Forum Inovasi Teknologi Akuakultur 2010

ABSTRAK PRESENTASI ORAL

Forum Inovasi Teknologi Akuakultur 2010

FF 01
PERFORMA IKAN NILA BEST DALAM MEDIA SALINITAS
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: L0ppt =2,1±0,23; W0ppt = 7,0±0.29; B0ppt = 139,8±6.72; L7,5ppt = 2,3±0.06; W7,5ppt = 8,2 ± 0,42; B7,5ppt = 164.3 ± 8,46; L15ppt = 2.3 ± 0,21; W15ppt 7.8 ± 0,45; B15ppt = 155,6 ± 8,95. Pengamatan setelah 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-50ppt: 4,0±0,34; 3-515ppt: 4,8±0,27; 5-80ppt: 7,4±0,35; 5-815ppt: 9,2±0,98. Pengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
KATA KUNCI: nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
PENGUJIAN LANGSUNG EMPAT STRAIN IKAN NILA (Oreochromis niloticus) PADA SALINITAS 40‰
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen (LT50) dengan 8 ulangan dari masing-masing strain. Analisa data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata LT50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT 50

Forum Inovasi Teknologi Akuakultur 2010

FF 03
PENGGUNAAN Saccharomyces Cereviceae PADA FERMENTASI PAKAN BUATAN UNTUK MENINGKATKAN PERTUMBUHAN NILA MERAH (Oreochromis Niloticus)
Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan, Universitas Padjadjaran

ABSTRAK
Penelitian ditujukan untuk menentukan persentase terbaik dari S. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. cereviceae sebagai perlakuan dan lima kali ulangan. Sebagai perlakuan adalah A0 (tanpa penambagan S. cereviceae); A1 (penambahan S. cereviceae 1%), A2 (penambahan S. cereviceae 2%), dan A3 (penambahan S. cereviceae 3%). Hasil penelitian menunjukkan penggunaan S. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. Pertumbuhan terbaik diperoleh pada penambahan S. cereviceae sebesar 2%
KATA KUNCI: Saccaromyces cereviceae, fermentasi, pakan buatan, nila merah

FF 04
ANALISIS KERAGAMAN GENETIK LIMA POPULASI NILA HITAM (Oreochromis sp.) DENGAN ANALISA SIDIK RAGAM RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD)
Iskandariah, Otong Zenal Arifin, dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi, Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. Populasi yang diamati meliputi jenis nila BEST, Nirwana, Gesit, lokal Kuningan, dan lokal Bogor. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD), dengan menggunakan primer OPA-03, OPA-04, OPC-14, dan OPC-15. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13.3333%–46.6667%, dengan nilai heterozigositas 0.0351–0.1952 dan jarak genetik antar populasi 0.1765– 0.5797.
KATA KUNCI: RAPD, genetik, populasi, ikan nila, Oreochromis

DAN YY Didik Ariyanto*). 106. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga.81% dan 83. titer antibodinya menurun. limfosit perlakuan tidak berbeda nyata dengan kontrol. ikan uji disuntik dengan PBS. agalactiae pada tingkat kepadatan 108. Pada akhir pendederan dilakukan identifikasi jenis kelamin. agalactiae. SR). KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. Fakultas Perikanan dan Ilmu Kelautan. XY. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. Perlakuan dengan injeksi sel utuh S. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. Pada uji tantang setelah minggu keenam. Hasil yang diperoleh bahwa sel utuh (whole cell) S. pengukuran bobot individu rata-rata dan penghitungan sintasan. dan differensial leukosit dilakukan analisa sidik ragam (Anova). genotipe. Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. 106.55% sedangkan genotipe XY dan YY masing-masing sebesar 79. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S.1 mL/ekor.01%. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). Kata kunci : Ikan nila. Komar Sumantadinata**). Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. yaitu genotype XX. titer antibodi. Uni Purwaningsih*). diferensiasi kelamin. Untuk kontrol. Sukamandi **) Dept. XY. Budidaya Perairan. KATA KUNCI: vaksin sel utuh. agalactiae. agalactiae secara intra peritoneal pada ikan uji sebanyak 0. Oreochromis niloticus Angela Mariana Lusiastuti*).Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. dan YY melalui evaluasi nisbah kelamin yang dihasilkan. seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. Tetapi setelah uji tantang. Data sintasan (Survival Rate. tidak cukup untuk memberikan protektif terhadap S. Genotipe XX mencirikan betina dan XY untuk jantan. Selain ditentukan secara genotipe. S. Pada perkembangannya. ikan nila . Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g.

DO. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. Selain itu. karena pada kondisi perairan yang kurang baik akan menyebabkan stres pada ikan. BOD. lingkungan perairan . dengan variasi perbedaan kepadatan bakteri vaksin (A=108. KATA KUNCI: manajemen pakan. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. Pemberian pakan tidak boleh berlebihan.5). NO2. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. Angela Mariana Lusiastuti. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. adalah septikemia dan meningoencephalitis. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. total nitrogen. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. NH3. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. ortofosfat dan total fosfat. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus).5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. pemanasan. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. KATA KUNCI: Streptococcus agalictiae. Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. TDS. keramba jaring apung (KJA). pH. D=102 cfu/mL dan E=kontrol). INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. kecerahan. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. NO3. Anjang Bangun Prasetio. Selain itu. Danau Maninjau. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). B=106. dan Joni Haryadi Pusat Riset Perikanan Budidaya. terutama dalam hal manajemen pemberian pakan. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. turbiditas. C=104.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. serta data status kegiatan budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau.

KATA KUNCI: heterosis.48% bt/hari dan 2.94%). sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74. tebal. Budidaya Perairan.21%). IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi.82%).44%). Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia). Komar Sumantadinata**). Nunuk Listiyowati.20%.64% bobot badan (bt)/hari.35% bt/hari. SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2. Parameter yang diamati meliputi keragaan pertumbuhan (panjang. tinggi. Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (-2. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat. tebal (0. oreochromis niloticus . Sukamandi selama lima bulan.87%) dan sintasan (0. Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. lebar (0. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4. bobot (-2.22%). persilangan.65%).06%).48%). tinggi (3.05) bila dibandingkan dengan dua populasi lainya. Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49. Fakultas Perikanan dan Ilmu Kelautan. sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2. Sukamandi **) Dept. bobot) dan sintasan. bobot ( -2. dan sintasan(1.Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*).80%. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.74%). tidak berbeda nyata (P<0. tebal (-1. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.53 % bt/hari.

5480). dan 96 jam.5094 (2.1295).13 dan 1. SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA.08 g. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). 48. streptococciasis. 1. benih ikan. 72.0930). NK1) dan 1 isolat S. KATA KUNCI: toksisitas.0839(2. N4M. vaksin. N17O. dan nilai terbesar dimiliki oleh bakteri S.81±0. Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan. N14G. Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin. Bogor. 72.6578–2.7138 mg/L (0.8532).1100). pemanasan. agalactiae (N3M. 48. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. dan 96 jam. ikan nila . 2. agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik.55±0.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar. Hasil penapisan menunjukkan bahwa bakteri S. uji stabilitas dan LC50–24. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S. Data diolah dengan analisis probit program LC50. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis. 3. 48.9421 mg/L (1. 0. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak.6904– 5.9237(0.8090) dan benih ikan nila 5. iniae (N2O). agalactiae (N4M) memiliki nilai LD50 terkecil.3354 (3.4227– 4. 3. KATA KUNCI: penapisan. dan 96 jam terhadap benih ikan mas adalah 4.0430 (4. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration (LC50) 24. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN.6799–13. dan sonikasi. iniae (N2O). Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan.6297–0.9823–4.8101–1.7877–2. Konfirmasi taksonomis hingga level spesies isolat bakteri S. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1. 0. Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar.0678 (1.7504). Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila. Hasil penelitian menunjukan bahwa Nilai LC50 24.5805). Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran.

sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu.354. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih. dan 80 ekor/m3 selama 5 bulan masingmasing mencapai ukuran 127. tas. Ikan ini relatif sensitif dengan perubahan lingkungan.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. dan 102. suhu kerut 88°C. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak. dan Sumatera. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. kambing dan ikan pari yaitu berisi. kerapu sunu . karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi.00. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. dan corak permukaannya spesifik.53 N/cm atau 138. 40. untuk dijadikan kulit tersamak.184. kekuatan regang (kemuluran) 66. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia.00 sampai jam 03.46 N/ cm2 atau 222. kekuatan tarik 2. dan cacing.66%. Sulawesi. kadar abu 2. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan. yang merupakan limbah perikanan dari perusahaan filet ikan. Telur yang ada dalam kolektor dapat diambil jam 07.62%. dan 15% . namun sintasannya masih rendah yaitu sekitar 1%–3%. Waktu pemijahannya sekitar jam 24. Nusa Tenggara Timur. Ikan ini mudah terserang parasit seperti cryptocarion. kadar lemak 6. Dalam pembesaran.5 g. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut.93% dan kadar Cr2O3 1. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g. kadar air 13.00–08. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. dompet. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. simetris.76 kg/cm2. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam.12 kg/cm. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi.0 g.5 kg. pembesaran.2 g. kakap putih. 10%. Pembenihan ikan ini mulai berkembang di sekitar Gondol.94%.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.00 pagi hari. dan sebagainya. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu.0–3. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek. benedinia. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa Tenggara Barat. 103. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat.97% sehingga sangat prospektif untuk dijadikan barang-barang kerajinan kulit. KATA KUNCI: pembenihan. sarung tangan. KATA KUNCI: bahan penyamak kron. lemas. garmen. liat. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi). Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20. Selain itu. kambing. kekuatan jahit 1.

mikroinjeksi. Alimuddin***). Namun demikian. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt).1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. KATA KUNCI: transfeksi. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. Komar Sumantadinata***). 10 µg/mL. M. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. Cromileptes altivelis Slamet Subyakto*).Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. Situbondo **) Fakultas Perikanan dan Kelautan. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. Irvan Faizal*****). mikroinjeksi. di antaranya Indonesia. Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. Ratu Siti Aliah*****). Metode elektroporasi dilakukan dengan voltase 50 V. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. elektroporasi. Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. hormon pertumbuhan. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. dan 3 detik. sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. Rustidja**). dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. dan 20 µg/ mL. jarak waktu antar kejutan 0. ikan kerapu tikus . lama kejut 30 ms. mikroinjeksi. transfer gen. Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. dan Gemi Triastutik*) *) Balai Budidaya Air Payau. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). Sasmito Jati****). Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. 2. jumlah kejutan 5.

serta terakhir perlakuan D (47. Sampling dilakukan setiap minggu. pertumbuhan. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan.19%) harian serta laju pertumbuhan bobot badan spesifik (6. Kendala yang dihadapi terutama terjadi pada stadia awal.00%) yang baik bagi benih kerapu sunu. dan 15% dari total biomassa benih. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. pertumbuhan panjang larva. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal.68 g) dan panjang total (6.20-4. laju pertumbuhan spesifik.39±0. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU. 10%.31±0. nisbah konversi pakan. laju pertumbuhan harian. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. D (kontrol). probiotik.35 mm). Namun. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut.25) dan efisiensi pakan (80. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan. optimasi pakan. Salah satu faktor yang berperan adalah lingkungan pemeliharaan. Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva. KATA KUNCI: larva kerapu sunu. dan efisiensi pakan pada benih kerapu sunu.20 cm. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3.02%) serta nisbah konversi pakan (1.35 cm).000 ekor/bak. laju pertumbuhan bobot badan harian (10. dan kualitas air.42±0.90±0. Pemberian pakan dilakukan tiga kali sehari. selanjutnya perlakuan C (64. C (probiotik).Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut. efisiensi pakan. Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0. dan perlakuan B (63. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen). B (oksigen).52±0. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan.86 mm).19±0. Pakan yang digunakan adalah pakan pelet komersial. oksigen .95 mm).73%) dan panjang total (9.50-0. Peubah yang diamati adalah sintasan. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus).19%) dan panjang total spesifik (1.69 g dan panjang total awal 3. Materi yang digunakan adalah larva kerapu sunu sebanyak 4. yaitu 5%. KATA KUNCI: benih kerapu sunu. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu. Nilai pertambahan panjang tertinggi A (72.69 mm).

Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L. Bejo Slamet. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster.03% dan perlakuan C adalah 8. serta bobot badan pada perlakuan A: 192.57 mm. KATA KUNCI: pakan buatan.50%. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1./mL dan mulai umur 17 hari diberikan nauplii Artemia.08 ± 2. Masing-masing perlakuan diulang 3 kali. aktivitas lisosim sebesar 1.55 mm dan C: 26.95 mg. Epinephelus fuscoguttatus Irwan Setyadi. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun nonspesifik ikan kerapu macan. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C.81 ± 0.12 mg dan C: 211. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN.5 ± 2.0x105 sell/mL. Perlakuan A dan B tidak berbeda nyata.96 mg. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19.62 ± 2. B: 196. terutama infeksi virus. sedangkan kontrol hanya disuntik dengan PBS. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol. indeks fagositik sebesar 1. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting. Anak Agung Ketut Alit. Perlakuan B: 4 kali/hari pada umur 7-20 hari.68 mm.87. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular. Mulai larva umur 2 hari diberikan Nannochloropsis sp. Des Roza.20 ± 0.62%. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut. kerapu macan .04 ± 0. mencapai ukuran panjang total pada perlakuan A: 24.5 ± 4. infeksi.87 cm dan sintasan setelah diuji tantang sebesar 72. Perlakuan C: 5 kali/hari pada umur 7-20 hari. dengan kepadatan 1. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari.1 ± 2. Gondol ABSTRAK Ikan kerapu macan. perlakuan B adalah 6.08 ± 1. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan. B: 24. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari. KATA KUNCI: Epinephelus fuscoguttatus. larva kerapu macan.00%. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari.65%. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny. imunstimulan. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind.

plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. Setiap bulan dilakukan pengamatan pertumbuhan bobot. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. perkembangan oosit . Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp. pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari.10% dan panjang total 21. Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. dan dilihat perkembangan oositnya. pembenihan. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. KATA KUNCI: kerapu bebek (Humpback grouper). sedangkan pada bak B : pakan pelet kering.72% dan panjang total 18. generasi kedua (F-2). dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya. panjang. Sampai dengan bulan Oktober telah berhasil memijah. kerapu bebek (Cromileptes altivelis). Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen. yang kurang baik. dengan sintasan 6. KATA KUNCI: efisiensi. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. konsentrat mempunyai sintasan 19. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. konsentrat yang bisa dibeli di pasaran.86 mm. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk. pada bak A : ikan rucah + cumi-cumi + vitamin. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm.

Ketut Mahardika. Sampel larva diambil pada umur 1. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor.8%-41. 2. dan 32 hari setelah menetas masingmasing sebanyak 10-20 ekor. 17. Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. 7. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D-15). Cromileptes altivelis Yasmina Nirmala Asih. pemeliharaan dilakukan hingga yuwana (2 bulan). 25. 5. Tetapi tingkat sintasan yang didapatkan masih rendah. 10.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. 4. KATA KUNCI: pemeliharaan larva. produksi massal . Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. Indah Mastuti. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. 15. organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: kerapu bebek. mutu benih kerapu. Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. 13.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. manajemen air media pemeliharaan dan manajemen pakan. Selain itu. 20. Tangki pemeliharaan yang digunakan ukuran 8-10 m3. histologi. Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. 3. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin.

Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. Oleh karena itu. 10%. Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat.651 ekor benih untuk setiap induknya. 10%. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. 15% (P>0. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. (pakan kontrol). KATA KUNCI: innate immunity. dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. pertambahan bobot. dan siklus kedua menggunakan larva dengan kekebalan bawaan. dan 20% dalam pakan. dan ketiga menggunakan larva tanpa kekebalan bawaan. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. survival rate. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR). laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. catfish seed. Kematian larva umumnya terjadi pada hari keempat. di lain pihak hasil tangkapan cenderung menurun. Tingkat kematian larva dapat mencapai 40%–80%. akibat serangan penyakit dan kondisi media.Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. Oleh karena itu. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan.797–457. I Nyoman Adiasmara Giri. Sumber protein utama pada pakan adalah tepung ikan. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). KATA KUNCI: protein sel tunggal. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). Lies Emmawati*). perlu alternatif lain sebagai substitusi tepung ikan. Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. laju pertumbuhan spesifik. Ketut Suwirya. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. Salah satu sumber protein alternatif adalah protein sel tunggal (PST).05). Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. Hasil penelitian menunjukkan bahwa nilai bobot akhir. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan.4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. siklus pertama. Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. 5%. Pangasius hypophthalmus . 15%. Pakan penelitian berupa pelet kering dengan kandungan PST 0%. Pakan diberikan 2 kali secara “adlibitum”.

