. Gaharu berwarna hitam dan coklat.000.Perkembangan Pemanfaatan Gaharu .000.000. Harga jual gaharu di mencapai Rp 30. Teri C 500.000.000.500.50.000.

cara uji. cara pemungutan. ditandai oleh warnanya yang hitam atau kehitaman berseling coklat. Setiap kelas mutu selanjutnya dibedakan lagi menjadi beberapa sub kelas berdasarkan ukuran. kandungan damar wangi. syarat lulus uji dan syarat penandaan. klasifikasi. syarat mutu. (c) teri dan dari pohon atau bagian pohon (d) kemedangan penghasil gaharu. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia dapat dilihat pada Tabel 4. istilah. berserat kasar dan kayunya yang lunak. (b) kacangan. kemedangan. warna. dengan aroma yang kuat. lambang dan singkatan. dan aroma ketika dibakar. serat. Menurut SNI 01-5009. spesifikasi. memiliki kandungan damar wangi dengan aroma yang lemah. bobot. Kemudian yang dimaksud dengan kemedangan adalah kayu yang berasal dari pohon atau bagian pohon penghasil gaharu.1-1999 yang dimaksud dengan gubal Gambar 1. dan abu gaharu. 10 .standar ini diuraikan mengenai definisi gaharu. Abu gaharu adalah serbuk kayu sisa pemisahan gaharu dari kayu. pengambilan contoh. Sampel gaharu (a) gaharu adalah kayu yang berasal kelas tanggung. ditandai oleh warnanya yang putih keabu-abuan sampai kecoklat-coklatan. Klasifikasi mutu gaharu terdiri dari gubal gaharu.

3. 4. 2. 1.. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia Kesetaraan dengan standar mutu di pasaran Kandungan damar wangi No Klasifikasi mutu Gubal Mutu Utama Mutu I Mutu II Kemedangan Mutu I Mutu II Mutu III Mutu IV Warna Bau/aroma (dibakar) A..Perkembangan Pemanfaatan Gaharu . 11 . Mutu VII Abu gaharu Mutu Utama Mutu I Mutu II Kurang Kurang kuat Cincangan Hitam Tinggi Sedang Kurang Kuat Sedang Kurang TATA NIAGA GAHARU Proses pemasaran gaharu di berbagai tempat di Indonesia dimulai dari pemungut gaharu yang menjual gaharu yang ditemukannya kepada pedagang pengumpul di desa atau di kecamatan dan selanjutnya oleh pedagang pengumpul dijual ke pedagang besar (eksportir) di Ibukota Propinsi. Super Super AB Sabah Super Hitam merata Hitam kecoklatan Hitam kecoklatan Tinggi Cukup Sedang Kuat Kuat Agak kuat Tanggung A Sabah I Tanggung AB Tanggung C Coklat kehitaman Coklat bergaris hitam Coklat bergaris putih tipis Kecoklatan bergaris putih tipis Kecoklatan bergaris putih lebar Putih keabuabuan garis hitam tipis Putih keabuabuan Tinggi Cukup Sedang Sedang Agak kuat Agak kuat Agak kuat Agak kuat 5. (Sulistyo A. 3. B.. 2. Mutu VI Kemedangan II Kemedangan III Kurang Kurang kuat 7. Mutu V Kemedangan I Sedang Agak kuat 6.. Siran) Tabel 4. 1. C. 1. 3. 2.

Pemungut bebas adalah pemungut gaharu dengan modal kerja sendiri sehingga bebas di dalam menentukan waktu pencarian gaharu dan menjual hasil perolehannya.Salah satu contoh alur tata niaga gaharu di Kalimantan Timur dapat diuraikan seperti pada Gambar 2. Pemungut terikat adalah pemungut gaharu yang dimodali sehingga waktu pencarian dan penjualan hasil perolehannya terikat pada pemberi modal yaitu pedagang pengumpul yang merupakan perpanjangan dari pedagang besar. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 2. Contoh alur tata niaga gaharu di Kalimantan dan Sumatra Pedagang pengumpul terdiri dari pedagang perantara di desa yang langsung melakukan pembelian gaharu yang diperoleh para pemungut. Pemungut gaharu terdiri dari pemungut bebas dan pemungut terikat. pedagang pengumpul di kecamatan maupun langsung kepada pedagang besar (eksportir) di Kota Samarinda. Hasil pembelian dari pedagang perantara ini kemudian dikumpulkan oleh pedagang pengumpul di kecamatan untuk selanjutnya dijual kepada pedagang besar karena adanya ikatan kontrak. Pembelian meningkat bilamana permintaan pasar terhadap gaharu tinggi. Pembelian gaharu dilakukan sepanjang tahun melalui pedagang pengumpul atau pemungut bebas. Pedagang besar selain memiliki modal besar juga izin usaha yang dikeluarkan oleh instansi pemerintah. baik kepada pedagang pengumpul di desa. bahkan untuk mendapatkan jumlah yang diinginkan mereka menanamkan modal yang disalurkan melalui 12 .

yaitu: penentuan kuota. pengambilan dari alam atau hasil budidaya (penangkaran). gaharu menjadi komoditi primadona dan memiliki nilai komersial yang cukup tinggi sehingga banyak diburu oleh konsumen. Gaharu yang diperdagangkan di Indonesia terdiri dari tiga jenis. gaharu dari Papua. baik di Indonesia maupun di luar negeri. Siran) pedagang pengumpul ataupun secara langsung kepada pemungut untuk modal kerja mencari gaharu. sedangkan jenis gaharu Gyrinops lebih banyak diproduksi dari Nusa Tenggara.Perkembangan Pemanfaatan Gaharu .. Pemungut Bebas Pemungut Pemungut Terikat Pedagang Perantara Pedagang Pengumpul Pedagang Besar Gambar 3. Oleh karena itu maka secara umum pemanfaatan gaharu harus mengikuti tahapan dan aturan-aturannya. 13 . yaitu: gaharu dari Sumatera dan Kalimantan dengan jenis Aquilaria malaccensis dan A. Alur tata niaga Gaharu di daerah (Kalimantan) PEMASARAN GAHARU Dalam dunia perdagangan gaharu. pengangkutan untuk peredaran dalam negeri dan pengangkutan untuk pemasaran luar negeri. microcarpa. Sulawesi dan Maluku lebih dikenal dengan nama Aquilaria filaria.. Pemasaran gaharu yang merupakan salah satu bentuk pemanfaatan tumbuhan dan satwa liar diatur berdasarkan Peraturan Pemerintah Nomor 8 Tahun 1999 dan Konvensi Perdagangan Internasional tentang jenis flora dan fauna liar yang terancam punah (CITES). Apabila diperhatikan maka perdagangan gaharu hasil alam di Indonesia dari dulu hingga saat ini lebih banyak bertumpu pada peyebaran secara ekologis jenis-jenis gaharu tersebut. (Sulistyo A...

pengangkutan dan peredaran secara domestik produk sampai akhirnya ke konsumen. cream whitening. Beberapa contoh produk dimaksud dapat dilihat pada gambar 3 dan 4 berikut. Pemasaran Dalam Negeri Pemasaran dalam negeri dimulai dari aktivitas pengambilan. hio. Karena perkembangan teknologi. Bahkan saat ini sudah dikembangkan daun jenis Aquilaria dan Gyrinops untuk bahan pembuatan minuman teh karena kandungan zat anti oksidan dalam daun yang cukup tinggi. pembersih muka. pemanfaatan untuk obat-obatan dan aroma terapi. lulur dan lotion 14 . tapi juga sudah mengarah ke produk turunannya. makmul. sabun. obat nyamuk.A. Gambar 4. lotion. produk gaharu yang diperdagangkan dalam negeri saat ini tidak saja terbatas pada chip atau serpihan dengan bermacam-macam kelas. lulur. antara lain: minyak. Produk turunan gaharu: sabun transparan.

Secara tradisional daerah pemasok gaharu untuk kota Surabaya adalah Kalimantan. yaitu sumatera. Pemasaran gaharu dalam negeri terbentuk karena adanya hubungan antara daerah pemasok dengan kota/pusat penerima. Oleh karena itu bentuk pemasaran gaharu di Indonesia lebih cocok dikatakan sebagai pasar “monopsoni”. ditambah dari daerah Indonesia bagian barat. Papua. namun karena akses yang mudah memasok gaharu pula ke Jakarta. Sulawesi. kelompok masyarakat maupun lembaga. Produk sirup dan teh untuk bahan minuman Dilihat dari pelaku usaha. maka terdapat kecenderungan untuk saling menekan harga. baik dalam menentukan harga maupun kualitas gaharu. banyak fihak yang terlibat dalam perdagangan gaharu. Daerahdaerah ini walaupun letaknya di Indonesia bagian timur. baik sebagai individu (perorangan). Maluku. misalnya pencari gaharu dan pedagang pengumpul di bagian hulu (hutan atau desa sekitar hutan) lebih banyak dibandingkan dengan pedagang menengah dan besar yang berdomisili di ibukota kabupaten atau propinsi.Sirup daun gaharu Gaharu leaf tea Gambar 5. Karena jumlah pelaku usaha pemasaran. termasuk Riau. NTB. NTT. Di duga banyak gaharu yang di perdagangkan secara illegal dari sumatera lewat Riau ke Singapura dan Malaysia. yaitu pasar yang dikuasai oleh pembeli. 15 .

yaitu: A. A. Pemasaran Luar Negeri Secara fisik. produk gaharu sulit dibedakan berdasarkan asal jenis tumbuhan dan asal daerahnya. filaria dan Gyrinops diatur perdagangannya oleh konvensi perdagangan internasional yaitu CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) melalui sistem quota. malaccensis. Demikian pula dari sisi warna dan aroma sangat sulit bagi orang awam atau pedagang pemula untuk dapat memilah-milahnya. Oleh karena kekhawatiran salah satu species penghasil gaharu yang mungkin bisa cepat punah. standar dan kualitas serta harga yang layak sehingga menguntungkan bagi kedua belah fihak. maka jenis Aquilaria yang ada. Lalu lintas perdagangan gaharu dalam negeri Beberapa permasalahan yang sering dijumpai di lapangan antara lain: sulitnya menentukan jenis gaharu.Secara garis besar. lalu lintas perdagangan gaharu di dalam negeri dapat dilihat pada gambar berikut. Kalimantan Sulawesi Papua Maluku Riau  Sumatera Sumatera Jakarta NTT NTB Surabaya Gambar 6. yaitu konsumen dan produsen. microcarpa. B. . A.

Gambar 7. Dalam beberapa tahun terakhir terdapat kecenderungan pembeli dari Taiwan untuk mengimpor gaharu dari Indonesia dalam bentuk log. produk gaharu yang diperdagangkan ke luar negeri mengikuti selera konsumen. Untuk gaharu yang berkualitas menengah ke bawah. wewangian dan aroma terapi. Gaharu dengan kualitas super (superking. dapat dilihat beberapa gaharu yang masih dalam bentuk gelondongan yang siap untuk diekspor. Pada gambar 6 berikut. 17 . ekspor lebih banyak dilakukan ke negara-negara Asia Selatan untuk digunakan sebagai bahan baku pembuatan minyak wangi dan untuk acara-acara ritual dalam bentuk hio.Menurut ASGARIN. makmul dan lain-lain. super A dan AB) umumnya dipasarkan ke negaranegara Timur Tengah untuk digunakan sebagai bahan acara ritual keagamaan. Nilai keseluruhan dari gaharu tersebut tidak kurang dari Rp 600 juta. Gaharu dalam bentuk gelondongan yang siap dikirim ke Taiwan. Kayu gaharu yang bentuknya masih gelondongan dan hanya sedikit mengandung gaharu tersebut digunakan sebagai hiasan yang dipasang di suatu ruangan dengan diberikan sedikit sentuan teknologi ukir sehingga terkesan mewah dan mempunyai nilai seni yang sangat tinggi.

filaria.000 (R) 25.000 (K) 65. malaccensis sebanyak hampir enam kali lipat. Sedangkan gaharu yang masuk ke Saudi Arabia di distribusikan lagi ke negara-negara lain di sekitarnya dan sebagian lagi di ekspor ke Inggris dan perancis.000 (K) 25. filaria sebanyak tujuh kali lipat.709 (R) 30. Menurut sebuah sumber. Dua negara ini pula yang menjadi daerah atau negara tujuan utama ekspor gaharu dari Indonesia.000 (K) 30. sedangkan untuk A. realisasi ekspor gaharu untuk ketiga jenis dapat terpenuhi 100% dari kuota yang ditetapkan. dan bahkan untuk Gyrinops realisasi ekspornya hanya mencapai 30% dari kuota yang ditetapkan. China. filaria yang banyak terpendam di rawa-rawa di Papua. Pada tahun 2008. pusat perdagangan gaharu dunia yang sangat penting adalah Singapura dan Riyad (Saudi Arabia). hal ini terjadi karena ditemukannya potensi baru yang sebelumnya luput dari inventarisasi. Perkembangan kuota dan realisasi ekspor gaharu Indonesia Tahun 2007 2008 2009 A.000(K) 326.250 (K) 74.Selama 3 (tiga) tahun terakhir jumlah kuota dan realisasi gaharu yang diekspor sebagaimana dapat dilihat pada tabel berikut.000 (K) 8. sedangkan pada A. Menurut ASGARIN.000 (K) - Tabel diatas memperlihatkan bahwa kuota ekspor gaharu pada tahun 2007 dari ketiga jenis yang dapat dipenuhi hanya dari jenis A.000 (R) 65. filaria 76. seperti dapat dilihat pada gambar berikut. malaccensis tidak dapat dipenuhi. Singapura selain mendapat pasokan gaharu dari Indonesia juga dari negara Asia Tenggara. 18 . Pada tahun 2009.000 (K) 23.882(R) Gyrinops 24. Tabel 5. Malaccensis 30.000 (R) 173. misalnya Vietnam dan Kamboja.000 (R) 455. dan sebagian lagi ke Timur Tengah.000 (K) 76. Hongkong.890 (R) A. misalnya untuk jenis A. lonjakan kuota yang signifikan terjadi pada jenis A. Oleh Singapura gaharu yang masuk dilakukan penyortiran dan pengemasan dan kemudian di ekspor kembali ke India. Taiwan dan Jepang.

pemberantasan hama dan penyakit hingga tumbuhan tersebut memiliki volume yang cukup memadai. pemeliharaan. sedangkan pohon-pohon penghasil gaharu yang tumbuh secara alami perlu dikonservasi dan dipelihara dengan baik untuk dijadikan pohon induk penghasil anakan. Siran) Hongkong Prancis UK India China Japan Malaysia Taiwan Kwait Oman Qatar Saudi Arabia UAE SINGAPORE Bahrain Middle East Riyadh Indonesia Iraq Iran Afrika Gambar 8.. (Sulistyo A.Perkembangan Pemanfaatan Gaharu . Teknik budidaya dimaksud meliputi kegiatan perbanyakan bibit. Luka tersebut menyebabkan pohon terinfeksi oleh penyakit (bakteri. Rekayasa produksi gaharu diarahkan untuk pohon-pohon penghasil gaharu hasil budidaya.. Secara garis besar proses pembentukan gaharu terdiri dari dua. yaitu secara alami dan buatan. penanaman. jamur) yang diduga mengubah pentosan atau selulosa menjadi resin atau damar. 19 .. virus. Lalu lintas perdagangan gaharu luar negeri REKAYASA PEMBENTUKAN GAHARU Teknik budidaya perlu dikuasai dengan baik untuk dapat membudidayakan pohon penghasil gaharu.. yang dua-duanya berkaitan dengan proses patologis yang dirangsang oleh adanya luka pada batang patah cabang atau ranting.

kegiatan lapangan dan kombinasi keduanya. kegiatan di laboratorium dan kegiatan uji lapangan yaitu: 1. 20 . Alur kegiatan rekayasa produksi gaharu. Oleh karena itu untuk dapat mengamati secara langsung proses pembentukan gaharu dilakukan rekayasa dengan cara inokulasi (penyuntikan) jamur atau cendawan pada pohon penghasil gaharu. Proses pembentukan gaharu di hutan alam sulit dipantau dan diamati. 6. 2. dimulai dari kegiatan laboratorium. koleksi dan isolasi jamur. Kegiatan yang “berskala laboratorium” dimulai dari kegiatan lapangan. 4. 3. dengan teknik induksi yang bermacam-macam dan jenis jamur yang bervariasi. Eksplorasi. Identifikasi jamur secara molekuler Penyaringan (screening) Uji efektivitas Formulasi media Produksi inokulan (jamur) Pembangunan plot demonstrasi untuk ujicoba di lapangan Observasi dan evaluasi Alur kegiatan rekayasa produksi gaharu secara garis besar dapat dilihat sebagaimana gambar berikut: Gambar 9. 8. 7. kadar gaharu menjadi semakin tinggi. Rekayasa pembentukan gaharu dengan inokulasi telah dilakukan oleh banyak fihak.Semakin lama kinerja penyakit berlangsung. 5. Tahapan rekayasa produksi gaharu meliputi banyak kegiatan.

. Siran) Sampai saat sudah berhasil dikoleksi 23 inokulan (isolat) dari sebagian besar propinsi di Indonesia. 21 . Berdasarkan bukti-bukti keberhasilan tersebut.Perkembangan Pemanfaatan Gaharu . maka secara resmi ke empat jenis isolat tersebut telah di “launching” Menteri Kehutanan (lihat gambar 8) pada Pameran Indo Green yang berlangsung di Jakarta Convention Center (JCC) pada tahun 1999.. Diantara isolat tersebut empat isolat sudah diujicoba pada beberapa jenis pohon penghasil gaharu di beberapa daerah dan memberikan hasil yang cukup bagus. Keterbatasan tersebut dimaksudkan hanya kepada masyarakat petani gaharu atau pelaku usaha gaharu yang telah mendapatkan pelatihan dari P3HKA saja yang boleh menggunakan inokulan tersebut. Berdasarkan pengamatan sementara. Gorontalo dan Papua. Launching tersebut juga dimaksudkan untuk memberikan akses kepada publik agar dapat memanfaatkan isolat tersebut untuk ujicoba produksi gaharu. Launching Inokulan Gaharu oleh Menteri Kehutanan Dengan adanya launching tersebut maka secara resmi inokulan prododuksi Puslitbang Hutan dan Konservasi Alam (P3HKA) telah dilepas di pasaran namun masih terbatas. Sumatera Barat. Gambar 10.. beberapa isolat lain yang juga cocok dan memberikan hasil yang cukup bagus adalah Jambi dan Kalimantan selatan. Ke empat isolat tersebut adalah: isolat dari Kalimantan Barat.. (Sulistyo A.

jenis asal isolat dan jenis pohon penghasil gaharu yang diinokulasi. jarak titik lubang dan lain sebagainya.Untuk melihat efektivitas pembentukan gaharu. Bali. Kalimantan Barat. ujicoba ke enam isolat telah dilaksanakan di 15 (lima belas) lokasi yang tersebar di beberapa propinsi di Indonesia. Sumsel. keterbukaan tajuk. virulensi inokulan yang digunakan. baik kegagalan maupun keberhasilanya. Sijunjung dan Padang Pariaman (Sumbar). Ujicoba tersebut dilaksanakan di lokasi dengan kondisi yang berbeda. Bioinduction : 15 locations Gambar 11. Menado dan Seram. Bogor (Jabar). untuk mengetahui perkembangan inokulasi. Lombok (NB). Carita (Banten). yaitu: Bohorok (sumut). Kalimantan Selatan. Jambi. Kalimantan Tengah. Penyebaran plot inokulasi dapat dilihat sebagaimana gamber berikut. baik kondisi ekologis. Sukabumi. Beberapa faktor penting yang diamati adalah: kondisi kelembaban dan suhu udara. 22 . Penyebaran plot inokulasi pembentukan gaharu (gambar bintang warna kuning) Evaluasi dan pengamatan terus menerus dilakukan. Bangka.

Perkembangan hasil inokulasi menurut waktu Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun 2 tahun 3 tahun Kualitas Kemedangan Kemedangan B Kemedangan A teri kacangan tanggung Apabila di sejajarkan dengan kualitas gaharu hasil alam yang ada di pasaran dalam negeri. (Sulistyo A. Contoh gaharu hasil panen yang dilakukan secara bertahap adalah sebagai berikut. Menurut rencana pada tahun 2011 akan dilakukan pemanen lagi untuk melihat perkembangan kualitas gaharu.. dan terus meningkat menjadi kelas teri setelah 1 tahun. Tabel 6. dengan harapan bahwa gaharu yang akan dipanen tersebut akan mempunyai kualitas` yang lebih bagus lagi dari sebelumnya... Pada saat ini pohon yang ditebang secara bertahap tersebut masih hidup dan masih tumbuh baik di lapangan.. maka hasil gaharu yang dipanen setelah 3 bulan inokulasi memiliki kualitas kemedangan. Siran) Perkembangan hasil inokulasi yang dilaksanakan di salah satu lplot penelitian yaitu daerah Sukabumi dari waktu ke waktu dapat dilihat sebagaimana tabel berikut. 23 . Kualitas gaharu tersebut terus meningkat menjadi kacangan setelah 2 tahun inokulasi dan secara signifikan meningkat menjadi tanggung pada 3 tahun setelah inokulasi.Perkembangan Pemanfaatan Gaharu .

24 . Gaharu hasil panen 3 bulan setelah penyuntikan. Gaharu hasil panen 9 bulan setelah penyuntikan (inokulasi) dengan kualitas kemedangan A.Gambar 12. Gambar 13. dengan kualitas kemedangan C.

Siran) Grade Kemedangan (US $ 100/kg) Gambar 14. Gaharu hasil panen satu tahun setelah penyuntikan dengan kualitas teri Grade Gubah AB (US $ 200-250/kg) Gambar 15. Gaharu hasil panen dua tahun setelah penyuntikan dengan kualitas kacangan 25 . (Sulistyo A.Perkembangan Pemanfaatan Gaharu .....

000 200. Harga gaharu yang cenderung meningkat dengan semakin tertundanya waktu panen. estimasi harga gaharu hasil panen dari plot penelitian P3HKA dapat dilihat sebagai mana tabel berikut.> US $ 800 Gambar 16.000 750. referensi harga gaharu hasil alam di pasaran dalam negeri dan penawaran dari pedagang gaharu dari Riyad (gambar sudut kanan atas).000 1. Umur Setelah Inokulasi 3 bulan 6 bulan 9 bulan 1 tahun Harga (Rp) 50. Gaharu hasil panen 3 (tiga) tahun setelah penyuntikan dengan kualitas tanggung Berdasarkan survey pasar.000. Tabel 7.000 26 .

..500..500.. Kualitas Hasil rekayasa Super Tanggung Kacangan Teri Kemedangan Hasil alam 1 Hasil alam 2 Hasil alam 3 Hasil alam 4 1 2 3 4 Tahun 5 6 7 8 9 10 Gambar 17.000 US$ 800 atau 7. Berdasarkan pemeriksaan laboratorium. waktu penundaan panen dan harga di pasaran sangan erat sekali. gaharu hasil panen 9 bulan setelah penyuntikan mengandung zat aktif yang cukup 27 . Grafik hubungan antara terbentuknya gaharu dengan waktu penundaan panen. Siran) Umur Setelah Inokulasi 2 tahun 3 tahun 4 tahun Harga (Rp) 2.Perkembangan Pemanfaatan Gaharu . (Sulistyo A. Grafik hubungan antara terbentuknya gaharu dengan waktu dapat dilihat pada grafik sebagai berikut. Semakin lama proses pembentukan gaharu di pohon maka akan semakin meningkat kualitas gaharu yang akan dihasilkan dan dengan sendirinya akan meningkatkan harga gaharu tersebut.000 ? Hubungan antara kualitas gaharu.

komponen volatile dan kokoa Dumasin = wangi mint. 28 . bahan kosemtik Isolongifolen = bahan odorant & parfum Indole = wangi bunga & parfum. penguat rasa/aroma pada roti &kue Komponen Kimia Ketoisophorone = wangi manis campuran kayu. Pemeriksaan kandungan kimia pada gaharu hasil alam menunjukkan hasil yang sama dengan gaharu hasil rekayasa jika dua-duanya diambil dari kualitas yang sama. Azulene = komponen minyak esensial tanaman. memiliki sifat pestisida Cadinene = konstituen minyak esensial berbagai tanaman Limonene = terpen aroma bunga & buah. manis buah & bunga 1 2 3 4 5 Tahun Gambar 18. anti inflamantory Ambrettolide = wangi musk. teh dan daun tembakau Valerolactone = wangi herbal Ambrox = odorant tipe amber. setidaknya terdapat 12 (dua belas) komponen kimia sebagaimana dapat dilihat pada gambar berikut. Kandungan kimia yang terdapat pada gaharu hasil rekayasa.banyak. insektisida botani. wangi & warna biru Benzylacetone = wangi manis bunga.konsituen utama dalam minyak melati Maltol = wangi caramel (manis).

Untuk dapat mewujudkan kondisi dan harapan tersebut. penyiapan bibit.Perkembangan Pemanfaatan Gaharu . dan pengamanan). Hanya dengan koordinasi dan integrasi yang baik di antara seluruh komponen masyarakat dan pemerintah. tranportasi. skema kredit dan asuransi). (Sulistyo A. Siran) PENUTUP Dengan ditemukannya teknologi inokulasi pembentukan gaharu. peluang penyerapan tenaga kerja yang besar dan penerimaan asli daerah yang cukup signifikan. subsistem hilir (pemanenan. riset dan pengembangan. 29 . infrastruktur. pemasaran). penanaman.. maka produk gaharu akan menjadi produk andalan dimasa depan. maka seluruh sektor harus memainkan peran sesuai dengan tugas pokok dan fungsinya masing-masing... penyediaan pupuk. subsistem pendukung (kebijakan pemerintah. terbukalah peluang yang besar untuk kegiatan pengusahaan gaharu yang dimulai dari subsistem hulu (penyiapan lahan. peralatan inokulasi. pengangkutan. pendidikan dan pelatihan. subsistem tengah (penyuntikan. penyediaan inokulan.. pemberantasan hama dan penyakit). Ketiga subsistem tersebut di atas memerlukan investasi yang cukup besar. pengolahan.

30 .

STATUS RISET GAHARU 31 .

32 .

Aspek PRODUKSI 33 .

.

Dari segi keberadaan material bibitnya lokasi sekitar hutan memiliki jumlah tegakan gaharu alam terbanyak. sehingga tidak menyebar jauh. Pengembangan gaharu ini perlu dilakukan. mengingat buah pohon ini bersifat rekalsitran. khususnya untuk menjaga kesinambungan produksi. sekaligus untuk melindungi ragam pohon penghasil gaharu yang ada di Indonesia. Dari segi kesiapan masyarakat. Dari aspek keamanan lingkungan dan keragaman hayati. masyarakat di sekitar hutan merupakan sasaran ideal yang dapat melipatgandakan peran dan fungsi program tersebut. pengembangan gaharu di sekitar hutan juga akan membantu pengamanan keragaman hayati dan kelestarian hutan. Dalam pengembangan gaharu.PENGEMBANGAN GAHARU DI SUMATERA Mucharromah Fakultas Pertanian Jurusan Perlindungan Tanaman Universitas Bengkulu PENDAHULUAN Gaharu merupakan produk kehutanan yang memiliki nilai ekonomi sangat tinggi dibanding produk kehutanan lainnya. sebagian bahkan pernah menjadi pengumpul. pada umumnya masyarakat yang tinggal di sekitar hutan sudah mengenal gaharu. kecuali dengan campur tangan manusia. sehingga sangat potensial untuk dikembangkan. mengingat 35 . sehingga pemahaman dan keterampilannya untuk mendukung pengembangan cluster industri gaharu telah sangat memadai.

termasuk dari wilayah barat Indonesia atau Sumatera dan dihargai sangat mahal. bangsa. yaitu meningkatkan kapasitas absorbsi dan retensi air tanah. maka pengembangan gaharu sangat berpotensi mensejahterakan masyarakat. Sementara gaharu 36 . khususnya yang berkaitan dengan pendanaan proses produksi yang memerlukan dana cukup besar. Sejauh ini produksi gaharu Indonesia masih banyak diambil dari alam sehingga disebut sebagai gaharu alam. Bentuk gaharu super sangat beragam. dan negara di samping menghindarkan dari bahaya bencana alam kekeringan. produksi gaharu justru tidak akan terjadi bila pohonnya tumbuh sangat baik dan tidak terganggu sedikit pun. menguatkan tanah. pengembangan gaharu tidak sama dengan pengembangan tanaman pertanian yang dapat langsung menghasilkan. pengembangan gaharu di wilayah sekitar hutan akan memperkuat fungsi hutan tersebut. di samping pemberdayaan dan pemakmuran masyarakat di sekitar wilayah hutan. dan kekurangan oksigen. Selain itu. Dengan nilai ekonomi gaharu yang sangat tinggi dan permintaan pasar dunia yang terus meningkat. Dengan demikian. Oleh karenanya. polusi. berwarna hitam mengkilat dan berat hingga tenggelam dalam air. dengan tekstur yang sangat keras dan halus tidak berserat. sehingga tidak mudah longsor serta menyerap CO2 dan menghasilkan O2 yang sangat penting dalam mendukung kehidupan. paningkatan temperatur udara. Pada pohon penghasil gaharu. mengingat pohon penghasil gaharu memiliki morfologi yang sangat mendukung perannya sebagai ’penjaga lingkungan’. pengembangan produksi gaharu tidak cukup hanya dilakukan dengan penanaman bibit pohon penghasilnya saja. khususnya yang memiliki kualitas super dan di atasnya. kekurangan air bersih.Aspek PRODUKSI masyarakat sudah dapat memperoleh penghasilan dari usaha pengembangan gaharu yang sangat prospektif secara ekonomi. tetapi juga perlu didukung dengan pengembangan teknik produksi dan pengembangan sistem yang akan mendukung pengembangan produksi. Namun demikian. longsor. Gaharu kualitas super sudah mengeluarkan aroma harum meski tanpa dipanasi atau dibakar. Gaharu alam telah dikenal sejak ribuan tahun lalu diperdagangkan ke Timur Tengah oleh para pedagang India dan Indo-China.

pembersihan. kecuali masyarakat di sekitar wilayah hutan yang sudah pernah terlibat dalam pencarian. sehingga lebih mampu menjaga keamanan lingkungan dan keragaman sumberdaya alam di sekitarnya. banyak masyarakat di sekitar hutan yang terampil membersihkan gaharu sehingga cukup siap untuk mendukung pengembangan gaharu di daerahnya.. Dengan makin meningkatnya permintaan pasar internasional. Kesiapan Teknologi Produksi Berbeda dengan produk pepohonan lainnya yang selalu dihasilkan selama tanaman tumbuh sehat atau dengan kata lain 37 . sehingga keberadaan pohon penghasil gaharu juga makin terancam akibat banyak yang ditebangi dan dicacah masyarakat untuk diambil gaharunya. Kesiapan SDM Pendukung Proses Produksi Meskipun gaharu sudah sangat lama menjadi salah satu komoditi ekspor Indonesia. hampir seperti seni memahat..Pengembangan Gaharu di . Kondisi ini tak akan dapat diatasi kecuali dengan melakukan pengembangan gaharu secara besar-besaran. maka volume perdagangan gaharu makin meningkat. Dengan pengalaman mencari gaharu alam yang sudah cukup lama. Dengan upaya ini.. maka produksi gaharu Indonesia akan tetap melimpah dan masyarakat yang memproduksinya juga makin makmur dan sejahtera. dan perdagangan gaharu. khususnya pada proses pasca panen. KESIAPAN PENGEMBANGAN GAHARU A. B.. Karenanya mereka merupakan kelompok sasaran yang sudah siap menjadi SDM untuk pengembangan gaharu. namun banyak masyarakat umum yang tidak mengetahui apa yang disebut gaharu. khususnya di area yang paling potensial yaitu wilayah sekitar hutan. pembersihan gaharu dari sisa kayu putihnya. (Mucharromah) yang memiliki kualitas lebih rendah (kemedangan dan abuk) disuling untuk diambil resinnya dan ampasnya dibuat makmul atau hio untuk ritual keagamaan. sehingga membutuhkan banyak tenaga kerja terampil. Proses ini sangat lambat.

d. Beberapa kelompok peneliti telah mampu melakukan inokulasi yang merangsang pembentukan gaharu (Mucharromah et al. maka teknik produksi inokulan dan induksi pembentukan gaharu dengan inokulasi telah siap untuk dilatihkan kepada masyarakat guna mendukung pengembangan produksi gaharu melalui pemberdayaan masyarakat di sekitar wilayah hutan. C. Namun mengingat teknik yang diterapkan belum biasa dilakukan masyarakat. Kebanyakan gaharu justru ditemukan pada pohon yang terganggu. Kadir.Aspek PRODUKSI produksi merupakan fungsi dari pertumbuhan tanaman sehat. Kesiapan Kontrol Kualitas Produk Untuk keberhasilan dan kesinambungan suatu proses produksi umumnya selalu dilakukan monitoring kualitas produk.. baik pelatihan teknik inokulasi maupun pelatihan teknik monitoring pembentukan gaharu. 2009). Selain itu juga perlu dilakukan teknik pelatihan produksi inokulan sehingga proses produksi dapat berlangsung lebih efisien. Faktor abiotik dapat berupa angin atau hujan angin dan petir. Dengan dukungan operasional. baik secara alami oleh faktor abiotik maupun biotik ataupun telah diinduksi oleh manusia. Sementara pembentukan gaharu oleh faktor biotik dapat disebabkan oleh infeksi jasad renik terhadap tanaman. Namun kejadian pembentukan gaharu oleh faktor abiotik dari alam ini sulit ditiru sehingga tidak dapat dijadikan dasar pada proses produksi dalam bentuk industri.c. 2006. 2008. maka untuk persiapan pelaksanaannya dalam proses produksi dibutuhkan pelatihanpelatihan. gaharu justru tidak akan didapat pada pohon yang tumbuh sehat tanpa ada gangguan apapun. selain akibat gesekan hewan dan perilaku manusia yang tidak direncanakan. Temuan tentang adanya jenis jasad renik yang dapat menginduksi terjadinya akumulasi resin wangi yang selanjutnya membentuk gaharu inilah yang mendasari adanya temuan tentang teknik induksi pembentukan gaharu yang dapat digunakan untuk mendukung proses produksi gaharu dalam skala industri. 2008a.b. Santoso et al. Untuk itu penyiapan SDM pendukung pengembangan gaharu juga perlu mempersiapkan personil yang mampu mengenali kualitas 38 ..

mutu utama = mutu super b. dengan 3 tanda mutu. dengan 7 kelas mutu. Ketiga sortimen tersebut dibagi lagi dalam 13 kelas kualitas. mutu kedua = mutu sabah super 2.dan mensortasi atau mengumpulkan gaharu yang dihasilkan berdasarkan gradasi kualitas dan kegunaannya. mutu pertama = mutu TGA/TK1 b. mutu TGB/TK2 c. yaitu gubal gaharu. tekstur. mutu TGF/TK6 g. seperti pelukaan yang disertai infeksi patogen melalui inokulasi atau proses lainnya. mutu utama b. Pada gaharu alam gradasi kualitas ditentukan berdasarkan standar mutu yang telah ditetapkan secara nasional dalam SNI 015009. yang terdiri dari: 1. yang selanjutnya membuat jaringan kayu tersebut memiliki warna. Gubal gaharu. Selain itu jaringan yang mengandung resin wangi gaharu juga hanya didapati pada bagian pohon yang mengalami proses tertentu. mutu TGD/TK4 e. Abu gaharu yang terbagi dalam 3 kelas mutu. dan tingkat kekerasan dan berat jenis berbeda. Adanya aroma harum yang khas dan tahan lama inilah yang membuat gaharu sangat disukai dan dihargai dengan nilai ekonomi yang sangat tinggi. mutu TGE/TK5 f. mutu pertama 39 . Kemedangan. kemedangan. mutu TGC/TK3 d. yaitu: a. Dari segi bentuknya. gaharu merupakan jaringan kayu dari pohon jenis tertentu (penghasil gaharu) dengan kandungan resin sesuiterpenoid volatil beraroma harum gaharu yang cukup tinggi. aroma. mutu pertama = mutu AB c.1-1999. yaitu: a. Hal ini membuat gaharu menjadi makin mahal dan nilainya sangat ditentukan oleh kualitas kadar dan kemurnian resin yang dikandungnya. dan abu gaharu. mutu ketujuh = setara dengan M3 3. Dalam standar ini kualitas gaharu dibedakan menjadi tiga sortimen. yaitu: a.

mutu kedua. proses pembentukan gaharu telah semakin cepat terjadi. Hal ini merupakan anomali dari kondisi perdagangan komoditi lainnya. Kesiapan Modal dan Kelembagaan Indonesia merupakan negara yang sangat kaya dengan beragam jenis pohon penghasil gaharu. Untuk itu pelatihan SDM dalam teknik monitoring perkembangan pembentukan gaharu dan kontrol kualitasnya sangat penting dilakukan. Namun pengembangan gaharu di sekitar wilayah hutan kemungkinan akan jauh lebih efisien proses produksinya. Perkembangan keberhasilan teknik inokulasi ini sangat prospektif untuk mendukung pengembangan produksi gaharu yang pohon penghasilnya telah mulai banyak dibudidayakan di Sumatera dan wilayah lain di Indonesia.. Teknik inokulasi untuk induksi pembentukan gaharu juga telah makin efisien dan murah. Pada hasil uji lanjut teknik produksi gaharu yang dilakukan beberapa bulan lalu di Provinsi Bengkulu. Dengan demikian pengembangan gaharu siap dilaksanakan.Aspek PRODUKSI c. Hal ini menjadi modal utama yang membuat proses produksi gaharu menjadi jauh lebih 40 . meskipun sebagian besar masih berada pada mutu TGC (Mucharromah et al. di mana pemilik barang merupakan penentu harga. 2008). Namun dengan tingkat keahlian sortasi. Saat ini sudah cukup banyak pohon penghasil gaharu yang telah diinokulasi. standar kualitas gaharu dan harganya akan lebih terjamin. tidak hanya di sekitar wilayah hutan tetapi bahkan hingga ke halaman rumah dan perkantoran serta sekolah. D. Pada 6 bulan setelah inokulasi telah dicapai produk kualitas kemedangan TGB dan TGA. khususnya dari jenis Aquilaria dan Gyrinops. Namun pembedaan kelas kualitas tersebut secara detil sangat sulit dilakukan sehingga pada prakteknya hingga saat ini konsumenlah yang menentukan tingkat mutu produk dan harga gaharu. yang biasanya baru dapat dicapai pada 12-18 bulan setelah inokulasi. di samping lebih besar manfaatnya bagi pengamanan lingkungan dan pemberdayaan serta pemakmuran masyarakat. seperti yang telah dilakukan di Kota Bengkulu dan sekitarnya.

2008 dan Sumarna. Sejauh ini keberadaan pohon penghasil gaharu di lapangan telah banyak membantu pelaksanaan uji efektivitas inokulasi. (Mucharromah) mudah dan murah... pelatihan monitoring pembentukan gaharu serta upaya produksi gaharu hasil inokulasi. dan satu famili Euphorbiaceae (Wiriadinata. Namun demikian pengembangan gaharu tetap memerlukan dukungan dana yang relatif besar meskipun rasio keuntungannya terhadap modal juga cukup besar.. Jumlah gaharu yang dihasilkan per pohon di hutan alam sangat bervariasi dari 0. sebagaimana disajikan pada analisis usaha inokulasi gaharu (Lampiran 1) dan analisis budidaya gaharu (Lampiran 2). Namun dari 41 . 1998). maka pengembangan gaharu hasil budidaya dan inokulasi dapat jauh lebih efisien dibandingkan produksi yang mengandalkan gaharu bentukan alam. Semakin lama maka semakin banyak resin wangi yang terakumulasi dan semakin tinggi kualitas gaharu yang dihasilkan. Selain itu. pelatihan inokulasi. Di alam tidak semua pohon penghasil gaharu membentuk gaharu atau hanya sedikit sekali menghasilkan gaharu. Pada gaharu budidaya.Pengembangan Gaharu di . satu famili Leguminoceae.. uji produksi. Hal ini membuat proses produksi gaharu alam menjadi kian mahal. Berdasarkan hasil analisis tersebut maka pengembangan gaharu paling efisien bila dilakukan di area sekitar hutan yang masih kaya dengan tegakan gaharu berdiameter > 20 cm yang dapat diinokulasi untuk mempercepat produksi dan menambah modal awal untuk penanaman pada area yang lebih luas untuk kesinambungan usaha pengembangan gaharu. 2002). Selain itu juga diperlukan adanya kerjasama dan komitmen semua pihak untuk membantu mengawali usaha ini berdasarkan expertise dan bidang pekerjaannya. Saat ini pembentukan gaharu di alam telah dilaporkan terjadi pada sedikitnya 16 jenis pohon dari beberapa genus famili Thymelaceae.3 hingga 14 kg dan umumnya semakin banyak dengan makin besarnya diameter pohon (MacMahon. tidak semua pohon menghasilkan gaharu. proses produksi gaharu sangat ditentukan kuantitasnya oleh jumlah lubang atau luka yang diinokulasi dan kualitasnya tergantung dengan lamanya waktu sejak inokulasi hingga panen. Dengan demikian.

Terbentuknya gaharu kualitas super atau yang sering disebut gubal super ini kemungkinan akan dapat dicapai seiring dengan pengembangan penelitian inokulan unggul yang terus dilakukan. Secara teoritis keunggulan inokulan dalam menginduksi pembentukan gaharu berkaitan dengan jenis dan kemurnian mikroorganisme yang digunakan. Bila kualitas seperti ini dapat dihasilkan dari inokulasi pohon pada awal proses pengembangan. maka penggunaan inokulan unggul dan teknik inokulasi yang meminimalkan kontaminasi akan dapat meningkatkan kualitas gaharu yang dihasilkan dan mengefisienkan proses produksi hingga dapat dilaksanakan dengan modal lebih rendah. 2008. gaharu hasil inokulasi hingga kini belum dapat mencapai kualitas tertinggi gaharu alam.000 per kg di tingkat ’end-consumer’ di luar negeri. tergantung intensitas atau kadar resin gaharu yang dikandungnya.komunikasi pribadi. 42 . Mucharromah dan Surya. justru mendegradasi kembali resin gaharu yang sudah dideposisi bahkan hingga menghancurkan selnya sehingga gaharu yang sudah mulai terbentuk menjadi hancur dan lapuk minimal sebagian dan kualitas gaharu yang dihasilkan akan menurun. karena kualitas seperti gaharu alam tersebut bernilai sangat tinggi. khususnya cendawan pelapuk kayu. sehingga mampu menutupi pembiayaan untuk pengembangan selanjutnya. dan lebih tinggi. Pada gaharu kualitas gubal.Aspek PRODUKSI segi kualitas. Saat ini kualitas gaharu hasil inokulasi sudah jauh lebih baik dan pada beberapa hasil penelitian sudah mendekati mutu gubal kualitas kemedangan B/C (Santoso. sebagaimana ditunjukkan oleh data mikroskopis perkembangan deposisi resin gaharu pada area jaringan sekitar lubang yang diinokulasi atau hanya dilukai (Mucharromah dan Marantika. 2008 . 2006) atau bahkan B (Surya. Sementara kehadiran jenis cendawan lainnya.000 hingga 16. 2009). Dengan demikian. Akibatnya jaringan kayu tersebut menjadi halus seperti dilapisi agar dan berwarna coklat kemerahan atau kehitaman. yaitu USD 2. akumulasi resin wangi terjadi maksimal hingga luber dan menutupi sel-sel di sekitarnya. yaitu super. double super. maka produksi gaharu selanjutnya tidak banyak memerlukan bantuan modal lagi.

2007)..c. A. aroma resin gaharu juga sangat menentukan kualitas. A. beccariana. MODEL PENGEMBANGAN GAHARU DI SUMATERA Secara teoritis akumulasi resin wangi gaharu telah dilaporkan distimulasi oleh infeksi cendawan dari jenis tertentu (Mucharromah dan Surya.. 2008a.. Pada pengamatan mikroskopis (Mucharromah dan Marantika. 2009) menunjukkan bahwa pada jaringan yang terkontaminasi resin gaharu yang awalnya berwarna coklat bening kemerahan berubah menjadi berwarna kehitaman dan menghilang sebelum akhirnya selnya menjadi hancur.. 2008).b.Pengembangan Gaharu di . (Mucharromah) Mucharromah et al. 2002).. 43 . sehingga aroma gubal gaharu kualitas terbaik dari berbagai wilayah dapat berbeda (Mucharromah et al. 2006.. 2006. dikenal menghasilkan gaharu yang disukai konsumen mancanegara sejak jaman dahulu.. microcarpa. dan A. agallocha yang banyak dijumpai di Sumatera. maka kualitas gubal super mungkin akan dapat dicapai. kemungkinan karena kemurnian resin yang dikandungnya. Santoso et al. A. Dengan teknik inokulasi dan jenis isolat yang lebih murni dan potensial serta waktu antara inokulasi dan panen yang lebih panjang. Oleh karenanya pengembangan gaharu di wilayah sekitar hutan dengan cara memperbanyak pohon-pohon jenis Aquilaria yang ada di lokasi tersebut dan menginokulasi pohon yang sudah tua untuk membiayai peremajaannya akan dapat mengembalikan potensi produksi gaharu yang dahulu dimiliki Sumatera dan wilayah Indonesia lainnya. Selain itu kekhasan aroma gaharu juga dipengaruhi oleh jenis pohon penghasilnya dan kemungkinan juga jenis mikro organisme inokulannya. 2008). Jenisjenis pohon penghasil gaharu dari spesies Aquilaria malaccensis. Selain karena kandungan resinnya yang jauh lebih tinggi. Sejauh ini aroma gaharu alam lebih lembut dibanding hasil inokulasi. hirta. Oleh karena itu dalam proses produksi gaharu dengan inokulasi perlu diterapkan prinsip-prinsip aseptik yang akan membatasi peluang terjadinya kontaminasi (Mucharromah et al. Sumarna..

setelah didapat inokulan efektif dan hasil inokulasi yang cukup menjanjikan. Pertama. Oleh karenanya campur tangan pemerintah sangat diharapkan. anakan alam atau bibit harus ditanam dan dipelihara. Meskipun gaharu yang dipanen akan menghasilkan produk yang dapat dijual. Mucharromah. khususnya pada masyarakat yang tidak memiliki modal dan hanya mengandalkan sumberdaya alam dan keterampilan. Selain itu. ketepatan teknik inokulasi. namun untuk pelaksanaan proses panen dan pembersihan tersebut diperlukan modal yang cukup besar. Kerjasama ini meliputi pemeliharaan dan penanaman kembali anakan alam yang ada di sekitar tegakan induk hingga mencapai populasi minimal 10-100 batang tanaman muda per pohon induk diinokulasi untuk produksi gaharu. pengembangan gaharu memerlukan modal yang cukup besar karena prosesnya cukup kompleks. Oleh karenanya di Bengkulu pengembangan gaharu diawali dengan pengujian efektivitas berbagai isolat cendawan yang berpotensi menginduksi pembentukan gaharu dan diikuti dengan pengembangan inokulan unggul yang masih terus dilakukan untuk peningkatan kualitas. maka kepada masyarakat pemilik tegakan gaharu yang diameternya telah mencapai > 20 cm ditawarkan kerjasama pengembangan gaharu dengan penanaman kembali dan inokulasi. Namun kerjasama ini masih membutuhkan cukup banyak modal untuk menjadi usaha pengembangan gaharu yang mandiri. 2005. Dengan demikian maka penggunaan jenis inokulan tertentu dan kemurniannya serta penerapan teknik aseptik dalam penyiapan dan aplikasi inokulan. Langenhein. Oleh karenanya pengembangan gaharu tidak dapat dilakukan secara mandiri. Selanjutnya pohon yang sudah cukup besar (diameter > 44 . Sejauh ini telah dilakukan pengembangan gaharu sebanyak > 10. 2004.000 batang yang ditanam di sekitar pohon induk yang diinokulasi. Sebagaimana diuraikan sebelumnya. dan keterampilan pekerja akan sangat mempengaruhi proses produksi dan kualitas produk.Aspek PRODUKSI Kemampuan cendawan inokulan dalam menstimulir produksi resin juga sangat terkait dengan tingkat akumulasi resin yang merupakan hasil netto dari proses sintesis dikurangi dengan degradasinya serta jenis resin dan kemurniannya (Agrios. 2004). karena masih harus melakukan panen dan proses pembersihan gaharu yang bersifat padat karya.

