Forum Inovasi Teknologi Akuakultur 2010

ABSTRAK PRESENTASI ORAL

Forum Inovasi Teknologi Akuakultur 2010

FF 01
PERFORMA IKAN NILA BEST DALAM MEDIA SALINITAS
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: L0ppt =2,1±0,23; W0ppt = 7,0±0.29; B0ppt = 139,8±6.72; L7,5ppt = 2,3±0.06; W7,5ppt = 8,2 ± 0,42; B7,5ppt = 164.3 ± 8,46; L15ppt = 2.3 ± 0,21; W15ppt 7.8 ± 0,45; B15ppt = 155,6 ± 8,95. Pengamatan setelah 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-50ppt: 4,0±0,34; 3-515ppt: 4,8±0,27; 5-80ppt: 7,4±0,35; 5-815ppt: 9,2±0,98. Pengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
KATA KUNCI: nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
PENGUJIAN LANGSUNG EMPAT STRAIN IKAN NILA (Oreochromis niloticus) PADA SALINITAS 40‰
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen (LT50) dengan 8 ulangan dari masing-masing strain. Analisa data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata LT50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT 50

Forum Inovasi Teknologi Akuakultur 2010

FF 03
PENGGUNAAN Saccharomyces Cereviceae PADA FERMENTASI PAKAN BUATAN UNTUK MENINGKATKAN PERTUMBUHAN NILA MERAH (Oreochromis Niloticus)
Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan, Universitas Padjadjaran

ABSTRAK
Penelitian ditujukan untuk menentukan persentase terbaik dari S. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. cereviceae sebagai perlakuan dan lima kali ulangan. Sebagai perlakuan adalah A0 (tanpa penambagan S. cereviceae); A1 (penambahan S. cereviceae 1%), A2 (penambahan S. cereviceae 2%), dan A3 (penambahan S. cereviceae 3%). Hasil penelitian menunjukkan penggunaan S. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. Pertumbuhan terbaik diperoleh pada penambahan S. cereviceae sebesar 2%
KATA KUNCI: Saccaromyces cereviceae, fermentasi, pakan buatan, nila merah

FF 04
ANALISIS KERAGAMAN GENETIK LIMA POPULASI NILA HITAM (Oreochromis sp.) DENGAN ANALISA SIDIK RAGAM RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD)
Iskandariah, Otong Zenal Arifin, dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi, Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. Populasi yang diamati meliputi jenis nila BEST, Nirwana, Gesit, lokal Kuningan, dan lokal Bogor. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD), dengan menggunakan primer OPA-03, OPA-04, OPC-14, dan OPC-15. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13.3333%–46.6667%, dengan nilai heterozigositas 0.0351–0.1952 dan jarak genetik antar populasi 0.1765– 0.5797.
KATA KUNCI: RAPD, genetik, populasi, ikan nila, Oreochromis

Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. Data sintasan (Survival Rate. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. Sukamandi **) Dept.01%.81% dan 83. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. Pada uji tantang setelah minggu keenam. Kata kunci : Ikan nila. titer antibodinya menurun. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. XY. Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. Komar Sumantadinata**). agalactiae. Fakultas Perikanan dan Ilmu Kelautan. Untuk kontrol. agalactiae secara intra peritoneal pada ikan uji sebanyak 0. KATA KUNCI: vaksin sel utuh. ikan uji disuntik dengan PBS. ikan nila . tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. pengukuran bobot individu rata-rata dan penghitungan sintasan. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. XY. 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga. 106. Pada akhir pendederan dilakukan identifikasi jenis kelamin. Oreochromis niloticus Angela Mariana Lusiastuti*). genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. Budidaya Perairan. dan differensial leukosit dilakukan analisa sidik ragam (Anova). Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. genotipe. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). Hasil yang diperoleh bahwa sel utuh (whole cell) S. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. Pada perkembangannya. diferensiasi kelamin. 106. limfosit perlakuan tidak berbeda nyata dengan kontrol. dan YY melalui evaluasi nisbah kelamin yang dihasilkan. agalactiae pada tingkat kepadatan 108.1 mL/ekor. Selain ditentukan secara genotipe. Tetapi setelah uji tantang. DAN YY Didik Ariyanto*). 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. agalactiae. tidak cukup untuk memberikan protektif terhadap S. Perlakuan dengan injeksi sel utuh S. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. Genotipe XX mencirikan betina dan XY untuk jantan. yaitu genotype XX.Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. Uni Purwaningsih*). seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. SR). S.55% sedangkan genotipe XY dan YY masing-masing sebesar 79. titer antibodi. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX.

turbiditas. ortofosfat dan total fosfat. KATA KUNCI: Streptococcus agalictiae. Selain itu. lingkungan perairan . 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. NO3. total nitrogen. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. TDS. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. NO2. Anjang Bangun Prasetio. DO. dengan variasi perbedaan kepadatan bakteri vaksin (A=108. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. keramba jaring apung (KJA). Angela Mariana Lusiastuti.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. kecerahan. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. adalah septikemia dan meningoencephalitis. Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. pH. Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. terutama dalam hal manajemen pemberian pakan. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. B=106. Pemberian pakan tidak boleh berlebihan. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar.5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. Selain itu. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. dan Joni Haryadi Pusat Riset Perikanan Budidaya. Danau Maninjau. melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. KATA KUNCI: manajemen pakan. C=104.5). Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. NH3. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. karena pada kondisi perairan yang kurang baik akan menyebabkan stres pada ikan. serta data status kegiatan budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. D=102 cfu/mL dan E=kontrol). pemanasan. Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. BOD.

53 % bt/hari. oreochromis niloticus . tebal (-1. Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (-2. sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74. SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2.05) bila dibandingkan dengan dua populasi lainya. tebal. Sukamandi selama lima bulan. sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2.06%).21%).Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*).80%.74%). Fakultas Perikanan dan Ilmu Kelautan.48%). lebar (0. Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia).94%).48% bt/hari dan 2. tinggi. Komar Sumantadinata**). tinggi (3. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. tebal (0. KATA KUNCI: heterosis. Sukamandi **) Dept.82%).22%).64% bobot badan (bt)/hari. persilangan. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4.44%).65%). dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi. Budidaya Perairan. bobot ( -2. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.20%. bobot (-2.87%) dan sintasan (0. tidak berbeda nyata (P<0. Nunuk Listiyowati. dan sintasan(1. Parameter yang diamati meliputi keragaan pertumbuhan (panjang. Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat.35% bt/hari. bobot) dan sintasan.

iniae (N2O).9421 mg/L (1.9823–4. agalactiae (N3M.7877–2.1295). Konfirmasi taksonomis hingga level spesies isolat bakteri S.7504). Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan. Hasil penelitian menunjukan bahwa Nilai LC50 24.6904– 5. dan 96 jam. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S. 3. Bogor. 72. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN. dan sonikasi. Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah. 0.1100). uji stabilitas dan LC50–24. N14G. vaksin.6297–0. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration (LC50) 24. dan 96 jam.55±0. 1. ikan nila .0839(2.6578–2.0430 (4. iniae (N2O). 48.5094 (2. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin. Data diolah dengan analisis probit program LC50. dan nilai terbesar dimiliki oleh bakteri S. Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar. 3.5480). pemanasan. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). agalactiae (N4M) memiliki nilai LD50 terkecil. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1. KATA KUNCI: toksisitas.9237(0. NK1) dan 1 isolat S. SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA.81±0.8090) dan benih ikan nila 5. 0. 2. streptococciasis. KATA KUNCI: penapisan.13 dan 1. Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila.0678 (1.0930). benih ikan. 72. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak. N4M. dan 96 jam terhadap benih ikan mas adalah 4. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran.6799–13. 48.4227– 4. 48. N17O. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis. Hasil penapisan menunjukkan bahwa bakteri S.7138 mg/L (0. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung.08 g.8532).3354 (3.8101–1.5805). agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar.

00. dan corak permukaannya spesifik.76 kg/cm2. Nusa Tenggara Timur. liat. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak. Dalam pembesaran.00–08. Ikan ini relatif sensitif dengan perubahan lingkungan. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. kambing dan ikan pari yaitu berisi. kadar lemak 6. 40. simetris. sarung tangan. dan 102. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya. Sulawesi. kekuatan tarik 2. dan Sumatera. garmen.97% sehingga sangat prospektif untuk dijadikan barang-barang kerajinan kulit. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa Tenggara Barat. dan cacing. kekuatan regang (kemuluran) 66. kekuatan jahit 1.94%. Telur yang ada dalam kolektor dapat diambil jam 07. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih.53 N/cm atau 138.354. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. yang merupakan limbah perikanan dari perusahaan filet ikan.93% dan kadar Cr2O3 1. tas. kakap putih. Pembenihan ikan ini mulai berkembang di sekitar Gondol. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20.00 pagi hari.0–3.12 kg/cm. KATA KUNCI: pembenihan. Waktu pemijahannya sekitar jam 24.62%. 103. kadar abu 2.5 g. kambing. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi). dompet. lemas. namun sintasannya masih rendah yaitu sekitar 1%–3%. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1. dan 80 ekor/m3 selama 5 bulan masingmasing mencapai ukuran 127. pembesaran.5 kg. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi.0 g.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan.66%. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g. Selain itu. Ikan ini mudah terserang parasit seperti cryptocarion. benedinia.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi.2 g. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia. 10%. untuk dijadikan kulit tersamak. sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu.00 sampai jam 03. KATA KUNCI: bahan penyamak kron.46 N/ cm2 atau 222. karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. dan 15% .184. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. dan sebagainya. kerapu sunu . suhu kerut 88°C. kadar air 13.

Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. Namun demikian. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. Komar Sumantadinata***). Cromileptes altivelis Slamet Subyakto*). Sasmito Jati****). Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. dan 3 detik. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. jumlah kejutan 5. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus.1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. Rustidja**). sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. Irvan Faizal*****). M. transfer gen. elektroporasi. 2. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. jarak waktu antar kejutan 0. KATA KUNCI: transfeksi. mikroinjeksi. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. Metode elektroporasi dilakukan dengan voltase 50 V. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. mikroinjeksi. sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. di antaranya Indonesia. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. lama kejut 30 ms. hormon pertumbuhan. ikan kerapu tikus . Situbondo **) Fakultas Perikanan dan Kelautan. Alimuddin***). dan 20 µg/ mL. Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. mikroinjeksi.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. Ratu Siti Aliah*****). 10 µg/mL. dan Gemi Triastutik*) *) Balai Budidaya Air Payau.

42±0.90±0. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu. KATA KUNCI: benih kerapu sunu.35 mm). D (kontrol). Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva.69 g dan panjang total awal 3. Pemberian pakan dilakukan tiga kali sehari. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen). dan efisiensi pakan pada benih kerapu sunu.20-4. laju pertumbuhan harian. B (oksigen).69 mm). KATA KUNCI: larva kerapu sunu. dan perlakuan B (63. probiotik. C (probiotik). selanjutnya perlakuan C (64.19±0.25) dan efisiensi pakan (80. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut. Peubah yang diamati adalah sintasan. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus). serta terakhir perlakuan D (47.73%) dan panjang total (9.52±0. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan. Kendala yang dihadapi terutama terjadi pada stadia awal. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan.19%) dan panjang total spesifik (1. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan. laju pertumbuhan bobot badan harian (10. 10%. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. Namun. efisiensi pakan. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal.19%) harian serta laju pertumbuhan bobot badan spesifik (6. Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan. Sampling dilakukan setiap minggu.86 mm).39±0.000 ekor/bak. Salah satu faktor yang berperan adalah lingkungan pemeliharaan. Nilai pertambahan panjang tertinggi A (72. Pakan yang digunakan adalah pakan pelet komersial. nisbah konversi pakan. Materi yang digunakan adalah larva kerapu sunu sebanyak 4.31±0. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total.95 mm). pertumbuhan panjang larva. dan 15% dari total biomassa benih. oksigen . rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU.02%) serta nisbah konversi pakan (1. yaitu 5%.35 cm). optimasi pakan.20 cm.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut. laju pertumbuhan spesifik. pertumbuhan.00%) yang baik bagi benih kerapu sunu.68 g) dan panjang total (6. dan kualitas air.50-0.

55 mm dan C: 26. terutama infeksi virus.5 ± 4. dengan kepadatan 1. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan.12 mg dan C: 211.03% dan perlakuan C adalah 8. sedangkan kontrol hanya disuntik dengan PBS. B: 24. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan.62 ± 2. aktivitas lisosim sebesar 1. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari. infeksi. imunstimulan.5 ± 2. Bejo Slamet. Perlakuan C: 5 kali/hari pada umur 7-20 hari. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Masing-masing perlakuan diulang 3 kali. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular. larva kerapu macan.57 mm. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind. Mulai larva umur 2 hari diberikan Nannochloropsis sp. B: 196. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0.95 mg. serta bobot badan pada perlakuan A: 192. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6.87 cm dan sintasan setelah diuji tantang sebesar 72.96 mg.1 ± 2.65%.62%.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari. Des Roza. Gondol ABSTRAK Ikan kerapu macan. Perlakuan B: 4 kali/hari pada umur 7-20 hari.00%. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun nonspesifik ikan kerapu macan. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. KATA KUNCI: Epinephelus fuscoguttatus. indeks fagositik sebesar 1. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny. mencapai ukuran panjang total pada perlakuan A: 24.04 ± 0. Perlakuan A dan B tidak berbeda nyata.20 ± 0.50%. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari.08 ± 2. kerapu macan . perlakuan B adalah 6. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan. Epinephelus fuscoguttatus Irwan Setyadi. KATA KUNCI: pakan buatan.68 mm. Anak Agung Ketut Alit.08 ± 1.81 ± 0./mL dan mulai umur 17 hari diberikan nauplii Artemia.0x105 sell/mL.87.

Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. dengan sintasan 6. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. konsentrat mempunyai sintasan 19. Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir. KATA KUNCI: efisiensi. Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk. Setiap bulan dilakukan pengamatan pertumbuhan bobot. pembenihan. kerapu bebek (Cromileptes altivelis). panjang. Sampai dengan bulan Oktober telah berhasil memijah. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. dan dilihat perkembangan oositnya. generasi kedua (F-2). Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah.72% dan panjang total 18. KATA KUNCI: kerapu bebek (Humpback grouper).) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor.86 mm. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. konsentrat yang bisa dibeli di pasaran.10% dan panjang total 21. pada bak A : ikan rucah + cumi-cumi + vitamin. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. yang kurang baik. dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. sedangkan pada bak B : pakan pelet kering. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu. pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. perkembangan oosit .

mutu benih kerapu. 2. pemeliharaan dilakukan hingga yuwana (2 bulan). Tangki pemeliharaan yang digunakan ukuran 8-10 m3. 3. organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. manajemen air media pemeliharaan dan manajemen pakan. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D-15). Selain itu. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. Sampel larva diambil pada umur 1. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. Tetapi tingkat sintasan yang didapatkan masih rendah.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. 4. 7. produksi massal . 17. Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. Cromileptes altivelis Yasmina Nirmala Asih. dan 32 hari setelah menetas masingmasing sebanyak 10-20 ekor. histologi. 5. 25. Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. Indah Mastuti. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3).Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. 20. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin. 10. Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. Ketut Mahardika.8%-41. 13. 15. KATA KUNCI: kerapu bebek. KATA KUNCI: pemeliharaan larva.

(pakan kontrol). siklus pertama. 15% (P>0. Lies Emmawati*). Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. 5%. di lain pihak hasil tangkapan cenderung menurun. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. I Nyoman Adiasmara Giri. survival rate. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). KATA KUNCI: innate immunity. Tingkat kematian larva dapat mencapai 40%–80%. Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. 15%.4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak.651 ekor benih untuk setiap induknya. Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. perlu alternatif lain sebagai substitusi tepung ikan. 10%. catfish seed. Salah satu sumber protein alternatif adalah protein sel tunggal (PST). Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. dan siklus kedua menggunakan larva dengan kekebalan bawaan. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. Pangasius hypophthalmus . Hasil penelitian menunjukkan bahwa nilai bobot akhir.797–457. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR).05). akibat serangan penyakit dan kondisi media. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. laju pertumbuhan spesifik. dan ketiga menggunakan larva tanpa kekebalan bawaan. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). Pakan penelitian berupa pelet kering dengan kandungan PST 0%. Oleh karena itu.Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. Kematian larva umumnya terjadi pada hari keempat. dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. Oleh karena itu. pertambahan bobot. Pakan diberikan 2 kali secara “adlibitum”. KATA KUNCI: protein sel tunggal. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. Ketut Suwirya. Sumber protein utama pada pakan adalah tepung ikan. dan 20% dalam pakan. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). 10%. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir.

Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). Ikan patin sebayak 15 ekor. Kecernaan protein tertinggi berturut-turut pakan C (82. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.93%) dan terendah salinitas 3‰ (25.35±0. C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati. benih. Kecernaan protein juga meningkat akibat penambahan enzim fitase. D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase).14%). Ikan uji yang digunakan berukuran 2 ± 0.4%) berbeda nyata lebih tinggi dibanding pakan E (68.3%) dan pakan D (80.763±0.1%) berbeda nyata lebih tinggi dibanding pakan D (97.32% per hari menjadi 4.00%). dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan.8%). selama 30 hari.17% per hari menjadi 1.010±0. Kecernaan P pakan B (98. dan salinitas 1‰ (3. dan (C) 3‰ dengan tiga kali ulangan. Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3. Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan. Ade Dwi Sasanti.223±0. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak).5 g/ekor. diikuti salinitas 2‰ (28. dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal.1%) dan pakan E (95.140±0.46% per hari. dan A (98. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰.910±0. Data diperoleh dianalisis sidik ragam.764±3. yang dilanjutkan dengan uji Tukey. Pangasius djambal.884±2. dan sintasan .75±0. (B) 2‰.674±2.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN. Dade Jubaedah.2%).07 cm). pakan B (82. Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter. Parameter yang diamati adalah laju pertumbuhan panjang badan. ikan patin.204±0. sintasan serta beberapa parameter kualitas air.92 cm).114±0. Pangasius hypopthalmus Mohamad Amin. Pakan diberikan 3 kali sehari secara at satiation.4%). KATA KUNCI: salinitas.25±0. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm. pakan C (98. sedangkan laju pertumbuhan panjang harian meningkat dari 1.0%). Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan. kemudian salinitas 3‰ (4. Analisis data dilakukan secara deskriptif.49 cm).3%). KATA KUNCI: fitase .1%).13% per hari. pakan A (82.

Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. lahan marjinal . Patin Siam. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan dan sintasan ikan. udang liar) serta jenis serangga air.12 g dan 3. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4.74±0. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. pengecekan induk. pemijahan. KATA KUNCI: budidaya. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia.42±0.27±0. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g). maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut.5 juta ha (rata-rata 20 juta ha). Padat tebar larva yang digunakan adalah 100 ekor/m2. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan.5).60±10. dan C (10 ekor/m2) dengan 3 kali ulangan.37 cm C 16.2%. B.31 cm B. Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. 0. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2).2%). Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masing-masing perlakuan: A.5%-9. sintasan ikan. Kata kunci: Intensifikasi. B (95. Larva yang ditebar berumur 20 jam setelah menetas. betok. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. yaitu antara 13. Akmal.3 g) dan SR perlakuan A (91. Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah. belut. B (7 ekor/m2).26 cm. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam.7% rendahnya sintasan ini diduga karena adanya faktor hama. dan C (613. Sularto. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. B (660 g). nila.7. penetasan telur dan pemeliharaan larva di kolam. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. komposisi pakan alami kolam.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia. 0.51 g dan 11. dan C (95.08 g dan 3.9%). ikan patin. Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11. Pupuk anorganik + organik. dan Syafrudin Balai Budidaya Air Tawar. Jika luas gambut Indonesia adalah 20 juta ha. predator yaitu antara lain: Ikan liar (gabus. Pupuk anorganik + organik yang difermentasi + Probiotik.49±1. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. sepat. Pupuk anorganik + organik + probiotik dan C. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam.19±0. namun perlakuan B (7 ekor/m2) memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan. Pemupukan. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery.5-26. Pemberian pakan dengan pelet apung sebanyak 5% per hari.

76%).47 g). di samping itu. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95.76 cm dan 2.74 g) dan 20 ekor/m2 (61. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.45 g).10%/hari. dan Sularto***) *) Pusat Riset Perikanan Budidaya. sedangkan petakan kedua ditebar sebanyak 2. KATA KUNCI: patin pasupati. 15 dan 20 ekor/m2 dengan bobot awal antara 15.17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99. Zafril Imran Azwar**).000 ekor atau kepadatan 10 ekor/m2.18) dan terendah pada 10 ekor/m2 (1.70–20. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan. 10. Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1. Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar.54 g dan panjang awal antara 10. 15 ekor/m2 (70.80%.30%). Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3. JAWA TENGAH Ongko Praseno*).60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin.5 m. pertumbuhan. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES.52%) dan terendah pada 20 ekor/m2 (91. pertumbuhan. Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Evi Tahapari. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%.09 cm dan 1. salinitas. nasutus . pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela. Percobaan dilakukan selama 100 hari pemeliharaan. Jakarta **) Balai Riset Perikanan Bididaya Air Tawar. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah.71). Evi Tahapari***).06%) dan terendah pada kepadatan 20 ekor/m2 (7.43–11. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya.36 cm.46 g). dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3. Kata kunci: padat tebar. Sifat biologi pertumbuhannya belum banyak diketahui. Padat tebar yang digunakan adalah 5. Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda.000 ekor atau kepadatan 5 ekor/m2. Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. diikuti dengan kepadatan 10 ekor/m2 (92.

dan kontrol. Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.002 mg/L (4. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan pertumbuhan . Probiotik diberikan dengan dosis yang berbeda. kemudian perlakuan dosis 0. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar. Ikan uji yang digunakan berukuran 1–2 inci. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo. sebagai perlakuan yaitu: (A) 0.60 ± 0. Perlakuan kedua adalah padat tebar: 5 ekor/L.49 cm). 10 ekor/L. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. Sukamandi. 106.001 mg/L.001 mg/L (86. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. Jakarta **) Balai Besar Riset Perikanan Budidaya Laut.67%). Analisis data dilakukan secara deskriptif.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*).003 mg/L (81. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air.001 mg/L (4. Uji tantang dilakukan dengan dua cara.003 mg/L dengan tiga kali ulangan. dosis. Nurbakti Listyanto*). yaitu: cara perendaman dan cara penyuntikan intraperitonial. Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. Kata kunci: uji tantang Aeromonas hydrophila. dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya.33%) dan terendah perlakuan dosis 0.35 ± 0.14 cm). kemudian dosis 0. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0. Pengamatan dilakukan selama 15 hari setelah perlakuan. Angela Mariana Lusiana**). benih.35 cm). 108. sintasan. dan kontrol (placebo). perendaman. dan (C) 0. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan. dan 15 ekor/L. (B) 0. 108. Parameter yang diamati adalah insidensi dan sintasannya.003 mg/L (4. Evi Tahapari*). 109.55 ± 0. Bogor ***) Pusat Riset Perikanan Budidaya. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*). diikuti dosis 0. Ikan uji yang digunakan berukuran 3–4 inci.002 mg/ L. Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal.002 mg/L (83. 107.67%). KATA KUNCI: probiotik. intraperitonial.

58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4.700 µm. substitusi protein 4. dan 25% ampas tahu:75% tapioka.52% (pakan B). Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. ampas tahu. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus. Pangasius nasutus . Derajat penetasan patin nasutus berkisar 44. KATA KUNCI oosit. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.03% (pakan C). ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad.250–1. dan tahap 5 (atresis) dengan diameter oosit 300–1.700–4.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati.16%–79.000 µm. Ke dalam wadah ditebar ikan patin ukuran 11.900 µm. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu. 50% ampas tahu:50% tapioka. larva.05% dengan lama inkubasi 22–25 jam. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur.03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Perkembangan oosit patin nasutus bersifat sinkronis grup. yakni pengamatan perkembangan gonad dan fertilisasi. Zafril Imran Azwar.850 µm. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. rearing. KATA KUNCI: fermentasi. artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai. Penelitin ini terdiri atas dua tahap.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. hatching. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu. tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm. 75% ampas tahu:25% tapioka. yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium. Aspergillus niger. substitusi protein 0% (kontrol) (pakan A). Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. Ukuran panjang total larva yang baru menetas berkisar 3.130–22. Bambang Iswanto. tahap 3 (granula kuning telur) dengan diameter oosit 700–1. substitusi protein 2. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologi-reproduksi berkaitan dengan kapasitas produksinya. dan substitusi protein 6.04% (pakan D).41±0. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar.

nasutus .54 cm). B.84 g/ekor dan terendah A. masing-masing perlakuan diulang sebanyak empat kali.35 cm/ekor dan A.1. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya.98±0.56 cm/ekor. 50% zeolit + 50% bioball dan D.30ab. 95. 89. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0. 0. siam.27a.34±0.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. 1. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.20 mm. 88.75% dan terendah perlakuan A. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih.42±0.10–1.64±0.69 cm/ekor diikuti B.13 mm. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1. diikuti perlakuan B. jambal. 2. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A. hibrida.02 g/ekor. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus.08 mm3 yang terserap 50% pada umur 30 jam dan habis terserap pada umur 60 jam. dan D. 100% zeolit B.25 g/ekor. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A. pertumbuhan. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20.6±0. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER. 75.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin. 1. C. 79.71±0. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D.23%.33%. C.01±0.62 g) dan panjang (2. C. 2.01±0. Kata kunci: embriogenesis.45 g/ekor.58%.60 cm/ekor. 4. diikuti perlakuan C. 91. 4. 25% zeolit + 75% bioball.24) x 103.14 mm. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var. berukuran panjang total 3. berukuran panjang total 3. 0. biofilter. dan D. C. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut.67%. larva.31ab. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi.47±0.28%.42. dengan kantung kuning telur berukuran 0. 0. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi.30a. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE.89±0. 75% zeolit + 25% bioball.20. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi. B.1±0. dengan kantung kuning telur berukuran 0. sedangkan patin hibrida siam-jambal sebesar -4. 92. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER. C.43b. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D. B. 88. 1. tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus. 1. KATA KUNCI: patin albino. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa.03±0.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias.

Hasil penelitian menunjukkan bahwa. dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N.6%–90. KATA KUNCI: feed digestibility. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein pakan yaitu 2. diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%. N waste. tambak. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. dan 3. Untuk menentukan total limbah N termasuk eksresi amonia. Dedi Jusadi**).27 g N untuk pakan berprotein 17%.1% untuk C-organik.2%–78. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. lama ikan bandeng digelondongkan.0% untuk protein dan 81. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77.6%–83.28% untuk pakan berprotein 26%. Oleh karena itu. Oleh karena itu. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur. ikan bandeng. Enang Harris**).76 g N untuk pakan berprotein 21%. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar. 2. padat penebaran udang windu. heterotrof bakteria .2% untuk bahan kering.2 kg/ha/musim. Jika bioflok terbentuk. KATA KUNCI: pengelolaan. Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2. 88. Neltje Nobertine Palinggi*). Pakan tersebut digiling ulang. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone. dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya. lama pemeliharaan ikan bandeng. Eddy Supriyono**). Maros **) Fakultas Perikanan dan Ilmu Kelautan. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. 21% dan 26%. milk fish. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. lalu ditambahkan kromium oksida (Cr2O3) sebagai indikator kecernaan.990 kg/ha/musim dengan rata-rata 292. produksi. Akhmad Mustafa. dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok). penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok).

Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. Dedi Jusadi**). Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng. Penambahan inokulasi bakteri komersial (Bacillus sp. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi.54% per tahun kurun waktu tahun 2005–2009. PATI. Oleh karena itu. Pati. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. Hatim Albasri. growing. Molase digunakan sebagai sumber Corganik. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia. Pada tahun yang sama. Enang Harris**). Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan. Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: Heterotrofic bakteria. Penyusun utama bioflok ini adalah bakteri heterotrof. (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. Khususnya di wilayah Pantai Utara yaitu Kendal. opsi kebijakan . Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. dan Pekalongan. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. dan Rasidi Pusat Riset Perikanan Budidaya.000 ton dan mengalami kenaikan rata-rata 13. (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL. DAN PEKALONGAN ) Anjang Bangun Prasetio. KATA KUNCI: budidaya. Eddy Supriyono**). Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475. Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L.975 ha.000 ton dan mengalami kenaikan sebesar 14.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*).) cenderung meningkatkan kandungan asam amino bioflok. kendala. bandeng.66% dari tahun-tahun sebelumnya.250 ton. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya.726 ha dan yang layak untuk budidaya sekitar 6.

34%) dan DP (63.00±3.****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan.0±10. ikan lele . menyusul heat shock-GFP (10. Clarias sp.3±0.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel. Gusrina*). keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele.33%. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan.65%) dan heat shock-GFP (18. 18. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp. keratinGFP. dan heat shock-GFP berturut-turut adalah 20. Ekspresi gen gfp tidak tampak lagi pada saat telur menetas. dan 15. KATA KUNCI: promoter. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA). Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. sedangkan DP dihitung ketika semua telur telah menetas. DP untuk â-aktin-GFP.00±1. Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10. GFP. keratin-GFP (21.67%.65%.33±3.Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN. mikroinjeksi. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. Hasil penelitian menunjukkan bahwa DKH-e (63. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung.66±1.34±1.63±10. Konstruksi gen dalam bentuk plasmid mBA-gfp. Komar Sumantadinata**). sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik.0%). Alimuddin**).03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi. DKH-e yang diinjeksi dengan â-aktin-GFP (25. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi. Data dianalisis secara deskriptif.0±0. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0.33±1.00±1. Fakultas Perikanan dan Ilmu Kelautan. FMIPA.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur. DKH-e dihitung sebelum telur menetas. Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji.67%). Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein. HEAT SHOCK DAN KERATIN PADA IKAN LELE.0%). dan Utut Widyastuti***).66%) relatif sama. Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi.0%) dan yang terendah â-aktin-GFP (3. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi.

KATA KUNCi: A.53% menjadi 92. Angela Mariana Lusiastuti. hydrophila.33% kadar sari dalam air. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak. pagi dan sore. aerasi. Feces yang dihasilkan diambil setiap hari.39% kadar asiaticosid. 6. bahan aktif. 5. Ikan lele dumbo berukuran 41.71±2. 24.34% kadar air. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%.. KATA KUNCI: kecernaan pakan. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. Taukhid. Pada perlakuan tanpa aerasi. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus).74±1. pegagan Centella asiatical [L] Urb. Melalui penambahan aerasi. Bak diisi air sebanyak 100 liter. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif).37% kadar abu. Kandungan bahan aktif hasil pengekstrasian pegagan segar. pakan tenggelam. pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. ikan lele dumbo (Clarias gariepinus).47±4. pakan terapung .623. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. 0.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB.15%) dibandingkan dengan pakan tenggelam (yakni 79.05). Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus).25% sehingga tidak berbeda nyata dengan pakan terapung. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0. hydrophila menjadi penyakit endemis di Indonesia. 39. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo. 1.23% kadar abu tak larut asam. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam.41 mg/L) dengan dosis efektif 250 mg/L. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi.53%) (P<0.47±4.05) dari 79.83% kadar sari dalam alkohol.30±2. Pemberian pakan sebesar 5% dari biomassa per harinya. Rita Febrianti. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan.

tapioka. Wadah percobaan yang digunakan adalah bak beton ukuran 1. dan perkembangan gonad). dan penurunan lemak 61. dan cuk yang diberikan diselang-seling secara adlibitum. KATA KUNCI: maggot. 7.10 g sebanyak 40 ekor.3–3. dan 30 g/40 liter masingmasing diulang 3 kali. panjang. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0.83% tidak memperlihat perbedaan dengan perlakuan kontrol. 20. 10. dan Darti Satyani Balai Riset Budidaya Ikan Hias ABSTRAK Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang.8 m. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. dan dirancang sistem resirkulasi. ikan. kualitas air (suhu.0 m x 0. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9.33±0. amonia. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11.Forum Inovasi Teknologi Akuakultur 2010 FF 45 PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus) Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. dan 25. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. alkalinitas. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol).96%. Laju pertumbuhan spesifik. dari perlakuan kontrol. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. fermentasi.56%.90%.0 m x 1.8–4.85%. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2. Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3.28%. oksigen. namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25. Jenis pakan berupa cacing tubifex. Parameter yang diamati sintasan dan pertumbuhan (bobot. Sulasy Rohmi. dan molase. 19. bloodworm. KATA KUNCI: gurame coklat. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar. dan gonad . pH. penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7. Siti Subandiyah.92%. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. 13. formulasi. reproduksi.7 cm mencapai TKG III.1 cm. Setiap perlakuan dengan 3 ulangan.81% dalam formulasi pakan. dan karbondioksida). lele dumbo FF 46 ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA Tutik Kadarini.

yakni 0. biokimia. 4. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. Masing-masing perlakuan mempunyai 2 ulangan.774 butir per sarang. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi. KATA KUNCI: fish TB.546 butir dan 2. produksi telur per sarang. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame.Forum Inovasi Teknologi Akuakultur 2010 FF 47 APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC. dan tingkat fertilitas telur yang dihasilkan. Perlakuan yang diterapkan adalah kadar protein 38%. pakan buatan. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. dan 71.75 buah. dan injuk sebagai bahan pembuat sarang. penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente.88 buah. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. KATA KUNCI: ikan gurame. Lamanto. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. yaitu di Jawa timur (Blitar dan Tukung Agung). lebih rendah dibandingkan dengan yang diberikan pakan tambahan berkadar protein 33%. 14% dan kontrol yakni masing-masing 79. Dari hasil penelitian menunjukkan bahwa di daerah Blitar. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang).94% (P=0.) DI JAWA Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. Pemberian pakan tambahan dengan kadar protein 38%.05%.5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. keragaan reproduksi . Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Induk gurami yang digunakan berbobot 2-3 kg/ekor. PCR FF 48 PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI Bambang Gunadi. dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.86%. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92.730 butir.13 buah) dan hanya daun sente (0. Mycobacterium fortuitum.351 butir. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang. namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0. daun sente. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan. dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0. Pakan yang diberikan berupa daun sente sebanyak 3. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama.26). Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0. dan 14% sesuai dengan label pada kemasan masing-masing. sehingga petani tidak mengalami banyak kerugian.5 buah). Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. yaitu seperti daun talas. dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2. Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp. Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman. Jakarta ABSTRAK Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. Mycobacteriosis. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa. 28.23% dibandingkan dengan pemberian pakan dengan kadar protein 33%. Sukamandi ABSTRAK Ikan gurame termasuk ikan dengan fekunditas rendah. 33%.09). 33%.

Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. Sintasan ikan uji berkisar antara 96. dengan ditandai tumbuhnya koloni transforman berwarna putih. protein efisiensi rasio. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5. oligosphorus. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi. fermentasi. dan selanjutnya polar dan dedak padi.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. yang menunjukkan terbentuknya plasmid rekombinan.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan berbeda nyata (P<0.14% dan kadar lemaknya turun sebesar 19. oligosporus yaitu 2. Kandungan protein dedak padi naik 19. Parameter yang diuji meliputi bobot akhir rata-rata. dan koloni berwarna biru tidak mengandung DNA sisipan. ikan mas . Kadar protein polar naik 38. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Retensi lemak tertinggi (35.67%–100%. Reza Samsudin. KATA KUNCI: R. dan pada Silver carp sebesar 1123 bp. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar. dan 6 hari. polar. dan polar fermentasi. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar.33%. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari. retensi lemak. polar. dedak padi fermentasi. Bogor dan terdiri atas dua tahap. retensi protein. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. dedak polar. Retensi protein dedak padi fermentasi. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ –GATGAAACTCGAGTAGCCCTTGCTCTTC.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG.05) dengan perlakuan lainnya.28%. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. pertambahan bobot relatif. dan polar fermentasi berbeda nyata (P<0.05) dengan dedak padi tanpa fermentasi. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. 4. Wadah percobaan yang digunakan yaitu akuarium volume 100 L.02% sedangkan kandungan lemaknya turun 13.3’). Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T. dedak padi.47 g/ekor. dengan padat penebaran ikan uji 30 ekor per akuarium. dan sintasan. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp. mud carp sebesar 1127 bp. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen.

41 g/hari. Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. dengan padat tebar 20 ekor/m3. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. dan parameter kualitas air yang lain dianalisis secara deskriptif. Parameter yang diuji adalah kualitas air terutama kandungan ammonia. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. tambak . Pertambahan berat rata-rata ikan mas strain wildan mencapai 1. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. KATA KUNCI: ammonia.64 kali lebih banyak dengan ukuran panen 1. Data setiap sampling dijadikan ulangan. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan.25 kali lebih besar dibanding pada kolam konvensional. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman.28 g/ ekor yang digunakan sebagai hewan uji. dan ikan mas galur majalaya sebesar 0. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan.15 g/hari. kemudian ikan mas galur kuningan sebesar 1. Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. salinitas rendah. Sutrisno*). serta keramba jaring apung di danau maupun waduk. Di mana satu di antaranya di desain sebagai kolam akuaponik. Ongko Praseno. akuaponik. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. sintasan. ukuran panen. karena akhirakhir ini banyak lahan yang tidak digunakan (marginal). pertumbuhan.86 g/hari. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. sawah. Benih ikan mas ukuran 18. Achmad Sudradjat. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. Provinsi Banten. wildan. KATA KUNCI: ikan mas. sedangkan yang lainnya sebagai kolam konvensional. dengan lokasi penelitian di Desa Kronjo. Lilis Sofiarsih*). ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. Kabupaten Tangerang. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). Sedangkan sintasan. Penelitian telah dilaksanakan dari bulan Nopember 2009—Pebruari 2010. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. ukuran panen.

Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2. cobia larvae. Siti Zuhriyyah. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat.58 cm dan 17. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. Hasil penelitian menunjukkan bahwa pertumbuhan panjang.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). Afifah. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata.067mg) serta kelangsungan hidup (12. (B) umur 10 hari dan (C) umur 15 hari. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. fry performance. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. serta mempunyai respons yang baik terhadap pakan buatan. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal.42%.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. dapat dikembangkan di bak terkontrol maupun di KJA.07%) relatif lebih tinggi dari pada perlakuan B dan C. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik. memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi. KATA KUNCI: artemia nauplii. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam. Masing-masing perlakuan diulang 3 kali. kemudian diberikan sebagai pakan larva. Siti Zuhriyyah Musthofa. KATA KUNCI: survival rate. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. lasted time feeding .

Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam. Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. Stakeholder. sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. KATA KUNCI: ikan hias. dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. KATA KUNCI: cobia. Lebih dari 100 spesies. budidaya. plasma nutfah . Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera. Herno Minjoyo*).Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). Lucky Marzuki Nasution*). termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias.

Artemia sp. dan yang terendah Moina. Tubifex sp. KATA KUNCI: deformity. multifocal granuloma . dan Tubifex sp. dan pertambahan panjang total sebesar 1. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias.586%. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. diam dan kepalanya menyembul tepat di bawah permukaan badan air. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm.. Depok ABSTRAK Deformity (dysmorphism. pakan alami. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias. Eni Kusrini*).778 cm. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. dengan 6 kali ulangan. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. diikuti Artemia.. Peacock bass ini akhirnya berenangnya jadi terbalik. Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata.226 g. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. laju pertumbuhan harian sebesar 32. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. granuloma. Deformity dapat disebabkan oleh : mutasi genetic. pertumbuhan. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian.Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*). Afrika. KATA KUNCI: Synodontis nigriventris. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. kondisi daya dukung lingkungan yang terus menurun. karena belum banyak yang membudidayakannya. atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. infeksi penyakit (cacing. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. peacock bass. bakteri. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. dan selalu berusaha mendekati sumber oksigen (aerator). virus). dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia.

Rainbow Papua . wortel dan tepung kepala udang. zat pemicu warna. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. density.3 cm dan bobot 2. dan Ahmad Musa Balai Riset Budidaya Ikan Hias. 20 ekor/bak. udang jembret (mysids) dan larva nyamuk. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. 40 ekor/bak. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. yaitu : astaxanthin. 60 ekor/bak.Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. T2. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak.50 g. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. T3. induk diberi pakan berupa naupli artemia/artemia pra dewasa. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF). dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut.87 ± 0. Hewan uji yang digunakan berukuran panjang total 5. Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. KATA KUNCI: banggai cardinal fish. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati. Selama penelitian. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. Hasil penelitian menunjukkan.9 ± 0. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. KATA KUNCI: maggot. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. Bastiar Nur. Variabel yang diamati meliputi. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai Sulawesi Tengah. Jhon Harianto Hutapea.

sintasan.33%. ukuran ekspor 1 inci (2.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari. 70. AF (aqua+formalin). Nina Meilisza. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. KO (76.5 cm dan panjang tertinggi sebesar 3.5 cm (ukuran ekspor).5 m dan tinggi air 40 cm. KATA KUNCI: benih botia. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. namun tidak berbeda nyata dengan perlakuan AO (81. oksitetrasiklin.67%). dan blitz ich) akan dilakukan melalui rancangan faktorial. KO (air kontrol+oksitetrasiklin). 20. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0.5 x 0. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis). dan Lili Sholichah Balai Riset Budidaya Ikan Hias. KF (71. namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis.0 cm. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. KF (air kontrol+formalin).009 gram.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. 35. dan 105 dan dianalisis secara deskriptif. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. media air. AB (aqua+blitz ich). Selama pemeliharaan. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. pertumbuhan panjang. larva Tetraodon palembangensis . Sintasan terendah dihasilkan oleh perlakuan KB sebesar 51. KATA KUNCI: prophylaksis.67% namun tidak berbeda nyata dengan perlakuan AB (55%).0 cm dan bobot rata-rata 0. Pada akhir penelitian (hari ke 105). Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium.67%). Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich). Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin. dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. AO (aqua+oksitetrasiklin). 55. sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).67%). Panjang rata-rata benih ikan botia di awal penelitian berukuran 1.5 x 0.05). I Wayan Subamia.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza. Masing-masing perlakuan dilakukan dengan 3 ulangan.05).6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.

ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy. SR (0-10 hari) 83. Asep Permana. Depok ABSTRAK Ikan palmas (Polypterus sp. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27. namun belum banyak diketahui data embriologinya.31% dan menghasilkan larva normal sebanyak 218 ekor.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar. perkembangan embrio. penyuntikan hormon. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. Pemijahan tersebut terdiri atas seleksi induk.6°C–29. pembuahan. masa inkubasi . aligator (Lepisosteus oculatus). Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari.). Asep Permana. tiger catfish (Platysoma sp.75 mL/kg untuk induk betina di bagian intraperitoneal. inkubasi telur dan perawatan larva.). hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. sehingga produksinya masih mengandalkan impor dari luar negeri.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. Ikan palmas jenis albino (Polypterus senegalus var. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. KATA KUNCI: palmas albino.). Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina. Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias. albino) masih sulit untuk memijah dalam wadah terkontrol. memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan. daya tetas telur 80. antara lain sinodontis (Synodontys sp. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina. platidoras (Platydoras sp). KATA KUNCI: Neocaridina heteropoda. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol.5 ml/kg untuk induk jantan dan 0. dan Bastiar Nur Balai Riset Budidaya Ikan Hias. dan red-fin shark (Ephalzeorhynchos sp.15%. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0.4°C.91%. polypterus senegalus albino.

Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks. Asep Permana. Tutik Kadarini.3–2. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka. sedang induk jantan belum ada yang mengandung sperma. Pada ikan yang baru di domestikasi. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai. KATA KUNCI: induk.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20.042 pg/mL. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungaisungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya.725 pg/mL. budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah. matang gonad. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A). pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32.7–1. hormon. Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor. dipelihara selama 6 bulan. implantasi.1272–0. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. LHRH 50 mg dan testosteron 50 mg (C). Pemijahan udang hias ini telah banyak dilakukan di kalangan petani.1630 g dan dua ekor induk jantan yang berukuran panjang 1. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2. Kepadatan 10 ekor induk dengan bobot 65–600 g. oocyt . Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya). panjang 40– 60 cm.0518 g. Rendy Ginanjar. dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. LHRH 100 mg dan testosteron 50 mg (B). murah dan aplikatif.5 cm dengan bobot 0. Rina Hirnawati. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air.9 cm dengan bobot 0. KATA KUNCI: Neocaridina heteropoda. Udang diberi pakan berupa moina beku sekali dalam setiap hari.0488–0. dan Darti Satyani Balai Riset Budidaya Ikan Hias.

The result showed that the percentage of male guppy at 50 mL/ L is 64. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method. and 75 mL/L. yeast (30–800 mg/kg) dan sumber lainnya. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. chrysin. The observation to sexual secondary characteristic guppy can be observed at least two months old. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan.000 mg/kg).000-4. KEYWORDS: honey. as the curative effort is not applicable. because of residual effects to human caused cancer. kemudian dipisahkan antara tangkai dan kelopaknya. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. but between treatments not significant different. The proportions test showed dose 50 mL/L have significant different to control. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control).05 significant level. 50 mL/L. The concluded that the optimum dose to produce male guppy is 50 mL/L.6%). The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0.07 ± 9.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias. the treatments gave significant different with control. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. Based on LSD test. KATA KUNCI: bunga tai kotok. the alternative masculinization application of natural substance like honey. carotenoid. guppy fish . suhu. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam.71%. male. 25 mL/L. The research was conducted experimental with completely randomized design.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. Therefore. Honey is a natural substance which have crysin. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias.

dan 2:1(B&:@&). substitusi.837–344. jumlah telur.Forum Inovasi Teknologi Akuakultur 2010 FF 69 PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. rasio (1:3) jumlah induk memijah 35 ekor. jumlah telur 237. pemijahan. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). Induk dipelihara dalam 8 buah bak berukuran 1.05) dengan rasio efisiensi proteinnya. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut.05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0. dan daya tetas telur.4 g dengan padat tebar 15 ekor/keramba. guttatus . diameter telur. KATA KUNCI: tepung ikan. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0. Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. daya tetas telur FF 70 SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&). Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22. semua induk secara individu dalam keadaan TKG=O. Lama penelitian berlangsung selama 6 bulan. B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan. jumlah telur. 1:3 (B&:@&).865–335. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap. Pada awal percobaan. diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%. jumlah telur 227. Maros ABSTRAK Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang.05±6. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah.5 m x 1. KATA KUNCI: Siganus guttatus.534–393. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor. Peubah biologis yang diamati meliputi: jumlah induk memijah.5 m x 1. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%.837 butir/ekor. 1:2 (B&:@&). jumlah telur 272. pakan ikan beronang.140 butir/ekor. Siganus guttatus Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.0 m dengan kepadatan 24 ekor/bak.975 butir/ekor. diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor.945–350. rasio (1:2) jumlah induk memijah 30 ekor. tepung rumput laut. diameter telur.333 butir/ekor. jumlah telur 129. S.pada induk beronang.

yaitu menggunakan tingkat teknologi tradisional plus. Pemadatan (flokulasi) N. produksi 78. sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Sebelum penebaran. oculata relatif tinggi (4. Dengan teknologi yang diterapkan.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. Dari pemeliharaan udang selama tiga bulan. dan Wartono Hadie Pusat Riset Perikanan Budidaya. oculata dengan NaOH dosis 75. Gondol ABSTRAK Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Karawang.1 kg dan sintasan 11. Tingkat total ammonium terlarut dalam air laut produksi masal N.2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. yaitu pertambahan berat rata-rata 230 g. kemudian dikeringkan sekitar satu minggu.n pengapuran sebanyak 175 kg/petak. Setelah dua hari. 427. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. rotifer Brachionus rotundiformis. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1. Nannochloropsis oculata. penebaran dilakukan setelah satu bulan dari penebaran tokolan. KATA KUNCI: pakan alami. salinitas rendah. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. oculata relatif rendah (3.3–8.2%.2. Empat petak tambak masing-masing berukuran 3. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah.8 kg dan kelangsungan hidup 100%. dilakukan pengolahan tanah tambak. tokolan. semi-continuous system .04 juta sel/mL dan rotifer 186±5. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34.5–50 m3 dengan rata-rata kepadatan akhir N. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. produksi 81. oculata 13. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. Pemeliharaan dilakukan selama tiga bulan. marine chlorella. Karawang FF 72 PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut.5 g. pada bulan pertama udang tidak diberi pakan.1±0. Penelitian ini dilakukan pada tambak di daerah Betok Mati.6%) dengan rasio DHA/EPA hanya 0. 100. Idil Ardi. KATA KUNCI: udang windu. dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368.Forum Inovasi Teknologi Akuakultur 2010 FF 71 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi.500 m2 digunakan untuk percobaan. Kecamatan Cilebar.

(B) 9%. masingmasing terdiri atas 3 ulangan. Siganus guttatus FF 74 ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA Lies Emmawati Hadie Pusat Riset Perikanan Budidaya. Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Maros ABSTRAK Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi.0 m x 1.2 ± 0.00. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global. Jakarta ABSTRAK Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. Padahal dalam upaya peningkatan produktivitas perikanan budidaya.00. 9%. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia.0 m. dan 13% dalam pakan berpengaruh tidak nyata (P<0. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. pertumbuhan. suhu dipermukaan bumi akan turun secara drastis. ikan langka.00). ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. Pemberian pakan dilakukan 3 kali/hari (pukul 08. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19. yang ditempatkan pada keramba jaring apung di laut. sintasan. dan (C) 13%.3 ± 10. 11.05) terhadap pertumbuhan dan sintasan ikan beronang. Permasalahan ini perlu dipikirkan solusinya. konservasi . Jika tidak ada efek rumah kaca. KATA KUNCI: pemuliaan. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus).79 g/ekor. Wadah penelitian yang digunakan adalah jaring berukuran 1. juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. KATA KUNCI: kadar lemak.0 m x 2. Hasil penelitian menunjukkan bahwa kadar lemak 5%. budidaya. dan 17.Forum Inovasi Teknologi Akuakultur 2010 FF 73 PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus) Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%. plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan.67 cm/ ekor dan bobot 155.

KATA KUNCI: kesesuaian lahan. (metacercaria. (Monogenea). Chiclidae. Dari Sampel yang diperiksa 33. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. perairan Kalukku. parasit .18 ha. Synodontis. kedalaman. budidaya laut. fosfat. KATA KUNCI: ikan hias air tawar. Oleh karena itu. kapiat albino. dan Ichthyophthirius multifiliis (Ciliata). Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. Gyrodatylus spp. dan Tanjung Dapuran. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. Red Fin Albino. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. dan insang. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. Trematoda). cukup sesuai 512. neon tetra. keramba jaring apung. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. nitrat. 98% terinfeksi parasit. salinitas.Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. cat fish. dan Dactylogyrus spp. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. sirip. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. Trichodina sp. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. arah arus. kecepatan arus. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. (Dinoflagelata).41 ha dan kurang sesuai 52. kecerahan. mas koki. perairan Papalan. sympilum dan Characidae. (Copepoda) dan Centrocestus sp. Argulus sp.18 ha yang terdiri dari sangat sesuai seluas 133. penyakit. dan platydoras. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. 2009. dan besi. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. Akhmad Mustafa. Sampel ikan hias antara lain dari golongan cyprinidae. Pulau Kambunong.59 ha. Kualitas air perairan yang diukur adalah: pH. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. Pulau Bekengkeng.

