BAB IV.

DOGMA SENTRAL BIOLOGI MOLEKULER Di dalam bab ini akan dibahas sekilas dogma sentral biologi molekuler sebagai mekanisme pelaksanaan dua dari tiga fungsi DNA sebagai materi genetik, yaitu fungsi genotipik dan fungsi fenotipik. Dengan mempelajari pokok bahasan ini akan diperoleh gambaran sekilas mengenai proses replikasi dan ekspresi gen beserta pengaturannya, terutama pada kelompok organisme prokariot. Setelah mempelajari pokok bahasan di dalam bab ini mahasiswa diharapkan mampu menjelaskan 1. tiga fungsi DNA sebagai materi genetik dan dogma sentral biologi molekuler, 2. prinsip dasar replikasi DNA, 3. prinsip dasar transkripsi dan transkripsi balik, 4. prinsip dasar translasi, dan 5. prinsip dasar pengaturan ekspresi gen. Pengetahuan awal yang diperlukan oleh mahasiswa agar dapat mempelajari pokok bahasan ini dengan lebih baik adalah struktur asam nukleat, khususnya DNA, yang telah dijelaskan pada Bab III. Selain itu, konsep dasar tentang replikasi DNA, transkripsi, pranslasi, dan pengaturan ekspresi gen yang telah diperoleh pada mata kuliah Genetika juga sangat mendukung pemahaman materi bahasan di dalam bab ini. Fungsi DNA sebagai Materi Genetik DNA sebagai materi genetik pada sebagian besar organisme harus dapat menjalankan tiga macam fungsi pokok berikut ini. 1. DNA harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya, dari generasi ke generasi. Fungsi ini merupakan fungsi genotipik, yang dilaksanakan melalui replikasi. 2. DNA harus mengatur perkembangan fenotipe organisme. Artinya, materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. Fungsi ini merupakan fungsi fenotipik, yang

Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler, Fak. Biologi Unsoed

52

Enzim ini hanya dapat bekerja apabila tedapat ujung 3’-OH bebas sehingga diperlukan adanya molekul primer. Mekanisme pelaksanaan kedua fungsi ini sering disebut sebagai dogma sentral genetika molekuler atau dogma sentral biologi molekuler. Ada tiga cara teoretis replikasi DNA yang pernah diusulkan. Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. Skema dogma sentral biologi molekuler Replikasi DNA Replikasi dapat dikatakan juga sebagai sintesis molekul DNA menggunakan molekul DNA sebagai cetakan (template). dan deoksitimidin trifosfat (dTTP). yaitu konservatif. deoksisitidin trifosfat (dCTP). Biologi Unsoed 53 . Fungsi ini merupakan fungsi evolusioner. Fak. DNA sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah.1. semikonservatif. transkripsi DNA RNA transkripsi balik translasi protein replikasi Gambar 4. 3. yang dilaksanakan melalui peristiwa mutasi. evolusi tidak akan pernah berlangsung. dan dispersif. Oleh karena itu. Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru.dilaksanakan melalui ekspresi gen dengan dua tahapan. deoksiguanosin trifosfat (dGTP). Tanpa perubahan semacam ini. sebelum enzim DNA polimerase bekerja terlebih dahulu diperlukan enzim primase untuk membetuk molekul primer. yaitu transkripsi dan translasi. komponen penyusun polimerisasi DNA berupa molekul deoksinukleosida trifosfat (dNTP). Sementara itu. yang terdiri atas deoksiadenosin trifosfat (dATP). Enzim utama yang berperan dalam proses replikasi adalah DNA polimerase. masing- Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Di dalam bab ini hanya akan dijelaskan secara singkat fungsi genotipik dan fungsi fenotipik DNA. Namun.

