DOGMA SENTRAL BIOLOGI MOLEKULER Di dalam bab ini akan dibahas sekilas dogma sentral biologi molekuler sebagai mekanisme pelaksanaan dua dari tiga fungsi DNA sebagai materi genetik, yaitu fungsi genotipik dan fungsi fenotipik. Dengan mempelajari pokok bahasan ini akan diperoleh gambaran sekilas mengenai proses replikasi dan ekspresi gen beserta pengaturannya, terutama pada kelompok organisme prokariot. Setelah mempelajari pokok bahasan di dalam bab ini mahasiswa diharapkan mampu menjelaskan 1. tiga fungsi DNA sebagai materi genetik dan dogma sentral biologi molekuler, 2. prinsip dasar replikasi DNA, 3. prinsip dasar transkripsi dan transkripsi balik, 4. prinsip dasar translasi, dan 5. prinsip dasar pengaturan ekspresi gen. Pengetahuan awal yang diperlukan oleh mahasiswa agar dapat mempelajari pokok bahasan ini dengan lebih baik adalah struktur asam nukleat, khususnya DNA, yang telah dijelaskan pada Bab III. Selain itu, konsep dasar tentang replikasi DNA, transkripsi, pranslasi, dan pengaturan ekspresi gen yang telah diperoleh pada mata kuliah Genetika juga sangat mendukung pemahaman materi bahasan di dalam bab ini. Fungsi DNA sebagai Materi Genetik DNA sebagai materi genetik pada sebagian besar organisme harus dapat menjalankan tiga macam fungsi pokok berikut ini. 1. DNA harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya, dari generasi ke generasi. Fungsi ini merupakan fungsi genotipik, yang dilaksanakan melalui replikasi. 2. DNA harus mengatur perkembangan fenotipe organisme. Artinya, materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. Fungsi ini merupakan fungsi fenotipik, yang

Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler, Fak. Biologi Unsoed


semikonservatif. dan dispersif. Enzim ini hanya dapat bekerja apabila tedapat ujung 3’-OH bebas sehingga diperlukan adanya molekul primer. evolusi tidak akan pernah berlangsung. Fak. DNA sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah. Sementara itu. sebelum enzim DNA polimerase bekerja terlebih dahulu diperlukan enzim primase untuk membetuk molekul primer. Namun. Di dalam bab ini hanya akan dijelaskan secara singkat fungsi genotipik dan fungsi fenotipik DNA. Enzim utama yang berperan dalam proses replikasi adalah DNA polimerase. Tanpa perubahan semacam ini. Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru. yang terdiri atas deoksiadenosin trifosfat (dATP). 3. masing- Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. yaitu konservatif. Fungsi ini merupakan fungsi evolusioner. Oleh karena itu. Mekanisme pelaksanaan kedua fungsi ini sering disebut sebagai dogma sentral genetika molekuler atau dogma sentral biologi molekuler. yaitu transkripsi dan translasi.dilaksanakan melalui ekspresi gen dengan dua tahapan. transkripsi DNA RNA transkripsi balik translasi protein replikasi Gambar 4.1. deoksiguanosin trifosfat (dGTP). komponen penyusun polimerisasi DNA berupa molekul deoksinukleosida trifosfat (dNTP). Skema dogma sentral biologi molekuler Replikasi DNA Replikasi dapat dikatakan juga sebagai sintesis molekul DNA menggunakan molekul DNA sebagai cetakan (template). deoksisitidin trifosfat (dCTP). Biologi Unsoed 53 . Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. dan deoksitimidin trifosfat (dTTP). Ada tiga cara teoretis replikasi DNA yang pernah diusulkan. yang dilaksanakan melalui peristiwa mutasi.

