BAB IV.

DOGMA SENTRAL BIOLOGI MOLEKULER Di dalam bab ini akan dibahas sekilas dogma sentral biologi molekuler sebagai mekanisme pelaksanaan dua dari tiga fungsi DNA sebagai materi genetik, yaitu fungsi genotipik dan fungsi fenotipik. Dengan mempelajari pokok bahasan ini akan diperoleh gambaran sekilas mengenai proses replikasi dan ekspresi gen beserta pengaturannya, terutama pada kelompok organisme prokariot. Setelah mempelajari pokok bahasan di dalam bab ini mahasiswa diharapkan mampu menjelaskan 1. tiga fungsi DNA sebagai materi genetik dan dogma sentral biologi molekuler, 2. prinsip dasar replikasi DNA, 3. prinsip dasar transkripsi dan transkripsi balik, 4. prinsip dasar translasi, dan 5. prinsip dasar pengaturan ekspresi gen. Pengetahuan awal yang diperlukan oleh mahasiswa agar dapat mempelajari pokok bahasan ini dengan lebih baik adalah struktur asam nukleat, khususnya DNA, yang telah dijelaskan pada Bab III. Selain itu, konsep dasar tentang replikasi DNA, transkripsi, pranslasi, dan pengaturan ekspresi gen yang telah diperoleh pada mata kuliah Genetika juga sangat mendukung pemahaman materi bahasan di dalam bab ini. Fungsi DNA sebagai Materi Genetik DNA sebagai materi genetik pada sebagian besar organisme harus dapat menjalankan tiga macam fungsi pokok berikut ini. 1. DNA harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya, dari generasi ke generasi. Fungsi ini merupakan fungsi genotipik, yang dilaksanakan melalui replikasi. 2. DNA harus mengatur perkembangan fenotipe organisme. Artinya, materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. Fungsi ini merupakan fungsi fenotipik, yang

Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler, Fak. Biologi Unsoed

52

sebelum enzim DNA polimerase bekerja terlebih dahulu diperlukan enzim primase untuk membetuk molekul primer. Biologi Unsoed 53 . deoksisitidin trifosfat (dCTP). Namun. Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru. Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. transkripsi DNA RNA transkripsi balik translasi protein replikasi Gambar 4. Ada tiga cara teoretis replikasi DNA yang pernah diusulkan. yang dilaksanakan melalui peristiwa mutasi. Di dalam bab ini hanya akan dijelaskan secara singkat fungsi genotipik dan fungsi fenotipik DNA. deoksiguanosin trifosfat (dGTP). Tanpa perubahan semacam ini. Enzim utama yang berperan dalam proses replikasi adalah DNA polimerase. semikonservatif. yaitu konservatif. Fungsi ini merupakan fungsi evolusioner.1. masing- Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. evolusi tidak akan pernah berlangsung. dan dispersif. Sementara itu. Mekanisme pelaksanaan kedua fungsi ini sering disebut sebagai dogma sentral genetika molekuler atau dogma sentral biologi molekuler. dan deoksitimidin trifosfat (dTTP). komponen penyusun polimerisasi DNA berupa molekul deoksinukleosida trifosfat (dNTP). 3. Enzim ini hanya dapat bekerja apabila tedapat ujung 3’-OH bebas sehingga diperlukan adanya molekul primer. DNA sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah. yaitu transkripsi dan translasi. Oleh karena itu. Skema dogma sentral biologi molekuler Replikasi DNA Replikasi dapat dikatakan juga sebagai sintesis molekul DNA menggunakan molekul DNA sebagai cetakan (template).dilaksanakan melalui ekspresi gen dengan dua tahapan. yang terdiri atas deoksiadenosin trifosfat (dATP). Fak.

Tiga cara teoretis replikasi DNA = untai lama = untai baru Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation. Percobaan pembuktian tersebut dilaporkan hasilnya pada tahun 1958 oleh M. Kemudian. pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat. Meselson dan F.2). konservatif semikonservatif dispersif Gambar 4. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru (Gambar 4. Prinsip kerja metode ini dapat dilihat pada Bab III. Sementara itu. Fak.2. Di antara ketiga cara replikasi DNA yang diusulkan tersebut.S.masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. Biologi Unsoed 54 . Stahl.W.

Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. Terjadinya sintesis DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. terjadi dua arah (bidireksional). selain terjadi replikasi dua arah. yang masing-masing mempunyai arah 5’→ 3’. baik pada prokariot maupun eukariot.Replikon. Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. ori. Namun. Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi. Biologi Unsoed 55 . ori dapat ditemukan di beberapa tempat. Sementara itu. sesuai dengan nama penemunya. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). garpu replikasi. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan hingga tercapai suatu ujung (terminus). Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). Fak. fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. Fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. Pada eukariot. Biasanya. inisiasi replikasi DNA. dan termini Setiap molekul DNA yang melakukan replikasi sebagai suatu satuan tunggal dinamakan replikon. Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori).

3. 2. yaitu 1. Bedanya dengan sumber basa untuk sintesis DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi digantikan oleh urasil. Adanya sumber basa nitrogen berupa nukleosida trifosfat. Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA.3’ 5’ 3’ fragmen-fragmen Okazaki untai tertinggal 5’ 5’ 3’ untai pengarah Gambar 4. guanosin trifosfat (GTP). Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). Diagram replikasi pada kedua untai DNA Transkripsi Transkripsi merupakan tahap awal ekspresi gen berupa perubahan urutan basa molekul DNA menjadi urutan basa molekul RNA. sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. untai DNA pasangannya. transkripsi merupakan proses sintesis RNA menggunakan salah satu untai molekul DNA sebagai cetakan (templat)nya.3. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. dan disebut sebagai pita antisens. Biologi Unsoed 56 . disebut sebagai pita sens. Jadi. Transkripsi mempunyai ciri-ciri kimiawi yang serupa dengan sintesis/replikasi DNA. Sementara itu. Jadi. Dengan perkataan lain. yang mempunyai urutan basa sama dengan urutan basa RNA. dan uridin trifosfat (UTP). sitidin trifosfat (CTP). Meskipun demikian. Fak. Adanya untai molekul DNA sebagai cetakan.

trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). kedua untai DNA segera menyatu kembali. Hanya saja enzim yang bekerja bukannya DNA polimerase. yaitu pengenalan promoter. inisiasi. Pemisahan kedua untai DNA pertama kali terjadi di suatu tempat tertentu. Tempat ini dinamakan promoter. Secara garis besar transkripsi berlangsung dalam empat tahap.OH pada suatu nukleotida bereaksi dengan gugus 5’. Nukleosida trifosfat pertama akan diletakkan di tapak inisiasi dan sintesis RNA pun segera dimulai. melainkan RNA polimerase. Pengikatan enzim RNA polimerase beserta kofaktor-kofaktornya pada untai DNA cetakan membentuk kompleks transkripsi. Berakhirnya polimerisasi RNA ditandai oleh disosiasi kompleks transkripsi atau terlepasnya enzim RNA polimerase beserta kofaktor-kofaktornya dari untai DNA Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Gugus 3’. Jadi. kedua untainya harus dipisahkan satu sama lain di tempat-tempat terjadinya penambahan basa pada RNA. begitu penambahan basa selesai dilakukan. RNA polimerase akan terikat pada suatu tempat di dekat promoter. Reaksi ini jelas sama dengan reaksi polimerisasi DNA. Agar molekul DNA dapat digunakan sebagai cetakan dalam sintesis RNA. elongasi. elongasi atau polimerisasi RNA berlangsung dari arah 5’ ke 3’. dan teminasi. Tempat ini sering dinyatakan sebagai posisi +1 untuk gen yang akan ditranskripsi. yang merupakan tempat pengikatan enzim RNA polimerase di sisi 5’ (upstream) dari urutan basa penyandi (gen) yang akan ditranskripsi.4. Biologi Unsoed 57 . Setelah mengalami pengikatan oleh promoter. sementara RNA polimerasenya sendiri bergerak dari arah 3’ ke 5’ di sepanjang untai DNA cetakan. Fak. Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. Selanjutnya. yang dinamakan tempat awal polimerisasi atau tapak inisiasi (initiation site). Selama sintesis RNA berlangsung kompleks transkripsi akan bergeser di sepanjang molekul DNA cetakan sehingga nukleotida demi nukleotida akan ditambahkan kepada untai RNA yang sedang diperpanjang pada ujung 3’ nya.

Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida. Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan.4 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Hal ini terjadi ketika RNA polimerase mencapai urutan basa tertentu yang disebut dengan terminator. urutan penyela 5‘ ATTAAAGGCTCCTTTTGGAGCCTTT TTT TT TAATTTCCGAGGAAAACCTCGGAAAAAAAA 3‘ transkripsi U U U C C U C G G A A A A U U U G G A G C C U U U U U U U U 5‘ 3‘ DNA 5’ 3’ Gambar 4.4. yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). Begitu pula halnya dengan molekul RNA hasil sintesis.cetakan. Di antara keduanya terminasi diri lebih umum dijumpai. maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 4. Biologi Unsoed 58 . Fak. Terminasi transkripsi dapat terjadi oleh dua macam sebab. promoter dapat mengikat RNA polimerase yang lain. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu.

selain terjadi secara alami pada virus dengan materi genetik berupa RNA (retrovirus). Hal ini karena proses transkripsi normal mempunyai mekanisme koreksi yang mengurangi frekuensi kesalahan transkripsi. tidak lama setelah penemuan enzim restriksi. Oleh karena cDNA merupakan hasil transkripsi balik RNA. Jika seorang peneliti ingin mengekspresikan suatu protein spesifik dari sistem eukariot di dalam sel yang tidak lazim memproduksi protein tersebut. khususnya mRNA. enzim transkriptase balik sebenarnya bukanlah merupakan katalisator yang efektif.Transkripsi balik Pada beberapa virus tertentu. Ketersediaan enzim transkriptase balik ini telah memberikan kemudahan bagi para peneliti untuk mempelajari gen yang bertanggung jawab terhadap pemunculan sifat-sifat tertentu. Proses penyalinan RNA menjadi DNA disebut sebagai transkripsi balik (reverse transcription) dan enzim utama yang mengatalisis proses tersebut adalah enzim transkriptase balik (reverse transcriptase). dapat juga dilakukan secara in vitro seperti halnya pada pembuatan perpustakaan cDNA (lihat Bab VI). Enzim transkriptase balik ditemukan oleh Howard Temin dan David Baltimore secara terpisah pada tahun 1970. Saat ini enzim transkriptase balik telah diproduksi secara komersial. yang dapat berupa molekul untai tunggal atau untai ganda. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Tujuan mengonversi mRNA menjadi cDNA adalah karena DNA sifatnya lebih stabil daripada RNA. proses ekspresi gen tetap berlangsung melalui transkripsi dan translasi. Selama satu periode transkripsi setidaknya terdapat rata-rata 10 kesalahan. Dengan demikian. maka ukurannya lebih pendek daripada DNA. Hal ini terutama terlihat pada cDNA organisme eukariot. yang relatif lebih parah bila dibandingkan dengan kesalahan pada replikasi normal. maka cara sederhana yang dapat dilakukan adalah mentransfer cDNA yang menyandi protein tersebut ke dalam sel resipien sebagai sel inang (lihat Bab V). yang hanya mengandung urutan basa intron. keberadaan molekul DNA tetap diperlukan sehingga RNA sebagai materi genetik terlebih dahulu harus diubah menjadi DNA. yang materi genetiknya berupa RNA. Fak. Biologi Unsoed 59 . DNA hasil transkripsi balik disebut sebagai DNA komplementer (cDNA). Proses transkripsi balik. Meskipun demikian.

sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. Translasi. sintesis Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. besar dan kecil. translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel. Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). suatu struktur organel yang banyak terdapat di dalam sitoplasma. atau pada hakekatnya sintesis protein. Molekul mRNA ditranslasi dengan arah 5’→ 3’. Tiap ribosom mempunyai dua tempat pengikatan tRNA. Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. elongasi. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. Fak. dan terminasi polipeptida. 2. 1. Pada kebanyakan prokariot ribosom mempunyai ukuran 70S. berlangsung di dalam ribosom. yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. Sebagai contoh.Translasi Bila dibandingkan dengan transkripsi. maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Empat puluh hingga 60 molekul tRNA yang berbeda 4. Ribosom terdiri atas dua subunit. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi. tetapi tidak dari ujung 5’ hingga ujung 3’. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil. sedangkan pada eukariot biasanya sekitar 80S. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. Biologi Unsoed 60 .

. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 4. arah gerakan ribosom P A ribosom CUG GGG 3’ mRNA 5’ AUC UAG ACC UGG GAC tRNA aa NH2 aa aa aa COOH aminoasil-tRNA aa NH2 ikatan peptida COOH Gambar 4. Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. akan diberikan di bawah ini. Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh. -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin.5. Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung.5.protein yang mempunyai urutan NH2-Met-Pro. Biologi Unsoed 61 . Hal ini berarti Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet). . Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus. khususnya pada prokariot. Sementara itu. Selanjutnya. berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Fak..

Biologi Unsoed 62 . Pengikatan aminoasil-tRNAfMet berikutnya. IF-2. yang melibatkan (1) perpindahan f-metala. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin.bahwa sintesis semua polipeptida selalu dimulai dengan metionin. Triplet kodon berikutnya.tRNAala. Kompleks inisiasi pada prokariot terbentuk antara mRNA. dan metionil-tRNAfMet terikat pada tapak P. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasiltRNAfMet berikutnya yang akan masuk ke tapak A. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. Selain itu.tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. Selanjutnya. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. misalnya alanil. kompleks inisiasi bergabung dengan subunit besar ribosom (50S). ke tapak A memerlukan protein-protein elongasi EF-Ts dan EF-Tu. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. metionil-tRNAfMet. serta sebuah molekul GTP. Fak. baik pada prokariot maupun eukariot. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet). IF-2. misalnya penyandi serin. suatu enzim yang terikat pada subunit ribosom 50S. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. dan IF-3). Khusus pada prokariot akan terjadi formilasi gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa fmetionin. dan IF-3. Langkah berikutnya adalah translokasi. dan subunit kecil ribosom (30S) dengan bantuan protein IF-1.

Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. tRNA di tapak P. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. Fak. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). Dengan berlangsungnya kedua proses tersebut secara bersamaan. Biologi Unsoed 63 . seperti yang akan dijelaskan nanti. sedangkan translasi terjadi di sitoplasma (ribosom). Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. kedua subunit ribosom pun memisah. Sebagai contoh. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A.akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. dan rantai polipeptida dari ribosom. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. Transkripsi terjadi di dalam nukleus. Selain itu. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. yaitu RF-1 dan RF-2. Terminasi ditandai oleh terlepasnya mRNA. Salah satu di antaranya seperti telah kita Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. tidak demikian halnya pada eukariot. Namun. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. juga menjadi sangat efisien. Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma. ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn onturn off) ekspresi gen. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom.

Pada kondisi tertentu represor akan berikatan dengan operator. Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. Monod pada tahun 1961. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. khususnya pada prokariot. Gen-gen yang menyandi pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. prosesing mRNA. atau bahkan tumpang tindih. Pengaturan Eskpresi Gen Produk-produk gen tertentu seperti protein ribosomal. tRNA. rRNA. yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. atau translasi. Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu.bicarakan di atas. Namun. Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. RNA polimerase. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. menyebabkan terhalangnya transkripsi gen-gen struktural. Fak. Sementara itu. Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model operon yang diajukan oleh F. Jacob dan J. Biologi Unsoed 64 . paling banyak terjadi pada tahap transkripsi. Pengaturan ekspresi gen pada prokariot Pengaturan ekspresi gen pada sistem prokariot telah banyak diungkapkan berdasarkan hasil penelitian mengenai induksi dan represi menggunakan Escherichia coli dan Salmonella typhimurium. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. misalnya transkripsi.

dan molekul efektor. Di luar operon terdapat gen regulator (R) beserta promoternya (PR). operator (O).6. operon PR R PO O GS1 GS2 GS3 represor efektor (induser atau korepresor) a) RNA polimerase induser RNA polimerase berjalan transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 4. Fak. Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. molekul protein represor yang dihasilkan oleh gen regulator. sedangkan pada represi adalah korepresor. Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). Biologi Unsoed 65 .dengan operator. Molekul efektor pada induksi adalah induser. dan gen-gen struktural (GS).

gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. Fak. transkripsi gen-gen struktural tidak dapat berlangsung. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator. Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.6 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas. Sebaliknya. dengan terikatnya represor oleh induser. Operon. Namun. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang.Pada Gambar 4. Dengan pengikatan ini. Operon trp. Akan tetapi. kalau pun ada. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi. Jadi. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor. Salah satu contohnya adalah operon lac. Akibatnya. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. nampaknya tidak begitu penting pada eukariot. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi. dengan adanya korepresor. Biologi Unsoed 66 . dan juga prosesing mRNA. promoter operon menjadi terbuka bagi RNA polimerase sehingga gen-gen struktural dapat ditranskripsi dan selanjutnya ditranslasi. Dengan demikian. memegang peran yang sangat penting dalam proses diferensiasi sel. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. Namun.

Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. Fak. mRNA di dalam sel-sel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. Dengan perkataan lain. Biologi Unsoed 67 . Sebagai contoh. Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. yaitu hanya membawa urutan sebuah gen struktural.mirip operon. dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. hormon. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik. Demikian pula. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. Jadi.

Jika suatu molekul RNA mengandung basa adenin sebanyak 20%. Fak. RNA. Mengapa pengukuran konsentrasi larutan DNA dilakukan pada λ260 nm? b. 2. 3.8? c. Sebutkan macam-macam ikatan yang terdapat pada molekul DNA. Bagaimanakah sekuens untai pasangannya? 4. Apakah perbedaan antara nukleotida dan nukleosida? c. Setelah dilakukan sentrifugasi dengan kecepatan tinggi di dalam larutan CsCl 8M. a. Fenomena apakah yang menyebabkan stabilitas molekul DNA? b. Apakah yang terjadi jika asam nukleat berada di dalam suasana asam mineral encer? c. Apakah artinya jika hasil pengukuran kemurnian larutan DNA memberikan nilai nisbah A260 /A280 kurang dari 1. dapatkah Saudara menghitung persentase ketiga basa lainnya? Jelaskan jawaban Saudara. Komponen manakah yang menentukan spesifisitas suatu molekul asam nukleat? b. Apakah yang dimaksud dengan titik leleh (melting temperature) molekul DNA? d. Suatu untai molekul DNA mempunyai sekuens 5‘. bagaimanakah pemisahan molekul DNA. Biologi Unsoed 68 . a.SOAL EVALUASI 1. Apakah yang dimaksud dengan pernyataan bahwa molekul DNA mempunyai nisbah aksial yang tinggi? d.AGTTGCAGCCTACGT-3‘. Apakah manfaat senyawa interkalator etidium bromid? Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. dan protein? 5. a.

nukleotida = nukleosida monofosfat. a. Fak. Ikatan glikosilik antara gula dan basa terputus. c. yang merupakan fungsi kandungan GC. d. 5‘. c. Untuk memvisualisasi molekul DNA menggunakan paparan sinar UV. 3.KUNCI JAWABAN 1.ACGTAGGCTGCAACT . 4. protein di atas. Tidak bisa karena molekul RNA merupakan polinukleotida untai tunggal. Nukleotida = fosfat + gula + basa. 5. Permukaan basa yang bersifat hidrofobik menyebabkan molekul-molekul air dikeluarkan dari sela-sela perpasangan basa sehingga perpasangan tersebut menjadi kuat. RNA di bawah. Jadi. ikatan hidrogen. d. Larutan DNA terkontaminasi oleh protein. nukleosida = gula + basa. Absorpsi maksimum sinar UV oleh DNA terjadi pada panjang gelombang 260 nm. persentase A tidak sama dengan persentase T sehingga kandungan basa T. Perbandingan antara panjang dan diameternya sangat tinggi sehingga molekul DNA sangat tipis memanjang.3‘. 2. b. G. c. b. ikatan fosfodiester. Ikatan glikosidik (glikosilik). dan C tidak dapat dihitung bedasarkan kandungan basa A. Interaksi penempatan (stacking interactions) antara pasangan-pasangan basa. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Biologi Unsoed 69 . a. b. a. DNA di tengah. Suhu ketika molekul DNA mulai mengalami denaturasi. Jadi. Basa nitrogen (basa nukleotida).

Sign up to vote on this title
UsefulNot useful