Proses ini dilakukan secara manual dengan melibatkan sejumlah besar tenaga kerja. untuk membersihkan 1 kg gaharu umumnya diperlukan 4-5 orang hari kerja. maka perlu ada suatu kelembagaan yang bertugas untuk membantu penyiapan dan pelaksanaan proses produksinya hingga berhasil berkembang menjadi industri gaharu yang mandiri. Kelembagaan tersebut dapat sangat sederhana 45 .000-68.Pengembangan Gaharu di ..000 orang/hari.. dilakukan proses pembersihan untuk memisahkan gaharu dari jaringan kayu yang lebih sedikit kandungan resin wanginya. Oleh karenanya pengembangan gaharu harus dilakukan secara serius. Proses inokulasi ini selain memerlukan keterampilan. Jumlah ini cukup besar dan akan mampu mempekerjakan masyarakat sekitar hutan sebanyak 280 hingga 340 orang/tahun dengan 200 hari kerja/tahun.. tetapi dari segi keamanan pekerja dan lingkungan. sehingga tidak berkelanjutan. Dengan peningkatan permintaan dan kapasitas produksi. juga keberanian dan ketersediaan personil dengan kondisi fisik yang mendukung pelaksanaan pekerjaan. Pada gaharu hasil inokulasi. (Mucharromah) 20 cm) perlu diinduksi dengan inokulasi jasad renik atau perlakuan lainnya agar membentuk gaharu. Setelah dipanen secara total. Selanjutnya pohon yang telah diinokulasi dimonitor hingga waktu panen. Dari segi jumlah tenaga kerja yang menangani proses pembersihan produk ini kemungkinan tidak banyak berbeda antara produksi gaharu alam dengan gaharu budidaya. Selain itu. mengingat proses produksi gaharu jauh lebih rumit dibandingkan proses produksi komoditi hasil hutan dan perkebunan atau pertanian lainnya. Proses induksi pembentukan gaharu dilakukan dengan memberikan inokulan pada sejumlah besar lubang yang dibuat spiral dengan jarak 7-10 cm horisontal dan 12-20 cm vertikal dari pangkal batang hingga ujung pucuk yang masih bisa dipanjat. sehingga untuk menghasilkan gaharu sebanyak 270 ton sebagaimana jumlah yang diekspor pada tahun 2000-an akan mampu menyerap tenaga kerja sebanyak 56.. sementara gaharu alam akan makin habis. sehingga upaya-upaya yang dilakukan akan memberi hasil yang berkelanjutan. pengembangan gaharu hasil budidaya dan inokulasi makin lama makin memberikan keuntungan melimpah dan makin ’sustainable’. maka jumlah tenaga kerja yang dikaryakan juga akan semakin meningkat.

maka proses pengembangan gaharu yang telah dilakukan sejauh ini berjalan aman. pengembangan inokulan unggul untuk peningkatan mutu serta pengembangan teknik pengawasan kualitas produk. tidak hanya dengan pihak yang dapat membantu pengembangannya.Aspek PRODUKSI bila pengembangan gaharu dapat diberlakukan seperti komoditi pertanian atau perkebunan hasil budidaya. Dalam hal pengembangan gaharu. penjualan gaharu hingga kini masih memerlukan adanya sertifikasi jumlah untuk memastikan bahwa batas kuota belum terlewati. baik halaman maupun kebun. sehingga cukup menyulitkan meskipun prosesnya sederhana. maka pengembangan gaharu perlu dilakukan dengan melibatkan berbagai pihak yang terkait dengan perdagangannya. baik oleh pihak swasta maupun perguruan tinggi dan kelompok masyarakat. Hal ini dikarenakan upaya pengembangan yang dilakukan masih belum mencapai tahap produksi gaharu yang siap diperdagangkan. Mengingat pohon yang diinokulasi atau bibit yang ditanam berada di lahan pribadi. Bila sudah mencapai tahap produksi. pelibatan banyak pihak ini bila tidak dipayungi dengan deskripsi tugas yang mendetil dan tidak saling tumpang-tindih. swasta atau kelompok masyarakat. dibuat secara sangat sederhana dengan kontrak kerjasama antara pemilik pohon/lahan dengan pelaksana yaitu perguruan tinggi. perguruan tinggi dapat memainkan peran yang dapat menguntungkan semua pihak. justru akan dapat menghambat pengembangan gaharu yang dituju. Hal ini mungkin perlu disederhanakan dalam upaya pengembangan gaharu yang dilakukan. Sejauh ini pengembangan gaharu yang dilakukan di Provinsi Bengkulu. Peran tersebut dapat dilakukan melalui kegiatan penelitian dan pengabdian pada masyarakat yang sudah secara 46 . maka dengan adanya aturan kuota. Namun bila perdagangan gaharu masih diatur oleh kuota yang dalam proses perdagangannya melibatkan banyak pihak. Dalam hal ini peran perguruan tinggi yang mengembangkan penelitian gaharu dapat dilakukan dalam bentuk pembinaan kelompok produksi gaharu di sekitar wilayah hutan serta penelitian untuk pemutakhiran teknik produksi. mengingat wilayah sekitar hutan yang menjadi area pengembangan gaharu umumnya cukup jauh dari lokasi institusi yang mensertifikasi produknya. Dalam pelaksanaannya.

sehingga keberhasilannya akan lebih terjamin. polusi. tidak hanya karena menghasilkan produk bernilai ekonomi yang sangat tinggi. 20 Oktober1995. Anonim. PENUTUP 1. New York. yang berpotensi sangat besar untuk pemberdayaan masyarakat di sekitar wilayah hutan.N. Untuk lebih mengefisienkan proses produksi dan menekan pembiayaan maka program pengembangan gaharu perlu dilakukan dengan mengadopsi model yang paling efisien dan praktis.Pengembangan Gaharu di . tidak hanya untuk menjamin peningkatan dan kesinambungan produksi gaharu. Pengembangan gaharu merupakan suatu program yang sangat besar. Plant Pathology. Jakarta. DAFTAR PUSTAKA Agrios. sebagaimana produk pertanian atau perkebunan dan kehutanan lainnya.. dan beragam kerusakan lingkungan lainnya. banjir. Hal ini sangat penting untuk diperhatikan mengingat proses pembentukan gaharu tidak berjalan secara otomatis pada tanaman yang tumbuh sehat. Makalah Dipresentasikan pada Temu Pertama Pakar Gaharu. Hal ini sangat penting dilakukan. Oleh karenanya pengembangan gaharu perlu dilaksanakan dengan perencanaan yang sangat matang dari setiap tahapan prosesnya sehingga dapat berjalan dan meningkatkan kemandirian masyarakat di wilayah sekitar hutan. kekeringan.. tetapi juga untuk melindungi hutan dan keragaman hayati yang ada di sekitarnya serta meningkatkan kapasitas hutan dalam menanggulangi potensi bahaya bencana alam yang disebabkan oleh longsor. (Mucharromah) rutin dilakukan perguruan tinggi dengan dukungan pendanaan dari instansi pemerintah maupun swasta. 47 . 1988. Academic Press... 1995. Analisa Penyebab Terjadinya Gubal dan Kemedangan pada Pohon Gaharu. G. tetapi juga karena upaya ini memerlukan investasi teknologi dan modal yang cukup besar bagi keberhasilannya. 2.

Hipotesa Mekanisme Pembentukan Gubal Gaharu. Seameo-Biotrop. Santoso. Tingkat Akumulasi Resin Gaharu Akibat Inokulasi Fusarium sp. 2005. Fenomena Pembentukan Gubal Gaharu pada Aquilaria malaccensis (Lamk. Indonesia.). Mucharromah. ”http://en.org/wiki /Agarwood”. Universitas Mataram. 1-2 Desember 2005. Potensi Tiga Isolat Fusarium sp. BKS-PTN Wilayah Barat. 2008. Mucharromah. Agarwood. 2006a. Fakultas Pertanian Universitas Mataram Bekerjasama dengan Balai Pengelolaan Daerah Aliran Sungai Dodokan Moyosari Nusa Tenggara Barat (BP DAS Dodokan Moyosari NTB). dan Hartal.) Merespon Pelukaan dan Infeksi Cendawan. 2006. 18 November 2006.). Hartal. Hartal. Updated April 16th. Teknologi Budidaya dan Produksi Gubal Gaharu di Provinsi Bengkulu. pada Berbagai Waktu Setelah Pengeboran Batang Aquilaria malaccensis (Lamk. 31 Oktober 2006. Prosiding Seminar Nasional Gaharu. Bengkulu. Makalah Seminar. White Lotus Aromatics. 14-16 Mei 2008. MacMahon. Asal Gaharu terhadap Alginate dan CaCl2. Mucharromah. Makalah Seminar Nasional Pengembangan Produksi Gaharu Provinsi Bengkulu untuk Mendukung Peningkatan Ekspor Gaharu Indonesia. http://members. Studi Mekanisme Akumulasi Resin Wangi Aquilaria malaccensis (Lamk. 2008. Respon Acremonium sp.Aspek PRODUKSI Anonim.. dalam Menginduksi Akumulasi Resin Wangi Gaharu pada Batang Aquilaria malaccensis (Lamk. Makalah Semirata Bidang MIPA. 12 Agustus 2008. Nusa Tenggara Barat. 2001. 2008. Maryani. (unpublished). com/ratrani/ Agarwood.). BKS-PTN Wilayah Barat. DIKTI. Laporan Penelitian Fundamental. 14-16 Mei 2008. 2008. 48 . Rahayu dan E. Accessed 16 April 2006. dan U. G. N. Mucharromah. FAPERTA UNIB. Universitas Bengkulu. 2006.aol. dan Surani. Terakhir dimodifikasi 11:11.wikipedia. Mucharromah. Bogor. C. html. Lombok. Universitas Bengkulu. Makalah Semirata Bidang MIPA. Mucharromah. Santoso. 1998. Misnawaty.

J. dan Y.K. Wahyuno. Studi Etiologi Gubal Gaharu pada Tanaman Ketimunan. Skripsi Fakultas Pertanian Universitas Bengkulu. Kanwil Dephut Propinsi NTB. Uji Coba Pembentukan Gaharu dengan Cara Inokulasi. 1996. Teknologi Budidaya Tanaman Gaharu untuk Menuju Sistem Produksi Gubal Gaharu secara Berkelanjutan. Turjaman. Makalah Workshop Gaharu Tingkat Nasional. Strategi Budidaya dan Pengembangan Produksi Gaharu.. 2006. Biodiversitas dan Karakterisasi Jamur Potensial Penginduksi Resin Gaharu. Y. Surya. Raintree. Parman dan T. Mulyaningsih. 2001.T. A Review on Agar (Gaharu) Producing Aquilaria Species. Database Entry For Aquilaria agallocha.) dan Gubal Gaharu Hasil Inokulasi serta Potensinya untuk Menginfeksi Bibit Gaharu.. 11-13 September 2006. 2006. L. D. Chang and A. Surabaya. Y.S. Purba. Austin.A. Agustini. Prosiding Seminar Nasional Gaharu. Inc. Prosiding Seminar Nasional Gaharu “Peluang dan Tantangan Pengembangan Gaharu di Indonesia”... 49 . Makalah Workshop Gaharu Tingkat Nasional. Bogor. Ngatiman dan Armansyah. 2006b. 11-12 April 1996. 2005. 2007. (Mucharromah) Mucharromah dan J. Journal of Tropical Forest Products 2 : 272-285.. 1-2 Desember 2005.Pengembangan Gaharu di . Teknik Inokulasi dan Produksi Gaharu. Bogor. Mataram. 1-2 Desember 2005.rain-tree. Seameo-Biotrop. SEAMEO BIOTROP. Sumarna. L.B. Azizil. Kerjasama Dirjen PHKA dan ASGARIN. Rahman. Makalah Temu Pakar Gaharu. Surabaya 12 September 2006. Texas. E. Date 3/3/06.. Mulyaningsih. Ng. M.N..htm.S.com/ aquilaria. Identifikasi Genus Cendawan yang Berasosiasi dengan Pohon Aquilaria malaccensis (Lamk. T. 2005. Raintree Nutrition. Irianto. Surabaya 11-13 September 2006. Makalah disampaikan pada Workshop Gaharu Tingkat Nasional. Sumarna. 1997.. Santoso. Y. Sites : hhtp//www. Kerjasama Dirjen PHKA dan ASGARIN. Parman. R.

5 250 500 250 6 25 1. Uraian Beban operasional Pembelian batang/tanah Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga ahli inokulasi Tenaga kerja Pemeliharaan/perawatan Operasi lainnya Total A. Proyeksi penghasilan Penjualan kelas BC Penjualan powder Total proyeksi penghasilan C.250 100 1.031 10.500 200 600 12 300 100 5.2.Aspek PRODUKSI Lampiran 1.000 90 1. Beban zakat/pajak Proyeksi keuntungan 5% % 60 100 Kg Kg 2.307 1 1 50 50 Btg Btg Kg Kg 50 50 25 2 50 50 1.025 104.826 QTY Unit Harga/unit (Rp’000) Total cost (Rp’000) Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.000 90 1. D.450 1 1 1 1 1 1 3 1 Btg Btg Set Btg Btg Btg Thn Btg 100 5.500 200 600 36 300 7.500 6.000 500 120.000 5 120.1. 2006 50 . Beban panen dan pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total A.168 50 50 50 1 50 Kg Kg Kg Btg Kg 5 10 5 6 0. 30 kg/batang (Kemedangan) Total proyeksi hasil : 50 kg/batang Penjualan kelas BC per batang : 60 kg Penjualan powder : 100 kg/batang No A. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Pengurusan surat-surat Umum lainnya Total Total beban operasi B. Analisis usaha inokulasi gaharu Waktu inokulasi Jumlah tegakan gaharu Proyeksi hasil : 3 tahun : 1 batang : 20 kg/batang (Kelas BC).

000 Total Btg Set Btg Btg Btg Btg 20 3.000 1.000 Total cost (Rp’000) 15.000 4.000 10. Beban inokulasi Pengadaan inokulan Pembelian peralatan Stressing agent Tenaga kerja Pemelihaaan/perawatan Operasi lainnya 51 .000 1.000 1.000 A+B C C.000 1...1.000 2.000 10.000 19.000 2.000 36.000 1 1.000 2.000 6..2..000 1.500 1.000 3. Analisis usaha budidaya gaharu Waktu budidaya Luas lahan Populasi tegakan Rasio jumlah suntikan Jumlah lubang Proyeksi hasil panen per batang Exchange rate IDR : 7 tahun : 1 ha : 1.000 49. Biaya pra operasi (start-up cost) Sarana & prasarana TBM Rumah jaga Sarana penerangan (PLN) Sarana komunikasi Sarana lainnya Total 1 1 1 1 Total biaya (direkapitulasi) Beban operasi Penanaman pohon baru Land clearing Pembelian bibit Pembuatan lubang Penanaman pohon gaharu Pemupukan Perawatan dan pengamanan Total 1 1.000 1.000 24.000 Unit Unit Unit 2.000 5.000 10 5 10 1 20.000 1.000 1.000 4.000 1. (Mucharromah) Lampiran 2.000 5 1 0.000 1.000 1 ha Btg Btg Btg Btg ha 1.5 5 24.000 500 5.000 25. Uraian Biaya akuisisi lahan Pembelian lahan Perizinan/sertifikat/notariat Total QTY Unit 1 1 ha Surat* B.Pengembangan Gaharu di .000/ha : 80 lubang/kg : 160/batang : 160/80 = 2 kg : 9.000 1.000 1. C.000 1.000 5.000 Harga/ unit (Rp’000) 15.000 No A.

500 Kg % 2.000 2.000 2.609.000 2. Uraian Beban panen & pasca panen Penebangan Angkut ke gudang Pembersihan gaharu Packing Total QTY Unit Harga/ unit (Rp’000) 5 5 10 2 Total cost (Rp’000) 5.000 5.000 20.000 4.000 3.000 Kg Kg Kg Kg 5 10 20 0.000 1.000 Btg Btg Kg Kg C.000 Total proyeksi penghasilan 5% Proyeksi keuntungan E F Beban zakat /pajak Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu.000.000.000 4. Beban pemasaran & umum lainnya Angkut penjualan Penjualan Retribusi Umum lainnya Total Total beban operasi 2.000 2.4.000 200.5 10.000 190.000 4. 2006 52 .3.000 40.000 71.Aspek PRODUKSI No C.000 1.000 1.000 34.500 D Proyeksi penghasilan Penjualan kelas C 2.000 2.000 20.

Maluku. Gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut memiliki scent of God’... dan parfum (Barden et al. incense. sebagai pengharum ruangan sembayang serta benda-benda rohani seperti rosario dan tasbih (Barden et al.(Eka Novriyanti) 2 KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp. Produk ini dihasilkan beberapa spesies penghasil gaharu dalam famili Thymeleaceae. pemanfaatan gaharu adalah untuk pengobatan.. 2005). Indonesia yang merupakan salah satu pemasok gaharu terbesar memiliki kekayaan jenis penghasil gaharu tertinggi di dunia. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti 53 . 2000)..Kajian Kimia Gaharu . Kalimantan. PADA Aquilaria microcarpa Eka Novriyanti Balai Penelitian Hutan Penghasil Serat Kuok PENDAHULUAN Gaharu adalah komoditas hasil hutan non-kayu yang bernilai ekonomi tinggi dengan harga pasar bervariasi tergantung kualitasnya... yaitu 27 spesies dari 8 genus dan 3 famili yang tersebar di Sumatera. mulai dari 300 ribu rupiah hingga 25 juta rupiah untuk kualitas double super. Incense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagaman. Pada prinsipnya. meskipun pengunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. dan Irian (Sumarna. 2000). Sementara itu.

ginjal. diuretic. (Hayne. Namun begitu. rangsangan fisiologi. dan bermanfaat untuk mengatasi berbagai panyakit seperti sakit gigi. antar jaringan (konsentrasi tertinggi berada di kulit. liver. Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. 1987. kayu teras. cacar. 2007).. dalam Isnaini. stimulan kerja saraf dan pencernaan. hepatitis. kanker. dan lain-lain pengembangan yang masih sangat luas untuk dilakukan. 1987). 2004). obat kuat pada masa kehamilan dan bersalin. Barden et al. malaria. Adelina. Suhartono dan Mardiastuti. juga memiliki sifat anti racun. 2004). anti serangga. Arah pemanfaatan informasi kimia gaharu di antaranya adalah penyusunan standar produk berdasarkan komposisi kimia yang dikandungnya sehingga lebih seragam dalam praktek penentuan kualitas produk. hal ini 54 . pengembangan senyawa-senyawa dalam gaharu dengan bio-teknologi. diare. 2000. 2004. Metabolit sekunder pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. Konsentrasi metabolit sekunder ini bervariasi antar spesies. atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Commission GIFNFC. anti mikrobia. Gaharu adalah senyawa fitoaleksin yang merupakan metabolit sekunder dari pohon gaharu sebagai mekanisme pertahanannya. Informasi mengenai bahan-bahan kimia yang terkandung dalam gaharu penting untuk pemanfaatan produk ini. Metabolit sekunder atau zat ekstraktif tanaman dapat efektif dalam melawan hama dan agen penyakit karena analog dengan komponen vital tertentu dari sistem sinyal seluler. 2007). informasi jalur biosintetis gaharu itu sendiri sehingga mungkin dapat dibuat sintetis senyawa. asma.. dan antar musim (Forestry Commission GIFNFC. maupun keadaan cekaman (Goodman et al. antar spesies. pangkal percabangan. akar. dan jaringan luka). 2007). 2002). rematik. Pohon gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. antar pohon dalam spesies yang sama.Aspek PRODUKSI inflamatory (Trupti et al. pengembangan pemanfaatan lain dengan terbukanya kemungkinan diidentifikasinya senyawa-senyawa baru dengan manfaat yang baru pula. tumor.

. suhu injeksi 2800C. Injeksi dilakukan dalam mode split. analisis kimia gaharu dilakukan dengan analisis GCMS pirolisis menggunakan aparatus Shimadzu GCMSQP2010. Kalimantan Tengah Tamiang Layang. sedangkan analisis kimia dilakukan untuk sampel berumur ± 1 tahun. kemudian increased mencapai 2800C hingga 30 menit. Pengukuran luasan infeksi dilakukan pada umur inokulasi 6 bulan..25 mm.. Gambar 1 menyajikan luasan infeksi Fusarium sp. Helium digunakan sebagai gas pembawa (carrier) (0. dioperasikan dengan electron impact (EI) mode pada 70 eV dan suhu ion source 2000C. ANALISIS KIMIA GAHARU HASIL INOKULASI ISOLAT DARI BEBERAPA DAERAH ASAL Dalam tulisan ini. Identifikasi senyawa dilakukan berdasarkan waktu retensi dan analisis MS. dan perlu dicatat tidak satupun isolat yang origin dari lokasi di mana penelitian dilakukan yaitu asal Carita. Meskipun secara deskriptif isolat asal Bahorok sepertinya menyebabkan infeksi yang paling besar. microcarpa. namun setelah sekian waktu ternyata pengaruhnya terhadap luasan infeksi menjadi tidak signifikan lagi. daerah asal isolat tidak berpengaruh nyata terhadap luasan infeksi yang terjadi pada batang pohon penghasil gaharu ini. dan ditahan pada suhu ini hingga menit ke-60.25 μm).8 ml/min) yang dilengkapi dengan kolom kapiler DB-5 MS (60 mm x 0.(Eka Novriyanti) masih memerlukan pemikiran dan terus melakukan penelitianpenelitian lanjutan yang akan membuka satu demi satu kebenaran yang saat ini masih belum terungkap. namun secara statistik.. Mentawai. 55 . pada batang A.Kajian Kimia Gaharu . Kondisi kromatografi adalah sebagai berikut: suhu oven kolom 500C. asal Bahorok. yaitu isothermal 500C selama 5 menit. Tidak signifikannya pengaruh asal isolat terhadap luas infeksi diduga disebabkan karena isolat yang diinokulasikan sama-sama Fusarium sp. dan Maluku. ketebalan film 0. Meskipun di awal inokulasi masing-masing isolat memperlihatkan kecepatan pembentukan infeksi yang berbeda sesuai virulensinya. Analisis komponen kimia dilakukan untuk gaharu rekayasa hasil inokulasi isolat Fusarium sp..

Burfield. 56 . 2009. Kelompok C: senyawa yang belum dikonfirmasi merupakan konstituen gaharu namun memiliki karakter odorant. yaitu: 1. Lampiran 1 menyajikan komponen kimia hasil analisis py-GCMS terhadap sampel gaharu inokulasi umur satu tahun.. 2005.Aspek PRODUKSI Gambar 1. Nor Azhah et al. kelompok A: konstituen gaharu yang sudah diidentifikasi pada pekerjaan beberapa peneliti sebelumnya 2. 2006. 2003.... 2005. microcarpa dengan pembeda daerah asal isolat Meskipun secara luasan infeksi tidak menunjukkan pengaruh yang nyata. Panjang infeksi pada umur inokulasi 6 bulan di batang A. Konishi. 2005. namun analisis komponen kimia dari gaharu hasil rekayasa ini menunjukkan adanya perbedaan. Kelompok B: senyawa berkarakter odorant namun merupakan hasil pirolisis komponen kayu seperti selulosa dan lignin 3. Tamuli. Alkhathlan et al. dengan tanpa membedakan jarak suntik menunjukkan bahwa akumulasi konsentrasi relatif tertinggi untuk konstituen terkonfirmasi (Yagura et al. Kelompok A pada Lampiran 1. Pojanagaroon dan Kaewrak. Sampel yang dianalisi adalah sampel masing-masing dari titik-titik inokulasi dengan jarak suntik 5 cm dan 20 cm. Bhuiyan et al. Lampiran 1 dibagi menjadi 3 kelompok. 2002.

.61%). konsentrasi relatif tertinggi justru dihasilkan oleh isolat asal Maluku (12. dan terakhir Kalimantan Tengah Tamiang Layang (18. Bahorok (10. dan Mentawai (11. diikuti Bahorok (12..14%).40%). Pengaruh kontribusi senyawa dalam kelompok ini pada wangi gaharu memerlukan investigasi lebih lanjut. Namun kontribusi komponen-komponen berkarakter odorant tersebut terhadap wangi gaharu masih memerlukan observasi yang lebih dalam lagi.89%. Bahorok. Dengan kata lain..23%). Keberadaan senyawasenyawa odorant hasil pirolisis komponen kayu ini kemungkinan memiliki peran pada kesatuan wangi yang dihasilkan incense gaharu yang dibakar.. Ditampilkannya fakta tersebut karena penggunaan gaharu pada umumnya sebagai incense yang menghasilkan wangi hanya jika kayu yang mengandung resinnya dibakar. karena digunakan sebagai incense yang mengumbar wangi saat dibakar. 57 . diikuti Mentawai. dan Mentawai (8. Untuk kelompok odorant yang merupakan pirolisis komponen kayu ini. maka keberadaan senyawa dalam kelompok B tidak bisa dikesampingkan walaupun bukan merupakan konstituen resin gaharu yang sebenarnya. Maluku.47%). diikuti masing-masing Maluku (10. Mentawai (24.27%).96%). Kalimantan Tengah Tamiang Layang (12.31%).37%). Untuk Kelompok C. isolat asal Kalimantan Tengah Tamiang Layang memberikan hasil gaharu artifisial yang relatif terbaik yang ditunjukan oleh relatif lebih besarnya infeksi yang terjadi dan akumulasi senyawa gaharu terkonfirmasi tertinggi. akumulasi konsentrasi relatif tertinggi dihasilkan oleh isolat asal Maluku (26. Secara kuantitas maupun kualitas (komponen kimia terkonfirmasi). Pola urutan konsentrasi yang sama juga terjadi untuk total konsentrasi relatif komponen berkarakter odorant.71%).Kajian Kimia Gaharu . dan Kalimantan Tengah Tamiang Layang.(Eka Novriyanti) 2008) terjadi pada isolat asal Kalimantan Tengah Tamiang Layang sebesar 12. Perbedaan konsentrasi ini kemungkinan sangat dipengaruhi oleh konsentrasi selulosa dan lignin dari bagian batang yang dijadikan sampel. Kelompok B pada Lampiran 1 merupakan kelompok senyawa berkarakter odorant yang merupakan hasil pirolisis selulosa dan lignin. Bahorok (22.47%).

. 2008).11%. kecuali untuk isolat asal Kalimantan Tengah Tamiang Layang yang justru lebih tinggi akumulasi konsentrasinya pada jarak suntik 20 cm (Tabel 1). Secara umum untuk kelompok A. Isolongifolene merupakan bahan yang sangat berguna sebagai odorant dan minyak parfum (Bunke dan Schatkowski. Tabel 1. dan. Inc.Aspek PRODUKSI Untuk komponen gaharu terkonfirmasi (Kelompok A). biasanya dimanfaatkan sebagai penguat rasa dan aroma (flavor enhancer) pada roti dan kue (Wikipedia Online. Indole merupakan konstituen utama dalam minyak melati dan karena minyak melati ini berharga mahal. dan bunga (International Flavor and Fragrance. pada A. 2002). Angka-angka ini tidak jauh berbeda karena diduga konsentrasi komponen kayu yang relatif sama pada pohon-pohon sampel yang relatif berumur sama dan tumbuh pada kondisi yang relatif sama. Untuk kelompok B. Senyawa ini pada konsentrasi rendah menyajikan wangi bunga dan merupakan konstituen dalam berbagai wangi bunga dan parfum. daun tembakau (The Good Scent Company. 2008). Valerolactone Ketoisophorone Maltol Indole Isolongifolen 58 . 2008). Ketoisophorone mengumbar wangi manis campuran kayu. 2008) Ambrox memiliki karakter odorant tipe amber dan juga merupakan anti-inflamatory yang potensial untuk bidang pengobatan (Castro et al. Komponen ini menyajikan wangi caramel dan digunakan untuk menghasilkan wangi yang manis pada fragrance. manis buah. Senyawa ini memiliki wangi herbal yang dimanfaatkan dalam industri parfum dan pewangi (Wikipedia Online.11% untuk jarak suntik 5 cm dan 20 cm. microcarpa yang memiliki karakterisitik odorant penting Komponen Ambrettolide Ambrox Keterangan Senyawa ini memiliki karakter wangi musk. 2008).17% dan 12. dihasilkan akumulasi masing-masing sebesar 12. secara umum jarak suntik 5 cm menghasilkan akumulasi konsentrasi yang lebih tinggi. jarak suntik 5 cm dan 20 cm menghasilkan akumulasi konsentrasi relatif masing-masing sebesar 11..25% dan 10. Komponen dalam gaharu hasil inokulasi berbagai daerah asal isolat Fusarium sp. 1997). produk ini dibuat sintetisnya dengan menggunakan indole (Wikipedia Online. teh.

1994. Azulene sangat sering ditemukan sebagai komponen dalam minyak esensial tanaman dalam family Asteraceae dan memiliki wangi dan warna biru pada minyak dan ekstraknya (LyndShiveley.59%) yang menghasilkan konsentrasi relatif lebih tinggi dibandingkan jarak suntik 5 cm (50. Dikenal juga sebagai cyclopentanone yang memiliki wangi mint. yang ditunjukan oleh infeksi yang lebih kecil. Blake.. Mann et al.. Dengan besarnya spasi injeksi akan menyebabkan proses pembentukan senyawa yang terjadi berlangsung relatif lebih lambat..(Eka Novriyanti) Komponen Limonene Keterangan Limonene merupakan terpen yang memiliki aroma bunga dan buah.81% dan 20. dengan spasi injeksi yang lebih kecil di mana infeksi terjadi lebih cepat dan lebih besar.96% untuk jarak suntik 20 cm dan 5 cm. 2008). masing-masing 24. The Good Scent Company. Senyawa ini muncul sebagai konstituen minyak esensial berbagai tanaman (Wikipedia Online. Cadinene Dumasin Benzylacetone Azulene Akumulasi total untuk komponen berkarakter odorant menunjukkan bahwa jarak suntik 20 cm (52. ada kemungkinan proses sintesis terjadi lebih cepat dibandingkan jarak injeksi yang lebih besar sehingga dihasilkan senyawa-senyawa baru yang lain yang berkarakter odorant namun akumulasinya belum cukup tinggi saat observasi dilakukan. 2008. Merupakan material wewangian dan untuk pengobatan serta memiliki sifat pestisida (ChemYQ. 2008.. Geraniol dan limonen juga dimanfaatkan dalam pengobatan herbal dan konstituen dalam berbagai tanaman obat (Wikipedia Online. Pola yang sama juga terlihat untuk akumulasi konsentrasi relatif pada kelompok senyawa C. Kajian lebih dalam lagi diperlukan untuk mengetahui perkembangan atau perubahan yang terjadi dengan semakin lamanya waktu inokulasi. juga merupakan komponen volatil pada kokoa (Wikipedia Online.Kajian Kimia Gaharu . 2008). 59 . selain sebagai bahan kosmetik dan flavouring karena memberi wangi sitrus. Limonen merupakan monoterpeneoid yang digunakan sebagai insektisida botani. Benzylacetone memiliki wangi manis bunga yang merupakan komponen atraktan yang melimpah pada bunga. 2004). Di pihak lain. 2008).23%). 2004). proses yang lambat ini kemungkinan memberi waktu dan kesempatan bagi senyawa tertentu untuk disintesis atau diakumulasikan hingga diperoleh konsentrasi yang relatif lebih tinggi.. Namun.

1999. Fotouhi et al. Rho et al. 2008). senyawa 4H-pyran-4-one dan derivatnya (Abrishami et a. 60 . di mana senyawa ini merupakan fenolik yang dihasilkan tanaman sebagai respon alami terhadap pelukaan (Sheikholeslam dan Weeks. 2004). Sedangkan koniferil alkohol merupakan intermediet dalam biosintetis eugenol dan isoeugenol (Cowan. 2008). PubChem Compound. 2008.. Senyawa asetosiringon juga tercatat pada semua gaharu hasil inokulasi kelima daerah asal isolat dalam penelitian ini. 2008). metileugenol.. Eugenol. dan elimicin (Rossi et al. 2007. 1999). 2002.. 2000). 2008). 1999)... syringal-dehyde (Pedroso et al. dan isometileugenol merupakan empat senyawa fenilpropanoid dari 12 senyawa volatil yang diketahui menyebabkan wangi yang manis pada Clarkia breweri (Rhodes. Eugenol serta isoeugenol digunakan dalam produksi vanilin yang merupakan bahan penting dalam industri wewangian (Cowan. Asetosiringon merupakan bioaktif dalam interaksi tanamanmikroba yang mempercepat pendeteksian kehadiran patogen oleh tanaman di mana konsentrasi senyawa ini meningkat dalam tanaman seiring dengan meningkatnya konsentrasi mikroba (Baker et al. derivat cyclopentane (Wikipedia Onlie.Aspek PRODUKSI Hasil analisis py-GCMS juga menunjukkan adanya senyawasenyawa yang pada beberapa hasil penelitian lain disebutkan sebagai senyawa pertahananan. benzoic acid (NBCI.. Rhodes. Beberapa di antara komponen ini bahkan juga memiliki karakter wangi yang diketahui merupakan konstituen minyak esensial dan digunakan secara komersil dalam industri parfum dan pengharum seperti vanillin. 2006). 1986). 2008).. 2007). Koeduka et al. dumasin (ChemYQ. dan guaiakol merupakan intermediet dalam pembuatan eugenol dan vanilin (Li dan Rosazza. Dalam Hua (2001) disebutkan bahwa konsentrasi asetosiringon meningkat 10 kali lipat ketika suatu jaringan aktif tanaman dilukai. eugenol (Cowan. 2008). isoeugenol.

dan obat-obatan. Letak dan jumlah grup hidroksil pada grup fenol diduga berkaitan dengan daya racun relative-nya terhadap mikroorganisme. Adalah fenol terhidroksilasi yang bersifat toksik pada mikroorganisme. pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masinng sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. 2. dan parasitisida (Wikipedia. pada A...(Eka Novriyanti) Tabel 2. Pada gaharu rekayasa hasil inokulasi Fusarium sp. deodoran. 1999). Kedua senyawa ini dan turunannya digunakan sebagai antiseptik. yaitu asam ferulat ataupun koniferil alkohol (Rhodes. 2000). Eugenol dan isoeugenol diturunkan dari prekursor lignin. 2008). Merupakan senyawa pertahanan tipe fitoaleksin yang termasuk dalam grup fenilpropanoid. memiliki sifat antimikrobial (Torssel. Eugenol digunakan dalam pembuatan parfum.. 1983. p:144). 61 . di mana daya racun akan semakin meningkat dengan semakin tingginya hidroksilasi (Cowan. Merupakan intermediet dalam pembuatan eugenol dan vanilin. Senyawa ini digunakan untuk menghasilkan isoeugenol yang diperlukan untuk membuat vanilin yang juga merupakan bahan yang penting dalam obat-obatan dan industri parfum dan pengharum. Hasil inokulasi Fusarium sp. 2008). Merupakan dimetil eter dari pirokatekol. minyak esensial.Kajian Kimia Gaharu . microcarpa ditemukan beberapa komponen senyawa yang sudah diidentifikasi merupakan konstituen gaharu dan beberapa senyawa lain yang memiliki karakter odorant dan secara komersil digunakan dalam industri perfumery dan flavoring. Senyawa-senyawa yang berdasarkan beberapa referensi diketahui merupakan pertahanan pada tanaman tertentu dan terdeteksi pada gaharu hasil inokulasi Senyawa Eugenol Keterangan Bersifat bakteriostatik terhadap jamur dan bakteri (Cowan. Konstituen resveratrol yang diturunkan dari asam p-hidroksisinamat dan 3 unit malonat. ekspektoran. contohnya adalah yang terdapat pada Linum usitiltissimum (Sengbusch.. 2008a). 1999). sedatif. yang juga digunakan sebagai antiseptik dan parasitisida (Li dan Rosazza. Koniferil alkohol Guaiakol Katekol dan pirogalol Veratrol KESIMPULAN 1.

K. J. daerah asal isolat menunjukkan perbedaan dalam konsentrasi senyawa-senyawa gaharu yang terbentuk. 1997.. D. Chang. Yasmin. Barden. T. C. Y. Averyanov. asal Kalimantan Tengah menunjukkan konsentrasi senyawa konstituen gaharu terkonfirmasi yang lebih tinggi. D. H. . Whitaker. htm. naturalhealthwizards. Hasnida. J. [2 Februari 2007]. A. F. Y. Majid. Mock. Molecules 7: 239–244. com/MedicinalPlantConstituents. J. [22 Mei 2007]. Bayat. R. 2004. N. namun isolat asal Maluku menunjukkan konsentrasi yang relatif lebih tinggi untuk total senyawa dengan karakter odoran. 2004 Medicinal Plant Constituents. freepatentsonline. Schatkowski. inokulasi Fusarium sp. Song. Blanchette. 2000. Isolongifolanol Derivates. C. R. http://www.net. N.com [31 Desember 2008]. M. [20 Juni 2008]. Sustainable Agarwood Production in Aquilaria Trees. Husni. N.. A. A..therainforestproject.org. P. B. Teimuri-Mofrad. Robert. A. A. http://www. Deahl. [21 Juni 2008]. http://www. Baker. Said. S. Azah. D. Heart of the Matter: Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis.traffic. J. A.pdf. Comparison of Chemical Profiles of Selected Gaharu Oils from Peninsular Malayia. www. S. A. 2006. Stimulatory Effect of Acetosyringone on Plant/Pathogen Recognition. Mailina. S. Mulliken. S. www. Rice. United State Patent. Blake. M. N. L. N. M.usda. The Malaysian Journal of Analytical Sciences 12 (2): 338-340. A.3. 2008. A. Meskipun secara statistik tidak memperlihatkan perbedaan yang signifikan terhadap luasan infeksi yang terbentuk setelah 6 bulan inokulasi. Secara umum. A. Anak. Shahrisa. E. gov/research/publications/publications. 2002. Bunke. Y. Synthesis of Some Aldoxime Derivatives of 4H-Pyran-4-ones.ars. DAFTAR PUSTAKA Abrishami. their Production and their Use.

http://www.. Ishihara. M. M. 2004. Castro. A.html?showSynonyms=1 [ 1 November 2008: 2. Yayasan Sarana Wana Jaya. 2008. S.cropwatch. Investigation of Electrooxidation Reaction of Some Tetrahydrobenzo[b]pyran Derivatives. csl.iff.nsf/0/45BD7B214C6F661E8025699000 5D79C2 [31 Desember 2008]. 1987. W. Succinaldehyde. S. 2008. T. M..uk/review/extraction. 1991. Shiga. 2008. E. CITES. Tsuneya. K. Altarejos. Phytochemistry 30 (2): 563566. 3: 721-726.Burfield.com/ Ingredients. Thymelaceae. hlm: 1467-1469. International Flavor and Fragrance. http://www. Plant Products as Antimicrobial Agents. Convention on International Trade in endangered Species of Wild Fauna and flora: Amendments to Appendices I and II of CITES. www. T. Clinical Microbiology Review 12 (4): 564-582.. Tetrahedron 58 (29): 5941-5949. Uneyama. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. [2 Februari 2007]. Dumasin. A. Heartwood and Tree Exudates. Sánchez. Synthesis of Ambrox® from Labdanolic Acid. Fatehi. Hayne. Three Sesquiterpenes from Agarwood.chemyq. L. M.cfm. Heravi.gov.org. 2002. Terjemahan dari: Nuttige Planten Van Indonesie. Food safety and Quality: Flavoruing Index.31 pm]. ChemYQ. Agarwood Chemistry. Hua. T. J. Chemicals from Trees. 2001. M. Int. Badan Litbang Kehutanan Jakarta. Cowan. http://www. J. and K.org/common/cop/13/raw / props/ID-Aguilaria-Gyrinops. 2005a. 1987. Electrochem. Tumbuhan Berguna Indonesia Jilid III. Hills. Nogueras. Fotouhi.com/ En/xz/xz11 [3 April 2008]. Sci. [14 Juli 2007]. M.fao.pdf.org/ ag/agn/jecfa-flav/index. http: // treechemicals. 1999.cites. 2007. FAO. http://www. Forestry Commission GIFNFC. M. J. S. Salido. 63 . Applied Microbiology 32: 278-281. Berlin: SpringerVerlag. Inc.

. Kish. of Pharmacognosy 18(1): 63-69. [20 Juni 2008].. and P. Program Pascasarjana Institut Pertanian Bogor. C. 2006. 28 (3): 471-473. NCBI PubChem. 2004.. www. 50 (3): 419-422.cgi?cid=243. USA. F. Sci. Induksi Produksi Gubal Gaharu melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik (Disertasi). P. Lab. A. T. Chem. Jackson. H. Applied and Environmental Microbiology 66 (2): 684-687. D. Benzoic acid. Spassova. Steil. N. M. Chang. T. http://pubchem. S. R. K. Gang. M. T. S. Bull. 1962. A. Lynd-Shiveley. Isolation of Syringaldehyde from Mikania laevigata Medicinal: Extract and its Influence on the Fatty Acid Profile of Mice. G. Vassão.. 2007. N.org. Korean Chem.nih. B.nlm. gov/summary/ summary. Chem. [1 Desember 2008]. E.ncbi. L. Pedroso. H. Brazilian Jour. Barison. Baek. D. S. Pharm. Santos. B. Fridman. 2002.com. Y. [22 Mei 2007]. ISHS Acta Hort 676. Lee. Konoshima. India. T. P. Bhattacharrya. Pojanagaroon. 2006. Lewis. D. P.Aspek PRODUKSI Isnaini. are Biosynthesized via Reduction of a Coniferyl Alcohol Ester. Kim. F. Orlova.actahort. 2004. D. 64 . Prema. Dudareva. A. Natl. I. S. Microbial Transformation of Terpenes. www. Acad. W. M. Konishi. Characteristic Aromatic Constituents of Spices. J. Biavatti. G.. Rosazza. Mechanical Methods to Stimulate Aloes Wood Formation in Aquiliria crassna Pierre ex H Lec (Kritsana) Trees. Koeduka. Nat. Y. M. W. N. Soc. S. 2000. Aromaticplant project. H. 2008. S. Eugenol and Isoeugenol. Y. Kim. J. Six New 2-(2-Phenylethyl)chromones from Agarwood. J. Azulene and Chamomile. Bogor. S. Shimada. New 5-Hydroxy-2-(hydroxymethyl)-4H-pyran-4one Derivative has Both Tyrosinase Inhibitory and Antioxidant Properties. Biocatalytic Synthesis of Vanillin. J. Campos. Kaewrak. Baiga. C. Pichersky. A. E. Kiyosawa. J. E. Deschamps. C. T. Bull. and I. Li. S. R. Noel.. Proc. 2008. Rho. You.

Kajian Kimia Gaharu .....(Eka Novriyanti)

Rhodes, D. 2008. Secondary Products Derived from Aromatic Amino Acids: Eugenol and Isoeugenol. www.hort.purdue.edu. [20 Juni 2008]. Rossi, P. G., L. Bao, A. Luciani, P. Panighi, J. M. Desjobert, J. Costa, J. Casanova, J. M. Bolla, and L. Berti. 2007. (E)-Methy-lisoeugenol and Elemicin: Antibacterial Components of Daucus carota L. Essential Oil Against Campylobacter jejuni. J. Agric. Food Chem. 55 (18): 7332-7336. Sengbusch, P. V. 2008. Phenolic Compounds. http://www.biologie. unihamburg. de/b-online/e20/20d.htm. [10 April 2008]. Sheikholeslam, S. N., D. P. Weeks. 1987. Acetosyringone Promotes High Efficiency Transformation of Arabidopsis thaliana Explants by Agrobacterium tumafacien. Plant Molecular Biology 8: 291198. Sumarna, Y. 2005. Budidaya Gaharu. Seri Agribusines. Penebar Swadaya. Jakarta. The Good Scent Company. 2008. Limonene; Ketoisophorone; Syringaldehyde, Tiglaldehyde. http://www.thegoodscents company.com/gca/gc1014951.html [20 Juni 2008]. Torssell, K. B. G. 1983. Natural Product Chemistry. John Wiley & Son Limited. Chichester, New Tork, brisbane, Toronto, Singapore. Trupti, C., P. Bhutada, K. Nandakumar, R. Somani, P. Miniyar, Y. Mundhada, S. Gore, K. Kain. 2007. Analgesik and Antiimflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal. Pharmacologyonline 1: 288-298. Vidhyasekaran, P. 2000. Physiology of Disease Resistant in Plant. CRC Press Inc. Boca Raton, Florida. Verpoorte, R., R. van der Heijden, J. Memelink. 2000. General Strategies. In Verpoorte, R. and A. W. Alfermann (eds). Metabolic Engineering of Plant Secondary Metabolism. Kluwer Academic Publisher. Dordrecht, Boston, London. p: 31-50. Wikipedia Online. 2008. Pyrrolidine; Propargyl Alcohol; Ptalic Acid; Mesityl Oxide; Maltol; Indole; Glutanic Acid, Furanone; Elemicin; DABCO; Crotonic Acid; Cadinene; Butyric Acid; Benzylacetone; Caprylic Acid. http://en.wikipedia.org/wiki/. [1 juni 2008].

65

Aspek PRODUKSI

Yagura, T., N. Shibayama, M. Ito, F. Kiuchi, G. Honda. 2005. Three Novel Diepoxy Tetrahydrochromones from Agarwood Artificially Produced by Intentional Wounding. Tetrahedron Letters 46: 4395-4398. Yagura, T., M. Ito, F. Kiuchi, G. Honda, Y. Shimada. 2003. Four New 2-(2-Phenylethyl) Chromone Derivatives from Withered Wood of Aquilaria sinensis. Chem. Pharm. Bull. 51:560-564. Zaika, E. I., R. A. Perlow, E. Matz, S. Broyde, R. Gilboa. 2004. Sub-strate Discrimination by Formamidopyrimidine-DNA Glycosylase. The Jour. of Biol. Chem. 279 (6) issue 6: 4849-4861.

66

Kajian Kimia Gaharu .....(Eka Novriyanti)

Lampiran 1. Komponen dalam gaharu hasil inokulasi Fusarium sp. pada A. microcarpa
Konsentrasi Relatif (%) Nama senyawa 5 cm Bo 20 cm 5 cm Kt 20 cm Me 5 cm 20 cm Mu 5 cm 20 cm

A. Komponen aromatis yang sudah diidentifikasi sebagai konstituen gaharu 4-(2’-Methyl-3’-butenyl) azulene 2,5-DIMETHOXY-4ETHYLBENZALDEHYDE 2-Hydroxy-4methylbenzaldehyde 4-Ethoxy-3methoxybenzaldehyde 4-METHYL-2,5DIMETHOXYBENZALDEHYDE Benzaldehyde, 2,4-dihydroxy Benzaldehyde, 2,4-dimethoxy- (CAS) 2,4-Dimethoxybenzaldehyde Benzaldehyde, 3,4-dihydroxy- (CAS) 3,4-Dihydroxybenzaldehyde Benzaldehyde, 3-hydroxy- (CAS) m-Hydroxybenzaldehyde Benzaldehyde, 4,6-dimethoxy2,3-dimethyl- (CAS) 2,4-Dimethoxy-5,6-dimethyl Benzaldehyde, 4-[[4-(acetyloxy)-3,5dimethoxyphenyl]methoxy]3-methoxy Benzaldehyde, 4-hydroxy(CAS) p-Hydroxybenzaldehyde 1,2-benzenedicarboxylic acid, diisooctyl ester (CAS) Isooctyl phthalate 2-Butanone, 4-phenyl- (CAS) Benzylacetone 2-Butanone, 3,3-dimethyl(CAS) 3,3-Dimethyl-2butanone 0,09 0,09 4,35 0,42 0,06 0,08 0,08 2,37 0,30 0,49 3,66 0,08 0,06 0,21 1,52 0,22 0,07 4,65 0,10 1,45 0,09 4,42 0,11 4,60 0,25 -

-

-

0,32

0,29

0,26

-

0,24

0,28

-

0,37

-

-

0,39

-

-

0,29

-

-

0,36

-

-

-

-

-

-

-

0,37

-

-

0,54

0,48

-

-

0,07

-

0,12

0,43 -

0,23 -

0,44 -

-

0,24 -

0,04

-

0,41 0,04

-

0,53 -

0,05

-

67

Aspek PRODUKSI

Konsentrasi Relatif (%) Nama senyawa 5 cm 2-Butanone, 3-phenyl- (CAS) 4H-1-Benzopyran-4-one, 2-(3,4-dihydroxyphenyl)-7-(. beta.-D-glucopyranosyl) 4H-1-Benzopyran-4one, 2-methyl- (CAS) 2-Methylchromone 4H-1-Benzopyran-4-one, 5,7-dihydroxy-2-methyl- (CAS) 2-Methyl-5,7-dihydroxy 4H-1-Benzopyran-4-one, 6-dihydroxy-2-methyl- (CAS) 6-Hydroxy-2-methylchromone 2-Coumaranone .gamma.-Eudesmol Hexadecanoic acid, 2-(octadecyloxy)-, tetradecyl ester (CAS) TETRADECYL Hexadecanoic acid, methyl ester (CAS) Methyl palmitate 2,4-Hexadienedioic acid, 3,4-diethyl-, dimethyl ester, (Z,Z)- (CAS) CIS.CIS.D 2,4-Hexadienedioic acid, 3-methyl-4-propyl-, dimethyl ester, (Z,E)- (CAS) .alpha.-humulene 1-Naphthalenol, 1,2,3,4-tetrahydro- (CAS) 1-Tetralol 1-Ethynyl-3,4-dihydro-2naphthalenecarbadehyde Phenol, 2,6-dimethoxy- (CAS) 2,6-Dimethoxyphenol Phenol, 3,4-dimethoxy- (CAS) 3,4-dimethoxyphenol Benzenepropanoic acid, methyl ester (CAS) Methyl hydrocinnamate Bo 20 cm 5 cm Kt 20 cm 0,05 Me 5 cm 20 cm Mu 5 cm 0,15 20 cm -

-

-

-

0,18

-

-

-

-

-

0,06

-

0,36

-

-

0,34

-

-

-

-

0,46

-

-

-

-

-

0,04 -

-

-

-

-

0,28 -

0,03

-

-

-

-

0,69

-

0,05 0,85

-

-

0,12

-

0,16

-

0,09

0,17

-

-

-

-

-

-

0,11 0,07

-

-

2,94 0,25 -

0,08 3,37 0,33 -

2,74 0,33 -

3,67 0,40 0,25

3,11 0,24 -

3,05 0,42 -

4,22 0,40 -

2,83 0,22 -

68

60 4.31 - 1. 3-(2-propynyloxy)-.24 Me 5 cm 20 cm Mu 5 cm 20 cm 0.17 0.12 5.28 69 . 1-(acetyloxy)(CAS) Acetol acetate 2-Propanone.5dimethoxyphenyl).89 9.79 0.58 13.55 0.15 3.74 16.25 0.67 6. ethyl ester (CAS) ETHYL 3-PROPARGYL Propanoic acid.95 10.66 0.74 0.Kajian Kimia Gaharu .28 5 cm Kt 20 cm 0.59 8.49 6.84 0.30 12.20 0. 5-Hydroxy2-methyl.19 0.15 4.99 0.(CAS) 5-hydroxy-2methyl-4H-pyran-4-one 2-Propanone.17 0.2-Benzenediol (CAS) Pyrocathecol 1.61 0.65 - - 0.62 10.66 0.66 0. 3-methyl(CAS) 3-methylpyrocathecol 0.27 0.03 - - 0.86 1.02 - 0.29 0.6.94 0.. METHYL Benzenepropanoic acid (CAS) Phenylpropionic acid 3.56 0. anhydride (CAS) Propionic anhydride Propanoic acid.87 0.66 2.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm Propanoic acid.3.20 1.20 9.7.38 0.2DIMETHYL-.50 4.14 0.44 - - 12.4A.28 8. ethenyl ester (CAS) vinyl propionate CYCLOPENTANEPROPANOIC ACID.95 6.46 1. 1-(4-hydroxy3-methoxyphenyl).49 - 0.(CAS) Acetovanillone 1.12 - 0.49 2.(CAS) Maltol 4H-Pyran-4-one. 1-(4-hydroxy-3.2.96 B.(CAS) Acetosyringone ACETOVANILLONE Ethanone. Komponen aromatis yang merupakan pyrolisis dari bagian kayu 4H-Pyran-4-one..8A-OCTAHYDRONAPHTHALENE Jumlah Rataan untuk kedua jarak suntik Bo 20 cm 0...18 0.5.26 0. 1-ACETYL-2.17 5.(CAS) Acetol Ethanone.4.17 0.30 8.04 3.83 0.5.58 3. 1-hydroxy.2-benzenediol. 3-Hydroxy-2methyl.57 0.8-HEXAHYDRO-2HCHROMENE 1.17 0.19 0.58 0.6.21 0.12 0.4.14 0.22 0.20 0.27 0.