764±3. dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan.92 cm). pakan C (98. Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3. Ikan patin sebayak 15 ekor.1%).49 cm).Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN. diikuti salinitas 2‰ (28.4%) berbeda nyata lebih tinggi dibanding pakan E (68. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm.4%). Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan. dan sintasan . KATA KUNCI: salinitas. (B) 2‰. benih.17% per hari menjadi 1.32% per hari menjadi 4.223±0. Parameter yang diamati adalah laju pertumbuhan panjang badan. Kecernaan protein tertinggi berturut-turut pakan C (82. yang dilanjutkan dengan uji Tukey. ikan patin.884±2. pakan B (82. dan (C) 3‰ dengan tiga kali ulangan. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin.763±0. dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor.14%).5 g/ekor.46% per hari. Ade Dwi Sasanti. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. Kecernaan P pakan B (98.204±0. Data diperoleh dianalisis sidik ragam. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). Pakan diberikan 3 kali sehari secara at satiation.1%) berbeda nyata lebih tinggi dibanding pakan D (97. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰.1%) dan pakan E (95. pakan A (82. kemudian salinitas 3‰ (4. Ikan uji yang digunakan berukuran 2 ± 0.010±0. Dade Jubaedah.13% per hari.8%). Analisis data dilakukan secara deskriptif. C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati. Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak). dan salinitas 1‰ (3.75±0.3%).35±0. sintasan serta beberapa parameter kualitas air.2%).114±0. Pangasius djambal. dan A (98. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32. Kecernaan protein juga meningkat akibat penambahan enzim fitase.3%) dan pakan D (80.93%) dan terendah salinitas 3‰ (25.140±0.0%). Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan.674±2. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya.00%).25±0. Pangasius hypopthalmus Mohamad Amin.910±0. KATA KUNCI: fitase . selama 30 hari. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.07 cm). D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase). sedangkan laju pertumbuhan panjang harian meningkat dari 1. Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4.

Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah.26 cm. yaitu antara 13. nila. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk.5%-9. 0. Pemberian pakan dengan pelet apung sebanyak 5% per hari. dan C (10 ekor/m2) dengan 3 kali ulangan.5).2%).3 g) dan SR perlakuan A (91. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4.08 g dan 3. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut.49±1.12 g dan 3. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia. predator yaitu antara lain: Ikan liar (gabus. Pupuk anorganik + organik.42±0. B (7 ekor/m2).7% rendahnya sintasan ini diduga karena adanya faktor hama. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2). Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. B. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan dan sintasan ikan. KATA KUNCI: budidaya.60±10. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan.5-26.31 cm B. Pemupukan. Pupuk anorganik + organik + probiotik dan C. B (95. pengecekan induk. ikan patin. Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. sepat. sintasan ikan. 0. Patin Siam.5 juta ha (rata-rata 20 juta ha).7. Sularto. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam. betok. Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11. udang liar) serta jenis serangga air. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. Pupuk anorganik + organik yang difermentasi + Probiotik. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam. dan C (613. komposisi pakan alami kolam.51 g dan 11.27±0. pemijahan.74±0. penetasan telur dan pemeliharaan larva di kolam.19±0. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masing-masing perlakuan: A.2%. dan C (95. Larva yang ditebar berumur 20 jam setelah menetas. Padat tebar larva yang digunakan adalah 100 ekor/m2.37 cm C 16. Kata kunci: Intensifikasi. Jika luas gambut Indonesia adalah 20 juta ha.9%). belut.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari. lahan marjinal . namun perlakuan B (7 ekor/m2) memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut. Akmal. B (660 g). dan Syafrudin Balai Budidaya Air Tawar. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g).

15 dan 20 ekor/m2 dengan bobot awal antara 15. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda. pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela.000 ekor atau kepadatan 10 ekor/m2. Sifat biologi pertumbuhannya belum banyak diketahui. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8. Percobaan dilakukan selama 100 hari pemeliharaan. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.43–11. Evi Tahapari***). dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3.76 cm dan 2.46 g).80%. Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih. Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1.45 g). Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. pertumbuhan. salinitas. diikuti dengan kepadatan 10 ekor/m2 (92. di samping itu. Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3.54 g dan panjang awal antara 10.36 cm. Padat tebar yang digunakan adalah 5.60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99. JAWA TENGAH Ongko Praseno*). nasutus . pertumbuhan.5 m. Evi Tahapari. Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin. 15 ekor/m2 (70. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt. Kata kunci: padat tebar.06%) dan terendah pada kepadatan 20 ekor/m2 (7. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%.18) dan terendah pada 10 ekor/m2 (1. KATA KUNCI: patin pasupati.74 g) dan 20 ekor/m2 (61.000 ekor atau kepadatan 5 ekor/m2.71). Zafril Imran Azwar**).52%) dan terendah pada 20 ekor/m2 (91.47 g). 10. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya. sedangkan petakan kedua ditebar sebanyak 2.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari. Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. dan Sularto***) *) Pusat Riset Perikanan Budidaya. Jakarta **) Balai Riset Perikanan Bididaya Air Tawar.76%).70–20.09 cm dan 1.17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3.30%).10%/hari. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah.

Nurbakti Listyanto*).35 cm). dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya. Bogor ***) Pusat Riset Perikanan Budidaya. Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109. Analisis data dilakukan secara deskriptif.67%). Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal.002 mg/ L. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. sebagai perlakuan yaitu: (A) 0. intraperitonial. Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0. Uji tantang dilakukan dengan dua cara. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan.14 cm). 108. dan (C) 0. Ikan uji yang digunakan berukuran 1–2 inci. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.35 ± 0. 106. dan kontrol (placebo). Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. kemudian perlakuan dosis 0.55 ± 0. Parameter yang diamati adalah insidensi dan sintasannya. KATA KUNCI: probiotik. 107.001 mg/L (86.001 mg/L (4. dan 15 ekor/L. sintasan. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar.003 mg/L (4.001 mg/L.003 mg/L (81. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif. 10 ekor/L. perendaman. dosis. Pengamatan dilakukan selama 15 hari setelah perlakuan.002 mg/L (83. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air. Angela Mariana Lusiana**). dan kontrol.33%) dan terendah perlakuan dosis 0. (B) 0. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. Perlakuan kedua adalah padat tebar: 5 ekor/L.49 cm). Evi Tahapari*). 109. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan.60 ± 0. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air.67%). Ikan uji yang digunakan berukuran 3–4 inci. 108. Sukamandi.003 mg/L dengan tiga kali ulangan. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*). Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. dan pertumbuhan . Jakarta **) Balai Besar Riset Perikanan Budidaya Laut.002 mg/L (4. Probiotik diberikan dengan dosis yang berbeda.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*). benih. kemudian dosis 0. Kata kunci: uji tantang Aeromonas hydrophila. diikuti dosis 0. yaitu: cara perendaman dan cara penyuntikan intraperitonial. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104.

ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologi-reproduksi berkaitan dengan kapasitas produksinya. dan tahap 5 (atresis) dengan diameter oosit 300–1. larva. Ke dalam wadah ditebar ikan patin ukuran 11. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. Bambang Iswanto. hatching. tahap 3 (granula kuning telur) dengan diameter oosit 700–1. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus. Derajat penetasan patin nasutus berkisar 44. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Ukuran panjang total larva yang baru menetas berkisar 3. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar. ampas tahu. yakni pengamatan perkembangan gonad dan fertilisasi. KATA KUNCI oosit. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai.900 µm. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger. substitusi protein 0% (kontrol) (pakan A). KATA KUNCI: fermentasi. Penelitin ini terdiri atas dua tahap. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium. Aspergillus niger. Perkembangan oosit patin nasutus bersifat sinkronis grup.41±0. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129. dan substitusi protein 6.250–1. yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. dan 25% ampas tahu:75% tapioka.05% dengan lama inkubasi 22–25 jam.700 µm. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. 50% ampas tahu:50% tapioka.850 µm.04% (pakan D).130–22.000 µm. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu. substitusi protein 2.16%–79. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm.700–4.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11. rearing. Pangasius nasutus . Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu.52% (pakan B).03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai.58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4. Zafril Imran Azwar. 75% ampas tahu:25% tapioka.03% (pakan C). substitusi protein 4. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya.