Fak. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru (Gambar 4.W.masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. Sementara itu. pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat.2. Di antara ketiga cara replikasi DNA yang diusulkan tersebut. konservatif semikonservatif dispersif Gambar 4. Tiga cara teoretis replikasi DNA = untai lama = untai baru Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Meselson dan F. Biologi Unsoed 54 . Percobaan pembuktian tersebut dilaporkan hasilnya pada tahun 1958 oleh M.S. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation.2). Stahl. Kemudian. Prinsip kerja metode ini dapat dilihat pada Bab III.

yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi. Biasanya. Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan hingga tercapai suatu ujung (terminus). Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. ori dapat ditemukan di beberapa tempat. baik pada prokariot maupun eukariot. Pada eukariot.Replikon. Terjadinya sintesis DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. selain terjadi replikasi dua arah. ori. Sementara itu. sesuai dengan nama penemunya. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). garpu replikasi. Biologi Unsoed 55 . yang masing-masing mempunyai arah 5’→ 3’. Namun. inisiasi replikasi DNA. Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori). terjadi dua arah (bidireksional). fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. Fak. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. dan termini Setiap molekul DNA yang melakukan replikasi sebagai suatu satuan tunggal dinamakan replikon. Fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase.

yang mempunyai urutan basa sama dengan urutan basa RNA. bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. guanosin trifosfat (GTP). 2. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Diagram replikasi pada kedua untai DNA Transkripsi Transkripsi merupakan tahap awal ekspresi gen berupa perubahan urutan basa molekul DNA menjadi urutan basa molekul RNA. Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. disebut sebagai pita sens. 3.3. dan uridin trifosfat (UTP). Bedanya dengan sumber basa untuk sintesis DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi digantikan oleh urasil. Jadi. Adanya sumber basa nitrogen berupa nukleosida trifosfat.3’ 5’ 3’ fragmen-fragmen Okazaki untai tertinggal 5’ 5’ 3’ untai pengarah Gambar 4. sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. Sementara itu. untai DNA pasangannya. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). Transkripsi mempunyai ciri-ciri kimiawi yang serupa dengan sintesis/replikasi DNA. Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. Meskipun demikian. Biologi Unsoed 56 . Adanya untai molekul DNA sebagai cetakan. yaitu 1. transkripsi merupakan proses sintesis RNA menggunakan salah satu untai molekul DNA sebagai cetakan (templat)nya. dan disebut sebagai pita antisens. Fak. Dengan perkataan lain. Jadi. sitidin trifosfat (CTP).

yang dinamakan tempat awal polimerisasi atau tapak inisiasi (initiation site). kedua untainya harus dipisahkan satu sama lain di tempat-tempat terjadinya penambahan basa pada RNA. Tempat ini sering dinyatakan sebagai posisi +1 untuk gen yang akan ditranskripsi. elongasi atau polimerisasi RNA berlangsung dari arah 5’ ke 3’. Agar molekul DNA dapat digunakan sebagai cetakan dalam sintesis RNA. Hanya saja enzim yang bekerja bukannya DNA polimerase.OH pada suatu nukleotida bereaksi dengan gugus 5’. Reaksi ini jelas sama dengan reaksi polimerisasi DNA. sementara RNA polimerasenya sendiri bergerak dari arah 3’ ke 5’ di sepanjang untai DNA cetakan. Gugus 3’. yaitu pengenalan promoter. Selama sintesis RNA berlangsung kompleks transkripsi akan bergeser di sepanjang molekul DNA cetakan sehingga nukleotida demi nukleotida akan ditambahkan kepada untai RNA yang sedang diperpanjang pada ujung 3’ nya. Setelah mengalami pengikatan oleh promoter. Biologi Unsoed 57 . Selanjutnya. dan teminasi. begitu penambahan basa selesai dilakukan. elongasi. Jadi. Fak.4. Pemisahan kedua untai DNA pertama kali terjadi di suatu tempat tertentu. Berakhirnya polimerisasi RNA ditandai oleh disosiasi kompleks transkripsi atau terlepasnya enzim RNA polimerase beserta kofaktor-kofaktornya dari untai DNA Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Tempat ini dinamakan promoter. yang merupakan tempat pengikatan enzim RNA polimerase di sisi 5’ (upstream) dari urutan basa penyandi (gen) yang akan ditranskripsi. Pengikatan enzim RNA polimerase beserta kofaktor-kofaktornya pada untai DNA cetakan membentuk kompleks transkripsi. RNA polimerase akan terikat pada suatu tempat di dekat promoter. Secara garis besar transkripsi berlangsung dalam empat tahap. melainkan RNA polimerase. Nukleosida trifosfat pertama akan diletakkan di tapak inisiasi dan sintesis RNA pun segera dimulai.trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. inisiasi. kedua untai DNA segera menyatu kembali.

