P. 1
Dogma Sentral Biologi Molekuler

Dogma Sentral Biologi Molekuler

|Views: 1,091|Likes:
Published by Habibah Suciati
Dogma Sentral Biologi Molekuler
Dogma Sentral Biologi Molekuler

More info:

Categories:Types, Resumes & CVs
Published by: Habibah Suciati on Mar 25, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

06/01/2014

pdf

text

original

BAB IV.

DOGMA SENTRAL BIOLOGI MOLEKULER Di dalam bab ini akan dibahas sekilas dogma sentral biologi molekuler sebagai mekanisme pelaksanaan dua dari tiga fungsi DNA sebagai materi genetik, yaitu fungsi genotipik dan fungsi fenotipik. Dengan mempelajari pokok bahasan ini akan diperoleh gambaran sekilas mengenai proses replikasi dan ekspresi gen beserta pengaturannya, terutama pada kelompok organisme prokariot. Setelah mempelajari pokok bahasan di dalam bab ini mahasiswa diharapkan mampu menjelaskan 1. tiga fungsi DNA sebagai materi genetik dan dogma sentral biologi molekuler, 2. prinsip dasar replikasi DNA, 3. prinsip dasar transkripsi dan transkripsi balik, 4. prinsip dasar translasi, dan 5. prinsip dasar pengaturan ekspresi gen. Pengetahuan awal yang diperlukan oleh mahasiswa agar dapat mempelajari pokok bahasan ini dengan lebih baik adalah struktur asam nukleat, khususnya DNA, yang telah dijelaskan pada Bab III. Selain itu, konsep dasar tentang replikasi DNA, transkripsi, pranslasi, dan pengaturan ekspresi gen yang telah diperoleh pada mata kuliah Genetika juga sangat mendukung pemahaman materi bahasan di dalam bab ini. Fungsi DNA sebagai Materi Genetik DNA sebagai materi genetik pada sebagian besar organisme harus dapat menjalankan tiga macam fungsi pokok berikut ini. 1. DNA harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya, dari generasi ke generasi. Fungsi ini merupakan fungsi genotipik, yang dilaksanakan melalui replikasi. 2. DNA harus mengatur perkembangan fenotipe organisme. Artinya, materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. Fungsi ini merupakan fungsi fenotipik, yang

Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler, Fak. Biologi Unsoed

52

yaitu konservatif.dilaksanakan melalui ekspresi gen dengan dua tahapan. transkripsi DNA RNA transkripsi balik translasi protein replikasi Gambar 4. Tanpa perubahan semacam ini. Fungsi ini merupakan fungsi evolusioner. Enzim ini hanya dapat bekerja apabila tedapat ujung 3’-OH bebas sehingga diperlukan adanya molekul primer. yang terdiri atas deoksiadenosin trifosfat (dATP). Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru.1. Mekanisme pelaksanaan kedua fungsi ini sering disebut sebagai dogma sentral genetika molekuler atau dogma sentral biologi molekuler. Fak. Sementara itu. Biologi Unsoed 53 . DNA sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah. Namun. Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. komponen penyusun polimerisasi DNA berupa molekul deoksinukleosida trifosfat (dNTP). deoksiguanosin trifosfat (dGTP). yang dilaksanakan melalui peristiwa mutasi. dan dispersif. Skema dogma sentral biologi molekuler Replikasi DNA Replikasi dapat dikatakan juga sebagai sintesis molekul DNA menggunakan molekul DNA sebagai cetakan (template). semikonservatif. dan deoksitimidin trifosfat (dTTP). Di dalam bab ini hanya akan dijelaskan secara singkat fungsi genotipik dan fungsi fenotipik DNA. 3. Enzim utama yang berperan dalam proses replikasi adalah DNA polimerase. masing- Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. deoksisitidin trifosfat (dCTP). Ada tiga cara teoretis replikasi DNA yang pernah diusulkan. Oleh karena itu. evolusi tidak akan pernah berlangsung. yaitu transkripsi dan translasi. sebelum enzim DNA polimerase bekerja terlebih dahulu diperlukan enzim primase untuk membetuk molekul primer.