98±0. pertumbuhan. 4.20 mm. 88. B. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa.31ab. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi. dengan kantung kuning telur berukuran 0.67%. 4.64±0. 50% zeolit + 50% bioball dan D. 1. B.24) x 103. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat.10–1. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus. 100% zeolit B. nasutus .89±0. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A. 95. C. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A.14 mm.28%.1.30a.03±0.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. 75% zeolit + 25% bioball.25 g/ekor.56 cm/ekor. berukuran panjang total 3. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER.08 mm3 yang terserap 50% pada umur 30 jam dan habis terserap pada umur 60 jam. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0. 25% zeolit + 75% bioball. 2.71±0. C. siam. 1.75% dan terendah perlakuan A.35 cm/ekor dan A.42±0. Kata kunci: embriogenesis.62 g) dan panjang (2.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias.45 g/ekor.54 cm). Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut.60 cm/ekor. C.84 g/ekor dan terendah A. B. 89. sedangkan patin hibrida siam-jambal sebesar -4. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi.6±0. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi.43b.23%.20. 0. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D.58%. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya.01±0. hibrida. larva.69 cm/ekor diikuti B. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih.13 mm. KATA KUNCI: patin albino. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20. 0. dengan kantung kuning telur berukuran 0.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam. masing-masing perlakuan diulang sebanyak empat kali. biofilter. 1. C. 1. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var.30ab. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE.27a. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1. 92. 75.47±0. C. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER. diikuti perlakuan C. berukuran panjang total 3. diikuti perlakuan B. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian.1±0. jambal. tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus. 79. dan D.02 g/ekor. 2. 88.01±0.33%.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan. 0.42.34±0. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi. dan D. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa. 91.

dan 3. Akhmad Mustafa. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. Untuk menentukan total limbah N termasuk eksresi amonia. KATA KUNCI: feed digestibility.27 g N untuk pakan berprotein 17%. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone. Oleh karena itu. Neltje Nobertine Palinggi*). 88. N waste. Dedi Jusadi**). dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya.28% untuk pakan berprotein 26%. lalu ditambahkan kromium oksida (Cr2O3) sebagai indikator kecernaan.2%–78. Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok). ikan bandeng. produksi. lama pemeliharaan ikan bandeng. 2. diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%.6%–90.2% untuk bahan kering.76 g N untuk pakan berprotein 21%. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau.0% untuk protein dan 81. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein pakan yaitu 2. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. Enang Harris**). Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2. padat penebaran udang windu. Eddy Supriyono**). dan Anugriati Balai Riset Perikanan Budidaya Air Payau. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak. heterotrof bakteria .Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. Maros **) Fakultas Perikanan dan Ilmu Kelautan. Pakan tersebut digiling ulang. KATA KUNCI: pengelolaan. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77.1% untuk C-organik. milk fish. dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. Jika bioflok terbentuk. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*).6%–83. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. Oleh karena itu.2 kg/ha/musim.990 kg/ha/musim dengan rata-rata 292. Hasil penelitian menunjukkan bahwa. lama ikan bandeng digelondongkan. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). 21% dan 26%. tambak.

000 ton dan mengalami kenaikan rata-rata 13. Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. dan Pekalongan. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L. Enang Harris**). Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia. Pati. Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12. Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475. Khususnya di wilayah Pantai Utara yaitu Kendal. Oleh karena itu. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif.726 ha dan yang layak untuk budidaya sekitar 6. bandeng.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). Dedi Jusadi**). (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL.66% dari tahun-tahun sebelumnya. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. DAN PEKALONGAN ) Anjang Bangun Prasetio. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. kendala. PATI. Hatim Albasri. (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Eddy Supriyono**). KATA KUNCI: Heterotrofic bakteria. Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. dan Rasidi Pusat Riset Perikanan Budidaya. Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. opsi kebijakan .) cenderung meningkatkan kandungan asam amino bioflok. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan.000 ton dan mengalami kenaikan sebesar 14.250 ton. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL.975 ha. Penambahan inokulasi bakteri komersial (Bacillus sp. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya. growing. Penyusun utama bioflok ini adalah bakteri heterotrof. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol. Molase digunakan sebagai sumber Corganik. KATA KUNCI: budidaya. Pada tahun yang sama.54% per tahun kurun waktu tahun 2005–2009.

3±0. Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein.00±1. Komar Sumantadinata**). Data dianalisis secara deskriptif. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi.0±10. HEAT SHOCK DAN KERATIN PADA IKAN LELE.00±1.34±1. DP untuk â-aktin-GFP. Clarias sp.65%) dan heat shock-GFP (18. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. Gusrina*). Alimuddin**).03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. dan Utut Widyastuti***).66%) relatif sama. keratinGFP. menyusul heat shock-GFP (10.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur.63±10. KATA KUNCI: promoter. DKH-e dihitung sebelum telur menetas. mikroinjeksi. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi.67%.33±3.0%). Konstruksi gen dalam bentuk plasmid mBA-gfp. Fakultas Perikanan dan Ilmu Kelautan. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi. dan 15. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. ikan lele .Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel.33±1.34%) dan DP (63. sedangkan DP dihitung ketika semua telur telah menetas. keratin-GFP (21. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA). Ekspresi gen gfp tidak tampak lagi pada saat telur menetas.66±1. Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi.0%) dan yang terendah â-aktin-GFP (3.67%).****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan. dan heat shock-GFP berturut-turut adalah 20. FMIPA.00±3. sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik. Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp. DKH-e yang diinjeksi dengan â-aktin-GFP (25.65%. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20.0%). GFP. Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10. 18. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi.0±0. Hasil penelitian menunjukkan bahwa DKH-e (63.33%. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan.

KATA KUNCi: A. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus). Ikan lele dumbo berukuran 41.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak.41 mg/L) dengan dosis efektif 250 mg/L. pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5.74±1. pakan tenggelam.05). Bak diisi air sebanyak 100 liter.37% kadar abu. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A. aerasi. pakan terapung .39% kadar asiaticosid. 5. 39.53%) (P<0. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi.47±4.25% sehingga tidak berbeda nyata dengan pakan terapung. pegagan Centella asiatical [L] Urb. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam. ikan lele dumbo (Clarias gariepinus). Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna.623. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb.83% kadar sari dalam alkohol. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani.30±2. Angela Mariana Lusiastuti.53% menjadi 92. 1.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang. hydrophila. KATA KUNCI: kecernaan pakan. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus). 0. Pada perlakuan tanpa aerasi. Taukhid. pagi dan sore. Pemberian pakan sebesar 5% dari biomassa per harinya.71±2.15%) dibandingkan dengan pakan tenggelam (yakni 79. Kandungan bahan aktif hasil pengekstrasian pegagan segar.. 24. Melalui penambahan aerasi. bahan aktif.47±4.05) dari 79. hydrophila menjadi penyakit endemis di Indonesia. Rita Febrianti. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%.34% kadar air. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif). Feces yang dihasilkan diambil setiap hari. 6.23% kadar abu tak larut asam.33% kadar sari dalam air.

dan cuk yang diberikan diselang-seling secara adlibitum. lele dumbo FF 46 ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA Tutik Kadarini. 7.7 cm mencapai TKG III. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11. dan perkembangan gonad). pH.33±0. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2. formulasi.10 g sebanyak 40 ekor. dan 25. dan 30 g/40 liter masingmasing diulang 3 kali. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium.90%. KATA KUNCI: gurame coklat. fermentasi. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9. dan karbondioksida). Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol).83% tidak memperlihat perbedaan dengan perlakuan kontrol. 20. Jenis pakan berupa cacing tubifex.85%.0 m x 1. Siti Subandiyah.92%. bloodworm. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. panjang.8–4. tapioka.3–3.81% dalam formulasi pakan. dan gonad .96%. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar. kualitas air (suhu. penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. 19. KATA KUNCI: maggot. 13. amonia. 10. dan penurunan lemak 61.1 cm. Setiap perlakuan dengan 3 ulangan.Forum Inovasi Teknologi Akuakultur 2010 FF 45 PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus) Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor.28%. Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3. Sulasy Rohmi. oksigen. namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25. dan Darti Satyani Balai Riset Budidaya Ikan Hias ABSTRAK Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang.0 m x 0. reproduksi. dan dirancang sistem resirkulasi. Parameter yang diamati sintasan dan pertumbuhan (bobot. Wadah percobaan yang digunakan adalah bak beton ukuran 1. ikan. alkalinitas.56%. dari perlakuan kontrol. dan molase. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0. Laju pertumbuhan spesifik. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter.8 m.