Cd. pestisida. muara Sungai Citarum. KATA KUNCI: logam berat. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. badan air Sungai Citarum dan Sungai Cimeta. batas daerah bahaya. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. residu . Perairan Waduk Cirata sudah tercemar oleh parameter Zn. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat.88 mg/L/kg daging ikan. KATA KUNCI: lahan perikanan budidaya. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. inlet. Piretroid. Cd. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. dan Karbamat.98 ton/bulan. Organofosfat. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS. Contoh yang diambil berupa air. Cd. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. pencemaran.86 ton/bulan. muara Sungai Cisokan. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet. pengambilan contoh. Variabel yang diamati adalah konsentrasi kandungan Pb. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. Tahapan penelitian meliputi: penentuan lokasi. Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. CD.8214 ton/bulan dan 1. preparasi. sedimen (lumpur/tanah). dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. serta debit air dari muara sungai yang masuk ke perairan waduk. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. identifikasi dan analisis data serta pelaporan. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. dan Zn dalam air dan daging ikan. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. zona 2 Purwakarta. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan.

Sukabumi. KATA KUNCI: komunitas. dan Protozoa. (13. A. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa.072–0. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae.marmorata.marmorata dan (4. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. bicolor bicolor. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton. dan sebanyak 150 ekor disimpan dalam alkohol absolut. Bacillariophyceae.5 ind. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies./L dan zooplankton berkisar antara 93. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias.n.65–0. dikelompokan pada jenis A. nebulosa. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. dan Cadas Bodas. indeks dominansi (C) = 0.33. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. Patok Batas. bicolor. selanjutnya digunakan untuk analisa genetik. Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009).75–4887. Dinophyceae. PELABUHAN RATU. A.71–19. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri.75– 993. fitoplankton. KATA KUNCI: Glass eel.83.17-9. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393. dan nilai kemerataan (E) = 0. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR. Copepoda.) DI PERAIRAN SUNGAI CIMANDIRI. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari.7) dikelompokan jenis A. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor.nebulosa .35). dan Desmiceae dari zooplankton ditemukan jenis Rotifer.12–3. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3./L. Pelabuhan Ratu. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi. pada region mitokondria 16SRNA. Ciputri. A. dan 4–6 m. 2–4. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu. Sungai Cimandiri.52) dikelompokan pada jenis A.31. Maleber. Palumbon.75 ind. Cyanophyceae.

Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra. selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). Pemberian pakan awal di mulai saat larva berumur D-2—D-10. dan 1790%) dan C (11. Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan. kuning telur) dan 3 ulangan. rotifer. 21. Gondol **) Mahasiswa Universitas Gadjah Mada. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut. Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya ABSTRAK Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. Osteochilus hasselti. adalah dengan program pemuliaan. 25. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata.17%). Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL). Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan. selanjutnya secara periodik 5 hari sampai dengan D-30.97%) dibanding perlakuan A (10. meristik . terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. Titiek Aslianti*). pola pemangsaan FF 82 KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT Mulyasari*). gonad kerang. Jogjakarta ABSTRAK Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. dan C.. dan 21. dan 17. KATA KUNCI: ikan nilem.99 mm.20 g.10 g. dan sirip anal (anal fin). 27. Dinar Tri Soelistyowati**). Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10.Forum Inovasi Teknologi Akuakultur 2010 FF 81 POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN Afifah*). KATA KUNCI: larva ikan kuwe. namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.94 g. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama.dan inter-populasi ikan nilem di Jawa Barat. sirip dada (pectoral fin). B.01 mm. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin).27 mm. pakan awal. sirip perut (ventral fin). Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan.

Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan.3 g/ekor. ikan patin . Harga pakan hanya Rp 2. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya. Ikan dipelihara selama 40 hari. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. bahan baku lokal.-–Rp 7. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. KATA KUNCI: efisiensi usaha. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%.Forum Inovasi Teknologi Akuakultur 2010 FF 83 EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar.0±0.-/kg. Metode penelitian dilakukan secara studi kasus. Balai Riset Perikanan Budidaya Air Tawar.05).000. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. 19%. KATA KUNCI: nilem.500.-–Rp 3.-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. Jakarta ABSTRAK Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. pakan buatan. dan 20%. serta sintasan ikan. Bogor ABSTRAK Pakan memegang peranan penting dalam budidaya ikan nilem.000. konversi pakan. Ikan uji yang digunakan adalah ikan nilem dengan bobot ratarata 5. pertumbuhan. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. protein. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0. Penelitian dilakukan di Kabupaten Brebes dan Batang.05) yaitu sebesar 1. Bogor. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem.800. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. KABUPATEN BATANG) Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. pakan FF 84 EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI.56%. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari. Parameter yang diamati yaitu pertumbuhan spesifik.

Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2.57±0.7 m. sintasan FF 86 KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON Gleni Hasan Huwoyon. KATA KUNCI: warna. Irin Iriana Kusmini. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir.19.02).8±1.65±0.1 m dan tinggi 0.6±0. Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk.1 m3 (lebar 1. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Bogor ABSTRAK Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari.8 m) dan bak fiberglass berbentuk oval volume 2. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis.7±0. Barbonymus schwanenfeldii. tengadak.02. Gondol ABSTRAK Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg).5 m3 (diameter 2 m dan tinggi 0. Pada beberapa jenis ikan.20). KATA KUNCI: penanganan calon induk. dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi. hitam: 1.Forum Inovasi Teknologi Akuakultur 2010 FF 85 PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN Jhon Harianto Hutapea.4 m dengan panjang 2. Irwan Setiadi. pertumbuhan mutlak (merah: 6. warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. Gunawan. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari. genetika . Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit.1±0. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. hitam: 0.30) dan laju pertumbuhan spesifik (merah: 0. ikan tuna sirip kuning.06. hitam: 5.

R3 = Daun mengkudu + 2. serat kasar. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0.05). Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan. BETN. bahan kering.5% molasses + 0. gula. Berdasarkan hasil penelitian. R4 = Daun mengkudu + 2.01).00% khamir laut.5% molasses + 0.05). Setelah kering.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan. Setelah 5 hari dipanen. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. protein kasar. dan energi di antara perlakuan berbeda nyata (P<0. silase. Hasil penelitian menunjukkan bahwa: pH. Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator. Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau. E = Daun mengkudu + 2.5% molasses + 0. pupuk . urea. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl.06% khamir laut. lemak kasar. daun mengkudu.04% khamir laut. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia). dan TSP.5% molasses + 0. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu. B = Daun mengkudu + 2.02% khamir laut. dan abu di antara perlakuan tidak berbeda nyata (P>0. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2.08% khamir laut. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu. Jepara. KATA KUNCI: khamir laut.5% molasses + 0.

Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I. CBIB. ditebari bandeng (10. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. rumput laut.1 ton/ha/16 mg menjadi 1./ha) dan petak II : bandeng (3. Erfan Andi Hendradjat. Sulawesi Selatan.5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar. penggunaan sarana produksi yang ramah lingkungan.48 kg/ha.000 ekor/ha) dan rumput laut (1 ton/ha). Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59. di mana termasuk cara budidaya udang. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1.73% dengan produksi sebesar 217. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara.000 ekor/ha. Perlakuan B. Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40. KATA KUNCI: biofilter. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu. KATA KUNCI: udang windu.46% dengan produksi udang windu sebesar 249. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I.000 ekor/ha) dan rumput laut (1 ton/ha).000. serta manajemen pakan dan air secara benar. Pada akhir penelitian diperoleh sintasan 63. rumput laut (2 ton/ha) dan tiram (20. petak I ditebari bandeng (10.000 ekor/ha).-/musim tanam dengan B/C rasio 2. udang windu. BL542 bulan III.977. rumput laut (2 ton/ha) dan tiram (40. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. MY1112 bulan II. KABUPATEN TAKALAR Muharijadi Atmomarsono.07.000 ind. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. bandeng (3. tambak marjinal .000 ekor/ha).000 ind/ha) dan petak II. Brata Pantjara. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10.

terutama salinitas yang mencapai 56 ppt. sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0.7 kg/ha/90 hari). BL542 bulan III. NH3. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah. diikuti perlakuan kombinasi probiotik A (50. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%. menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. PO4.05% dan 298. Nurbaya.8% dan 228. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. Penelitian dilakukan di laboratorium basah. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%.7 kg/ha/90 hari). sintasan. Maros. (D2) kontrol 2. (C2) probiotik komersial dengan dosis pakan 50%. dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan NH3 selama penelitian relatif lebih tinggi pada perlakuan yang tidak menggunakan probiotik dengan dosis pakan 100%. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial. air laut salinitas 28 ppt sebanyak 15 L. tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani. Penelitian dilaksanakan selama 90 hari. dan total Vibrio. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian.7 kg/ha/90 hari). dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari.05) pada akhir penelitian. NO3. Pengamatan sintasan udang windu dilakukan pada akhir penelitian.35% dan 448. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. dan C) Kontrol (tanpa probiotik). udang windu . production. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: probiotic bacteria. Balai Riset Perikanan Budidaya Air Payau. B) Pergiliran probiotik BT951 bulan I. NO2. Sintasan udang windu tertinggi didapatkan pada perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60. MY1112 bulan II. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masing-masing 3 kali dan lama pemeliharaan 10 minggu. Muliani. total bakteri. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%.11%. survival rate. Oleh karena itu. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. Nurbaya. dosis pakan. KATA KUNCI: probiotik. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. (C1) probiotik komersial dengan dosis pakan 100%. kandungan BOT di atas 30 mg/L.

000 ek/ha bandeng) menunjukkan hasil yang terbaik. rumput laut. dan pertumbuhan udang serta aman bagi konsumen. produksi. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1. 31) yang ditebar pada masing-masing tambak adalah 10. Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha). Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari. Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu. KATA KUNCI: probiotik.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto. Sampling dilakukan 30 hari sekali selama 90 hari. sintasan. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. namun belum mampu menurunkan kandungan amoniak dalam media budidaya.0%. Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau.9 kg dan secara finansial memberikan keuntungan sebesar Rp 11.-/ha /90 hari. udang windu.572. Tjaronge. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an.500 m2 dengan kedalaman 80 cm. Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari. produksi . Sintasan dan produksi udang windu dan ikan bandeng masingmasing adalah 66. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0. Maros selama 90 Hari. masing-masing terdiri atas 2 ulangan. Selama pemeliharan tidak diberi pakan. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: multitropik. M.5% dengan produksi 19.8% dan 63. serta 99. Tokolan udang windu (PL.masing-masing dengan dua kali ulangan.4 ha. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha). baik pada air maupun pada dasar tanah tambak.000 ekor/ha).000 ekor/ha (1 ekor/m2). Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok. rumput laut dan ikan bandeng adalah perlakuan B (10. Oleh karena itu. Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus).000. dan kontrol (tanpa aplikasi probiotik). kesehatan.9% dan 33.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya. ikan bandeng. Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu.7 kg.

dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia.1%) serta tanpa transfeksi (49. Sukenda**).0%). termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. gen anti virus. Ketika ditantang dengan WSSV. ekspresi gen. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. 4 hari. yang sampai saat ini belum bisa diatasi secara secara tuntas. danAndi Tenriulo*) **) **) Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. KATA KUNCI: ekspresi.05) dibandingkan dengan kontrol. transfeksi. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. Maros Departemen Budidaya Perairan. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. Promoter dikatakan aktif apabila gen penanda dapat terekspresi. KATA KUNCI: promoter. udang windu .3% dan tidak berbeda nyata (P>0. Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. Alimuddin**). Selain itu. Syarifuddin Tonnek. Komar Sumantadinata**). Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. IPB. 3 hari. Bunga Rante Tampangallo. 2 hari. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. EGFP. Fakultas Perikanan dan Ilmu Kelautan. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. 12 jam. gen PmAV menunjukkan respons meningkat (up-regulation). Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. 1 hari. uji tantang. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda.Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. Aan Fibro Widodo. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR. udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo.

hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. White Spot Syndrome Virus (WSSV). Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. dan disertai ulserasi lapisan mukosa epitel. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. serta berpeluang untuk digunakan secara langsung di lapangan. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. monodon dengan melihat gejala klinis dan studi histopatologi. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. Nurhidayah. sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. Penelitian dilakukan untuk membuat. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. KATA KUNCI: White Spot Syndrom Virus (WSSV). Teknik serologi. antibodi monoklonal . dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). Antibodi monoklonal memiliki kespesifikan yang tinggi. menyeleksi.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. Setelah pengujian. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. khususnya ELISA. serta epidemi penyakit di lapangan. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. KATA KUNCI: ELISA. karena relatif mudah dan murah. cepat dan akurat. Pewarnaan jaringan menggunakan Hematoxilin eosin.

0328 mg/L) pada akhir penelitian. namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan.234). Budidaya ini berkembang dengan teknologi intensif.05) dengan perlakuan A (1. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei). kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11. sintasan. Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12).258). sintasan (90. Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan.9).114±0.05) terhadap pertumbuhan. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%. dan pemeliharaan berlangsung 80 hari di tambak. Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau.45 g/ekor dan ditebar kepadatan 100 ekor/bak. rasio konversi pakan dan produksi udang vaname. feed. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak. dan (B) pembesaran dengan tebar tokolan (PL 27).31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya.257±0.Setiap perlakuan dengan 2 ulangan. Instalasi BRPBAP.7 m sebanyak 9 buah. Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0. tokolan. namun terbatas pada golongan masyarakat menengah keatas (padat modal).Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun.120). Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei). Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi. Takalar. sintasan. Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6. 829. sintasan ( 92. dan kepadatan benur dan tokolan adalah 50 ekor/m2.51).034) berbeda nyata (P<0.549±0. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%. benur. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). RKP pada pembesaran udang vaname teknologi intensif. produksi (1831. KATA KUNCI: udang vaname.0±149. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. and L vannamei .18235 mg/L) dibandingkan dengan perlakuan A (0. Selama pemeliharan 85 hari.masing-masing perlakuan diulang tiga kali.5±88.096±0. karena berpengaruh terhadap pertumbuhan. Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah.. menggunakan 4 petak masing masing berukuran 4.085±0.102 CFU/mL. budidaya udang intensif.000 m2/petak.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10. produksi (2087.048). Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0. KATA KUNCI: growth. Riset ini dilaksanakan di tambak Punaga.83±8. dan efisiensi biaya produksi. survival rate.

2 kkal GE/g). Hidayat Suryanto Suwoyo. konversi pakan (FCR).7%–1130.05). Sintasan antara 73. suhu 28°C–30°C. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). C/P rasio 14. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4.1 kkal GE/g). Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon).9%–79.464 mg/kg tubuh/jam. kecernaan total dan kecernaan protein masingmasing 26. B (protein 31%.71%–22.5 g/ekor dengan kepadatan 10 ekor per akuarium.00. 5 kali sehari pada pukul 07. retensi protein (RP). FCR 1.39%.1 g. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI .00. Penelitian dilakukan di tambak percobaan Punaga Takalar. Ing Mokoginta**) dan Dedy Yaniharto***) *) **) Balai Riset Perikanan Tawar.4–2. Selama pemeliharaan. ekskresi amonia dan stabilitas pakan.000 m2. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an. pertumbuhan.8% dan 11.8 kkal GE/g).5%. dan pH 8. dan 23. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7. sedangkan ekskresi amonia antara 1.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. Pakan diberikan at satiation. fotoperiod dibuat 12 jam terang–gelap. Bogor Departemen Budidaya Perairan. C (protein 33%. dan E atau komersial (protein 40. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname. Litopenaeus vannamei Deisi Heptarina*).029–2.2%.intensif. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0.9%–68.5%–36. D (protein 35%. Kisaran nilai masing-masing parameter tersebut adalah. C/P rasio 15.5%–62. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu. Kemudian dilanjutkan uji kecernaan. Perlakuan terdiri atas pakan A (protein 29%. namun kurang diimbangi dengan penyediaan pakan yang sesuai.69%. retensi lemak (RL). Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media. PR 532. M.00.2% serta WS berkisar antara 49. kecernaan total. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0.5 kkal GE/g).6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik.INTENSIF DI TAMBAK Abdul Mansyur.4%.0–8. C/ P rasio 16. JKP 59. RL dan RP masing-masing 26. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan. laju pertumbuhan harian. sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya. Namun. Jakarta Utara. K ATA KUNCI: protein optimal.00.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2. C/P rasio 11.05) terhadap pertambahan berat mutlak. produksi. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB). 11. Agus Suprayudi**).7%. C/P rasio 13.6 kkal GE/g). Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum.5. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0. 19. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. sintasan. Bobot yuwana yang ditebar rata-rata 0.3%–86. Fakultas Perikanan dan Ilmu Kelautan. 15. sintasan.4%–94. yuwana. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13. jumlah konsumsi pakan (JKP). salinitas 24–25 ppt.00. kecernaan protein.4. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0.05).1% dan 65. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH.2–78. pertumbuhan relatif (PR). Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%. Litopenaeus vannamei . rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi .

Haryanti*). Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. KATA KUNCI: Litopenaeus vannamei. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. and SP) pada udang yang sehat. Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. Lila Gardenia. Gondol Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. IMNV dan PvNV . Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. SOD. hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). dan Rustidja**) *) **) Balai Besar Riset Perikanan Budiaya Laut. dan SP mampu berdiri sendiri. Namun demikian. SOD. dan moribund. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. protein haemolimph dan ekspresi enzim (GPI. TSV. PGM. EST. SPF. L. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. SOD.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. toleran. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terus-menerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . IHHNV. Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. belum dapat diyakinkan secara pasti bahwa ekspresi EST. toleran dan terinfeksi TSV. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. Untuk mengetahui jenis virus yang menyerang udang tersebut maka.Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. toleran. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. KATA KUNCI: enzim. Taura Syndrome Virus. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). SOD. Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. MBV. WSSV. EST. Semua gejala tersebut diduga akibat adanya serangan virus. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. PGM. dan SP.

