BAB IV.

DOGMA SENTRAL BIOLOGI MOLEKULER Di dalam bab ini akan dibahas sekilas dogma sentral biologi molekuler sebagai mekanisme pelaksanaan dua dari tiga fungsi DNA sebagai materi genetik, yaitu fungsi genotipik dan fungsi fenotipik. Dengan mempelajari pokok bahasan ini akan diperoleh gambaran sekilas mengenai proses replikasi dan ekspresi gen beserta pengaturannya, terutama pada kelompok organisme prokariot. Setelah mempelajari pokok bahasan di dalam bab ini mahasiswa diharapkan mampu menjelaskan 1. tiga fungsi DNA sebagai materi genetik dan dogma sentral biologi molekuler, 2. prinsip dasar replikasi DNA, 3. prinsip dasar transkripsi dan transkripsi balik, 4. prinsip dasar translasi, dan 5. prinsip dasar pengaturan ekspresi gen. Pengetahuan awal yang diperlukan oleh mahasiswa agar dapat mempelajari pokok bahasan ini dengan lebih baik adalah struktur asam nukleat, khususnya DNA, yang telah dijelaskan pada Bab III. Selain itu, konsep dasar tentang replikasi DNA, transkripsi, pranslasi, dan pengaturan ekspresi gen yang telah diperoleh pada mata kuliah Genetika juga sangat mendukung pemahaman materi bahasan di dalam bab ini. Fungsi DNA sebagai Materi Genetik DNA sebagai materi genetik pada sebagian besar organisme harus dapat menjalankan tiga macam fungsi pokok berikut ini. 1. DNA harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya, dari generasi ke generasi. Fungsi ini merupakan fungsi genotipik, yang dilaksanakan melalui replikasi. 2. DNA harus mengatur perkembangan fenotipe organisme. Artinya, materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. Fungsi ini merupakan fungsi fenotipik, yang

Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler, Fak. Biologi Unsoed

52

komponen penyusun polimerisasi DNA berupa molekul deoksinukleosida trifosfat (dNTP). DNA sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah. yaitu konservatif. transkripsi DNA RNA transkripsi balik translasi protein replikasi Gambar 4. sebelum enzim DNA polimerase bekerja terlebih dahulu diperlukan enzim primase untuk membetuk molekul primer. dan deoksitimidin trifosfat (dTTP). Mekanisme pelaksanaan kedua fungsi ini sering disebut sebagai dogma sentral genetika molekuler atau dogma sentral biologi molekuler. yang terdiri atas deoksiadenosin trifosfat (dATP). Enzim ini hanya dapat bekerja apabila tedapat ujung 3’-OH bebas sehingga diperlukan adanya molekul primer. Enzim utama yang berperan dalam proses replikasi adalah DNA polimerase. Fak.1. Sementara itu. Skema dogma sentral biologi molekuler Replikasi DNA Replikasi dapat dikatakan juga sebagai sintesis molekul DNA menggunakan molekul DNA sebagai cetakan (template). Di dalam bab ini hanya akan dijelaskan secara singkat fungsi genotipik dan fungsi fenotipik DNA. Ada tiga cara teoretis replikasi DNA yang pernah diusulkan. Namun. Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. Oleh karena itu. Fungsi ini merupakan fungsi evolusioner. Tanpa perubahan semacam ini. semikonservatif. masing- Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. yaitu transkripsi dan translasi. 3. deoksiguanosin trifosfat (dGTP). Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru. Biologi Unsoed 53 . dan dispersif.dilaksanakan melalui ekspresi gen dengan dua tahapan. evolusi tidak akan pernah berlangsung. yang dilaksanakan melalui peristiwa mutasi. deoksisitidin trifosfat (dCTP).

Biologi Unsoed 54 . Stahl. pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat.W.S. konservatif semikonservatif dispersif Gambar 4. Di antara ketiga cara replikasi DNA yang diusulkan tersebut. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru (Gambar 4.2). Tiga cara teoretis replikasi DNA = untai lama = untai baru Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation.2. Sementara itu. Fak. Percobaan pembuktian tersebut dilaporkan hasilnya pada tahun 1958 oleh M. Kemudian. Meselson dan F.masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. Prinsip kerja metode ini dapat dilihat pada Bab III.

garpu replikasi. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. sesuai dengan nama penemunya. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). Sementara itu. Namun. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. dan termini Setiap molekul DNA yang melakukan replikasi sebagai suatu satuan tunggal dinamakan replikon. Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan hingga tercapai suatu ujung (terminus). Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. Fak. yang masing-masing mempunyai arah 5’→ 3’. Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’.Replikon. inisiasi replikasi DNA. baik pada prokariot maupun eukariot. ori. ori dapat ditemukan di beberapa tempat. Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. Biasanya. Biologi Unsoed 55 . Pada eukariot. selain terjadi replikasi dua arah. Terjadinya sintesis DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. terjadi dua arah (bidireksional). Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori). yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi. Fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA.

3. Dengan perkataan lain. Adanya untai molekul DNA sebagai cetakan. Fak. untai DNA pasangannya.3. dan disebut sebagai pita antisens. Meskipun demikian. sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Bedanya dengan sumber basa untuk sintesis DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi digantikan oleh urasil. bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. Biologi Unsoed 56 . yang mempunyai urutan basa sama dengan urutan basa RNA. guanosin trifosfat (GTP). Sementara itu.3’ 5’ 3’ fragmen-fragmen Okazaki untai tertinggal 5’ 5’ 3’ untai pengarah Gambar 4. disebut sebagai pita sens. dan uridin trifosfat (UTP). Diagram replikasi pada kedua untai DNA Transkripsi Transkripsi merupakan tahap awal ekspresi gen berupa perubahan urutan basa molekul DNA menjadi urutan basa molekul RNA. Transkripsi mempunyai ciri-ciri kimiawi yang serupa dengan sintesis/replikasi DNA. Jadi. Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. sitidin trifosfat (CTP). Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. Adanya sumber basa nitrogen berupa nukleosida trifosfat. Jadi. yaitu 1. Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. 2. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). transkripsi merupakan proses sintesis RNA menggunakan salah satu untai molekul DNA sebagai cetakan (templat)nya.

Pengikatan enzim RNA polimerase beserta kofaktor-kofaktornya pada untai DNA cetakan membentuk kompleks transkripsi. RNA polimerase akan terikat pada suatu tempat di dekat promoter. Tempat ini dinamakan promoter. Gugus 3’. Fak. inisiasi.OH pada suatu nukleotida bereaksi dengan gugus 5’. begitu penambahan basa selesai dilakukan. kedua untainya harus dipisahkan satu sama lain di tempat-tempat terjadinya penambahan basa pada RNA.trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). Reaksi ini jelas sama dengan reaksi polimerisasi DNA. Jadi. Setelah mengalami pengikatan oleh promoter.4. Berakhirnya polimerisasi RNA ditandai oleh disosiasi kompleks transkripsi atau terlepasnya enzim RNA polimerase beserta kofaktor-kofaktornya dari untai DNA Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Selanjutnya. kedua untai DNA segera menyatu kembali. Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. Tempat ini sering dinyatakan sebagai posisi +1 untuk gen yang akan ditranskripsi. yang merupakan tempat pengikatan enzim RNA polimerase di sisi 5’ (upstream) dari urutan basa penyandi (gen) yang akan ditranskripsi. melainkan RNA polimerase. Hanya saja enzim yang bekerja bukannya DNA polimerase. elongasi. yaitu pengenalan promoter. dan teminasi. elongasi atau polimerisasi RNA berlangsung dari arah 5’ ke 3’. Pemisahan kedua untai DNA pertama kali terjadi di suatu tempat tertentu. Biologi Unsoed 57 . Secara garis besar transkripsi berlangsung dalam empat tahap. Agar molekul DNA dapat digunakan sebagai cetakan dalam sintesis RNA. sementara RNA polimerasenya sendiri bergerak dari arah 3’ ke 5’ di sepanjang untai DNA cetakan. Selama sintesis RNA berlangsung kompleks transkripsi akan bergeser di sepanjang molekul DNA cetakan sehingga nukleotida demi nukleotida akan ditambahkan kepada untai RNA yang sedang diperpanjang pada ujung 3’ nya. Nukleosida trifosfat pertama akan diletakkan di tapak inisiasi dan sintesis RNA pun segera dimulai. yang dinamakan tempat awal polimerisasi atau tapak inisiasi (initiation site).