5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan.774 butir per sarang. keragaan reproduksi . Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. 14% dan kontrol yakni masing-masing 79. Induk gurami yang digunakan berbobot 2-3 kg/ekor. 33%. Sukamandi ABSTRAK Ikan gurame termasuk ikan dengan fekunditas rendah.Forum Inovasi Teknologi Akuakultur 2010 FF 47 APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame.94% (P=0. Mycobacterium fortuitum. Mycobacteriosis. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp. Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente.5 buah). dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang. produksi telur per sarang.23% dibandingkan dengan pemberian pakan dengan kadar protein 33%. dan 71. dan injuk sebagai bahan pembuat sarang.05%. Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0. pakan buatan.88 buah. Masing-masing perlakuan mempunyai 2 ulangan. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92.546 butir dan 2. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0. lebih rendah dibandingkan dengan yang diberikan pakan tambahan berkadar protein 33%.13 buah) dan hanya daun sente (0. dan tingkat fertilitas telur yang dihasilkan. PCR FF 48 PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI Bambang Gunadi.730 butir.351 butir. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi. Pakan yang diberikan berupa daun sente sebanyak 3. KATA KUNCI: ikan gurame. daun sente.) DI JAWA Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. KATA KUNCI: fish TB. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0.26). dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10. yaitu seperti daun talas. biokimia. Dari hasil penelitian menunjukkan bahwa di daerah Blitar. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2. 33%. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. Jakarta ABSTRAK Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan. dan 14% sesuai dengan label pada kemasan masing-masing. Perlakuan yang diterapkan adalah kadar protein 38%. 4. yaitu di Jawa timur (Blitar dan Tukung Agung).86%. Lamanto. dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. yakni 0. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa. sehingga petani tidak mengalami banyak kerugian. penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman.75 buah. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang). Pemberian pakan tambahan dengan kadar protein 38%.09). 28.

dengan ditandai tumbuhnya koloni transforman berwarna putih. ikan mas . Retensi protein dedak padi fermentasi. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi. Sintasan ikan uji berkisar antara 96. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. Bogor dan terdiri atas dua tahap.02% sedangkan kandungan lemaknya turun 13.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan berbeda nyata (P<0. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar.28%. Reza Samsudin. dan selanjutnya polar dan dedak padi. dan polar fermentasi. dedak padi fermentasi. retensi protein. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp. pertambahan bobot relatif.33%. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. yang menunjukkan terbentuknya plasmid rekombinan. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas. dan polar fermentasi berbeda nyata (P<0.3’). Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5. retensi lemak. KATA KUNCI: R. dan 6 hari. dedak polar.47 g/ekor. fermentasi. Retensi lemak tertinggi (35. Wadah percobaan yang digunakan yaitu akuarium volume 100 L. dengan padat penebaran ikan uji 30 ekor per akuarium. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen. dedak padi. oligosporus yaitu 2. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). 4. polar.05) dengan dedak padi tanpa fermentasi. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. Kandungan protein dedak padi naik 19.67%–100%.05) dengan perlakuan lainnya.14% dan kadar lemaknya turun sebesar 19. dan koloni berwarna biru tidak mengandung DNA sisipan. mud carp sebesar 1127 bp. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ –GATGAAACTCGAGTAGCCCTTGCTCTTC. dan sintasan. polar. oligosphorus.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. Kadar protein polar naik 38. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. dan pada Silver carp sebesar 1123 bp. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. Parameter yang diuji meliputi bobot akhir rata-rata. protein efisiensi rasio.

dan ikan mas galur majalaya sebesar 0. dan parameter kualitas air yang lain dianalisis secara deskriptif. serta keramba jaring apung di danau maupun waduk. KATA KUNCI: ammonia. dengan padat tebar 20 ekor/m3. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. Achmad Sudradjat.64 kali lebih banyak dengan ukuran panen 1. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. karena akhirakhir ini banyak lahan yang tidak digunakan (marginal).Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). KATA KUNCI: ikan mas. Kabupaten Tangerang. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. dengan lokasi penelitian di Desa Kronjo. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1.28 g/ ekor yang digunakan sebagai hewan uji. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak.25 kali lebih besar dibanding pada kolam konvensional. pertumbuhan. sawah. sintasan. Benih ikan mas ukuran 18. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. Ongko Praseno. kemudian ikan mas galur kuningan sebesar 1. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan. Sutrisno*).86 g/hari. akuaponik. Data setiap sampling dijadikan ulangan. sedangkan yang lainnya sebagai kolam konvensional. Provinsi Banten. Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. wildan. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. Sedangkan sintasan. Parameter yang diuji adalah kualitas air terutama kandungan ammonia.41 g/hari. ukuran panen. tambak . Penelitian telah dilaksanakan dari bulan Nopember 2009—Pebruari 2010.15 g/hari. salinitas rendah. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan. ukuran panen. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. Di mana satu di antaranya di desain sebagai kolam akuaponik. Lilis Sofiarsih*).

memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya. fry performance.58 cm dan 17. cobia larvae. Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. Hasil penelitian menunjukkan bahwa pertumbuhan panjang. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat. Afifah. serta mempunyai respons yang baik terhadap pakan buatan. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata.42%. Siti Zuhriyyah Musthofa. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. Masing-masing perlakuan diulang 3 kali. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74.07%) relatif lebih tinggi dari pada perlakuan B dan C. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik. kemudian diberikan sebagai pakan larva. lasted time feeding . KATA KUNCI: artemia nauplii. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. dapat dikembangkan di bak terkontrol maupun di KJA. dan Afifah Balai Besar Riset Perikanan Budidaya Laut.067mg) serta kelangsungan hidup (12. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). KATA KUNCI: survival rate. Siti Zuhriyyah. (B) umur 10 hari dan (C) umur 15 hari. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien.

sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. Lucky Marzuki Nasution*). budidaya. Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. plasma nutfah .Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). Stakeholder. KATA KUNCI: cobia. Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam. dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. KATA KUNCI: ikan hias. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera. komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. Herno Minjoyo*). Lebih dari 100 spesies.

DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. pertumbuhan. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. virus).778 cm.Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*).226 g. dan Tubifex sp. Depok ABSTRAK Deformity (dysmorphism. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva.. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. dengan 6 kali ulangan. dan selalu berusaha mendekati sumber oksigen (aerator).586%. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia. infeksi penyakit (cacing. granuloma. laju pertumbuhan harian sebesar 32. Artemia sp. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. Eni Kusrini*). Tubifex sp. kondisi daya dukung lingkungan yang terus menurun. multifocal granuloma . diikuti Artemia. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. karena belum banyak yang membudidayakannya. atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh.. pakan alami. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. dan yang terendah Moina. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. Afrika. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. Deformity dapat disebabkan oleh : mutasi genetic. KATA KUNCI: Synodontis nigriventris. peacock bass. Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata. bakteri. dan pertambahan panjang total sebesar 1. KATA KUNCI: deformity. diam dan kepalanya menyembul tepat di bawah permukaan badan air. Peacock bass ini akhirnya berenangnya jadi terbalik. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias.

Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan.50 g. T3. udang jembret (mysids) dan larva nyamuk. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. Hewan uji yang digunakan berukuran panjang total 5.9 ± 0. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. Hasil penelitian menunjukkan. wortel dan tepung kepala udang. T2. Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. zat pemicu warna. Bastiar Nur. Selama penelitian. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. KATA KUNCI: banggai cardinal fish. yaitu : astaxanthin. Variabel yang diamati meliputi. dan Ahmad Musa Balai Riset Budidaya Ikan Hias. 40 ekor/bak. 60 ekor/bak. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF).3 cm dan bobot 2. Jhon Harianto Hutapea. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. KATA KUNCI: maggot. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. induk diberi pakan berupa naupli artemia/artemia pra dewasa. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai Sulawesi Tengah. Rainbow Papua . Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. density. 20 ekor/bak.87 ± 0. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut.