25 g. C) 2J : 2 B. yang dilakukan selama 5 bulan. 0. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. pertumbuhan. yang meliputi pertambahan panjang dan bobot. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. B) 1 J : 2 B. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). 2%. Imron. beserta persilangannya. pendederan II.5% berturut-turut untuk perlakuan A.31 mm. khususnya rasio jantan-betina.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. Asahan. dan 0. 25%. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro.5%. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal. pemijahan. rasio kelamin. dan tidak berbeda nyata antar perlakuan. berturut-turut 0. dan D) 2 J : 4 B. C. diikuti perlakuan D. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji.25 m2/ekor induk. berturut-turut 27%. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan. Penelitian dilakukan dengan rancangan acak lengkap. dan pembesaran. diberikan pada pagi dan sore. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. 0. A dan B. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.21 g. KATA KUNCI: genetik. dan 13%. Barito. KATA KUNCI: mortalitas.42 mm. Romy Suprapto. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. yaitu 0%. 6. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. 0. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. dengan sistem resirkulasi. Sebagai perlakuan adalah rasio jantan-betina. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. Musi. Penelitian meliputi pembenihan. berdasarkan nilai heterosis yang didapat. dan 9. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. Namun demikian. B.27 mm.20 g. dan D. reproduksi. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. udang galah . Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. pendederan I. Ciasem. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. 0. persilangan. Pada sistem tersebut kematian induk relatif rendah. dengan lama pengujian 8 minggu.

6±21. 4.0%). desinfektan. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C. B. Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰. dan D.4%) diikuti oleh populasi hasil crossbreeding (57. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah. crossbreeding.4 mm) dan populasi inbreeding (21.0.00% dan 3.8±1. namun tidak berbeda nyata (P>0.8±1. 37. sirih. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan budidaya dapat dioptimalkan.93.8±7.0%) dan populasi inbreeding (25.4 mm). Fakultas Perikanan dan Ilmu Kelautan. **) Jurusan Budidaya. Pada karakter pertumbuhan. . (0 cfu/mL). C.83% dan 3. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan. Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan. yaitu inbreeding. Tiga tipe persilangan. 45. (8. B (perendaman dalam larutan formalin 250 mg/L). C.92.5%. yaitu A. Sukamandi. (0 cfu/mL). Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan. Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah. larva udang galah.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. Hewan uji yang digunakan adalah larva udang galah umur dua hari. Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*). keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Perlakuan yang diberikan yaitu A (kontrol. KATA KUNCI: bawang putih. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan D (perendaman dalam larutan ekstrak bawang putih). merupakan langkah bio-security. 52.5% dan 3. keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24.05) terhadap kelimpahan bakteri.7 mm) diikuti oleh populasi hasil outbreeding (21. tanpa penambahan desinfektan). Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74. Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan. C (perendaman dalam larutan ekstrak daun sirih). Harry Wuwungan**). dengan nilai sebagai berikut: A.0±1. 47. formalin. Hasil penelitian menunjukkan bahwa pada karakter sintasan. dan D. outbreeding. B. sintasan (SR) dan perkembangan larva (LSI).93.5±28.4 x 103 cfu/mL) .5 x 103). Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi. KATA KUNCI: inbreeding. Dinar Soelistyawati**). (4.

Forum Inovasi Teknologi Akuakultur 2010

K 21
VARIASI FENOTIP UDANG GALAH (Macrobrachium rosenbergii) DARI POPULASI PERAIRAN KARAWANG, PELABUHAN RATU, DAN BONE
Eni Kusrini*), Lies Emmawati**), dan Wartono Hadie**)
*)

Balai Riset Budidaya Perikanan Ikan Hias, Depok
*)

Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang), Pelabuhan Ratu, dan Bone. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air,Karawang dengan Pelabuhan Ratu lebih dekat. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu.
KATA KUNCI: udang galah, populasi, jarak genetik

K 22
PEMELIHARAAN LARVA UDANG PAMA (Penaeus semisulcatus) DENGAN KEPADATAN BERBEDA
Muslimin, Sulaeman, Andi Tenriulo, dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. semisucatus) dengan kepadatan berbeda. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau, Maros dengan panjang awal mysis adalah 100-190 milimikron. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm, diameter 15 cm dan Volume 3 L. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm, lebar 40 cm, dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut, maka ditambahkan pemanas/heater suhu 30°C. Hewan uji ini ditebar dengan kepadatan berbeda. Perlakuan yang diujicobakan adalah: A. Kepadatan larva 25 ekor/L; B. Kepadatan larva 50 ekor/L; C. Kepadatan larva 75 ekor/L; D. Kepadatan larva 100 ekor/L; E. Kepadatan larva 125 ekor/L; dan F. Kepadatan larva 150 ekor/L. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap, di mana masing-masing perlakuan di ulang tiga kali. Jenis pakan yang diberikan berupa pakan alami chetoceros, artemia, dan pakan buatan. Pemberian pakan dilakukan setiap pagi dan sore (08.00 dan 16.00 wita). Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0,05) terhadap laju sintasan dan pertumbuhan larva udang pama. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%, (B) 32%, (C) 31%, (E) 24%, (D) 16%, dan (F) 10%.
KATA KUNCI: kepadatan, larva udang pama, sintasan dan pertumbuhan

Forum Inovasi Teknologi Akuakultur 2010

K 23
ESTIMASI PADAT TEBAR UDANG PAMA Penaeus semisulcatus BERDASARKAN TINGKAT KONSUMSI OKSIGEN
Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1.446–6.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan. Wadah percobaan yang digunakan adalah bentik jar (chamber), yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. Oksigen terlarut diukur dengan alat pengukur O2 (TPSTM Model WP-82 DO meters). Data laju respirasi selama proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. Ver.1.2. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan, dengan kisaran tingkat konsumsi oksigen 0,26–7,27 mg/g/jam. Kisaran kelarutan oksigen pada awal penelitian adalah 3,14–7,9 mg/L dan setelah 1 jam pengukuran 0,03–0,48 mg/L dan kontrol tetap berkisar 4 mg/L. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4,0235 g adalah 15,65 g/m3.
KATA KUNCI: udang pama, padat tebar, estimasi

K 24
POLIKULTUR KEPITING BAKAU (Scylla serrata) DAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN METODE TEBAR YANG BERBEDA
Sulaeman, Aan Fibro Widodo, dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan, akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP), BRPBAP, Maros. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0,18±0,03 g, panjang karapas 4,6±0,1 mm dan lebar karapas 5,9±0,1 mm. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar); B (metode gantung); dan C (gabungan antara keduanya). Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0,05) terhadap pertumbuhan bobot mutlak, bobot harian, pertumbuhan panjang dan lebar karapas mutlak dan harian, tetapi berpengaruh nyata (P<0,05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66,96 %; 58,17 kg/250 m2, disusul perlakuan C: 64,06; 44,95 kg/250 m2 dan terendah pada perlakuan B: 60,58%; 40,52 kg/250 m2.
KATA KUNCI: kepiting bakau, metode sebar, polikultur, rumput laut

Forum Inovasi Teknologi Akuakultur 2010

K 25
LAJU PEMANGSAAN LARVA KEPITING BAKAU (Scylla serrata) TERHADAP PAKAN ALAMI ROTIFERA (Brachionus SP.)
Aan Fibro Widodo, Sulaeman, dan Muslimin Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp.). Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros, Sulawesi Selatan. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau, yaitu: A (625 ind./mL); B (500 ind./mL); C (375 ind./mL); D (250 ind./mL); dan E (125 ind./mL). Peubah yang diamati adalah laju pemangsaan, sintasan, dan peubah kualitas air. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0,05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. Hasil terbaik diperoleh pada perlakuan A, yaitu kepadatan rotifera 625 ind./mL dengan laju pemangsaan sebesar 259,1667 ind./larva/jam dan sintasan 86,0%.
KATA KUNCI: kepadatan, kepiting bakau, laju pemangsaan, rotifera, zoea

K 26
ANALISIS DIATOM EPIPELIC SEBAGAI INDIKATOR KUALITAS AIR DAN TANAHUNTUK BUDIDAYA UDANG
Supono Budidaya Perairan Universitas Lampung

ABSTRAK
Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Karena hidup di dasar tambak, jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang, yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang. Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. Selain diatom epipelic, data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0,75), TOM (rs = 0,71), dan nitrat (rs = 0,66), sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0,72), kandungan liat (rs = 0,65), dan kandungan bahan organik (rs = 0,62).
KATA KUNCI: diatom epipelic, tambak udang, kualitas air, kualitas sedimen

72). Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot.Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini. Dianalisis dengan Rancangan Acak Lengkap (RAL).6-71. simpangan baku. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. namun kemampuan produksi para pembudidaya hanya sampai 4 inci. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci. Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. Pertambahan bobot (71. Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci.6±10. ragam. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2.74) dan panjang (7.0±0. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6. benih. KATA KUNCI: Cherax quadricarinatus. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang. dan panjang total). pertumbuhan. Gleni Hasan Huwoyon. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda.9 g. dan panjang total tiap individu.47) terbaik adalah benih lobster air tawar asal Tangerang.0 cm dan adanya pertambahan bobot sebesar 58.6-7. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. panjang standar. dan Tulung Agung). panjang standar. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar. lokasi .9±9. Bogor. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan.

73 g. (D) Kombinasi Gracilaria sp. (13.1 ± 4. masing-masing 58. pakan (B) dengan R² = 0. 38.92 g dan 219.31 m.06 µg/hari).05 mm dan 10. E.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON. (P<0.99 mm dan 36.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria.44 µg. (B) Ulva sp.00 µm dan 38. + Sargassum sp.52 µg/hari) dan terendah pemberian pakan Sargassum sp.82 µg/hari).. Gracilaria. dan Sargassum sp. pakan (B)= E.9 ± 1.50 g dan 217. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir. KATA KUNCI: Haliotis squamata.68 µg/hari). + Ulva sp. kombinasi Gracilaria sp. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan.19 ± 6.44 µg.23 g dan 121. (13.44 ± 102. Ulva. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali. dan pakan (C) dengan R² = 0. 73.05) antar perlakuan. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30. yaitu: (A) Gracilaria sp. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi.05).17 ± 25.26 ± 10. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Sargassum. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut.37 mm. cottonii 37.44 µm dan 65. (C) Sargassum sp. lebar dan bobot cangkang.613. Riani Rahmawati. Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp...73±2. (rasio 1:1:1). Ibnu Rusdi.06 ± 170.80 sampai 31. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A. Bambang Susanto. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir. B. serta pakan (C)= kombinasi Gracilaria + E.06 g. aplikasi teknologi pembesaran . Ulva sp.16 g dan -86.59±2. sangat sesuai dalam memacu pematangan gonad induk abalon H.58 m x 0. dilakukan dengan menerapkan 4 perlakuan pemberian pakan. cottoni. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp. + Sargassum sp.39 g.0 ± 0. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit. cottonii : 40.891.02 g.44 µg serta 92. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata. + Ulva sp.39 m x 0. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0. dan kombinasi keduanya. KATA KUNCI: abalon Haliotis squamata. (7.17 ± 2.854. dan C berturut-turut adalah 120. + Sargassum sp.89 µm dan 38. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m. yaitu pada perlakuan pemberian pakan Gracilaria sp.56 ± 48. Riani Rahmawati.18 mm dan 7. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga. + Ulva sp. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto.03 ± 1. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon. I Nyoman Adiasmara Giri. squamata. (-5.39 mm dan 10.

Abalon diberi pakan rumput laut Gracilaria sp.13) lebih tinggi dibandingkan dengan induk asal Bali (0. Kepadatan awal benih abalon adalah 450 ekor per wadah. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. Nilai variasi genetik induk abalone asal Banten (0. dan Ulva sp. dan Ulva sp./Ulva sp. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. 60/40% memberikan pertumbuhan abalon terbaik. KATA KUNCI: abalon Haliotis squamata. dengan proporsi yang berbeda Gracilaria sp. tinggi 22 cm. Gondol. dan 60/40% (C) sebagai perlakuan.2 g dan panjang cangkang 2.52.06). offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. mengingat permintaannya yang cukup tinggi. wild. Ibnu Rusdi. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. Est-3*. penjarangan . Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. Sampel yang digunakan berasal dari Bali dan Banten. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut. Est-1*. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. Untuk itu. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. 80/20% (B).7 cm. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: allozyme. proporsi pakan. Gpi*. Est-4* dan Cah-3*. peluang pasar serta teknik budidayanya yang sederhana.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin. Hirmawan Tirta Yudha. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. genetic monitoring. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. Est-2*. Setiap perlakuan terdiri atas 2 ulangan. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. Tatam Sutarmat. dengan bobot awal 2. Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan. pembesaran. 100/0% (A)./Ulva sp. Pakan dengan proporsi Gracilaria sp. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan.6-3. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air.

Forum Inovasi Teknologi Akuakultur 2010

M 05
ISOLASI, KARAKTERISASI, DAN UJI PATOGENISITAS BAKTERI VIBRIO YANG DIISOLASI DARI LARVA ABALON SAKIT DI HATCHERI
Zafran, Indah Mastuti, dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. Karena itu, tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut, Gondol, Bali. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar, yaitu media spesifik untuk bakteri Vibrio. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0,05 µm). Setiap perlakuan diulang 3 kali. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1, isolat-2, dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13,33%; 18,33%; dan 21,67%; sedangkan mortalitas pada kelompok kontrol hanya 3,33%.
KATA KUNCI: abalon, Haliotis squamata, vibriosis, Vibrio cincinnatiensis, uji patogenisitas

M 06
PENDEDERAN TIRAM MUTIARA (Pinctada maxima) DENGAN PERBEDAAN UKURAN TEBAR AWAL
Sudewi, Apri I. Supii, dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan. Namun, masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan. Perlakuan yang diberikan adalah ukuran tebar 3,44±0,44 mm (perlakuan A); 10,85±0,1 mm (perlakuan B); dan 20,36±0,55 mm (perlakuan C). Parameter yang diamati adalah laju pertumbuhan harian dan sintasan. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0,44±0,01 mm/hari (perlakuan A); 0,46±0,03 mm/hari (perlakuan B) dan 0,30±0,01 mm/hari (perlakuan C). Laju pertumbuhan lebar cangkang 0,37±0,01 mm/hari (perlakuan A); 0,4±0,03 mm/hari (perlakuan B) dan 0,27±0,00 mm/hari (perlakuan C). Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0,05) dibandingkan dengan perlakuan C. Sintasan yang diperoleh untuk perlakuan A, B, dan C berturut-turut 37,16%; 71,69%; dan 46,42%. Oleh karena itu, untuk memperoleh pertumbuhan dan sintasan yang baik, penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm.
KATA KUNCI: Pinctada maxima, pertumbuhan, sintasan, ukuran awal spat

Forum Inovasi Teknologi Akuakultur 2010

M 07
KAJIAN POTENSI KELAUTAN UNTUK BUDIDAYA TIRAM MUTIARA (Pinctada maxima) DI WILAYAH PESISIR KABUPATEN JEMBRANA-BALI
Apri I. Supii*), Ida Ayu Astarini**), dan Sudewi*)
*)

Balai Besar Riset Perikanan Budidaya Laut, Gondol
**)

Fakultas MIPA Universitas Udayana

ABSTRAK
Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan, pada tingkat nasional, regional maupun lokal. Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Berdasarkan hasil pengkajian, secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari, Sumber Sari, Teluk Awen, dan Teluk Rabu. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara, akan tetapi jika diinginkan, budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. Pantai Pengambengan khususnya, tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai.
KATA KUNCI: potensi kelautan, tiram mutiara, Pinctada maxima, Jembrana

Forum Inovasi Teknologi Akuakultur 2010

LL 1
PERFORMANSI PERTUMBUHAN DAN KANDUNGAN KERAGINAN RUMPUT LAUT (Kappaphycus alvarezii) DENGAN APLIKASI METODE BUDIDAYA VERTIKULTUR
Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Produksi rumput laut ditargetkan meningkat dari 2,6 juta ton per tahun sekarang ini menjadi 7,6 juta ton per tahun pada 2014, sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. Umumnya pembudidaya rumput laut, Kappaphycus sp. mengaplikasikan metode long line, di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut, Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan, yakni 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m, di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masing-masing dengan 3 kali ulangan. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver. 3,1. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut, K. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m dari permukaan perairan. Oleh karena itu, metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468,75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan.
KATA KUNCI: Kappaphycus alvarezii, pertumbuhan, kandungan keraginan, vertikultur

LL 2
PERBANYAKAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN KULTUR JARINGAN MENGGUNAKAN WADAH YANG BERBEDA
Siti Fadilah, Rosmiati, dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. verrucosa. Rumput laut dikumpulkan dari Kabupaten Brebes, Jawa Tengah. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0,1%. Eksplan diinokulasi ke dalam media cair yang diperkaya PES. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker, sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu. Pengamatan panjang tunas, jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81,70%) daripada botol (90,75%). Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2,40 mm pada stoples dan 2,42 mm pada botol. Sedangkan jumlah tunas dalam stoples (7,50) lebih banyak dibandingkan dalam botol (7,03). Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26,70 dibandingkan dalam botol yang hanya 6,20.
KATA KUNCI: botol, kepadatan eksplan, stoples

Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. Rosmiati. hibridisasi.5 mili/second.e dan stabil setelah jam ke9 sampai ke-12 s. promoter. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. KATA KUNCI: mutu genetik. ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT. Alimuddin**). Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) .e. Alias L.e). Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas.Irvan Faizal****). Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV. daya tahan penyakit. Makassar **) Departemen Budidaya Perairan-FPIK. b-actin. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. persentase sel berpendar rata-rata 10%. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%–10%. Pola ekspresi keempat promoter relatif sama. KATA KUNCI: Kappaphycus alvarezii. fusi protoplas . Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. kappaphycus alvarezii. Rajamuddin*).Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT. Utut Widyastuti***). panjang kejutan: 0. Fadilah. mulai berpendar jam pertama – kedua setelah elektroporasi (s. puncak jam ketiga – keenam s.1 second. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12. Balai Riset Perikanan Budidaya Air Payau. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik. dan St. jumlah kejutan: 4 kali dan interval kejutan: 0. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. Sebagai tahap awal dalam rangka produksi rumput laut transgenik. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. Kappaphycus alvarezii Muh. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA.BPPT. ZPT. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. transgenesis. Keratin dan b-actin. cytomegalovirus/ CMV. dan sumber karbon yang berbeda. Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid.

tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. I Nyoman Radiarta. Pada umumnya. SIG. Pandeglang . usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. KATA KUNCI: rumput laut. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. Rekomendasi pencegahan penyakit. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. Untuk itu. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. dan status wilayah kawasan. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. pembudidaya rumput laut. khususnya di Kecamatan Sumur. Erlania. taman nasional ujung kulon. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. Kabupaten Pandeglang. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). konservasi dan wisata). rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. kondisi sosek-ekonomi. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air.

pada rasio IAA: kinetin (0.5:0. Tahap (2) adalah regenerasi massa sel embriogenik somatik. 1.8%. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh. embriogenesis somatik . Rajamuddin*). KATA KUNCI : Kappaphycus alvarezii. Makassar **) Balai Riset Perikanan Budidaya Air Payau.1 mg/L) dengan konsentrasi agar (0. dan 2.8%).5%). ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. 0. 1. Pada media cair. Pada tahap induksi kalus. dan 1.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0. kalus.2 mg/L) dengan konsentrasi agar media induksi (0. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0.4%.6% dan 0. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%. embrio somatik. Andi Asdar Jaya*). Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm).8% dan 1. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati.0:0.0:0.6%. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau. adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio. morfologi. 0.4 mg/L. Pemeliharaan dilakukan selama 8 minggu.0%.0% menghasilkan persentase induksi kalus tertinggi (90%).0:1. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. Perkembangan sel-sel embriogenik diamati pada kultur cair. Ridwan*). namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan. dan 0. Alias L.6%. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0.0 mg/L. KATA KUNCI: keragaman.0 mg/L. pengggantian media dilakukan setiap minggu dengan komposisi media yang sama.1:1. 0.5 mm dapat dicapai dalam satu bulan kultur. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid. Rosmiati. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan. Pada tahap regenerasi massa sel embriogenik.0 mg/L.

dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). uji organoleptik .780. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. crakers. A-2 (30% tepung rumput laut dan 70% tepung terigu). Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn 85%. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. KATA KUNCI: rumput laut. KATA KUNCI: strategi pengembangan. produksi pada tahun 2008 sebesar 750 ton. Parameter mutunya adalah kandungan zat gizi (air. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. gizi. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. kadar abu. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. rasa. Hasnawi. aroma. protein.24 ha. Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. dan berpengaruh nyata terhadap rupa dan tekstur. dan karbohidrat) dan uji organoleptik. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. 01-2973–1992 dan SII 0177–1990. denga metode budidaya tali panjang (long line). rumput laut. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. Mery Sukmiwati. A-1 (15% tepung rumput laut dan 85% tepung terigu). Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. lemak. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam program-program pokok pengembangan.143. abu.13 ha dan 3.

SPOS.09 dan 90. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra ALOS AVNIR-2 akuisisi 28 Juli 2009. Kebutuhan kapur didasarkan pada nilai SPOS tanah dengan mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur.29 ton/ha dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju.884 g/cm3 dan SPOS tanah berkisar antara 0. SKCl.32 dan 113.02% serta 44. bahan organik dan berat volume tanah.614%. Rachmansyah. analisis spasial.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI SPOS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. Penelitian ini bertujuan untuk melakukan analisis spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG). Maros ABSTRAK Kabupaten Mamuju.30 dan 1. Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut.2 digunakan untuk pembuatan peta distribusi SPOS tanah. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia.60 dan 36. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. Maluku .02.15 dan 19. SIG. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan. Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet. inderaja. Peubah kualitas tanah yang diukur adalah: pHF. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei. pirit. Program ArcView 3. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai SPOS tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat dan berkelanjutan.78% sehingga memiliki faktor konversi berturut-turut sebesar 2. Oleh karena itu. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. Kebutuhan kapur CaCO3 untuk tambak di Kabupaten Mamuju berkisar antara 1. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0. namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta.36 dan 3. Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95. tambak. SP. infrastruktur (jalan) dan sebaran penduduk. S POS . Kapur pertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur. klorofil-a dan suhu permukaan laut). tanah. ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan.28% dengan rata-rata 7. Adang Saputra. pHFOX. KATA KUNCI: kebutuhan kapur.71 g/cm3 dengan rata-rata 0. KATA KUNCI: budidaya laut.

Hatim Albasri**).Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). tambak terbengkalai. Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. bandeng LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. KATA KUNCI: produktivitas tambak. Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. udang dan bandeng. rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara. ikan patin. Kabupaten Brebes . Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. Adang Saputra**). Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). Evi Tahapari***). Sukamandi *) ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. analisis location quotient. dan Sularto***) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Jakarta **) Pusat Riset Perikanan Budidaya. udang. analisis komoditas unggulan dan andalan.400 m2 selama 3 bulan pemeliharaan. Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. analisis komoditas. KATA KUNCI: minapolitan. Di samping itu. peningkatan pendapatan. Introduksi kaji terap dilakukan dilahan seluas 2. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. dan analisis usaha perikanan. Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. konversi pakan serta pertumbuhan yang cukup baik. Wartono Hadie**). rumput laut. Jakarta **) Pusat Riset Perikanan Budidaya. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan.

TAA. TPA. Pada kedalaman 0. sagu. PO4. Fe. Al dan tekstur. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. sagu (Metroxylon sagu). pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent. nipah. Kabupaten Mamuju . Marsambuana Pirzan. sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman.75 m. paku laut (Acrostichum aureum).75 m tanah vegetasi api-api. rumput. Oleh karena itu. N-total. A. campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah. Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. pirit. SP. bakau. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. tanpa vegetasi. sedangkan yang dianalisis di laboratorium adalah pHKCl.50-0. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). SPOS. bakau. penutup/penggunaan lahan. TSA. dan Kamariah Balai Riset Perikanan Budidaya Air Payau. pHFOX dan potensial redoks. karbon organik. SKCl.50-0. padi (Oryza sativa). rumput. KATA KUNCI: keragaman. pHOX. bakau (Rhizophora apiculata).Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. nipah. nipah (Nypa fruticans). kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. pesisir. masingmasing pada kedalaman tanah 0-0. Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. tanah. rumput. Hasil penelitian menunjukkan bahwa. Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. Pada kedalaman 0-0. kelapa (Cocos nucifera).25 m tanah jenis penutup/penggunaan lahan api-api. Kualitas tanah yang diukur langsung di lapangan adalah pHF.25 m dan 0.

Pada umumnya yang tergolong sangat sesuai (114. walaupun dengan model regresi yang berbeda. Akhmad Mustafa.077 ha.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. tersebar di wilayah pesisir Kecamatan Sungai Pinyuh. Mempawah Hilir dan Mempawah Timur. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. Data sekunder yang diperoleh berupa data iklim. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan. Oleh karena itu. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. pH. dan fosfat. kualitas air. amonia.986 ha). cukup sesuai (168. oksigen terlarut. Data lapangan (fisiko-kimia air dan tanah). nitrit. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. data sekunder. dan bahan organik total. salinitas. pH. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia. dan data citra satelit digital. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50.272 ha). citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. KATA KUNCI: kesesuaian lahan. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik. Sulawesi Barat . nitrat. tambak. amonia. KALIMANTAN BARAT Utojo. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat. dianalisis secara spasial dengan metode PATTERN menggunakan SIG. sedangkan yang kurang sesuai (213. tambak. nitrit. sedangkan peubah bebas adalah suhu. terdapat di Kecamatan Segedong dan Siantan. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497.819 ha). Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. KATA KUNCI: klorofil. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). fosfat. Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil.000. Sungai Kunyit.047 dengan rata-rata 6.000. nitrat.046 dan 22.398 µg/L.

BRPBAT. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda.. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. Analisis kandungan minyak nabati Dunaliella sp. dan 6:3. dengan menggunakan cara modifikasi (Banerjee et al.. DO. Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. Parameter kualitas air yang diamati adalah suhu. KATA KUNCI: mikroalga. dan penghitungan dilakukan di laboratorium. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. Spesies dominan adalah Limnaea sp. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan. indeks diversitas dan keseragaman spesies. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya.60% menggunakan perlakuan pelarut hexana. Analisis data dilakukan secara deskriptif untuk komposisi jenis. 5:4. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP. minyak nabati . kecerahan. kemudian 6. Dunaliella.0 sel/mL. Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda.5 mg/L.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6. Kultur ini ditempatkan diluar ruangan. Bogor. 2002 dan Dayananda et al. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis. dan Nematoda.. pupuk. pH. KATA KUNCI: makrobentos. Tidak terdapat perbedaan nyata (P>0. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5.75). identifikasi. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9. Proses pengayakan termasuk penyeleksian.02–8. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp.. dilakukan di dalam bakbak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. 2006). Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0.). Chironomus sp. kolam. ekstraksi. dan BOD5. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung. penghitungan kelimpahan. Jakarta. Kultivasi Dunaliella sp. total bahan organik (TOM). BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan.

Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12. Departemen Pertanian. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. Pengolahan data dilakukan secara deskriptif. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat. KATA KUNCI: ketahanan pangan. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. Berdasarkan perhitungan statistik ANOVA. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. dengan skor 19. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. Botryococcus braunii . Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. salinitas. 02 sel/mL pada sistem outdoor. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. Metode penelitian menggunakan metode survei.25/ hari pada indoor dan 3.33 sel/mL pada sistem indoor dan 7. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan.65/hari pada outdoor.37. braunii. dan pH.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan. laju pertumbuhan. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. rawan pangan. salah satunya adalah Desa Merakan di daerah Jawa Timur. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. KATA KUNCI: kepadatan.

Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. dan Balai Budidaya Laut (BBL) Ambon. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. Infeksi bakteri. penanganan aspek teknis. penanganan aspek teknis. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. tes katalase dan oksidase dilakukan sebelum uji PCR. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. KATA KUNCI: unit usaha. KATA KUNCI: Aeromonas hydrophila. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. aerolysin dan primer spesifik . Uji awal berupa pengecatan gram. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. Isti Koesharyani. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. sehingga AH-26 merupakan isolat yang pathogen. Sedangkan dengan menggunakan spesifik primer. pembudidayaan. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. kemungkinan merupakan strain yang tidak pathogen. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. pengelolaan bisnis. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. Bakteri merupakan salah satu penyebab penyakit pada ikan. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. profitabilitas. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. uji PCR.

periphyton. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m). Winarlin. Ani Widiyati. Waduk Cirata .86-0.Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat. KATA KUNCI: kedalaman.Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti.81 (ind/cm2) dan 0. Masing. kedalaman 2 meter (B).masing perlakuan 5 kali ulangan. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar. kedalaman 3 meter(C) dan kedalaman 4 meter (D).91. Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A). namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae. Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. yaitu 4423.

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

dan Achmad Sudradjat*) **) *) Pusat Riset Perikanan Budidaya. KATA KUNCI: strain. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas. Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. Akuarium yang digunakan berukuran panjang 60 cm. ikan mas.Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. ikan nila. Sidi Asih***). Jakarta Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. lebar 40 cm. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. pertumbuhan . salinitas. dan tinggi 40 cm dengan ketinggian air 15 cm. Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. sintasan. KATA KUNCI: streptococcosis. sintasan terendah didapatkan pada salinitas 12 ppt. Cianjur Wildan. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*). Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. dan Sutisna Kuningan. Masingmasing perlakuan menggunakan 2 ulangan. Hary Krettiawan*). Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. telah banyak menginfeksi ikan nila. responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. 8 ppt (6–10 ppt). Majalaya. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). dan 12 ppt (11–15 ppt). Bogor ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas.

pakan. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. Pemeliharaan ikan belida dilakukan di kolam. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan. Iwan Malhani Al’Wazan. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan.20 siklus dan nilai RC ratio sebesar 1. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. dengan jangka waktu pengembalian modal selama 3. anakan ikan nila . Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya. ikan belida yang banyak hidup di perairan umum Sumatera. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan SeptemberNovember 2009.64 sedangkan FCR total sebesar 1. ekonomi. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september . Jawa.53. Jakarta ABSTRAK Ikan karnivor. KATA KUCI: ikan belida. yang diberi sekat jaring nilon hita. termasuk jenis ikan karnivor. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya. KATA KUNCI: budidaya. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan.36. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. dan kalimantan. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. Dalam hal dukungan dana permodalan. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya.

Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. Dalam kegiatan budidaya ikan. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. jaring tancap dan keramba jaring apung. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. KATA KUNCI: ikan belida. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) **) Pusat Riset Perikanan Budidaya. kurang lebih 60% pengeluaran berasal dari pakan. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. KATA KUNCI: ikan nila. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. Untuk menguasai teknologi domestikasinya. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. Budidaya ikan nila dapat dilakukan di kolam. pelet maggot . palm kernal meal. yang dikenal dengan nama PKM (palm kernel meal). Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. Selama proses adaptasi pada kolam pemeliharaan. Jakarta Balai Riset Perikanan Budidaya Air Tawar.

Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. Rasio konversi pakan 1. 95 – 2.150. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. baik disebabkan oleh infeksi virus. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. sintasan. Padat penebaran yang digunakan sebagai perlakuan adalah 100. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. Pendederan ikan kerapu macan. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bakbak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. 25 – 1. dan 200 ekor/m³.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. 65 g/ ekor. KATA KUNCI: pertumbuhan. penyakit infeksi . baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Masing-masing perlakuan diulang 3 kali.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. dan Zafran Balai Besar Riset Perikanan Budidaya Laut. Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. Epinephelus fuscoguttatus. Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. sedangkan kontrol hanya disuntik dengan PBS. bakteri maupun berbagai jenis parasit. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. KATA KUNCI: vaksin bakteri. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. Fris Johnny. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. 05. 05) tidak mempengaruhi sintasan.

sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut. Supii.520 µm. dan (B) Induk asal alam. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³.000 butir. Agus Priyono. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet.80. dan pada induk asal alam 20-92 % dengan SAI 2. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. aspek biologi reproduksi . Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan.004.20.450. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam.240.000 butir. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. Tridjoko. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. dengan jumlah 8% biomass/hari.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma. Ketut Suwirya. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 . Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan. indeks somatik gonad dan diameter oocytnya. Apri I. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia. Kualitas telur yang dihasilkan relatif masih fluktuatif.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad.25-4. Plectropoma laevis. KATA KUNCI: kerapu raja sunu.

Giri Balai Besar Riset Perikanan Budidaya Laut. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. tawes . Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. pertambahan berat. pertambahan berat. Kata kunci : Jaring apung. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. dibandingkan dengan perlakuan lainnya. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi. ikan tengadak.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. pertumbuhan. Rudy Gustiano. Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. (1988). dan N. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. konversi pakan. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal.A. Peubah yang diamati adalah sintasan. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. KATA KUNCI: truss morfometrik. tengadak albino. dengan periode pemeliharaan120 hari. Hasil penelitian menunjukkan bahwa laju pertumbuhan. total biomass dan biaya pakan. Himawan Tirta Yudha. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA.

Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi.05) dibandingkan kolam ikan kontrol (82. pemakaian insektisida perlu dilakukan secara selektif. KATA KUNCI: toksisitas. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat). kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur. amonia (0. kronis . KATA KUNCI: substrat. Untuk itu. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7.4%) pada kolam substrat 1 (pasir. Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi. dan nitrat (11.86%–85.3 mg/L). nitrogen. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan.Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar.82%).5%–90.681mg/L) dan nitrat (0. juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut. dan nitrat (37.lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar. akut. yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air). produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar. tumbuhan air.05). karbofuran.14%–92. Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat. karena di samping harus efektif terhadap hama tanaman padi. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan.5 mg/L). Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen. Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya.58%).7–1. amonia (42.5 mg/L).303–1.5%–66.36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0. Sintasan (93. dan Scirpus sp. Perlakuan pada penelitian ini terdiri atas dua perlakuan. amonia (20.081–0. Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0.).11%–44. khususnya ikan. Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air.82%).8 mg/L). Typha sp. Kisaran persentase efektivitas penyisihan TN (28%– 58. yaitu TN (42.32 %).849 mg/L) dan nitrat (0.67%). amonia (0.33%). sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan.5–14.4–0.

Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Dactylogyrus. gurame.00 mg/L. dan Quadriacanthus kobiensis serta menimbulkan kematian. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis. yaitu M1: T39 (GCGAACGGGTGAGTAACACG) dan T13 (TGCACACAGGCCACAAGGGA). (e) garam 5. (b) biji teh 15. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut. Ketujuh perlakuan itu yaitu: (a) biji teh 10.00 mg/L efektif untuk memberantas Trichodina dan monogenea.00 mg/L. Trichodina. Pada riset ini. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp. Dua pasang primer. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar.00 mg/L (g) kontrol.00 mg/L. KATA KUNCI: mycobacteriosis. dan Polymerase Chain Reaction . Hasil penelitian menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10. limpa. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya. KATA KUNCI: ekstoparasit.000.00–6. dan primer M2: PreT43 (AATGGGCGCAAGCCTGATG) dan T531 (ACCGCTACACCAGGAAT) digunakan pada penelitian ini. Ada beberapa bahan nabati dan alami yang dapat digunakan. yang telah dikembangkan oleh beberapa peneliti. dan darah. serbuk biji teh dan garam.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar. (d) garam 4. Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. dan limpa. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain–Jenssen. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. ginjal. (c) biji teh 20. sehingga upaya pengendaliannya sering terlambat. sedangkan preparat histopatologi diambil dari organ hati. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS.000. Mycobacterium fortuitum PADA IKAN GURAME.000.00 mg/L dan garam 4. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies.00–20.00 mg/ L. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy). Mycobacterium fortuitum. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. Oleh karena itu. Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan. selanjutnya dibandingkan dengan teknik diagnosa melalui uji biokimia dan histopatologis. Gyrodactylus. (f) garam 6.00 mg/L. Sensitivitas teknik diagnosa terhadap bakteri target.

B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai.45 g/ekor. Parameter yang diamati yaitu laju pertumbuhan spesifik. pakan ikan beronang.73 g dengan padat tebar 15 ekor/keramba. Hasil penelitian menunjukkan bahwa penggunaan fitase 1. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau. efisiensi pakan. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap. Cijeruk dengan bobot rata-rata 8. efisiensi pakan.500. pertumbuhan. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra. namun nilai ini tidak berbeda nyata dengan 1. 1. dan 2. Balai Riset Perikanan Budidaya Air Tawar.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0.60±0. substitusi.000. Bogor. 1. 500. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22.05). nilem.V. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan. tepung bungkil kopra.000 unit/kg pakan.000 unit fitase/kg pakan.05) terhadap pertumbuhan. rasio efisiensi protein. KATA KUNCI: tepung bungkil kedelai. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. S.15±5. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan.500 dan 2. guttatus . dan tingkat sintasan. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0. KATA KUNCI: fitase. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. dan sintasan ikan beronang. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. C.

Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak. sintasan . KATA KUNCI: pakan rucah. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot. Maros selama 40 Hari. Tjaronge Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: budidaya bandeng.Variabel yang diamati adalah pertumbuhan lebar karapas.850. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut. pelet. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis.04 ± 0. tambak. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M. bobot dan sintasan serta kualitas air. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass.2 mm dan bobot 0. lebar karapas dan sintasan (P>0. rajungan.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau.).05) dengan perlakuan yang lain. 100% ikan rucah jenis ikan tembang (Clupea sp. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus). 50% ikan rucah + 50% pelet.2 ± 0. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak. B. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. 100% pakan buatan/pelet dan C. pertumbuhan.02 g. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur).526.-/tahun/ha.

Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional. KATA KUNCI: pupuk organik.-. 35.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari.5 cm (ukuran ekspor).6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. dan Lili Sholichah Balai Riset Budidaya Ikan Hias.9 dan 1154 kg/ha.43.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. 55.5 m dan tinggi air 40 cm. masing-masing mencapai 986. Oleh karena itu.0 cm. bandeng.625% dan 60.5 x 0. B/C rasio 1. masing-masing dengan dosis 2. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. 20. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. ampas tahu. KATA KUNCI: benih botia. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. Pada akhir penelitian (hari ke 105). dan 105 dan dianalisis secara deskriptif.0 cm dan bobot rata-rata 0. 70. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. Produksi bandeng pada perlakuan A dan B. masing-masing mencapai 56. pupuk kandang dan dedak.5 ton/ha. Nina Meilisza. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1.100. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. pertumbuhan panjang.816%. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B). Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.5 cm dan panjang tertinggi sebesar 3. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Selama pemeliharaan. ukuran ekspor 1 inchi (2.009 gram. Sintasan bandeng pada perlakuan A dan B. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia.5 x 0. Erfan Andi Hendradjat. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok.98 g/ekor menjadi 232.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Padat penebaran bandeng pada masingmasing perlakuan adalah 15. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran.467. produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut.5 cm) . semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B).

memberikan pengaruh yang berbeda nyata (P<0. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp.01 g dan panjang total rata-rata 3.50 ± 0.. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi.. Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali. KATA KUNCI: Melanotaenia sp.00. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar.98 ± 0. dan Irsyaphiani Insan**) *) **) Balai Riset Budidaya Ikan Hias. Pakan diberikan tiga kali sehari yaitu pada pukul 8. (B) Culex sp. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp. pH 6. Gigih Setia Wibawa*).0-8.0 – 8. Depok. Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5.00 dan 16.09 g dan pertambahan panjang total rata-rata sebesar 0. Hasil penelitian menunjukkan bahwa perlakuan pH 7.5 – 5. sintasan . Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal. dan (C) Tubifex sp.24 cm..05) terhadap rata-rata pertambahan panjang total dan sintasannya. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar. gonad. Selama 45 hari pemeliharaan.) Eni Kusrini*). ikan diberi perlakuan pemberian pakan alami yang berbeda. Depok Pusat Riset Perikanan Budidaya. namun tidak berbeda nyata (P>0. (A) Chironomus sp. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya. 12. pendederan. Rendy Ginanjar. memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp.9 dan pH 7. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian.85 ± 0. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya. pertumbuhan.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. KATA KUNCI: Benih ikan pelangi. pH air pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur.8 (sebagai kontrol). Agus Priyadi*).Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP.32 ± 0.0 – 6. dan Culex sp.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat.0. dengan pertambahan bobot rata-rata sebesar 0. pakan alami.00 dengan metode pemberian sekenyangnya (adlibitum).05) terhadap pertambahan bobot rata-rata ikan.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor. Jakarta ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula.

Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. Depok Universitas Diponegoro. 97. pertumbuhan.07%. 30 ekor/liter dan E. Sintasan dari masing-masing perlakuan adalah sebagai berikut: A. resirkulasi. tetapi berpengaruh nyata (p<0. Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari.67 mm. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L).Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*). Pakan yang diberikan selama penelitian adalah nauplii artemia. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap. dan Jacques Slembrouck**) **) *) Balai Riset Budidaya Ikan Hias Depok. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. KATA KUNCI: ikan botia. padat tebar . Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. Asep Permana*). 96. Lili Sholichah*). Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi. Rendy Ginanjar*).02 g.02 cm dengan bobot 0. 35 ekor/liter. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). padat tebar. B. Prancis ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air.22% dan E. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara.67%. C. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi.05) terhadap pertumbuhan. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan.13±0. sintasan.22±0. B (2 ekor/L). 25 ekor/liter. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). 15 ekor/liter. B.45%. 20 ekor/liter. D.81%. Marendra Gladiyakti**) *) **) Balai Riset Budidaya Ikan Hias. 96. 95. Indonesia Institute Recherche Pour Le Developpement. Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan. KATA KUNCI: Metynnis hypsauchen. D. C. ketersediaan pakan dan padat penebaran. Ikan uji yang digunakan adalah benih berukuran panjang 2. 96.

area penjemuran atau alat pengeringan pakan (drying). Unit produksi maggot memiliki prasyaratan sebagai berikut. temperature. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. kolam budidaya dan manajement budidaya yang baik.) . dan homing atau reproduksi. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. Unit budidaya ikan memiliki prasyarat sebagai berikut. biokonversi. Kawasan Mina Pakan Mandiri.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. ketersediaan pakan dan pemasaran. memiliki bak untuk restokin. Unit pengolah pakan memiliki prasyarat sebagai berikut. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. salinitas dan arus. sedangkan factor eksternal yaitu. propinsi Jambi. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. memiliki bak kultur. KATA KUNCI: maggot. 2) unit pengolahan pakan dan 3) unit budidaya. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. Migrasi terbagi menjadi migrasi vertical dan horizontal. Ikan Sidat (Anguilla sp. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. Ikan migrasi. bahan pakan seperti vitamin dan dedak. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. fisiologi dan tingkah laku dalam merespon perubahan lingkungan. makanan. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. air tersedia dalam jumah yang cukup. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. KATA KUNCI: Phenotipic plasticity. lunar. memiliki mesin pelet. Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau.

Persilangan. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. Ikan yang di gunakan adalah hasil persilangan 4 strain. Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.560). terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Oreochromis niloticus . jarak genetik. Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST. Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD).15%). Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan dengan Pseudomonas aeruginosa.Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. Didik Ariyanto. Aktivitas reduksi nitrat terjadi dari awal inkubasi.mossambicus). dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri.236 – 0. untuk mengamati variasi genetik benih persilangan ikan nila.17 mM. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*).mossambicus). reduksi nitrat . mossambicus) Nunuk Listiyowati. Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi.28 mM. terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&). nila merah (Red NIFI).26% – 63.h-1 dan 0. Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan. Sukamandi. nitrogen anorganik. Iman Rusmana**). Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik. nila BEST (Bogor Enhancement Strain of Tilapia). Hasil dari persentase polimorfik (berkisar 5. Kata kunci: Randomly Amplified Polymorphic DNA (RAPD). Selain itu. mujair (O. Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi. NIRWANA (nila ras wanayasa).40 mM dan 0. Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Kata kunci: denitrifikasi.h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. tetapi yang menghasilkan benih hanya 15 populasi.16 mM. Jarak genetik 15 populasi persilangan berkisar (0.

nutrisi dan serat kasar .09% menjadi 4. bungkil sawit. distibusi. ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma. PGC terdistribusi secara berkelompok di bagian ventral. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). KATA KUNCI: PGC. Sukamandi **) Universitas Jenderal Soedirman. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. 6 hari (D3).74% menjadi 5. kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. sebagai bahan baku pakan ikan patin. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. menurunkan lemak bungkil sawit dari 14. Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. fermentasi. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia.37% setelah proses fermentasi. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. KATA KUNCI: Bacillus sp. Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi. Isdy Sulistyo2). Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. rasio inti sel:sitoplasma yang besar.. migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.8%. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral. 4 hari (D2).37% dan meningkatkan kadar protein dari 13. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia. Pada tahap pembentukan mata. inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC.91% menjadi 15.) Priadi Setyawan1). Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). Osphronemus goramy.

Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma.1994). Perbedaan dari kedua sistem ini adalah sifat produksinya. Depok ABSTRAK Ikan patin (Pangasius sp. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. Jakarta **) Pusat Riset Perikanan Budidaya. kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. dengan masing-masing hatchery terpisah lokasinya. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran.. integrasi. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. Wartono Hadie**). demikian juga ditinjau dari segi higienis dan kesehatan benih. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. Subang. sebagai materi kegiatan tahun mendatang. Angela M. betina homogamet . Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal. di antaranya daerah Bogor dan Subang. Lusiastuti***). dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Bogor ****) Balai Riset Budidaya Ikan Hias. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. dan Labuan (Merak). Tipe integrasi bersifat soliter.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP. dan kluster pemeliharaan larva dan benih. Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik. salah satunya melalui Catfish Club Indonesia. KATA KUNCI: UPR. jantan fungsional.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. Pengambilan data melalui responden dilakukan dengan cara purposive sampling. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi. pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk. patin. kluster penetasan telur. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. KATA KUNCI: ikan nilem. Eni Kusrini****). sex reversal. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. Jakarta ***) .Balai Riset Perikanan Budidaya Air Tawar. dkk.

1. Anang H K. salinitas. memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia.27 pada ukuran konsumsi dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. intensitas cahaya. dan nitrit). larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih.57 % dalam satu generasi. KATA KUNCI: sintasan. sintasan dan kualitas air (meliputi suhu. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva). Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. Diketahui estimasi nilai heritabilitas rata-rata h²(S+D) = 0. oksigen terlarut/DO. ikan mas strain rajadanu . M H Fariddudin A. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). KATA KUNCI: seleksi generasi. Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. 15 butir/ liter perlakuan (I). amonia. pH.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. kepadatan. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva. 10 butir/liter (perlakuan H).2 gram. pertumbuhan. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. Agus Priyono. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar.

Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik. KATA KUNCI: antibakteri. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus).Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. Klaten. penyakit streptococcosis . Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. dan Lila Gardenia Pusat Riset Perikanan Budidaya. penanggulangan. Hambali Supriyadi. eksplorasi. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus).dan Tasikmalaya. Survei dilakukan di beberapa daerah yaitu Cianjur. bakteri probiotik. karena mampu menghambat pertumbuhan bakteri Streptococcus iniae.

Secara umum. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Kabupaten Pandeglang. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. Provinsi Banten. Pandeglang . dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. KATA KUNCI: kerang hijau. Teluk Lada. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. budidaya laut. Hatim Albasri. Erlania. Untuk menjamin keberlangsungan usaha budidaya kerang hijau. Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. Kabupaten Pandeglang. SIG. di perairan Panimbang Kabupaten Pandeglang.

. Bali.. dan diferensial hemosit. Retna Utami**).UPU Probolinggo (Jatim). Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan.Wartono Hadie*). Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro. Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. kelompok kedua adalah penghasil benih. Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP Samas. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp. BBUG Klungkung. Bali. Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. KATA KUNCI: udang. Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Ikhsan Khasani**). Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. sedangkan dari kelompok protozoa adalah Epistylis sp. kelompok kedua adalah BBU Pamarican (Jabar). Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. KATA KUNCI: huna (Cherax sp. manajemen.Forum Inovasi Teknologi Akuakultur 2010 pK 01 1. Imron**). Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP.) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Parameter yang diamati meliputi pemeriksaan parasit.). Vorticella sp.42%. dan Opercularia plikatilis. dan kelompok ketiga ialah pembudidaya. kelompok kedua adalah penghasil benih. dan Jatim. Zoopthalmium sp.. serta UPR yang mengembangkan usaha perbenihan udang galah.Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak.Bali. padahal permintaan cukup besar. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. tingkat sintasan. BBAP Samas-Yogya(Jateng).).Yogyakarta. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). tembakau (Tobacum nikotiana) . dan kelompok ketiga ialah pembudidaya. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas.. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya. Jateng. STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*). BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. induk. tingkat kesembuhan. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76. Carchecium sp.. dan Spiranura sp. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro.

Pemeliharaan dilakukan selama tiga bulan.000 kg/ha rumput laut. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan.8 kg dan kelangsungan hidup 100 %. Dari pemeliharaan udang selama tiga bulan. Idil Ardi.66% dan 108.84 kg/ha. Empat petak tambak masing-masing berukuran 3. pengapuran dan pemupukan. polikultur.6 kg/ha. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. produksi 78. Gracilaria verrucosa. produksi . yaitu pertambahan berat rata-rata 230 g. masing-masing dengan dua ulangan. pemberantasan hama.22% dan 72. namun polikultur udang vaname dan rumput laut masih kurang informasinya. dan Wartono Hadie Pusat Riset Perikanan Budidaya. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35.1 kg dan kelangsungan hidup 11. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. sedangkan pada dua bulan berikutnya diberi pakan pellet udang. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. produksi 81. Penelitian ini dilakukan pada tambak di daerah Betok Mati. Kecamatan Cilebar. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. Dengan teknologi yang diterapkan. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. Sebelum penebaran. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak.500 m2 digunakan untuk percobaan. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Karawang. KATA KUNCI: vaname. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. penebaran dilakukan setelah satu bulan dari penebaran tokolan. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. pada bulan pertama udang tidak diberi pakan.n pengapuran sebanyak 175 kg/petak.5 g. kemudian dikeringkan sekitar satu minggu. Hewan uji yang digunakan adalah udang vaname PL-48. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. KATA KUNCI: udang windu. survival rate. namun berbeda tidak nyata (P>0. salinitas rendah. pengeringan. yaitu menggunakan tingkat teknologi tradisional plus. dilakukan pengolahan tanah tambak.2 %. Setelah dua hari. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. tokolan.

25. KATA KUNCI: plankton. Pada budidaya udang vaname pola tradisional plus. pola tradisional. dan Cyanophyceae. pelakuan B = sagu. Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0. kotoran. dan perlakuan D = tanpa sumber karbohidrat. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. Dinophyceae. KATA KUNCI: tepung tapioka. probiotik. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. udang windu .6 m sebanyak 12 buah.3 g dengan padat tebar 50 ekor/bak. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. dan metabolit udang. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Hal tersebut perlu mendapat dukungan dari penelitian. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. Pada budidaya udang windu intensif. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. pola intensif. masing-masing dengan 3 ulangan. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. menggunakan bak kayu ukuran 1 m x 1 m x 0. indeks keseragaman menunjukkan komunitas plankton pada perlakuan D relatif lebih merata dibanding perlakuan lainnya. perlakuan C = tapioka. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. Polychaeta. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. dan Rotatoria. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea.05) terhadap kelimpahan dan jumlah jenis plankton. indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no.

Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. oksigen terlarut.05) pada sintasan dan produksi udang vaname. pertumbuhan. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0. namun berpengaruh tidak nyata (P>0. NO2. dan indeks dominasi plankton selama pemeliharaan udang windu. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. suhu. B = 2 mg/L. perlakuan B = kotoran sapi. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. NO3. BOT. dan perlakuan C = dedak padi halus.427). Nitzschia. Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin. Hasil penelitian menunjukkan perlakuan berpengaruh tidak nyata (P>0. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname. KATA KUNCI: dinamika plankton. C = 4 mg/L. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. PO4. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang.362). setiap 15 hari. pH. indeks keseragaman (0. pupuk organik.689–0. sintasan.780) dan indeks dominansi (0. dan produksi udang vaname.324–0.5 m dengan volume air 400 L.05) terhadap pertumbuhan udang vaname.000 ekor/petak). Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea. KATA KUNCI: probiotik. Abdul Malik Tangko. dan Pleurosigma dari Kelas Bacillariophyceae. sintasan. Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing-masing: indeks keragaman (1. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0.05) terhadap jmlah jenis dan kelimpahan plankton. tambak . serta Oscillatoria dari kelas Cyanophyceae. indeks keseragaman. udang windu.199–1.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. indeks keragaman.

Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak. KATA KUNCI: efisiensi. umur pemeliharaan. udang windu .650. Substrak tanah lumpur.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L. biaya pakan pada perlakuan A dan B masing-masing Rp 11. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak). B. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau.2 cm dan bobot awal 0. Perlakuan yang diujicobakan dalam penelitian ini adalah A. KATA KUNCI: substrak.3±1. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71. budidaya. biaya produksi. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau. Substrak tanah sawah.03±0.0±5.24. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan.984.8±0.6.. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru.01 g. masing-masing dengan dua ulangan. di mana masing-masing perlakuan diulang tiga kali. dan substak tanah lumpur. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak.5 dan 21. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka. Substrak tanah tambak.sedangkan pada perlakuan A dan B masing-masing 2.. dan C.239. udang pama. Penelitian dilaksanakan pada tambak ukuran luas 4.634.05) antara perlakuan substrak tanah tambak. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1. substrak tanah sawah.dan Rp 19.875. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A).. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak.14 dan 2. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak. Machluddin Amin. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2.

92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah.66 kg/bak (7.767. masingmasing bak mempunyai ukuran panjang. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20. Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A. pertumbuhan udang.325. ukuran 80 sampai dengan 96 ekor/kg). dengan rata-rata berat 11. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91.3 ± 7. namun tidak berakibat terjadi kematian massal.86 g/ekor. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang. B). di mulai setelah satu minggu penebaran.64 kg/bak atau rata-rata 11.66 g/ekor. lebih tinggi daripada perlakuan B = 41.61%. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. Namun demikian.235 kg/ha).2 kg/500 m2 = 506 kg/ha. kisaran produksi 12. Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. fermentasi probiotik.5 m dan 1 m. lebar dan kedalaman secara berurutan adalah 10 m.28-13.4 ± 0.3 ± 5. KATA KUNCI: molase. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan. udang vaname. kisaran produksi 9. Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan. Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B).15%.7%. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2. 1.998. Maros. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali. salinitas rendah . Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah.45 kg/bak atau rata-rata 12. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C).7% dan perlakuan C = 36.0 ± 2. dengan rata-rata berat 12.86 kg/bak (8.7%. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar.68-13.2 ± 13. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau.1 ± 13. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan.6 kg/500 m2 = 406 kg/ha.7 kg/500 m2 = 320 kg/ha.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: tepung tapioka. ukuran 84 sampai dengan 89 ekor/kg) dan C (16.975 dan lebih rendah dibandingkan perlakuan B yang mencapai 1.

3±1.57 hari . Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang. C. 85%. Q.) dan probiotik B (mengandung bakteri Bacillus polimyxa. Rhodococcus sp. Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata. Universitas Padjadjaran. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. dan 0‰ sebesar 11.4255–0.6±0. Pemberian probiotik A memberikan pengaruh terhadap rata-rata pertumbuhan mutlak benih udang windu.Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan R.. Penelitian II pengujian probiotik B. Penelitian I adalah pengujian probiotik A.5 mg/L. Pemberian probiotik A dengan konsentrasi 0. udang galah. Nitrobacter sp. udang windu. Pemberian probiotik B dengan konsentrasi 2.0 hari. Pemberian bakteri probiotik A (Bacillus sp.) yang berukuran PL-20. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah.5 mg/L.003 mL/L. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab. sedangkan juvenil dan udang dewasa hidup diperairan tawar. sebelum diaplikasikan di tambak. karena secara alamiah larva hidup di periran bersalinitas..3660 g. dan pertumbuhan udang. pemberian dengan konsentrasi 0. Aplikasi probiotik setiap tiga hari sekali. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol).0 mg/L. 85%. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL). 1995).4440 g dan kontrol 0. B. dan Rhodobacter sp. sintasan. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. KATA KUNCI: salinitas.) berpengaruh nyata terhadap sintasan benih udang windu.001 mL/L menghasilkan sintasan sebesar 81. pertumbuhan . Kontrol (tanpa pemberian probiotik A). Nitrosomonas sp. Pengaruh perlakuan terhadap sintasan. kualitas air. diikuti perlakuan 5‰ sebesar 10±0.15. laterosporus. 5 ‰. Pemberian probiotik B dengan konsentrasi 5. Pemberian probiotik A dengan konsentrasi 0.8935 g).50%.002 mL/L. 10 ‰.75%–68.25%. P. Pemberian probiotik A dengan konsentrasi 0. dan kontrol 66. sebagai dasar perbaikan sistem penyediaan larva udang galah.. Rata-rata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0.001 mL/L.75%.). Dengan meneliti dua jenis probiotik. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz. Pemberian bakteri dengan konsentrasi 0. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan. waktu inkubasi. Parameter yang diukur adalah kualitas air. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji. Pemberian probiotik B dengan konsentrasi 7. dan tiga ulangan. dan D. terdiri atas: A. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62. Tingkat sintasan yang diberi probiotik B berkisar antara 63. yaitu probiotik A (mengandung bakteri Bacillus sp. sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. B. sintasan. 88%. Kontrol (tanpa pemberian probiotik B). pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F. terdiri atas: O. KATA KUNCI: probiotik. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter)..001 mL/L menghasilkan pertumbuhan tertinggi (0.25%. Masing-masing perlakuan diulang sebanyak empat kali.

dan ukuran templat. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. konsentrasi. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi. 15 ppt.67%. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten. udang galah . sedangkan sintasan pada perlakuan 25 ppt mencapai 61.92±0. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. diantaranya karakteristik templat DNA genom yang meliputi kemurnian. 10 ppt (kontrol). Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. 10 ppt. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. 15 ppt. Sukamandi. 25 ppt. 20 ppt. Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna.33±0. Hasil yang diperoleh adalah pada salinitas 5 ppt. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. yaitu templat dengan berat molekul tinggi (1). Ditinjau dari keragaan pertumbuhan. Selain itu. salinitas. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3).05). dan 20 ppt sintasan dari post larva udang galah mencapai 100%. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. PCR. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. Guna mendukung prgoram revitalisasi tambak.13 cm dan 1. KATA KUNCI: pertumbuhan.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH.09 cm. KATA KUNCI: Macrobrachium rosenbergii. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29.

Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar.Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. baik pertumbuhan bobot. Oleh karena itu.5%. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki.66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. kepiting bakau. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen. Sulaeman. Berdasarkan persentase.05). kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. Pakan diberikan dua kali sehari selama penelitian. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan. manipulasi lingkungan. maupun lebar karapas (P>0. ikan rucah (B). KATA KUNCI: kepiting bakau. kepiting lunak . panjang. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). Dari pencapaian bobot ini. perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet. KATA KUNCI: pergantian kulit. Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. pemberian pakan. dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. Sintasan yang diperoleh pada penelitian ini yakni 52%–54. dan gabungan keduanya (C).

dan produksi serta parameter kualitas air. KATA KUNCI: rajungan. dan pelestarian alam. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi. Dibalik manfaat mangrove yang demikian banyaknya. bobot. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau. restoking kepiting bakau. tambak bersalinitas tinggi.2 mm dan 0.2 ± 2. Ikan bandeng yang digunakan adalah gelondongan umur 1. pertumbuhan. KATA KUNCI: kerapatan hutan mangrove. Tambak yang digunakan berukuran 10.573.2 g. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya. Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan. Peubah yang diamati adalah pertumbuhan lebar karapas. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.000 ekor/ha ukuran crablet-30. Tambak ditebari benih rajungan.5 bulan dengan panjang dan bobot masing-masing adalah 8.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009.000–1. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi./m2.300 pohon/ha dengan rata-rata 1. produksi . sehingga perlu riset budidaya rajungan pada musim kemarau.02 g dengan kepadatan 1 ind.05±0. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. jumlah permudaan 450–500 pohon/ ha.0 ± 2. rumput laut dengan kepadatan 1. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari). dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1.100 pohon/ha. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan. data yang diperoleh dibahas secara deskriptif. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1. Hasnawi. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh.000 m2.04 ha. sintasan. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan.1±0. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa.7 cm dan 4. perlindungan. sintasan. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰—4 9‰) mengakibatkan sintasan dan produksi rendah.

Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. bioakumulasi. Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0. Secara umum. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. Kappaphycus alvarezii. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. Provinsi Gorontalo. Secara umum. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya. layak. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. kondisi perairan sangat mendukung pengembangan budidaya rumput laut.03 mg/L. cukup layak dan tidak layak. logam berat . SIG. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). Untuk memfokuskan kegiatan budidaya rumput laut. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. I Nyoman Radiarta. KATA KUNCI: Danau Maninjau. Adang Saputra. KATA KUNCI: minapolitan.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. rumput laut. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. Anjang Bangun Prasetio. Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet).

Subang. Sampling air secara regular untuk pengamatan fisika.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. Supii. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet. KATA KUNCI: kualitas air.814-0. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. dan plankton dilakukan seminggu sekali. TSS. kimia. Indeks keanekaragaman berkisar antara H’=2. Adi Hanafi. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom. GONDOL-BALI Apri I. Nitzschia sigma. KATA KUNCI: alga perifiton. alga hijau biru dan alga hijau). nitrit. Dara Kasih**). Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan. Perifiton yang terdapat di Tambak Blanakan. Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. dan Erlania*) *) Pusat Riset Perikanan Budidaya. Subang. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah.076-0. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. DO. tambak. Kualitas kimia air untuk pH.962.711-2. SUBANG Joni Haryadi*). Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air. indeks keseragaman berkisar antara E=0. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10.853.085. 20 dan 30. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. N. sedangkan indeks dominansi berkisar antara D=0. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. BBRPBL Gondol . outlet. inlet. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut.

Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung. yang terdiri atas: 9 jenis pakan untuk ikan mas. nila (Oreochromis niloticus) dan bawal (Colossoma sp. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi. yaitu: ikan mas (5.17% dan 8.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal. P. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp. kelimpahan.73–1. dan 3).48%–9. Bogor. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan.89%–17. Panen Moina sp.900 g sedimen + 20 g TSP.. dan bawal adalah 1. 1.83– 1. Ani Widiyati.) di laboratorium. KATA KUNCI: konversi pakan. serta produksi Moina sp. indek dominasi.53%–15. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio).21%). 9. 1.78%).23%–6. 2). KATA KUNCI: limbah. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan. Data dianalisis secara deskriptif. K = 16:20:0. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur. limbah hara N dan P .89. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas. dan 1.53%) dan ikan bawal (8.87.dengan produksi Moina sp. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan. ikan nila. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP.63% dan 10. akuaponik. ikan nila (3. Pengukuran N dan P dilakukan pada ikan dan pakan. Parameter yang diamati adalah jenis. volume air 500 L.90.71%–10. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP .88–1. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP. Perlakuan adalah pemupukan dengan perbandingan N. dan keanekaragaman plankton.58%–13. Kusdiarti. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g.89% dan 11.16 g. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp.96 ±1. dilakukan pada hari ke-8 sejak dilakukannya penebaran.

Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian. Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. Sukenda***). dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah. hama. mata. Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur. penyakit. N4M (2). namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. Budidaya rumput laut khususnya Kappaphycus sp. N14G (3).6 juta ton per tahun pada 2014. sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. Bogor Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) **) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani Pong-Masak Balai Riset Perikanan Budidaya Air Payau. di laut dan Gracillaria sp.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*).1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. agalactiae setelah dilakukan uji Postulat Koch. Isolat 1. KATA KUNCI: Streptococcus agalactiae. khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. Postulat Koch. Oreochromis niloticus. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). Hasil yang diperoleh. Produksi rumput laut ditargetkan meningkat dari 2. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. Esti Handayani Hardi**). diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S.6 juta ton per tahun sekarang ini menjadi 7. Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. dan NK1 (5) yang berasal dari organ otak. Oleh karena itu. pencegahan . agalactiae. N17O (4). Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir. sehingga dapat meminimasi kegagalan panen. Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. 4. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S. KATA KUNCI: rumput laut.

02–9.695.32 ha. analisis hierarki proses. dan total suspensi <25–80 mg/L. Kata kunci : Opsi pemanfaatan wilayah pesisir. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27. kesesuaian rumput laut.81–6.039–0. Mudian Paena.90 ppt. demikian pula dengan karakteristik físika dan kimia oseanografinya.85 mg/L. dengan tingkat kesesuaian lahan sesuai 21. kedalaman 1–40 meter. Syarifuddin Tonnek. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara. dan Makmur Balai Riset Perikanan Buddidaya Air Payau. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan.38–44.610. suhu 29.Indra Jaya Asaad.095.820. pH antara 6.01169 mg/L. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. karakteristik. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian.09 mg/L. kurang sesuai 2.685 mg/L. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009. Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir. nitrit <0. Penelitian ini bertujuan untuk mengetahui potensi.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden.66°C. . besi 0. Petrus Rani Pong-Masak. KATA KUNCI: potensi.1113 mg/L. Kabupaten Kepulauan Selayar. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari.33 ha. KARAKTERISTIK.30 ha dan tidak sesuai 3.0267–0. fosfat 0. Pengumpulan data primer dilakukan dengan cara wawancara mendalam. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1.95 ha.0032–0.0037 mg/L. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder.57°C–30. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis.3 meter.37. salinitas 36.10–36.0008–0. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau. oksigen terlarut 5. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir. bahan organik total 37.1–8. nitrat 0. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya. Rachman Syah.

dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. Kabupaten Pontianak . kandungan oksigen telarut. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. NO3. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. Makmur.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. konduktivitas. analisis faktor. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. A. pH. Cakupan wilayah penelitian meliputi Teluk Hurun. NO2. faktor teknologi budidaya. NH3. Parameter kualitas perairan yang diamati adalah suhu. lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. Muhammad Chaidir Undu. yaitu : faktor infrastruktur dan kondisi perairan. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. Utoyo. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor.Indra Jaya Asaad. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. salinitas. Rachman Syah. tambak. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. PO4 dan Fe. dan faktor pasar. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. Kata kunci : kualitas perairan. KATA KUNCI: keramba jaring apung.Indra Jaya Asaad.

46%. rasa. kemudian direndam dalam larutan KOH 0. dan pH). Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air. Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik. dan protein masing-masing sebesar 14. abu. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna. bau. abu.0%. dan dijemur di bawah sinar matahari selama 18 jam. dan rendemennya 37. TVB.04 mgN% dan 6. Kelompok kedua ditebar di atas lantai dengan beralaskan waring. dicuci dengan air bersih. Rendemen dendeng sidat dengan bumbu kasar sebesar 57. Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15. dan 28.44%. dan tekstur) menggunakan skala hedonik. Rumput laut coklat dibagi menjadi dua kelompok. dendeng. 28. Sedangkan nilai TVB dan pH masing-masing sebesar 21.4%. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). Kadar air. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. dan dijemur di bawah sinar matahari selama 18 jam. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk. kadar abu. Jakarta **) Pusat Riset Perikanan Budidaya.97%. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat.1% selama 60 menit. KATA KUNCI: pengeringan. viskositas 8. rendemen. analisis fisika-kimia .41%.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.32%. terbuka di atas lantai pada suhu ruang (sekitar 30°C). dan viskositas natrium alginat). dan mutu natrium alginatnya mempunyai kadar air 19.0%. Rumput laut coklat setelah dipanen. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempah-rempah kasar dan halus (ekstrak). protein lemak. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. Selanjutnya. rumput laut coklat. 7.663 cps. kadar abu 19. kapang) dan rendemen.26%. mikrobiologi (Angka Lempeng Total/ALT. KATA KUNCI: ikan sidat.25% dan dendeng dengan bumbu ekstrak sebesar 59. natrium alginat. lemak.1%. kimiawi (kadar air.

Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. kekurangan modal. pengalaman petani ikan dan Kebijakan Pemerintah. serta ketersediannya dalam skala kecil. Faktor pendorong yaitu ketersediaan air yang melimpah. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi. Metode yang digunakan adalah studi kasus. prasarana fisik yang kurang mendukung. Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. KATA KUNCI: potensi desa. Identifikasi faktor-faktor pendorong maupun faktor-faktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya. kelembagaan yang menunjang. agribisnis perikanan . Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. harga ikan yang tergantung pembeli dan cuaca.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. polusi air. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat.