BAB IV.

DOGMA SENTRAL BIOLOGI MOLEKULER Di dalam bab ini akan dibahas sekilas dogma sentral biologi molekuler sebagai mekanisme pelaksanaan dua dari tiga fungsi DNA sebagai materi genetik, yaitu fungsi genotipik dan fungsi fenotipik. Dengan mempelajari pokok bahasan ini akan diperoleh gambaran sekilas mengenai proses replikasi dan ekspresi gen beserta pengaturannya, terutama pada kelompok organisme prokariot. Setelah mempelajari pokok bahasan di dalam bab ini mahasiswa diharapkan mampu menjelaskan 1. tiga fungsi DNA sebagai materi genetik dan dogma sentral biologi molekuler, 2. prinsip dasar replikasi DNA, 3. prinsip dasar transkripsi dan transkripsi balik, 4. prinsip dasar translasi, dan 5. prinsip dasar pengaturan ekspresi gen. Pengetahuan awal yang diperlukan oleh mahasiswa agar dapat mempelajari pokok bahasan ini dengan lebih baik adalah struktur asam nukleat, khususnya DNA, yang telah dijelaskan pada Bab III. Selain itu, konsep dasar tentang replikasi DNA, transkripsi, pranslasi, dan pengaturan ekspresi gen yang telah diperoleh pada mata kuliah Genetika juga sangat mendukung pemahaman materi bahasan di dalam bab ini. Fungsi DNA sebagai Materi Genetik DNA sebagai materi genetik pada sebagian besar organisme harus dapat menjalankan tiga macam fungsi pokok berikut ini. 1. DNA harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya, dari generasi ke generasi. Fungsi ini merupakan fungsi genotipik, yang dilaksanakan melalui replikasi. 2. DNA harus mengatur perkembangan fenotipe organisme. Artinya, materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. Fungsi ini merupakan fungsi fenotipik, yang

Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler, Fak. Biologi Unsoed

52

3. Di dalam bab ini hanya akan dijelaskan secara singkat fungsi genotipik dan fungsi fenotipik DNA. Skema dogma sentral biologi molekuler Replikasi DNA Replikasi dapat dikatakan juga sebagai sintesis molekul DNA menggunakan molekul DNA sebagai cetakan (template). Tanpa perubahan semacam ini. Biologi Unsoed 53 . dan dispersif. DNA sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah. sebelum enzim DNA polimerase bekerja terlebih dahulu diperlukan enzim primase untuk membetuk molekul primer. Ada tiga cara teoretis replikasi DNA yang pernah diusulkan. Mekanisme pelaksanaan kedua fungsi ini sering disebut sebagai dogma sentral genetika molekuler atau dogma sentral biologi molekuler. deoksisitidin trifosfat (dCTP). dan deoksitimidin trifosfat (dTTP). komponen penyusun polimerisasi DNA berupa molekul deoksinukleosida trifosfat (dNTP). yang terdiri atas deoksiadenosin trifosfat (dATP). Oleh karena itu. transkripsi DNA RNA transkripsi balik translasi protein replikasi Gambar 4. yaitu transkripsi dan translasi. Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. yang dilaksanakan melalui peristiwa mutasi. yaitu konservatif. semikonservatif. Enzim utama yang berperan dalam proses replikasi adalah DNA polimerase.dilaksanakan melalui ekspresi gen dengan dua tahapan. deoksiguanosin trifosfat (dGTP). Enzim ini hanya dapat bekerja apabila tedapat ujung 3’-OH bebas sehingga diperlukan adanya molekul primer. masing- Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.1. evolusi tidak akan pernah berlangsung. Sementara itu. Namun. Fak. Fungsi ini merupakan fungsi evolusioner. Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru.