I Wayan Subamia. Nina Meilisza. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. 20. Sintasan terendah dihasilkan oleh perlakuan KB sebesar 51. dan Lili Sholichah Balai Riset Budidaya Ikan Hias.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin.67%). Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich). Masing-masing perlakuan dilakukan dengan 3 ulangan. Pada akhir penelitian (hari ke 105). ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. AF (aqua+formalin).67%). sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit.33%. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). KATA KUNCI: benih botia.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.67%).5 x 0. dan blitz ich) akan dilakukan melalui rancangan faktorial. 35. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. dan 105 dan dianalisis secara deskriptif.0 cm dan bobot rata-rata 0. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2.5 cm (ukuran ekspor). AB (aqua+blitz ich). AO (aqua+oksitetrasiklin). sintasan.05). KF (air kontrol+formalin). Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0. 70. Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium. oksitetrasiklin.0 cm.5 x 0. Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari. KF (71. 55.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. Selama pemeliharaan.009 gram.5 cm dan panjang tertinggi sebesar 3.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83.05). KATA KUNCI: prophylaksis.67% namun tidak berbeda nyata dengan perlakuan AB (55%). lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. KO (76. namun tidak berbeda nyata dengan perlakuan AO (81. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis). larva Tetraodon palembangensis . ukuran ekspor 1 inci (2. pertumbuhan panjang. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. KO (air kontrol+oksitetrasiklin). Panjang rata-rata benih ikan botia di awal penelitian berukuran 1.5 m dan tinggi air 40 cm. media air.

dan red-fin shark (Ephalzeorhynchos sp. pembuahan. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. Asep Permana.6°C–29. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy. aligator (Lepisosteus oculatus). memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan.). SR (0-10 hari) 83. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73.5 ml/kg untuk induk jantan dan 0. Asep Permana. Ikan palmas jenis albino (Polypterus senegalus var. daya tetas telur 80.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar. dan Bastiar Nur Balai Riset Budidaya Ikan Hias.75 mL/kg untuk induk betina di bagian intraperitoneal. Pemijahan tersebut terdiri atas seleksi induk. Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. polypterus senegalus albino.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina. Depok ABSTRAK Ikan palmas (Polypterus sp. hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol. inkubasi telur dan perawatan larva.4°C. KATA KUNCI: palmas albino. albino) masih sulit untuk memijah dalam wadah terkontrol. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27.15%. namun belum banyak diketahui data embriologinya. perkembangan embrio. Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias. penyuntikan hormon.). masa inkubasi .31% dan menghasilkan larva normal sebanyak 218 ekor. tiger catfish (Platysoma sp. sehingga produksinya masih mengandalkan impor dari luar negeri.91%. platidoras (Platydoras sp). Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina. antara lain sinodontis (Synodontys sp.). telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan. KATA KUNCI: Neocaridina heteropoda. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias.

7–1. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya). Rina Hirnawati. implantasi. Udang diberi pakan berupa moina beku sekali dalam setiap hari.1272–0. hormon. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air. Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi. Rendy Ginanjar. matang gonad.0518 g. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana. Pada ikan yang baru di domestikasi.725 pg/mL.3–2. panjang 40– 60 cm. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka. LHRH 100 mg dan testosteron 50 mg (B). dipelihara selama 6 bulan. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. KATA KUNCI: Neocaridina heteropoda.9 cm dengan bobot 0. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2. Asep Permana.0488–0.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20. Tutik Kadarini. Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks. oocyt . Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm.5 cm dengan bobot 0. LHRH 50 mg dan testosteron 50 mg (C). bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah.042 pg/mL. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. murah dan aplikatif. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungaisungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya. Kepadatan 10 ekor induk dengan bobot 65–600 g. KATA KUNCI: induk. dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A).1630 g dan dua ekor induk jantan yang berukuran panjang 1. dan Darti Satyani Balai Riset Budidaya Ikan Hias. sedang induk jantan belum ada yang mengandung sperma. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32. budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai.

50 mL/L. Based on LSD test. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. KATA KUNCI: bunga tai kotok. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control).) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya.6%). the alternative masculinization application of natural substance like honey. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias. but between treatments not significant different. because of residual effects to human caused cancer. The proportions test showed dose 50 mL/L have significant different to control. 25 mL/L. carotenoid. and 75 mL/L. The concluded that the optimum dose to produce male guppy is 50 mL/L. The research was conducted experimental with completely randomized design. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias. the treatments gave significant different with control.000-4.000 mg/kg). chrysin. kemudian dipisahkan antara tangkai dan kelopaknya. yeast (30–800 mg/kg) dan sumber lainnya. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. male. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam.71%. as the curative effort is not applicable. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2. Therefore. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. The result showed that the percentage of male guppy at 50 mL/ L is 64. The observation to sexual secondary characteristic guppy can be observed at least two months old. suhu.05 significant level. guppy fish . Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit.07 ± 9. Honey is a natural substance which have crysin. KEYWORDS: honey. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan.

Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor.05±6. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut. jumlah telur 272. daya tetas telur FF 70 SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG. jumlah telur. rasio (1:3) jumlah induk memijah 35 ekor.05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap. Induk dipelihara dalam 8 buah bak berukuran 1. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. substitusi. jumlah telur 227. jumlah telur 237. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&). S. Siganus guttatus Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. semua induk secara individu dalam keadaan TKG=O.05) dengan rasio efisiensi proteinnya. pakan ikan beronang.975 butir/ekor. 1:2 (B&:@&).5 m x 1.5 m x 1.pada induk beronang. diameter telur.140 butir/ekor. Maros ABSTRAK Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang.837–344.333 butir/ekor.4 g dengan padat tebar 15 ekor/keramba. diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%.534–393. Pada awal percobaan. KATA KUNCI: tepung ikan. 1:3 (B&:@&). KATA KUNCI: Siganus guttatus. diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%. dan 2:1(B&:@&). Maros ABSTRAK Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. jumlah telur. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. dan daya tetas telur. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). guttatus . Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. Peubah biologis yang diamati meliputi: jumlah induk memijah.837 butir/ekor. pemijahan. rasio (1:2) jumlah induk memijah 30 ekor.0 m dengan kepadatan 24 ekor/bak. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama. jumlah telur 129. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22. diameter telur.945–350. Lama penelitian berlangsung selama 6 bulan.Forum Inovasi Teknologi Akuakultur 2010 FF 69 PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau.865–335. diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor. B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan. tepung rumput laut.

memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah.1±0.04 juta sel/mL dan rotifer 186±5. Karawang.2%. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. Idil Ardi. pada bulan pertama udang tidak diberi pakan. Setelah dua hari. sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Empat petak tambak masing-masing berukuran 3.3–8. Pemeliharaan dilakukan selama tiga bulan. KATA KUNCI: udang windu. dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368.8 kg dan kelangsungan hidup 100%.5 g. tokolan. Penelitian ini dilakukan pada tambak di daerah Betok Mati. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. kemudian dikeringkan sekitar satu minggu. produksi 81. Dengan teknologi yang diterapkan.n pengapuran sebanyak 175 kg/petak. KATA KUNCI: pakan alami.1 kg dan sintasan 11. Sebelum penebaran. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. produksi 78. dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2.2. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. marine chlorella.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. yaitu pertambahan berat rata-rata 230 g. oculata dengan NaOH dosis 75. Dari pemeliharaan udang selama tiga bulan. oculata relatif rendah (3. rotifer Brachionus rotundiformis. dan Wartono Hadie Pusat Riset Perikanan Budidaya. penebaran dilakukan setelah satu bulan dari penebaran tokolan. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. Gondol ABSTRAK Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. oculata relatif tinggi (4. salinitas rendah. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1. 427. 100.500 m2 digunakan untuk percobaan. Tingkat total ammonium terlarut dalam air laut produksi masal N. Kecamatan Cilebar. Pemadatan (flokulasi) N.5–50 m3 dengan rata-rata kepadatan akhir N. Karawang FF 72 PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut. yaitu menggunakan tingkat teknologi tradisional plus. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. dilakukan pengolahan tanah tambak.6%) dengan rasio DHA/EPA hanya 0.Forum Inovasi Teknologi Akuakultur 2010 FF 71 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi.2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. oculata 13. semi-continuous system . Nannochloropsis oculata.

dan 17.67 cm/ ekor dan bobot 155. Jakarta ABSTRAK Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. Wadah penelitian yang digunakan adalah jaring berukuran 1. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia.0 m x 2. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19.0 m x 1. Maros ABSTRAK Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi. suhu dipermukaan bumi akan turun secara drastis.00.Forum Inovasi Teknologi Akuakultur 2010 FF 73 PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus) Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau.05) terhadap pertumbuhan dan sintasan ikan beronang. masingmasing terdiri atas 3 ulangan. KATA KUNCI: pemuliaan. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus).3 ± 10. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. Siganus guttatus FF 74 ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA Lies Emmawati Hadie Pusat Riset Perikanan Budidaya. yang ditempatkan pada keramba jaring apung di laut. Padahal dalam upaya peningkatan produktivitas perikanan budidaya. karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Pemberian pakan dilakukan 3 kali/hari (pukul 08.00. ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. 11. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%. Hasil penelitian menunjukkan bahwa kadar lemak 5%. dan (C) 13%. 9%. Permasalahan ini perlu dipikirkan solusinya. pertumbuhan.79 g/ekor. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia. Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. dan 13% dalam pakan berpengaruh tidak nyata (P<0. konservasi . Jika tidak ada efek rumah kaca.2 ± 0.0 m. plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. budidaya. (B) 9%. ikan langka.00). sintasan. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global. KATA KUNCI: kadar lemak. juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin.

Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi.18 ha yang terdiri dari sangat sesuai seluas 133. Argulus sp. sirip. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. dan insang. Pulau Bekengkeng. dan Ichthyophthirius multifiliis (Ciliata). kedalaman.18 ha. Trichodina sp. Akhmad Mustafa. 98% terinfeksi parasit. nitrat. arah arus. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. (Dinoflagelata). mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. fosfat. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. KATA KUNCI: kesesuaian lahan.59 ha. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. Synodontis. Pulau Kambunong. neon tetra. Trematoda). Ektoparasit yang teridentifikasi antara lain: Oodinium spp. KATA KUNCI: ikan hias air tawar. (Copepoda) dan Centrocestus sp. (metacercaria. dan Tanjung Dapuran. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. perairan Kalukku. salinitas. kapiat albino. dan platydoras. Kualitas air perairan yang diukur adalah: pH. sympilum dan Characidae. dan Dactylogyrus spp. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. penyakit. Dari Sampel yang diperiksa 33. Chiclidae. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. parasit . cukup sesuai 512. mas koki. Sampel ikan hias antara lain dari golongan cyprinidae. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. 2009. Oleh karena itu. cat fish. budidaya laut. kecepatan arus. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. keramba jaring apung. kecerahan. dan besi.41 ha dan kurang sesuai 52. perairan Papalan. (Monogenea). Gyrodatylus spp. Red Fin Albino.

Piretroid. badan air Sungai Citarum dan Sungai Cimeta. Cd. preparasi. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. dan Karbamat. pestisida. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. Organofosfat. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan. KATA KUNCI: lahan perikanan budidaya. dan Zn dalam air dan daging ikan. CD. Variabel yang diamati adalah konsentrasi kandungan Pb. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. Cd. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. Contoh yang diambil berupa air. batas daerah bahaya. pencemaran. identifikasi dan analisis data serta pelaporan. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. zona 2 Purwakarta. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet. Tahapan penelitian meliputi: penentuan lokasi. KATA KUNCI: logam berat. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb.8214 ton/bulan dan 1. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. inlet.88 mg/L/kg daging ikan. pengambilan contoh. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. muara Sungai Citarum. serta debit air dari muara sungai yang masuk ke perairan waduk.98 ton/bulan. residu .86 ton/bulan. sedimen (lumpur/tanah). muara Sungai Cisokan. Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. Perairan Waduk Cirata sudah tercemar oleh parameter Zn. Cd. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat.

65–0.5 ind. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi./L dan zooplankton berkisar antara 93. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. Bacillariophyceae. Sukabumi.75– 993. dan sebanyak 150 ekor disimpan dalam alkohol absolut. dan Cadas Bodas.83. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa. indeks dominansi (C) = 0. Pelabuhan Ratu. Palumbon.71–19. Cyanophyceae.33.marmorata. dan nilai kemerataan (E) = 0.marmorata dan (4. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias. Patok Batas. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. dan 4–6 m.n. Copepoda. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik. Sungai Cimandiri.17-9.75 ind.nebulosa .12–3. (13.072–0.52) dikelompokan pada jenis A. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri. nebulosa. Maleber. bicolor. selanjutnya digunakan untuk analisa genetik.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu. Ciputri.75–4887. bicolor bicolor.35). Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton. pada region mitokondria 16SRNA. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. fitoplankton. 2–4. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies. A. KATA KUNCI: Glass eel. PELABUHAN RATU. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae.31. A. dikelompokan pada jenis A.) DI PERAIRAN SUNGAI CIMANDIRI. Dinophyceae. A. dan Desmiceae dari zooplankton ditemukan jenis Rotifer.7) dikelompokan jenis A./L. dan Protozoa. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat. KATA KUNCI: komunitas. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari.

10 g. Jogjakarta ABSTRAK Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. Gondol **) Mahasiswa Universitas Gadjah Mada. Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya ABSTRAK Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. sirip perut (ventral fin). Osteochilus hasselti. pakan awal. KATA KUNCI: larva ikan kuwe.20 g. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan. Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata. meristik . sirip dada (pectoral fin). rotifer.dan inter-populasi ikan nilem di Jawa Barat. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL). 21..Forum Inovasi Teknologi Akuakultur 2010 FF 81 POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN Afifah*). Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. 25. pola pemangsaan FF 82 KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT Mulyasari*). adalah dengan program pemuliaan. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). selanjutnya secara periodik 5 hari sampai dengan D-30. dan 17. Pemberian pakan awal di mulai saat larva berumur D-2—D-10. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. Dinar Tri Soelistyowati**). namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.17%). dan sirip anal (anal fin).27 mm. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin).94 g. dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut.99 mm. dan C. gonad kerang. dan 1790%) dan C (11. Titiek Aslianti*). Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan. kuning telur) dan 3 ulangan. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra. Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan. 27. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10.01 mm. Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan. dan 21. B. terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. KATA KUNCI: ikan nilem.97%) dibanding perlakuan A (10.

Balai Riset Perikanan Budidaya Air Tawar. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. 19%. Ikan uji yang digunakan adalah ikan nilem dengan bobot ratarata 5. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0. bahan baku lokal.05) yaitu sebesar 1. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. ikan patin . pakan buatan. Harga pakan hanya Rp 2.05). KABUPATEN BATANG) Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan.500. Penelitian dilakukan di Kabupaten Brebes dan Batang.-–Rp 7. Bogor.3 g/ekor.-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6. pertumbuhan. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. dan 20%. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari. serta sintasan ikan.0±0. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%.-–Rp 3. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya.800. protein.Forum Inovasi Teknologi Akuakultur 2010 FF 83 EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. Parameter yang diamati yaitu pertumbuhan spesifik. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. pakan FF 84 EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI.56%.-/kg. KATA KUNCI: nilem. Bogor ABSTRAK Pakan memegang peranan penting dalam budidaya ikan nilem. Metode penelitian dilakukan secara studi kasus.000. Ikan dipelihara selama 40 hari.000. Jakarta ABSTRAK Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. konversi pakan. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. KATA KUNCI: efisiensi usaha. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin.

Irwan Setiadi. sintasan FF 86 KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON Gleni Hasan Huwoyon.57±0. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. genetika . Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari. warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut. KATA KUNCI: warna. KATA KUNCI: penanganan calon induk.Forum Inovasi Teknologi Akuakultur 2010 FF 85 PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN Jhon Harianto Hutapea.7 m.7±0. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. pertumbuhan mutlak (merah: 6. tengadak. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2. hitam: 5. Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Pada beberapa jenis ikan. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2.19. ikan tuna sirip kuning. dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut. Irin Iriana Kusmini.02).65±0.1 m3 (lebar 1. Barbonymus schwanenfeldii. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g).1±0. hitam: 1. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar. Gondol ABSTRAK Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg).4 m dengan panjang 2.6±0. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir.06. Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk. Bogor ABSTRAK Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera.8 m) dan bak fiberglass berbentuk oval volume 2. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari.1 m dan tinggi 0. hitam: 0. Gunawan.5 m3 (diameter 2 m dan tinggi 0. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi.30) dan laju pertumbuhan spesifik (merah: 0.20).02.8±1.

Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan. E = Daun mengkudu + 2.00% khamir laut. protein kasar. bahan kering.01). Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau. R3 = Daun mengkudu + 2. serat kasar. KATA KUNCI: khamir laut. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. Setelah 5 hari dipanen.5% molasses + 0. daun mengkudu. dan energi di antara perlakuan berbeda nyata (P<0.04% khamir laut. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2. dan abu di antara perlakuan tidak berbeda nyata (P>0. gula.05). dan TSP.5% molasses + 0. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0. Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator. silase. R4 = Daun mengkudu + 2.05). Setelah kering. lemak kasar. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan.5% molasses + 0. Jepara. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu.02% khamir laut. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu.5% molasses + 0. Hasil penelitian menunjukkan bahwa: pH. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. BETN. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia).06% khamir laut. B = Daun mengkudu + 2.08% khamir laut. pupuk . urea.5% molasses + 0. Berdasarkan hasil penelitian.

000 ekor/ha) dan rumput laut (1 ton/ha). probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA. rumput laut (2 ton/ha) dan tiram (40. di mana termasuk cara budidaya udang.-/musim tanam dengan B/C rasio 2. Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu. KATA KUNCI: udang windu. tambak marjinal . udang windu. Brata Pantjara. petak I ditebari bandeng (10.1 ton/ha/16 mg menjadi 1. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.000 ekor/ha) dan rumput laut (1 ton/ha). Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram.000 ind.977.000 ekor/ha). bandeng (3. penggunaan sarana produksi yang ramah lingkungan. KABUPATEN TAKALAR Muharijadi Atmomarsono. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal.07./ha) dan petak II : bandeng (3. Pada akhir penelitian diperoleh sintasan 63. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1. CBIB. Erfan Andi Hendradjat.5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I.000. ditebari bandeng (10.46% dengan produksi udang windu sebesar 249. Perlakuan B. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik. BL542 bulan III. KATA KUNCI: biofilter.000 ind/ha) dan petak II. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau.73% dengan produksi sebesar 217. rumput laut. rumput laut (2 ton/ha) dan tiram (20. MY1112 bulan II. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10. Sulawesi Selatan. serta manajemen pakan dan air secara benar.48 kg/ha.000 ekor/ha).000 ekor/ha.