W. Sementara itu.masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. Tiga cara teoretis replikasi DNA = untai lama = untai baru Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Percobaan pembuktian tersebut dilaporkan hasilnya pada tahun 1958 oleh M. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru (Gambar 4. Meselson dan F. Biologi Unsoed 54 . pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat. Prinsip kerja metode ini dapat dilihat pada Bab III. Fak.S. Kemudian. Stahl.2. konservatif semikonservatif dispersif Gambar 4. Di antara ketiga cara replikasi DNA yang diusulkan tersebut.2).

sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. Terjadinya sintesis DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. baik pada prokariot maupun eukariot. ori. Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori). Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan hingga tercapai suatu ujung (terminus). fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. inisiasi replikasi DNA. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. terjadi dua arah (bidireksional). Biasanya. Biologi Unsoed 55 . Fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. sesuai dengan nama penemunya. selain terjadi replikasi dua arah. Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi.Replikon. yang masing-masing mempunyai arah 5’→ 3’. ori dapat ditemukan di beberapa tempat. Namun. Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. Pada eukariot. Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. Sementara itu. dan termini Setiap molekul DNA yang melakukan replikasi sebagai suatu satuan tunggal dinamakan replikon. Fak. garpu replikasi. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand).

Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. transkripsi merupakan proses sintesis RNA menggunakan salah satu untai molekul DNA sebagai cetakan (templat)nya. sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. untai DNA pasangannya. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). Adanya untai molekul DNA sebagai cetakan. Adanya sumber basa nitrogen berupa nukleosida trifosfat. sitidin trifosfat (CTP). Jadi. Jadi.3’ 5’ 3’ fragmen-fragmen Okazaki untai tertinggal 5’ 5’ 3’ untai pengarah Gambar 4. yaitu 1. Biologi Unsoed 56 . dan disebut sebagai pita antisens. Bedanya dengan sumber basa untuk sintesis DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi digantikan oleh urasil. 2. Transkripsi mempunyai ciri-ciri kimiawi yang serupa dengan sintesis/replikasi DNA. yang mempunyai urutan basa sama dengan urutan basa RNA. Meskipun demikian. Sementara itu. disebut sebagai pita sens. Fak. bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. guanosin trifosfat (GTP). Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA.3. 3. Diagram replikasi pada kedua untai DNA Transkripsi Transkripsi merupakan tahap awal ekspresi gen berupa perubahan urutan basa molekul DNA menjadi urutan basa molekul RNA. Dengan perkataan lain. Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. dan uridin trifosfat (UTP). Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.

inisiasi.4. Setelah mengalami pengikatan oleh promoter. begitu penambahan basa selesai dilakukan. kedua untainya harus dipisahkan satu sama lain di tempat-tempat terjadinya penambahan basa pada RNA. Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. Fak. Berakhirnya polimerisasi RNA ditandai oleh disosiasi kompleks transkripsi atau terlepasnya enzim RNA polimerase beserta kofaktor-kofaktornya dari untai DNA Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). RNA polimerase akan terikat pada suatu tempat di dekat promoter. Selanjutnya. elongasi. Selama sintesis RNA berlangsung kompleks transkripsi akan bergeser di sepanjang molekul DNA cetakan sehingga nukleotida demi nukleotida akan ditambahkan kepada untai RNA yang sedang diperpanjang pada ujung 3’ nya. Hanya saja enzim yang bekerja bukannya DNA polimerase. melainkan RNA polimerase. yang dinamakan tempat awal polimerisasi atau tapak inisiasi (initiation site). Tempat ini dinamakan promoter.OH pada suatu nukleotida bereaksi dengan gugus 5’. yang merupakan tempat pengikatan enzim RNA polimerase di sisi 5’ (upstream) dari urutan basa penyandi (gen) yang akan ditranskripsi. kedua untai DNA segera menyatu kembali. dan teminasi. Secara garis besar transkripsi berlangsung dalam empat tahap. Pemisahan kedua untai DNA pertama kali terjadi di suatu tempat tertentu. Pengikatan enzim RNA polimerase beserta kofaktor-kofaktornya pada untai DNA cetakan membentuk kompleks transkripsi. Nukleosida trifosfat pertama akan diletakkan di tapak inisiasi dan sintesis RNA pun segera dimulai. Biologi Unsoed 57 . yaitu pengenalan promoter. Agar molekul DNA dapat digunakan sebagai cetakan dalam sintesis RNA. sementara RNA polimerasenya sendiri bergerak dari arah 3’ ke 5’ di sepanjang untai DNA cetakan. Tempat ini sering dinyatakan sebagai posisi +1 untuk gen yang akan ditranskripsi. Jadi. Gugus 3’. Reaksi ini jelas sama dengan reaksi polimerisasi DNA. elongasi atau polimerisasi RNA berlangsung dari arah 5’ ke 3’.

Begitu pula halnya dengan molekul RNA hasil sintesis. yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). Hal ini terjadi ketika RNA polimerase mencapai urutan basa tertentu yang disebut dengan terminator. promoter dapat mengikat RNA polimerase yang lain. urutan penyela 5‘ ATTAAAGGCTCCTTTTGGAGCCTTT TTT TT TAATTTCCGAGGAAAACCTCGGAAAAAAAA 3‘ transkripsi U U U C C U C G G A A A A U U U G G A G C C U U U U U U U U 5‘ 3‘ DNA 5’ 3’ Gambar 4. Di antara keduanya terminasi diri lebih umum dijumpai. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 4. Terminasi transkripsi dapat terjadi oleh dua macam sebab. Biologi Unsoed 58 . Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). Fak.4 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.cetakan.4.

keberadaan molekul DNA tetap diperlukan sehingga RNA sebagai materi genetik terlebih dahulu harus diubah menjadi DNA. Dengan demikian. yang materi genetiknya berupa RNA. DNA hasil transkripsi balik disebut sebagai DNA komplementer (cDNA).Transkripsi balik Pada beberapa virus tertentu. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Oleh karena cDNA merupakan hasil transkripsi balik RNA. Fak. yang dapat berupa molekul untai tunggal atau untai ganda. Biologi Unsoed 59 . Selama satu periode transkripsi setidaknya terdapat rata-rata 10 kesalahan. Saat ini enzim transkriptase balik telah diproduksi secara komersial. Proses penyalinan RNA menjadi DNA disebut sebagai transkripsi balik (reverse transcription) dan enzim utama yang mengatalisis proses tersebut adalah enzim transkriptase balik (reverse transcriptase). proses ekspresi gen tetap berlangsung melalui transkripsi dan translasi. tidak lama setelah penemuan enzim restriksi. Hal ini karena proses transkripsi normal mempunyai mekanisme koreksi yang mengurangi frekuensi kesalahan transkripsi. Ketersediaan enzim transkriptase balik ini telah memberikan kemudahan bagi para peneliti untuk mempelajari gen yang bertanggung jawab terhadap pemunculan sifat-sifat tertentu. maka ukurannya lebih pendek daripada DNA. maka cara sederhana yang dapat dilakukan adalah mentransfer cDNA yang menyandi protein tersebut ke dalam sel resipien sebagai sel inang (lihat Bab V). Jika seorang peneliti ingin mengekspresikan suatu protein spesifik dari sistem eukariot di dalam sel yang tidak lazim memproduksi protein tersebut. Proses transkripsi balik. yang relatif lebih parah bila dibandingkan dengan kesalahan pada replikasi normal. yang hanya mengandung urutan basa intron. Hal ini terutama terlihat pada cDNA organisme eukariot. selain terjadi secara alami pada virus dengan materi genetik berupa RNA (retrovirus). Enzim transkriptase balik ditemukan oleh Howard Temin dan David Baltimore secara terpisah pada tahun 1970. khususnya mRNA. Meskipun demikian. enzim transkriptase balik sebenarnya bukanlah merupakan katalisator yang efektif. dapat juga dilakukan secara in vitro seperti halnya pada pembuatan perpustakaan cDNA (lihat Bab VI). Tujuan mengonversi mRNA menjadi cDNA adalah karena DNA sifatnya lebih stabil daripada RNA.

Molekul mRNA ditranslasi dengan arah 5’→ 3’. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel. Sebagai contoh. Pada kebanyakan prokariot ribosom mempunyai ukuran 70S. dan terminasi polipeptida. Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A. berlangsung di dalam ribosom. besar dan kecil. sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. sedangkan pada eukariot biasanya sekitar 80S. Tiap ribosom mempunyai dua tempat pengikatan tRNA. 2. Empat puluh hingga 60 molekul tRNA yang berbeda 4. elongasi. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. 1. Ribosom terdiri atas dua subunit. Fak. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. suatu struktur organel yang banyak terdapat di dalam sitoplasma. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi. yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S).Translasi Bila dibandingkan dengan transkripsi. sintesis Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Translasi. maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. atau pada hakekatnya sintesis protein. tetapi tidak dari ujung 5’ hingga ujung 3’. yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. Biologi Unsoed 60 . Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil.

Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh.5. khususnya pada prokariot.. . Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 4. akan diberikan di bawah ini. berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya. arah gerakan ribosom P A ribosom CUG GGG 3’ mRNA 5’ AUC UAG ACC UGG GAC tRNA aa NH2 aa aa aa COOH aminoasil-tRNA aa NH2 ikatan peptida COOH Gambar 4. pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA. Fak. Biologi Unsoed 61 . . Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Hal ini berarti Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.protein yang mempunyai urutan NH2-Met-Pro. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Sementara itu. Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet). Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus. -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin.5. Selanjutnya.

suatu enzim yang terikat pada subunit ribosom 50S.tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. dan metionil-tRNAfMet terikat pada tapak P. Biologi Unsoed 62 . yang melibatkan (1) perpindahan f-metala. dan IF-3. Kompleks inisiasi pada prokariot terbentuk antara mRNA. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. Selanjutnya. Langkah berikutnya adalah translokasi. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasiltRNAfMet berikutnya yang akan masuk ke tapak A.tRNAala.bahwa sintesis semua polipeptida selalu dimulai dengan metionin. misalnya alanil. metionil-tRNAfMet. Selain itu. ke tapak A memerlukan protein-protein elongasi EF-Ts dan EF-Tu. kompleks inisiasi bergabung dengan subunit besar ribosom (50S). Pengikatan aminoasil-tRNAfMet berikutnya. serta sebuah molekul GTP. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. misalnya penyandi serin. dan subunit kecil ribosom (30S) dengan bantuan protein IF-1. Khusus pada prokariot akan terjadi formilasi gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa fmetionin. baik pada prokariot maupun eukariot. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. IF-2. Triplet kodon berikutnya. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet). dan IF-3). Fak. IF-2. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.

Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. Dengan berlangsungnya kedua proses tersebut secara bersamaan. seperti yang akan dijelaskan nanti. Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. tRNA di tapak P. dan rantai polipeptida dari ribosom. Fak. tidak demikian halnya pada eukariot. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom. Namun. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). Transkripsi terjadi di dalam nukleus. Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. kedua subunit ribosom pun memisah. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn onturn off) ekspresi gen.akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. yaitu RF-1 dan RF-2. Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. juga menjadi sangat efisien. Salah satu di antaranya seperti telah kita Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. sedangkan translasi terjadi di sitoplasma (ribosom). Biologi Unsoed 63 . Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. Selain itu. Terminasi ditandai oleh terlepasnya mRNA. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. Sebagai contoh.

menyebabkan terhalangnya transkripsi gen-gen struktural. Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model operon yang diajukan oleh F. Pengaturan Eskpresi Gen Produk-produk gen tertentu seperti protein ribosomal. Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. Fak. atau bahkan tumpang tindih. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. rRNA. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. Gen-gen yang menyandi pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. Sementara itu. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. atau translasi. Biologi Unsoed 64 . RNA polimerase. misalnya transkripsi. Monod pada tahun 1961. prosesing mRNA. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. tRNA. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. khususnya pada prokariot. Jacob dan J. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. Pada kondisi tertentu represor akan berikatan dengan operator. paling banyak terjadi pada tahap transkripsi.bicarakan di atas. Namun. Pengaturan ekspresi gen pada prokariot Pengaturan ekspresi gen pada sistem prokariot telah banyak diungkapkan berdasarkan hasil penelitian mengenai induksi dan represi menggunakan Escherichia coli dan Salmonella typhimurium. Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim.

dengan operator. sedangkan pada represi adalah korepresor. Molekul efektor pada induksi adalah induser. Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). Di luar operon terdapat gen regulator (R) beserta promoternya (PR). operator (O). Biologi Unsoed 65 . dan gen-gen struktural (GS). dan molekul efektor. Fak.6. molekul protein represor yang dihasilkan oleh gen regulator. operon PR R PO O GS1 GS2 GS3 represor efektor (induser atau korepresor) a) RNA polimerase induser RNA polimerase berjalan transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 4.