Fak. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation. Tiga cara teoretis replikasi DNA = untai lama = untai baru Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Biologi Unsoed 54 . Kemudian. Stahl.masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. Meselson dan F. Prinsip kerja metode ini dapat dilihat pada Bab III.2). konservatif semikonservatif dispersif Gambar 4. Percobaan pembuktian tersebut dilaporkan hasilnya pada tahun 1958 oleh M.S.W. Sementara itu. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru (Gambar 4.2. Di antara ketiga cara replikasi DNA yang diusulkan tersebut. pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat.

Biasanya. Biologi Unsoed 55 . yang masing-masing mempunyai arah 5’→ 3’. Namun. fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. Pada eukariot. Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan hingga tercapai suatu ujung (terminus). Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Terjadinya sintesis DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori). Untai DNA tersebut sering dinamakan untai pengarah (leading strand). terjadi dua arah (bidireksional). baik pada prokariot maupun eukariot.Replikon. ori dapat ditemukan di beberapa tempat. inisiasi replikasi DNA. dan termini Setiap molekul DNA yang melakukan replikasi sebagai suatu satuan tunggal dinamakan replikon. Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. Sementara itu. Fak. yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi. selain terjadi replikasi dua arah. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). ori. Fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. sesuai dengan nama penemunya. garpu replikasi. Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’.

dan uridin trifosfat (UTP). sitidin trifosfat (CTP). yang mempunyai urutan basa sama dengan urutan basa RNA. transkripsi merupakan proses sintesis RNA menggunakan salah satu untai molekul DNA sebagai cetakan (templat)nya. disebut sebagai pita sens. Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. Adanya sumber basa nitrogen berupa nukleosida trifosfat. Adanya untai molekul DNA sebagai cetakan. untai DNA pasangannya.3. Fak. sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. guanosin trifosfat (GTP). dan disebut sebagai pita antisens. yaitu 1. Biologi Unsoed 56 . Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. 2. Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. 3. Jadi. Bedanya dengan sumber basa untuk sintesis DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi digantikan oleh urasil.3’ 5’ 3’ fragmen-fragmen Okazaki untai tertinggal 5’ 5’ 3’ untai pengarah Gambar 4. Meskipun demikian. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). Diagram replikasi pada kedua untai DNA Transkripsi Transkripsi merupakan tahap awal ekspresi gen berupa perubahan urutan basa molekul DNA menjadi urutan basa molekul RNA. Dengan perkataan lain. Sementara itu. Transkripsi mempunyai ciri-ciri kimiawi yang serupa dengan sintesis/replikasi DNA. Jadi. bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA.

sementara RNA polimerasenya sendiri bergerak dari arah 3’ ke 5’ di sepanjang untai DNA cetakan.OH pada suatu nukleotida bereaksi dengan gugus 5’. kedua untai DNA segera menyatu kembali. yang dinamakan tempat awal polimerisasi atau tapak inisiasi (initiation site). Pemisahan kedua untai DNA pertama kali terjadi di suatu tempat tertentu. Jadi. Biologi Unsoed 57 . elongasi atau polimerisasi RNA berlangsung dari arah 5’ ke 3’. Selama sintesis RNA berlangsung kompleks transkripsi akan bergeser di sepanjang molekul DNA cetakan sehingga nukleotida demi nukleotida akan ditambahkan kepada untai RNA yang sedang diperpanjang pada ujung 3’ nya. RNA polimerase akan terikat pada suatu tempat di dekat promoter. begitu penambahan basa selesai dilakukan. melainkan RNA polimerase. Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. Secara garis besar transkripsi berlangsung dalam empat tahap. yang merupakan tempat pengikatan enzim RNA polimerase di sisi 5’ (upstream) dari urutan basa penyandi (gen) yang akan ditranskripsi. dan teminasi. Tempat ini sering dinyatakan sebagai posisi +1 untuk gen yang akan ditranskripsi. Gugus 3’. Pengikatan enzim RNA polimerase beserta kofaktor-kofaktornya pada untai DNA cetakan membentuk kompleks transkripsi. Reaksi ini jelas sama dengan reaksi polimerisasi DNA.4. elongasi. kedua untainya harus dipisahkan satu sama lain di tempat-tempat terjadinya penambahan basa pada RNA. yaitu pengenalan promoter. Selanjutnya. Hanya saja enzim yang bekerja bukannya DNA polimerase. Fak. Tempat ini dinamakan promoter. Agar molekul DNA dapat digunakan sebagai cetakan dalam sintesis RNA. Setelah mengalami pengikatan oleh promoter.trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). Berakhirnya polimerisasi RNA ditandai oleh disosiasi kompleks transkripsi atau terlepasnya enzim RNA polimerase beserta kofaktor-kofaktornya dari untai DNA Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. inisiasi. Nukleosida trifosfat pertama akan diletakkan di tapak inisiasi dan sintesis RNA pun segera dimulai.