Terminasi transkripsi dapat terjadi oleh dua macam sebab. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida. maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 4. Di antara keduanya terminasi diri lebih umum dijumpai. yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). Biologi Unsoed 58 . Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). promoter dapat mengikat RNA polimerase yang lain. Fak.4 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.4. urutan penyela 5‘ ATTAAAGGCTCCTTTTGGAGCCTTT TTT TT TAATTTCCGAGGAAAACCTCGGAAAAAAAA 3‘ transkripsi U U U C C U C G G A A A A U U U G G A G C C U U U U U U U U 5‘ 3‘ DNA 5’ 3’ Gambar 4.cetakan. Begitu pula halnya dengan molekul RNA hasil sintesis. Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. Hal ini terjadi ketika RNA polimerase mencapai urutan basa tertentu yang disebut dengan terminator.

keberadaan molekul DNA tetap diperlukan sehingga RNA sebagai materi genetik terlebih dahulu harus diubah menjadi DNA. Proses penyalinan RNA menjadi DNA disebut sebagai transkripsi balik (reverse transcription) dan enzim utama yang mengatalisis proses tersebut adalah enzim transkriptase balik (reverse transcriptase). Hal ini terutama terlihat pada cDNA organisme eukariot. Saat ini enzim transkriptase balik telah diproduksi secara komersial. yang relatif lebih parah bila dibandingkan dengan kesalahan pada replikasi normal. selain terjadi secara alami pada virus dengan materi genetik berupa RNA (retrovirus). yang materi genetiknya berupa RNA. Hal ini karena proses transkripsi normal mempunyai mekanisme koreksi yang mengurangi frekuensi kesalahan transkripsi. khususnya mRNA. Selama satu periode transkripsi setidaknya terdapat rata-rata 10 kesalahan. yang dapat berupa molekul untai tunggal atau untai ganda. tidak lama setelah penemuan enzim restriksi.Transkripsi balik Pada beberapa virus tertentu. Jika seorang peneliti ingin mengekspresikan suatu protein spesifik dari sistem eukariot di dalam sel yang tidak lazim memproduksi protein tersebut. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. dapat juga dilakukan secara in vitro seperti halnya pada pembuatan perpustakaan cDNA (lihat Bab VI). Tujuan mengonversi mRNA menjadi cDNA adalah karena DNA sifatnya lebih stabil daripada RNA. Meskipun demikian. enzim transkriptase balik sebenarnya bukanlah merupakan katalisator yang efektif. Oleh karena cDNA merupakan hasil transkripsi balik RNA. DNA hasil transkripsi balik disebut sebagai DNA komplementer (cDNA). Biologi Unsoed 59 . Enzim transkriptase balik ditemukan oleh Howard Temin dan David Baltimore secara terpisah pada tahun 1970. Proses transkripsi balik. Fak. Dengan demikian. proses ekspresi gen tetap berlangsung melalui transkripsi dan translasi. yang hanya mengandung urutan basa intron. Ketersediaan enzim transkriptase balik ini telah memberikan kemudahan bagi para peneliti untuk mempelajari gen yang bertanggung jawab terhadap pemunculan sifat-sifat tertentu. maka ukurannya lebih pendek daripada DNA. maka cara sederhana yang dapat dilakukan adalah mentransfer cDNA yang menyandi protein tersebut ke dalam sel resipien sebagai sel inang (lihat Bab V).

Translasi. Sebagai contoh. tetapi tidak dari ujung 5’ hingga ujung 3’. Empat puluh hingga 60 molekul tRNA yang berbeda 4. 1. sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. sintesis Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. Ribosom terdiri atas dua subunit. Tiap ribosom mempunyai dua tempat pengikatan tRNA. yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A. suatu struktur organel yang banyak terdapat di dalam sitoplasma. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil. Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. Molekul mRNA ditranslasi dengan arah 5’→ 3’.Translasi Bila dibandingkan dengan transkripsi. translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. Pada kebanyakan prokariot ribosom mempunyai ukuran 70S. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). berlangsung di dalam ribosom. sedangkan pada eukariot biasanya sekitar 80S. dan terminasi polipeptida. 2. elongasi. atau pada hakekatnya sintesis protein. maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel. Fak. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. besar dan kecil. Biologi Unsoed 60 . Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi.

Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh. Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA. . Hal ini berarti Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet). khususnya pada prokariot. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin. Fak. berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus. . akan diberikan di bawah ini. Selanjutnya. Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. arah gerakan ribosom P A ribosom CUG GGG 3’ mRNA 5’ AUC UAG ACC UGG GAC tRNA aa NH2 aa aa aa COOH aminoasil-tRNA aa NH2 ikatan peptida COOH Gambar 4. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 4.protein yang mempunyai urutan NH2-Met-Pro.5. Biologi Unsoed 61 .5. Sementara itu..

Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. ke tapak A memerlukan protein-protein elongasi EF-Ts dan EF-Tu.tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P.bahwa sintesis semua polipeptida selalu dimulai dengan metionin. yang melibatkan (1) perpindahan f-metala. dan IF-3. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet). kompleks inisiasi bergabung dengan subunit besar ribosom (50S). dan IF-3). Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasiltRNAfMet berikutnya yang akan masuk ke tapak A. Fak. Selain itu. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Pengikatan aminoasil-tRNAfMet berikutnya. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. metionil-tRNAfMet. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. Langkah berikutnya adalah translokasi. misalnya alanil. Khusus pada prokariot akan terjadi formilasi gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa fmetionin.tRNAala. IF-2. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. misalnya penyandi serin. Triplet kodon berikutnya. Selanjutnya. Biologi Unsoed 62 . IF-2. dan metionil-tRNAfMet terikat pada tapak P. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. suatu enzim yang terikat pada subunit ribosom 50S. baik pada prokariot maupun eukariot. serta sebuah molekul GTP. Kompleks inisiasi pada prokariot terbentuk antara mRNA. dan subunit kecil ribosom (30S) dengan bantuan protein IF-1.

dan rantai polipeptida dari ribosom. ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn onturn off) ekspresi gen. Salah satu di antaranya seperti telah kita Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Namun. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom.akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. Selain itu. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A. Biologi Unsoed 63 . Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. tidak demikian halnya pada eukariot. Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. juga menjadi sangat efisien. Transkripsi terjadi di dalam nukleus. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. Sebagai contoh. tRNA di tapak P. kedua subunit ribosom pun memisah. Dengan berlangsungnya kedua proses tersebut secara bersamaan. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. yaitu RF-1 dan RF-2. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). seperti yang akan dijelaskan nanti. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma. Fak. sedangkan translasi terjadi di sitoplasma (ribosom). Terminasi ditandai oleh terlepasnya mRNA.

Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. Gen-gen yang menyandi pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. rRNA. prosesing mRNA. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. Pengaturan Eskpresi Gen Produk-produk gen tertentu seperti protein ribosomal. Monod pada tahun 1961. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. paling banyak terjadi pada tahap transkripsi. Pada kondisi tertentu represor akan berikatan dengan operator. Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. Fak.bicarakan di atas. khususnya pada prokariot. menyebabkan terhalangnya transkripsi gen-gen struktural. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. atau bahkan tumpang tindih. Pengaturan ekspresi gen pada prokariot Pengaturan ekspresi gen pada sistem prokariot telah banyak diungkapkan berdasarkan hasil penelitian mengenai induksi dan represi menggunakan Escherichia coli dan Salmonella typhimurium. Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model operon yang diajukan oleh F. misalnya transkripsi. Biologi Unsoed 64 . RNA polimerase. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. Jacob dan J. atau translasi. Namun. Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. tRNA. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. Sementara itu.

6. Fak. dan gen-gen struktural (GS). molekul protein represor yang dihasilkan oleh gen regulator. dan molekul efektor. sedangkan pada represi adalah korepresor. operon PR R PO O GS1 GS2 GS3 represor efektor (induser atau korepresor) a) RNA polimerase induser RNA polimerase berjalan transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 4. Biologi Unsoed 65 . Molekul efektor pada induksi adalah induser. Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.dengan operator. operator (O). Di luar operon terdapat gen regulator (R) beserta promoternya (PR).