Begitu pula halnya dengan molekul RNA hasil sintesis. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. urutan penyela 5‘ ATTAAAGGCTCCTTTTGGAGCCTTT TTT TT TAATTTCCGAGGAAAACCTCGGAAAAAAAA 3‘ transkripsi U U U C C U C G G A A A A U U U G G A G C C U U U U U U U U 5‘ 3‘ DNA 5’ 3’ Gambar 4.4 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Terminasi transkripsi dapat terjadi oleh dua macam sebab. Hal ini terjadi ketika RNA polimerase mencapai urutan basa tertentu yang disebut dengan terminator. Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). Di antara keduanya terminasi diri lebih umum dijumpai. Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 4. promoter dapat mengikat RNA polimerase yang lain. Fak. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida.4.cetakan. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). Biologi Unsoed 58 .

proses ekspresi gen tetap berlangsung melalui transkripsi dan translasi. maka ukurannya lebih pendek daripada DNA. Selama satu periode transkripsi setidaknya terdapat rata-rata 10 kesalahan. dapat juga dilakukan secara in vitro seperti halnya pada pembuatan perpustakaan cDNA (lihat Bab VI). Proses penyalinan RNA menjadi DNA disebut sebagai transkripsi balik (reverse transcription) dan enzim utama yang mengatalisis proses tersebut adalah enzim transkriptase balik (reverse transcriptase). Meskipun demikian. Proses transkripsi balik. Ketersediaan enzim transkriptase balik ini telah memberikan kemudahan bagi para peneliti untuk mempelajari gen yang bertanggung jawab terhadap pemunculan sifat-sifat tertentu. yang materi genetiknya berupa RNA. yang relatif lebih parah bila dibandingkan dengan kesalahan pada replikasi normal. Hal ini karena proses transkripsi normal mempunyai mekanisme koreksi yang mengurangi frekuensi kesalahan transkripsi. maka cara sederhana yang dapat dilakukan adalah mentransfer cDNA yang menyandi protein tersebut ke dalam sel resipien sebagai sel inang (lihat Bab V). Saat ini enzim transkriptase balik telah diproduksi secara komersial. yang hanya mengandung urutan basa intron. DNA hasil transkripsi balik disebut sebagai DNA komplementer (cDNA). Jika seorang peneliti ingin mengekspresikan suatu protein spesifik dari sistem eukariot di dalam sel yang tidak lazim memproduksi protein tersebut. Tujuan mengonversi mRNA menjadi cDNA adalah karena DNA sifatnya lebih stabil daripada RNA. keberadaan molekul DNA tetap diperlukan sehingga RNA sebagai materi genetik terlebih dahulu harus diubah menjadi DNA.Transkripsi balik Pada beberapa virus tertentu. Oleh karena cDNA merupakan hasil transkripsi balik RNA. khususnya mRNA. tidak lama setelah penemuan enzim restriksi. Dengan demikian. selain terjadi secara alami pada virus dengan materi genetik berupa RNA (retrovirus). Enzim transkriptase balik ditemukan oleh Howard Temin dan David Baltimore secara terpisah pada tahun 1970. yang dapat berupa molekul untai tunggal atau untai ganda. enzim transkriptase balik sebenarnya bukanlah merupakan katalisator yang efektif. Fak. Biologi Unsoed 59 . Hal ini terutama terlihat pada cDNA organisme eukariot. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.

Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A. Molekul mRNA ditranslasi dengan arah 5’→ 3’. Biologi Unsoed 60 . Tiap ribosom mempunyai dua tempat pengikatan tRNA. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel. elongasi. dan terminasi polipeptida. suatu struktur organel yang banyak terdapat di dalam sitoplasma. translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. Empat puluh hingga 60 molekul tRNA yang berbeda 4. Sebagai contoh. 1. Pada kebanyakan prokariot ribosom mempunyai ukuran 70S. yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. besar dan kecil. Fak. Translasi. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. sintesis Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. tetapi tidak dari ujung 5’ hingga ujung 3’. sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. 2. sedangkan pada eukariot biasanya sekitar 80S. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi. berlangsung di dalam ribosom. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2.Translasi Bila dibandingkan dengan transkripsi. maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. atau pada hakekatnya sintesis protein. Ribosom terdiri atas dua subunit. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil.