Biologi Unsoed 58 . promoter dapat mengikat RNA polimerase yang lain.4 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. Begitu pula halnya dengan molekul RNA hasil sintesis. Terminasi transkripsi dapat terjadi oleh dua macam sebab. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. Di antara keduanya terminasi diri lebih umum dijumpai. urutan penyela 5‘ ATTAAAGGCTCCTTTTGGAGCCTTT TTT TT TAATTTCCGAGGAAAACCTCGGAAAAAAAA 3‘ transkripsi U U U C C U C G G A A A A U U U G G A G C C U U U U U U U U 5‘ 3‘ DNA 5’ 3’ Gambar 4.4. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. Hal ini terjadi ketika RNA polimerase mencapai urutan basa tertentu yang disebut dengan terminator. Fak. maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 4.cetakan. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida.

khususnya mRNA. Proses penyalinan RNA menjadi DNA disebut sebagai transkripsi balik (reverse transcription) dan enzim utama yang mengatalisis proses tersebut adalah enzim transkriptase balik (reverse transcriptase). yang dapat berupa molekul untai tunggal atau untai ganda. tidak lama setelah penemuan enzim restriksi. Fak. Dengan demikian. proses ekspresi gen tetap berlangsung melalui transkripsi dan translasi. yang materi genetiknya berupa RNA. Oleh karena cDNA merupakan hasil transkripsi balik RNA. Ketersediaan enzim transkriptase balik ini telah memberikan kemudahan bagi para peneliti untuk mempelajari gen yang bertanggung jawab terhadap pemunculan sifat-sifat tertentu. Hal ini karena proses transkripsi normal mempunyai mekanisme koreksi yang mengurangi frekuensi kesalahan transkripsi. Hal ini terutama terlihat pada cDNA organisme eukariot. Selama satu periode transkripsi setidaknya terdapat rata-rata 10 kesalahan. maka cara sederhana yang dapat dilakukan adalah mentransfer cDNA yang menyandi protein tersebut ke dalam sel resipien sebagai sel inang (lihat Bab V). selain terjadi secara alami pada virus dengan materi genetik berupa RNA (retrovirus). yang relatif lebih parah bila dibandingkan dengan kesalahan pada replikasi normal. yang hanya mengandung urutan basa intron. Meskipun demikian. enzim transkriptase balik sebenarnya bukanlah merupakan katalisator yang efektif. Tujuan mengonversi mRNA menjadi cDNA adalah karena DNA sifatnya lebih stabil daripada RNA. Proses transkripsi balik. dapat juga dilakukan secara in vitro seperti halnya pada pembuatan perpustakaan cDNA (lihat Bab VI). Saat ini enzim transkriptase balik telah diproduksi secara komersial. Enzim transkriptase balik ditemukan oleh Howard Temin dan David Baltimore secara terpisah pada tahun 1970.Transkripsi balik Pada beberapa virus tertentu. keberadaan molekul DNA tetap diperlukan sehingga RNA sebagai materi genetik terlebih dahulu harus diubah menjadi DNA. Jika seorang peneliti ingin mengekspresikan suatu protein spesifik dari sistem eukariot di dalam sel yang tidak lazim memproduksi protein tersebut. DNA hasil transkripsi balik disebut sebagai DNA komplementer (cDNA). Biologi Unsoed 59 . maka ukurannya lebih pendek daripada DNA. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.

2. Empat puluh hingga 60 molekul tRNA yang berbeda 4. sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. Tiap ribosom mempunyai dua tempat pengikatan tRNA. Fak. Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel. Translasi. Molekul mRNA ditranslasi dengan arah 5’→ 3’. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. 1. sintesis Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi. elongasi. Sebagai contoh. atau pada hakekatnya sintesis protein. berlangsung di dalam ribosom. yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. Pada kebanyakan prokariot ribosom mempunyai ukuran 70S. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). sedangkan pada eukariot biasanya sekitar 80S. suatu struktur organel yang banyak terdapat di dalam sitoplasma.Translasi Bila dibandingkan dengan transkripsi. Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. dan terminasi polipeptida. Biologi Unsoed 60 . Ribosom terdiri atas dua subunit. tetapi tidak dari ujung 5’ hingga ujung 3’. besar dan kecil.