Sebaliknya. dengan terikatnya represor oleh induser. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. Operon. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. promoter operon menjadi terbuka bagi RNA polimerase sehingga gen-gen struktural dapat ditranskripsi dan selanjutnya ditranslasi. Dengan pengikatan ini. memegang peran yang sangat penting dalam proses diferensiasi sel. Salah satu contohnya adalah operon lac. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Akan tetapi. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon. gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. kalau pun ada. nampaknya tidak begitu penting pada eukariot.Pada Gambar 4. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang. dan juga prosesing mRNA. Dengan demikian. transkripsi gen-gen struktural tidak dapat berlangsung. Biologi Unsoed 66 . pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator. Fak. Operon trp.6 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor. dengan adanya korepresor. Namun. Jadi. Namun. Akibatnya.

molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. Demikian pula. Biologi Unsoed 67 . misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata.mirip operon. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. yaitu hanya membawa urutan sebuah gen struktural. Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. Fak. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. mRNA di dalam sel-sel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. hormon. Dengan perkataan lain. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik. Jadi. Sebagai contoh.

Apakah artinya jika hasil pengukuran kemurnian larutan DNA memberikan nilai nisbah A260 /A280 kurang dari 1. dan protein? 5. Apakah yang dimaksud dengan titik leleh (melting temperature) molekul DNA? d. Apakah yang dimaksud dengan pernyataan bahwa molekul DNA mempunyai nisbah aksial yang tinggi? d. Apakah yang terjadi jika asam nukleat berada di dalam suasana asam mineral encer? c. a. Suatu untai molekul DNA mempunyai sekuens 5‘. a. a. Fak. Sebutkan macam-macam ikatan yang terdapat pada molekul DNA. dapatkah Saudara menghitung persentase ketiga basa lainnya? Jelaskan jawaban Saudara.AGTTGCAGCCTACGT-3‘. Biologi Unsoed 68 . Apakah manfaat senyawa interkalator etidium bromid? Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Bagaimanakah sekuens untai pasangannya? 4. 3. 2.SOAL EVALUASI 1. RNA. Mengapa pengukuran konsentrasi larutan DNA dilakukan pada λ260 nm? b. Jika suatu molekul RNA mengandung basa adenin sebanyak 20%. Fenomena apakah yang menyebabkan stabilitas molekul DNA? b. Setelah dilakukan sentrifugasi dengan kecepatan tinggi di dalam larutan CsCl 8M. Apakah perbedaan antara nukleotida dan nukleosida? c. bagaimanakah pemisahan molekul DNA.8? c. Komponen manakah yang menentukan spesifisitas suatu molekul asam nukleat? b.

Untuk memvisualisasi molekul DNA menggunakan paparan sinar UV. Suhu ketika molekul DNA mulai mengalami denaturasi. c. Larutan DNA terkontaminasi oleh protein. ikatan fosfodiester. d. Interaksi penempatan (stacking interactions) antara pasangan-pasangan basa. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. persentase A tidak sama dengan persentase T sehingga kandungan basa T. Absorpsi maksimum sinar UV oleh DNA terjadi pada panjang gelombang 260 nm. dan C tidak dapat dihitung bedasarkan kandungan basa A. 2. Ikatan glikosilik antara gula dan basa terputus. a. Permukaan basa yang bersifat hidrofobik menyebabkan molekul-molekul air dikeluarkan dari sela-sela perpasangan basa sehingga perpasangan tersebut menjadi kuat. 3. protein di atas. b. b. Ikatan glikosidik (glikosilik). c. DNA di tengah. Perbandingan antara panjang dan diameternya sangat tinggi sehingga molekul DNA sangat tipis memanjang. yang merupakan fungsi kandungan GC. nukleosida = gula + basa. RNA di bawah. Fak. Biologi Unsoed 69 . a. 5‘. a.KUNCI JAWABAN 1.3‘. b. Jadi. 4. Jadi. c. Basa nitrogen (basa nukleotida). Nukleotida = fosfat + gula + basa.ACGTAGGCTGCAACT . Tidak bisa karena molekul RNA merupakan polinukleotida untai tunggal. d. G. nukleotida = nukleosida monofosfat. ikatan hidrogen. 5.

Sign up to vote on this title
UsefulNot useful