Fak.masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. Prinsip kerja metode ini dapat dilihat pada Bab III. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru (Gambar 4. Tiga cara teoretis replikasi DNA = untai lama = untai baru Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.W. Sementara itu. Meselson dan F. pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat.2). Percobaan pembuktian tersebut dilaporkan hasilnya pada tahun 1958 oleh M.2. Kemudian. konservatif semikonservatif dispersif Gambar 4.S. Stahl. Biologi Unsoed 54 . Di antara ketiga cara replikasi DNA yang diusulkan tersebut.

dan termini Setiap molekul DNA yang melakukan replikasi sebagai suatu satuan tunggal dinamakan replikon. garpu replikasi. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. Fak. yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi. Terjadinya sintesis DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. Biasanya. yang masing-masing mempunyai arah 5’→ 3’. Biologi Unsoed 55 . Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. inisiasi replikasi DNA. Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori). Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. Fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. Sementara itu. sesuai dengan nama penemunya. fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. ori dapat ditemukan di beberapa tempat. sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. baik pada prokariot maupun eukariot. selain terjadi replikasi dua arah. Pada eukariot. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). terjadi dua arah (bidireksional).Replikon. ori. Namun. Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan hingga tercapai suatu ujung (terminus).

3. bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. dan uridin trifosfat (UTP).3’ 5’ 3’ fragmen-fragmen Okazaki untai tertinggal 5’ 5’ 3’ untai pengarah Gambar 4. transkripsi merupakan proses sintesis RNA menggunakan salah satu untai molekul DNA sebagai cetakan (templat)nya. Diagram replikasi pada kedua untai DNA Transkripsi Transkripsi merupakan tahap awal ekspresi gen berupa perubahan urutan basa molekul DNA menjadi urutan basa molekul RNA. Adanya untai molekul DNA sebagai cetakan. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. yaitu 1. Bedanya dengan sumber basa untuk sintesis DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi digantikan oleh urasil. Meskipun demikian. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). Transkripsi mempunyai ciri-ciri kimiawi yang serupa dengan sintesis/replikasi DNA. 2. yang mempunyai urutan basa sama dengan urutan basa RNA. dan disebut sebagai pita antisens. Jadi. sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. Biologi Unsoed 56 . disebut sebagai pita sens. Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA.3. Dengan perkataan lain. Sementara itu. sitidin trifosfat (CTP). Fak. Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. untai DNA pasangannya. guanosin trifosfat (GTP). Jadi. Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. Adanya sumber basa nitrogen berupa nukleosida trifosfat.

yang merupakan tempat pengikatan enzim RNA polimerase di sisi 5’ (upstream) dari urutan basa penyandi (gen) yang akan ditranskripsi. Pemisahan kedua untai DNA pertama kali terjadi di suatu tempat tertentu. Tempat ini dinamakan promoter. Agar molekul DNA dapat digunakan sebagai cetakan dalam sintesis RNA. Nukleosida trifosfat pertama akan diletakkan di tapak inisiasi dan sintesis RNA pun segera dimulai.trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi).OH pada suatu nukleotida bereaksi dengan gugus 5’. Selama sintesis RNA berlangsung kompleks transkripsi akan bergeser di sepanjang molekul DNA cetakan sehingga nukleotida demi nukleotida akan ditambahkan kepada untai RNA yang sedang diperpanjang pada ujung 3’ nya.4. kedua untai DNA segera menyatu kembali. Setelah mengalami pengikatan oleh promoter. Jadi. Secara garis besar transkripsi berlangsung dalam empat tahap. Selanjutnya. elongasi. Biologi Unsoed 57 . sementara RNA polimerasenya sendiri bergerak dari arah 3’ ke 5’ di sepanjang untai DNA cetakan. Berakhirnya polimerisasi RNA ditandai oleh disosiasi kompleks transkripsi atau terlepasnya enzim RNA polimerase beserta kofaktor-kofaktornya dari untai DNA Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Gugus 3’. yaitu pengenalan promoter. Reaksi ini jelas sama dengan reaksi polimerisasi DNA. yang dinamakan tempat awal polimerisasi atau tapak inisiasi (initiation site). Tempat ini sering dinyatakan sebagai posisi +1 untuk gen yang akan ditranskripsi. Pengikatan enzim RNA polimerase beserta kofaktor-kofaktornya pada untai DNA cetakan membentuk kompleks transkripsi. inisiasi. elongasi atau polimerisasi RNA berlangsung dari arah 5’ ke 3’. Hanya saja enzim yang bekerja bukannya DNA polimerase. Fak. Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. melainkan RNA polimerase. kedua untainya harus dipisahkan satu sama lain di tempat-tempat terjadinya penambahan basa pada RNA. dan teminasi. begitu penambahan basa selesai dilakukan. RNA polimerase akan terikat pada suatu tempat di dekat promoter.