5.5. Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh. pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA.protein yang mempunyai urutan NH2-Met-Pro.. Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Biologi Unsoed 61 . Fak. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 4. -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin. akan diberikan di bawah ini. Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. Selanjutnya. . khususnya pada prokariot. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. Sementara itu. arah gerakan ribosom P A ribosom CUG GGG 3’ mRNA 5’ AUC UAG ACC UGG GAC tRNA aa NH2 aa aa aa COOH aminoasil-tRNA aa NH2 ikatan peptida COOH Gambar 4. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus. Hal ini berarti Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. . yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet). berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya.

IF-2. dan subunit kecil ribosom (30S) dengan bantuan protein IF-1. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin.bahwa sintesis semua polipeptida selalu dimulai dengan metionin. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. kompleks inisiasi bergabung dengan subunit besar ribosom (50S). metionil-tRNAfMet. dan IF-3. IF-2. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasiltRNAfMet berikutnya yang akan masuk ke tapak A. misalnya penyandi serin. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Langkah berikutnya adalah translokasi. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. serta sebuah molekul GTP.tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. misalnya alanil. baik pada prokariot maupun eukariot. Selain itu. Khusus pada prokariot akan terjadi formilasi gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa fmetionin. suatu enzim yang terikat pada subunit ribosom 50S.tRNAala. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. dan IF-3). Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. Pengikatan aminoasil-tRNAfMet berikutnya. Triplet kodon berikutnya. Biologi Unsoed 62 . Selanjutnya. yang melibatkan (1) perpindahan f-metala. Fak. ke tapak A memerlukan protein-protein elongasi EF-Ts dan EF-Tu. Kompleks inisiasi pada prokariot terbentuk antara mRNA. dan metionil-tRNAfMet terikat pada tapak P. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet).

tRNA di tapak P. Fak. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. Dengan berlangsungnya kedua proses tersebut secara bersamaan. kedua subunit ribosom pun memisah. Selain itu. Sebagai contoh. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. Transkripsi terjadi di dalam nukleus. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. tidak demikian halnya pada eukariot. juga menjadi sangat efisien. Namun. seperti yang akan dijelaskan nanti. yaitu RF-1 dan RF-2. dan rantai polipeptida dari ribosom. Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma. Biologi Unsoed 63 . Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis.akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. Terminasi ditandai oleh terlepasnya mRNA. sedangkan translasi terjadi di sitoplasma (ribosom). Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). Salah satu di antaranya seperti telah kita Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn onturn off) ekspresi gen.

Pada kondisi tertentu represor akan berikatan dengan operator. Monod pada tahun 1961. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. Fak. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. menyebabkan terhalangnya transkripsi gen-gen struktural. atau bahkan tumpang tindih. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. tRNA. Namun. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. paling banyak terjadi pada tahap transkripsi. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. Sementara itu. misalnya transkripsi. Biologi Unsoed 64 . Gen-gen yang menyandi pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. Pengaturan Eskpresi Gen Produk-produk gen tertentu seperti protein ribosomal. khususnya pada prokariot. Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. Pengaturan ekspresi gen pada prokariot Pengaturan ekspresi gen pada sistem prokariot telah banyak diungkapkan berdasarkan hasil penelitian mengenai induksi dan represi menggunakan Escherichia coli dan Salmonella typhimurium. Jacob dan J. prosesing mRNA.bicarakan di atas. RNA polimerase. atau translasi. Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model operon yang diajukan oleh F. rRNA.

sedangkan pada represi adalah korepresor. Biologi Unsoed 65 . dan gen-gen struktural (GS). Fak.dengan operator.6. Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Di luar operon terdapat gen regulator (R) beserta promoternya (PR). Molekul efektor pada induksi adalah induser. operon PR R PO O GS1 GS2 GS3 represor efektor (induser atau korepresor) a) RNA polimerase induser RNA polimerase berjalan transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 4. operator (O). dan molekul efektor. molekul protein represor yang dihasilkan oleh gen regulator.

