BAB IV.

DOGMA SENTRAL BIOLOGI MOLEKULER Di dalam bab ini akan dibahas sekilas dogma sentral biologi molekuler sebagai mekanisme pelaksanaan dua dari tiga fungsi DNA sebagai materi genetik, yaitu fungsi genotipik dan fungsi fenotipik. Dengan mempelajari pokok bahasan ini akan diperoleh gambaran sekilas mengenai proses replikasi dan ekspresi gen beserta pengaturannya, terutama pada kelompok organisme prokariot. Setelah mempelajari pokok bahasan di dalam bab ini mahasiswa diharapkan mampu menjelaskan 1. tiga fungsi DNA sebagai materi genetik dan dogma sentral biologi molekuler, 2. prinsip dasar replikasi DNA, 3. prinsip dasar transkripsi dan transkripsi balik, 4. prinsip dasar translasi, dan 5. prinsip dasar pengaturan ekspresi gen. Pengetahuan awal yang diperlukan oleh mahasiswa agar dapat mempelajari pokok bahasan ini dengan lebih baik adalah struktur asam nukleat, khususnya DNA, yang telah dijelaskan pada Bab III. Selain itu, konsep dasar tentang replikasi DNA, transkripsi, pranslasi, dan pengaturan ekspresi gen yang telah diperoleh pada mata kuliah Genetika juga sangat mendukung pemahaman materi bahasan di dalam bab ini. Fungsi DNA sebagai Materi Genetik DNA sebagai materi genetik pada sebagian besar organisme harus dapat menjalankan tiga macam fungsi pokok berikut ini. 1. DNA harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya, dari generasi ke generasi. Fungsi ini merupakan fungsi genotipik, yang dilaksanakan melalui replikasi. 2. DNA harus mengatur perkembangan fenotipe organisme. Artinya, materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. Fungsi ini merupakan fungsi fenotipik, yang

Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler, Fak. Biologi Unsoed

52

dilaksanakan melalui ekspresi gen dengan dua tahapan. dan dispersif. Enzim ini hanya dapat bekerja apabila tedapat ujung 3’-OH bebas sehingga diperlukan adanya molekul primer. Oleh karena itu. yang dilaksanakan melalui peristiwa mutasi. Mekanisme pelaksanaan kedua fungsi ini sering disebut sebagai dogma sentral genetika molekuler atau dogma sentral biologi molekuler.1. 3. Tanpa perubahan semacam ini. Skema dogma sentral biologi molekuler Replikasi DNA Replikasi dapat dikatakan juga sebagai sintesis molekul DNA menggunakan molekul DNA sebagai cetakan (template). deoksiguanosin trifosfat (dGTP). transkripsi DNA RNA transkripsi balik translasi protein replikasi Gambar 4. Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. evolusi tidak akan pernah berlangsung. semikonservatif. Biologi Unsoed 53 . Namun. DNA sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah. sebelum enzim DNA polimerase bekerja terlebih dahulu diperlukan enzim primase untuk membetuk molekul primer. Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru. dan deoksitimidin trifosfat (dTTP). Fungsi ini merupakan fungsi evolusioner. Di dalam bab ini hanya akan dijelaskan secara singkat fungsi genotipik dan fungsi fenotipik DNA. Fak. masing- Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Enzim utama yang berperan dalam proses replikasi adalah DNA polimerase. yaitu transkripsi dan translasi. yaitu konservatif. yang terdiri atas deoksiadenosin trifosfat (dATP). komponen penyusun polimerisasi DNA berupa molekul deoksinukleosida trifosfat (dNTP). Ada tiga cara teoretis replikasi DNA yang pernah diusulkan. deoksisitidin trifosfat (dCTP). Sementara itu.

Prinsip kerja metode ini dapat dilihat pada Bab III. Fak. pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation.2). konservatif semikonservatif dispersif Gambar 4. Meselson dan F.2.W. Kemudian. Di antara ketiga cara replikasi DNA yang diusulkan tersebut.masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru.S. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru (Gambar 4. Percobaan pembuktian tersebut dilaporkan hasilnya pada tahun 1958 oleh M. Stahl. Tiga cara teoretis replikasi DNA = untai lama = untai baru Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Biologi Unsoed 54 . Sementara itu.

Biasanya. Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. sesuai dengan nama penemunya. sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. dan termini Setiap molekul DNA yang melakukan replikasi sebagai suatu satuan tunggal dinamakan replikon. Namun.Replikon. baik pada prokariot maupun eukariot. Biologi Unsoed 55 . Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. yang masing-masing mempunyai arah 5’→ 3’. Fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). Pada eukariot. inisiasi replikasi DNA. ori dapat ditemukan di beberapa tempat. selain terjadi replikasi dua arah. garpu replikasi. Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. terjadi dua arah (bidireksional). Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori). Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. Terjadinya sintesis DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. Fak. yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi. ori. Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan hingga tercapai suatu ujung (terminus). Sementara itu.

Fak. 2.3’ 5’ 3’ fragmen-fragmen Okazaki untai tertinggal 5’ 5’ 3’ untai pengarah Gambar 4. 3. untai DNA pasangannya. Diagram replikasi pada kedua untai DNA Transkripsi Transkripsi merupakan tahap awal ekspresi gen berupa perubahan urutan basa molekul DNA menjadi urutan basa molekul RNA. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Dengan perkataan lain. Bedanya dengan sumber basa untuk sintesis DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi digantikan oleh urasil. Jadi. Adanya untai molekul DNA sebagai cetakan. Transkripsi mempunyai ciri-ciri kimiawi yang serupa dengan sintesis/replikasi DNA. dan uridin trifosfat (UTP). Jadi. yang mempunyai urutan basa sama dengan urutan basa RNA. bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. Biologi Unsoed 56 . disebut sebagai pita sens. Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. dan disebut sebagai pita antisens.3. Adanya sumber basa nitrogen berupa nukleosida trifosfat. Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). yaitu 1. Sementara itu. Meskipun demikian. sitidin trifosfat (CTP). sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. transkripsi merupakan proses sintesis RNA menggunakan salah satu untai molekul DNA sebagai cetakan (templat)nya. guanosin trifosfat (GTP).

Pemisahan kedua untai DNA pertama kali terjadi di suatu tempat tertentu. yang merupakan tempat pengikatan enzim RNA polimerase di sisi 5’ (upstream) dari urutan basa penyandi (gen) yang akan ditranskripsi. melainkan RNA polimerase. sementara RNA polimerasenya sendiri bergerak dari arah 3’ ke 5’ di sepanjang untai DNA cetakan. inisiasi. yaitu pengenalan promoter. Reaksi ini jelas sama dengan reaksi polimerisasi DNA. Pengikatan enzim RNA polimerase beserta kofaktor-kofaktornya pada untai DNA cetakan membentuk kompleks transkripsi. kedua untai DNA segera menyatu kembali. Selanjutnya.OH pada suatu nukleotida bereaksi dengan gugus 5’. begitu penambahan basa selesai dilakukan. Nukleosida trifosfat pertama akan diletakkan di tapak inisiasi dan sintesis RNA pun segera dimulai. RNA polimerase akan terikat pada suatu tempat di dekat promoter. Gugus 3’. elongasi. kedua untainya harus dipisahkan satu sama lain di tempat-tempat terjadinya penambahan basa pada RNA. yang dinamakan tempat awal polimerisasi atau tapak inisiasi (initiation site). Tempat ini sering dinyatakan sebagai posisi +1 untuk gen yang akan ditranskripsi. Selama sintesis RNA berlangsung kompleks transkripsi akan bergeser di sepanjang molekul DNA cetakan sehingga nukleotida demi nukleotida akan ditambahkan kepada untai RNA yang sedang diperpanjang pada ujung 3’ nya. Berakhirnya polimerisasi RNA ditandai oleh disosiasi kompleks transkripsi atau terlepasnya enzim RNA polimerase beserta kofaktor-kofaktornya dari untai DNA Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Jadi. Biologi Unsoed 57 . dan teminasi. Hanya saja enzim yang bekerja bukannya DNA polimerase. elongasi atau polimerisasi RNA berlangsung dari arah 5’ ke 3’. Secara garis besar transkripsi berlangsung dalam empat tahap.trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). Tempat ini dinamakan promoter.4. Agar molekul DNA dapat digunakan sebagai cetakan dalam sintesis RNA. Setelah mengalami pengikatan oleh promoter. Fak. Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer.

yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). Biologi Unsoed 58 .4. Fak. maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 4. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. urutan penyela 5‘ ATTAAAGGCTCCTTTTGGAGCCTTT TTT TT TAATTTCCGAGGAAAACCTCGGAAAAAAAA 3‘ transkripsi U U U C C U C G G A A A A U U U G G A G C C U U U U U U U U 5‘ 3‘ DNA 5’ 3’ Gambar 4. Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). Hal ini terjadi ketika RNA polimerase mencapai urutan basa tertentu yang disebut dengan terminator. Terminasi transkripsi dapat terjadi oleh dua macam sebab. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida. Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. promoter dapat mengikat RNA polimerase yang lain.4 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Di antara keduanya terminasi diri lebih umum dijumpai. Begitu pula halnya dengan molekul RNA hasil sintesis.cetakan.

Tujuan mengonversi mRNA menjadi cDNA adalah karena DNA sifatnya lebih stabil daripada RNA. Jika seorang peneliti ingin mengekspresikan suatu protein spesifik dari sistem eukariot di dalam sel yang tidak lazim memproduksi protein tersebut. dapat juga dilakukan secara in vitro seperti halnya pada pembuatan perpustakaan cDNA (lihat Bab VI).Transkripsi balik Pada beberapa virus tertentu. selain terjadi secara alami pada virus dengan materi genetik berupa RNA (retrovirus). tidak lama setelah penemuan enzim restriksi. DNA hasil transkripsi balik disebut sebagai DNA komplementer (cDNA). yang materi genetiknya berupa RNA. Ketersediaan enzim transkriptase balik ini telah memberikan kemudahan bagi para peneliti untuk mempelajari gen yang bertanggung jawab terhadap pemunculan sifat-sifat tertentu. yang relatif lebih parah bila dibandingkan dengan kesalahan pada replikasi normal. Selama satu periode transkripsi setidaknya terdapat rata-rata 10 kesalahan. Dengan demikian. Biologi Unsoed 59 . Hal ini terutama terlihat pada cDNA organisme eukariot. Oleh karena cDNA merupakan hasil transkripsi balik RNA. maka ukurannya lebih pendek daripada DNA. Saat ini enzim transkriptase balik telah diproduksi secara komersial. keberadaan molekul DNA tetap diperlukan sehingga RNA sebagai materi genetik terlebih dahulu harus diubah menjadi DNA. Proses penyalinan RNA menjadi DNA disebut sebagai transkripsi balik (reverse transcription) dan enzim utama yang mengatalisis proses tersebut adalah enzim transkriptase balik (reverse transcriptase). Enzim transkriptase balik ditemukan oleh Howard Temin dan David Baltimore secara terpisah pada tahun 1970. Meskipun demikian. yang hanya mengandung urutan basa intron. khususnya mRNA. Proses transkripsi balik. maka cara sederhana yang dapat dilakukan adalah mentransfer cDNA yang menyandi protein tersebut ke dalam sel resipien sebagai sel inang (lihat Bab V). proses ekspresi gen tetap berlangsung melalui transkripsi dan translasi. Hal ini karena proses transkripsi normal mempunyai mekanisme koreksi yang mengurangi frekuensi kesalahan transkripsi. Fak. enzim transkriptase balik sebenarnya bukanlah merupakan katalisator yang efektif. yang dapat berupa molekul untai tunggal atau untai ganda. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.

Fak. atau pada hakekatnya sintesis protein. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi. yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. Molekul mRNA ditranslasi dengan arah 5’→ 3’. Biologi Unsoed 60 . Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil. Ribosom terdiri atas dua subunit. Empat puluh hingga 60 molekul tRNA yang berbeda 4. suatu struktur organel yang banyak terdapat di dalam sitoplasma. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). sedangkan pada eukariot biasanya sekitar 80S. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. Translasi. berlangsung di dalam ribosom. maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. 1. sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. Tiap ribosom mempunyai dua tempat pengikatan tRNA. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). elongasi. Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A. besar dan kecil. tetapi tidak dari ujung 5’ hingga ujung 3’. Sebagai contoh. sintesis Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.Translasi Bila dibandingkan dengan transkripsi. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel. Pada kebanyakan prokariot ribosom mempunyai ukuran 70S. 2. dan terminasi polipeptida. translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul.

Hal ini berarti Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin. Selanjutnya. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 4. Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh. berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya. pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA. arah gerakan ribosom P A ribosom CUG GGG 3’ mRNA 5’ AUC UAG ACC UGG GAC tRNA aa NH2 aa aa aa COOH aminoasil-tRNA aa NH2 ikatan peptida COOH Gambar 4. khususnya pada prokariot.. Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. Biologi Unsoed 61 . . Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Fak.5. . Sementara itu. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. akan diberikan di bawah ini.protein yang mempunyai urutan NH2-Met-Pro. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus.5. Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet).

Triplet kodon berikutnya. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. Khusus pada prokariot akan terjadi formilasi gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa fmetionin. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. Selain itu. baik pada prokariot maupun eukariot. metionil-tRNAfMet. dan IF-3).tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. misalnya penyandi serin. dan IF-3. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet). Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A.tRNAala. suatu enzim yang terikat pada subunit ribosom 50S. Biologi Unsoed 62 . kompleks inisiasi bergabung dengan subunit besar ribosom (50S). Langkah berikutnya adalah translokasi. dan metionil-tRNAfMet terikat pada tapak P. Fak. Selanjutnya. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. serta sebuah molekul GTP. yang melibatkan (1) perpindahan f-metala. IF-2. ke tapak A memerlukan protein-protein elongasi EF-Ts dan EF-Tu. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasiltRNAfMet berikutnya yang akan masuk ke tapak A. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin. misalnya alanil.bahwa sintesis semua polipeptida selalu dimulai dengan metionin. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. IF-2. Kompleks inisiasi pada prokariot terbentuk antara mRNA. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. dan subunit kecil ribosom (30S) dengan bantuan protein IF-1. Pengikatan aminoasil-tRNAfMet berikutnya.

Terminasi ditandai oleh terlepasnya mRNA. ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn onturn off) ekspresi gen. Fak. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A. Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir.akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. Sebagai contoh. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. sedangkan translasi terjadi di sitoplasma (ribosom). tRNA di tapak P. Biologi Unsoed 63 . dan rantai polipeptida dari ribosom. Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. Transkripsi terjadi di dalam nukleus. tidak demikian halnya pada eukariot. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). seperti yang akan dijelaskan nanti. yaitu RF-1 dan RF-2. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. Namun. Selain itu. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. Dengan berlangsungnya kedua proses tersebut secara bersamaan. Salah satu di antaranya seperti telah kita Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. kedua subunit ribosom pun memisah. juga menjadi sangat efisien.

yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. Jacob dan J. misalnya transkripsi. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model operon yang diajukan oleh F. Fak. atau bahkan tumpang tindih. khususnya pada prokariot. Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. tRNA. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel.bicarakan di atas. Biologi Unsoed 64 . Pada kondisi tertentu represor akan berikatan dengan operator. Gen-gen yang menyandi pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. Pengaturan Eskpresi Gen Produk-produk gen tertentu seperti protein ribosomal. menyebabkan terhalangnya transkripsi gen-gen struktural. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. paling banyak terjadi pada tahap transkripsi. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. RNA polimerase. prosesing mRNA. Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. Namun. atau translasi. Monod pada tahun 1961. Sementara itu. rRNA. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. Pengaturan ekspresi gen pada prokariot Pengaturan ekspresi gen pada sistem prokariot telah banyak diungkapkan berdasarkan hasil penelitian mengenai induksi dan represi menggunakan Escherichia coli dan Salmonella typhimurium.

Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). molekul protein represor yang dihasilkan oleh gen regulator. Fak. Molekul efektor pada induksi adalah induser. operon PR R PO O GS1 GS2 GS3 represor efektor (induser atau korepresor) a) RNA polimerase induser RNA polimerase berjalan transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 4. dan molekul efektor. operator (O).6. dan gen-gen struktural (GS). Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Biologi Unsoed 65 .dengan operator. Di luar operon terdapat gen regulator (R) beserta promoternya (PR). sedangkan pada represi adalah korepresor.