Biologi Unsoed 58 . Fak. Hal ini terjadi ketika RNA polimerase mencapai urutan basa tertentu yang disebut dengan terminator.4. promoter dapat mengikat RNA polimerase yang lain. Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. Di antara keduanya terminasi diri lebih umum dijumpai. Terminasi transkripsi dapat terjadi oleh dua macam sebab. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 4. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. urutan penyela 5‘ ATTAAAGGCTCCTTTTGGAGCCTTT TTT TT TAATTTCCGAGGAAAACCTCGGAAAAAAAA 3‘ transkripsi U U U C C U C G G A A A A U U U G G A G C C U U U U U U U U 5‘ 3‘ DNA 5’ 3’ Gambar 4. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho).cetakan. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida. Begitu pula halnya dengan molekul RNA hasil sintesis.4 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.

Enzim transkriptase balik ditemukan oleh Howard Temin dan David Baltimore secara terpisah pada tahun 1970. dapat juga dilakukan secara in vitro seperti halnya pada pembuatan perpustakaan cDNA (lihat Bab VI). Jika seorang peneliti ingin mengekspresikan suatu protein spesifik dari sistem eukariot di dalam sel yang tidak lazim memproduksi protein tersebut.Transkripsi balik Pada beberapa virus tertentu. Selama satu periode transkripsi setidaknya terdapat rata-rata 10 kesalahan. yang relatif lebih parah bila dibandingkan dengan kesalahan pada replikasi normal. selain terjadi secara alami pada virus dengan materi genetik berupa RNA (retrovirus). yang materi genetiknya berupa RNA. Saat ini enzim transkriptase balik telah diproduksi secara komersial. yang dapat berupa molekul untai tunggal atau untai ganda. keberadaan molekul DNA tetap diperlukan sehingga RNA sebagai materi genetik terlebih dahulu harus diubah menjadi DNA. Proses transkripsi balik. Meskipun demikian. maka ukurannya lebih pendek daripada DNA. enzim transkriptase balik sebenarnya bukanlah merupakan katalisator yang efektif. proses ekspresi gen tetap berlangsung melalui transkripsi dan translasi. khususnya mRNA. Biologi Unsoed 59 . Hal ini karena proses transkripsi normal mempunyai mekanisme koreksi yang mengurangi frekuensi kesalahan transkripsi. Ketersediaan enzim transkriptase balik ini telah memberikan kemudahan bagi para peneliti untuk mempelajari gen yang bertanggung jawab terhadap pemunculan sifat-sifat tertentu. Fak. tidak lama setelah penemuan enzim restriksi. Oleh karena cDNA merupakan hasil transkripsi balik RNA. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Tujuan mengonversi mRNA menjadi cDNA adalah karena DNA sifatnya lebih stabil daripada RNA. DNA hasil transkripsi balik disebut sebagai DNA komplementer (cDNA). maka cara sederhana yang dapat dilakukan adalah mentransfer cDNA yang menyandi protein tersebut ke dalam sel resipien sebagai sel inang (lihat Bab V). Dengan demikian. yang hanya mengandung urutan basa intron. Proses penyalinan RNA menjadi DNA disebut sebagai transkripsi balik (reverse transcription) dan enzim utama yang mengatalisis proses tersebut adalah enzim transkriptase balik (reverse transcriptase). Hal ini terutama terlihat pada cDNA organisme eukariot.

Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil. Empat puluh hingga 60 molekul tRNA yang berbeda 4. besar dan kecil. berlangsung di dalam ribosom. Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. elongasi. maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. Pada kebanyakan prokariot ribosom mempunyai ukuran 70S. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi. translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. suatu struktur organel yang banyak terdapat di dalam sitoplasma. atau pada hakekatnya sintesis protein. dan terminasi polipeptida. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A. yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Molekul mRNA ditranslasi dengan arah 5’→ 3’. Fak. 2. Translasi. yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. sedangkan pada eukariot biasanya sekitar 80S. sintesis Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Ribosom terdiri atas dua subunit. tetapi tidak dari ujung 5’ hingga ujung 3’. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel. Tiap ribosom mempunyai dua tempat pengikatan tRNA. 1. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. Sebagai contoh. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). Biologi Unsoed 60 .Translasi Bila dibandingkan dengan transkripsi.