arah gerakan ribosom P A ribosom CUG GGG 3’ mRNA 5’ AUC UAG ACC UGG GAC tRNA aa NH2 aa aa aa COOH aminoasil-tRNA aa NH2 ikatan peptida COOH Gambar 4. Selanjutnya. Biologi Unsoed 61 . Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya. akan diberikan di bawah ini.protein yang mempunyai urutan NH2-Met-Pro. -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin. Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA.. Sementara itu. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus.5. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. khususnya pada prokariot. Fak. Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 4. Hal ini berarti Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet).5. . Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh. .

yang melibatkan (1) perpindahan f-metala. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. Selain itu. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. Triplet kodon berikutnya. Selanjutnya. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasiltRNAfMet berikutnya yang akan masuk ke tapak A. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin.tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. dan subunit kecil ribosom (30S) dengan bantuan protein IF-1. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. ke tapak A memerlukan protein-protein elongasi EF-Ts dan EF-Tu. kompleks inisiasi bergabung dengan subunit besar ribosom (50S).tRNAala. misalnya alanil. Biologi Unsoed 62 . misalnya penyandi serin. dan metionil-tRNAfMet terikat pada tapak P. Langkah berikutnya adalah translokasi. Kompleks inisiasi pada prokariot terbentuk antara mRNA. dan IF-3). dan IF-3. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. metionil-tRNAfMet. Fak. IF-2. Pengikatan aminoasil-tRNAfMet berikutnya. suatu enzim yang terikat pada subunit ribosom 50S.bahwa sintesis semua polipeptida selalu dimulai dengan metionin. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. IF-2. Khusus pada prokariot akan terjadi formilasi gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa fmetionin. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet). serta sebuah molekul GTP. baik pada prokariot maupun eukariot.

akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. Transkripsi terjadi di dalam nukleus. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. yaitu RF-1 dan RF-2. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom. tRNA di tapak P. kedua subunit ribosom pun memisah. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. seperti yang akan dijelaskan nanti. Biologi Unsoed 63 . juga menjadi sangat efisien. Selain itu. Salah satu di antaranya seperti telah kita Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. tidak demikian halnya pada eukariot. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. Fak. dan rantai polipeptida dari ribosom. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A. ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn onturn off) ekspresi gen. Terminasi ditandai oleh terlepasnya mRNA. sedangkan translasi terjadi di sitoplasma (ribosom). Dengan berlangsungnya kedua proses tersebut secara bersamaan. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. Namun. Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma. Sebagai contoh.

RNA polimerase. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. Namun. atau translasi. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. Gen-gen yang menyandi pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. Biologi Unsoed 64 . yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. atau bahkan tumpang tindih.bicarakan di atas. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. Monod pada tahun 1961. khususnya pada prokariot. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. Pengaturan Eskpresi Gen Produk-produk gen tertentu seperti protein ribosomal. rRNA. menyebabkan terhalangnya transkripsi gen-gen struktural. Fak. Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model operon yang diajukan oleh F. paling banyak terjadi pada tahap transkripsi. prosesing mRNA. tRNA. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. Pengaturan ekspresi gen pada prokariot Pengaturan ekspresi gen pada sistem prokariot telah banyak diungkapkan berdasarkan hasil penelitian mengenai induksi dan represi menggunakan Escherichia coli dan Salmonella typhimurium. Sementara itu. Pada kondisi tertentu represor akan berikatan dengan operator. Jacob dan J. misalnya transkripsi.

Di luar operon terdapat gen regulator (R) beserta promoternya (PR). dan gen-gen struktural (GS). operon PR R PO O GS1 GS2 GS3 represor efektor (induser atau korepresor) a) RNA polimerase induser RNA polimerase berjalan transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 4. dan molekul efektor.6. Molekul efektor pada induksi adalah induser. sedangkan pada represi adalah korepresor. operator (O). Biologi Unsoed 65 . Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. molekul protein represor yang dihasilkan oleh gen regulator.dengan operator. Fak.

gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. Namun. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi. transkripsi gen-gen struktural tidak dapat berlangsung. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon. Akibatnya. dengan terikatnya represor oleh induser. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator. Akan tetapi. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. Fak. dan juga prosesing mRNA. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang. dengan adanya korepresor. Jadi. Biologi Unsoed 66 . kalau pun ada. memegang peran yang sangat penting dalam proses diferensiasi sel. Salah satu contohnya adalah operon lac.6 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. Namun. Operon. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot.Pada Gambar 4. Dengan pengikatan ini. promoter operon menjadi terbuka bagi RNA polimerase sehingga gen-gen struktural dapat ditranskripsi dan selanjutnya ditranslasi. nampaknya tidak begitu penting pada eukariot. Sebaliknya. Operon trp. Dengan demikian. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas.

Demikian pula. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. yaitu hanya membawa urutan sebuah gen struktural. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. mRNA di dalam sel-sel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. Sebagai contoh. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. Jadi. hormon. Fak. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. Dengan perkataan lain. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu.mirip operon. Biologi Unsoed 67 .

Suatu untai molekul DNA mempunyai sekuens 5‘. a. 2. Fak. Komponen manakah yang menentukan spesifisitas suatu molekul asam nukleat? b. Apakah manfaat senyawa interkalator etidium bromid? Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Apakah yang dimaksud dengan titik leleh (melting temperature) molekul DNA? d. Jika suatu molekul RNA mengandung basa adenin sebanyak 20%. Mengapa pengukuran konsentrasi larutan DNA dilakukan pada λ260 nm? b. bagaimanakah pemisahan molekul DNA. Apakah artinya jika hasil pengukuran kemurnian larutan DNA memberikan nilai nisbah A260 /A280 kurang dari 1. a. Fenomena apakah yang menyebabkan stabilitas molekul DNA? b. Biologi Unsoed 68 .AGTTGCAGCCTACGT-3‘. Setelah dilakukan sentrifugasi dengan kecepatan tinggi di dalam larutan CsCl 8M. Apakah yang terjadi jika asam nukleat berada di dalam suasana asam mineral encer? c. Apakah yang dimaksud dengan pernyataan bahwa molekul DNA mempunyai nisbah aksial yang tinggi? d. Bagaimanakah sekuens untai pasangannya? 4. a. RNA. Sebutkan macam-macam ikatan yang terdapat pada molekul DNA. Apakah perbedaan antara nukleotida dan nukleosida? c.8? c. dan protein? 5. 3.SOAL EVALUASI 1. dapatkah Saudara menghitung persentase ketiga basa lainnya? Jelaskan jawaban Saudara.

Untuk memvisualisasi molekul DNA menggunakan paparan sinar UV. a. 5. c. Interaksi penempatan (stacking interactions) antara pasangan-pasangan basa. nukleotida = nukleosida monofosfat. Tidak bisa karena molekul RNA merupakan polinukleotida untai tunggal. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.ACGTAGGCTGCAACT . 3. a. d. c.KUNCI JAWABAN 1. G. Jadi. yang merupakan fungsi kandungan GC. Nukleotida = fosfat + gula + basa. Fak. Suhu ketika molekul DNA mulai mengalami denaturasi. b.3‘. Jadi. RNA di bawah. Biologi Unsoed 69 . Basa nitrogen (basa nukleotida). Absorpsi maksimum sinar UV oleh DNA terjadi pada panjang gelombang 260 nm. 2. Permukaan basa yang bersifat hidrofobik menyebabkan molekul-molekul air dikeluarkan dari sela-sela perpasangan basa sehingga perpasangan tersebut menjadi kuat. c. nukleosida = gula + basa. ikatan hidrogen. DNA di tengah. protein di atas. Ikatan glikosidik (glikosilik). 5‘. Larutan DNA terkontaminasi oleh protein. b. d. b. ikatan fosfodiester. 4. Perbandingan antara panjang dan diameternya sangat tinggi sehingga molekul DNA sangat tipis memanjang. a. persentase A tidak sama dengan persentase T sehingga kandungan basa T. dan C tidak dapat dihitung bedasarkan kandungan basa A. Ikatan glikosilik antara gula dan basa terputus.

Sign up to vote on this title
UsefulNot useful