07 - - - - - - 70 .18 0.5-Trimethoxybenzoic Benzoic acid.30 1.52 0.(CAS) o-Cresol Phenol. 2-methyl.92 0.40 20 cm 1.(CAS) p -Cresol Phenol.4. 2-methoxy. 4-ethyl-2-methoxy(CAS) p-Ethylguaiacol Phenol (CAS) Izal Jumlah Rataan untuk kedua jarak suntik 1.40 5 cm 1.39 13.39 0.57 2.52 11.82 0.34 11.06 0.35 1. 3.11 0.64 - 0.31 0.(CAS) 6-ETHYL-.54 12.28 Kt 20 cm 2.16 - - 0.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 3-Methoxy-pyrocathecol 4-METHYL CATHECOL Phenol.64 - 0.12 0.47 Mu 5 cm 1. 2-methoxy-4-propyl(CAS) 5-PROPYL-GUAIACOL Phenol.50 0.47 C.70 0.01 0.5-trimethoxy-. Komponen berkarakter odorant lainnya yang belum disebutkan sebagai konstituen gaharu Ascaridole 2H-Pyran-2-one.71 1.18 0.35 0.14 - 0. 4-methyl.08 0.35 11.23 0.19 0.14 0.27 1.14 0.24 - 0.23 Me 5 cm 1.VALEROLACTONE Oxacycloheptadec-8-en-2-one (CAS) Ambrettolide Oxacycloheptadecan-2-one (CAS) Dihydroambrettolide Benzoic acid.4.18 12.07 14.15 0.36 0. 4-ethenyl-.06 - - 0. 3-methoxy.11 1.82 0.37 0. methyl ester (CAS) 3.31 11.05 0.57 0.69 0.90 0.(CAS) m-Guaiacol Phenol.43 12. 6-ethyltetrahydro.13 0.19 0.87 11.45 2.22 0.43 1.37 Bo 20 cm 1.63 20 cm 1.DELTA.24 0.13 0.46 0. 4-(methylamino)Benzoic acid.(CAS) m-Cresol Phenol. methyl ester (CAS) METHYL 4-VINYLBENZOATE 2.18 1.40 0.(CAS) Guaiacol Phenol.82 0. 3-methyl.36 13.89 10.03 - 0.

2-methoxy-4-(2propenyl).7..20 71 .30 0.32 1.beta.(CAS) Eugenol 5-BUTYL-2-VALERYLFURAN 2(3H)-Furanone.55 Mu 5 cm 1.07 0.95 0. dimethylhydrazone (CAS) Cyclopentanone dimethylhydrazone Cyclopropyl carbinol Cyclopentanone (CAS) Dumasin 1-Eicosanol (CAS) n-Eicosanol TRANS-ISOELEMICIN Ethanone. 3-acetyldihydro.93 - 0..20 - 4.5.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm .33 - 6.. (E).45 0.17 1.76 0..Kajian Kimia Gaharu . cisCholestane-3.93 0.71 0.beta.04 - 0.28 1.-bisabolene 2-Butanone (CAS) Mehtyl ethyl ketone Butyric acid.23 20 cm 0.84 - 0. 1-(2.67 0.14 1. (3.22 - 0.66 20 cm 2. 2-methoxy-4-(1propenyl)-.53 0. 2-methoxy-4-(1propenyl).-Cyclocitral Cyclopentanone.78 Bo 20 cm 0.5-dihydroxyphenyl)(CAS) Quinacetophenone Phenol.45 1.25 1.99 - 4. m-nitrophenyl ester (CAS) m-Nitrophenyl butyrate Carveol.24 - 0.12 - 0.51 0.6.03 0..66 5 cm 0.61 - - - - - - - 0.09 Me 5 cm 1. beta.98 Kt 20 cm 0.(CAS) Isoeugenol Phenol.(CAS) 2.65 0..70 0.93 - 3.85 - - - - - 0.38 0.38 - 4.beta.31 - 0.33 - - 0.22 - - 1.).6.26 0.7-triol. dihydro-.98 1.61 - 4.(CAS) 2-acetylbutyrolactone 0.beta.42 4.alpha.(CAS) (E)isoeugenol Phenol. 3-methyl(CAS) Citraconic anhydride Citronellyl acetate .5-furandione..

55 0.60 0.26 - 0.54 - 0. delta.(CAS) 2-methylindole 6-Nitro-5-hydroxy-1.03 0.66 - 0.76 - 0.25 - - 0.02 - 72 .13 0.36 0. 3-methyl.39 0. 5.5-Dihydrodecanoic acid.HEXALACTONE 3.09 - - - - - - - 0.74 1.21 0. 1-methylethyl ester (CAS) Isopropyl hexanoate 3-Hexenoic acid 1H-Indole (CAS) Indole 1H-Indole.64 0.04 0.56 0.-lactone Muskolactone Bo 20 cm 5 cm 0.54 0.51 0.69 - 0. 5-methyl(identity?) (CAS) 2-Penten-4olide 2(3H)-Furanone.40 0.65 0.14 0. acetate (CAS) 2-HEPTYL ACETATE 2-Heptanone.56 0.31 - 0.09 - 0.54 - 0.21 0.70 - 0. 5-hexyldihydro.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm 2(5H)-Furanone.09 Mu 5 cm 20 cm - - - - - - 0.18 0.63 - 0.09 - 0.(CAS) 4-decanolide 2-Furancarboxaldehyde (CAS) Furfural 2-Furanmethanol (CAS) Furfuryl alcohol 2-Furanmethanol.65 - 0.5-dimethyl(CAS) 4.38 0. 2-methyl.18 Kt 20 cm Me 5 cm 20 cm 0.11 - 0.30 0.59 0.28 0.93 - - 0.03 0.(CAS) 3-Methyl-2-heptanone Hexanoic acid.31 0.23 0.GAMMA.71 0.98 0.4-Dimethylbut-2enolide 2(5H)-Furanone.35 - 0.2dimethylindole Indolizine (CAS) Indolizin Ionol 2 3-pentanone CAS) Diethyl ketone 1-Penten-3-one (CAS) Ethyl vinyl ketone .77 0.03 - 0.75 1.06 0.48 0. tetrahydro(CAS) Tetrahydrofurfuryl alcohol 2-Heptanol.

(CAS) 4-methyl-4-nonanol 2.45 3.3-Benzenediol.15 - 0. N-acetyl.6.6-TRIDEUTERIO-OMENTHONE Benzene..19 0.11 0. 1-(1-METHYLPENTYL)3-(2.3-Benzenediol.65 3.22 0.43 0.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm L-isoleucine. 1-methoxy-4-methyl(CAS) p-methylanisole NEROLIDOL ISOMER 4-Nonanol.13 0. 4-methyl. 5-methyl(CAS) Orcinol Benzaldehyde. 4-hydroxy3.50 - 0.47 0.13 0.Kajian Kimia Gaharu .7-dimethoxy-2-methylindan1-one Lineolone METHYL MALONIC ACID p-Menthane-2-one-1.58 0.19 Kt 20 cm 0.93 - 0.56 - 0.04 0.57 3.5-dimethoxy.42 0.29 - 0..57 0.5-DIHYDROXYNORBORNANE Piperidine. 9-TRIMETHYLSILYL 1.70 0.(CAS) 4-Ethylresorcinol 1.34 - 0.17 - 0.04 0.04 5 cm 0.5-DIMETHOXY-PHENYL)PROPIONIC ACID 3-PHENYL-PROPIONIC ACID ISOPROPYL ESTER 2-PROPYNOIC ACID 9H-Purine.(CAS) 6-METHYLPURINE.5-Norbornanediol (CAS) 2.(CAS) NITROSOPIPERIDINE PIPERIDINE.01 0.52 0.20 0.50 0.21 0.(CAS) Syringaldehyde Bo 20 cm 0.20 Me 5 cm 20 cm 0.3-d3 (CAS) 2.21 Mu 5 cm 0.(CAS) N-Acetyl-L-isoleucine 5. 6-methyl-9(trimethylsilyl).15 0.48 2. 1-nitroso.. 4-ethyl.3.40 0.52 0.86 - 0..89 0.89 2.58 73 .13 20 cm 0.50 5.21 0.

Furanone 2(3H)-Furanone.21 - - 0.(CAS) Homovanillic acid ISO-VELLERAL Benzenemethanol. 4-hydroxy-3-methoxy.96 0.(CAS) 6-HYDROXYCYCLO 2(5H)-FURANONE 2.alpha.(CAS) Veratryl alcohol 2-Butanone.52 Me 5 cm 0. 3.40 5 cm 0.39 1.3DIHYDROFURAN 2(3H)-Furanone.36 - 1.50 Kt 20 cm 0. 4-hydroxy-3methoxy.45 0.55 0. 1-(2-furanyl).97 0.(CAS) 2-Acetyfuran 2-ACETYL FURAN 2(3H)-Furanone (CAS) .72 0.11 0.13 - 1.06 - 0.4-dimethoxy(CAS) Vanillin methyl ether Benzaldehyde. hexahydro3-methylene.alpha.15 - 0.26 74 .23 - 0.17 - 2.4-dimethoxy.23 - - 0.63 - - - - - 0.(CAS) Zingerone Ethanone.02 - - - - - - - - 0.20 0.(CAS) 2-methoxymandelic acid Benzeneacetic acid.09 0.77 0.48 0. 4-(4-hydroxy3-methoxyphenyl).59 20 cm 0.12 0.13 0.45 - - - - - 0.14 0.70 - 1.28 - 2.11 0.52 Mu 5 cm 0.hydroxy-2-methoxy.(CAS) Vanillin Benzeneacetic acid.14 - 1.5-DIMETHYL-3(2H) FURANONE 2-ETHYL-4-HYDROXY-5METHYL-3(2H)FURANONE 2-HYDROXY-5-METHYL-2(5H)FURANONE 3-HYDROXY-5-METHYL-2(5H)FURANONE 0. 3. 5-methyl(CAS) 5-Methyl-2-oxo-2.38 Bo 20 cm 0.Aspek PRODUKSI Konsentrasi Relatif (%) Nama senyawa 5 cm (E)-2-hydroxy-4’phenylstilbene 1-TRICOSENE Benzaldehyde. .01 20 cm 0.61 0.32 - - - - - - - - 0.27 0.10 - 0.12 0.04 0.

80 2.18 0.(CAS) 4-allyl-2.6dimethoxyphenol 9H-Xanthen-9-one. 2. Zaika et al. (2002). Sheikholeslam & Weeks (1987).30 45.34 43.(Eka Novriyanti) Konsentrasi Relatif (%) Nama senyawa 5 cm 5-HYDROXYMETHYLDIHYDRO-FURAN-2-ONE HYDROXY DIMETHYL FURANONE 2-(Acetyloxy)-1-[2-(acetyloxy02-(3-furanyl)ethyl]-5a[(acetyloxy)methyl]hexah 2-Methoxy-4-methylphenol Phenol.83 43. Me = Mentawai. Baker et al.87 - 1. (2007).34 46. Kt = Kalimantan Tengah Tamiang Layang.30 - Me 5 cm 1. 75 ..13 0. Pedroso et al. (2008). Koeduka et al..57 19.33 26.33 50. Hua et al.65 5 cm - Kt 20 cm 1. Valentines et al.52 3.6-dimethoxy-4-(2propenyl).23 27.70 25.23 0.23 - - - - 0.06 2. Rho et al.. (2007).37 25. 1. (2008). The Good Scent Company (2008).(CAS) 6-O-METHYLXanthosine (CAS) Xanthine riboside Jumlah Rataan untuk kedua jarak suntik Total Rataan total untuk kedua jarak suntik Keterangan: Referensi: Bo 20 cm 1.65 46. International flavor and fragrance. Abrishami et al.17 2.10 52.05 3.93 22. (2004).14 44. Lynd-Shiveley (2004). (2008). Mu = maluku FAO (2008).32 37. Azah et al.19 45. Fotouhi et al.06 - - - 18.02 20 cm 1.81 - 2.33 0.71 21. (2001).31 17.86 18. (2004).. Inc (2008). (2005). (2002).3-dihydroxy-6-methoxy-8methyl. ChemYQ (2008).10 3. Rossi et al.56 Bo = Bahorok.06 Mu 5 cm 20 cm 1.Kajian Kimia Gaharu .29 26.48 49. Castro et al. (2006). Bunke & schatkowski (1997).12 24.95 2.01 44.95 0.62 0. Wikipedia encyclopedia Online (2008).

76 .

mulai dari bongkahan. aloeswood. jinkoh. Sitepu. Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu yang merupakan produk komersil bernilai ekonomis tinggi. Bentuk perdagangan gaharu beragam. perdagangan produk ini di Indonesia pertama kali tercatat pada abad ke-5 Masehi. Dalam perdagangan internasional. dan minyak gaharu (Surata dan Widnyana. di mana China dilaporkan sebagai pembeli utama. meskipun penggunaan produk ini sebenarnya tidak terbatas hanya pada bidang wewangian saja. komoditas ini dikenal dengan berbagai nama seperti agarwood. serbuk. oudh. kresna. gaharu bernilai jual tinggi terutama dari resin wanginya yang disebut sebagai ‘scent of God’. 77 . karas.3 TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU Erdy Santoso. chip. Najmulah. Ahmad Yani. Saat ini. dan masih banyak lagi nama lainnya. Ragil Setio Budi Irianto. Gaharu telah diperdagangkan sejak ratusan tahun lalu. 2001). Menurut Suhartono dan Mardiastuti (2002). Sugeng Santosa. Irnayuli R. sebenarnya merupakan endapan resin yang terakumulasi pada jaringan kayu sebagai reaksi pohon terhadap pelukaan atau infeksi penyakit. Komoditas berbentuk minyak biasanya diperoleh dari penyulingan atau ekstraksi chip gaharu dari kelas yang bermutu rendah. Maman Turjaman.

2004. Barden et al. anti mikrobia.. juga memiliki sifat anti racun. dan yang lainnya dapat memicu pembentukan gaharu. incense. mekanisme pembentukan dapat menyebar ke bagian lain pada pohon. pelukaan mekanis pada batang. pengaruh bahan-bahan kimia seperti metal jasmonat. In-cense gaharu digunakan dalam ritual kepercayaan dan upacara-upacara religius keagamaan. Gyrinops dan Aquilaria dalam Appendix II CITES. diare. gula merah. obat kuat pada masa kehamilan dan bersalin. Penelitian-penelitian ini terutama didorong oleh berbagai hal seperti pasokan komersil untuk gaharu yang masih sangat tergantung dari produksi alam yang karena tingginya intensitas pemungutan produk ini telah menyebabkan tercantumnya genus utama tanaman penghasil gaharu. 2000). hepatitis. Selain itu. Untuk menghasilkan gaharu secara artifisial. 2000.. seperti yang telah disebutkan sebelumnya tidak menyebabkan terjadinya penyebaran mekanisme pembentukan ini ke bagian lain dari pohon yang tidak terkena efek langsung faktor abiotik tersebut. ginjal. pemanfaatan gaharu adalah untuk pengobatan. sembahyang serta benda-benda rohani seperti rosario dan tasbih (Barden et al. diuretic. di mana selama proses tersebut berlangsung dihasilkan variasi mutu dan pada akhir proses dapat diperoleh gaharu dengan mutu paling tinggi (Sumadiwangsa dan Harbagung. tumor. malaria. Lain halnya jika pembentukan gaharu dipicu oleh faktor biotik seperti jamur atau jasad renik lainnya. 2002). Terbentuknya gaharu pada tanaman penghasilnya. tidak semua tanaman penghasilnya mengandung gaharu yang hanya terpicu pembentukannya jika terjadi kondisi cekaman. sebagai pengharum ruangan. Penelitian mengenai berbagai aspek yang terkait dengan gaharu sudah dilakukan sejak lama dan semakin berkembang dewasa ini. rematik. Sementara itu. dalam bidang pengobatan gaharu digunakan sebagai analgesik dan anti imflamatory (Trupti et al.. liver. 2000).Aspek PRODUKSI Pada prinsipnya. 2007) dan diketahui bermanfaat untuk mengatasi berbagai penyakit seperti sakit gigi. karena 78 . 1987. cacar. oli. terpicu oleh faktor biotik maupun abiotik.. stimulan kerja saraf dan pencernaan (Heyne. 2000). Suhartono dan Mardiastuti. asma. Proses pembentukan gaharu juga membutuhkan waktu yang lama. dan parfum (Barden et al. Namun pembentukan gaharu oleh faktor abiotik. Adelina. kanker.

Inokulasi jenis fungi Fusarium spp. Isolat-isolat yang diamati No 1 2 3 4 5 6 7 8 9 10 11 Kode Ga 1 Ga 2 Ga 3 Ga 4 Ga 5 Ga 6 Ga 7 Ga 8 Ga 9 Ga 10 Ga 11 Asal lokasi Kalimantan Tengah Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Sumatera Barat Gorontalo No 12 13 14 15 16 17 18 19 20 21 Kode Ga 12 Ga 13 Ga 14 Ga 15 Ga 16 Ga 17 Ga 18 Ga 19 Ga 20 Ga 21 Asal lokasi Lampung Bengkulu Bogor Mentawai Kaltim LK Kalbar Yanlapa NTB Kalsel MIC Kalteng TL Media yang digunakan untuk menambahkan fungi. yang telah menunjukkan adanya pembentukan gaharu secara alami.. Isolat fungi tersebut diperoleh dari batang Aquilaria spp.(Erdy Santoso. Kalimantan. BAHAN DAN METODE A. microcarpa 79 . pada A. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Bogor. microcarpa pada kegiatan ini bahan berupa pohon A. Tabel 1. NTB dan Sulawesi (Tabel 1). yaitu Potato Dekstrose Agar (PDA).Teknologi Induksi Pohon . Dengan terjadinya penyebaran pembentukan gaharu ke jaringan lain pada batang pohon. Maluku. dkk) penyebab mekanisme ini adalah mahluk yang melakukan semua aktivitas yang diperlukan untuk kehidupannya. Batang Aquilaria spp. diambil dari beberapa tanaman gaharu yang terdapat di Jawa.. yang diinokulasi di Laboratorium Mikrobiologi Hutan.. Sumatera.. maka kualitas dan kuantitas produk gaharu yang dihasilkan akan lebih memuaskan. Bahan Bahan yang digunakan pada kegiatan ini adalah 21 isolat Fusarium spp.

Identifikasi juga mengamati ciri makrokonidia. dan lain-lain. terdiri dari bor listrik. Sebelum penginjeksian. genset. isolat diletakkan pada gelas obyek yang kemudian ditutup dengan cover glass preparat. microcarpa di Hutan Penelitian Carita. Kalbar. yang diamati adalah ukuran diameter koloni. kemudian diinokulasi pada suhu kamar dan diletakkan di ruangan inokulasi selama tujuh hari. Jambi (13) dan Padang (14) serta campuran dari keempat isolat tersebut (15). Alat inokulasi. Rancangan acak lengkap dengan perlakuan daerah asal isolat (I). Inokulasi Pohon contoh adalah A. Metode Untuk identifikasi masing-masing koloni ditumbuhkan pada media PDA dalam cawan petri. B. Teknik Inokulasi 1. Jambi. mikrokonidia serta bentuk konidiofor.Aspek PRODUKSI umur 13 tahun. mata bor ukuran 3 mm. Untuk fungi pembentuk gaharu asal Gorontalo. asal Gorontalo (II). Kalimantan Barat (12). yang diamati adalah bentuk dan miselium. Masing-masing isolat diinokulasikan pada 3 ulangan. diamati juga warna koloni dan keberadaan aerial miselium. semua peralatan yang digunakan disterilkan terlebih dahulu dengan alkohol 70% untuk menghindari adanya kontaminasi dari mikrobamikroba lain. Pengeboran dilakukan 80 . Sediaan kultur diinkubasi selama tujuh hari. baik secara horizontal maupun vertikal. C. dan Padang (Sumatera Barat). Untuk pengamatan morfologi dilakukan melalui mikroskop parameter. diinkubasi dengan cara diletakkan pada ruang tertutup yang kelembabannya dijaga dengan cara memasukkan kapas yang telah dibasahi aquadesh steril. Inokulasi dilakukan pada semua pohon contoh. setelah itu koloni yang tumbuh pada gelas obyek diamati di bawah mikroskop setelah preparat diberi zat pewarna. yaitu Fusarium spp. Sediaan kultur dibuat dengan cara memindahkan potongan kecil isolat fungi menggunakan alat pelubang gabus berdiameter lima mm.

dkk) dengan kedalaman mencapai 1/3 diameter batang dengan tujuan inokulum cair nantinya mencapai kambium dan bagian floem kayu. microcarpa.. Pengambilan data dilakukan secara acak pada beberapa titik injeksi inokulasi dan nilai panjang infeksi merupakan rata-rata dari panjang titiktitik infeksi tersebut dalam satu pohon.. 1. HASIL DAN PEMBAHASAN A. Keragaman Isolat Fusarium spp. yang Berasal dari Berbagai Daerah Karakter morfologi aerial miselium. Keragaman Morfologi Isolat Fusarium spp. warna koloni dan diameter koloni isolat Fusarium spp. Inokulum Fusarium spp. Pengamatan dan Pengambilan Contoh Gaharu Pengamatan infeksi dilakukan pada umur inokulasi 2 bulan dan 6 bulan dengan mengukur panjang infeksi vertikal dan horizontal yang terjadi pada permukaaan batang A. Pengeboran batang pohon contoh (A) dan injeksi isolat pada lubang bor (B) B 2.(Erdy Santoso. yang berasal dari berbagai daerah sangat 81 .. Lubang injeksi dibiarkan terbuka untuk memberi kondisi aerasi bagi mikroba yang diinokulasikan. A Gambar 1.. cair selanjutnya diinjeksikan sebanyak 1 ml untuk setiap lubang bor di batang pohon.Teknologi Induksi Pohon .

++ Warna Medium PDA Putih.Aspek PRODUKSI beragam (Tabel 2).++ Ada. unggu Putih krem Putih.+++ Ada. disebabkan oleh perbedaan asal isolat.++ Tidak ada Ada. kuning muda Putih. kuning muda Putih Putih. Keragaman karakter morfologi Fusarium spp.+++ Ada. Tabel 2.++ Ada.++ Ada.+++ Ada.++ Ada. krem No. coklat muda Coklat muda Putih Putih Putih Putih krem Putih Putih krem. merah muda Putih Putih Coklet. Tabel 2. putih Putih. kuning. ++ Cukup banyak. yang berasal dari berbagai daerah Kode isolat Karakter morfologi Asal lokasi Diameter koloni mm/7 hari Kalteng Maluku Sukabumi Kalsel Kaltim Belitung Riau Bengkulu Jambi Padang Gorontalo Lampung Bangka Bogor Mentawai Kaltim LK Kalbar Yanlapa Mataram Kalsel MIC Kaltel TL 61 49 48 50 45 38 59 49 59 61 58 58 59 61 56 57 59 58 52 50 69 Aerial Miselium Ada. kuning muda Putih.++ Ada.++ Ada.+ Ada.+++ Ada. Keragaman morfologi Fusarium spp.++ Ada.+ Ada.+++ Ada. coklat muda Putih Putih kecoklatan Putih tulang. Keberadaan Aerial Miselium 82 .+++ Ada. Koloni pada 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 Kelimpahan relatif aerial miselium: + Sedikit.+ Ada.+++ Ada.++ Ada. +++ Banyak a.

beberapa isolat memiliki warna putih dan warna kuning muda pada isolat Ga-1.. Ga-11. 2006). Isolat Ga-1. Aerial miselium yang terbentuk dengan kelimpahan relatif banyak merupakan mekanisme fototropi terhadap kehadiran cahaya (Irawati. Irawati (2004) melaporkan bahwa secara umum cendawan yang ditumbuhkan pada kondisi terang secara terus-menerus akan membentuk aerial miselium relatif lebih banyak. dan Ga-20 memiliki warna koloni putih dan kuning muda. Walaupun sebagian besar isolat Fusarium spp. Hasil yang diperoleh menunjukkan bahwa warna koloni putih terdapat pada isolat Ga-4. Ga-13.Karakter aerial miselium terdapat hampir pada setiap isolat Fusarium spp. Ga-13. dan Gambar 4). Isolat ga-17 dan Ga-21 memiliki kemiripan warna koloni dengan isolat Fusarium yang berasal dari Riau yang telah teridentifikasi dan merupakan spesies Fusarium solani (Luciasih et al. cokelat muda (Ga-2). Ga-9. Selain warna putih. dan Ga-19 (Gambar 2. Warna Koloni Selain aerial miselium. putih krem (Ga-7. Ga-10. Ga-14. Ga-12. karena pada penelitian semua isolat yang diuji mendapat perlakuan cahaya yang sama. maka perbedaan kelimpahan aerial miselium adalah disebabkan oleh karakter masing-masing isolat. Ga-6. Ga-17. Ditemukan juga isolat yang memiliki warna koloni yang sangat berbeda dengan isolat lain. yaitu warna hifa miselium didominasi 83 . keragaman morfologi isolat Fusarium spp. b. 2004). Ga-10. Ga-6. Gambar 3. dan Ga-16 merupakan isolat dengan kelimpahan aerial miselium sedikit. Ga-5. namun terdapat perbedaan antar isolat jika dilihat berdasarkan kerlimpahan relatif aerial miseliumnya. adalah warna koloni. dan Ga17 memiliki kelimpahan aerial miselium relatif banyak (Tabel 2). Namun. Isolat Ga-10 dan Ga11 memiliki warna koloni putih dan warna cokelat muda (peach). Fusarium solani merupakan spesies yang kosmopolit dengan ciri khas kelimpahan mikrokonidianya elips. Ga-19. Isolat yang tidak memiliki aerial miselium dijumpai pada Ga-15 asal Mentawai. Ga8. sedangkan isolat Ga-3. Isolat Ga-18. dan Ga-21). memiliki aerial miselium.

yaitu diameter kurang dari 40 mm (isolat Ga-6). Ga-3. Ga-7. Ga-17. Ga-3. Semua isolat yang diuji dapat diklasifikasikan menjadi tiga kelompok.Aspek PRODUKSI oleh warna ungu namun memiliki warna koloni putih sedikit tipis pada aerial miselium yang terletak pada bagian tepi koloni (Gambar 3). Ga-11. Gambar 2. isolat dengan diameter antara 40-50 mm (isolat Ga-2. berhubungan dengan kecepatan tumbuh hifa. Keragaman yang terdapat pada warna koloni berhubungan dengan pigmen yang dikandung oleh dinding sel hifa. berkisar antara 30-69 mm. diperoleh adanya hubungan yang erat antara kecepatan tumbuh hifa dengan kehadiran aerial miselium. 2. Ga-4. Ga-18. Jumlah septa makrokonidia dominan berjumlah 2-3 yang dimiliki oleh isolat Ga-1. Ga-16. Ga-6. Ga-18. dan kelimpahan mikrokonidia. Ga-15. maka isolat perlu diuji. bentuk. dan Ga-21) (Tabel 2. Ga-5. Keragaman diameter koloni Fusarium spp. Ga-7. Keragaman Mikro dan Makrokonidia serta Konidiofor Isolat Fusarium spp. percabangan konidiofor. Untuk mengetahui kemampuan virulensi. Hasil pengamatan menunjukkan bahwa keragaman terlihat pada karakter jumlah septa makrokonidia. Gambar 3. Pada beberapa isolat Fusarium. Cendawan yang tidak berpigmen umumnya berwarna hialin. Ga-19. c. Fusarium spp. Ga-13. dari ke-10 isolat tersebut terdapat perbedaan pada 84 . Ga10. memiliki keragaman pada karakter morfologi juga tampak adanya keragaman karakter mikrokonidia dan makrokonidia dari isolat yang diuji. misalnya terhadap inangnya. Ga-20. kecepatan tumbuh merupakan karakter yang khas pada setiap isolat. Namun. Ga-5. Ga-8. Diameter Koloni Diameter koloni Fusarium spp. dan Ga-21. Ga-10. dan Ga-20). Diameter koloni merupakan veriebel yang berhubungan erat dengan kecepatan tumbuh. Ga-14. dan isolat dengan diameter lebih dari 50 mm (isolat Ga-1. Ga-12. Kecepatan tumbuh yang tinggi dapat berhubungan juga dengan kemampuan virulensi. Ga-8. dan Gambar 4). Ga-9. Selain itu.

Ga-11. Sedangkan isolat Ga-1. Keragaman morfologi Fusarium spp. Ga-6. Ga-13. Ga-15. Ga-2. Gambar 2.Teknologi Induksi Pohon . Ga-4. dkk) percabangan konidifornya.(Erdy Santoso. Keragaman morfologi Fusarium spp. Ga-8. dan Ga16) umur tujuh hari pada medium PDA. Ga-6.. GA-7. Ga-7. Isolat dengan konidiofor bercabang adalah Ga-18 dan Ga-21. Ga-12.. Ga-5.. dan Ga-10 memiliki konidiofor sederhana (Tabel 3). Ga-3. (isolat Ga-9. 85 . Ga-5.. dan Ga-8) umur tujuh hari pada medium PDA Gambar 3. (isolat Ga-1. Ga-3. Ga-14. Ga-10.

yang berasal dari berbagai daerah Karakter histologi No Kode Makrokonidia Jumlah septa 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Ga-1 Ga-2 Ga-3 Ga-4 Ga-5 Ga-6 Ga-7 Ga-8 Ga-9 Ga-10 Ga-11 Ga-12 Ga-13 Ga-14 Ga-15 Ga-16 Ga-17 Ga-18 Ga-19 Ga-20 Ga-21 3 4 3 4-7 2 3 2 2 5 3 4 5 4 7 4 7 5 3 4 2 3 Konidiofor Simpel Bercabang Simpel Simpel Simpel Simpel Simpel Simpel Simpel Simpel Bercabang Simpel Simpel Simpel Bercabang Simpel Bercabang Bercabang Simpel Bercabang Bercabang Mikrokonidia Kelimpahan Banyak Banyak Banyak Banyak Sedikit Sedikit Sedikit Sedikit Sedikit Banyak Banyak Banyak Sedikit Sedikit Banyak Sedikit Sedikit Banyak Banyak Sedikit Banyak Bentuk Elips Elips. oval Elips Isolat Ga-2. (isolat Ga-17. sekat Elips Elips Elips Elips Elips Elips. dan Ga-15 memiliki jumlah septa empat. Keragaman karakter makrokonidia Fusarium spp. Ga-3. dan Ga-21) umur tujuh hari pada medium PDA Tabel 3. oval Elips Elips. oval Elips. oval Elips.Aspek PRODUKSI Gambar 4. Ga-20. Keragaman morfologi Fusarium spp. Ga-19. sekat 3 Elips Elips Elips Elips. Ga-18. oval Elips Elips. namun dari ke-3 isolat tersebut dapat dibedakan berdasarkan 86 . sekat Elips. lonjong Elips.

solani dengan mikrokonidianya berbentuk elips.. Mikrokonidia pada berbagai Fusarium memiliki bentuk yang khas. Luciasih et al. Ga-7. namun Booth (1971) membedakan Cylindrocarpon karena karakter pangkal konidianya yang relatif tumpul dan tidak memiliki hock/foot cell yang jelas seperti pada Fusarium spp. Ga-14. sambunicum (isolat Ga-1). Ga-3. tricinctum berdasarkan karakter bentuk makrokonidianya. Dua dari tiga isolat tersebut. juga bentuk mikrokonidianya relatif lebih besar untuk F. dan Ga-16 merupakan isolat yang memiliki jumlah septa makrokonidia relatif banyak. yaitu isolat Ga-12 dan Ga-14 memiliki kemiripan pada bentuk konidiofor dan bentuk mikrokonidia. Genus Fusarium memiliki kemiripan dengan Cylindrocarpon pada karakter morfologi. (2006) melaporkan bahwa keragaman antar Fusarium spp. solani dibedakan dari F. antara lain berdasarkan karakter kelimpahan dan bentuk mikrokonidianya.. dan F. Cowan (1999) menerangkan bahwa tanaman memiliki kemampuan yang tidak terbatas dalam mensintesis substansi 87 . dan Ga-5). solani keberadaannya paling dominan sehingga perlu mendapat perhatian khusus. namun kedua isolat tersebut berbeda pada tipe makrokonidianya. solani (isolat Ga-4. Isolat Ga-14 berbeda dengan isolat Ga-16 karena pada isolat Ga-16 mikrokonidianya bersekat (Gambar 7). dan Ga9). Spesies tersebut merupakan F. Ga-6. Di antara ketiga spesies tersebut F.(Erdy Santoso. bentuk mikrokonidianya elips dan oval. dari 21 isolat Fusarium spp...Teknologi Induksi Pohon . yaitu berbentuk bulan sabit (fusoid) sehingga memungkinkan dapat dengan mudah dibedakan dengan genus lain yang memiliki ciri mirip Fusarium. Sedangkan F. Isolat Ga-12. Isolat Ga-13 memiliki bentuk konidifor simpel dan Ga-15 bentuk konidifornya bercabang. Isolat Ga-2 memiliki konidifor bercabang. sambunicum.. Ga-8. F. Isolat Ga-12 memiliki ukuran relatif lebih besar pada makrokonidianya apabila dibandingkan dengan Ga-14 (Gambar 5 dan Gambar 6). beberapa isolat telah teridentifikasi sampai pada tingkat spesies. tricinctum (isolat Ga-2. Fusarium solani berbeda dengan F. yaitu berkisar 5-7 (Tabel 3). dkk) percabangan konidifor dan bentuk mikrokonidianya.

Ga-20. dan Ga-18) dengan perbesaran 40x 88 . Ga-5. (isolat Ga-4. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. Ga8. Ga-14. Ga-11. dan Ga-21) dengan perbesaran 40x Gambar 6. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp. Pada umumnya senyawa-senyawa tersebut merupakan metabolit sekunder yang seringkali berperan dalam mekanisme pertahanan tanaman terhadap serangan mikroorganisme. (isolat Ga-1. Gambar 5. GA-10. Ga-17. Ga. serangga ataupun herbivora. Ga12.2. GA-7.Aspek PRODUKSI aromatis yang kebanyakan merupakan senyawa fenol atau turunan oksigen-tersubstitusinya. Ga-9. Ga-15.

Biosintesis keduanya terpicu pada level gen (Verpoorte et al.. Vidhyasekaran. Terdapat jalur biosintesis yang terpicu pada level gen setelah pelukaan atau infeksi dan ada yang terjadi pada level senyawa. Ga-13. baik fitoantisipin maupun fitoaleksin. ekspresi dari jalur biosintesis yang terlibat akan berbeda. (isolat Ga-3. 2004). Pohon penghasil gaharu sehat tidak pernah memproduksi sesquiterpenoid sebagai metabolit sekunder yang beraroma harum (Yuan dalam Isnaini. di antaranya sebagai minyak esensial (monoterpenoid). kadangkala terpicu pengaktifannya saat pelukaan.. fitoaleksin sebagai agen anti mikrobial (sesqui-. sedangkan pada tanaman lain biosintesis sesquiterpenoid 89 . dan triterpena). Tanaman dapat mensintesis dan mengakumulasi metabolit sekunder sebagai respon terhadap infeksi oleh agen tertentu. Fitoaleksin adalah senyawa aktif anti mikrobial yang diproduksi secara de novo setelah pelukaan atau infeksi. Fitoantisipin adalah senyawa aktif anti mikrobial yang telah terdapat pada tanaman. Ga-6. dan Ga-19) dengan per-besaran 40x Gaharu merupakan senyawa fitoaleksin dari pohon gaharu sebagai mekanisme pertahanannya terhadap infeksi patogen. Metabolit sekunder dalam sistem pertahanan tanaman. Ga-16.Teknologi Induksi Pohon . Sebagai contoh. 2000). 2000). di-. rangsangan fisiologi maupun keadaan cekaman (Goodman et al. Metabolit sekunder tanaman yang diturunkan dari terpenoid memiliki berbagai fungsi dalam tanaman. atraktan serangga. Berdasarkan berbagai fungsi tersebut. memainkan peranan penting (Verpoorte et al.. dkk) Gambar 7. biosintesis sesquiterpena tertentu pada solanaceae terpicu oleh infeksi mikroba.. di mana senyawa yang telah ada secara enzimatis dirubah menjadi senyawa aktif ketika pelukaan.. 2004)..(Erdy Santoso. 2000. Kayu beresin ini merupakan metabolit sekunder yang dibentuk tanaman sebagai respon pertahanan. dalam Isnaini. Keragaman makrokonidia (a) dan mikrokonidia (b) Fusarium spp.

Jenis-jenis tropis dan sub-tropis umumnya mengandung jumlah ekstratif yang lebih banyak dibanding jenis-jenis di daerah temperet (Forestry Comission GIFNFC. antar pohon dalam spesies yang sama. akar. Konsentrasi metabolit sekunder bervariasi antar spesies. Zat ekstratif yang terdiri dari bermacam-macam bahan ini memilki fungsi yang penting dalam daya tahan terhadap serangan jamur dan serangga. pangkal percabangan. B. anthraquinone biasa ditemukan di seluruh bagian tanaman (Verpoorte. senyawa pertahanan tipe fitoaleksin. kayu teras. Gaharu sendiri telah diidentifikasi sebagai sesquiterpenoid. Kerentanan pohon dalam menghadapi infeksi jamur akan berkaitan dengan 90 . Metabolit sekunder pada kayu dapat disebut sebagai zat ekstratif. memberi bau. pohon penghasil gaharu akan memberi respon untuk mempertahankan dan memulihkan dirinya. Analisis Infeksi Batang Dalam kondisi menghadapi infeksi oleh jamur. sehingga dihasilkan produk gaharu yang diinginkan. Zat ekstratif pada kayu teras dapat menjadi pertahanan pohon terhadap agen perusak meskipun pengaruhnya sangat bervariasi pada berbagai habitat (Hills. karena analog dengan komponen vital tertentu dari sistem sinyal seluler atau dapat terlibat dengan enzim vital dan memblokir jalur metabolisme (Forestry Comission GIFNFC. 2000). rasa. antar jaringan (konsentrasi tertinggi berada di kulit. 1987). dan jaringan luka). antar spesies. Senyawa kimia yang dimiliki pohon merupakan salah satu upaya pertahanan pohon terhadap mikroorganisme penyebab penyakit. Metabolit sekunder tanaman efektif dalam melawan hama dan agen penyakit. Daya tahan pohon akan menentukan pemenang antara pohon dengan penyakit yang disebabkan mikro-organisme tersebut. dan warna pada kayu. 2007). dan antar musim. misalnya pada Morinda citrifolia.Aspek PRODUKSI merupakan ekspresi pembentukan yang umum. 2007). Rowell (1984) menyatakan bahwa di antara fungsi zat ekstratif adalah sebagai bagian dari mekanisme sistem pertahanan pohon terhadap serangan mikroorganisme. Dalam hal pembentukan gaharu tentunya diharapkan penyakitlah yang akan menang.

223a terhadap infeksi yang terbentuk pada Kalimantan Barat batang A.857a lagi memberikan pengaruh nyata Jambi 2. isolat campuran menyebabkan infeksi yang lebih tinggi dibandingkan Asal isolat Rataan isolat yang lain (Gambar 8). microcarpa pada umur inokulasi 2 bulan dan 6 bulan. pada umur inokulasi 6 umur inokulasi bulan.05 dan campuran. dapat direfleksikan masing-masing oleh besar infeksi dan komponen kimianya. microcarpa..Teknologi Induksi Pohon . Dari hasil analisis sidik ragam.(Erdy Santoso. Pada saat (Isolate origin) (Mean value) ini. microcarpa... secara statistik asal isolat tidak 1. dkk) gaharu yang terbentuk. terlihat bahwa asal isolat berpengaruh nyata terhadap panjang infeksi yang terjadi pada batang A. dari Gambar 8 Gorontalo 4.297a halnya dengan kondisi pada umur Campuran 3.13 cm diikuti oleh isolat campuran. Padang.133a terlihat bahwa infeksi tertinggi masih Keterangan: Nilai yang diikuti oleh huruf yang disebabkan oleh isolat asal Gorontalo sama tidak berbeda nya-ta pada 0. Kalbar. 91 . diikuti oleh isolat campuran (Tabel 4). isolat asal Gorontalo menyebabkan infeksi yang paling besar pada batang pohon penghasil gaharu. yaitu 4. Hasil uji lanjut Duncan memastikan bahwa pada dua bulan sejak inokulasi. Berbeda dengan kondisi pada Tabel 4. Pada umur inokulasi 2 bulan isolat Fusarium spp. Uji lanjut Duncan untuk infeksi 2 bulan umur 2 bulan. Pada Gambar 8 terlihat panjang infeksi yang terjadi pada batang pohon A. Namun sama Padang 2.193a inokulasi 2 bulan.. dan yang terendah adalah infeksi yang terbentuk oleh isolat asal Jambi. asal Gorontalo memperlihatkan nilai infeksi yang paling besar.

Namun sama halnya dengan kondisi pada umur inokulasi 2 bulan. Meskipun terjadi 9 menunjukkan perubahan panjang infeksi yang terjadi sejak masihbulan inokulasi hingga bulan keenam. tetapitidak mengalami perkembangan. Namun begitu. dari Gambar 8 Aspek PRODUKSI terlihat bahwa infeksi tertinggi masih disebabkan oleh isolat asal Gorontalo dan campuran. tetapi infeksi bulan keenam oleh isolat asal Gorontalo terlihat infeksi merupakan isolat yang menyebabkan infeksi terbesar. Meskipun masih dua merupakan isolat yang menyebabkan infeksi terbesar. microcarpa Gambar 8. Laju infeksi pada batang A. Panjang infeksi batang A.05 crocarpa. huruf yang sama tidak berbeda nya- Gambar 8.bentuk pada batang A. microcarpa Gambar sejak dua bulan inokulasi hingga bulan keenam. asal daerah isolat tidak memberikan pengaruh nyata pada laju infeksi yang terjadi (nilai signifikansi 0. Panjang infeksi batang A. mita pada 0. secara statistik untuk bulan keenam inokulasi. microcarpa 92 . Gambar 9 menunjukkan perubahan panjang infeksi yang Gambar 9. Gorontalo terlihat tidak mengalami bulan keenam oleh isolat asal sedangkan infeksi oleh keempat asal perkembangan.186 pada 5%). sedangkan infeksi oleh keempat asal isolat yang 71 | lain menunjukkan peningkatan yang beragam.

Secara morfologi isolat Fusarium spp. 4. Ga-11. namun terdapat warna koloni merah muda. yang berarti isolat ini menghasilkan kuantitas gaharu yang paling besar. namun ada kemungkinan hal ini masih merupakan pengaruh dari isolat asal Gorontalo tersebut.Teknologi Induksi Pohon . Meskipun isolat campuran menunjukkan panjang infeksi yang lebih tinggi saat 6 bulan setelah inokulasi.. jadi sebaiknya isolat ini digunakan untuk inokulasi 93 . dan Ga-17 merupakan isolat yang memiliki kecepatan tumbuh tinggi apabila dibandingkan dengan isolat Fusarium yang lain.. didominasi warna putih. kuning. Hal ini diduga ada kaitannya dengan pertahanan masing-masing pohon contoh. KESIMPULAN 1. Meskipun tetap menyebabkan infeksi yang besar. Hampir semua isolat memiliki aerial miselium. Secara histologi isolat Fusarium spp. microcarpa ini dapat dikatakan bahwa isolat asal Gorontalo menyebabkan infeksi yang terbesar. kekonsistenan perkembangan infeksi sebaiknya diteliti lebih lanjut dengan mengikuti perkembangan laju infeksi oleh isolat asal Gorontalo ini hingga kurun waktu tertentu. meskipun yang terbesar masih disebabkan oleh isolat campuran dan isolat asal Gorontalo. 3. Hasil inokulasi Fusarium spp. Uji perbedaan kecepatan tumbuh menunjukkan bahwa isolat Ga9.. 2. Isolat Fusarium spp.(Erdy Santoso. pada batang Aquilaria microcarpa dapat dianalisis kuantitas dan kualitasnya melalui pendekatan besaran infeksi dan komponen kimia yang dapat dianggap masing-masing sebagai refleksi kuantitas dan kualitas gaharu yang terbentuk. dkk) Perkembangan infeksi yang terjadi hingga 6 bulan setelah inokulasi menunjukkan asal daerah isolat tidak lagi memberikan pengaruh yang nyata. Dari perkembangan infeksi pada pohon A. dan ungu. asal Gorontalo menyebabkan infeksi yang paling besar.. memiliki karakter makrokonidia bersepta 3-4 dan makrokonidia didominasi oleh bentuk elips.

Bogor Luciasih. Jilid III. 6-7. 1984. Hua SST. Badan Litbang Kehutanan. (England : Commonwealth Mycological Institute). microcarpa jika diinginkan hasil gaharu dalam jumlah besar. (1971). A. Inhibitory Effect of Acetosyringone on Two Aflatoxin Biosynthetic Genes. pp. Tumbuhan Berguna Indonesia. Induksi Produksi Gubal Gaharu Melalui Inokulasi Cendawan dan Aplikasi Faktor Biotik.cfm. Jurnal Penelitian Hutan dan Konservasi Alam III(5):555-564. Hills. pp. Bogor. (1987). W. http: // treechemicals. dan E. Irawati. Jakarta. pp. Booth. N. Applied Microbiology 32 : 278-281. Heart of The Matter Agarwood Use and Trade and CITES Implementation for Aquilaria malaccensis. Isnaini. 2006. Rm. Nooranie. Forestry Commission GIFNFC. Heyne. www. Santoso. Rowell. 1999. Forest and Landscape Denmark. 2001. Plant Products as Antimicrobial Agents.A. Y. 2004. A. Pusat Litbang Hutan dan Konservasi Alam. DAFTAR PUSTAKA Adelina. Cowan. csl..SL. 1987. A. 120-127. C. 94 . M.Aspek PRODUKSI pada A. Disertasi). D. Washington : American Chemical Society. gov. Clinical microbiology Review. [14 Juli 2007].12 (4) : 564-582. and S. 2004. 267-269. 2004. E. Seed Leaflet : Aquilaria malaccensis Lamk.. Heartwood and Tree Exudates. Teresia. Michael (2000). Karakterisasi Mikoriza Rhizocstonia dari Perakaran Tanaman Vanili Sehat. Barden. Wahyuno. Chemicals from Trees. [2 Februari 2007].uk/review/extraction. pp. M. Program Pascasarjana Institut Pertanian Bogor. Tesis. TRAFFIC Network. K. Magelang. Berlin : SpringerVerlag. The Chemistry of Solid Wood.dk. The Genus Cylondrocarpon. Keanekaragaman Jenis Jamur yang Potensial dalam Pembentukan Gaharu dari Batang Aquilaria spp. 2. 2007.kvl.

Pusat Penelitian Hasil Hutan. P. and Alfermann. C. Somani. Physiology of Disease Resistant in Plant.Teknologi Induksi Pohon . In Verpoorte. Y. Kain. 2000. Bhutada.. J. (Editors). K. Metabolic Engineering of Plant Secondary Metabolism. Miniyar. Info Hasil Hutan 6 (1) : 1-16. E. CITES and Implementation in Indonesia. Jakarta. A. K. Boston. W. In : Verpoorte. dkk) Soehartono. R van der Heijden. R. and Alfermann. Florida. Kluwer Academic Publisher. Aisuli 14. Pharmacology-online 1 : 288-298. Laju Pertumbuhan Tegakan Gaharu (Aquilaria malaccensis) di Riau yang Ditanam dengan Intensitas Budidaya Tinggi dan Manual. R. Surata. Widnyana. Gore. General Strategies. Plant Secondary Metabolism.. I M. Dordrecht. (Editors). P. Teknik Budidaya Gaharu. Bogor. Nagao Natural Environment Foundation. Boston. Metabolic Engineering of Plant Secondary Metabolism. 95 . 2001. p : 1-30. 2002. Boca Raton. A. Analgesik and AntiImflamatoryactivity of Heartwood of Aquilaria agallocha in Laboratory Animal.. Vidhyasekaran. 2007. p : 31-50.. dan Harbagung. Memelink. W.. Nandakumar. R. Dordrecht. Kluwer Academic Publisher. CRC Press Inc... Verpoorte. 2000.. Mardiastuti. Balai Penelitian Kehutanan Kupang. 2000. London. P. R. 2000. London. T. S. R. Mundhada. A. Sumadiwangsa. I K. Trupti.(Erdy Santoso. Verpoorte. S.

96 .

Thymelaeaceae). Beberapa spesies Fusarium seperti F. Menurut Nobuchi dan Siripatanadilok (1991).. hingga saat ini masih terus diteliti. lateritium telah berhasil diisolasi oleh Santoso (1996). DAN Fusarium sp. DALAM PEMBENTUKAN GUBAL GAHARU PADA Aquilaria microcarpa Gayuh Rahayu Departemen Biologi. asal gubal gaharu pada Gyrinops verstegii (sin. Institut Pertanian Bogor Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Esti Wulandari Departemen Biologi. gubal gaharu diduga dapat terbentuk melalui infeksi cendawan. A. FMIPA. Rahayu et al. oxyporum. FMIPA. A. F. Institut Pertanian Bogor LATAR BALAKANG Gaharu merupakan salah satu komoditi hasil hutan bukan kayu (HHBK) yang dihasilkan oleh beberapa spesies pohon gaharu (Aquilaria sp. dan F. crassna. filaria) dan A.4 EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp. microcarpa) umur 97 . Magnoliopsida. bulbigenium. Selain itu. malaccensis mampu menginduksi gejala pembentukan gubal pada pohon gaharu (A. (1999) menyatakan bahwa beberapa isolat Acremonium sp. Proses pembentukan gubal pada pohon gaharu. A. malaccensis.

Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam). Oleh sebab itu penelitian ini bertujuan untuk mengetahui efektivitas dan interaksi antara Acremonium sp. Oleh sebab itu. larutan gula 2%. terdeteksi senyawa oleoresin (Prema dan Bhattacharyya. yang berasal dari Aquilaria sp. IPBCC 07. BAHAN DAN METODE A. Acremonium sp. merangsang perubahan warna kayu dan pembentukan senyawa terpenoid. dan Fusarium sp. Banten.sp. microcarpa umur 13 tahun di Hutan Penelitian Carita. dan Acremonium sp. (1995) juga menemukan proses SAR dari infeksi Pseudomonas lachrymans pada timun terhadap F. (1997). dalam pembentukan gubal pada pohon gaharu (A. Liu et al. Sebagai contoh. 1962). (2007) dan Rahayu (2008) juga menyatakan bahwa Acremonium sp. biakan Acremonium sp. Departemen Biologi FMIPA IPB). Padang (koleksi Laboratorium Mikrobiologi Hutan. oxysporum f. hasil induksi cendawan. Padahal menurut Sticher et al. pada beberapa kasus infeksi cendawan pada tumbuhan. Mekanisme infeksi kedua cendawan ini pada satu lokasi infeksi belum dipelajari. dan sebaliknya. 98 .Aspek PRODUKSI 2 tahun. infeksi cendawan yang pertama dapat membangkitkan resistensi yang disebut Systemic Acquired Resistance (SAR) terhadap infeksi cendawan kedua. seringkali diperoleh dari satu gejala gubal. melalui pemanfaatan kedua cendawan tersebut sebagai penginduksi ganda memerlukan informasi awal mengenai kemungkinan terbentuknya SAR yang dibangkitkan oleh Fusarium sp. Pada gubal gaharu. microcarpa). terhadap Fusarium sp.525 (koleksi IPBCC. cucumerinum dapat membangkitkan SAR tanaman semangka terhadap infeksi Colletotrichum lagenarium. perubahan warna kayu dan adanya senyawa terpenoid dijadikan indikator efektivitas dan interaksi antara inokulan dalam pembentukan gubal. Caruso dan Kuc (1977) menyatakan bahwa infeksi F. Bahan Bahan dan alat yang digunakan adalah pohon A. dan Fusarium sp. oxysporum. terhadap Acremonium sp. Rahayu et al. Infeksi ganda Fusarium sp.

pohon dilubangi lagi pada jarak 15 cm secara vertikal dari deretan lubang yang pertama. Jarak antar set perlakuan dalam 1 pohon ± 30 cm. dan alat pencetaknya. meteran. saja (AA) atau Fusarium sp. diremajakan pada media agaragar kentang dekstrosa (Difco) dan diinkubasi pada suhu ruang selama 7 hari. B. Pembuatan Inokulan Acremonium sp. kemudian dibentuk berupa pelet dengan ukuran 4 mm x 40 mm. 2. ditumbuhkan pada 300 ml media cair. Fusarium sp. mata bor berukuran 4 mm. dan Fusarium sp. serta batang dengan perlakuan tunggal (diberi Acremonium sp. Pertama-tama. batang yang dilubangi dan diberi larutan gula (G). bahan pelet. Biakan ini akan digunakan sebagai sumber inokulum untuk pembuatan inokulan. aquades. kemudian zona perubahan warna batang diukur secara horizontal 99 . Uji Efektivitas dan Interaksi Acremonium sp. dan Fusarium sp. Ke dalam lubang pada deretan kedua ini dimasukkan inokulan 2. Efektivitas dan interaksi diukur melalui perkembangan pembentukan gejala gubal di sekitar daerah induksi. Acremonium sp. dan diinkubasi selama 3 minggu menggunakan inkubator bergoyang. yang dilubangi saja (B). bor. lubang diberi larutan gula 2% sebelum pemberian inokulan. Ke dalam deretan lubang ini dimasukkan inokulan 1 sampai lubang dipenuhi oleh inokulan. Jarak antar lubang dalam deretan sekitar 5 cm. saja (FF)) digunakan sebagai pembanding. Pengamatan dilakukan setiap 1 bulan selama 4 bulan. Metode 1. Untuk inokulan berupa pelet. Batang yang tidak diberi perlakuan (K).alkohol. Pasangan inokulan (FA atau AF) adalah set perlakuan. Seminggu kemudian. dengan kedalaman lubang maksimal 1/3 diameter batang. Batang di sekitar lubang dikupas kulitnya. sederetan lubang dibuat di sekeliling batang utama (mulai ketinggian 0. ditumbuhkan pada media serbuk gergaji selama 2 minggu.5-1 m di atas permukaan tanah) dengan mata bor berdiameter 4 mm. Perubahan warna batang dan pembentukan wangi merupakan indikator pembentukan gubal.

Deteksi Senyawa Terpenoid Senyawa terpenoid dideteksi dengan metode LiebermanBurchard (Harborne. dihomogenisasi lalu dipindahkan ke tabung reaksi steril. Tingkat wangi dinyatakan dalam rataan skor dari 3 responden. Kayu di sekitar titik inokulasi dipahat. Daerah yang menunjukkan perubahan warna kayu dari putih menjadi coklat-kehitaman diambil dengan dipahat dan dibawa ke laboratorium untuk pengamatan selanjutnya. dan tingkat wangi) dianalisis dengan SAS versi 9. kemudian disaring pada cawan petri steril dan diuapkan sampai kering (sampai terbentuk endapan berwarna kuning). Pada endapan ditambahkan 1 ml dietil eter pekat. Wangi dinyatakan dalam tingkat wangi dan persentase titik induksi dengan kategori agak wangi dan sangat wangi. 1987). 2 = wangi). 2 = coklat. 1 = agak wangi. Perubahan warna diamati pada 10 titik untuk setiap pohon. ditambahkan 3 tetes asam asetat anhidrat dan 1 tetes H2SO4 pekat. tingkat perubahan warna. Wangi ditetapkan berdasarkan sistem skor (0 = tidak wangi. lebar zona perubahan warna. Tingkat perubahan warna kayu dinyatakan dalam rataan dari hasil pengamatan 3 responden. 4. Perubahan warna menjadi merah atau ungu menunjukkan adanya senyawa triterpenoid (Harbone.4 g kayu yang berubah warna direndam dalam 5 ml etanol absolut panas. kemudian diamati wanginya secara organoleptik ketika kayu dibakar. 1987). Setelah diamati tingkat wanginya. Sebanyak 0. kemudian absorbansinya diukur dengan spektrofotometer pada λ 268 nm. Sebanyak 5 ml etanol absolut ditambahkan ke dalam larutan.Aspek PRODUKSI dan vertikal. Analisis Data Data hasil pengamatan (panjang. sampelsampel dari kayu yang mengalami perubahan warna dipisahkan dari bagian yang sehat. Bila terdapat pengaruh nyata dari perlakuan yang diamati maka setiap taraf perlakuan 100 .1 menggunakan Rancangan Acak Lengkap (RAL) satu faktor dengan waktu dan uji F pada α = 5%. 3 = coklat kehitaman). 1 = putih kecoklatan. 3. Tingkat perubahan warna kayu ditetapkan berdasarkan sistem skor (0 = putih.

.00 6.30a Lebar (cm) 0.(Gayu Rahayu.82a 0. Sedangkan pada parameter lainnya. AF justru lebih baik.94a 0..12 Titik induksi wangi (%) 1.18a Wangi (skor) Titik induksi agak wangi (%) 34. Tabel 1.Efektivitas dan Interaksi .45c 1.75b 2. Efektivitas inokulan tunggal maupun ganda Acremonium dan Fusarium relatif lebih tinggi dalam merangsang pembentukan gejala gubal gaharu dibandingkan dengan metode induksi lainnya. Berdasarkan persentase titik induksi pada kategori wangi. Pemberian gula menyebabkan gejala pembentukan gubal gaharu menjadi tertekan. Sebagai inokulan tunggal A dan F memiliki efektivitas yang relatif sama.54ab 3.16 0. HASIL A.63ab 0.59ab 101 .62ab 0.) dibandingkan dengan menggunakan uji lanjut Duncan pada taraf 5%.14a 3. dkk.87a 0.07 39.37 31. inokulan ganda lebih efektif.24 4.39 0. Di antara inokulan ganda.70a 0.83a Warna (skor) 1.55 20.20a 3. Pembentukan gejala gubal gaharu hasil inokulasi cendawan tunggal dan ganda Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Inokulan tunggal Inokulan ganda AA FF AF FA 2. Gejala pembentukan gubal akibat inokulan ganda juga cenderung tidak berbeda nyata dari inokulan tunggalnya. Efektivitas Inokulan dalam Menginduksi Gejala Pembentukan Gubal Gaharu Secara umum semua perlakuan menyebabkan perubahan warna kayu dan merangsang munculnya perubahan aroma kayu (Tabel 1).. AF lebih efektif dalam menginduksi pembentukan wangi daripada FA dan inokulan tunggal.90b 1..

Aspek PRODUKSI

Rataan* Perubahan warna kayu Perlakuan Panjang (cm) Kontrol positif Kontrol negatif
*

Lebar (cm) 0,55b 0,73ab 0,00c

Warna (skor) 1,02d 1,16d 0,00e

Wangi (skor)

Titik induksi agak wangi (%) 10,41 11,11 0,00

Titik induksi wangi (%) 0,00 0,00 0,00

G B K

1,86b 2,87ab 0,00c

0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Kayu mengalami perubahan warna dari putih menjadi coklat atau coklat kehitaman (Gambar 1). Pemberian inokulan tidak berpengaruh pada panjang dan lebar zona perubahan warna. Namun panjang zona perubahan warna tertinggi terjadi berturut-turut pada kayu yang diberi perlakuan ganda FA dan AF. Sedangkan tingkat perubahan warna dipengaruhi oleh inokulan. Tingkat perubahan warna tertinggi pada FA dan berbeda nyata dari perlakuan lainnya.

Pemberian inokulan juga tidak berpengaruh nyata terhadap pembentukan wangi. Berbeda dengan perubahan warna kayu, tingkat wangi tertinggi terjadi pada kayu yang diberi inokulan ganda AF. Secara rataan nilai tingkat wangi yang terbentuk dari hasil perlakuan inokulan termasuk dalam kategori tidak wangi, Meskipun demikian, pemberian inokulan meningkatkan persentase titik induksi yang wangi. Bahkan inokulan tunggal AA dan inokulan ganda menghasilkan titik induksi pada kategori wangi (Tabel 1).

a

b

c

d

Gambar 1. Perubahan warna kayu dengan tingkat kegelapan yang berbeda dari (a) intensitas terendah sampai (d) intensitas tertinggi

102

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Periode induksi berpengaruh pada semua parameter pembentukan gubal kecuali panjang zona perubahan warna (Tabel 2). Secara umum, nilai parameter pembentukan gubal tertinggi terjadi pada bulan ke-2, kecuali tingkat perubahan warna. Pada bulan ke-2 induksi, intensitas warna cenderung naik, tapi intensitas warna kayu pada bulan ke-4 relatif sama dengan bulan ke-3.
Tabel 2. Pengaruh periode induksi pada gejala pembentukan gubal gaharu
Rataan* Perubahan warna kayu Bulan Panjang (cm) 1 2 3 4
*

Lebar (cm) 0,68a 0,71a 0,65b 0,65b

Tingkat (skor) 0,83c 1,24b 1,67a 1,65a

Wangi (skor)

Titik induksi agak wangi (%) 8,43 39,47 17,45 18,45

Titik induksi wangi (%) 0,00 0,00 0,00 6,74

2,46ab 2,58a 2,32ab 2,26b

0,32c 0,64a 0,51b 0,36c

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

B. Interaksi Inokulan 1 dan Inokulan 2
Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2 (Tabel 3). Inokulasi F sebelum inokulasi A tidak mempengaruhi pembentukan gejala gubal pada titik A termasuk pembentukan wangi. Kehadiran F justru cenderung meningkatkan respon perubahan warna kayu akibat inokulasi A. Demikian pula inokulasi A sebelum F tidak mempengaruhi pembentukan gejala gubal pada titik F, kecuali warna pada F menjadi lebih gelap dan persentase titik induksi yang wangi relatif lebih tinggi dibandingkan dengan inokulan tunggalnya. Inokulan ganda AF dan FA menghasilkan masing-masing 8,33% titik induksi pada kategori wangi. Infeksi sekunder juga tidak secara konsisten mempengaruhi infeksi primer (Tabel 4). Inokulasi F sebelum inokulasi A cenderung tidak mempengaruhi pembentukan gejala gubal termasuk tingkat

103

Aspek PRODUKSI

wangi, kecuali pada perubahan warna kayu. Intensitas warna pada titik induksi F lebih baik dibandingkan dengan perlakuan tunggalnya. Infeksi kedua oleh F juga cenderung tidak mempengaruhi gejala pembentukan gubal dan tingkat wangi. Infeksi sekunder oleh cendawan yang sama dengan cendawan tidak berpengaruh pada pembentukan gejala gubal (Tabel 5). Meskipun demikian, secara umum nilai parameter gejala gubal pada titik infeksi sekunder lebih rendah daripada pada titik infeksi primernya. Inokulan A dan F memiliki potensi yang relatif sama dalam merangsang pembentukan wangi.
Tabel 3. Pengaruh inokulan 1 terhadap inokulan 2 dalam gejala pembentukan gubal gaharu
Rataan* Perla-kuan Perubahan warna kayu Panjang (cm) FAa AAa AFf FFf GGg BBb KKk
*

Lebar (cm) 0,71bcd 0,66bcd 0,83abcd 0,75abcd 0,53d 0,65cd 0,00e

Warna (skor) 2,15ab 1,82bc 1,57cd 1,36de 1,02e 1,13e 0,00f

Wangi (skor) 0,60ab 0,63ab 0,70a 0,62ab 0,38c 0,47bc 0,00d

Titik induksi agak wangi (%) 26,37 36,11 40,27 27,78 0,00 0,00 0,00

Titik induksi wangi (%) 8,33 0,00 8,33 0,00 0,00 0,00 0,00

2,73abc 1,96bc 2,52abc 2,61abc 1,75c 2,40abc 0,00e

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 4. Pengaruh infeksi sekunder dengan cendawan yang berbeda dari cendawan penginfeksi primer
Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,68ab 3,87a Lebar (cm) 0,99ab 0,95abc Warna (skor) 1,53cd 2,22a Wangi (skor) Titik induksi agak wangi (%) 34,37 13,89 Titik induksi wangi (%) 0,00 0,00

FFF FAF

0,62ab 0,50bc

104

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Rataan* Perlakuan Perubahan warna kayu Panjang (cm) 3,13abc 3,88a 1,98bc 3,35abc 0,00d Lebar (cm) 0,96abc 1,06a 0,56d 0,80abcd 0,00e Warna (skor) 1,98ab 1,93ab 1,01e 1,20de 0,00f Wangi (skor) Titik induksi agak wangi (%) 32,63 38,86 20,83 13,89 0,00 Titik induksi wangi (%) 2,78 4,15 0,00 0,00 0,00

AAA AFA GGG BBB KKK
*

0,63ab 0,70a 0,38c 0,47bc 0,00d

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 5. Pengaruh infeksi sekunder cendawan yang sama dengan cendawan penginfeksi primernya
Rataan* Perlakuan Panjang (cm) 3,13abc 1,96bc 3,68ab 2,61abc Lebar (cm) 0,96abc 0,66bcd 0,99ab 0,75abcd Warna (skor) 1,98ab 1,82bc 1,53cd 1,36de Wangi (skor) 0,63ab 0,63ab 0,62ab 0,61ab Titik induksi agak wangi (%) 32,63 36,11 34,37 27,78 Titik induksi wangi (%) 2,78 0,00 0,00 0,00

AAA AAa FFF FFf
*

dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

C. Pembentukan Senyawa Terpenoid
Senyawa terpenoid terdeteksi pada semua perlakuan. Pada perlakuan tunggal FF dan gandanya terbentuk warna merah, yang menunjukkan adanya senyawa triterpenoid. Warna merah pada minyak gaharu dijadikan sebagai pembanding kandungan triterpenoid perlakuan. Pada ekstrak kayu B, G, dan inokulan A terbentuk warna hijau. Warna hijau ini menunjukkan adanya senyawa sterol (Harborne, 1987). Sedangkan pada K tidak terbentuk

105

27* 0.06* 0.06* 3 0 0.11* 0.25* 0. nilai absorbansi ekstrak terpenoid hasil perlakuan kurang dari nilai absorbansi minyak gaharu (0. Secara umum.23** 0. Selain itu.22* 0.06* 0. Pada 3 bsi.24* 0.05* 0.15* * Endapan berwarna hijau. Nilai absorbasi ekstrak kayu gaharu yang berubah warna Perlakuan K G B AF A AF F FA F FA A AA FF Bulan ke1 0 0.15* 0.25** 4 0 0.29* 0.14* 0.21* 0. Hal ini menunjukkan kandungan triterpenoid yang relatif tinggi pula (Tabel 6).12** 0.19** 0.40* 0. Hal ini menunjukkan bahwa pada K tidak terdapat senyawa triterpenoid maupun sterol. Hal ini menunjukkan bahwa inokulan ganda tidak efektif dalam meningkatkan kandungan senyawa terpenoid.39* 0. Begitu pula dengan nilai absorban inokulan 1 yang tidak dipengaruhi oleh inokulan 2.11** 0.34* 0. Hal ini menunjukkan bahwa pemberian inokulan 2 tidak mempengaruhi besarnya nilai absorban inokulan 1. Kandungan senyawa triterpenoid pada zona perubahan warna bervariasi pada setiap perlakuan selama 4 bsi (Tabel 6).12* 0.20* 0. ** Endapan berwarna merah-kecoklatan 106 . perlakuan tunggal FF terbentuk endapan merah dan memiliki nilai absorbansi yang relatif tinggi.12** 0.12** 0.20** 0.23* 0. Tabel 6.20** 0. Inokulan AF maupun FA juga tidak mempengaruhi kandungan terpenoid. secara umum nilai absorban perlakuan inokulan ganda hampir sama dengan inokulan tunggal (Tabel 6).23** 0.Aspek PRODUKSI warna (bening).45* 0.813) sebagai pembandingnya.14** 2 0 0.

di New Zealand. Sedangkan pada pohon yang diberi inokulan ganda klorosis terjadi pada tiga cabang dekat lubang induksi. Ketersediaan hara terganggu karena jalur distribusinya ke daun terhambat akibat pengeboran. Walker et al. Sebelumnya. jumlah daun yang mengalami klorosis tidak berbeda dengan 1 bsi. Fotosintat sebagai sumber karbon dalam pembentukan metabolit sekunder antimikrob pun terganggu. inokulasi Acremonium sp. Secara umum inokulan tunggal mengakibatkan klorosis pada daun-daun di dua cabang dekat lubang induksi. karena daun merupakan tempat utama berlangsungnya fotosintesis.. karena kemungkinan sumber karbon lebih diutamakan untuk pembentukan tunas baru. (1997) juga menyatakan bahwa perubahan warna kayu menjadi warna coklat (browning) dapat disebabkan oleh serangan patogen (cendawan) 107 . Efektivitas Induksi Pohon-pohon yang diberi perlakuan menurun kebugarannya mulai 1 bsi. Pada akhirnya. Perubahan warna kayu terjadi pada semua perlakuan. dan Fusarium sp. Caruso and Kuc (1977) menyatakan bahwa Colletotrichum lagenarium menyebabkan klorosis pada daun tanaman semangka dan muskmelon.. perkembangan gejala pembentukan gubal pun terganggu.(Gayu Rahayu. Penurunan kebugaran ditunjukkan oleh adanya daundaun yang mengalami klorosis pada cabang pertama dan kedua dari daerah lubang induksi dan kemudian daun-daun ini gugur. Pelukaan. dan Fusarium sp. Berkurangnya jumlah daun secara drastis dapat menghambat proses fotosintesis. Berbeda dengan daun-daun pada pohon perlakuan.. pada pohon kontrol daun-daun tidak mengalami klorosis sampai akhir pengamatan.Efektivitas dan Interaksi . menyebabkan perubahan warna kayu dari putih menjadi gelap.) PEMBAHASAN A. adanya inokulan juga menjadi penyebab klorosis. Selain itu. larutan gula.. dkk. Pohon semakin merana ketika diserang ulat. Tajuk-tajuk pohon menjadi gundul. Menurut Braithwaite (2007) Acremonium sp. tetapi klorosis hampir memenuhi luasan helai daun. Pada 2 bsi. berasosiasi dengan gejala perubahan warna kayu dan dicline pada Quercus sp. Klorosis mungkin berhubungan dengan ketersediaan hara.

inokulan ganda lebih baik dari inokulan tunggal maupun cara induksi lainnya. Sedangkan pada parameter lainnya. Menurut Nobuchi and Siripatanadilok (1991). Namun. nilai tertinggi diperoleh pada bulan ke-2 induksi. bahwa perubahan warna dari putih menjadi coklat-kehitaman merupakan gejala awal terbentuknya senyawa gaharu. Hal ini didukung oleh pernyataan Rahayu dan Situmorang (2006). Perubahan warna kayu pada gaharu mungkin dapat mengindikasi adanya senyawa gaharu. Berdasarkan persentase titik induksi yang wangi. Kemungkinan besar fenomena ini berhubungan dengan kebugaran pohon yang menurun mulai bulan ke-2.Aspek PRODUKSI dan kerusakan fisik. Hal ini membuktikan bahwa wangi merupakan respon spesifik terhadap bentuk gangguan (Rahayu et al. 2007). Hal ini disebabkan karena gula tersebut segera dipergunakan pohon untuk proses penyembuhan daripada dimanfaatkan oleh cendawan. Aroma wangi dan frekuensi wangi pada pemberian inokulan ganda AF relatif lebih tinggi dibandingkan dengan perlakuan lainnya. 2007). intensitas warna kayu lebih rendah dibandingkan 108 . Hal ini menunjukkan bahwa metabolisme terpenoid dapat berlangsung terus dan berakhir pada produk selain seskuiterpenoid ketika dipanen. perubahan warna kayu menjadi coklat muncul setelah sel-sel kehilangan pati akibat pelukaan. Senyawa wangi merupakan senyawa yang mudah menguap sehingga kemungkinan besar tergolong senyawa seskuiterpenoid. Namun demikian metabolisme isopentenil pirofosfat sebagai pekursor pembentukan terpenoid (McGarvey and Croteau.. Aroma wangi merupakan bagian dari senyawa gaharu (Rahayu et al.. Periode inkubasi cenderung mempengaruhi semua parameter gejala gubal gaharu. 1995) mungkin tidak berhenti pada produk seskuiterpenoid tetapi dapat masuk dalam jalur metabolisme selanjutnya. Semakin lama periode induksi semakin gelap warna kayu. Aroma wangi mulai terdeteksi pada bulan ke-2 dan menurun pada bulan berikutnya. Pemberian larutan gula (G) menekan perkembangan gejala pembentukan gubal gaharu. Pada penelitian ini senyawa triterpenoid dan sterol juga terdeteksi.

B. dkk. dan inokulan tunggal AA terbentuk warna hijau. Heterobasidion juga menyebabkan busuk batang tetapi C. Kemungkinan besar hal ini disebabkan aktivitas patologis yang berbeda. Acremonium dan Fusarium dikenal sebagai penyebab busuk batang atau kanker batang pada pohon berkayu. Triterpenoid terdeteksi pada pemberian inokulan tunggal FF dan inokulan ganda yang ditunjukkan dengan terbentuknya endapan berwarna merah pada pengujian Lieberman-Burchard. (1999) yang membuktikan bahwa inokulasi Heterobasidion annosum yang diikuti oleh Ceratocystis polonica menekan pembentukan gejala bluestain pada pohon Norway spruce (Picea abies).) dengan pemberian inokulan ganda FA.. Putri (2007) juga menyatakan bahwa pemberian Acremonium sp. Sesuai dengan pernyataan Rahayu et al.Efektivitas dan Interaksi . Pada penelitian ini triterpenoid mulai terdeteksi pada 1 bsi. polonica. annosum. polonica adalah penyebab bluestain saja dan tidak menyebabkan busuk batang. dalam bentuk inokulan tunggal atau inokulan ganda dapat merangsang pohon gaharu membentuk senyawa terpenoid. (1997) menyatakan bahwa serangan cendawan pada pohon Pinus akan merangsang pohon untuk membentuk senyawa terpenoid sebagai pertahanan pohon. polonica terbentuk SAR setelah 3 minggu infeksi H. (1999) bahwa terjadinya pembentukan wangi gaharu tidak selalu diikuti oleh perubahan warna kayu. pada A. 109 . Selain itu penelitian sebelumnya. Sedangkan pada perlakuan B. crassna terbukti dapat merangsang pembentukan senyawa terpenoid. dan Fusarium sp. (1999) menyatakan bahwa pada Norway spruce (P. Krokene et al. Pembentukan Senyawa Gaharu Acremonium sp.. G. abies) terhadap C.. Heterobasidion mungkin merangsang pohon membentuk senyawa fitoaleksin yang bersifat anti C. Secara umum inokulan 1 tidak membangkitkan resistensi pohon terhadap inokulan 2. Hal ini berbeda dari hasil penelitian Krokene et al. Hal ini menunjukkan bahwa aroma wangi yang dihasilkan tidak selalu sebanding dengan intensitas warna kayu.. Paine et al.(Gayu Rahayu. Kemungkinan lain adalah periode inokulasi antara inokulan 1 dan inokulan 2 yang hanya berselang 1 minggu.

Braithwaite. L. Beever. Plant Physiol. Metode Fitokimia. M. Induced Resistance to Phatogenic Fungi in Norway Spruce. Hill. Protection of Watermelon and Muskmelon Against Colletotrichum lagenarium by Colletotrichum lagenarium. Berryman. Bandung Terjemahan dari: Phytochem Methods. D. Induksi dengan inokulan 1 yang hanya berselang 1 minggu dari pemberian inokulan 2 tidak membangkitkan resistensi pohon terhadap inokulan 2. 90(1): 45-56. E. N.E. J. 67: 1285-1289. New Zealand Plant Protection 60:297-303 Caruso. SIMPULAN Semua pohon yag diinokulasi menurun kebugarannya sejak 1 bulan setelah inokulasi. Inokulan ganda terutama AF lebih efektif daripada inokulan tunggal dalam merangsang pembentukan wangi. Dehbi.M.R. Harborne (1987) menyatakan bahwa sterol merupakan salah satu senyawa yang tergolong ke dalam senyawa terpenoid.. R. Franceschi. Waipara. 2000.. Institut Teknologi Bandung. 1987.L. DAFTAR PUSTAKA Benhamou.A. P. F. H. 2007. Soc. Inglis. Ramsfield. Solheim. V. A.F. Amer. J. BacterialMediated Induced Resistance in Cucumber: Beneficial Effect of the Endophytic Bacterium Serratia plymuthica on the Protection Against Infection by Pythium ultimum.A. Phytopathol. Semua inokulan.L. Phytopathol. kecuali inokulan tunggal A merangsang pohon membentuk triterpenoid. 1977. 121: 565-569. M. Krokene. N. Pay and C. J. Gagné. C. 1999. Investigation of Oak Tree Decline In Theauckland Region.. Harbone. 110 .. Padmawinata K dan I Sudiro (penerjemah). Dick.D. Quéré.B. Christiansen.W. T. S.Aspek PRODUKSI Warna hijau ini mengindikasikan yang terbentuk adalah senyawa sterol. Kuc.

1997. K. Forest 63:226-235.. 1991. Métraux. 42:179-206. Yogyakarta. Rev.. 22-24 August 2007. T. Plant Cell 7:1015-1026. 1995. Bogor. Mauch-Mani.L. Acremonium and MethylJasmonate Induce Terpenoid Formation in Agarwood Tree (Aquilaria crassna). Pembentukan Gaharu dengan Cara Inokulasi. Raffa. Nobuchi.... Potensi Hifomiset dalam Menginduksi Pembentukan Gubal Gaharu.(Gayu Rahayu. and Host Conifers. Pusat Litbang Hutan dan Konservasi Alam. Kloepper. A. G. Switzerland. E. 111 . Putri dan Juliarni. Increasing Fragrance and Terpenoid Production in Aquilaria crassna by Multi-Application of MethylJasmonate Comparing to Single Induction of Acremonium sp. Paine.W.P. Sticher.Efektivitas dan Interaksi . J.) Liu. 2007. Siripatanadilok. 3 route A Gockel. Makalah dipresentasikan dalam International Conference on Microbiology and Biotechnology... B. Perhimpunan Fitopatologi Indonesia. Harrington. Y. L. Rahayu. Jakarta.. Université de Fribourg. S.J. Prosiding Kongres Nasional XV dan Seminar Perhimpunan Fitopatologi Indonesia. 1700 Fribourg. Induction of Systemic Resistance in Cucumber by Plant Growth-Promoting Rhizobacteria: Duration of Protection and Effect of Host Resistance on Protection and Root Colonization. Preliminary Observation of Aquilaria crassna Wood Associated with the Formation of Aloeswood. Kyoto Univ. 85:1064-1068. G. Isnaini. Interactions Among Scolytid Bark Beetles. 1997. Rahayu. dkk. Terpenoid Metabolism. Rahayu.J. D. 2008. their Associated Fungi.D. Entomol. 1995. Umboh. Bull. G. J. and F. Purwokerto. Systemic Acquired Resistance. Institute de Biologie Végétale. McGarvey. Hlm 1-3. 1996. Makalah Diskusi Hasil Penelitian dalam Menunjang Pemanfaatan Hutan yang Lestari. Santoso. Tuzun. Croteau. hlm 573-581. T. Purwokerto. 11-12 November 2008.C. M. Makalah dipresentasikan dalam 3rd Asian Conference on Crop Protection.I. L. 1999. T. Phytopathol. Annu.. S. 16-18 September 1999..F. 11-12 Maret 1996.

112 .

Aspek SILVIKULTUR 113 .

114 .

Karena potensi harga yang sangat tinggi.. 1996. dan Popullaria sp. Sidiyasa dan Suharti. Parman et al. gaharu harus dihasilkan dari pohon hasil budidaya. Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Pengembangan tanaman gaharu umumnya tidak bertujuan untuk menghasilkan kayu. Akibatnya populasi jenis-jenis gaharu menyusut tajam. Pythium sp. 2007.. kurang dari 5% gaharu terbentuk dari populasi pohon dan bila terbentuk biasanya kurang dari 10% biomas kayu pada pohon yang terinfeksi.. Namun gaharu alam dapat mencapai kualitas tertinggi (kelas super) yang harganya bisa mencapai Rp 30 juta/kg. dalam perdagangan resmi...5 UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN VEGETATIF Atok Subiakto. Phialophora sp. 2007). Konsekuensinya. Erdy Santoso.. Budidaya gaharu memerlukan input iptek agar pertumbuhan dan produksi resin gaharu dapat optimal. sehingga jenis ini dimasukkan dalam Appendix II CITES (Santoso et al. 2001. 1987). (Santoso et al. Dukungan iptek dimaksud 115 .. bukan dari alam. Cylindrocarpon sp. khususnya jamur Fusarium sp. Di alam. Daijo and Oller. melainkan ditujukan untuk menghasilkan resin gaharu yang terbentuk dari respon tanaman atas infeksi mikroba.. eksploitasi gaharu alam dilakukan tanpa mengindahkan kelestariannya. Trichoderma sp.

dan 8 minggu) dan temperatur penyimpanan (25. Pembahasan makalah ini difokuskan pada aspek pembibitan atau perbanyakan bibit pohon penghasil gaharu. Makalah ini menyajikan hasil penelitian berkaitan dengan aspek perbenihan dan perbanyakan stek gaharu.5oC). Proyek ITTO PD 425/06 berupaya untuk mengembangkan dan menerapkan iptek pada penanaman pohon penghasil gaharu agar pertumbuhan dan produktivitas resin gaharunya tinggi. 2. Perlakuan pada uji penyimpanan benih adalah waktu (0.1oC dan 4. 4.9-6. baik pertumbuhan maupun produktivitas resin gaharunya. 116 . Perlakuan pada uji waktu simpan bibit cabutan adalah tiga waktu simpan (1. Bibit cabutan yang digunakan dalam uji waktu simpan cabutan adalah campuran Aquilaria microcarpa dan A. METODE A. Perbanyakan bibit pohon penghasil gaharu dapat dilakukan. 1980). Penerapan perbanyakan vegetatif dan pemuliaan pohon berpotensi untuk menghasilkan bibit klon gaharu yang memiliki keunggulan. 1960). 6.Aspek SILVIKULTUR berkaitan dengan aspek pembibitan dan penyuntikan stimulan gaharu. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. malacensis. dan 3 hari penyimpanan) serta kondisi penyapihan (dalam sungkup dan tanpa sungkup). 2.4-26. Namun informasi iptek mengenai teknik perbenihan dan teknik perbanyakan vegetatif gaharu masih sangat terbatas. Perbanyakan Generatif Pengujian pada perbanyakan generatif dilakukan pada benih (biji) dan cabutan (anakan alam). Biji rekalsitran umumnya cepat berkecambah dan tidak dapat disimpan dalam jangka panjang (Roberts and King. Biji pohon penghasil gaharu tergolong rekalsitran (Hou. Pengujian dilakukan menggunakan rancangan acak lengkap dengan 5 ulangan. Benih pohon penghasil gaharu yang digunakan pada uji penyimpanan dan daya kecambah benih adalah campuran Aquilaria microcarpa dan A. malacensis asal Sukabumi. baik secara generatif maupun vegetatif.

. Persen kecambah dari hasil uji lain pihak.0001). Perbanyakan Generatif Biji gaharu tergolong rekalsitran.. 2007. Subiakto dan Sakai. Penelitian dilakukan pada rumah kaca yang menggunakan sistem pendingin kabut KOFFCO system (Sakai dan Subiakto. Hasil uji pengecambahan biji dari dua kondisi penyimpanan disajikan pada Tabel 1 dan Tabel 2.0993). Uji produksi bibit stek gaharu dilakukan dalam tiga tahap.. dan 3 kali pada bulan ketiga.. HASIL DAN PEMBAHASAN A. Pada pengujian ketiga. sehingga harus secepatnya dikecambahkan.) B. Perlakuan pada pengujian pertama menggunakan prosedur rutin. 2007). Pada pengujian kedua perlakuan intensitas penyiraman dikurangi menjadi sekali seminggu dengan media arang sekam. periode penyimpenyimpanan biji panan mempengaruhi persen Periode Kondisi Refrigerator kecam-bah benih (P Anova = < simpan ruang (%) (%) 0. Penyiraman 2 kali seminggu. Secara teknis pengecambahan biji gaharu mudah dilakukan. dkk. media menggunakan campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 1:1 dan intensitas penyiraman 1 kali pada bulan pertama. Perbanyakan Vegetatif Teknik perbanyakan vegetatif yang digunakan pada penelitian ini adalah teknik stek pucuk.(Atok Subiakto. Uji penyimpanan benih dilakukan untuk mengetahui seberapa lama benih gaharu dapat disimpan. 2 kali pada bulan kedua. malacensis. Di Tabel 1. yaitu media campuran serbuk kulit kelapa dan sekam padi dengan perbandingan 2:1. media tabur dapat menggunakan arang sekam Langsung 2 minggu 4 minggu 6 minggu 8 minggu 82 69 77 56 48 69 69 61 24 117 . Bahan stek yang digunakan pada pengujian ini adalah A.Uji Produksi Bibit . Kondisi penyimpanan (kondisi ruang dan dalam re-frigerator) tidak secara nyata mempengaruhi perkecambahan benih (P Anova = 0.

Pada Tabel 2 simpan ruang (%) (%) tampak ada penurunan antara Langsung 74 persen berkecambah dan 2 minggu 50 54 persen jadi bibit. Pada jenis gaharu penyimpanan pada kondisi ruang selama 2 bulan masih dapat menghasilkan kecambah dengan tingkat keberhasilan 48%. Persen tumbuh bibit cabutan dari uji penyimpanan dan dapat pula dilakukan dengan kondisi tanam bibit menggunakan bibit yang diperoleh dari cabutan di Periode Dalam Tanpa bawah pohon induknya. Oleh sebab itu untuk mendapatkan persen jadi bibit yang tinggi. penaburan biji dilakukan segera setelah buah yang masak dan jatuh. pengecambahan harus dilakukan segera setelah pengunduhan buah. Persen jadi bibit (6 minggu setelah penaburan) dari hasil uji dimulai pada minggu kedua penyim-panan biji dan persen jadi bibit dihitung pada minggu keenam setelah Periode Kondisi Refrigerator penaburan.0001). Pada jenis-jenis biji rekalsitran seperti meranti. Penggunaan sungkup meningkatkan secara nyata persen tumbuh bibit cabutan (P Anova = < 0. Dalam pengujian ini media kecambah yang digunakan adalah arang sekam padi. Perkecambahan umumnya Tabel 2. Umumnya bibit cabutan yang masih memiliki kotiledon dapat langsung ditanam dalam kantong plastik tanpa penyungkupan.4 minggu 64 58 annya cenderung lebih besar 6 minggu 37 48 bila bibit disimpan dalam 8 minggu 29 9 jangka waktu yang lebih lama. Penurun. kotiledonnya telah luruh. 118 .Aspek SILVIKULTUR atau zeolit. Pasimpan sungkup (%) sungkup (%) (hari) da pengujian penanaman 0 80 40 cabutan digunakan bibit 1 76 46 gaharu berukuran tinggi 2 87 24 7 cm. Perbanyakan generatif Tabel 3. Hasil uji penanaman 3 76 38 cabutan disajikan pada Tabel 3.

Sungkup dapat dibuat dari plastik PVC transparan.8276) dalam persen jadi stek. 2007). 2007. Pada tahap pertama digunakan prosedur baku pembuatan stek. Perlakuan jenis tidak menunjukkan perbedaan nyata (P Anova = 0.) Namun bila kotiledon telah luruh. Hasil pengujian menunjukkan media berpengaruh secara nyata (P Anova = 0. yaitu cahaya. penyungkupan harus rapat agar kelembaban dalam sungkup dapat dijaga pada level di atas 95%.. Perlakuannya adalah jenis dan wadah tanam (tabur) stek. 2002). dan zeolit).. penyiraman dikurangi menjadi satu kali seminggu.6600) dalam persen jadi stek.(Atok Subiakto. namun persen berakar masih di bawah 70%. adapun perlakuan yang diuji adalah tiga jenis media (arang sekam padi. Uji produksi stek dilakukan dalam tiga tahap penelitian. 2007). dan media pada tingkat optimal bagi pertumbuhan (Sakai et al. maka dilakukan pengujian lebih lanjut.0083) terhadap persen jadi stek. Pembuatan stek dinilai dapat diusahakan secara ekonomis bila persen jadi mencapai 70% (Subiakto dan Sakai. Demikian pula perlakuan wadah tanam tidak menunjukkan perbedaan nyata (P Anova = 0. Perbanyakan Vegetatif Uji produksi stek gaharu dilakukan dengan menggunakan teknologi KOFFCO system yang dikembangkan oleh Badan Litbang Kehutanan dan Komatsu (Sakai dan Subiakto. Penyimpanan bibit cabutan selama tiga hari masih memberikan hasil yang cukup baik (76%) bila penanamannya menggunakan sungkup.Uji Produksi Bibit . Pada pengujian tahap kedua. Zeolit merupakan media dengan porositas yang baik dan tidak ditumbuhi oleh cendawan 119 .. Mengingat persen jadi stek masih di bawah 70%. maka penanaman bibit cabutan harus melalui tahap penyungkupan. temperatur.. Subiakto dan Sakai. Ratarata persen jadi stek pada uji tahap pertama berkisar antara 4047%. Hasil uji produksi stek gaharu disajikan pada Tabel 4. Hasil pengujian ini membuktikan bahwa kelembaban tinggi di dalam sungkup mempengaruhi keberhasilan penanaman bibit cabutan. pasir. dkk.. Media terbaik adalah zeolit. B. Teknologi ini mengatur kondisi lingkungan. kelembaban.

crassna dan A. Tabel 4. Pada pengujian ketiga digunakan media campuran cocopeat dan sekam padi yang telah disteril. dan 3 kali seminggu). Hasil pengujian menunjukkan bahwa pada tingkat kepercayaan 5%. microcarpa Campuran A. microcarpa A.Aspek SILVIKULTUR ataupun alga. siram 1 kali seminggu Media cocopeat : sekam = 1:1. penyiraman berpengaruh secara nyata terhadap persen berakar stek (P Anova = 0. 2 kali seminggu. microcarpa Campuran A. termasuk cendawan pembusuk. crassna dan A. crassna A. media coco-peat : sekam = 2:1 Tanpa pot-tray. maka perlu dicoba media lain yang memiliki tingkat porositas relatif sama dengan zeolit. crassna dan A. siram 1 kali seminggu Media zeolit. siram 1 kali seminggu Media cocopeat : sekam = 1:1. crassna dan A. media coco-peat : sekam = 2:1 Dengan pot-tray. crassna dan A. Efek dari penyiraman adalah menyebabkan jenuhnya media dan meningkatkan pertumbuhan cendawan. microcarpa Campuran A. siram 3 kali seminggu. siram 3 kali seminggu Persen berakar (%) 40 42 44 47 17 31 55 53 69 49 120 . siram 3 kali seminggu. microcarpa Campuran A. microcarpa Campuran A. crassna dan A. Karena zeolit adalah media yang berat dan relatif lebih mahal. siram 3 kali seminggu. crassna A. Persen berakar stek dari rangkaian uji produksi stek Tahapan riset 1 1 1 1 2 2 2 3 3 3 Spesies A. siram 1 kali seminggu Media pasir. media coco-peat : sekam = 2:1 Dengan pot-tray.0210). microcarpa Perlakuan Tanpa pot-tray. siram 2 kali seminggu Media cocopeat : sekam = 1:1. media coco-peat : sekam = 2:1 Media sekam bakar. microcarpa Campuran A. siram 3 kali seminggu. Perlakuan yang diuji adalah tingkat penyiraman (1 kali seminggu. Penyiraman terbaik adalah dua kali seminggu dengan persen berakar 69%.

(Atok Subiakto. Pen. Namun dengan mengantisipasi penurunan daya kecambah. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil Gaharu Aquilaria microcarpa. S.G. Turjaman. In : Flora Malesiana (Van Steenis.html (diakses : 5 Febuari 2001). The Netherland. Sakai. H.. 1-15. p. Makalah Temu Pakar Gaharu di Kanwil Dephut Propinsi NTB. C. 2001. Rahman.yahoo. IV-5 : 499-509. Penyiraman terbaik dilakukan dua kali dalam seminggu. J. dan M. dan D. Benih gaharu tidak perlu disimpan dalam refrigerator. 121 . 1996. dan N. and A. Gunawan.. Studi Etiologi Gubal Gaharu Pada Tanaman Ketimunan. dkk. Persen kecambah terbaik diperoleh dari benih yang langsung dikecambahkan setelah pengunduhan.) KESIMPULAN 1.. V. 2. cukup disimpan pada suhu ruangan..J. 7:73-80. dan Y. Nuroniah. Subiakto. E. Groningen.G. W. 2002.. JICA. A. Pembuatan stek gaharu tersebut dilaksanakan pada rumah kaca dengan KOFFCO system. Pedoman Pembuatan Stek Jenisjenis Dipterokarpa dengan KOFFCO System. ed). Sakai. Thymelaceae. benih masih dapat disimpan selama dua bulan. Mataram. J. Subiakto. Scent of Earth. Santoso. Komatsu. C. Vol. Walter-Noodhoff.. D. 1960. Mass Propagation Method from The Cutting of Three Dipterocarps Species. T.. Hou. Kamata. 2007. Mulyaningsih. 6. A. Penanaman bibit cabutan menggunakan sungkup menghasilkan persen tumbuh lebih baik dibandingkan bila tidak menggunakan sungkup. com/scent-of-earth/alag.. Media terbaik untuk penyetekan gaharu adalah campuran antara serbuk kulit kelapa (cocopeat) dan sekam padi dengan perbandingan 1:1. Badan Litbang Kehutanan. A. Oller. Bogor. Series I. Res. Parman. DAFTAR PUSTAKA Daijo.Uji Produksi Bibit . Htn & KA. For. C. URL:http://store. 2007.

Mycorrhiza 16 : 459-464..Aspek SILVIKULTUR Sidiyasa. Tropical Press SDN. 122 . Y. H. Arbuscular Mycorrhizal Fungi Increased Early Growth of Two Timber Forest Product Species Dyera polyphylla and Aquilaria filaria Under Greenhouse Conditions. Tamai. M. 1980. Suharti. K. 2007. dan M. E. Sakai. Kuala Lumpur. King. F. 1-5. 2006. Subiakto. and Roberts. H. In : Recalcitran Crop Seeds (Chin. Jenis-Jenis Tumbuhan Penghasil Gaharu. W. Komatsu. and M. Manajemen Persemaian KOFFCO System. BHD. Malaysia. Bogor.. and E. E. Bogor.. The Characteristic of Recalcitrant Seeds. Roberts. Makalah Utama Diskusi Pemanfaatan Kayu Kurang Dikenal. JICA. A. Badan Litbang Kehutanan. Cisarua. Santoso. 1987. Turjaman. dan C. eds). H.

Pohon penghasil gaharu yang ditemukan dengan ciri-ciri adanya lubang kecil yang disebut lubang semut. bahan aditif minyak wangi. dan minyak esensial untuk kegiatan keagaman. Cara perburuan ini mengancam kelestarian gaharu di habitat alaminya. bahkan kegiatan sehari-hari.6 APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp. Aquilaria 123 . budaya. Division of Applied Bioscience. Di alam. sehingga untuk mencegah punahnya pohon penghasil gaharu. Hokkaido University Maman Turjaman Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu (dalam Bahasa Inggris dikenal dengan agarwood atau eaglewood) adalah kayu resin yang bernilai komersial tinggi karena digunakan sebagai dupa. Graduate School of Agriculture. of Ecological Chemistry. DI PERSEMAIAN Irnayuli R. Sitepu Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Aryanto Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam Yasuyuki Hashidoko Lab. sejak November 1994. perburuan gaharu dilakukan secara agresif dan tidak bijaksana. ditebang dan dipanen gaharunya.

Gaharu terjadi melalui proses patogenisitas di mana jenis patogen fungi tertentu menginfeksi jenis pohon tertentu dan sebagai respon terhadap serangan patogen. Keberadaan gaharu semakin menipis di alam. Indonesia.Aspek SILVIKULTUR dan Gyrinops. seperti bakteri penghuni perakaran yang disebut rhizobakteri pemacu pertumbuhan tanaman (RPPT atau plant growth promoting rhizobacteria). Istilah RPPT digunakan untuk bakteri yang dapat membantu pertumbuhan tanaman melalui 124 . Agar ketersediaan produk gaharu dan pohon penghasil gaharu tidak punah dan untuk menjaga kesinambungan produksi gaharu yang lestari. Kedua genus ini ditemukan tumbuh alami di paling tidak 12 negara. perlu upaya budidaya pohon penghasil gaharu. Upaya peningkatan mutu bibit di persemaian dapat dilakukan dengan pemupukan. Lain halnya dengan komoditas pertanian yang langsung ditanam di lapangan. Vietnam. Budidaya merupakan kunci utama dalam meningkatkan produksi gaharu yang semakin menipis. termasuk Bangladesh. yaitu Aetoxylon. Butan. pohon menghasilkan metabolit sekunder atau senyawa resin yang menyebabkan bau wangi ketika dibakar. Appendix II TRAFFIC-CITES-CoP13 Prop. Selain ditemukan pada kedua genus di atas. persiapan bibit kehutanan dilakukan mulai di persemaian. penggunaan biji yang bermutu baik dan inokulasi mikroba yang dapat memacu pertumbuhan. Lao PRD. Filipina. Wikstroemia. Thailand. Myanmar. produk unik ini juga dapat terjadi pada beberapa genus tanaman lainnya. 2004). dan Papua New Guinea (Barden et al. Gonystylus. Enkleia. Phaleria. Malaysia. Kegiatan budidaya pohon penghasil gaharu tidak terlepas dari penyediaan bibit yang berkualitas tinggi. dua genus pohon penghasil gaharu terpenting yang termasuk ke dalam famili Thymelaeaceae (Ordo: Myrtales dan Kelas: Magnoliopsida) telah masuk ke dalam daftar CITES (the Convention on the International Trade in Endangered Species of Wild Flora and Fauna). Kamboja..49 (2004) mencatat ada 24 spesies yang termasuk genus Aquilaria dan tujuh spesies termasuk ke dalam genus Gyrinops. dalam Gunn et al. Gaharu hasil budidaya diharapkan akan dapat memenuhi kebutuhan pasokan gaharu untuk ekspor ke negara-negara pemakai.

(2005) melaporkan bahwa Azospirilum brazilance meningkatkan jumlah dan panjang akar lateral. Sedangkan Azospirillum chroococcum diketahui dapat memproduksi AIA.. yang dikenal sebagai bakteri penambat nitrogen. Azospirillum sp. AG. kandungan nitrogen pada tanaman yang diinokulasi tidak meningkat secara myata. dan diduga adalah produksi fitohormon oleh bakteri penambat nitrogen tersebut. 2004). 1994. yaitu asam indol asetat (AIA/auksin). sehingga respon peningkatan pertumbuhan tanaman disebabkan oleh mekanisme lain dan bukan nitrogen.. giberelin (AG).. maka dilakukan penelitian uji aplikasi bakteri penghasil AIA/auksin dalam memacu pertumbuhan bibit penghasil gaharu Aquilaria sp. Namun.(Irna R. Barbieri et al.. membantu proses terbentuknya mikoriza. (1986) dalam Ahmad et al. dan sitokinin (berbagai sumber dalam Narula et al. di persemaian. sampai saat ini informasi penelitian tentang pemanfaatan bakteri fitohormon untuk tanaman kehutanan di daerah tropis masih terbatas. Mikroorganisme yang menghuni rhizosfir berbagai macam tanaman umumnya memproduksi auksin sebagai metabolit sekunder sebagai respon terhadap suplai eksudat akar yang berlimpah di zona perakaran. bakteri terlebih dahulu diseleksi secara in vitro untuk 125 . dan kinetin. dkk) mekanisme yang beragam. Di antara mekanisme ini. Kokalis-Burelle et al. baik secara langsung maupun tidak langsung (Glick. Narula et al. Mekanisme ini meliputi produksi fitohormon. (2006) mengatakan bahwa dalam studi pemanfaatan bakteri penambat nitrogen untuk meningkatkan produksi tanaman. Glick. Untuk menguji hipotesa ini. Sedangkan Pseudomonas putida GR12-2 pada bibit canola meningkatkan panjang akar sampai tiga kali lipat.. solubilisasi atau mineralisasi fosfat. 1995... 2006). Dalam penelitian ini. 2006). Sitepu. Dikatakan bahwa bakteri penghasil hormon pertumbuhan diduga memegang peranan penting dalam memacu pertumbuhan tanaman.Aplikasi Rhizobakteri Penghasil . sequestration besi oleh siderofor. penambatan nitrogen. misalnya dapat memproduksi tiga jenis fitohormon.. 1995. 2006). fitohormon mendapatkan perhatian penelitian karena aplikasi bakteri penghasil fitohormon dilaporkan meningkatkan produksi tanaman inang secara berkesinambungan (Narula et al. Lucy et al. dan pencegahan terjadinya serangan patogen tular tanah (Garbaye.

Analisa sekuens DNA menggunakan BigDye Terminator v3. (1991). 1112F (5 GTCCCGCAACGAGCGCAAC 3).6-6. Bakteri Penghasil Fitohormon: Identifikasi. Seleksi awal rhizobakteri secara in vitro dilakukan untuk mengetahui kemampuannya dalam memproduksi fitohormon (asam indol asetat-AIA) melalui karakterisasi kualitatif dan kuantitatif. Foste City. diameter 47 mm.. 518R (5 GTATTACCGCGGCTGCTGG 3). 926F (5 AAACTCAAAGGAATTGACGG 3).1 cycle (Applied Biosystems. dan/atau 1080RM (5 ACGAGCTGACGACA 3).2 yang mengandung 1% sukrosa sebagai sumber karbon dan 0. 3. Katakterisasi kualitatif menggunakan metode colorimetric Brick et al. dan diinkubasi dalam gelap pada suhu 28°C. Toyo Roshi Kaisha Ltd. Karakterisasi in vitro dan Persiapan Inokulum Rhizobakteri diisolasi dari rhizosfir dan rhizoplan bibit atau sapling menggunakan media campuran mineral Winogradsky’s bebas N dengan pH 5. Rhizobakteri ini kemudian diidentifikasi secara molekuler mengikuti metode Weisburg et al.45mm. 2 (Advantec. 4. BAHAN DAN METODE A. (1991) yang dimodifikasi sebagai berikut: Rhizobakteri ditumbuhkan dalam media agar Winogradsky’s yang dimodifikasi (AWM) yang diberi 100 mg/L L-tryptophan (C 11H 12N 2O 2).3% gellan gum sebagai bahan pemadat (Hashidoko et al. Setelah inkubasi selama 3 hari. 2. yaitu: 1.. 126 . USA) dengan empat pilihan primer.Aspek SILVIKULTUR mengetahui kapasitasnya sebagai bakteri penghasil fitohormon AIA/auksin. media ditumpuk dengan membran nitrocellulose berukuran pori 0. membran dipindahkan dan ditumpuk pada kertas saring berdiameter 55 mm No. Segera setelah agar diinokulasi rhizobakteri. 2002). Homologi sekuens ditelusuri dengan menggunakan BLASTN online DNA database in National Center for Bio-technology Information (NCBI).

Rhizobakteri yang membentuk cincin halo berwarna merah muda sampai merah pekat digunakan untuk uji kuantitatif AIA. Dari ketiga uji pendahuluan untuk mendapatkan bakteri penghasil AIA. Sedangkan karakterisasi AIA secara kuantitatif dilakukan mengikuti metode Narula (2004). Japan) yang telah direndam sebelumnya dalam larutan Salkowski. Selain itu. CK8 karena Aquilaria sp. untuk mengetahui kemampuan bakteri dalam membantu terbentuknya asosiasi mikoriza pada bibit Aquilaria sp. Rhizobakteri yang mampu memproduksi AIA akan membentuk cincin halo warna merah di sekitar koloni. Kemudian larutan Salkowski ditambahkan pada supernatant kultur rhizobakteri. Glickmann dan Dessaux (1995) menyatakan bahwa larutan Salkowsky memberikan respon positif tidak hanya terhadap auksin (IAA) melainkan juga terhadap asam indolpirufat dan indoleacetamide. merah.. dkk) Tokyo.5 jam. diketahui berasosiasi dengan fungi mikoriza arbuskula.. Sitepu. maka dipilih sembilan bakteri (Tabel 1). 127 . yaitu Chromobacterium sp. Rhizobakteri dikulturkan pada media MW cair yang ditambah dengan 100mg/L L-tryptophan dan diinkubasikan pada suhu 28°C dalam kondisi statis di dalam gelap selama 7 hari. Strain rhizobakteri yang bereaksi positif dengan larutan Salkowski kemudian diuji untuk mengetahui kemampuannya dalam memacu pertumbuhan akar Vigna radiata sebagai tanaman uji. digunakan juga satu isolat bakteri pemacu asosiasi mikoriza.(Irna R.. melainkan diduga merupakan indikasi perbedaan/variasi derifat dari senyawa indol yang dikonversi dari L-triptophan. radiata tidak menunjukkan adanya korelasi yang positif antara intensitas kepekatan warna merah dengan laju pertumbuhan tanaman (tinggi dan total panjang akar). uji lanjutan pada V. Setelah 0. dan merah tua. Tidak adanya korelasi yang spesifik ini mengindikasikan bahwa kepekatan warna merah bukan merupakan indikasi tingginya kuantitas IAA yang dihasilkan.Aplikasi Rhizobakteri Penghasil . kemudian dikelompokkan menjadi merah muda.. Namun demikian. Intensitas warna yang terbentuk. Perubahan warna diamati setelah 30 menit kemudian. pembentukan warna dibaca pada A665nm.

Inokulasi Bakteri Fitohormon pada Bibit Aquilaria sp. AIA: asam indol asetat 128 . Sel bakteri yang ditumbuhkan pada media cair MW + 100 mg/L L-tryptophan diinkubasi dengan menggoyang selama 3 hari pada suhu 28ºC. H: Hopea. Rizoplan Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Hopea sp. Pada saat penanaman. teysmanniana S. Informasi bakteri PGPR penghasil fitohormon yang digunakan sebagai inokulum Strain bakteri Stenotrophomonas sp. parviflora Rizoplan Rizoplan Sapling ~1 bln Sapling ~1. kemudian ditanam dalam polybag yang berisi 500 g media tanah yang tidak steril. dan bobot kering biomassa. CK34 Bacillus sp. UP: Universitas Palangkaraya.Aspek SILVIKULTUR B. CK28 bacteria (DQ195889) Burkholderia Proteosp. CK26 Sub kelas Proteobacteria Bacilli Proteobacteria Hasil analisa colorimetric AIA Merah Inang Substrat Sta-dium Asal lokasi Dipterocarpus sp. * isolat mycorrhization helper bacteria. S. CK67 NI CK53 NI CK54 Proteobacteria S. teysmanniana Rizoplan Sapling ~1th Bibit~ 6 bln Nyaru Menteng Nyaru Menteng Pembi-bitan UP Nyaru Menteng Serratia sp. Rizoplan S. CK8 (DQ195926) Proteobacteria * Catatan: S: Shorea. CK41 Azospirillum sp. diameter. Tabel 1. setelah itu kultur bakteri agak dikentalkan dengan menambahkan 0. Bibit ditumbuhkan di rumah kaca dan disiram setiap hari dengan air keran. 1 ml larutan bakteri juga disebarkan di daerah perakaran. Pengamatan dilakukan terhadap tinggi. balangeran S. CK59 bacteria (DQ195914) Dipterocarpus sp.5 th NI CK 61 Chromobacterium sp. Inokulasi dilakukan pada bibit yang berumur 4 minggu dengan cara merendam bibit dalam larutan bakteri selama 30 menit.5% gellan gum selama 30 menit. teysmanniana Rizoplan Rizoplan Rizoplan Merah muda Merah muda Merah muda pupus Merah muda pupus Merah muda pupus Merah tua Merah tua Merah muda Sapling ~1 th Nyaru Menteng Sapling ~1 tah Nyaru Menteng Burkholderia Proteosp. NI: bakteri yang belum teridentifikasi.

.(Irna R.0 (SPSS Inc. USA). Rancangan Percobaan dan Analisa Data Penelitian menggunakan rancangan acak lengkap dengan faktor tunggal. yaitu 10 isolat bakteri. Bakteri NICK53 yang membentuk warna merah tua dibanding dengan kontrol media tanpa bakteri C.. dkk) a b Gambar 1.. yang masing-masing diulang sebanyak 10 bibit per perlakuan. berat kering total. yaitu tinggi. Chicago.. Analisa persentase peningkatan pertumbuhan dilakukan sebagai berikut: %Peningkatan = Bibit yang diinokulasi bibit kontrol Bibit kontrol x 100% 129 .Aplikasi Rhizobakteri Penghasil . (b): Pembentukan warna pada media cair. Warna merah yang terbentuk di sekitar koloni setelah direaksikan dengan reagen Salkowski (a): Pembentukan warna pada membrane nitroselulose 3 hari setelah inkubasi. dan persentase peningkatan pertumbuhan. Sitepu. Parameter yang diukur untuk mengetahui respon bibit terhadap inokulasi. indeks mutu bibit. Data dianalisa secara statistik dengan analisa sidik ragam menggunakan program SPSS®version 10.. diameter. Data yang berbeda nyata diuji lanjut dengan Least Significant Difference untuk mengelompokkan perlakuan yang tidak berbeda nyata.

Dua isolat bakteri. parviflora umur kurang lebih 1.Aspek SILVIKULTUR HASIL DAN PEMBAHASAN Bibit Aquilaria sp. Bakteri fitohormon memberikan pengaruh nyata terhadap tinggi tanaman mulai 1-5 bulan setelah inokulasi (P < 0. menunjukkan respon beragam terhadap inokulasi bakteri fitohormon (Gambar 2). β Proteobacteria) dan Chromobacterium sp. CK8 (DQ195926. tinggi merupakan parameter yang reliable untuk mengamati respon bibit terhadap inokulasi mikroba pemacu pertumbuhan. Kedua bakteri ini berasal dari rhizoplan S. β Proteobacteria) merupakan isolat yang paling konsisten dalam memberikan pengaruh paling efektif dalam meningkatkan pertumbuhan tinggi selama lima bulan setelah inokulasi (Gambar 2). 130 . (2007) bahwa respon diameter bibit Shorea selanica terhadap inokulasi RPPT tidak konsisten.05). Respon yang serupa juga telah dilaporkan oleh Sitepu et al. Pada habitat hutan yang rimbun dengan kanopi yang bertingkat. berkisar antara 12.5 tahun dari arboretum Nyaru Menteng. Pertumbuhan diameter tidak menunjukkan respon yang konsisten terhadap inokulasi (Tabel 2). Respon tanaman diamati melalui pertumbuhan tinggi dan diameter setiap bulannya. Dijelaskan bahwa tanaman hutan pertumbuhannya jauh lebih lambat dari tanaman pertanian sehingga untuk pertumbuhan stadium awal di persemaian. Semua bibit yang diinokulasi secara signifikan memiliki pertumbuhan tinggi yang lebih baik daripada tanaman kontrol melalui analisa Least Significant Difference (LSD). bibit yang tumbuh di lantai hutan perlu memiliki kemampuan untuk segera tumbuh tinggi bersaing dengan bibit di sekitarnya untuk mendapatkan cahaya agar dapat tumbuh baik.7% dibandingkan dengan bibit yang tidak diinokulasi pada lima bulan setelah inokulasi. netral atau negatif terhadap pertumbuhan tanaman jika dibandingkan dengan tanaman yang tidak diinokulasi (kontrol negatif ). Kalimantan Tengah.2-38. CK28 (DQ195889. Bakteri fitohormon memberikan pengaruh positif. Peningkatan pertumbuhan tinggi bibit Aquilaria sp. teysmanniana umur kurang lebih 1 tahun dan S. yaitu Burkholderia sp.

enam bulan setelah inokulasi. dan indeks mutu bibit (Gambar 3 dan Gambar 4). 2005). bibit cenderung tumbuh lambat (Tabel 2). Yazid et al. Tidak responnya bibit terhadap bakteri.. dan Shorea pinanga (Lee. Sitepu... juga terhadap berat kering total. enam bulan setelah inokulasi. ditumbuhkan di bawah tegakan meranti di Hutan Penelitian Dramaga. Pengaruh bakteri PGPR terhadap pertumbuhan tinggi bibit Aquilaria sp. sampai 5 bulan setelah inokulasi.Aplikasi Rhizobakteri Penghasil .. tidak disterilisasi pada saat inokulasi bakteri sehingga mikroba alami yang terdapat dalam tanah. yaitu Shorea leprosula. kemudian bebas untuk berinteraksi dengan bakteri yang diinokulasikan. 131 . 1990. Turjaman et al. Hopea odorata. Fungi mikoriza dilaporkan baru berperan efektif tujuh bulan setelah inokulasi pada tanaman dipterokarpa.. Angka di atas notasi adalah peningkatan pertumbuhan dibanding kontrol Inokulasi tidak memberikan pengaruh nyata terhadap pertumbuhan tinggi. 1994. dkk) Gambar 2. Bibit Aquilaria sp. Diduga tidak adanya respon bibit yang nyata pada bulan keenam dan selanjutnya disebabkan karena bibit telah terinfeksi oleh fungi mikoriza secara alami yang dapat berasal dari tanah maupun air yang dipakai untuk menyiram tanaman walaupun analisa infeksi mikoriza alami tidak dilakukan. dapat dijelaskan sebagai berikut: Tanah sebagai media tumbuh dan bibit Aquilaria sp. rasio pucuk terhadap akar. Shorea acuminata. Inokulasi juga tidak berpengaruh terhadap pertumbuhan setelah bibit dipindah ke lapangan.(Irna R..

yang diinokulasi bakteri 132 . Tabel 1. P/A: Pucuk/akar Gambar 3. Analisa sidik ragam pada parameter pertumbuhan yang diukur Parameter Diameter (mm) Tinggi (cm) Berat Kering Pucuk (g) Berat Kering akar (g) Berat Kering Total (g) Rasio P/A Indeks Mutu Bibit tn * tn * Analisa sidik ragam * * tn tn tn tn tn * * tn * tn tn Catatan: tn: tidak nyata pada taraf 0. Berat kering total bibit Aquilaria sp.Aspek SILVIKULTUR Tabel 2.05 *: nyata pada taraf 0.05.

merangsang infeksi ektomikoriza pada tahapan pembentukan akar lateral antara Laccaria rufus dan Pinus sylvestris. MHB) juga telah dilaporkan. Gambar 4. yaitu Chromobacterium sp. 2002). dan Rhodococcus sp. (1998) pada bibit loblolly dan slash pine melaporkan bahwa inokulasi RPPT meningkatkan biomassa tegakan. Sedangkan Paenibacillus monteilii dan Paenibacillus resinovorans memacu simbiosis antara Pisolithus alba dengan Acacia holosericea di mana P. 1994... 133 .(Irna R. dalam penelitian ini. Sitepu. Bakteri tertentu dapat berperan dalam merangsang terbentuknya asosiasi mikoriza antara fungi mikoriza dan tanaman inangnya.. monteilii meningkatkan biomassa fungi di dalam tanah (Founoune et al. Salah satu dari kedua inokulan yang paling efektif.. Burkholderia sp. CK8 adalah bakteri yang telah diuji secara in vitro dapat membantu pertumbuhan miselia fungi ektomikoriza Laccaria sp.. yang diinokulasi bakteri Pada bibit Aquiliaria sp. Indeks mutu bibit Aquilaria sp. Brule et al.. Pseudomonas fluorescense BBc6R8 memacu simbiosis antara Laccaria bicolor S238N-Douglas fir (Pseudotsuga menziesii) dan efek dari bakteri MHB ini paling efektif pada saat fungi mikoriza tumbuh berada pada kondisi yang tidak optimal (Garbaye. Penelitian yang dilakukan oleh Enebak et al. Penelitian yang dilakukan oleh Poole et al.. yaitu pada enam bulan setelah inokulasi.Aplikasi Rhizobakteri Penghasil . 2001). dkk) Gambar 4. Pengaruh tidak langsung dari inokulasi RPPT berupa pembentukan asosiasi mikoriza (disebut sebagai mycorrhizal helper bacteria.. (2001) menyatakan bahwa bakteri Paenibacillus sp. pengaruh mikoriza dimulai lebih awal.

(2004) menunjukkan bahwa inokulasi ganda fungi mikoriza arbuskula dan bakteri Azotobacter dengan tambahan asam indol butirat secara nyata meningkatkan survival rate sapling Morus alba (Moraceae) yang ditanam pada kondisi yang bergaram tinggi dari 25-50%. terutama dalam menyeleksi isolat dalam jumlah besar sebelum dilakukan uji selanjutnya. menunjukkan respon beragam terhadap inokulasi bakteri penghasil fitohormon. yaitu Burkholderia sp.7% dibandingkan dengan bibit yang tidak diinokulasi. Dalam penelitian ini. KESIMPULAN Bibit Aquilaria sp. Uji lanjutan inokulasi ganda dengan fungi mikoriza arbuskula perlu dilakukan untuk mengetahui mikroba yang berperan dalam memacu pertumbuhan bibit pada stadia lanjut di persemaian sebelum dipindah ke lapangan. Uji in vitro merupakan metode yang praktis. baik di persemaian maupun di lapangan. CK8 adalah dua bakteri yang secara konsisten memacu pertumbuhan tinggi. CK28 yang menghasilkan warna pink muda pada uji colorimetric.Aspek SILVIKULTUR Untuk mengetahui apakah fenomena MHB ini juga berlaku untuk Aquilaria sp. Penelitian yang dilakukan oleh Kashyap et al. Dua isolat Burkholderia sp. Dari hasil in vitro didapat sembilan bakteri penghasil indol yang kemudian diuji lanjut pada bibit Aquilaria sp. Dalam hal ini bibit bermikroba dapat meningkatkan ketahanan tumbuh tanaman pada kondisi ekstrim. dan apakah hipotesa di atas benar. maka perlu uji lebih lanjut untuk mengetahui pengaruh inokulasi ganda antara bakteri dan fungi mikoriza arbuskula dalam memacu pertumbuhan bibit. pendekatan yang dilakukan adalah menyeleksi bakteri secara in vitro terlebih dahulu sebelum dilakukan uji pada tanaman target di persemaian. Respon pertumbuhan bibit Aquilaria sp. terhadap inokulasi menghasilkan satu bakteri penghasil indol yang efektif. Inokulasi bakteri penghasil fitohormon dapat meningkatkan tinggi bibit Aquilaria sp.2-38. Peningkatan pertumbuhan tinggi bervariasi dari 12. segera setelah inokulasi berturut-turut selama lima bulan. CK28 dan Chromobacterium sp. 134 .

S.. P. The enhancement of plant growth by free-living bacteria. and J. Lemoine.. Pierrat. Bostock. Brick. Glickmann. J.L. and S. 2001. A. S. Rousselet. Dessaux. Survival in the soil of the ectomycorrhizal fungus Laccaria bicolor and the effects of mycorrhiza helper Pseudomonas fluorescens. Sall. Helper bacteria: a new dimension to the mycorrhizal symbiosis. Enebak. Applied and Environmental Microbiology 57: 535-538. Silverstone.A. 135 .. and Y. Soil Biology and Bio-chemistry 33: 1683-1694. Gerard. R. A critical examination of the specificity of the Salkowski reagent for indolic compounds produced by phytopathogenic bacteria. 1995..E. Kloepper. Sommer. I. Founoune. Glick. F. dan M. and J. G. Garbaye. J. Rapid in situ assay for indoleacetic acid production by bacteria immobilized on a nitrocellulose membrane. DAFTAR PUSTAKA Ahmad. Brulé. J. Courrier. I. Khan. Mycorrhiza Helper Bacteria stimulate ectomycorrhizal symbiosis of Acacia holosericea with Pisolithus alba. S. J. 1991.. Branget. 1995. J. R. F. 1994.C. G. dkk) Ucapan Terimakasih Para penulis mengucapkan terimakasih kepada Bapak Ahmad Yani dan Bapak Zaenal yang telah membantu pengukuran dan perawatan tanaman di Hutan Penelitian Dramaga. 2002.. Turkish Journal of Biology 29: 29-34.(Irna R. Neyra. S. and J. Garbaye. Ahmad.M. New Phytologist 153: 81-89. Frey-Klett. M.C.. M. Sitepu... B.M. New Phytologist 128: 197-210. Ba.W. C.M. Forest Science 44: 139-144.Aplikasi Rhizobakteri Penghasil .L. 2005. E. Effect of plant growthpromoting rhizobacteria on loblolly and slash pine seedlings. Indole acetic acid production by the indigenous isolates of Azotobacter and fluorescent Pseudomonas in the presence and absence of tryptophan.R. H. Lorquin. Applied Environmental Microbiology 61: 793-796. Wei. 1998. Duponnois. Chotte. Canadian Journal of Microbiology 41: 109-117.

Y. P.M. M.. India. 2004. Tawaraya. W. 2007. and D. M. AMBIO 19: 383-385.J. Department of Microbiology. Y. Applied Soil Ecology 31: 91-100.R. Sunari. and M. J. pp. Kloepper. PhD Dissertation. Canberra. 2005. Segah.R. Tahara. J. 2001. Lucy. M. New Phytologist 151: 743-751. 2004. Inoculation with the ectomycorrhizal fungi 136 . I. Limin. The mycorrhizal association of the Dipterocarpaceae in the tropical rain forests of Malaysia. H. Merbach. G. and P. Kokalis-Burelle. Resource Management in Asia-Pacific Working Paper No. Tamai.67. 2002. 2006. Whipps. 18 pp. Turjaman. Screening of plant-growth promoting rhizobacteria from Dipterocarpaceae plants growing in Indonesian tropical rain forests. 2006. Stevens. M.H. free-living nitrogen-fixing bacteria inhabiting the rhizoplane of plants. Behl. 91 pp. J. Osaki. and investigations of their functions on seedling growth..S.51. Soft gel medium solidified with gellan gum for preliminary screening for rootassociating. 1990. E. Gans. B. Singadan. N. Chatterton. Tada.. Deubel. Sitepu. Antonie van Leeuwenhoek 86: 1-25.. and W. M. Narula. L. Glick. Osaki. and B.V. Bio-science Biotechnology Biochemistry 66: 2259–2263.. Eaglewood in Papua New Guinea. Hokkaido University. Bending. Plant Soil Environment 52:119-129. and K. Paranodules and colonization of wheat roots by phytohormone producing bacteria in soil. Hashidoko. Y.Aspek SILVIKULTUR Gunn. Read. S.K. Cha.S. and S.J. Plant growth-promoting rhizobacteria as transplants amendments and their effects on indigenous rhizo-sphere microorganisms. M. S.. N. N. Biofertilizer technology-A manual. Hisar. Applications of free living plant growth-promoting rhizobacteria. The Australian National University. CCS Haryana Agricultural University. Reed. E.W. Narula.. Poole. 2004. A. R. Reddy. Bacteria associated with Pinus sylvestris-Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro.D. Lee.

Forest Ecology Management 67: 339-343.M.. S. S.. Growth stimulition of Hopea spp. improves early growth of Shorea pinanga nursery seedlings.A. 137 . Yazid. Journal of Bacteriology 173: 697-707. Sitepu.Aplikasi Rhizobakteri Penghasil .S. dkk) Pisolithus arhizus and Scleroderma sp. 1994. Weisburg. D.M. and F. Pelletier. Lane. New Forest 30: 67-73. S. W. and D.. 16S ribosomal DNA amplification for phylogenic study. Lee. Barns.. G. (Dipterocarpaceae) seedlings following ectomycorrhizal inoculation with an exotic strain of Pisolithus tinctorius. Lapeyrie..J..(Irna R. 1991.

138 .

. Enkleia. Ahmad Yani. Bhutan. Ragil S. 1960). China. Jenis-jenis ini merupakan sumber utama dari kayu gaharu (semacam kayu yang 139 . 1998. Irnayuli R. Myanmar. Vietnam. Malaysia. Erdy Santoso Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Salah satu famili pohon tropika yang sekarang menjadi perhatian dunia internasional adalah Thymelaeaceae. Thymeleaceae terdiri dari 50 genera dengan Aetoxylon. Oyen dan Dung. Gonystylus. India. Sitepu. Gyrinops. Pada saat ini Aquilaria.7 PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT JENIS Aquilaria Maman Turjaman. dan Aquilaria yang memproduksi gaharu (Ding Hou. 2001). Famili pohon ini sangat penting karena menghasilkan produk gaharu dan kayu mewah untuk masyarakat di sekitar kawasan hutan di kawasan Asia (Lemmens et al. Irianto. dan Filipina..B. Najmulah. Cambodia. Bangladesh. 1999). Jenis-jenis Aquilaria pada umumnya banyak dijumpai pada hutan-hutan primer dan sekunder dataran rendah di Indonesia. Phaleria. Papua Nugini. maka jenisjenis ini mengalami kelebihan pemanenan di seluruh kawasan Asia selama 20 tahun terakhir (Paoli et al. Thailand. Karena disebabkan tingginya nilai produk gaharu. Gyrinops. Aryanto. dan Gonystylus dimasukkan ke dalam CITES (Convention on the International Trade in Endangered Species) Appendix II (CITES 2005). Wikstroemia. Sugeng Sentosa.

grandiflora (Giri and Mukerji. 1990). Produk gaharu biasanya digunakan sebagai bahan dasar parfum. Zizyphus mauritiana (Guissou et al. Tujuan dari penelitian ini adalah menentukan tingkat pengaruh fungi mikoriza arbuskula pada jenis-jenis Aquilaria. obat tradisional. Parkia biglobosa. Pada saat ini kegiatan reforestasi memproduksi ratusan juta bibit tanaman hutan setiap tahunnya... Pada tahap awal pertumbuhan jenis Aquilaria sering mengalami pertumbuhan yang lambat. Namun demikian. dan produk komersial lainnya (Eurling dan Gravendeel. incence. Ketersediaan nutrisi tanah merupakan salah satu faktor pembatas untuk pertumbuhan awal dalam kegiatan penanaman bibit-bibit tanaman hutan pada kondisi lahan hutan yang terdegradasi (Santiago et al. baik di tingkat persemaian maupun di lapangan. 140 . belum dilaporkan adanya uji inokulasi fungi mikoriza arbuskula pada jenis-jenis Aquilaria. 1998). 2000). sulit sekali untuk melakukan pengaturan perlindungan genus ini dan termasuk juga dalam pengaturan kelestarian produksi gaharu alami. Penggunaan bibit tanaman hutan yang vigor sangat diperlukan dalam kegiatan reforestasi. 11 jenis Eucalyptus (Adjoud et al. 2002). Dari hasil studi literatur. Telah banyak dilaporkan dalam beberapa jurnal internasional pentingnya pemanfaatan fungi mikoriza arbuskula dari beberapa jenis tanaman hutan yang berbeda untuk membantu kegiatan reforestasi. Pada kenyataannya ketersediaan bibit biasanya cenderung dibuat dengan kualitas rendah dan mengalami defisiensi unsur hara dan pada akhirnya mengalami kematian yang tinggi pada saat telah ditanam di tingkat lapang. Sesbania aegyptiaca dan S. 2005).. Tectona grandis (Rajan et al. 2004). Tamarindus indica. 1996). sebab pada umumnya kondisi lahan hutan tropika di Indonesia kahat unsur hara terutama N dan P. Fungi mikoriza arbuskula (FMA) telah diuji dengan hasil yang signifikan pertumbuhannya pada jenis Leucaena leucocephala (Michelsen dan Rosendahl. jenis Aquilaria berkurang populasinya di alam.Aspek SILVIKULTUR mempunyai resin wangi) yang termasuk dalam urutan teratas dari kelompok hasil hutan bukan kayu bernilai sangat tinggi yang berasal dari hutan tropika.

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

BAHAN DAN METODE
A. Perbenihan dan Perkecambahan
Benih Aquilaria crassna diperoleh dari Dramaga (Bogor), A. malaccensis dikoleksi dari Desa Gudang (Pulau Bangka), A. microcarpa dari Desa Mianas (Kalimantan Barat), A. beccariana berasal dari Sanggau (Kalimantan Barat). Semua benih Aquilaria spp. direndam selama dua jam, kemudian disterilisasi dengan sodium hypochlorit (5%) selama lima menit. Setelah disterilisasi, benih tersebut dicuci beberapa kali dengan air sampai bersih. Benih Aquilaria spp. dikecambahkan pada bak plastik yang berisi media zeolite. Benih Aquilaria spp. mulai berkecambah 21 hari setelah ditaburkan.

B. Media Semai
Jenis tanah ultisol diambil dari Hutan Penelitian Haurbentes, Jasinga dan kemudian disimpan di rumah kaca. Media semai tersebut disaring dengan diameter saringan lima mm. pH media adalah 4,7; P tersedia (Bray-1) adalah 0,17 mg kg-1, dan N total (Kjeldahl) was 1.7 mg kg-1. Kemudian media semai disterilisasi pada temperatur 121oC selama 30 menit.

C. Inokulum Mikoriza Arbuskula
Fungi mikoriza arbuskula, G. decipiens, G. clarum, Glomus sp. ZEA, dan Glomus sp. ACA diisolasi dari Desa Kalampangan, Palangkaraya, Kalimantan Tengah melalui teknik pot kultur. Teknik pot kultur dimulai dengan cara spora tunggal. Inang yang digunakan untuk mempropagasi FMA adalah Pueraria javanica. Pot plastik diisi dengan zeolite steril dan ditambahkan 5 g dari masingmasing jenis FMA. Kemudian ditanam benih P. javanica yang telah berumur enam hari pada pot plastik tersebut. Pot-pot disusun pada rak-rak besi di rumah kaca dan dipelihara selama 90 hari. Spora, hifa eksternal, dan akar yang terkolonisasi dari masing-masing jenis FMA diamati di bawah mikroskop.

141

Aspek SILVIKULTUR

D. Inokulasi FMA
Polybag (ukuran 15 cm x 10 cm) diisi tanah steril 500 g. Inokulasi FMA diberikan 5 g untuk setiap pot dan diletakkan dekat akar semai Aquilaria spp. Semai empat jenis Aquilaria yang tidak diinokulasi sebagai kontrol. Dari hasil penelitian pendahuluan, penggunaan inokulum steril tidak memberikan pengaruh pertumbuhan pada Aquilaria spp. Semai dipelihara dan disiram setiap hari pada kondisi rumah kaca dan diamati selama 6 bulan. Temperatur di rumah kacar berkisar antara 26-35oC dan kelembaban udara 8090%. Gulma dan hama yang mengganggu semai dimonitor setiap hari.

E. Parameter Pertumbuhan
Percobaan inokulasi pada jenis-jenis Aquilaria terdiri atas (a) kontrol (tanpa inokulum); (b) Entrophospora sp.; (c) G. decipiens; (d) G. clarum; (e) Glomus sp. ZEA; dan (f) Glomus sp. ACA. Desain penelitian dilakukan dengan rancangan acak lengkap (RAL) dengan 30 ulangan. Parameter yang diukur adalah tinggi, diameter, dan daya hidup semai. Setelah berumur enam bulan, dilakukan pemanenan pucuk dan akar semai Aquilaria. Semua sampel di-oven pada suhu 70oC selama tiga hari. Analisis N dan P jaringan semai dilakukan dengan metode semi-micro Kjeldahl dan vanadomolybdate-yellow assay (Olsen and Sommers, 1982). Pada tingkat lapang, percobaan yang dilakukan hanya pada jenis A. beccariana dengan desain RAL yang sama. Percobaan dilakukan di Kawasan Hutan Dengan Tujuan Khusus (KHDTK) Dramaga di bawah naungan tegakan Gmelina arborea. Paramater yang diamati pada tingkat lapang ini adalah tinggi dan diameter A. beccariana yang telah dilakukan selama dua tahun.

F. Kolonisasi Mikoriza Arbuskula
Akar dari masing-masing jenis Aquilaria dicuci untuk membersihkan partikel-partikel tanah yang masih menempel. Akar dibersihkan dalam 100 g l-1 KOH selama satu jam, diasamkan dalam larutan HCl dan diberi warna dengan 500 mg l -1 tryphan blue dalam lactoglycerol (Brundrett et al., 1996). Kemudian akar

142

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

dicuci dalam 50% glycerol dan 100 potong akar berukuran satu cm diamati di bawah mikroskop compound dengan perbesaran 200x. Penghitungan kolonisasi mikoriza dilakukan dengan sistem skoring keberadaan dan tidak adanya struktur FMA (McGonigle et al., 1990).

G. Analisis Statistik
Analisis statistik menggunakan ANOVA dengan software StatView 5.0 (Abacus Concepts). Sedangkan analisis statistik lanjutan menggunakan uji beda nyata terkecil (LSD) apabila nilai F signifikan.

HASIL DAN PEMBAHASAN
Lima jenis fungi mikoriza arbuskula (FMA) sangat efektif mengkolonisasi sistem perakaran dari A. crassna, A. malaccensis, A. Microcarpa, dan A. beccariana setelah enam bulan diinokulasi pada kondisi rumah kaca. Dari hasil penelitian sebelumnya Santoso et al. (2008), kolonisasi FMA yang terjadi pada akar bibit A. microcarpa dimulai sebelum minggu ke-7 setelah inokulasi. Tidak ada perbedaan nyata antara lima jenis FMA dalam mengkolonisasi perakaran empat jenis Aquilaria. Kolonisasi FMA dapat meningkatkan parameter pertumbuhan tinggi, diameter batang, berat kering, berat basah, dan daya hidup semai Aquilaria di persemaian (Tabel 1). Pada jenis A. crassna, A. Malaccensis, dan A. microcarpa, penggunaan FMA Entrophospora sp. lebih efektif meningkatkan parameter pertumbuhan dibandingkan jenis FMA lainnya. Khusus FMA G. clarum sangat efektif meningkatkan parameter pertumbuhan pada jenis A. beccariana. Semai yang tidak diinokulasi terkolonisasi oleh FMA yang tidak teridentifikasi (110%), tetapi tidak dapat mempengaruhi pertumbuhan empat jenis Aquilaria. Kolonisasi FMA mampu meningkatkan serapan N dan P pada jaringan empat jenis Aquilaria dibandingkan semai yang tidak diinokulasi (Tabel 2). Peningkatan serapan N dan P ini memberikan pengaruh pada peningkatan dari parameter pertumbuhan empat jenis Aquilaria. Pada tingkat lapang, dilakukan kegiatan penanaman hanya pada jenis A. beccariana dua tahun setelah diinokulasi oleh FMA. Hasil penelitian pada tingkat lapang menunjukkan bahwa

143

Aspek SILVIKULTUR

jenis G. clarum lebih efektif dalam meningkatkan pertumbuhan A. beccariana dibandingkan dengan kontrol dan jenis FMA lain yang telah diujicobakan. Dari hasil penelitian ini memberikan informasi yang sangat penting dalam memanfaatkan inokulum FMA pada jenis-jenis Aquilaria spp. Regenerasi jenis-jenis Aquilaria yang berkelanjutan dapat dibantu dengan adanya pemanfaatan teknologi FMA dimulai pada saat di persemaian. Penggunaan FMA yang efektif dapat meningkatkan pertumbuhan Aquilaria yang sangat signifikan, sehingga biomassa pohon penghasil gaharu yang akan dipanen akan meningkat, artinya produk gaharu hasil induksi yang akan dipanen lebih meningkat produksinya. Penelitian ini sejalan dengan penelitian yang terdahulu, yaitu tentang pemanfaatan FMA pada 11 jenis Eucalyptus spp. (Adjoud et al., 1996), 17 jenis tanaman legume (Duponnois et al., 2001), Sesbania aegyptiaca dan S. grandiflora (Giri dan Mukerji, 2004). Penelitian pemanfaatan FMA pada jenis-jenis pohon tropika (Muthukumar et al., 2001) dan khususnya jenis-jenis Aquilaria menunjukkan bahwa ada kemungkinan inokulum FMA dapat menurunkan penggunaan pupuk kimia di persemaian. Meskipun perhitungan tentang keuntungan dan biaya penggunaan FMA belum diuji dalam penelitian ini, hasilnya tidak diragukan lagi menunjukkan FMA dapat menurunkan penggunaan pupuk kimia dalam penyediaan semai tanaman penghasil gaharu. Selanjutnya mekanisme penggunaan FMA sebagai pemacu pertumbuhan jenisjenis Aquilaria pada tanah masam dan pada tanah yang populasi FMA sangat rendah harus menjadi perhatian dan pertimbangan untuk mengetahui keberadaan FMA alami. Pola penanaman jenis-jenis Aquilaria dengan pola agroforestry sangat membantu mempercepat ketersediaan pohon-pohon penghasil gaharu di Indonesia. Pada prinsipnya, pencampuran dilakukan untuk melindungi pertumbuhan semai Aquilaria pada tahun pertama dan kedua dari sengatan sinar matahari. Jenis-jenis Aquilaria yang telah dikolonisasi oleh FMA akan dapat mempunyai hubungan antara sistem perakaran pohon jenis-jenis lain, sehingga kebutuhan nutrisi untuk pertumbuhan gaharu dapat terpenuhi.

144

. Penggunaan FMA pada jenis-jenis Aquilaria sangat signifikan dalam memacu pertumbuhan awal di persemaian dan lapangan.clarum. dan beberapa jenis lain pohon buah-buahan. sangat efektif dalam memacu pertumbuhan tanaman dan serapan nurtisi pada jenis A. baik di tingkat semaian maupun lapangan.Penggunaan Fungsi Mikoriza . Ent = Entrophospora sp. Ketersediaan inokulum FMA di tingkat 145 . dkk. clarum untuk memacu pertumbuhan tanaman dan serapan nutrisinya. ACA. KESIMPULAN DAN REKOMENDASI 1. G. decipiens. crassna. Direkomendasikan untuk menggunakan jenis FMA efektif untuk mempercepat pertumbuhan jenis-jenis Aquilaria mulai di tingkat persemaian.) Jenis-jenis pohon yang direkomendasikan sebagai pohon pencampur dengan pohon penghasil gaharu adalah pohon karet. kelapa... sengon. Khusus jenis pohon penghasil gaharu A. Gambar 1. jengkol. Pertumbuhan tinggi dan diameter pohon penghasil gaharu Aquilaria beccariana setelah dua tahun ditanam di tingkat lapang. dan A. gmelina. ZEA. malaccensis. G. Gc = G.(Maman Turjaman. kelapa sawit.ZEA = Glomus sp.Aca = Glomus sp. microcarpa. Jenis FMA Entrophospora sp. K = Kontrol.. Gg = G. 2. melinjo. A. beccariana lebih memilih jenis FMA G..

C. Mycorrhiza 14 : 307-312. Founoune. (ed) Flora Malesiana. CITES. 2005.. Plant Systematics and Evolution 254 : 1-12. UNEP. R. B.G. Mycorrhiza 6 : 129-135. Convention on International Trade in Endangered Species of Wild Fauna and Flora. 48 pp. Vol. 146 . II and III of CITES.. Mukerji. Ding Hou. to Arbuscular Mycorrhizal Fungi in a Phosphorus-Deficient Sandy Soil. and K. Lapeyrie.Aspek SILVIKULTUR pengguna dan sosialisasi penggunaanya perlu dilakukan. agar penggunaan FMA menjadi efektif dan efisien. Groningen.C. A. ACIAR Monograph 32. Brundrett. Guisso. Response of 11 Eucalyptus Species to Inoculation with Three Arbuscular Mycorrhizal Fungi. 1996. Grove and N. Guinko and R. 2004. Tamarindus indica L. Inoculation of Acacia holosericea with Ectomycorrhizal Fungi in a Semiarid Site in Senegal : Growth Response and Influences on The Mycorrhizal Soil Infectivity After 2 Years Plantation. Series I. The Netherlands. 1996. and Zizyphus mauritiana Lam. B.J. R. Duponnois.M. DAFTAR PUSTAKA Adjoud. Mycorrhizal Inoculant Alleviates Salt Stress in Sesbania aegyptiaca and Sesbania grandiflora Under Field Conditions : Evidence for Reduced Sodium and Improved Magnesium Uptake. Appendices I. D. TrnL-TrnF Sequence Data Imply Paraphyly of Aquilaria and Gyrinops (Thymelaeaceae) and Provide New Perspectives for Agarwood Identification. Thymelaeaceae. Bâ. C. In : Van Steenis. T.M.G. Masse and R. Malajczuk. Wolters-Noordhoff. Biology and Fertility Soils 26 : 194-198. Duponnois. 1998. Bougher. 6.) Benth. Gravendeel. Dell. Eurlings. Plenchette. M. 2005. Pontanier (2005). p. S. and B.. Halli-Hargas and F. H. N. Forest Ecology and Management 207 : 351-362. Giri. J-M.Ouadba. Canberra. 1-15.. 1960. D. T. M. Responses of Parkia biglobosa (Jacq.G. Working with Mycorrhizas in Forestry and Agriculture.

Indonesia. Forest Ecology and Management 126: 91-95. G.A. Kolonisasi Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil 147 . Santiago. A New Method Which Gives an Objective Measure of Colonization of Roots by Vesicular-Arbuscular Mycorrhizal Fungi. 1990.P. Effect of Post-Planting Inoculation with Bradyrhizobium sp. and Mycorrhizal Fungi on The Growth Brazilian Rosewood.. Indonesia.J.. An Ecological and Economic Assessment of The Nontimber Forest Product Gaharu Wood in Gunung Palung National Park. New Phytologist 115 : 495-501. Essential-Oil Plants. I. Screening of Arbuscular Mycorrhizal Fungi for Their Symbiotic Efficiency with Tectona grandis. L. Bogor. American Society of Agronomy. Timber Trees : Minor Commercial Timbers. B. Turjaman..G. Oyen. Udaiyan and V. S. Santoso. Ex Benth.Penggunaan Fungsi Mikoriza . Rosendhal. R. Prosea.A. Juss) to Indigenous Arbuscular Mycorrhizal Fungi. 1999. G. Biology and Fertility Soils 34 : 417-426 Olsen. Plant Resources of South-East Asia No. Conservation Biology 15 : 1721-1732. Dalbergia nigra Allem. S. T. 1998.. in Two Tropical Soils.. and S.D..E. Wong (Eds. Reddy and D..C.. Michelsen. Evans. Prosea. Paoli.) Methods of Soil Analysis Part 2 Chemical and Micro-biological Properties. Rajan. A. 2001.W. and L. New Forests 24 : 15-25. D.H. Indonesia. Garcia and M.. Samsoedin.R.(Maman Turjaman. Scotti. Phosphorus and Drought Stress on The Growth of Acacia nilotica and Leucaena leucocephala Seedlings.M.H.R.X. Peart. p 403-430.) Lemmens. Swan. 2001. Fairchild and J. Sommers. West Kalimantan. and N. Madison.D. Gunawan dan M. Bagyaraj.J.. Plant Resources of South-East Asia No. E. G. 5 (2). Muthukumar. dkk.K. Dung (Eds.. Rajeshkannan. Response of Neem (Azadirachta indica A. Leighton and I. Miller. T. 2008. M. 2002. A.).R. McGonigle. 1990.J. M.L. Plant and Soil 124 : 7-13. Soerianegara and W. Phosphate-Solubilizing and Asymbiotic Nitrogen-Fixing Bacteria Under Tropical Nursery Conditions. D. Phosphorus.M. 1982. K. The Effect of VA Mycorrhizal Fungi. 2000. Q..).P. In : Page AL (ed. Bogor. 19.

Bogor.Aspek SILVIKULTUR Gaharu. Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam. Jurnal Penelitian Hutan dan Konservasi Alam IV (5): 499-509. 148 .

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

Lampiran 1. Kolonisasi mikoriza arbuskula dan pertumbuhan pada jenisjenis Aquilaria setelah enam bulan pada kondisi di rumah kaca
Kolonisasi AM Tinggi (cm) Diameter (mm) Berat basah Pucuk (g) Akar (g) Berat kering Pucuk (g) Akar (g) Daya hidup (%)

Perlakuan

A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens Glomus clarum Glomus sp. ZEA Glomus sp. ACA 10a 85b 71b 79b 61b 84b 15,40a 19,20b 32,18d 45,30e 32,03d 26,24c 1,90a 2,37b 3,94c 5,02d 3,75c 3,53c 0,30a 5,46e 4,74d 6,74f 3,14b 3,84c 0,10a 2,54c 1,64b 2,82d 1,38c 1,20b 0,09a 1,76c 1,59c 2,30d 0,97b 1,19b 0,02a 0,78c 0,41b 0,91d 0,36b 0,28b 73 100 100 100 100 100 2a 97b 88b 83b 85b 87b 13,39a 24,74d 21,99c 20,28c 17,24b 18,09b 2,23a 3,89c 3,67c 3,58c 2,84b 2,98b 0,75a 4,32c 3,87c 3,46c 2,24b 2,70b 0,34a 2,29c 3,41d 1,55b 1,08b 1,23b 0,23a 1,31c 1,44c 0,95b 0,64b 0,76b 0,09a 0,37b 0,57c 0,30b 0,24b 0,28b 67 100 97 93 87 90 1a 97b 88b 83b 84b 86b 16,43a 25,97c 21,91b 19,96b 22,33b 21,30b 2,28a 3,88c 3,02b 2,94b 3,26b 3,12b 1,46a 4,68c 2,92b 2,90b 2,62b 2,74b 0,52a 2,24c 1,20b 1,28b 1,38b 1,22b 0,41a 1,44c 0,88b 1,95c 0,79b 0,89b 0,18a 0,48c 0,27b 0,78c 0,27b 0,26b 73 100 100 97 90 93 4a* 73b 63b 78b 78b 59b 20,90 a 46,14 c 29,58 b 32,43 b 38,94 c 24,60 a 2,9 a 5,4 c 4,1 b 4,4 b 4,7 b 3,7 a 0,68a 1,06a 0,33a 3,82b 3,26b 0,86a 2,99b 4,19b 0,13a 1,35b 1,56b 0,27a 1,01b 1,52b 70 100 100 100 87 100

12,58b 5,72b 11,64b 7,36b 8,82b 9,92b 4,3b 4,54b

13,46b 6,94b

149

Aspek SILVIKULTUR

Lampiran 2. Kandungan N dan P pada jenis-jenis Aquilaria setelah enam bulan diinokulasi oleh beberapa jenis fungi mikoriza arbuskula (FMA)
N Concentrations (mg/g) N Content (mg/plant) P Concentrations (mg/g) P Content (mg/plant)

Perlakuan A. crassna Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. malaccensis Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. microcarpa Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA A. beccariana Kontrol Entrophospora sp. G. decipiens G. clarum Glomus sp. ZEA Glomus sp. ACA

7,9 ± 0,1a* 9,8 ± 0,1c 8,2 ± 0,2a 8,7 ± 0,2b 8,7 ± 0,1b 10,8 ± 0,2d

2,6 ± 0,6a 37,7 ± 4,3d 26,7 ± 4,1c 7,4 ± 1,0b 25,8 ± 3,6c 45,9 ± 9,6d

0,78 ± 0,02a 1,42 ± 0,03e 0,85 ± 0,02b 0,95 ± 0,02c 0,96 ± 0,03c 1,22 ± 0,02d

0,26 ± 0,06a 5,4 ± 0,6d 2,8 ± 0,5c 0,82 ± 0,14b 2,85 ± 0,41c 5,14 ± 1,0d

8,6 ± 0,2a 12,1 ± 0,1d 10,7 ± 0,1c 10,4 ± 0,1b 11,1 ± 0,2c 10,9 ± 0,2c

3,49 ± 0,5a 17,28 ± 2,0c 9,02 ± 0,7b 20,5 ± 3,3c 8,8 ± 0,9b 9,7 ± 1,8b

0,65 ± 0,02a 0,73 ± 0,01b 0,85 ± 0,01c 0,72 ± 0,02b 0,77 ± 0,03b 1,04 ± 0,03d

0,26 ± 0,04a 1,06 ± 0,15d 0,75 ± 0,07c 1,60 ± 0,20e 0,6 ± 0,07b 0,92 ± 0,17c

7,8 ± 0,1a 9,6 ± 0,2c 9,6 ± 0,1c 9,3 ± 0,1c 9,4 ± 0,1c 8,9 ± 0,2b

1,02 ± 0,07a 16,9 ± 1,5d 11,7 ± 0,9c 8,3 ± 0,4b 9,17 ± 1,35b 8,28 ± 0,40b

0,65 ± 0,02a 1,12 ± 0,03d 0,86 ± 0,01c 0,78 ± 0,02b 0,77 ± 0,03b 0,77 ± 0,02b

0,08 ± 0,01a 1,97 ± 0,18d 1,20 ± 0,18c 0,70 ± 0,03b 0,75 ± 0,12b 0,9 ± 0,1b

6,0 ± 0,1a 9,9 ± 0,2c 10,6 ± 0,1c 11,3 ± 0,d 9,4 ± 0,1b 8,8 ± 0,2b

5,02 ± 0,07a 10,2 ± 1,0c 11,8 ± 0,8c 12,5 ± 0,4d 9,17 ± 1,35b 9,28 ± 0,40b

0,40 ± 0,02a 0,98 ± 0,02d 0,89 ± 0,03c 1,11 ± 0,02e 0,77 ± 0,03b 0,97 ± 0,02d

0,10 ± 0,01a 0,87 ± 0,20d 1,25 ± 0,21c 1,95 ± 0,03e 0,75 ± 0,12b 1,04 ± 0,1c

*Nilai-nilai dengan huruf yang sama adalah tidak berbeda nyata (P<0.05).

150

8
HAMA PADA TANAMAN PENGHASIL GAHARU
Ragil SB Irianto, Erdy Santoso, Maman Turjaman, Irnayuli R. Sitepu
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Tanaman penghasil gaharu yang ada di Indonesia sekitar 27 jenis, beberapa di antaranya yang cukup potensial menghasilkan gaharu yaitu Aquilaria spp., Aetoxylontallum spp., Gyrinops spp., dan Gonystylus spp. Pemanfaatan gaharu di Indonesia oleh masyarakat terutama di pedalaman Pulau Sumatera dan Kalimantan telah berlangsung ratusan tahun yang lalu. Secara tradisional gaharu dimanfaatkan, antara lain dalam bentuk dupa untuk upacara keagamaan, pengharum tubuh dan ruangan, bahan kosmetik dan obat-obatan sederhana. Produk gaharu saat ini sangat dicari oleh para pencari gaharu, karena harganya yang cukup mahal, dimana harga gaharu super dapat mencapai sekitar Rp 40 juta/kg. Akibat dari harga yang cukup tinggi tersebut, maka para pencari gaharu semakin intensif untuk mendapatkannya, saat ini para pencari gaharu mulai memfokuskan mencari gaharu di Pulau Papua yang potensi alamnya (gaharu) masih cukup tinggi dibandingkan dengan di Pulau Kalimantan atau Sumatera.

151

Aspek SILVIKULTUR

Dengan semakin langkanya tanaman penghasil gaharu di lapang dan harganya yang cukup tinggi tersebut, maka para peneliti kehutanan, rimbawan, dan masyarakat awam mulai mendomestikasi atau menanam tanaman penghasil gaharu di luar habitat aslinya. Saat ini banyak sekali para petani maupun orang kota yang mulai menanam tanaman penghasil gaharu dalam skala kecil dari beberapa pohon sampai dengan ribuan pohon. Penanaman tanaman penghasil gaharu yang monokultur dan di luar habitat aslinya pada umumnya akan rentan terhadap serangan hama dan penyakit. Dimulai dua tahun yang lalu banyak sekali sentra penanaman tanaman penghasil gaharu yang terserang hama daun Heortia vitessoides Moore. Sentra penanaman tanaman penghasil gaharu yang terserang hama dan telah dilaporkan terdapat di KHDTK Carita (2008), Sanggau (2007), Mataram (2009), dan lain-lain.

HAMA Heortio vitessoides
A. Gejala Serangan
Gejala serangan tingkat awal adalah permukaan daun yang muda dimakan oleh larva instar pertama dan daun tersebut hanya meninggalkan tulang-tulang daunnya. Pada stadia lebih lanjut ulatulat tersebut mulai menyerang daun-daun pada bagian cabang lebih atasnya dan menyebabkan tanaman menjadi gundul. Ngengat meletakkan telurnya pada bagian bawah permukaan daun yang muda pada cabang tanaman yang dekat dengan permukaan tanah.

B. Siklus Hidup
1. Telur
Ngengat meletakkan telurnya yang berwarna putih kekuningkuningan yang akan segera berubah menjadi kuning kehijauhijauan dalam bentuk kluster pada bagian bawah permukaan daun

152

(Ragil SB Irianto. vitessoides 153 . Stadium pupa berkisar 8 hari. Telur akan menetas sekitar 10 hari.. Siklus hidup hama daun tanaman penghasil gaharu H. Stadium ngengat berkisar sekitar 4 hari. Larva instar terakhir pada saat akan berkepompong mulai berhenti makan dan ulat turun ke permukaan tanah untuk berkepompong. Ngengat betina dapat meletakkan telur sebanyak 350-500.. dkk. ulat ini terdiri dari 5 instar dan berlangsung selama 23 hari.. Larva/Ulat Ulat H. vitessoides pada instar pertama berwarna kuning pucat dan pada instar selanjutnya menjadi hijau kekuning-kuningan..Hama pada Tanaman . jumlah telur yang dihasilkan per imago betina berkisar antara 350-500. 3. Ngengat Serangga dewasa berbentuk ngengat yang aktif pada waktu malam. Pupa Larva instar terakhir sebelum berkepompong akan berhenti makan dan turun ke permukaan tanah dengan bantuan benang sutera yang dihasilkannya.) yang muda pada cabang tanaman yang dekat dengan permukaan tanah. Ulat akan membungkus dirinya dengan butiran-butiran tanah atau serpihan-serpihan serasah yang ada di permukaan dengan bantuan benang-benang suteranya. 4. Ngengat (4 Hari) Kepompong (8 Hari) Telur (10 Hari) Larva (23 Hari) Gambar 1. 2.

durian. dan lain-lain. dan lain-lain untuk merangsang tumbuhnya tunas-tunas baru. rambutan. sudah populer di tingkat petani. B. seperti Beauveria bassiana atau Bacillus thuringiensis. sistemik atau dengan insektisida yang berbahan aktif mikroorganisme. yaitu dengan cara mengambil ulat atau telur yang ada di tanaman tersebut. Pencarian sarang semut rangrang yang memiliki ratu merupakan salah satu faktor 154 . Karena hama ini memakan daun dan pada serangan berat umumnya tanaman gundul. Nabati Pengendalian nabati merupakan pengendalian yang cukup sederhana dan dapat dilakukan oleh petani sendiri dengan mengambil bahan-bahan yang ada di sekitar lokasi penanaman tanaman gaharu. 3. 2.Aspek SILVIKULTUR STRATEGI PENGENDALIAN A. growmore. Mekanis Pengendalian mekanis merupakan pengendalian yang sangat sederhana. Kimiawi Pengendalian kimiawi dapat dilakukan dengan insektisida kontak. Jangka Pendek 1. seperti tanaman nangka. Pengendalian dengan cara ini mudah diaplikasikan terutama pada pesemaian atau bibit yang baru dua tahun. Predator Rangrang Semut rangrang (Oecophylla smaradigna) merupakan serangga yang mudah ditemukan di kampung-kampung pada tanamantanaman yang banyak mengeluarkan nektar. maka disarankan pada saat penyemprotan dikombinasikan dengan pemupukan lewat daun dengan pupuk daun seperti gandasil. Jangka Menengah 1. dimana tanaman masih bisa dijangkau oleh orang dengan berdiri tanpa bantuan alat. melinjo.

. C. R.Hama pada Tanaman . dkk. V. 2008. Heortia vitessoides Moore A Serious Pest of Agarwod Plant (Aquilaria malaccensis Lamk). 2004. J. Bhattacharyya. P. DAFTAR PUSTAKA Kalita.. P. and S.. Semut Sahabat Petani: Meningkatkan Hasil Buah-Buahan dan Menjaga Kelestarian Lingkungan Bersama Semut Rangrang.(Ragil SB Irianto. vitessoides merupakan suatu cara pengendalian yang sangat diharapkan dalam jangka panjang. 2. ICRAF.) keberhasilan dalam perkembangan populasi serangga tersebut dalam jangka panjang. Mele. 59 p. Mele. baik parasit maupun predator dari serangga perusak daun tanaman penghasil gaharu H. 2002. Jangka Panjang 1. Musuh Alami Musuh alami. A Historical Review of Research on The Weaver Ant Oecophylla in Biological Control. T. Nath. Teknik Silvikultur Pengendalian dengan cara teknik silvikultur merupakan salah satu cara pengendalian yang sudah menyatu dengan penanaman suatu tanaman dan termasuk pengendalian yang sudah cukup dikenal oleh petani. C. 155 . P. T. Agricultural and Forest Entomology 10: 13-22.. V.. dan N. Geobios 29: 13-16. Cuc.

156 .

Aspek SOSIAL EKONOMI DAN KONSERVASI 157 .

158 .

Jika tanaman ini terluka. Aquilaria yang merupakan tanaman penghasil gaharu saat ini menjadi jenis yang dilindungi 159 .9 PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN HUTAN BERBASIS MASYARAKAT (PHBM) Sri Suharti Pusat Litbang Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu tanaman hutan yang mempunyai nilai ekonomi tinggi karena kayunya mengandung resin yang harum. baik disebabkan penyakit atau serangan serangga. pau d’aquila (Portugis). Resin ini sebetulnya dapat melindungi tanaman dari infeksi yang lebih besar sehingga dapat dianggap sebagai sistim imun yang dihasilkan (Squidoo. Tanaman penghasil gaharu secara alami tumbuh di wilayah Asia Selatan dan Asia Tenggara. chenxiang (China). 2008). gaharu (Indonesia). akan menghasilkan resin/substansi aromatik berupa gumpalan atau padatan berwarna coklat muda sampai coklat kehitaman yang terbentuk pada lapisan dalam dari jenis kayu tertentu sebagai reaksi dari infeksi/ luka tersebut. aloeswood. oudh. rusak atau terinfeksi. bois d’aigle (Perancis). Gyrinops. dan adlerholz (Jerman). dan Gonystylus. Sejenis resin beraroma ini berasal dari tanaman jenis Aquilaria. ood. Beberapa nama diberikan pada gaharu seperti agarwood. oodh (Arab).

Aspek SOSIAL EKONOMI DAN KONSERVASI di banyak negara dan eksploitasi gaharu dari hutan alam dianggap sebagai kegiatan ilegal. maka masyarakat yang mampu membudidayakan gaharu adalah kelompok yang memiliki permodalan yang kuat. Salah satu bentuk kemitraan yang dapat dikembangkan adalah pola PHBM (Pengelolaan Hutan Berbasis Masyarakat). Pengembangan budidaya gaharu dengan pola PHBM (sistem bagi hasil) merupakan salah satu alternatif bentuk usahatani produktif yang selain bertujuan untuk mengembangkan budidaya gaharu secara luas juga sekaligus dapat meningkatkan pendapatan masyarakat serta mengurangi tekanan masyarakat terhadap hutan yang tingkat ketergantungannya terhadap hutan tinggi. Sampai saat ini. Upaya pembudidayaan tersebut makin berkembang karena ditunjang oleh kemajuan hasil penelitian yang menunjukkan bahwa budidaya gaharu memberikan keuntungan yang layak bagi pelakunya. permintaan akan gaharu jauh melebihi supply yang ada. perlu dikembangkan suatu skema kerjasama antara pemilik modal dengan masyarakat. Sebagai akibatnya pada beberapa tahun terakhir ada kecenderungan besar-besaran untuk mambudidayakan gaharu terutama di wilayah Asia Tenggara (Squidoo. Jambi. 2006). tingginya harga gaharu dan makin langkanya tanaman gaharu di hutan alam juga mendorong masyarakat di berbagai daerah untuk melakukan budidaya gaharu seperti yang terjadi di Riau. eksploitasi gaharu secara ilegal ternyata tetap berlangsung dan konsumen yang kurang memahami hal ini secara tidak sadar justru menciptakan permintaan yang tinggi yang dapat membahayakan keberadaan tanaman Aquilaria (Blanchette. Meskipun demikian. PHBM diharapkan menjadi suatu cara yang efektif karena melibatkan masyarakat sekitar hutan dan parapihak pemangku 160 . Sumatera Utara. Di Indonesia. Kesepakatan internasional seperti CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) yang disepakati oleh 169 negara ditetapkan untuk menjamin bahwa perdagangan gaharu tidak mengganggu survival dari Aquilaria. 2008). Untuk mengembangkan budidaya gaharu secara lebih luas. Namun karena pengusahaan gaharu memerlukan modal yang tidak sedikit. dan Kalimantan Selatan.

. Departemen Kehutanan... (1) dimana: NPV Bt Ct i n = = = = = Net Present Value (Nilai Kini Bersih)..Prospek Pengusahaan Gaharu ......... dan saling mendukung....... waktu... METODOLOGI Tulisan ini merupakan hasil desk study dari berbagai pustaka.. biaya pada tahun t........ diolah dan Dianalisis secara deskriptif... Data dan informasi yang berhasil dihimpun....... NPV atau nilai kini bersih dirumuskan sebagai berikut: n Bt − Ct NPV = ∑ t =0 (1 + i)t ....... dan data statistik yang tersedia........ Suatu kegiatan usaha dinyatakan layak secara finansial bila nilai NPV > 0...... Tulisan ini bertujuan untuk memberikan gambaran tentang prospek pengusahaan gaharu oleh masyarakat melalui pola pengelolaan hutan berbasis masyarakat (PHBM).. CITES... Asosiasi Gaharu Indonesia (Asgarin).... tingkat diskonto atau potongan (=bunga bank yang berlaku). Data dan informasi serta literatur tersebut dihimpun dari berbagai sumber antara lain. laporan hasil penelitian.. serta berbagai terbitan lainnya.. Khusus untuk perhitungan analisis finansial usahatani gaharu digunakan kriteria kelayakan Net Present Value (NPV). BPS..... umur ekonomi proyek (cakrawala waktu)....... benefit atau penerimaan pada tahun t...... IRR atau tingkat pengembalian internal dirumuskan sebagai berut: 161 . saling memperkuat.. hak dan kewajiban) dengan prinsip saling menguntungkan...... dan Benefit Cost Ratio (B/C ). Internal Rate of Return (IRR)...(Sri Suharti) kepentingan lainnya untuk bekerjasama dan berbagi (ruang.

....... benefit atau penerimaan pada tahun t. PROSPEK PENGUSAHAAN GAHARU A. nilai B/C dirumuskan sebagai beikut: n Bt ∑ t =0 (1 + i)t B/C = n Ct ∑ t =0 (1 + i)t ................ Prospek Pasar Gaharu Indonesia adalah produsen gaharu terbesar di dunia dan menjadi tempat tumbuh endemik beberapa spesies gaharu komersial dari 162 ........................... Suatu bisnis dinyatakan layak secara finansial bilai nilai IRR lebih besar dari tingkat suku pinjaman di bank yang berlaku saat ini. umur ekonomis proyek......... (2) dimana: IRR = i1 = NPV1 = i2 = Internal Rate of Raturn (tingkat keuntungan internal)............. nilai NPV mendekati nol positif............... tingkat diskonto....................... (3) dimana: B/C Bt Ct i n = = = = = Benefit Cost Ratio ( Rasio penerimaan-biaya). NPV2 = nilai NPV negatif mendekati nol....... Selanjutnya............... Kegiatan usaha dikatakan layak apabila B/C > 1..... biaya pada tahun t..... tingkat diskonto untuk menghasilkan NVP2 negatif mendekati nol.. tingkat diskonto untuk menghasilkan NPV1 mendekati nol...Aspek SOSIAL EKONOMI DAN KONSERVASI IRR = i1 + NPV1 NPV1 − NPV2 (i2 − i1) .......

Selain itu. karena adanya kekhawatiran akan punahnya spesies gaharu di Indonesia. 2005).487 ton. Bahkan sejak tahun 2000.. beccariana. dan Gyrinops spp. total ekspor gaharu dari Indonesia terus menurun hingga jauh di bawah ambang kuota CITES. Hal ini banyak dikeluhkan oleh beberapa eksportir gaharu Indonesia. 2005). Pada tahun 1985. tingginya permintaan gaharu belum dapat dipenuhi karena kekurangan bahan baku bermutu tinggi untuk ekspor. dupa. A. filarial. tetapi juga digunakan sebagai bahan baku obat-obatan. Namun dari sisi negara pengekspor.(Sri Suharti) marga Aquilaria seperti A.Prospek Pengusahaan Gaharu . dan lain-lain. jumlah ekspor gaharu Indonesia mencapai sekitar 1. Tingginya harga jual gaharu mendorong masyarakat untuk memburu gaharu. penghasil gaharu terbaik ke dalam daftar Ap-pendix II dan sejak saat itu ekspor gaharu dibatasi oleh kuota yaitu hanya 250 ton/tahun (Anonim.) dimasukkan dalam Apendix II pada konvensi CITES tanggal 2-14 Oktober 2004 di Bangkok (Gun et al. malaccensis. maka sejak tahun 2005 Departemen Kehutanan kembali menurunkan kuota ekspor menjadi hanya 125 ton/tahun (Anonim. gaharu tidak hanya digunakan sebagai bahan wangi-wangian (industri parfum). microcarpa. Ekspor untuk pasar Timur Tengah sebagai contoh menurun dari 67. Seiring dengan kemajuan ilmu pengetahuan dan teknologi industri.400 kg tahun 2006. Oleh karena itu pada tahun 1995 CITES memasukkan A. A. tidak hanya dengan cara memungut dari pohon gaharu yang mati alami melainkan juga dengan menebang pohon hidup. Selanjutnya. karena sulitnya memperoleh bahan 163 .. hirta.. Permintaan terhadap gaharu terus meningkat karena banyaknya manfaat gaharu... namun eksploitasi hutan alam tropis dan perburuan gaharu yang tidak terkendali telah mengakibatkan spesies-spesies gaharu menjadi langka.245 kg pada tahun 2005 menjadi 39. beberapa agama di dunia mensyaratkan wangi gaharu yang dibakar sebagai sarana peribadatan (untuk keperluan kegiatan religi). dan pengawet berbagai jenis asesoris. Semakin sulitnya mendapatkan gaharu di hutan alam telah mengakibatkan semua pohon gaharu (Aquilaria spp. malaccensis. kosmetika. 2004). Perkembangan yang terjadi selanjutnya ternyata kurang begitu bagus. A. A.

Keluhan kekurangan bahan baku gaharu untuk ekspor juga dialami oleh pemasok pasar Singapura.000 225.772 175.000 68.000/ kg untuk kualitas rendah dan Rp 80.649 245.401 81.000 75.000-50. **): CITES Annual Report Data Compiled by UNEP-WCMC. harga gaharu di tingkat pengumpul berkisar antara Rp 30. Sebagai contoh.577 293.000 kg) 148.150 219. Penurunan kemampuan ekspor Indonesia tersebut sudah diprediksi oleh berbagai pihak karena eksploitasi hutan dan perburuan gaharu yang tidak terkendali.377 74. Tabel 1. Pada tahun 1980. Kenaikan pesat terjadi pada saat krisis ekonomi melanda Indonesia tahun 1997.245 n/a Tahun 1995 1996 1997 1998 1999 2000 2001 2002 2003 *): CITES Management Authority of Indonesia.593 305.000 180.079 81.000/kg pada tahun 1993.593 287.002 n/a ≠) 313.Aspek SOSIAL EKONOMI DAN KONSERVASI baku gubal super yang diminta.523 (termasuk A.000/kg untuk kualitas super.000 120. pada tahun 2006 hanya mampu mengekspor 2-3 ton/bulan (Adijaya.002 (termasuk A.000 50.826 70.000 300.000 300.377 74. CV Ama Ina Rua.212 76.000 150.546 n/a Net ekspor laporan CITES **) 323. dari Indonesia tahun 1995 . Hasil pemanenan dan ekspor gaharu jenis Aquilqria spp.2003 Kuota hasil panen resmi*) n/a 300. yaitu hanya naik menjadi Rp100. baik di pasar dunia maupun di tingkat pengumpul.826 n/a n/a Total ekspor gaharu (semua spesies)*) n/a≠ 299.000 225.000 150. Pada awalnya kenaikan harga gaharu relatif lambat. filarial dan jenis lain 287. eksportir di Jakarta yang pada tahun 2005 bisa mengekspor 5-6 ton/bulan. pada Tabel 1 disajikan data hasil kajian tentang perdagangan gaharu di Indonesia yang diterbitkan CITES pada tahun 2003.000 75.filarial 180.000 Aktual ekspor berdasar CITES Indonesia*) n/a≠)) 299.000 50.238 81. ≠): the reason for the unavailability of data for 1995 1nd 1998 is not known 164 .000 70. 2009).483 147. Penurunan kemampuan ekspor Indonesia tersebut sangat berpengaruh terhadap perkembangan harga gaharu.000 Kuota hasil aktual*) n/a 160. Sebagai gambaran.

Malaysia. A. dihasilkan gaharu sebagai salah satu hasil hutan bukan kayu yang bernilai ekonomi tinggi. Wiguna. 2009.8 juta ha. dan Gonystilus yang keseluruhannya termasuk dalam famili Thymelaeaceae. Potensi dan Peluang Usaha Sebagaimana diuraikan sebelumnya. Kondisi tersebut menggambarkan bahwa gaharu sangat prospektif untuk dikembangkan.09 juta ha.. Hutan Produksi yang Dapat Dikonversi 22. 2007).65 juta ha. Hutan Produksi Tetap 36. malaccensis. Gyrinops. Gaharu dihasilkan oleh pohon-pohon terinfeksi yang tumbuh di daerah tropika dan memiliki marga Aquilaria.23 juta ha (Departemen Kehutanan.. A. Kamboja.. Dari kawasan hutan tersebut khususnya dari kawasan hutan produksi alam.. beccariana. B.31 juta ha. microcarpa. Enam di antaranya ditemukan di Indonesia (A. dan Indonesia. hirta. Hutan Lindung 31. China Selatan. Indonesia memiliki potensi yang sangat besar untuk menghasilkan gaharu. 2006). dan Taman Buru 0.5 juta ha. Philipina. sehingga produksi gaharu Indonesia terus menurun.Prospek Pengusahaan Gaharu . Hutan Produksi Terbatas 22. khususnya bagi Indonesia yang memiliki potensi biologis yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. Kenaikan harga gaharu terus berlanjut dan makin tajam hingga mencapai Rp10 juta/ kg pada tahun 2000 dan meningkat lagi hingga mencapai Rp 15 juta/ kg pada tahun 2009 (Adijaya. Marga Aquilaria terdiri dari 15 spesies. A.(Sri Suharti) di mana harga gaharu mencapai Rp 3-5 juta/kg. Lao PDR. tersebar di daerah tropis Asia mulai dari India. cumingiana. A. Thailand. Pada saat ini luas kawasan hutan dan perairan Indonesia berdasarkan Keputusan Menteri Kehutanan tentang Penunjukkan Kawasan Hutan dan Perairan serta Tata Guna Hutan Kesepakatan (TGHK) tercatat seluas 137. Myanmar. Pakistan.6 juta ha. namun potensi yang tersedia tersebut sampai saat ini belum dimanfaatkan secara optimal dan produksi gaharu lebih banyak berasal dari proses alami. 165 . terdiri dari Kawasan Suaka Alam dan Pelestarian Alam 23.

Sembilan spesies di antaranya terdapat di Indonesia yaitu di Sumatera. Maluku. dan kepulauan Solomon serta kepulauan Nicobar. dan abu/ bubuk (Sumarna. dan Irian Jaya. Pemanenan dapat dilakukan pada kondisi pohon belum mati. Bali. 2009) atau di bawah tegakan pohon hutan seperti meranti. tersebar di Asia Tenggara mulai dari Malaysia. kemedangan. kecuali Jawa. 2002). Enam di antaranya tersebar di Indonesia bagian timur serta satu spesies terdapat di Srilanka (Anonim. Serawak. Bali. Papua New Guinea. filarial). Kalimantan. rekayasa produksi untuk menghasilkan gaharu sudah dapat mulai dilakukan dengan cara teknik induksi/inokulasi penyakit pembentuk gaharu yang sesuai dengan jenis pohon. Karena sifat permudaan gaharu yang toleran terhadap cahaya (butuh naungan). Marga Gonystilus memiliki 20 spesies. Keberhasilan berbagai hasil penelitian 166 . Sabah. Hasil rekayasa tersebut dapat dipanen satu atau dua tahun kemudian. Marga Gyrinops memiliki tujuh spesies. mahoni. Pembudidayaan tanaman penghasil gaharu dapat dilakukan secara monokultur maupun tumpangsari dengan tanaman lainnya. Keenam jenis tersebut terdapat hampir di seluruh kepulauan Indonesia. 2007). penanaman pohon gaharu sebaiknya dilakukan secara tumpangsari atau berada di bawah naungan tegakan lain seperti karet. kelapa. durian (Rizlani dan Aswandi.Aspek SOSIAL EKONOMI DAN KONSERVASI dan A. Hutan Rakyat juga dapat ditanam pada areal tanaman perkebunan (karet. Setelah tanaman penghasil gaharu berumur 5 tahun dengan diameter 15 cm. HTI. sawit. Indonesia. sawit. Philipina. dan Nusa Tenggara. Jika ditanam secara monokultur dan tanpa naungan resiko kegagalan penanaman (tanaman muda) lebih tinggi. Persyaratan tumbuh serta pemeliharaan tanaman penghasil gaharu relatif tidak terlalu rumit. Peninsula. pulai seperti yang dikembangkan di KHDTK Carita. dan lain-lain). Beberapa alternatif pengembangan budidaya pohon penghasil gaharu selain pada hutan produksi (LOA). Berbagai hasil penelitian tentang tanaman gaharu memberikan hasil yang sangat menggembirakan karena berbagai jenis tanaman gaharu dari hutan alam ternyata dapat dibudidayakan dan produksi gaharu dapat direkayasa. tetapi idealnya dipanen setelah pohon mati dengan variasi mutu produksi akan terdiri dari kelas gubal.

. Selain itu Dinas Kehutanan Riau juga menanam jenis yang sama seluas 10 hektar di Taman Hutan Raya Syarif Hasyim. microcarpa.. malaccensis seluas lebih dari 10 hektar. Pengusahaan gaharu dilakukan pada luasan satu ha dengan jarak tanam 5 m x 5 m. malacensis dan A. Analisis finansial tersebut menggunakan beberapa batasan dan asumsi sebagai berikut: 1. berikut ini dilakukan contoh analisis finansial budidaya gaharu dengan asumsi tingkat keberhasilan mencapai 60%. sehingga total produksi 480 kg/ha dengan 3 kualitas masingmasing kelas kemedangan I sebesar 10%. PT Budidaya Perkasa di Riau dengan menanam A. 167 . 2.. Tanaman yang bertahan hidup dan menghasilkan gaharu diasumsikan 60% dengan tingkat produksi 2 kg per pohon. BP DAS Batanghari bekerjasama dengan Badan Litbang Kehutanan pada 2004/2005 membuat demplot budidaya gaharu di antara tegakan tanaman karet rakyat seluas 50 ha (Sumarna. sampai akhir tahun 2002 terdapat sekitar 116 petani yang tergabung dalam Kelompok Tani Penghijauan Indah Jaya yang telah mengembangkan lebih dari seratus ribu bibit gaharu (Anonim. C.(Sri Suharti) tersebut makin mendorong dan menggugah pemburu gaharu untuk melakukan budidaya tanaman gaharu. Sebagai contoh usaha yang dilakukan oleh para petani di Desa Pulau Aro. Jambi. 2007). Selanjutnya pada tahun 2001-2002 beberapa individu atau kelompok tani juga mulai tertarik untuk membudidayakan jenis pohon penghasil gaharu.Prospek Pengusahaan Gaharu . yang menanam gaharu dari jenis A. kelas kemedangan II sebesar 40%. Selain itu. Kecamatan Tabir Ulu. sehingga kerapatan 400 pohon per hektar. 2008). Upaya pembudidayaan gaharu sudah mulai dirintis sejak tahun 1994/1995 oleh sebuah perusahaan pengekspor gaharu.. Kelayakan Pengusahaan Gaharu Untuk memperoleh gambaran bagaimana kelayakan pengusahaan gaharu melalui budidaya dan rekayasa produksi gaharu. Kabupaten Merangin. dan kelas kemedangan III sebesar 50%. Di desa tersebut.

sehingga total biaya inokulan Rp 20 juta/ha. dan adanya pencurian pohon di kebun gaharu (Duryatmo. Analisis finansial menggunakan tingkat diskonto sebesar 15%.350 juta. tenaga kerja untuk inokulasi. kegagalan dalam melakukan inokulasi.Aspek SOSIAL EKONOMI DAN KONSERVASI 3. 6.47% dari total biaya. dan B/C = 3. beban biaya yang relatif besar adalah untuk pembelian bahan inokulan.000/HK. Harga inokulan diasumsikan Rp 50. 2009). Upah tenaga kerja. PROSPEK PENGUSAHAAN GAHARU DENGAN POLA PHBM A. Hasil analisis finansial menunjukkan bahwa pengusahaan gaharu tersebut layak untuk dilaksanakan karena dapat menghasilkan keuntungan bersih nilai kini (NPV) sebesar Rp 147. Peluang Pengembangan Gaharu dengan Pola PHBM Pembudidayaan tanaman penghasil gaharu akhir-akhir ini makin marak karena sebagian masyarakat sudah dapat menikmati hasilnya.32 (Lampiran 1). dan tenaga kerja untuk pemungutan hasil (panen) yang besarnya mencapai Rp 77 juta atau sekitar 54.350 juta. Harga jual produksi gaharu hasil inokulasi untuk kelas kemedangan I = Rp 5 juta/kg. dan biaya tenaga kerja Rp 74.000/pohon. IRR sebesar 48.50 juta. dan kelas kemedangan III = Rp 500 ribu/kg. Berdasarkan asumsi dan batasan tersebut ternyata untuk pengusahaan satu hektar gaharu dibutuhkan biaya sebesar Rp 141. Namun di sisi lain juga dijumpai beberapa kasus ketidakberhasilan pengusahaan gaharu yang disebabkan antara lain oleh kegagalan dalam pemeliharaan. 5.53%. Biaya tersebut meliputi biaya pra-investasi dan persiapan lahan serta penanaman sebesar Rp 26.74 juta/ ha. biaya bahan dan peralatan Rp 40. 168 . baik tenaga kerja keluarga maupun luar keluarga diasumsikan sebesar Rp 50. Kalau diperhatikan lebih seksama. sedangkan upah tenaga kerja untuk inokulasi Rp 30. kelas kemedangan II = Rp 2 juta/ kg.000/pohon. 4.50 juta.

masyarakat di dalam dan di sekitar kawasan hutan dapat menjadi aset bagi usaha-usaha penjagaan... kelompok usaha bersama/koperasi. Pada areal hutan milik. pemeliharan. keterampilan... Karena bentuk kerjasamanya adalah kemitraan. baik dalam areal hutan milik (hutan rakyat) maupun dalam kawasan hutan Negara. Masyarakat dengan keterbatasan sumberdaya yang dimiliki (lahan. 169 . dan di sisi lain. Perubahan paradigma ke arah PHBM menjadi momentum penting bagi masyarakat desa hutan. sarana prasarana. Pengembangan gaharu melalui pola PHBM merupakan salah satu alternatif peningkatan produksi gaharu melalui pelibatan masyarakat dalam budidaya gaharu. Di satu sisi masyarakat dapat mendayagunakan potensi-potensi kehutanan untuk kesejahteraan mereka. perlu dikembangkan suatu pola kemitraan dalam budidaya tanaman penghasil gaharu. pengusaha/investor. dan lain-lain) dapat ikut berperan dalam pengusahaan tanaman gaharu. Dengan pola ini diharapkan areal tanam dan juga kualitas dan kuantitas produksi gaharu akan dapat ditingkatkan. baik di lahan milik di luar kawasan hutan maupun di kawasan hutan. parapihak yang tertarik (pemerintah. input produksi. masyarakat diharapkan melakukan penanaman gaharu pada lahannya sendiri terutama pada lahan kosong (tidak produktif ) secara swadaya. Pengembangan gaharu dengan pola PHBM dapat dilakukan. dan pengelolaan hutan (Hayat. meningkatkan peluang keberhasilan serta mengurangi resiko kerugian yang diderita. maka parapihak yang terlibat dalam kegiatan ini dapat memperoleh bagian/ sharing manfaat sesuai kontribusi masing-masing. PHBM merupakan salah satu jawaban dari pergeseran paradigma dalam pengelolaan sumberdaya hutan dari yang berbasis negara (state based) ke arah yang berbasis komunitas/masyarakat (community based) (Indradi.Prospek Pengusahaan Gaharu .(Sri Suharti) Untuk lebih membudayakan penanaman gaharu secara luas. 2009). Salah satu bentuk kemitraan yang dapat dikembangkan adalah melalui pola pengelolaan hutan berbasis masyarakat (PHBM). masyarakat) dapat berbagi peran dan tanggung jawab untuk mengembangkan tanaman gaharu. akses pasar. 2007). Melalui pola PHBM.

Pengadaan bibit dan inokulasi dapat difasilitasi oleh mitra kerjasama yang disalurkan kepada petani. Adanya peningkatan kesejahteraan dari budidaya gaharu selanjutnya akan mengurangi tekanan masyarakat terhadap sumberdaya hutan dalam bentuk illegal logging dan perambahan lahan bahkan masyarakat secara sadar akan mempertahankan 170 . baik dalam bentuk bantuan/hibah maupun melalui sistim kredit yang akan dibayar jika tanaman gaharu telah menghasilkan nantinya. Oleh karena lahan milik rakyat umumnya tidak begitu luas dan sudah ditumbuhi berbagai jenis tanaman. produktivitas meningkat serta kesejahteraan masyarakat akan meningkat pula. Keterlibatan masyarakat dalam pengelolaan hutan meningkatkan posisi tawar serta rasa memiliki masyarakat terhadap sumberdaya hutan yang ada. Oleh karena kawasan hutan umumnya sudah ditumbuhi dengan berbagai jenis tumbuhan. Hal ini sesuai dengan paradigma pembangunan kehutanan yang lebih menitikberatkan pada peningkatan partisipasi masyarakat dalam pengelolaan hutan dan menempatkan masyarakat desa hutan sebagai patner/mitra menuju pengelolaan hutan lestari. baik berupa pengadaan bibit. biaya tanam. biaya inokulasi tanaman maupun informasi tentang peluang dan teknik pengembangan gaharu. Pengembangan tanaman gaharu dalam kawasan hutan dapat dilakukan melalui pelibatan masyarakat sekitar hutan dalam pengelolaan hutan. Dalam prakteknya pengembangan hutan rakyat gaharu umumnya dikombinasikan dengan tanaman semusim atau tahunan lainnya yang sudah ada (tanaman sisipan). maka perlu diberikan berbagai bentuk insentif.Aspek SOSIAL EKONOMI DAN KONSERVASI Agar masyarakat bersedia menanam gaharu. proporsi tanaman gaharu yang ditanam disesuaikan dengan luasan dan kondisi areal hutan milik yang ada. Dampak positif yang terjadi selanjutnya adalah sumberdaya hutan akan lebih terjaga dan terpelihara. baik secara ekonomi. sosial maupun ekologi. Berbagai hasil penelitian menunjukkan bahwa pola kerjasama kemitraan pengelolaan hutan dengan masyarakat desa hutan memberikan dampak positif. maka pola tanam yang dikembangkan adalah pola tumpangsari (sisipan atau tanaman sela di antara tegakan yang sudah ada).

3. Pengembangan kerjasama memang layak secara ekonomi dalam jangka panjang (sesuai jangka waktu kontrak perjanjian kerjasama).. apapun penyebabnya (Aswandi. Tanaman gaharu dipilih karena tanaman ini dapat tumbuh di dalam areal hutan yang sudah banyak ditumbuhi tegakan pohon dengan intensitas cahaya < 70%.(Sri Suharti) setiap jengkal hutan dari kerusakan. 171 . B.. Adanya pengaturan kerjasama yang saling menguntungkan dan adil sesuai dengan kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan bersama.. 2009).Prospek Pengusahaan Gaharu . 2. pengembangan gaharu dengan pola PHBM memberikan peluang kepada masyarakat untuk memperoleh manfaat ganda yaitu dari hasil tanaman gaharu jika telah menghasilkan nantinya serta kesempatan untuk memanfaatkan lahan di antara tanaman untuk usahatani tanaman semusim. 4. pemeliharaannya relatif mudah dan bernilai ekonomi tinggi. Sistim Bagi Hasil dalam PHBM Pengembangan gaharu dengan pola PHBM merupakan salah satu alternatif usaha yang dapat mengakomodasikan kepentingan ekologi di satu sisi dan pertimbangan ekonomi di sisi lain. Adanya kesepahaman tentang resiko dan konsekuensi dari adanya perjanjian kerjasama tersebut. Beberapa prinsip utama yang dipegang dalam pengembangan gaharu dengan pola PHBM adalah: 1. Menempatkan masyarakat sebagai mitra dalam pengelolaan hutan secara tidak langsung juga telah memposisikan masyarakat sebagai garda terdepan dalam pengamanan sumberdaya hutan. Beberapa skenario sebagai alternatif bentuk kemitraan yang dapat dikembangkan antara lain sebagaimana disajikan dalam Tabel 2. Adanya tujuan bersama yang ingin dicapai.. Dari sisi masyarakat.

3. Berbeda dengan pengusahaan gaharu skala besar yang dilakukan oleh para investor. Alternatif bentuk kemitraan yang dapat dikembangkan Jenis input Skenario I 1 Lahan Saprodi Tenaga kerja Bahan inokulan Biaya inokulasi Pengolahan hasil Pemasaran √ √ √ √ √ √ √ 2 3 Skenario II 1 √ √ √ √ √ √ √ 2 3 Skenario III 1 √ √ √ √ √ √ √ √ √ √ √ √ 2 3 Skenario IV 1 2 3 √ √ Keterangan: 1. Dengan demikian meskipun investor/penyandang dana 172 . populasi tanaman gaharu dalam setiap garapan petani berjumlah relatif sedikit serta tidak seragam. Konsekuensinya. 2. Dengan pola PHBM. Gaharu diusahakan sebagai investasi jangka panjang.Aspek SOSIAL EKONOMI DAN KONSERVASI Tabel 2. maka gaharu bukan merupakan komoditi utama yang diusahakan. baik dari segi permodalan. Sebagaimana sifat usahatani skala kecil oleh masyarakat yang ketergantungannya terhadap lahan usahatani yang dimiliki/digarap sangat tinggi. Besarnya bagi hasil yang diperoleh oleh masingmasing pihak yang terlibat dalam PHBM disesuaikan dengan kontribusi masing-masing pihak dan merupakan hasil kesepakatan bersama. tergantung luas lahan garapan dan kepadatan tanaman yang ada. Petani. Investor/Pengusaha. teknologi serta akses terhadap pasar dapat ikut berpartisipasi dalam budidaya tanaman gaharu. budidaya gaharu oleh masyarakat umumnya dilakukan dalam skala kecil dengan pola campuran. Pemda/Pihak lain Sebagaimana diuraikan sebelumnya. pengembangan gaharu dengan pola PHBM dapat dilakukan di areal hutan milik maupun di dalam kawasan hutan sepanjang persyaratan tumbuhnya terpenuhi. diharapkan masyarakat yang memiliki banyak keterbatasan. sepanjang modal yang dimiliki mencukupi untuk biaya budidaya tanaman berikut biaya inokulasinya yang cukup besar.

Cangkara. petai. Oleh karena areal kerjasama sudah ditumbuhi berbagi jenis tumbuhan.. Selama ini masyarakat ikut menggarap lahan di Petak 21 dengan budidaya berbagai tanaman jenis pohon serbaguna (JPSG) dan buah-buahan seperti melinjo.Prospek Pengusahaan Gaharu . Uji coba ini merupakan kerjasama antara Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam dengan masyarakat sekitar areal KHDTK Carita. Kegiatan dilaksanakan dengan melibatkan masyarakat yang telah berusahatani di areal tersebut untuk ikut mengembangkan tanaman penghasil gaharu di lahan garapan mereka. Kegiatan dilaksanakan pada sebagian Petak 21 di areal KHDTK Carita dengan luas ± 40 hektar. C.. maka pola tanam yang diterapkan adalah pola tumpangsari (sisipan di antara tanaman yang ada). dan hawuan. khaya. cengkeh. belum tentu bagian hasil/sharing yang diperolehnya akan paling besar pula. Dengan demikian jumlah 173 . dan Cilaban sebanyak 49 orang (anggota Kelompok Tani Hutan Giri Wisata Lestari yang dipimpin Ustad Jafar sebanyak 40 orang dan Kelompok Tani Hutan Carita Lestari pimpinan Pak Rembang sebanyak 19 orang). Banten pada tahun 2008 telah dikembangkan uji coba skema kemitraan budidaya tanaman penghasil gaharu dengan pola PHBM. Apalagi jika pengembangan kemitraan dengan pola PHBM bertujuan untuk meningkatkan kelestarian sumberdaya hutan (dalam hal ini tanaman gaharu yang sudah langka) dan meningkatkan kesejahteraan masyarakat desa hutan dan bukan semata-mata untuk tujuan komersial (mendapat profit terbesar). Banten. jengkol. di areal tersebut juga terdapat berbagi pohon hutan seperti meranti. Kelompok masyarakat yang terlibat dalam kegiatan penelitian ini berasal dari Desa Sindang Laut dan Desa Suka Jadi tepatnya dari Kampung Longok.. pulai. Uji Coba Pengembangan Gaharu dengan Pola PHBM di KHDTK Carita Di areal KHDTK Carita. dan nangka.(Sri Suharti) memberikan kontribusi input dengan porsi terbesar. mahoni.. Gaharu ditanam dengan jarak ± 5 m x 5 m. durian. Selain tanaman JPSG milik masyarakat.

dan masyarakat calon peserta untuk mempelajari prospek partisipasi masyarakat dalam kegiatan dan pemeliharaan tanaman. Dengan pendekatan yang lebih intensif ini diharapkan masyarakat akan lebih memahami tujuan kerjasama penelitian serta dapat lebih aktif berpartisipasi dalam budidaya tanaman plot uji coba. 2. Pihak pertama akan membantu mencarikan investor untuk bekerjasama menyediakan produksi jamur pembentuk gaharu untuk kegiatan inokulasi untuk 75% tanaman gaharu lainnya.000 pohon (± 400 pohon/ha). 4. Pihak pertama memberikan pembinaan teknis budidaya tanaman gaharu secara rutin kepada pihak kedua. 174 . Pihak pertama menyediakan biaya bagi pihak kedua untuk melakukan kegiatan budidaya penanaman pohon gaharu yang meliputi biaya upah dan bibit tanaman. Setelah diperoleh gambaran prospek partisipasi masyarakat dalam pembangunan demplot uji coba ini dilanjutkan dengan penyusunan rancangan teknis kerjasama penelitian dan penyusunan draft perjanjian kerjasama. Sebelum penanaman.Aspek SOSIAL EKONOMI DAN KONSERVASI tanaman gaharu yang ditanam di areal kerjasama sebanyak 15. Pemda. 5. Beberapa prinsip utama yang disepakati antara pihak pertama (Puslitbang Hutan dan Konservasi Alam) dengan pihak kedua (kelompok masyarakat peserta uji coba) dalam pola kemitraan di areal KHDTK carita adalah: 1. Pihak pertama akan memberikan pelatihan budidaya gaharu serta pemanenan gaharu (paket training gaharu) kepada pihak kedua. Pihak pertama menyediakan jamur pembentuk gaharu untuk kegiatan inokulasi sebanyak 25% dari jumlah tanaman gaharu pada masing-masing penggarap setelah tanaman gaharu berumur ≥ 5 tahun. kegiatan pembangunan demplot uji coba tanaman penghasil gaharu di KHDTK Carita diawali dengan pendekatan yang lebih intensif kepada berbagai pihak yang terkait pengembangan gaharu di areal tersebut seperti Perhutani. 3.

Pihak kedua berkewajiban memelihara dan menjaga keamanan tanaman gaharu dan tanaman hutan lainnya. sebagian hasil tanaman gaharu akan diberikan pada Desa Sindang Laut sebesar 2. 9. Pihak kedua berkewajiban melaporkan setiap kejadian seperti serangan hama/penyakit tanaman.(Sri Suharti) 6. pihak pertama dan pihak kedua memperoleh hasil tanaman gaharu yang ditanam dan dipelihara di lokasi kerjasama dengan proporsi masing-masing 35% untuk pihak pertama dan 60% untuk pihak kedua. 175 . 7. Selain pihak pertama dan pihak kedua. Pihak kedua berkewajiban mengikuti aturan teknis dan kaidah konservasi yang berlaku di dalam areal KHDTK Carita. kebakaran atau bencana lain yang mengakibatkan kerusakan sumberdaya hutan... baik pada tanaman gaharu atau tanaman lainnya di areal kerjasama..Prospek Pengusahaan Gaharu . 8. 10.. Jika sudah menghasilkan. Jika pada saat pemanenan tanaman gaharu ternyata ada tanaman yang mati/hilang/tidak/belum menghasilkan.5%. maka resiko akan ditanggung bersama sehingga perhitungan bagi hasil pada saat panen ditentukan dengan rumus sebagai berikut: = P akhir ∑ tan total − ∑ tan mati x P awal ∑ tan total Keterangan: Pakhir = Proporsi bagi hasil tanaman gaharu yang diterima masingmasing pihak jika ada tanaman yang mati/hilang/tidak/ belum menghasilkan = Proporsi bagi hasil tanaman gaharu sesuai kesepakatan yang tertuang dalam perjanjian kerjasama ini Pawal Butir-butir kesepakatan tersebut tertuang dalam naskah perjanjian kerjasama yang disusun berdasarkan hasil kesepakatan/ negosiasi antara pihak pertama dan pihak kedua.5% dan LMDH (kelompok) 2.

Aspek SOSIAL EKONOMI DAN KONSERVASI KESIMPULAN DAN SARAN 1. Trubus online. Diakses 16 Februari 2009. Prinsip utama yang dipegang dalam pengembangan kerjasama kemitraan dengan pola PHBM adalah prinsip kelestarian dan kelayakan secara ekonomi dalam jangka panjang sesuai jangka waktu kontrak serta saling menguntungkan berdasarkan nilai kontribusi yang diberikan masing-masing pihak untuk mencapai tujuan sosial.co. http:// www. 2002. GAHARU: HHBK yang Menjadi Primadona.74 juta/ha. Skema kemitraan dengan pola PHBM memberikan kesempatan kepada para-pihak yang berminat mengembangkan tanaman gaharu untuk bekerjasama sesuai dengan input/sumberdaya yang dimiliki dan memperoleh bagian hasil/sharing sesuai dengan kontribusi serta kesepakatan parapihak yang terlibat. Gaharu: Harta di Kebun. dan ekologi.53%. Anonim.go. 3. meningkatkan produktivitas lahan serta meningkatkan pendapatan masyarakat sekitar hutan. Gaharu sangat prospektif untuk dikembangkan. 2009. DAFTAR PUSTAKA Adijaya. 4. 5.id/ Halaman/STANDARDISASI_& _LINGUNGAN_ KEHUTANAN/INFO_V02/VI_V02. Info Pusat Standardisasi dan Lingkungan Departemen Kehutanan.htm.trubus.php?mod=publisher&op =viewarticle&cid=8 &artid=290. IRR sebesar 48. 176 .id/mod. D. Diakses 20 Januari 2009.32. Budidaya gaharu layak untuk dilaksanakan karena secara finansial akan memberikan keuntungan bersih nilai kini (NPV) sebesar Rp 147.online. Kerjasama kemitraan pengembangan tanaman penghasil gaharu dengan pola PHBM merupakan salah satu alternatif solusi untuk menjaga kelestarian hutan. http:// www. ekonomi. khususnya bagi Indonesia yang memiliki potensi biologi yaitu tersedianya beragam spesies tumbuhan penghasil gaharu dan masih luasnya lahan-lahan kawasan hutan yang potensial serta tersedianya teknologi inokulasi yang menunjang untuk pembudidayaan gaharu. dan B/C = 3.dephut. 2.

ffi. Indradi.bticnet. 51. Mencari Solusi PHBM di Geumpang. Review of Significant Trade Aquilaria malaccensis.. Blanchette. Y. 12 Februari. http:// forestry-senu57. P. http://laksmananursery. A. Sungadan. Aswandi.id/id/news /1/tahun/2007/bulan/11/tanggal/17/id/ 60/. http:// www. Access November. 2009. http://bpk-aeknauli. C. Diakses 16 Februari 2009.php ?option=com_content&task= view&id= 74&Itemid=1. Diakses. 2009. Vietnam. M.php?mod=publisher &op=viewarticle&cid=1& artid=1618. Perkembangan Gaharu dan Prospeknya di Indonesia. Working paper No.umn. http:// www. Sustainable Agarwood Production in Aquilaria Trees. Eaglewood in Papua New Guinea. Depatemen Kehutanan. 2009. htm..id. 2007.org/index. S. Departemen Kehutanan. Anonim. (2004).Prospek Pengusahaan Gaharu . Diakses 16 Februari 2009.cites.. 2007. or. 2009.. R.edu/ agarwood. http://www. Rizlani. Statistik Kehutanan Indonesia 2006. 2009. 2006.cfans. Jakarta..trubus-online. B. 2009.or. BIOTROP Training and Information Centre. Prospek Budidaya Gaharu Secara Ringkas. BUDIDAYA GAHARU : Alternatif Pemberdayaan Masyarakat Desa Hutan.com/2008/01 /perkembangangaharu-dan-prospeknya-di. Steven. 2003. Chatteron. L. Perjalanan Panjang Pengelolaan Hutan Berbasis Masyarakat di Indonesia.. 177 . 2008. Diakses 4 Maret 2009. Z.co. Tersandung Wangi Gaharu.htm. Duryatmo. 3 2008. Tropical Rain Fo rest Project. http://fwi. Di akses 4 Maret 2009.org/eng /com/PC/14/EPC14-09-02-02-A2. Sumari and P. dan Aswandi.pdf.blogspot. Gun.id/mod.html. 2005. http://www.. Pelatihan Nasional: BUDIDAYA DAN PENGOLAHAN GAHARU.html. Diakses 16 Februari 2009. Diakses 13 Januari. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES).com/2009/01/ prospek-budidaya-gaharu-secara ringkas. com/gaharu.(Sri Suharti) Anonim. Trubus online. Anonim. Diakses 16 Februari 2009. Hayat.blogspot. http://forestpathology.

co. . Wiguna. Budidaya dan Rekayasa Produksi Gaharu. http://www. Tinggi Permintaan Terganjal Pasokan. Trubus online. Squidoo. http://www. Squidoo. Temu Pakar Pengembangan Gaharu.Sumarna. 2007.online. Diakses 16 Februari 2009. Direktorat Jenderal RLPS. Access November. Y. squidoo. LLC and respective copyright owners. 2006. Production and marketing of cultivated agarwood.3 2008.id/mod.php?mod =publisher&op=viewarticle& cid=8 &artid=290.trubus. Jakarta. 2008.com/agarwood Copyright © 2008. I.

500 3000 1250 250 5000 0 0 0 0 0 250 0 250 6750 125 350 300 150 0 0 7675 0 125 350 300 300 0 0 1075 0 250 700 600 300 0 0 1850 0 250 700 600 300 250 0 2100 0 375 1050 900 300 0 20000 22625 0 2500 2500 250 5250 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 0 0 2500 0 2500 500 5500 20000 500 26500 6750 1750 4900 4200 1950 800 20000 40350 III. Pupuk TSP/SP-36 4. Peralatan pertanian 7.000/kg. Bahan inokulan Biaya bahan & peralatan c. Bibit tanaman gaharu 2. KCl Rp 6000/kg. 744000 II. Pra-investasi 2. NPV (DF 15%) b. IRR. Tenaga kerja upahan 3. Pra investasi 1. Lampiran 1.53% 3. Analisis NPV. Output (kg) b.550.742 48. Keterangan I. Lain-lain Biaya pra investasi b. IV.000/tanaman .3176 2500 1000 0 3500 16425 -16425 -21675 2500 1000 0 3500 7075 -7075 -28750 2000 500 0 2500 6850 -6850 -35600 1500 500 0 2000 6600 -6600 -42200 1500 500 12000 14000 39125 -39125 -81325 1500 500 0 2000 7125 -7125 -88450 1500 500 0 2000 6650 -6650 -95100 20000 25000 0 45000 46250 697750 602650 33000 29500 12000 74500 141350 602650 179 Catatan: Produksi gaharu 480 kg/ha dengan harga rata-rata Rp 1. B/C 0 0 0 0 5250 -5250 -5250 147. Tenaga kerja keluarga 2. Biaya bahan & peralatan 1. Pupuk Urea 3. Tenaga kerja inokulasi Biaya tenaga kerja Total biaya Cash flow Cash flow komulatif a. Nilai output Gaharu kemedangan I (10%) Gaharu kemedangan II (40%) Gaharu kemedangan III (50%) Cash outflow (Rp 1000) a. dan pupuk kandang Rp 150/kg Harga inokulan Rp 50.Lampiran 1. jumlah tanaman 400 phn/ha dibutuhkan 450 phn dg sulaman. Cash inflow (Rp 1000) a.000/phn. Harga pupuk urea Rp 2500/kg. K2= Rp 2 juta/kg dan K3=Rp 500. IRR (%) c. TSP Rp 7000/kg. Pupuk kandang 6. Harga bibit Rp 15. Persiapan lahan & tanam 3. Biaya tenaga kerja 1.000/kg Harga gaharu K1= Rp 5 juta/kg. Sewa lahan 4. Pupuk KCl 5. dan B/C dari Pengusahaan tanaman gaharu per hektar 0 0 0 0 0 0 0 0 0 480 744000 240000 384000 120000 0 0 1250 0 1250 0 375 1050 900 300 0 0 2625 0 250 700 600 300 300 0 2150 0 0 0 0 0 0 0 0 1 2 3 4 5 Tahun ke6 7 8 Total No.

Aspek SOSIAL EKONOMI DAN KONSERVASI 180 .

namely. 181 . the gaharu production may be considered low. Only small group of farmers using introduced inoculants.and in-side the forest in Indonesia. the gaharu export market remains open. Most of the gaharu formation usually relays on natural infection. In South Kalimantan. The success of gaharu formation may not be only due to inoculants but may also be influenced by environmental characteristics (climate. The present work focused on characterizing the environment. Therefore there is a big opportunity for the Indonesian farmers to establish eaglewood plantation. soil properties and plant species). This is because.10 THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN SITE FOR EAGLEWOOD PLANTATION PROJECT Erry Purnomo Lambung Mangkurat University. South Kalimantan INTRODUCTION Eaglewood (gaharu) may play an important role in gaining foreign exchange and as a source of income for people living in out. There is a lack of information on factors influencing the success of gaharu formation. climate. soil properties and plant diversity surrounding the newly grown and existing gaharu stands in South Kalimantan Province.

6 Figure 1. The selected study sites B. The sites located in Banjar. The data were supplied by the Weather Bureau in Banjarbaru.2 Belanti (3) (HSS) Rejo (Banjar) 115.4 3. The data obtained were for the last 9 years observation. HST) Kalaka (HST) Kandangan (HSS) Madang (HSS) 115. 14 sites would be used for newly planted eaglewood trees and 9 sites for inoculation trial.0 2.1 115. The selected site were used for growing eagle wood and inoculation. Climatic Characters The climate parameters collected were rainfall. Site Distribution of selected sites for the project can be seen in Figure 1.6 2.3 North 115. South Kalimantan. Hulu Sungai Selatan (HSS) and Hulu Sungai Tengah (HST). 115.5 Layuh (2. 182 .6 22.7 Wawai (HST) 115.8 km 115.8 3. HST) Aluan (3) (HST) Bawan (HST) Gading (HST) Batung (HST) Layuh (HKK) (HST) Rasau (HST) Kambat (2. The climatic data for all sites were represented by Kandangan weather station.2 3.0 oS 3.4 2. Location-wise.Aspek SOSIAL EKONOMI DAN KONSERVASI METHODS A.4 oE 115. air temperature and relative humidity.

total nitrogen (N). air temperature and relative humidity for the last 9 years are shown in Figure 2. 183 . the content of total carbon (C). Soil Properties Soil properties measured were particle fraction analysis. The rainfall distribution can be observed in Figure 2a. The average annual rainfall in the study area was 2361. electric conductivity (EC).The Environmental Characteristics .... cation exchange capacity (CEC). Plant Diversity The diversity of plant species was determined to show its association with the success of inoculation. and CO2 evolution. In each site. RESULTS A. (1982). Method used for particle fraction analysis was described in Klute (1986) and the methods for other soil properties were described in Page et al. Climatic Characters The average rainfall.72 mm. respectively. total potassium (K) and total phosphorus (P). The rainy season commenced in October and ended in July each year. A significant low rainfall occurred in the period of July-September.(Erry Purnomo) C. soil pH. plant species grown under gaharu tree were collected plant within area of 6x6 m2.. The pattern of air temperature and relative humidity are shown in Figure 2b and 2c. D.

(1994). cation exchange capacity (CEC). Bars indicate the standard error mean 9 years observation B. If applicable. Soil Properties The soil properties of each site are presented in Figures 3-11. Soil properties measures were particle fraction analysis. Total nitrogen (N). total potassium (K) and total phosphorus (P). followed by clay and sand fractions. electric conductivity (EC). soil pH. level of status of each soil property will be made available as categorized by Djaenuddin et al.Aspek SOSIAL EKONOMI DAN KONSERVASI 500 [a] 400 30 [b] 29 Air temperature (oC) 30 [b] 29 Rainfall (mm) 300 200 100 28 27 26 25 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month 0 l t ary ary rch Apri May June July gus mbertobermbermber nu ru Ma Au pte Oc ove ece Ja Feb N D Se Month Air temperature (oC) 28 27 26 25 0 l t r r r r ary ary rch pri May June July gus mbe tobe mbe mbe nu ru Ma A Au pte Oc ove ece Ja Feb N D Se Month Figure 2. the content of total carbon (C). The particle fraction analysis (Figure 3) shows that all soil samples dominated by slit fraction. air temperature [b] and relative humidity [c] for the last 9 years. 184 . and CO2 evolution. The rainfall [a].

16 gsa da i H i 15 T Lan Man Waw and Waasauyuh K ang ur Gaat (2Belandang angk M R La Mad Ha mb H Ma Ka Site Figure 4. Particle fraction analysis of each soil 2.5 Total C content (%) 1.0 Very low Be ti lan t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin . Two sites.. namely.. 100 80 60 Sand Silt Clay % 40 20 0 n Bela 5 ti 1 t ) ) i s 3 g h 3 w . respectively. Most of the soil classified as very low to low level of K concentration. The total C of soil for each site 185 .. The low level of C and N content confirms the low level of organic matter content of the soil.16 angsa andala awai dingin awa au (10 Kate g Hig adin (2 & 3 lanti 1 ng Lo gkinkin W as M W Man uh an aur G bat da Han Be TL R Lay Mad H Ma Kam Site Figure 3. It was found that Wawai and Belanti 13 sites had very low and moderate levels of N content. only 5 sites had low C. The N content of the soils (Figure 5) was generally low.(Erry Purnomo) The category range of total C total content was very low to low (Figure 4).. Mandala and Madang Low had K content of moderate level.5 0.The Environmental Characteristics . Most of the selected sites contained very low C.5 Moderate 2.0 Low 1. The K and P contents of the soils from all sites are demonstrated in Figures 6.0 0.

C. Most of total P content of the soils was categorized as very low to low. Only one site (Belanti 13) had a slightly acidic value (Figure 8). except for Hangkinkin site. At 5 sites.05 0. The low EC readings indicate the absence of salinity problem. Only one site (Rasau 10) was categorized as very high (Figure 7). Number of Plant Species It was observed that the number of plant species was varied from site to site (Figure 12).Aspek SOSIAL EKONOMI DAN KONSERVASI 0.20 Total N content (%) Low 0. The low EC readings may be associated with the far distance from the shore. There were 3 sites and 2 sites had CEC of moderate and high.25 Moderate 0. Except. at Madang Low. respectively. there were 3-5 plant species. all soils had EC below 1 mS cm-1 (Figure 9). The low CEC indicates a low storage cation capacity and results in prone to cation leaching. Almost all the soil pH of the selected soils was categorized into very acidic to acidic category. For EC reading. 186 . it was observed that the microbial was lower than the other sites. The CO2 evolution as an indication microbial activity was similar site-wise (Figure 11). The CEC of the soils were commonly low (Figure 10). The total N of soil for each site One site (Rasau 10) had a very high K level.00 Very low la n Be 16 ngsat dalawai 3 inginawai (10) ates High ding & 3) ti 13 Low inkin n a d W sau h K ng r Ga t (2 elan ang ngk 5ti 1 T La Ma W Man B ad Ha Ra Layu ada Hau mba M M Ka Site Figure 5.15 0.10 0.

..16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 7.16 gsa dalawai 3inginawa u (10 ate High ding & 3nti 13 Lowinkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2Belaadangangk M H L M d Ha am b a M K Site Figure 6. Total K content of soil for each site 2600 2400 Total P content (%) 2200 2000 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s ...(Erry Purnomo) The other 8 sites had 5-14 plant species and one site had 22 plant species.The Environmental Characteristics . Total P content of soil for each site 187 . 1200 1000 Total K content (%) 800 600 400 200 0 Very high High Moderate Low Very low nt Bela ) ) t s i .

Cation exchange capacity of soil for each site 188 . Electrical conductivity readings for soil each site Cation exchnage capacity (cmol[+]kg-1) 40 30 High 20 Moderate 10 Low Very low ) ) t s i g a 3 3 h n n .16 gsa dalawai 3 inginawai (10 Kate High ding & 3 ti 13 Low inkin g i 15 T Lan Man WaMand WRasauyuhadang ur Ga t (2BelandanHangk La M Ha am b a Ma K Site Figure 9.16 gsa dal ai ngi wa (10 ate Hig din & 3 ti 1 Low nki 15 T Lan Man Waw andi Wa asau yuh K ang ur Gaat (2Belan dang angki R La n ti a M H ad Ha m b a M M Bel Ka Site 0 Gambar 10.1 angs anda awanding aw au (uh Katng Hr Gadi (2 & lantiang Lngkink WRas y W Ma M BeMad Ha n ti 1 T L L a Ma d a H a u m b a t a Bela K Site 0 Figure 8. Soil pH for each site 130 Electric conductivity (mScm-1) 120 110 100 2 1 0 nt Bela ) ) t s .Aspek SOSIAL EKONOMI DAN KONSERVASI 7 Neutral Slightly acidic 6 Soil pH H2O 5 Acidic 4 Very acidic la i 3 6 in in ai 10) 3) 13 ow at es igh ng 5 .

(Erry Purnomo) 2000 1600 1200 CO2 evolution (mg C kg-1) 800 400 0 an t Bel ) ) t s i g a 3 ... CO2 evolution from soil from each site DISCUSSION The rainfall pattern was typical the study area.. In May. The number of plant species found in each site 189 . June and October the rainfall ranged 132-151 mm. The lowest rainfall was observed in the period of July-September ranging 54-84 mm.The Environmental Characteristics . 25 Number of plant species each site 20 15 10 5 t la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin . The highest rainfall occurred in the period of November-April ranging 215-358 mm..16 gsa da H i i 15 T Lan Man W aw and W a asau yuh Kdang ur Ga at (2 Belan dang angk M nti R La Ma H Ha amb Ma ela B K 0 Sites Gambar 12. The schedule of inoculation may have to consider the climatic condition throughout the year.16 gsa dal wai 3 inginawa u (10 ate High din & 3nti 1 g Low inkin i 15 T Lan Man Wa and WRasaayuhaK ang ur Ga t (2BelaadanHangk M L M d Ha am b a M K Site Gambar 11.

190 . The number plant species were varied from site to site. Banjar. The annual total rainfall in the area under study was 2361 mm. It seems that there was a shading affect on the gaharu trees growth. This may result in the failure of gaharu formation. In general. (1994) leads the need to amend to improve the soil fertility status. improving the fertility status may results in healthier eaglewood trees. ACKNOWLEDGEMENT I would like to thank ITTO for funding the work. Maman Turjaman for the invitation to be involved in the project. Hulu Sungai Selatan and Hulu Sungai Tengah. Therefore. The rainy season began in October and ease in June. it was found that there was gaharu trees growth variation under different plan species grown surrounding the gaharu trees. The healthy trees may immune to the infection.Aspek SOSIAL EKONOMI DAN KONSERVASI The low fertility status according to Djaenuddin et al. Dr. However. M Yani. namely. I also acknowledge the anonymous reviewer who critically commented on the manuscript. CONCLUSION The selected sites were distributed in regencies. the soil in each site was considered very poor. It is too early to gain any conclusion on the effect of environmental characters on gaharu production. Presto Janu Saputra and Storus for supporting the field work. Mrs. From field observation. further study is still needed to investigate the relationship between soil properties or plant diversity on eaglewood growth or the success of inoculants application. Plants grown under the gaharu was quite divers from site to site.

Pp. Sukardi. S. 2nd Edition. Land Suitability for Agricultural and Silviculture Plants.. A. Part 1 Physical and mineralogy methods...REFERENCE Djaenuddin.L.. V. Bogor. (In Indonesian). and Jordens. D. Subagjo. Center for Soil and Agroclimate Research. (1986) Methods of soil Analysis. and Keeney. Dai. Miller.R. Ds. (1982) Methods of soil Analysis. Hakim. April 1994. 2nd Edition. E. J. L. N. R.. S. ASA. Suharta. Widagdo. 191 . Versi 1.H. Ismangun.. Hardjowigeno. SSSA. Klute. M. 7.. Laporan Teknis No. SSSA. Madison. Basuni. Marsudi.. A.0.1188 Page. Bachri. Madison.. ASA. Suwandi... H.R. Pp 1159. Chemical and microbiological properties. D.

Aspek SOSIAL EKONOMI DAN KONSERVASI 192 .

Karena jenis pohon ini mempunyai nilai ekonomi tinggi. Dalam kegiatan penelitian ini difokuskan pada jenis-jenis pohon dari genus Aquilaria. Wikstromeae spp. Gaharu merupakan salah satu kayu aromatik penting. Oleh karena itu beberapa 193 . dan Gyrinops spp..(Pratiwi) 11 KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI BEBERAPA HUTAN TANAMAN DI JAWA BARAT Pratiwi Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu merupakan salah satu hasil hutan non kayu yang mempunyai nilai penting.. Genus ini termasuk dalam famili Thymelaeaceae. (Chakrabarty et al... seperti Aquilaria spp. 1986). microcarpa. 1994. karena secara ekonomis jenis ini dapat meningkatkan devisa negara dan sumber penghasilan bagi masyarakat yang hidup di dalam maupun sekitar hutan.. Ada beberapa jenis tumbuhan yang dapat menghasilkan gaharu.. malaccensis dan A.Karakteristik Lahan Habitat . Gonystylus spp. Enkleia spp.... Sidiyasa et al.. maka keberadaan jenis ini perlu dipertahankan.. Aetoxylon spp. Salah satu upaya yang dapat dilakukan adalah dengan mengembangkan tanaman gaharu dalam hutan tanaman di beberapa area. Awalnya gaharu berasal dari pohon tropika yang terinfeksi jamur. sehingga hasil hutan non kayu ini menjadi subjek pemanenan yang cukup tinggi. yaitu A.

Dramaga. dan iklim (termasuk iklim mikro) harus dipertimbangkan sebagai bagian dari ekosistem yang terintegrasi. sehingga keberadaan jenis ini dapat dilestarikan. Sifat-sifat tanah yang spesifik mempengaruhi komposisi vegetasi yang ada di atasnya (Pratiwi. Secara administrasi pemerintahan. Tanah sebagai bagian dari suatu ekosistem merupakan salah satu komponen penyangga kehidupan. dan Sukabumi. organisme. Pratiwi dan Mulyanto (2000) serta Jenny (1941) menyebutkan bahwa tanah merupakan hasil proses pelapukan batuan yang dipengaruhi oleh faktor-faktor iklim. Lokasi dan Waktu Penelitian Penelitian dilakukan pada bulan September 2008 di Carita. maka penelitian ini bertujuan untuk mendapatkan informasi tentang sifat-sifat habitat pohon penghasil gaharu di hutan tanaman gaharu di daerah Carita. di samping air. Sepanjang komponen tanah bervariasi. Provinsi Banten sedangkan 194 . udara. sebagaimana juga diharapkan dapat meningkatkan pendapatan dan kesejahteraan masyarakat. Sehubungan dengan hal tersebut di atas. Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah dan topografi serta vegetasi. maka tanah dan karakteristiknya akan berbeda-beda dari satu tempat ke tempat lain. 1991). Carita terletak di Kabupaten Pandeglang. METODOLOGI A. dan energi matahari. topografi. Dramaga. Diharapkan informasi ini dapat mendukung pengembangan hutan tanaman pohon penghasil gaharu. dan waktu. Tanah yang berbeda dengan sistem lingkungan yang bervariasi akan menentukan vegetasi yang ada di atasnya.Aspek SOSIAL EKONOMI DAN KONSERVASI informasi sehubungan dengan habitat pohon penghasil gaharu perlu diinventarisasi. jenis tanah. Selanjutnya Pratiwi dan Mulyanto (2000) menyatakan bahwa penyebaran tumbuhan. dan Sukabumi. agar kemampuan lahannya dapat diketahui. termasuk sifat-sifat tanahnya dan komposisi vegetasi tumbuhan bawah yang ada di sekitarnya.

Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Temperatur udara bervariasi antara 24ºC sampai 30ºC. C. dan meteran. alat-alat survei lapangan seperti bor tanah. B. cangkul.000 mm per tahun. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC.000 (Lembaga Penelitian 195 . Dramaga. Pengambilan Contoh Tanah Plot dibuat di area yang telah dipilih berdasarkan peta tanah Jawa dan Madura pada skala 1:500.(Pratiwi) Dramaga terletak di Kabupaten Bogor. 1951) dan curah hujan tahunan sekitar 3.. 2005).Karakteristik Lahan Habitat . Jawa Barat serta Sukabumi di Provinsi Jawa Barat.. Bahan lain adalah berupa data hasil analisis vegetasi untuk tingkat semai (termasuk tumbuhan bawah). Metode Penelitian Penelitian dilakukan dengan membuat plot-plot penelitian untuk pengamatan sifat-sifat tanah. topografi. Pengamatan terhadap sifat-sifat tanah dan topografi dilakukan di dalam plot yang sama dengan pengamatan vegetasi. Sedangkan alat yang dipakai dalam penelitian lapangan adalah alat-alat tulis. 1951) dan curah hujan sekitar 3. 1.600 mm per tahun.. dan vegetasi.. dan Sukabumi. Jumlah contoh tanah yang diambil di masing-masing lokasi adalah sebanyak 6 buah. 1951) dan curah hujan sekitar 3. Bahan dan Alat Penelitian Sebagai bahan penelitian adalah contoh tanah yang diambil dalam plot penelitian di Carita.959 mm. Kelembaban udara ratarata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. Kelembaban udara rata-rata berkisar antara 80% sampai 90%. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. Munsell Color Chart. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson.

5 m (Kartawinata et al. 1962). 30-60 cm.. Sedangkan tingkat semai dan tumbuhan bawah diamati dengan cara membuat petak 1 m x 1 m di dalam jalur pengamatan pohon dan belta. Al. Seluruh jenis pohon dan belta dihitung dan diukur diameternya. Dengan demikian ada 18 contoh tanah yang dikumpulkan.Aspek SOSIAL EKONOMI DAN KONSERVASI Tanah. Contoh tanah diambil dari setiap horizon yang telah diidentifikasi untuk dianalisis di laboratorium. contoh tanah diambil pada 20 titik yang tersebar di masing-masing horizon. porositas. KTK. Pengamatan Vegetasi Pengamatan vegetasi dilakukan terhadap seluruh vegetasi yang ada dalam plot. Kriteria 196 . Mg. Sedangkan untuk pengamatan belta dilakukan dengan membuat petak berukuran 10 m x 10 m di sepanjang jalur tersebut dengan interval 10 m. Seluruh semai dan tumbuhan bawah yang ada dicatat dan dihitung jumlahnya. ketersediaan P. Dua macam contoh tanah yang diambil adalah contoh tanah terganggu untuk analisis sifat-sifat fisik dan kimia tanah serta contoh tanah tidak terganggu untuk pengamatan sifat fisik tanah (porositas dan berat jenis tanah). KB.. Sifat-sifat tanah yang dianalisis. 1981). dan sifat kimia yaitu pH H2O. 2. Kemudian contoh tanah dicampur sesuai kedalamannya. Sedangkan belta merupakan tumbuhan dengan diameter setinggi dada (1. Pada setiap kedalaman tanah. K. berat jenis. Kriteria pohon adalah tumbuhan dengan diameter setinggi dada (1. dan semai. Plot-plot contoh berukuran 20 m x 20 m dibuat untuk pengamatan pohon dengan interval 20 m pada jalur sepanjang satu km.3 m)>10 cm. permeabilitas. belta. meliputi: a) sifat fisik yaitu tekstur. Ntotal. dan H+ (sifat kimia) (Blackmore et al. dan > 60 cm di setiap lokasi penelitian. yaitu pada tingkat pohon. 1976). Na. Pengamatan vegetasi dilakukan terhadap semai dan tumbuhan bawah yang ada di bawah tegakan/pohon penghasil gaharu.3 m) antara 2 cm sampai < 10 cm dan semai merupakan permudaan dari kecambah sampai tinggi < 1. Corg. Contoh tanah komposit diambil pada kedalaman 0-30 cm. Ca. Total tanah komposit yang dikumpulkan dari masing-masing lokasi adalah enam contoh (tiga untuk analisis sifat fisik tanah dan tiga untuk analisis sifat kimia tanah).

yaitu: SI = Dimana : 2w a+b SI = Similarity Index w = Jumlah dari nilai penting terkecil untuk jenis yang sama yang ditemukan pada dua komunitas yang dibandingkan (A dan B) a = Jumlah nilai penting dari semua jenis yang ada di komunitas A b = Jumlah nilai penting dari semua jenis yang ada di komunitas B 197 . Jenis yang diperoleh kemudian dibuat spesimen herbariumnya untuk diidentifikasi di laboratorium Botani dan Ekologi Hutan... Analisis Data Sifat-sifat fisik dan kimia tanah dihitung sesuai dengan formula pada standar prosedur dari setiap karakteristik tanah kemudian ditabulasi untuk setiap horizon. Seluruh semai dan tumbuhan bawah yang ada dalam plot dicatat nama daerahnya. Untuk vegetasi. jalur dibuat sebanyak tiga buah masing-masing sepanjang 100 m. dan dihitung jumlahnya serta diukur luas penutupan tajuknya. P3HKA. 1976). Bogor. 1974). data yang diperoleh ditentukan spesies dominannya dengan menghitung nilai penting sesuai dengan rumus yang dikemukakan oleh Kartawinata et al.5 m (Kartawinata et al.. (1976). Pada masingmasing lokasi.. Spesies dominan merupakan spesies yang mempunyai nilai penting tertinggi di dalam tipe vegetasi yang bersangkutan. Plot-plot berukuran 1 m x 1 m diletakkan di jalur pengamatan vegetasi di dalam tegakan/pohon penghasil gaharu. Indeks kesamaan jenis dihitung dengan menggunakan rumus Sorensen (Mueller-Dum-bois and Ellenberg.Karakteristik Lahan Habitat .. D.(Pratiwi) semai adalah permudaan jenis tumbuhan berkayu dari kecambah sampai tinggi < 1.

1951) dan curah hujan sekitar 3. Sedangkan Sukabumi mempunyai topografi bergelombang sampai berbukit dengan tipe curah hujan A (Schmidt dan Ferguson. Topograpfi di daerah Carita bergelombang sampai bergunung sedangkan di Dramaga datar sampai bergelombang dan di Sukabumi bergelombang sampai berbukit. Vulkanik material dari lokasi-lokasi ini memiliki sifat andesitik.000 mm per tahun.600 mm per tahun. Temperatur udara bervariasi antara 20ºC sampai dengan 25ºC. Temperatur udara bervariasi antara 24ºC sampai 30ºC. Bahan induk tanah Carita adalah dari Gunung Danau sedangkan Dramaga dan Sukabumi masing-masing dari Gunung Salak dan Gede Pangrango. Kelembaban udara rata-rata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan Konservasi Alam. Karakteristik Tanah di Daerah Penelitian Karakteristik tanah sangat dipengaruhi oleh faktor-faktor pembentukan tanah dan sifat-sifat tanah. Sedangkan Dramaga mempunyai topografi datar sampai bergelombang dengan tipe curah hujan A (Schmidt dan Ferguson. khususnya sifat fisik dan kimia. Dramaga. Ini berarti bahan induk daerah ini kaya akan mineral-mineral ferro-magnesium dan beberapa mineral sebagai sumber elemen basa. 1. 1951) dan curah hujan sekitar 3. Kelembaban udara rata-rata berkisar antara 80% sampai 90%. 198 .959 mm.Aspek SOSIAL EKONOMI DAN KONSERVASI HASIL DAN PEMBAHASAN A. Tipe mineral-mineral ini sangat dipengaruhi oleh sifat-sifat tanah. Faktor-Faktor yang Mempengaruhi Pembentukan Tanah di Lokasi Penelitian Penelitian dilakukan di tiga lokasi. yaitu Carita. Lokasi penelitian Carita memiliki topografi bergelombang sampai bergunung dengan tipe curah hujan A (Schmidt dan Ferguson. Temperatur minimum sekitar 26ºC dan temperatur maksimum 32ºC. dan Sukabumi. 2005). 1951) dan curah hujan tahunan sekitar 3.

Sifat Fisik Tanah Sifat fisik tanah.(Pratiwi) Penggunaan lahan di ketiga lokasi penelitian adalah hutan tanaman pohon penghasil gaharu. melinjo (Gnetum gnemon). Tabel 5. Dari data tekstur tanah dapat dilihat juga bahwa tanah di dalam profil menunjukkan adanya akumulasi liat. dengan areal sekitar 5 ha dan dibangun pada tahun 1998 dengan total 346 pohon. Sedangkan tanah di lokasi penelitian Sukabumi memiliki KB lebih dari 50% sehingga diklasifikan sebagai alfisol. 199 . microcarpa di Sukabumi.. Pada tabel tersebut terlihat bahwa ketiga lokasi penelitian memiliki sifat-sifat fisik tanah yang relatif sama. antara lain berkaitan dengan tekstur. Di Carita. Ini berarti seluruh tanah di lokasi penelitian memiliki sub horizon argilik. dan Tabel 3. Hal ini mengindikasikan bahwa partikel tanah yang dominan adalah fraksi liat. dan Tabel 6). Sifat-Sifat Tanah a.8. Implikasi dari kelas tekstur ini adalah retensi air dan hara pada tanah ini relatif bagus. berat jenis. Tanah yang memiliki horizon argilik dapat diklasifikasikan sebagai alfisol atau ultisol tergantung kejenuhan basanya (KB). nangka (Artocarpus integra). Tanah di Carita dan Dramaga memiliki KB kurang dari 50% (Tabel 4. Pohon penghasil gaharu ditanam bersama dengan tanaman lain. 2. Spesies yang ditanam adalah Aquilaria crassna dan A. Data analisis tekstur tanah menunjukkan bahwa tanah di semua lokasi penelitian memiliki kelas tekstur liat.Karakteristik Lahan Habitat ... Hal ini menunjukkan bahwa tanah di lokasi penelitian berkembang dari material vulkanik tuff. Hasil penelitian sifat-sifat fisik tanah disajikan pada Tabel 1. Tabel 2. dan permeabilitas. Ketinggian daerah ini sekitar 100 meter di atas permukaan laut. durian (Durio zibethinus) dan sebagainya. Berat jenis (BD) tanah di semua lokasi penelitian kurang dari 1 tetapi lebih dari 0. Oleh karena itu tanah ini diklasifikasikan sebagai ultisol. Sedangkan di Dramaga dan Sukabumi. gaharu ditanam secara monokultur dan ditanam masing-masing tahun 1993 dan 1999. umumnya pohon serbaguna seperti pete (Parkia speciosa).. porositas. jenis yang ditanam adalah Aquilaria microcarpa. microcarpa di Darmaga dan A.

93 0.45 66. Tabel 1.57 69.90 0.33 5. sehingga tanah di lokasi penelitian termasuk dalam ordo andisol dalam sistem taksonomi tanah (Soil Survey Staff.87 0.90 64.98 9.99 68. porositas tanah di horizon permukaan lebih rendah daripada di bagian bawahnya.85 Berat Jenis Porositas (%) Tabel 2.33 8.99 63.01 Tekstur Debu (%) 25. 1994).13 Debu (%) 12.10 36.84 0.10 22.78 Kelas tekstur Liat Liat Liat 0.21 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 200 . Informasi ini menunjukkan bahwa terjadi fenomena pemadatan tanah (soil compaction) karena adanya injakan (trampling) dan mungkin adanya jatuhan butir-butir hujan dari batang pohon (stem fall).51 Liat (%) 66.55 6. Sifat-sifat fisik tanah di lokasi penelitian Dramaga Sifat fisik Kedalaman (cm) Pasir (%) 0-30 30-60 > 60 0 30 60 8.09 Liat (%) 79. Hal ini menunjukkan bahwa tanah ini mempunyai sifat andik.86 66.35 57. Sifat-sifat fisik tanah di lokasi penelitian Carita Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 8. Sedangkan berat jenis tanah di tiga kedalaman kurang dari satu.48 Kelas tekstur Liat Liat Liat 0.69 85.59 11.08 81.96 65.33 6.Aspek SOSIAL EKONOMI DAN KONSERVASI Data porositas tanah menunjukkan bahwa di semua lokasi penelitian.

kecuali Sukabumi.49 84. dan Mn.75 Berat Jenis Porositas (%) 0-30 30-60 > 60 0 30 60 Sedangkan porositas di lokasi penelitian menunjukkan bahwa semakin ke bawah porositasnya semakin kecil. N. dan Tabel 6.73 5. Mg.95 11. maka akan mengakibatkan kapasitas tanah menampung air dan udara menurun.97 0.. kejenuhan basa (KB).90 26. Namun demikian tanah-tanah di lokasi 201 . Sifat Kimia Tanah Sifat-sifat kimia tanah. Namun demikian Bullock et al. Hal ini menunjukkan semakin ke dalam jumlah pori-pori semakin kecil yang diakibatkan antara lain oleh adanya pemadatan tanah. Sifat-sifat fisik tanah di lokasi penelitian Sukabumi Sifat fisik Kedalaman (cm) Tekstur Pasir (%) 12. Hal ini terjadi juga di ketiga lokasi penelitian.. P tersedia.37 Liat (%) 68. Ca. pH H 2O di semua lokasi penelitian umumnya kurang dari lima. Keterangan yang lebih lengkap dapat dilihat pada Tabel 4. Fe. C.09 Kelas tekstur Liat Liat Liat 0. Na.Karakteristik Lahan Habitat .. Pratiwi dan Garsetiasih (2003) menyatakan bahwa pemadatan tanah dapat diakibatkan oleh karena injakan manusia. kapasitas tukar kation (KTK). Zn.54 Debu (%) 18. Al. meliputi pH H2O. di mana lokasi-lokasi ini merupakan hutan tanaman. Cu.86 0. (1985) menyatakan bahwa nilai ini tergantung bukan saja oleh jumlah pori tetapi juga tingkat kontinuitas pori.59 68. Nilai permeabilitas tanah menunjukkan laju pergerakan air. Adanya pori-pori yang menurun jumlahnya.(Pratiwi) Tabel 3.78 9. Tabel 5..15 62.83 63. K. umumnya diikuti dengan penurunan persentase ruang pori atau porositas dan juga penurunan nilai permeabilitas tanah. Peningkatan berat jenis tanah. Hal ini terlihat pada lokasi penelitian. b.43 67.

Menurut Sutanto (1988). Perbandingan C/N di semua horizon tergolong tinggi. Hal ini dapat dimengerti karena di lokasi penelitian Carita. K. H. Tanah dengan kandungan Al yang tinggi memiliki sifat toksik. Pratiwi (2004 dan 2005) menyatakan bahwa unsur ini khususnya di lapisan atas mempunyai fungsi yang sangat penting dalam perkecambahan biji. khususnya di horizon bagian atas. 202 .Aspek SOSIAL EKONOMI DAN KONSERVASI penelitian masih dikategorikan asam. Mn. Zn. ketersediaan dari unsur-unsur esensial ditentukan oleh bahan organik dan proses-proses dinamis yang ada di dalam profil tanah. dan H+. maka reaksinya asam dan kejenuhan basanya kurang dari 100%. Oleh karena itu di ketiga lokasi penelitian tidak ada bahaya keracunan Al. Di samping pH. O. dan S) dan unsur hara mikro (Fe. Di areal penelitian Dramaga. Ca. Al+3. K tergolong medium sedangkan di Carita dan Sukabumi masing-masing tergolong rendah dan tinggi dan Al+3 dan H+ rendah sampai sangat rendah di semua lokasi. tetapi di Carita. N. dan Co). Jumlah carbon organik relatif rendah di semua horizon. Unsur-unsur ini dikategorikan sebagai unsur hara makro (C. Kandungan P di semua lokasi penelitian tergolong sangat rendah (< 2). Cu. P. 2004 dan 2005). namun karena adanya proses pelapukan yang intensif dan juga adanya pencucian (leaching). Mo. Walaupun tanah-tanah di lokasi penelitian berkembang dari bahan vulkanik andesitik yang kaya akan material-material basa. bahan organik juga menyebabkan meningkatnya KTK dengan meningkatnya muatan negatif. carbon organik lebih tinggi daripada Sukabumi dan Dramaga. Unsur hara esensial merupakan unsur yang diperlukan oleh tanaman dan fungsinya tidak dapat digantikan oleh unsur lain (Pratiwi. Tumbuhan bawah merupakan sumber bahan organik. Cl. Rendahnya carbon organik dan nitrogen total berhubungan dengan rendahnya bahan organik. Hal ini menunjukkan bahwa dekomposisi bahan organik tidak terlalu kuat. Elemen penting lainnya adalah K. dijumpai banyak tumbuhan bawah jika dibandingkan dengan lokasi penelitian Sukabumi dan Dramaga. Mg. B. Carbon organik dan nitrogen total di lokasi penelitian menurun semakin ke bawah. Reaksi ini mempengaruhi ketersediaan unsur hara esensial.

Unsur-unsur tersebut adalah Fe. Tabel 4. di mana pH daerah Sukabumi lebih tinggi daripada Carita dan Dramaga. Dari Tabel 4. Jumlah kation tertinggi di areal penelitian terdapat di Sukabumi dan yang terendah di Carita.77). Kecenderungan ini terjadi di areal penelitian. Kondisi ini relatif sesuai untuk pertumbuhan tanaman.35-41.50 (Rendah) 1.(Pratiwi) Unsur hara mikro juga mempengaruhi pertumbuhan tanaman. Sifat-sifat kimia tanah di lokasi penelitian Dramaga Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) Horizon 1 (0-30 cm) 4.70 (Rendah) 1. Cu.0515.60 (Rendah) 1. Di semua horizon dari tiga lokasi penelitian ini.07) sedangkan di Dramaga medium (16. dan Tabel 6 mengindikasikan bahwa tanah di Sukabumi memiliki KB tinggi (39. Tanah dengan pH lebih tinggi umumnya memiliki KTK yang lebih tinggi.. Ada kecenderungan bahwa daerah dengan pH yang tinggi memiliki kejenuhan basa yang tinggi pula.. Unsur-unsur Fe. tetapi diperlukan dalam jumlah sangat sedikit. Tabel 5. Zn. Kapasitas tukar kation (KTK) menunjukkan tingkat kesuburan tanah. dan Tabel 6 menunjukkan secara jelas bahwa KTK NH4Oact pH 7 dari seluruh profil sangat tinggi daripada KTK sum of cation. KTK tanah dianalisis dengan larutan buffer NH4Oact pH 7 dan KTK sum of cation. Tabel 5.15 (Rendah) Horizon 2 (30-60 cm) 4..Karakteristik Lahan Habitat . Cu. Tanah dengan KTK tinggi dapat menyerap unsur hara. sehingga ketersediaan hara akan lebih bagus pada areal dengan KTK rendah.75) dan yang terendah adalah di Carita (13. KTK tinggi berarti areal tersebut cukup subur.01-17. Tabel 4.. kation basa didominasi oleh calcium dan magnesium.03 (Rendah) 0.43 (Rendah) 0. Kandungan kation basa di Sukabumi termasuk tinggi sedangkan di Dramaga medium dan Carita termasuk rendah.12 (Rendah) Horizon 3 (>60 cm) 4. Hal ini disebabkan karena Sukabumi memiliki pH H 2O tertinggi.03 (Rendah) 0.11(Rendah) 203 . dan Mn. dan Zn relatif rendah sementara kandungan Mn sedang sampai relatif cukup.

33 4.30 (Rendah) 17.01 1.70(Medium) 0.44 5.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 1. Sifat-sifat kimia tanah di lokasi penelitian Carita Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K 1.49 (Sangat rendah) 0.99 (Medium) 46.29 (Medium) 1.44 (Medium) 0.13 (Rendah) Horizon 1 (0-30 cm) 4.40 5.20 Tabel 5.26 (Rendah) 16.53 (Rendah) 0.72 (Sangat rendah) 0.17 (Rendah) 1.16 (Sangat rendah) 0.60 1.50 (Rendah) 1.36 4.70 (Sangat rendah) Horizon 2 (30-60 cm) 4.52 (Rendah) 0.26 (Medium) 3.00 (Sangat rendah) 0.41 2.24 85.17 (Rendah) 1.90 (Sangat rendah) 0.68 (Medium) 4.20 (Sangat rendah) Horizon 3 (>60 cm) 4.88 (Medium) 5.31 (Medium) 0.09 (Medium) 0.32 ( Medium) 1.01 (Sangat rendah) 0.14 (Rendah) 1.64 4.20 (Sangat rendah) 204 .88 88.75 (Medium) 40.3 (Sangat rendah) Horizon 3 (>60 cm) 1.51 (Rendah) 0.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): Al H 0.60 (Rendah) 2.28 79.48 2.19 ( Medium) 0.80 2.7 (Sangat rendah) 5.71 (Sangat rendah) 0.58 (Tinggi) 0.04 3.61 (Medium) 35.08 (Sangat rendah) 1.7 (Sangat rendah) Horizon 2 (30-60 cm) 1.14 (Rendah) 1.60 (Rendah) 0.26 (Rendah) 16.75 (Rendah) 0.44 (Medium) 0.16 (Rendah) 1.

80 16.64 3.64 (Tinggi) 10.07 (Sangat tinggi) 69.07 (Medium) 0.70 (Sangat rendah) Horizon 3 (>60 cm) 4.77 (Rendah) 16.49 7.04 1.40 (Rendah) 0..48 (Tinggi) 78.60 (Rendah) 1.98 (Tinggi) 10.48 1.36 (Medium) 41.11 (Rendah) 14.56 (Tinggi) 16.43 (Medium) 36.35 (Tinggi) 63.22 (Rendah) 0.99 (Tinggi) 10.52 (Sangat tinggi) 0.05 (Sangat tinggi) 0.68 2.22 (Rendah) 13.03 (Rendah) 14.49 (Sangat rendah) Horizon 3 (>60 cm) 0.71 (Tinggi) 0.49 (Sangat rendah) Horizon 2 (30-60 cm) 0..84 (Sangat tinggi) 14..40 (Sangat rendah) 205 .22 (Rendah) 39.21 (Rendah) 13.45 1.84 (Rendah) 0.(Pratiwi) Sifat-sifat kimia Na KTK KB (%) KCl (me/100 gr): Al H 0.15 (Rendah) 3.60 17.27 (Sangat rendah) 5.00 1.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 0.18 (Rendah) 3.Karakteristik Lahan Habitat .20 (Rendah) 15.94 (Sangat tinggi) 0. Sifat-sifat kimia tanah di lokasi penelitian Sukabumi Sifat-sifat kimia pH H2O 1:1 C org (%) N-total (%) P Bray (ppm) NH4OAc pH 7 (me/100 gr): Ca Mg K Na KTK KB (%) KCl (me/100 gr): 16.53 6.10 (Rendah) 1.60 (Rendah) 0.40 Tabel 6.40 (Medium) 0.86 (Tinggi) Horizon 1 (0-30 cm) 5.00 28.72 1.08 1.52 2.36 (Rendah) 0.11 (Rendah) 3.01 (Rendah) 0..90 (Sangat rendah) Horizon 2 (30-60 cm) 5.10 (Rendah) 2.

20 1.25 Horizon 2 (30-60 cm) 2.12 1. 2.30 Horizon 3 (>60 cm) 6.05 N HCl (ppm): Fe Cu Zn Mn Horizon 1 (0-30 cm) 2.56 26.52 1. Jumlah jenis tumbuhan bawah dan familinya di lokasi penelitian Lokasi penelitian Jumlah jenis Jumlah famili Ko n d i s i i n i a g a k nya k a r e n a Carita 30 18 perbedaan sistem penanaman dalam Dramaga 8 16 hutan tanaman tersebut.76 (Sangat rendah) 0.40 17. Komposisi Vegetasi dan Spesies Dominan 1.42 0.32 (Sangat rendah) 0.12 0.36 1.40 (Rendah) 0.32 1. Dramaga.44 1. mendukung beberapa anakan muncul dari jenis-jenis lain selain jenis tanaman penghasil gaharu. 206 . sapling serta tiang didominasi oleh gaharu. Komposisi Tumbuhan Bawah Hasil pengamatan menunjukkan bahwa komposisi jenis tumbuhan bawah di Carita lebih tinggi dibandingkan di Sukabumi dan Dramaga (Tabel 7). dan Sukabumi. Tabel 7.00 0.Aspek SOSIAL EKONOMI DAN KONSERVASI Sifat-sifat kimia Al H 0.36 B. Di Carita pohon Sukabumi 6 3 penghasil gaharu ditanam dengan sistem campuran dengan jenis tanaman serba guna sedangkan di Sukabumi dan Dramaga ditanam dengan sistem monokultur. Areal ini merupakan hutan tanaman pohon penghasil gaharu. Dengan demikian untuk tingkat pohon. Sistem penanaman di Carita yang multikultur. Umum Analisis vegetasi dilakukan terhadap vegetasi/tumbuhan bawah di Carita. Oleh karena itu analisis vegetasi ditekankan pada tumbuhan bawah.56 22.

(Pratiwi) 3. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor lingkungan seperti iklim. Jenis Tumbuhan Bawah Dominan Secara ekologis. Di Carita jenis dominan dan kodominan dari tumbuhan bawah yang ditemui adalah jampang (Panicum disachyum) dan selaginela (Selaginella plana) sedangkan di Dramaga adalah pakis (Dictyopteris iregularis) dan seuseureuhan (Piper aduncum) serta di Sukabumi adalah jampang (Panicum disachyum) dan rumput pait (Panicum barbatum) (Lampiran 1. topografi. Data ini mengindikasikan bahwa habitat dari masing-masing lokasi penelitian secara ekologis memiliki karakteristik yang berbeda-beda.. nilai vegetasi ditentukan oleh peran dari jenis dominan. Lampiran 2.Karakteristik Lahan Habitat . dan Lampiran 3). Hal ini diindikomuni-tas tumbuhan di lokasi penelitian kasikan dengan nilai indeks similaritas yang rendah (<50%) Lokasi Carita Dramaga Sukabumi (Tabel 8).. Indeks Kesamaan Jenis Tumbuhan Bawah Berdasarkan indeks kesamaan jenis menurut Sorensen (MuellerDumbois and Ellenberg.. Tanah di tiga lokasi penelitian memiliki bahan induk yang relatif sama. Nilai ini merupakan hasil dari interaksi di antara jenis dengan kondisikondisi lingkungan. 4. dan karakteristik tanah. 207 . Jenis dominan merupakan jenis yang mempunyai nilai penting tertinggi di dalam komunitas yang bersangkutan. yaitu material volkanik yang bersifat andesitik. Hasil pengamatan menunjukkan bahwa jenis dominan dan kodominan masing-masing areal penelitian berbeda.. Indeks similaritas (%) dari dengan lainnya. 1974) komposisi jenis tumbuhan bawah di tiap lokasi penelitian berbeda satu Tabel 8. Carita - 9 - 35 9 - Darmaga Sukabumi - KESIMPULAN 1.

Sifat-sifat fisik dan kimia tanah di areal penelitian mendukung pertumbuhan pohon penghasil gaharu. In C. H. Tingkat kesuburan ini berhubungan dengan tingkat dari proses pelapukan. Sedangkan di Dramaga jenis dominan dan kodominan masing-masing adalah pakis (Dictyopteris irregularis) dan seuseureuhan (Piper aduncum). WWF-Traffic India. McGrawhill. tanah Carita kurang subur dibandingkan dengan Dramaga dan Sukabumi. 208 . L. Part II. Komposisi jenis tumbuhan bawah juga berbeda di tiap lokasi penelitian sebagaimana diindikasikan dengan nilai SI < 50%. A. Kumar and V. 280 p. Soil Analyses. Black (ed. 1965.. Trade in Agarwood. 1962. Perbedaan komposisi jenis ini dikarenakan adanya perbedaan faktor-faktor lingkungan seperti iklim. 1994. Perbedaan sifat-sifat fisik dan kimia tanah di lokasi penelitian disebabkan perbedaan tingkat proses pelapukan yang berhubungan dengan kondisi lingkungan dari proses pelapukan tersebut. Jenny. topografi. K. Menon. 4. DAFTAR PUSTAKA Allison. dan sifat-sifat tanah. Jenis dominan dan kodominan di masing-masing areal penelitian berbeda. Di Carita tumbuhan bawah yang dominan adalah jampang (Panicum disachyum) dan jenis kodominan adalah selaginela (Selaginella plana). Bogor. 6. serta di Sukabumi masing-masing jampang (Panicum disachyum) dan rumput pait (Panicum barbatum).A. 1941. Sehubungan dengan tingkat pelapukan.E. Organic Matter by Walkey and Black methods. 5.). Factors of Soil Formation. LPT. New York. Chakrabarty. 3. Peta Tanah Tinjau Jawa dan Madura. Lembaga Penelitian Tanah.Aspek SOSIAL EKONOMI DAN KONSERVASI 2.

PhD Thesis. and H.U.(Pratiwi) Mueller-Dumbois.H. Dept. Kalimantan Timur. Minerlogy. United Stated Department of Agriculture. Sutanto. John Willey and Son. Bogor. Hutan Penelitian Carita. Six Edition. 209 . 2005. Schmidt. 1988. Kabupaten Berau.H. D. Report No.. Mulyanto. Aims and Methods of Vegetation Ecology.. West Java. Belgium.A. Soil Survey Staff. The Relationship Between Soil Characteristics with Vegetation Diversity in Tanjung Redep. 1951. 2005.. Ellenberg. Pusat Litbang Hutan dan Konservasi Alam.Agric. Procedure for Collecting Samples and Methods of Analyses for Soil Survey. Indonesia. 2004. S. 306 p. Buletin Penelitian Hutan 474: 59-66. and J. Sutomo. A. Revised ed. 233 p. Forestry and Estate Crops Research Journal 1(1): 27-33. Thesis. 1984. K. New York. Prawira. F. Pratiwi. S. Soil Conservation Service. Key to Soil Taxonomy. Ciri dan Sifat Lahan Habitat Mahoni (Swietenia macrophylla King. MSc. International Training Center For Post Graduate Soil Scientists. R. Sidiyasa. Buletin Penelitian Hutan 644: 63-76. ITC-RUG.. Soil Characteristics and Vegetation Composition Along a Topotransect in The Gunung Gede Pangrango National Park. Kementrian Perhubungan. 1986. 21 p. East Kalimantan. Eksplorasi dan Studi Permudaan Jenis-Jenis Penghasil Gaharu di Wilayah Hutan Kintap. Gent. Rainfall Based on Wet and Dry Period Ratios for Indonesia with Western New Guinea. 1991. dan R. Jakarta. Pratiwi.) di Beberapa Hutan Tanaman di Pulau Jawa. Indonesia. Pusat Litbang Hutan dan Konservasi Alam. Charge Properties and Classification of Soils on Volcanic Materials and Limestone in Central Java. 2000. Universiteit Gent. Verhand. Pratiwi. Pratiwi and B. 1974. Kalimantan Selatan... Soil Conservation Service.S.Karakteristik Lahan Habitat . Djawatan Meteorologi dan Geofisika. 1994. Hubungan Antara Sifat-Sifat Tanah dan Komposisi Vegetasi di Daerah Tabalar. Ferguson. Gakuryoku XI(2):127-131. 42. I. 68 p.

Solanum jamaicence Mill.99 10.86 1.43 1.37 0.85 4. Total Panicum montanum Roxb. Cyclea barbata Miers.00 5. Gagajahan Ki koneng Babadotan Pakis anjing Gaharu Pete Kanyere Cingcanan Plectronia sp.66 8.91 2.25 0.43 1. Tetracera indica L.85 1.43 1.43 1. Graminae Ageratum conizoides Linn.71 5.29 5.00 300. Amaryllidiaceae Elaeocarpus glaber Blume Elaeocarpaceae Seuseureuhan Piper aduncum L. Compositae 100.71 0. Nilai penting jenis tumbuhan bawah di Carita No.25 0.00 9.00 5.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 1.25 0.05 1.37 0.29 1.93 1.25 0. Bridelia monoica L.50 0.36 6.12 0. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Nama daerah Jampang Selaginella Harendong merah Cingcau Rumput pait Ilat Parasi Terongan Hatta Peletok Paku anam Pakis Sasahan Harendong Kokopian Mahoni Cacabean Alang-alang Hawuan Kakacangan Pacing Nama botani Famili Kr (%) Fr (%) Dr (%) NP (%) 47. Swietenia macrophylla King Morinda bracteosa Hort. Clidenia hirta Don.57 4.12 0.80 1.62 0.00 100.17 7.48 0.62 1. Cecropia peltata L.23 0.30 2.75 1. Ixora sp.73 3.09 1.62 0.49 0.43 1.75 0.43 1.Chr. Gramínea Selaginella plana Hiern.25 0.00 100.93 1. Aquilaria malaccensis Lamk. Stachystarpheta jamaisensis Vahl.09 3.30 2.12 0. Morinda bracteosa Hort.28 57.50 0.43 1.05 2. Imperata cylindrica Linn.09 2.17 2. Cyperus difformis Linn.39 3.10 0.50 0. Tapeinochilus teysmannianus K.43 1.43 1.62 0.39 9.45 0.25 0.72 4.43 25.43 1.70 16.70 32. Coniograma intermedia Hieron.25 0.43 2.23 0.43 1.43 2.83 9.11 0. Parkia speciosa Hassk. Graminae Curculigo latifolia Dryand.71 1.25 0.25 21.43 1. Dictyopteris irregularis Presl. Lygodium circinatum Sw.69 2.18 6. Melastoma malabathricum L.88 7.00 14.81 10.18 2.76 7.98 0.12 81.43 2.25 8.25 0.23 0.25 0.43 2.25 0.25 0.43 1.80 Panicum disachyum Linn.05 2.98 0.25 0.71 4.97 6.93 1. Dryopteris dentata C.99 3.82 3. Selaginellaceae Melastomataceae Meraispermaceae Cyperaceae Solanaceae Polypodiaceae Moraceae Schizophyllaceae Polypodiaceae Dilleniaceae Melastomaceae Rubiaceae Meliaceae Rubiaceae Graminae Verbenaceae Zingiberaceae Piperaceae Rubiaceae Polypodiaceae Thymelaeaceae Leguminosae Euphorbiaceae Rubiaceae Panicum barbatum Lamk.52 5.25 0.49 1.58 10.25 0.80 1.00 Keterangan: Kr Fr Dr NP : Kerapatan relatif : Frekuensi relatif : Dominansi relatif : Nilai penting 210 .57 4.28 22.Sch.75 0.47 2.02 4.85 2.

Total Zingiberaceae Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 211 .25 20.14 1. Nilai penting jenis tumbuhan bawah di Dramaga No.(Pratiwi) Lampiran 2..Sch.21 57. Ageratum conizoides Linn..Karakteristik Lahan Habitat .03 5.72 11.71 5.72 16.89 11.00 16.04 43.71 5.00 Dr (%) 28.53 100.00 NP (%) 74.55 3.52 5.76 5.03 16. Compositae Tapeinochilus teysmannianus K.19 22.72 16.76 5.76 5.16 37.89 17.08 34.72 11.41 11. Micania scandens Willd.00 Fr (%) 16. Piper aduncum Linn.42 1.00 Rumput pait Panicum barbatum Lamk. Famili Polypodaceae Piperaceae Araceae Graminae Gramínea Compositae Kr (%) 29.06 19..14 100. Rumput padi Areu Babadotan Pacine Oryza grandulata Nees.64 11.89 100.56 300.78 30. Alocasia sp.. 1 2 3 4 5 6 7 8 Nama daerah Pakis Seuseureuhan Tales Nama botani Dictyopteris irregularis Presl.

16 100.62 16. 1 2 3 4 5 6 Nama daerah Jampang Nama botani Panicum distachyum Linn.00 Dr (%) 50.87 10.67 8.74 2. Famili Gramínea Graminae Melastomaceae Compositae Kr (%) 56.Lampiran 3.71 14.35 22.00 17.38 4. Nilai penting jenis tumbuhan bawah di Sukabumi No.67 16. Compositae Graminae Alang-alang Imperata cilíndrica Linn. Total Keterangan: Kr : Kerapatan relatif Fr : Frekuensi relatif Dr : Dominansi relatif NP : Nilai penting 212 .57 100.06 300.33 16.28 3. Harendong Babadotan Kirinyuh Clidenia hirta Don.9 58.34 16.14 30.94 32.24 4.67 8.00 NP (%) 139.00 Rumput pait Panicum barbatum Lamk.56 24.76 7.57 3. Euphatorium pallascens DC. Ageratum conizoides Linn.33 100.00 Fr (%) 33.

gaharu merupakan komoditi hasil hutan non-kayu penting. filaria. Gaharu banyak diproduksi di Indonesia. 2001. microcarpa. A. karena merupakan sumber pendapatan terbesar yang memiliki nilai pasar tinggi (Kaskija.12 POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria malaccensis Lamk. Jenis pohon penghasil gaharu menghasilkan resin yang memiliki aroma wangi dan jenis-jenis yang menghasilkan gaharu dengan 213 . dengan nama perdagangan “agarwood/aloe-wood/ eaglewood”. Indonesia merupakan salah satu eksportir terbesar produk gaharu dan sudah menyumbangkan sekitar 6.) DI PROVINSI LAMPUNG DAN BENGKULU. selama ini banyak dikenal sebagai bahan untuk membuat wangi-wangian. hirta. A. malaccensis Lamk. dan lain-lain. seperti A. A.. 1987. Gaharu merupakan komoditi hasil hutan bukan kayu yang banyak diminati oleh pasar luar negeri (Soehartono dan Newton. SUMATERA Titiek Setyawati Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam PENDAHULUAN Gaharu. 2000).2 milyar rupiah ke kas negara pada tahun 1995. 2002). beccariana. Indonesia juga merupakan habitat endemik beberapa jenis gaharu komersial dari marga Aquilaria. Bagi Suku Dayak Punan di Kalimantan Timur. negara penghasil gaharu terbesar di dunia. Zuhud 1994). bahan obat serta juga kulitnya dapat dibuat untuk bahan tali atau kain (Puri. A. Heyne.

masingmasing sortimen akan dibedakan lagi berdasarkan kelas mutunya. dan Wikstroemia (2 jenis).33 pohon/ha (Irian Jaya) (Anonim. kemedangan. baik batang maupun akar pohon secara kimiawi oleh beberapa jenis jamur. Dalam proses selanjutnya.87 pohon/ha (Sumatera). Gaharu dihasilkan dari proses pembusukan atau infeksi. Satu pohon biasanya dapat menghasilkan 0. 2001) dan bahkan semua jenis penghasil gaharu (Aquilaria spp. informasi mengenai jenis. yaitu gubal gaharu. 2001) yang tumbuh tersebar di Indonesia.37 pohon/ha (Kalimantan). Usaha budidaya jenis pohon penghasil gaharu juga belum banyak mengalami perkembangan yang nyata dan produk gaharu masih lebih banyak dipanen dari hutan alam. Nusa Tenggara Timur. 3. Resin yang dihasilkan memiliki aroma wangi yang merupakan ciri khas dalam menentukan kualitas gaharu. Sumatera. Enkleia (1 jenis). Gonystylus (2 jenis). Karena eksploitasi yang intensif sehingga mengancam keberadaanya di alam. 2001).untuk kualitas super. Berdasarkan hasil pengamatan di lapangan. dan abu gaharu.000. karena eksploitasi yang berlebihan (Zich dan Compton. keberadaan serta potensi pohon penghasil gaharu yang ada di Indonesia sampai saat ini masih belum terkoleksi dengan baik. Hampir sebagian besar jenis dapat ditemukan di Kalimantan. Potensi yang diperkirakan ada saat ini yaitu 1. Meskipun jumlah ekspor gaharu saat ini mengalami penurunan pesat dibandingkan dengan tahun-tahun sebelumnya. Pada umumnya gaharu diperdagangkan dalam tiga kelompok sortimen. 2007). dan Gyrinops 214 . Menurut Sidiyasa (1986) dalam Mai dan Suripatty (1996).5 sampai 4 kg gaharu dengan harga di tingkat pencari Rp 700.Aspek SOSIAL EKONOMI DAN KONSERVASI kualitas tinggi banyak diperdagangkan ke luar negeri. Dari beberapa pustaka yang ada. dan 4. gaharu ternyata dihasilkan tidak dari satu jenis pohon saja melainkan dari berbagai macam jenis. Bahkan beberapa jenis sudah menjadi langka akibat perburuan jenis-jenis tertentu yang tidak terkendali. Nusa Tenggara Barat. kedelapan jenis tersebut masuk dalam marga Aetoxylon (1 jenis). jenis pohon penghasil gaharu dari marga Aquilaria dan Wiekstroemia memiliki lebih dari 2 jenis (Sellato. sejak tahun 1994 gaharu masuk dalam Appendix II daftar CITES (Soehartono dan Newton. serta Irian Jaya. Jenis yang saat ini banyak dipanen di Irian Jaya sudah sangat terancam keberadaannya. Aquilaria (2 jenis).

Harga gaharu saat ini sangat bervariasi tergantung dari kualitasnya. Masyarakat di lokasi hutan di Sumatera pada umumnya mengumpulkan gaharu dalam kelompok yang masing-masing terdiri dari 3 sampai 5 orang. maka diharapkan tersedia bukti yang kuat menyangkut status jenis-jenis pohon penghasil gaharu di Indonesia. Mengingat semakin terancamnya keberdaan jenis pohon penghasil gaharu yang ada di habitat alaminya. maka tidaklah heran jika gaharu sangat dicari oleh para pedagang sedangkan pemanenan masih mengandalkan gaharu yang tumbuh di alam dan pencarian dilakukan oleh masyarakat lokal yang memiliki akses masuk ke dalam hutan.. baik dari sisi potensi dan persebarannya. diperlukan upaya eksplorasi dan konservasi. Mengingat keberadaan jenis-jenis pohon penghasil gaharu yang mulai langka dan terancam punah. Selama beberapa dekade ini.Potensi dan Kondisi . Dengan tersedianya informasi yang memadai.. Sumatera. Makalah ini bertujuan untuk memberikan informasi menyangkut aspek potensi dan persebaran gaharu (A. Untuk jenis gaharu yang terbaik di kelasnya harganya bisa melebihi 20 juta rupiah per kilogram tergantung kualitasnya (Anonim.2 milyar rupiah di tahun 1995. diharapkan jenis ini dapat keluar dari daftar CITES sebagai jenis yang harus dilindungi. 1997 dalam Soehartono dan Newton.) di Provinsi Lampung dan Bengkulu.(Titiek Setyawati) spp. baik ek-situ maupun in-situ. malaccencis Lamk. 2009). Kelompok tersebut biasanya akan tinggal di hutan selama lebih kurang seminggu untuk mencari 215 .. maka diperlukan upaya serius dari berbagai macam pihak yang berkepentingan agar keberadaan jenis-jenis tersebut di Indonesia dapat dipantau. Dengan usia tanam dari 6 hingga 8 tahun gaharu mampu menghasilkan getah sekitar dua kilogram. karena berbagai macam alasan yang menyangkut status konservasinya.) masuk dalam Appendix II CITES sejak tahun 2004. 2000) dan sudah memberikan sumbangan kepada pemasukan negara sejumlah 6. Harga gaharu saat ini bervariasi mulai dari 5 juta hingga 20 juta rupiah per kilogramnya. Mengingat harga gaharu yang demikian tinggi.. Indonesia dikenal sebagai negara penghasil gaharu terbesar (Direktorat Jenderal PHPA.

sehingga orang harus tinggal lebih dari 2 minggu atau bahkan sebulan hanya untuk mendapatkan gaharu. Kondisi hutan sebagian sudah dialihfungsikan menjadi lahan perkebunan dan ladang masyarakat. Kecamatan Pesisir Selatan. Jika gaharu ditemukan. Resort Biha. METODE PENELITIAN A. Kawasan Hutan Bukit Rupi berada di Desa Segala Midar.884 ha dengan cakupan wilayah meliputi Resort Merpas. pencarian gaharu makin sulit akibat potensinya yang mulai menurun. tepatnya di Kabupaten Lampung Tengah. Kecamatan Pubian. Kawasan Hutan Bukit Rupi berada di luar kawasan TNBBS namun demikian merupakan kawasan hutan lindung yang dikelola oleh Dinas Kehutanan Provinsi Lampung Tengah. Seringkali terjadi bahwa kualitas gaharu tidak seperti yang mereka inginkan dan pada akhirnya pohon yang sudah terlanjur ditebang ditinggalkan begitu saja di hutan. Lampung Survei jenis-jenis pohon penghasil gaharu di Provinsi Lampung dilakukan di satu lokasi yang ada di dalam kawasan Taman Nasional Bukit Barisan Selatan (Hutan Biha) dan dua lokasi di luar kawasan TNBBS. maka mereka akan menebang pohonnya secara manual menggunakan kampak. Namun demikian masih ada beberapa lokasi hutan alam. Lokasi survei berada di Desa Sumur Jaya. Areal penelitian masuk dalam Seksi Konservasi Wilayah II Krui dengan luas kawasan ± 96. Pada saat ini.Aspek SOSIAL EKONOMI DAN KONSERVASI gaharu di pedalaman hutan. Kondisi topografi di hutan alam ini sedikit berbukit dengan beberapa lokasi memiliki kelerengan hingga 35 derajat. Kawasan Hutan Biha masuk dalam Blok Hutan Podomoro. dimana ditemukan tegakan gaharu yang masih utuh. Kabupaten Lampung Tengah. Seksi Krui. Lokasi Penelitian 1. Kabupaten Lampung Barat. Pugung 216 . yaitu di Hutan Bukit Rupi dan Hutan Gunung Sugih.

Curah hujan ratarata di bagian barat adalah 3..964 m dpl. S e k s i Ko n s e r va s i jenis-jenis pohon penghasil gaharu Wilayah Krui.500 mm/th sedangkan di bagian timur 2.000 mm/ th.000-3. Kawasan hutan TNBBS ini terletak di ujung selatan dari rangkaian pegunungan Bukit Barisan dan secara geografis berada pada 4031’5057’ LS dan 103024’1 0 4 0 BT s e d a n g k a n secara administratif p e n ge l o l a a n te r b a g i d a l a m t i g a w i l aya h pengelolaan. Peta lokasi survei dan pengamatan 2. dan Seksi di Provinsi Lampung Konservasi Wilayah III Sukaraja.500-3. dan Biha.(Titiek Setyawati) Tampak. Gambar 1.. yaitu Seksi Konservasi Wilayah I Liwa. Waktu tempuh dari pusat kota Bengkulu sekitar 30 menit dengan jarak sekitar 20 km (Gambar 2). Bengkulu Lokasi kedua kawasan hutan sangat berdekatan dengan Tahura Rojolelo yang terletak di antara 03 42’-03 44’LS sampai 102 21’BT dan berada di ketinggian 10-30 m dpl. 217 ...Potensi dan Kondisi . Krui. Topografi kawasan ini bergelombang dan berbukit-bukit dengan ketinggian berkisar antara 0-1. Lokasi penelitian secara detil tertera pada Gambar 1.

GPS Garmin 12 satelit. dan potensi sebaran jenis pohon penghasil gaharu ini adalah semua jenis pohon yang diduga menghasilkan gaharu yang terdapat di kawasan hutan lindung. Tanaman yang umum ditanam antara lain padi. alat plak herbarium. kantung plastik. kelapa sawit. jeruk. Prosedur Kerja Kajian lapangan di Kabupaten Lampung Tengah dan Lampung Barat dilakukan pada bulan Oktober dan Desember 2007 sedangan 218 . Talang Empat) dan Pungguk Gambo (Kec. B. dan tali rafia. kertas gambar spesial. Lokasi penelitian di Kawasan Hutan Binjai Temula (Kec. karet. antara lain alkohol 96%. Alat yang digunakan untuk pengambilan data di lapangan. pisang. Bengkulu Utara Kawasan hutan dekat Desa Tanjung Terdana sebagian besar sudah dikonversi menjadi areal persawahan dan perkebunan masyarakat. dan tanaman palawija lainnya. tinta gambar spesial. kompas. fenologi. Bahan dan Alat Bahan yang dijadikan sebagai obyek kegiatan ekologi. baik primer dan sekunder. BAHAN DAN ALAT A. larutan sub-limat. karung plastik. kamera digital. kertas koran. pena/alat gambar. kertas plak herbarium. Pondok Kelapa). tambang nilon. jati.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 2.

1. Pengumpulan data lapangan.. yakni topografi datar (kemiringan lereng kurang dari 10%) dan bergelombang berat (kemiringan 25% atau lebih). dan 5 orang tenaga teknis lapangan. Untuk itu digunakan blanko isian mencakup data pohon. baik di lahan kering maupun lahan basah. Pengamatan dan analisis gaharu meliputi beberapa macam kegiatan. Waktu pengamatan lapangan masing-masing selama 8 dan 10 hari.(Titiek Setyawati) Kabupaten Bengkulu Utara. 200-500 m. Pengamatan pertama di Bengkulu dilaksanakan di Hutan Lindung Kelompok Hutan Binjai Temula.. Eksplorasi dilakukan di berbagai kondisi hutan. dan lebih dari 500 m dpl dengan topografi yang berbeda. Kecamatan Pondok Kelapa. 219 . data kondisi lingkungan tempat tumbuh. Ketinggian tempat di lahan kering ada 3 macam.. Desa Dusun Baru. Kecamatan Talang Empat dan yang kedua di Hutan Lindung Kelompok Hutan Pungguk Gambo. antara lain: 2.Potensi dan Kondisi . yaitu pada bulan Oktober dan Desember 2008. Panjang tiap jalur eksplorasi yaitu 1 km dengan jarak antar jalur 500 m. Beberapa contoh pohon akan diambil untuk keperluan identifikasi dan koleksi herbarium. Koleksi data primer di lapangan mencakup keanekaragaman jenis pohon penghasil gaharu dan kondisi lingkungan tempat tumbuhnya dengan menggunakan metode eksplorasi dalam jalur-jalur yang sistematik. Desa Tanjung Terdana. baik secara langsung melalui wawancara dengan masyarakat yang tinggal di dekat dan sekitar hutan maupun tidak langsung dengan cara melakukan kajian pustaka.. Kegiatan pengamatan dan pengukuran di lapangan dikerjakan oleh seorang peneliti. 3 orang teknisi. dan data penggunaan tradisional penduduk setempat. Di samping itu dibuat juga blangko isian tersendiri yang digunakan untuk bahan wawancara dengan penduduk yang berisi pertanyaan-pertanyaan menyangkut berbagai macam informasi tentang karakter jenis-jenis pohon penghasil gaharu yang dikenal oleh penduduk setempat. Provinsi Bengkulu dilaksanakan dua kali. Kuesioner dipersiapkan sebelum kegiatan lapangan dilakukan. yaitu antara 0-200 m. 3.

tingkat pancang (tinggi lebih dari 150 cm dengan diameter kurang dari 10 cm) dan tingkat tiang (diameter 10-20 cm) di sekitar titik pusat kuadran. Jarak anakan pertama dengan pohon induk diukur. 10. Pengidentifikasian jenis-jenis pohon penghasil gaharu dan proses koleksi herbarium dari kegiatan eksplorasi. 7. Pendataan pohon meliputi nama jenis. diameter batang. Pada tiap titik pusat kuadran dilakukan perisalahan 4 individu pohon penghasil gaharu atau pohon lainnya yang terdekat dengan titik pusat atau 1 individu pohon pada tiap kuadran. maka dibuat risalah anakan menggunakan metoda jalur transek sepanjang 1 km dari titik anakan pertama ditemukan. Penulisan deskripsi jenis-jenis pohon penghasil gaharu yang disertai gambar lukisan spesimen herbarium. 11.Aspek SOSIAL EKONOMI DAN KONSERVASI 4. Mengadakan pendugaan potensi dan sebarannya dengan menggunakan metode titik pusat kuadran (quadrant center point method) sepanjang jalur eksplorasi dengan jarak antara titik pertama dan titik berikutnya 50 m. 9. dan tinggi pohon. 8. Penggambaran lukisan spesimen herbarium jenis pohon penghasil gaharu. Estimasi regenerasi jenis-jenis pohon penghasil gaharu yang terdapat di kawasan hutan dengan cara menghitung permudaan tingkat semai (tinggi kurang dari 150 cm). Pengolahan data hasil wawancara dengan masyarakat lokal. 6. Pengolahan data potensi keberadaan jenis pohon penghasil gaharu dan wilayah sebarannya yang terdapat di dalam kawasan hutan alam. 5. Selanjutnya dibuat petak 10 m x 10 m di setiap selang 200 m dari jalur transek. Pembuatan tally sheet untuk mengisi data tentang masa berbunga dan berbuah jenis-jenis pohon penghasil gaharu. Individu pohon tersebut yang dirisalah dibatasi jarak terjauh 25 m dari titik pusat kuadran dan diameter batangnya 20 cm atau lebih. Penduduk yang tinggal di dekat kawasan diminta untuk mengisi blanko kosong yang harus diisi dengan informasi kapan masa 220 . Jika anakan yang pertama ditemukan berada jauh dari pohon induk.

KR merupakan rasio jumlah individu dari suatu jenis terhadap jumlah total jenis di dalam plot dan FR merupakan rasio frekuensi dari suatu jenis terhadap total frekuensi seluruh jenis di dalam plot (Kent dan Coker.. Krebs. Kelimpahan Relatif (KR). Frekuensi: jumlah unit contoh (10 m x 10 m). malaccensis Lamk. Kepadatan: jumlah individu per plot (100 m2). Nilai Penting (NP): perkiraan secara keseluruhan pentingnya suatu jenis pohon di dalam komunitas lokalnya. C. Nilai NP ini diperoleh dengan cara menjumlahkan Dominansi Relatif (DoR). dan sebagainya) dan mengisi data curah hujan. 1992. dan Frekuensi Relatif (FR) dari jenis tertentu. Beberapa definisi dan kalkulasi yang digunakan dalam analisis vegetasi. Luas bidang dasar untuk tiap plot dijumlah untuk memperoleh LBD tiap pohon dengan menggunakan rumus: LBD (m2) = pi x d (diameter dalam m)2/4 (Kent dan Coker. kering.. di mana jenis ditemukan. 5.. jumlah buah dan bunga (persentase). 1994).(Titiek Setyawati) berbunga. antara lain: 2. 4. di Provinsi Lampung ini menunjukkan bahwa di beberapa lokasi di dalam kawasan Taman Nasional Bukit Barisan Selatan ini masih terdapat 221 .. DR merupakan rasio total luas bidang dasar dari suatu jenis terhadap jumlah total luas bidang dasar dari seluruh jenis yang ada. panas. Luas Bidang Dasar (LBD): luasan bagian melintang dari batang >20 cm sebatas dada (diameter of breast height (dbh)).Potensi dan Kondisi . kondisi iklim atau cuaca pada saat berbunga atau berbuah (hujan. 1992). jumlah pohon yang berbuah dan berbunga. Hasil Pengamatan di Lampung Hasil pengamatan yang diperoleh dalam rangka melakukan kajian potensi sebaran jenis A. 3. HASIL DAN PEMBAHASAN A. 1999. Analisis Data 1.

Namun demikian. Tampaknya tidak banyak gangguan seperti pengambilan gubal gaharu di kawasan ini. Hasil pengamatan regenerasi alam jenis gaharu di Kawasan Hutan Way Waya. Lampung Tengah 4). Tegakan dapat dikatakan alami. Jumlah pohon gaharu yang dapat ditemukan di Bukit Rupi. Kemungkinan besar biji gaharu terbang dan menemukan media yang baik untuk tumbuh besar di kebun milik penduduk tersebut. Lampung Tengah. Di beberapa tempat juga tampak tandatanda bekas perambahan hutan yang tentunya sebagian besar untuk mengambil kayu gaharu. mereka tidak merasa menanam pohon penghasil gaharu dan menemukan pohon tersebut tumbuh di halaman kebun mereka. Khusus di Bukit Rupi.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan alam pohon gaharu meskipun jumlah dan potensi regenerasi alamnya tampak mengalami penurunan seperti yang ada di Kawasan Hutan Biha. Nampak bahwa kondisi batang tegakan pohon sangat halus dan tidak ditemukan cacat pohon. belum ada laporan bahwa pohon tersebut pernah menghasilkan gaharu atau terinfeksi oleh patogen. Kemungkinan hal ini disebabkan akses ke dalam kawasan hutan yang relatif sulit dibandingkan dengan Kawasan Hutan Biha. Lampung Tengah menunjukkan 222 . jumlah tegakan pohon. Lampung Tengah tertera pada Tabel 1. karena berdasarkan wawancara dengan pemilik kebun. Gunung Sugih. Di lokasi ini juga dijumpai tegakan pohon penghasil gaharu alami yang tumbuh Gambar 3. Anakan gaharu yang ditemukan tumbuh secara besar di wilayah perkebunan alami di Kawasan Hutan Bukit milik masyarakat (Gambar Rupi. sapling. dan anakan yang ditemukan pada enam plot sampel tampak cukup banyak. Tampak pada Gambar 3 kecambah gaharu yang tumbuh melimpah menyerupai permadani di bawah tegakan induknya yang ditemukan di Kawasan Hutan Bukit Rupi.

sehingga pemungut kayu gaharu setiap saat dapat secara kebetulan maupun ada juga yang dengan niat keras. namun bukan sama sekali tidak ditemukan seperti di Kawasan Hutan Gunung Sugi. Lampung Tengah. Tegakan pohon A. Lampung Tengah 223 . Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Hutan Biha sangat sedikit. Tampak bahwa tidak satu pun jenis penghasil gaharu ditemukan di petak sampel (Tabel 2) di antara 13 jenis pohon hutan yang berhasil diidentifikasi di laboratorium Botani Hutan. menemukan jenis gaharu tersebut.. meskipun lokasinya sama-sama di satu kabupaten. sehingga kemungkinan sejak dahulu sudah banyak masyarakat yang memanfaatkan gaharu yang tumbuh alami namun hal ini tidak dibarengi dengan upaya budidayanya..Potensi dan Kondisi .(Titiek Setyawati) perkembangan yang sedikit berbeda dengan yang ada di Bukit Rupi. Kurangnya jumlah pohon ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung. Gambar 4. yang ditemukan tumbuh secara alami di perkebunan milik masyarakat yang lokasinya berbatasan dengan Kawasan Hutan Bukit Rupi. Nampak pula bahwa sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu... malaccensis Lamk. Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Biha tertera pada Tabel 3.

malaccensis Lamk. Lampung Tengah Tabel 1. 2. 5. dan anakan A. pancang. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Rupi. Penduduk setempat yang sudah melakukan upaya bu-didaya penanaman pohon gaharu (A. Jumlah pohon. malaccensis Lamk. 3. Lampung Tengah No. Gunung Sugih. Jumlah pohon (> 10 cm) 26 9 8 14 16 8 Jumlah pancang 34 15 21 16 19 17 Jumlah anakan 14 21 30 14 11 9 Tabel 2. Lampung Tengah Pohon No 1 2 3 Nama jenis Artocarpus elasticus Ganophyllum falcatum Bombax valetonii Plot 15 5 4 Batang 45 10 5 Tiang Plot 2 0 0 Batang 6 0 0 Pancang Plot 0 4 2 Batang 0 15 4 Semai Plot 0 0 0 Batang 0 0 0 224 . pancang.Aspek SOSIAL EKONOMI DAN KONSERVASI Gambar 5. 6.) di kebun miliknya di Kawasan Hutan Gunung Sugih. anakan dan semai beberapa jenis pohon alami yang ada dalam 50 plots penelitian di Kawasan Hutan Way Waya. Jumlah pohon. 4. plot 1.

. 4.(Titiek Setyawati) Pohon No 4 5 6 7 8 9 10 11 12 13 Nama jenis Pterospermum diversifolium Laportea stimulans Vitex sp. 3.. plot 1. dan anakan A. malaccensis Lamk. 2.Potensi dan Kondisi .. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Biha. Artocarpus sp. Desa Sendang Baru. Kecamatan Sendang Agung. Pohon gaharu yang masih ada di Kawasan Hutan Register 22 Way Waya. pancang. Alstonia angustifolia Pometia pinnata Cananga odorata Litsea sp. Hibiscus macrophyllus Plot 4 0 3 3 2 4 2 3 2 1 Batang 5 0 7 5 3 5 3 5 3 1 Tiang Plot 4 1 5 4 1 2 5 5 4 4 Batang 8 4 12 8 2 5 8 6 5 5 Pancang Plot 6 5 0 2 0 3 0 2 0 2 Batang 18 17 0 7 0 10 0 7 0 3 Semai Plot 4 12 11 10 0 6 12 5 13 0 Batang 8 20 23 15 0 12 23 12 20 0 Tabel 3. Lampung Barat No. Kabupaten 225 . oleh karena itu pembuatan plot dilakukan di hutan belukar tersebut. Jumlah pohon. Jumlah pohon (> 10 cm) 2 Jumlah pancang 1 2 4 Jumlah anakan 3 8 5 12 Berdasarkan informasi penduduk yang tinggal di Kawasan Hutan Lindung Bukit Sugih (Register 22 Way Waya) bahwa jenis pohon gaharu sudah sulit dijumpai karena adanya pembalakan hutan maupun adanya pencari gaharu di masa lampau.. Ficus sp. Namun demikian masih terdapat beberapa pohon penghasil gaharu alami yang tersisa di daerah hutan belukar.

28 cm. (Thymelaeaceae). itu pun terbagi tempatnya menjadi tiga titik dengan jarak tempuh yang berbeda. Adapun jenis pohon penghasil gaharu yang ditemui hanya satu jenis yaitu A. malaccensis Lamk. 85. Lampung Barat 226 . (kiri) dan anakan yang tumbuh di bawahnya (kanan) di lokasi Kawasan Hutan Biha. hanya tinggal sekitar 5 pohon. sedangkan tingkat tiang tidak dijumpai. Dari 50 plot yang dibuat terdapat 5 plot yang dijumpai pohon penghasil gaharu. Gambar 6. dan 102 batang. masing-masing satu batang pohon yang berdiameter 20 cm. Lampung Tengah.Aspek SOSIAL EKONOMI DAN KONSERVASI Gunung Sugih. 25 cm. 30 cm. tingkat pancang hanya satu batang. dan 34 cm. dan tingkat anakan terdapat 3 plot dengan jumlah masing-masing 30. Titik yang terdekat berjarak sekitar 5 km dengan jarak tempuh sekitar 1 jam berjalan kaki. Tegakan pohon A. malaccensis Lamk.

Hasil Pengamatan di Kawasan Hutan di Provinsi Bengkulu Hasil menunjukkan bahwa A. Desa Tanjung Terdana. Tegakan gaharu pada tingkat tiang dan pancang tidak ditemukan pada plot sampel namun mendominasi pada tiangkat seedling (38. Sampai saat ini masih terdapat perburuan gaharu di hutan alam dan bahkan masyarakat atau penduduk lokal mengumpulkan anakan pohon gaharu (semai dan pancang) dari hutan alam untuk diperdagangkan. memiliki indeks nilai penting yang cukup tinggi pada tingkat pohon. Kondisi regenerasi di kawasan ini hampir sama dengan kawasan yang sebelumnya..20%). Sedangkan jumlah pohon gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Pungguk Gambo tertera pada Tabel 5.Potensi dan Kondisi .(Titiek Setyawati) B.72%).86% (urutan kedua setelah Cinnamomum porectum (Roxb.. Hal ini dimungkinkan dengan semakin terbukanya akses ke dalam kawasan hutan lindung dan kemungkinan besar juga adalah tingkat reproduksi tegakan yang mulai berkurang. merupakan jenis yang ditemukan di kedua lokasi penelitian di Bengkulu Utara. Tampak bahwa jumlah pohon sangat sedikit dan menurut informasi yang diperoleh dari masyarakat sekitar. malaccensis Lamk. Berdasarkan hasil analisis vegetasi di Kelompok Hutan Binjai Temula. yaitu Binjai Temula.) Kostm. Kecamatan Talang Empat dan Kelompok Hutan Pungguk Gambo. Berdasarkan angka nilai pentingnya. sebagian besar masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu. Desa Dusun Baru. malaccensis Lamk. (57. Kedua lokasi berada di Provinsi Bengkulu dan kedua kawasan juga masuk dalam kawasan hutan lindung.. yaitu 39. Jumlah pohon penghasil gaharu dan potensi regenerasi alam yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Binjai Temula tertera pada Tabel 4. sehingga sejak dahulu sudah banyak memanfaatkan gaharu yang tumbuh alami. Kecamatan Pondok Kelapa.. pada Kawasan Lindung Kelompok Hutan 227 . yaitu di Kelompok Hutan Binjai Temula. Tampak bahwa potensi tegakan alam dan regenerasi alam yang ada di Kawasan Binjai Temula ini sangat sedikit. Hal ini terjadi terutama di Kawasan Lindung Kelompok Hutan Pungguk Gambo. A.

pohon penghasil gaharu (>20 cm) menduduki urutan keempat (43. malaccensis Lamk. Bengkulu Utara No. plot 1. Gambar 7. pancang. dan anakan A. Kecambah atau biji yang mulai tumbuh (kiri) dan beberapa anakan mulai tinggi (kanan) di areal Kelompok Hutan Pungguk Gambo Tabel 4. Jumlah pohon (> 10 cm) 1 1 0 1 1 0 Jumlah pancang 0 0 0 0 0 0 Jumlah anakan 0 3 1 2 3 2 228 .82%). Tegakan tidak ditemukan di tingkat tiang dan hanya memiliki nilai penting 3. (90.) Kostm. Pada plot sampel di lokasi Pungguk Gambo. 6. C. banyak ditemukan kecambah atau biji-biji yang mulai berkecambah di bawah pohon induknya serta beberapa anakan dengan pertumbuhan yang cukup sehat (Gambar 7). 5. 3. porectum (Roxb. dan Garcinia diocia Blume (56.30%).59% pada tingkat pancang dan berada di urutan keempat (19.55%). 4.20%) setelah Vitex pubescens Vahl. 2. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Binjai Temula. (67.Aspek SOSIAL EKONOMI DAN KONSERVASI Pungguk Gambo. Jumlah pohon.48%) untuk tingkat seedling atau semai.

. Masa 229 . plot 1. Jumlah pohon. karena akan dipungut oleh penduduk untuk diperdagangkan.(Titiek Setyawati) No. yang ditemukan di tiap-tiap plot sampel di Kawasan Hutan Pungguk Gambo No. Tegakan pada tingkat pohon terlihat sangat rapat (Gambar 8) dan pada sebagian petak sampel terdapat pohon dengan ukuran diameter yang cukup besar namun belum menampakkan tandatanda terjadinya pembusukan yang mengakibatkan terbentuknya gaharu (Gambar 9). malaccensis Lamk.5 kg pada musim yang baik. 2. 4. Pada umumnya pohon mulai berbunga dan berbuah pada umur 5 sampai 6 tahun bahkan pohon berukuran sedang bisa menghasilkan biji kurang lebih 1.. 5 6 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 1 0 1 0 0 0 0 0 Jumlah pancang 0 0 2 0 0 0 0 0 0 0 Jumlah anakan 0 0 0 0 0 3 0 4 0 0 Biji yang mulai berkecambah tersebut tumbuh sangat rapat dan pada umumnya hanya bertahan beberapa hari saja. Namun demikian semai/seedling berukuran tinggi di atas 10 cm saja dihitung dalam petak pengamatan (2 m x 2 m) untuk memperoleh angka nilai penting. pancang dan anakan A. 3... plot 7 8 9 10 Jumlah pohon (> 10 cm) 1 0 0 1 Jumlah pancang 0 0 0 0 Jumlah anakan 2 1 3 3 Tabel 5.Potensi dan Kondisi .

Meskipun ada. Pohon gaharu dengan diameter ≥ 50 cm Pohon berbunga pada bulan Juli dan Agustus dan menghasilkan buah matang pada bulan November-Desember. Buah yang matang berwarna coklat kehitamhitaman. 230 . Petani menggunakan pestisida jika perlu untuk membasmi serangga ini. Perkecambahan biji dan anakan yang muda sangat rentan terhadap penyakit damping off yang disebabkan oleh jamur (Kundu dan Ka-chari. Sumarna et al. 2001). 2004).. 2000. Gambar 8. Masalah utama di lapangan adalah penyakit pada anakan yang disebabkan oleh serangga kecil yang hinggap di ujung daun anakan. Di Sumatera. Penyakit seperti ini tidak ditemukan di lokasi penelitian di Bengkulu Utara. Buah ini harus langsung dipanen dari pohonnya. Tegakan gaharu yang rapat Gambar 9. masa berbunga dan berbuah 2 kali dalam setahun. Pembungaan pada bulan Maret-April akan menghasilkan buah di bulan Juli-Agustus (Adelina. menghisap cairan daun dan menyebabkan helai pucuk daun bergulung dan mengakibatkan anakan menjadi kerdil.Aspek SOSIAL EKONOMI DAN KONSERVASI berbunga dan berbuah biasanya terjadi pada bulan-bulan kering.

sudah mengalami penurunan populasi. Beberapa peneliti menduga bahwa hanya 10% dari pohon Aquilaria yang mengandung gaharu.. Soehartono dan Newton. 2001).Potensi dan Kondisi .37 pohon/ha di Kalimantan.(Titiek Setyawati) dilaporkan hanya sedikit di beberapa tempat saja. Bisanya petani akan membuang anakan yang sakit.. Berdasarkan hasil pengamatan lapangan dan estimasi potensi regenerasi alam jenis-jenis pohon penghasil gaharu yang tumbuh di hutan alam di beberapa lokasi contoh di Kabupaten Lampung Tengah dan Lampung Barat. tampak bahwa potensi tegakan alam A. Demikian pula dengan potensi regenerasinya yang ditunjukkan dengan sedikitnya jumlah semai maupun anakan yang ada di bawah tegakan alam.33 pohon/ha di Papua. Indonesia merupakan eksportir utama produk gaharu dan dengan tingginya permintaan pasar akhir-akhir ini serta tingginya harga yang ditawarkan di pasar dunia. dan 4.. KESIMPULAN DAN SARAN A. Hasil pengamatan di dua lokasi contoh di Kabupaten Bengkulu Utara. 2. Meskipun tampak bahwa di kawasan Bengkulu Utara di sebagian tempat tampak rapat namun keberadaan pohon penghasil gaharu sendiri tidak menjamin adanya resin gaharu. Kesimpulan 1. tampak bahwa potensi tegakan alam A. Tampak bahwa stock di kawasan hutan di Sumatera lebih rendah dibandingkan dengan kawasan hutan yang ada di Kalimantan dan Papua. 2007.. masih banyak namun demikian kondisinya saat ini menghadapi ancaman penurunan populasi di berbagai tingkatan umur 231 . Sebagai akibatnya populasinya di alam makin lama makin berkurang. 3. malaccensis Lamk. Namun hal ini tidak mengurangi kerusakan dan berkurangnya populasi gaharu di alam (Anonim. Saat ini gaharu sudah masuk dalam Appendix II CITES. maka banyak kolektor yang tidak berpengalaman pada akhirnya ikut mengeksploitasi gaharu di alam. Estimasi potensi stock kayu gaharu di Indonesia yaitu 1.87 pohon/ha di Sumatera. malaccensis Lamk.

Untuk data masa pembungaan dan berbuah sampai saat penelitian belum dapat diperoleh mengingat masa pengamatan tidak bertepatan dengan masa berbunga dan berbuah. sehingga potensi regenerasi alami akan mengalami hambatan karena ketidakseimbangan pertumbuhan di setiap tingkatan terutama tidak terjadinya pertumbuhan mencapai tingkat tiang. tidak hanya pohonnya namun juga anakan alaminya.Aspek SOSIAL EKONOMI DAN KONSERVASI tegakan. Meskipun demikian jenis pohon ini mengalami ancaman serius akibat perburuan. khususnya Kabupaten Bengkulu Utara memiliki potensi tegakan alam gaharu yang juga cukup baik dilihat dari sisi populasi tegakan alaminya. kawasan hutan di Provinsi Bengkulu. malaccensis Lamk. Tampak pula terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. di Bengkulu ditemukan adanya laporan serangan serangga yang menyebabkan pertumbuhan tegakan gaharu menjadi kerdil. Kawasan hutan di Provinsi Lampung dan Bengkulu memiliki potensi yang cukup baik untuk dijadikan areal sumberdaya genetik untuk jenis A. terutama di tingkat seedling dan sapling. Akibatnya bagi proses regenerasi alaminya terjadi kekosongan tegakan pada tingkat tiang. Berlainan dengan temuan yang ada di Provinsi Lampung. Sedikit lebih baik dari kondisi gaharu di Provinsi Lampung. B. khususnya Kabupaten Lampung Tengah dan Lampung Barat memiliki potensi tegakan alam gaharu yang cukup merata meskipun di beberapa lokasi jumlah sampelnya tidak memadai. sehingga diperlukan penyuluhan bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan Taman Nasional Bukit Barisan Selatan dan kawasan hutan lindung. akibat pemanenan gaharu yang kurang memperhatikan aspek kelestarian. Saran Provinsi Lampung. 3. Sebagian besar penduduk memperjualbelikan anakan alami untuk 232 . Meskipun ada beberapa lokasi sampel dengan kondisi tegakan pohon dewasa yang sangat kurang. mengingat potensi jenis gaharu yang masih tampak baik.

Harper Collins College Publishers. Mengingat masih terjadi pemanfaatan kayu gaharu di alam yang kurang mengindahkan aspek kelestarian. wwf. 1987. 1994. maka diperlukan penyuluhan atau pendidikan konservasi bagi masyarakat setempat terutama penduduk yang tinggal berdekatan dengan kawasan hutan lindung yang merupakan habitat alami jenis pohon penghasil gaharu ini. I.depan. 103. Ayo Tanam Gaharu.. Downloaded: 24 Januari 2007. Jim Green. J. Kachari. dan IV. Tumbuhan Berguna Indonesia. 2002. L. Vol. Kaskija. k o m p a s . Heyne. II.Potensi dan Kondisi . Ecological Methodology. K.php?fuseactian=whatwedo.. gaharu Anonim. dan P. Seed Science and Technology. DAFTAR PUSTAKA Adelina. CIFOR. Punan Local Histories and Recent Developments in Bulungan. Kundu. Gaharu (Aquilaria). Seed Leaflet No. Anonim.(Titiek Setyawati) dikembangkan lebih lanjut atau ditanam di kebun masyarakat ataupun dijual ke luar daerah Bengkulu. Ko m p a s o n l i n e : h t t p : / / r e g i o n a l . Krebs. Indonesia. 2009. III. December 2004. 2000. 2007. 2004.species_gaharu. Siapkan Masa Depan.or. M. Ecology : The Experimental Analysis of Distribution and Abundance. C. Media on line : http// www. Yayasan Sarana Wana Jaya. M. Forest & Landscape Denmark. C. dan J. 1992. Jakarta. 1999. CRC Press. East Kalimantan. Behalven Press. Desiccation Sensitivity and Recalcitrant Behaviour of Seeds of Aquilaria agallocha Roxb..ayo. terutama gangguan terhadap proses regenerasi alaminya.masa. Krebs. Kent. Claiming the Forest.id/index. Aquilaria malaccensis Lamk. Badan Penelitian dan Pengembangan Kehutanan. N. 233 . Coker..tanam.c o m / r e a d / xml/2009/07/24/1300220/siapkan. J. Vegetation Description and Analysis : A Practical Approach.

M. 2000. 2001. CIFOR. 1996. Centre for Plant Biodiversity Research. 1880-2000. Canberra.R. Bulungan Ethnobiology Handbook. Australia. CIFOR. CSIRO Plant Industry. B. R. dan A. dan J. A. East West Center-Prosea. 2001. Pembibitan Jenis Pohon Penghasil Gaharu (Aquilaria malaccensis Lamk).Aspek SOSIAL EKONOMI DAN KONSERVASI Mai. 2001. Irian Jaya. dan B. Newton. Syaffari. 234 . R. Bogor. Bogor. Suripatty. Resources and People in Bulungan. Sellato. Indonesia. 1994.C. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria II. Mindawati. An information Document Prepared by TRAFFIC Oceania for the Eleventh Meeting of the CITES Plants Committee. Forest.CIFOR. Puri. T. Trade and Social Dynamics in Borneo.C. Biological Conservation No. Soehartono.A. Elements for a History of Settlement.. Y. with reference to CITES Decisions 11. Status and Use in Indonesia. 2001. Zich. dan N.A. Zuhud.113 Regarding Aquilaria spp. Pengaruh Wadah Penyimpanan dan Kelas Diameter Terhadap Pertumbuhan Stump Wikstroemia polyantha. Soehartono. Pelestarian dan Pemanfaatan Keanekaragaman Tumbuhan Obat Hutan Tropika Indonesia. 2001. T.K. Indonesia. 96. Buletin Penelitian Kehutanan 1(1). F. Conservation and Sustainable Use of Tropical Trees in the Genus Aquilaria I. Newton. Agarwood (Gaharu) Harvest and Trade in Papua New Guinea : A Preliminary Assessment. dan A. The Impact of Gaharu Harvesting in Indonesia. Compton. Latin.112 and 11. Balai Penelitian Kehutanan Manokwari. Biological Conservation No 97. E. Sumarna.

Cinnamomum iners Blume Peltophorum grande prain Eurya acuminata APDC. Strombosia javanica Blume Garcinia celebica L. Cratoxylum formosum Dyer. Schima wallichii Korth.. Evodia aromatica Blume Alstonia angustiloba Miq. Antidesma tetandrum Blume Peronema canescens Jack Famili Thymelaeaceae Verbenaceae Myrtaceae Rubiacea Lecythidiaceae Moraceae Moraceae Lauraceae Dilleniaceae Moraceae Rhizophoraceae Dilleniaceae Selaginelaceae Dilleniaceae Rutaceae Rutaceae Apocynaceae Sterculiaceae Lauraceae Melastomataceae Melastomataceae Hypericaceae Theaceae Guttiferae Ulmaceae Mimosaceae Olacaceae Guttiferae Lauraceae Celasteraceae Theaceae Euphorbiaceae Verbenaceae 235 . Carallia brachiata Merr Tetracera indica L.. Parkia speciosa Hassk. Dillenia excelsa Gieg.(Titiek Setyawati) Lampiran 1. Daftar jenis pohon yang di survei dalam plot pengamatan gaharu di Bukit Rupi. Cinnanmomum porectum (Roxb.) Kosterm. Artocarpus elasticus Reinw. Comersonia bartamia Merr Dehaasia caesia Blume Clidenia hirta don Kibessia azurea DC. Parasponia parvifolia Miq. Lampung Tengah No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Nama lokal Kayu alim Leban Kelat Kelepu Putat Lahu Ketaran Kilada Simpur Terap Sepat Rempelas Lingkem Ranggung Ancau Cempaka Pulai Lupang Medang Kedukduk Gio Kemutul Seru Asam Kandis Nerung Petai Sebasah Beruas Tepa Sago Sidi Nyari Sungkai Nama botanis Aqualaria malaccensis Lamk. Vitex pubescens Vahl. Artocarpus anisophyllus Reinw. Dillenia sumatrana Miq.Potensi dan Kondisi . Garcinia dioica Bl. Selaginella plana Hiern. Clausena excavata Burm. Ficus variegata Bl... Eugenia grandis Wight Neonauclea calycina Merr Barringtonia sp.

Ganophyllum falcatum Blume Lucuma maingayi Dub Carallia brachiata Merr Famili Thymelaceae Lauraceae Verbenaceae Myrtaceae Leguminosae Lauraceae Dilleniaceae Moraceae Leguminosae Burseraceae Euphorbiaceae Euphorbiaceae Rubiaceae Euphorbiaceae Hyperiaceae Styraxaceae Compositae Rutaceae Lauraceae Annonaceae Liliaceae Euphorbiaceae Symplocaceae Myristicaceae Guttiferae Euphorbiaceae Euphorbiaceae Hyperiaceae Elaeocarpaceae Linnaceae Lauraceae Myrtaceae Rubiaceae Rubiaceae Rubiaceae Sapotaceae Sapotaceae Rhizophoraceae 236 .Beras Salung Gajah Salung Urat Use Nyaran Ingitdare Nama botanis Aquilaria malaccensis Lamk Cinnamomum porectum (Roxb. Tarenna confusa K et V.Angit Jungjung bukit Sugi Sipunan Kenidai Kendung Naran Kandis Kbg Saka/ Seketut Pelangas Lulus Gamat Marabikang Kemalau Gelam Abang K.f Eugenia glomerata K et V Timonius sericanthus Boerl Tarenna sp. Clausena exavata Actinodaphne glabra Blume Orophea sp Pleomele elliptica H. Aporusa aurita Miq Cratoxylum sumatranum (Jack) Blume Elaeocarpus stipularis Blume Ixonanthes petiolaris Blume Litsea firma Hook.) Kostrm Vitex pubescens Vahl Rhodamnia cinerea Jack Parkia speciosa Hassk Litsea odorifera T et B Dillenia exelsa Gilg Artocarpus elasticus Reinw Archidendron jiringa (Jack) Nielsen Canarium dichotonum Miq Baccaurea racemosa Muell Arg Croton argyratus Blume Neonauclea calycina Merr Glochidion zeylanicum Juss Cratoxylum formosum (jack) Dyer Styrax benzoind Dryand Vernonia arborea Ham. Daftar jenis pohon yang ada di dalam Kelompok Hutan Binjai Temula. Desa Dusun Baru.Gambir Ketepung K. Bengkulu Utara No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Nama lokal Karas Gadis Leban Marapuyan Petai Berawas Sipo Terap Jering Tetak Tunjuk Semipis Kademe Semuting Seubo-ubo Kemutun K.Aspek SOSIAL EKONOMI DAN KONSERVASI Lampiran 2. Kecamatan Talang Empat.Br Bridelia monoica Merr Symplocos cochinchinense Lour Horsfieldia glabularis Warb Garcinia dioica Blume Aporusa sp.

Sign up to vote on this title
UsefulNot useful