Fak. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. Akibatnya. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.Pada Gambar 4. Operon trp. Jadi. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi. Sebaliknya. Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. Dengan demikian. dan juga prosesing mRNA. transkripsi gen-gen struktural tidak dapat berlangsung. dengan terikatnya represor oleh induser. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon. Operon. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas. Salah satu contohnya adalah operon lac. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. nampaknya tidak begitu penting pada eukariot. kalau pun ada. gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. promoter operon menjadi terbuka bagi RNA polimerase sehingga gen-gen struktural dapat ditranskripsi dan selanjutnya ditranslasi. Biologi Unsoed 66 . ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor. Namun. Akan tetapi. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator.6 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. Namun. dengan adanya korepresor. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang. memegang peran yang sangat penting dalam proses diferensiasi sel. Dengan pengikatan ini.

Sebagai contoh. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. hormon. Biologi Unsoed 67 . Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik. yaitu hanya membawa urutan sebuah gen struktural. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Jadi. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. Demikian pula. mRNA di dalam sel-sel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya.mirip operon. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. Fak. Dengan perkataan lain.

bagaimanakah pemisahan molekul DNA. Setelah dilakukan sentrifugasi dengan kecepatan tinggi di dalam larutan CsCl 8M. Apakah yang dimaksud dengan titik leleh (melting temperature) molekul DNA? d. Mengapa pengukuran konsentrasi larutan DNA dilakukan pada λ260 nm? b.SOAL EVALUASI 1. Apakah yang terjadi jika asam nukleat berada di dalam suasana asam mineral encer? c. Komponen manakah yang menentukan spesifisitas suatu molekul asam nukleat? b. Apakah manfaat senyawa interkalator etidium bromid? Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Fak. Biologi Unsoed 68 . Apakah perbedaan antara nukleotida dan nukleosida? c.AGTTGCAGCCTACGT-3‘. Apakah artinya jika hasil pengukuran kemurnian larutan DNA memberikan nilai nisbah A260 /A280 kurang dari 1. Fenomena apakah yang menyebabkan stabilitas molekul DNA? b. a. 2. Jika suatu molekul RNA mengandung basa adenin sebanyak 20%. a. Suatu untai molekul DNA mempunyai sekuens 5‘. RNA. 3. dan protein? 5. a. Bagaimanakah sekuens untai pasangannya? 4. Sebutkan macam-macam ikatan yang terdapat pada molekul DNA. Apakah yang dimaksud dengan pernyataan bahwa molekul DNA mempunyai nisbah aksial yang tinggi? d. dapatkah Saudara menghitung persentase ketiga basa lainnya? Jelaskan jawaban Saudara.8? c.

5. a. Jadi. persentase A tidak sama dengan persentase T sehingga kandungan basa T. Ikatan glikosilik antara gula dan basa terputus. nukleotida = nukleosida monofosfat. ikatan hidrogen. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. dan C tidak dapat dihitung bedasarkan kandungan basa A. DNA di tengah. Permukaan basa yang bersifat hidrofobik menyebabkan molekul-molekul air dikeluarkan dari sela-sela perpasangan basa sehingga perpasangan tersebut menjadi kuat.ACGTAGGCTGCAACT . Perbandingan antara panjang dan diameternya sangat tinggi sehingga molekul DNA sangat tipis memanjang. protein di atas. b. b. Interaksi penempatan (stacking interactions) antara pasangan-pasangan basa. Ikatan glikosidik (glikosilik).3‘. nukleosida = gula + basa. c. Tidak bisa karena molekul RNA merupakan polinukleotida untai tunggal. a. Basa nitrogen (basa nukleotida). a. d. Suhu ketika molekul DNA mulai mengalami denaturasi. yang merupakan fungsi kandungan GC. d. Absorpsi maksimum sinar UV oleh DNA terjadi pada panjang gelombang 260 nm.KUNCI JAWABAN 1. RNA di bawah. 3. b. Fak. 2. G. Nukleotida = fosfat + gula + basa. c. 5‘. Biologi Unsoed 69 . ikatan fosfodiester. Jadi. Untuk memvisualisasi molekul DNA menggunakan paparan sinar UV. c. Larutan DNA terkontaminasi oleh protein. 4.

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->