Akibatnya. Dengan demikian. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang. transkripsi gen-gen struktural tidak dapat berlangsung. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi. Jadi. Namun. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. Biologi Unsoed 66 . dan juga prosesing mRNA. Operon trp. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas.Pada Gambar 4. Dengan pengikatan ini. Operon. nampaknya tidak begitu penting pada eukariot. Namun. dengan terikatnya represor oleh induser. Fak. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Akan tetapi. gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. Salah satu contohnya adalah operon lac. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi. dengan adanya korepresor.6 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon. kalau pun ada. Sebaliknya. promoter operon menjadi terbuka bagi RNA polimerase sehingga gen-gen struktural dapat ditranskripsi dan selanjutnya ditranslasi. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor. memegang peran yang sangat penting dalam proses diferensiasi sel. Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi.

dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. Jadi. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. yaitu hanya membawa urutan sebuah gen struktural. Dengan perkataan lain. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. Biologi Unsoed 67 . molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula.mirip operon. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. hormon. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. Fak. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. Demikian pula. Sebagai contoh. mRNA di dalam sel-sel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik.

Mengapa pengukuran konsentrasi larutan DNA dilakukan pada λ260 nm? b. Bagaimanakah sekuens untai pasangannya? 4. Setelah dilakukan sentrifugasi dengan kecepatan tinggi di dalam larutan CsCl 8M. Jika suatu molekul RNA mengandung basa adenin sebanyak 20%.8? c. Apakah manfaat senyawa interkalator etidium bromid? Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Apakah perbedaan antara nukleotida dan nukleosida? c. a. Fak. RNA.SOAL EVALUASI 1. 2. Apakah artinya jika hasil pengukuran kemurnian larutan DNA memberikan nilai nisbah A260 /A280 kurang dari 1. Suatu untai molekul DNA mempunyai sekuens 5‘. Apakah yang dimaksud dengan pernyataan bahwa molekul DNA mempunyai nisbah aksial yang tinggi? d. Apakah yang dimaksud dengan titik leleh (melting temperature) molekul DNA? d. Apakah yang terjadi jika asam nukleat berada di dalam suasana asam mineral encer? c. Fenomena apakah yang menyebabkan stabilitas molekul DNA? b. dapatkah Saudara menghitung persentase ketiga basa lainnya? Jelaskan jawaban Saudara. bagaimanakah pemisahan molekul DNA. 3. Biologi Unsoed 68 . Sebutkan macam-macam ikatan yang terdapat pada molekul DNA. a. dan protein? 5.AGTTGCAGCCTACGT-3‘. a. Komponen manakah yang menentukan spesifisitas suatu molekul asam nukleat? b.

Basa nitrogen (basa nukleotida). c. DNA di tengah. 5‘. b. b. Jadi. Untuk memvisualisasi molekul DNA menggunakan paparan sinar UV. a. nukleosida = gula + basa. b. c. Perbandingan antara panjang dan diameternya sangat tinggi sehingga molekul DNA sangat tipis memanjang. a. 2. RNA di bawah. Ikatan glikosilik antara gula dan basa terputus.ACGTAGGCTGCAACT . Ikatan glikosidik (glikosilik). Tidak bisa karena molekul RNA merupakan polinukleotida untai tunggal. 3. ikatan hidrogen. a. Interaksi penempatan (stacking interactions) antara pasangan-pasangan basa. protein di atas. Permukaan basa yang bersifat hidrofobik menyebabkan molekul-molekul air dikeluarkan dari sela-sela perpasangan basa sehingga perpasangan tersebut menjadi kuat. c. persentase A tidak sama dengan persentase T sehingga kandungan basa T. Nukleotida = fosfat + gula + basa. Fak. G. d. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. d. ikatan fosfodiester. Biologi Unsoed 69 . dan C tidak dapat dihitung bedasarkan kandungan basa A.KUNCI JAWABAN 1. nukleotida = nukleosida monofosfat. yang merupakan fungsi kandungan GC. Absorpsi maksimum sinar UV oleh DNA terjadi pada panjang gelombang 260 nm. Jadi. 5.3‘. 4. Larutan DNA terkontaminasi oleh protein. Suhu ketika molekul DNA mulai mengalami denaturasi.