protein yang mempunyai urutan NH2-Met-Pro. -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh. Sementara itu. berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya. . Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Selanjutnya. Hal ini berarti Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 4. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. . khususnya pada prokariot. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus.. akan diberikan di bawah ini. Biologi Unsoed 61 . Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. Fak. pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA.5. yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet). Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. arah gerakan ribosom P A ribosom CUG GGG 3’ mRNA 5’ AUC UAG ACC UGG GAC tRNA aa NH2 aa aa aa COOH aminoasil-tRNA aa NH2 ikatan peptida COOH Gambar 4.5.

tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. Selanjutnya. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasiltRNAfMet berikutnya yang akan masuk ke tapak A. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. dan metionil-tRNAfMet terikat pada tapak P.tRNAala. metionil-tRNAfMet. misalnya penyandi serin.bahwa sintesis semua polipeptida selalu dimulai dengan metionin. Biologi Unsoed 62 . suatu enzim yang terikat pada subunit ribosom 50S. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. Fak. dan IF-3). Langkah berikutnya adalah translokasi. IF-2. Selain itu. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. kompleks inisiasi bergabung dengan subunit besar ribosom (50S). serta sebuah molekul GTP. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet). dan subunit kecil ribosom (30S) dengan bantuan protein IF-1. Kompleks inisiasi pada prokariot terbentuk antara mRNA. baik pada prokariot maupun eukariot. yang melibatkan (1) perpindahan f-metala. ke tapak A memerlukan protein-protein elongasi EF-Ts dan EF-Tu. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. Triplet kodon berikutnya. IF-2. dan IF-3. Khusus pada prokariot akan terjadi formilasi gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa fmetionin. misalnya alanil. Pengikatan aminoasil-tRNAfMet berikutnya.

sedangkan translasi terjadi di sitoplasma (ribosom). Salah satu di antaranya seperti telah kita Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Terminasi ditandai oleh terlepasnya mRNA. Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom. Dengan berlangsungnya kedua proses tersebut secara bersamaan. Fak. Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. tidak demikian halnya pada eukariot. dan rantai polipeptida dari ribosom. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A. Selain itu. ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn onturn off) ekspresi gen. Namun. seperti yang akan dijelaskan nanti. tRNA di tapak P.akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. Sebagai contoh. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). yaitu RF-1 dan RF-2. Transkripsi terjadi di dalam nukleus. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. Biologi Unsoed 63 . Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. kedua subunit ribosom pun memisah. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. juga menjadi sangat efisien. Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom.

RNA polimerase. khususnya pada prokariot. yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. Gen-gen yang menyandi pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya.bicarakan di atas. Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. Pengaturan Eskpresi Gen Produk-produk gen tertentu seperti protein ribosomal. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. Pada kondisi tertentu represor akan berikatan dengan operator. Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model operon yang diajukan oleh F. Jacob dan J. Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. atau bahkan tumpang tindih. rRNA. prosesing mRNA. Monod pada tahun 1961. misalnya transkripsi. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. Biologi Unsoed 64 . atau translasi. Fak. paling banyak terjadi pada tahap transkripsi. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. menyebabkan terhalangnya transkripsi gen-gen struktural. Pengaturan ekspresi gen pada prokariot Pengaturan ekspresi gen pada sistem prokariot telah banyak diungkapkan berdasarkan hasil penelitian mengenai induksi dan represi menggunakan Escherichia coli dan Salmonella typhimurium. tRNA. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. Sementara itu. Namun.

Biologi Unsoed 65 . molekul protein represor yang dihasilkan oleh gen regulator. Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO).dengan operator. Di luar operon terdapat gen regulator (R) beserta promoternya (PR). Molekul efektor pada induksi adalah induser. Fak. dan molekul efektor. operator (O). operon PR R PO O GS1 GS2 GS3 represor efektor (induser atau korepresor) a) RNA polimerase induser RNA polimerase berjalan transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 4. sedangkan pada represi adalah korepresor. dan gen-gen struktural (GS).6.