Sebaliknya. Biologi Unsoed 66 . promoter operon menjadi terbuka bagi RNA polimerase sehingga gen-gen struktural dapat ditranskripsi dan selanjutnya ditranslasi. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Jadi. Dengan pengikatan ini. gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. Dengan demikian. dengan terikatnya represor oleh induser. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang. Namun. Salah satu contohnya adalah operon lac. Operon. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor. nampaknya tidak begitu penting pada eukariot. transkripsi gen-gen struktural tidak dapat berlangsung. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon.Pada Gambar 4. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. dan juga prosesing mRNA. Akibatnya. dengan adanya korepresor. kalau pun ada. Operon trp. memegang peran yang sangat penting dalam proses diferensiasi sel. Fak.6 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. Namun. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator. Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. Akan tetapi. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi.

mirip operon. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Fak. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. Biologi Unsoed 67 . Sebagai contoh. yaitu hanya membawa urutan sebuah gen struktural. Jadi. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. Dengan perkataan lain. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik. molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. mRNA di dalam sel-sel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. Demikian pula. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. hormon.

Apakah artinya jika hasil pengukuran kemurnian larutan DNA memberikan nilai nisbah A260 /A280 kurang dari 1. Sebutkan macam-macam ikatan yang terdapat pada molekul DNA. 3. Suatu untai molekul DNA mempunyai sekuens 5‘. Apakah yang dimaksud dengan titik leleh (melting temperature) molekul DNA? d.8? c. Apakah perbedaan antara nukleotida dan nukleosida? c. a. Biologi Unsoed 68 . Apakah yang terjadi jika asam nukleat berada di dalam suasana asam mineral encer? c. 2. Apakah manfaat senyawa interkalator etidium bromid? Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. dapatkah Saudara menghitung persentase ketiga basa lainnya? Jelaskan jawaban Saudara. Fak. Apakah yang dimaksud dengan pernyataan bahwa molekul DNA mempunyai nisbah aksial yang tinggi? d. dan protein? 5. bagaimanakah pemisahan molekul DNA. Jika suatu molekul RNA mengandung basa adenin sebanyak 20%. RNA. Komponen manakah yang menentukan spesifisitas suatu molekul asam nukleat? b. Bagaimanakah sekuens untai pasangannya? 4.AGTTGCAGCCTACGT-3‘. a. a.SOAL EVALUASI 1. Fenomena apakah yang menyebabkan stabilitas molekul DNA? b. Mengapa pengukuran konsentrasi larutan DNA dilakukan pada λ260 nm? b. Setelah dilakukan sentrifugasi dengan kecepatan tinggi di dalam larutan CsCl 8M.

ikatan fosfodiester. b. persentase A tidak sama dengan persentase T sehingga kandungan basa T. a. 4. Jadi. yang merupakan fungsi kandungan GC. dan C tidak dapat dihitung bedasarkan kandungan basa A. Jadi. DNA di tengah. d. Interaksi penempatan (stacking interactions) antara pasangan-pasangan basa. RNA di bawah. Ikatan glikosilik antara gula dan basa terputus. Ikatan glikosidik (glikosilik). Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. c. a. c. c. Perbandingan antara panjang dan diameternya sangat tinggi sehingga molekul DNA sangat tipis memanjang. Basa nitrogen (basa nukleotida). Permukaan basa yang bersifat hidrofobik menyebabkan molekul-molekul air dikeluarkan dari sela-sela perpasangan basa sehingga perpasangan tersebut menjadi kuat. Tidak bisa karena molekul RNA merupakan polinukleotida untai tunggal. Suhu ketika molekul DNA mulai mengalami denaturasi. 3. a. b. Absorpsi maksimum sinar UV oleh DNA terjadi pada panjang gelombang 260 nm. 5‘. d. Fak. Biologi Unsoed 69 . 5.ACGTAGGCTGCAACT . b. nukleotida = nukleosida monofosfat. nukleosida = gula + basa.KUNCI JAWABAN 1. Untuk memvisualisasi molekul DNA menggunakan paparan sinar UV. protein di atas. Nukleotida = fosfat + gula + basa. 2. ikatan hidrogen. G.3‘. Larutan DNA terkontaminasi oleh protein.