Namun.6 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. Dengan pengikatan ini. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Dengan demikian. Namun. Akan tetapi. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon. Salah satu contohnya adalah operon lac. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. Operon. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor. gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. kalau pun ada. memegang peran yang sangat penting dalam proses diferensiasi sel. dengan adanya korepresor. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi. dan juga prosesing mRNA. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas. transkripsi gen-gen struktural tidak dapat berlangsung. Operon trp.Pada Gambar 4. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. promoter operon menjadi terbuka bagi RNA polimerase sehingga gen-gen struktural dapat ditranskripsi dan selanjutnya ditranslasi. Akibatnya. Sebaliknya. nampaknya tidak begitu penting pada eukariot. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. Jadi. Biologi Unsoed 66 . yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang. Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. Fak. dengan terikatnya represor oleh induser. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi.

Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. Sebagai contoh. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. Dengan perkataan lain. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. Demikian pula. yaitu hanya membawa urutan sebuah gen struktural. Biologi Unsoed 67 . dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. Fak. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik.mirip operon. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. Jadi. mRNA di dalam sel-sel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. hormon.

Suatu untai molekul DNA mempunyai sekuens 5‘. Bagaimanakah sekuens untai pasangannya? 4. dan protein? 5. Mengapa pengukuran konsentrasi larutan DNA dilakukan pada λ260 nm? b. a. bagaimanakah pemisahan molekul DNA. Apakah artinya jika hasil pengukuran kemurnian larutan DNA memberikan nilai nisbah A260 /A280 kurang dari 1.8? c. Komponen manakah yang menentukan spesifisitas suatu molekul asam nukleat? b. dapatkah Saudara menghitung persentase ketiga basa lainnya? Jelaskan jawaban Saudara. 2. RNA. a. Apakah manfaat senyawa interkalator etidium bromid? Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler.AGTTGCAGCCTACGT-3‘. Fenomena apakah yang menyebabkan stabilitas molekul DNA? b. Sebutkan macam-macam ikatan yang terdapat pada molekul DNA. Jika suatu molekul RNA mengandung basa adenin sebanyak 20%. Setelah dilakukan sentrifugasi dengan kecepatan tinggi di dalam larutan CsCl 8M. 3.SOAL EVALUASI 1. Apakah yang dimaksud dengan titik leleh (melting temperature) molekul DNA? d. Apakah yang terjadi jika asam nukleat berada di dalam suasana asam mineral encer? c. Apakah perbedaan antara nukleotida dan nukleosida? c. Apakah yang dimaksud dengan pernyataan bahwa molekul DNA mempunyai nisbah aksial yang tinggi? d. a. Biologi Unsoed 68 . Fak.

b. Fak. 5. protein di atas. Absorpsi maksimum sinar UV oleh DNA terjadi pada panjang gelombang 260 nm. d. Tidak bisa karena molekul RNA merupakan polinukleotida untai tunggal. b. Jadi. c. G. Biologi Unsoed 69 .3‘. Nukleotida = fosfat + gula + basa. Perbandingan antara panjang dan diameternya sangat tinggi sehingga molekul DNA sangat tipis memanjang. DNA di tengah. nukleotida = nukleosida monofosfat.ACGTAGGCTGCAACT . a. Interaksi penempatan (stacking interactions) antara pasangan-pasangan basa. 2. Larutan DNA terkontaminasi oleh protein. Jadi. Permukaan basa yang bersifat hidrofobik menyebabkan molekul-molekul air dikeluarkan dari sela-sela perpasangan basa sehingga perpasangan tersebut menjadi kuat. Agus Hery Susanto (2012) Bahan Ajar Biologi Molekuler. Suhu ketika molekul DNA mulai mengalami denaturasi. Ikatan glikosidik (glikosilik).KUNCI JAWABAN 1. dan C tidak dapat dihitung bedasarkan kandungan basa A. nukleosida = gula + basa. persentase A tidak sama dengan persentase T sehingga kandungan basa T. yang merupakan fungsi kandungan GC. 4. c. d. 5‘. RNA di bawah. c. Untuk memvisualisasi molekul DNA menggunakan paparan sinar UV. ikatan fosfodiester. a. Ikatan glikosilik antara gula dan basa terputus. 3. ikatan hidrogen. Basa nitrogen (basa nukleotida). b. a.

Sign up to vote on this title
UsefulNot useful