(C1) probiotik komersial dengan dosis pakan 100%. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. Nurbaya. B) Pergiliran probiotik BT951 bulan I. dosis pakan. sintasan. Maros. KATA KUNCI: probiotik. total bakteri. Penelitian dilakukan di laboratorium basah. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari.8% dan 228. BL542 bulan III. Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. Nurbaya.05) pada akhir penelitian. diikuti perlakuan kombinasi probiotik A (50. udang windu . Muliani.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2.7 kg/ha/90 hari). KATA KUNCI: probiotic bacteria. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak.7 kg/ha/90 hari). Balai Riset Perikanan Budidaya Air Payau. Penelitian dilaksanakan selama 90 hari.05% dan 298. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah. air laut salinitas 28 ppt sebanyak 15 L.11%. Oleh karena itu. NH3. menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. MY1112 bulan II. sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. dan total Vibrio. Pengamatan sintasan udang windu dilakukan pada akhir penelitian. Sintasan udang windu tertinggi didapatkan pada perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60. tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani. survival rate.7 kg/ha/90 hari). kandungan BOT di atas 30 mg/L. NO3. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11. Hasil penelitian menunjukkan. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan NH3 selama penelitian relatif lebih tinggi pada perlakuan yang tidak menggunakan probiotik dengan dosis pakan 100%. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. (C2) probiotik komersial dengan dosis pakan 50%. dan C) Kontrol (tanpa probiotik). (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masing-masing 3 kali dan lama pemeliharaan 10 minggu. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. terutama salinitas yang mencapai 56 ppt. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. production. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. PO4. dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau. NO2. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial.35% dan 448. (D2) kontrol 2.

M.0%. Tjaronge. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. Sampling dilakukan 30 hari sekali selama 90 hari. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1.7 kg. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya.9 kg dan secara finansial memberikan keuntungan sebesar Rp 11. namun belum mampu menurunkan kandungan amoniak dalam media budidaya. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha). Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an. rumput laut. Maros selama 90 Hari. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81. serta 99.000 ekor/ha). Sintasan dan produksi udang windu dan ikan bandeng masingmasing adalah 66. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha).500 m2 dengan kedalaman 80 cm. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). dan pertumbuhan udang serta aman bagi konsumen. KATA KUNCI: multitropik. udang windu.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1.-/ha /90 hari. Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari. Selama pemeliharan tidak diberi pakan. Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari. Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau.000. Oleh karena itu. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. produksi. 31) yang ditebar pada masing-masing tambak adalah 10.000 ekor/ha (1 ekor/m2).) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto. baik pada air maupun pada dasar tanah tambak. produksi . Tokolan udang windu (PL. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok.8% dan 63. masing-masing terdiri atas 2 ulangan. ikan bandeng.572.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13. KATA KUNCI: probiotik. sintasan. Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu.9% dan 33. yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya. rumput laut dan ikan bandeng adalah perlakuan B (10. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. kesehatan. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.masing-masing dengan dua kali ulangan. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp. Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu. dan kontrol (tanpa aplikasi probiotik).4 ha.000 ek/ha bandeng) menunjukkan hasil yang terbaik.5% dengan produksi 19.

EGFP. termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. IPB. Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. Maros Departemen Budidaya Perairan. Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. 12 jam. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. yang sampai saat ini belum bisa diatasi secara secara tuntas. udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. gen PmAV menunjukkan respons meningkat (up-regulation). 4 hari. KATA KUNCI: promoter. 1 hari. danAndi Tenriulo*) **) **) Balai Riset Perikanan Budidaya Air Payau. Aan Fibro Widodo. Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi.0%). Promoter dikatakan aktif apabila gen penanda dapat terekspresi. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. 3 hari.3% dan tidak berbeda nyata (P>0. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. KATA KUNCI: ekspresi. uji tantang.1%) serta tanpa transfeksi (49. Komar Sumantadinata**). Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. Syarifuddin Tonnek. Selain itu. Sukenda**). gen anti virus. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). Alimuddin**). diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR.Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. udang windu . Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. Ketika ditantang dengan WSSV. Fakultas Perikanan dan Ilmu Kelautan. ekspresi gen.05) dibandingkan dengan kontrol. transfeksi. Bunga Rante Tampangallo. 2 hari. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva.

Pewarnaan jaringan menggunakan Hematoxilin eosin. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. menyeleksi. khususnya ELISA. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. serta berpeluang untuk digunakan secara langsung di lapangan. Antibodi monoklonal memiliki kespesifikan yang tinggi. sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. Teknik serologi.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. dan disertai ulserasi lapisan mukosa epitel. Nurhidayah. KATA KUNCI: White Spot Syndrom Virus (WSSV). karena relatif mudah dan murah. monodon dengan melihat gejala klinis dan studi histopatologi. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. cepat dan akurat. Penelitian dilakukan untuk membuat. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. serta epidemi penyakit di lapangan. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. antibodi monoklonal . merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. Setelah pengujian. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. KATA KUNCI: ELISA. White Spot Syndrome Virus (WSSV). dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan.

sintasan (90.549±0. produksi (1831.7 m sebanyak 9 buah.102 CFU/mL. dan kepadatan benur dan tokolan adalah 50 ekor/m2.31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0.51).085±0.5±88.. Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0.0±149. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11.45 g/ekor dan ditebar kepadatan 100 ekor/bak. produksi (2087. 829. menggunakan 4 petak masing masing berukuran 4. kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0.05) terhadap pertumbuhan. Instalasi BRPBAP. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0. Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6.000 m2/petak. namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan. KATA KUNCI: udang vaname. dan pemeliharaan berlangsung 80 hari di tambak. RKP pada pembesaran udang vaname teknologi intensif.masing-masing perlakuan diulang tiga kali. dan efisiensi biaya produksi.9).257±0.Setiap perlakuan dengan 2 ulangan. survival rate.05) dengan perlakuan A (1. sintasan ( 92.034) berbeda nyata (P<0. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%.18235 mg/L) dibandingkan dengan perlakuan A (0. karena berpengaruh terhadap pertumbuhan.120). and L vannamei . budidaya udang intensif. sintasan.234).Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. Selama pemeliharan 85 hari. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari. Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei). Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1. Budidaya ini berkembang dengan teknologi intensif. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak. namun terbatas pada golongan masyarakat menengah keatas (padat modal).0328 mg/L) pada akhir penelitian. sintasan.048). Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. dan (B) pembesaran dengan tebar tokolan (PL 27).83±8. rasio konversi pakan dan produksi udang vaname.114±0. Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan. Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah. KATA KUNCI: growth.258). benur. tokolan. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun. Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12). Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau. Takalar. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei). Riset ini dilaksanakan di tambak Punaga.096±0. feed. Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10.

6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik.05). Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an.5 g/ekor dengan kepadatan 10 ekor per akuarium. yuwana. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan.00. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0. produksi. Litopenaeus vannamei Deisi Heptarina*). ekskresi amonia dan stabilitas pakan.5%–36. dan pH 8.8 kkal GE/g).2–78. Kemudian dilanjutkan uji kecernaan. Penelitian dilakukan di tambak percobaan Punaga Takalar. dan E atau komersial (protein 40. JKP 59. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI .3%–86.9%–68.000 m2. jumlah konsumsi pakan (JKP). konversi pakan (FCR). C/P rasio 11.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2. Perlakuan terdiri atas pakan A (protein 29%. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan.00.05). Bobot yuwana yang ditebar rata-rata 0.7%.2%. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu.1 g. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Selama pemeliharaan. 19.8% dan 11.464 mg/kg tubuh/jam.5 kkal GE/g). Agus Suprayudi**). Jakarta Utara. sedangkan ekskresi amonia antara 1.9%–79. Kisaran nilai masing-masing parameter tersebut adalah. 15.029–2. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname. retensi protein (RP).4%. sintasan.0–8. 5 kali sehari pada pukul 07. PR 532. Bogor Departemen Budidaya Perairan. Hidayat Suryanto Suwoyo. pertumbuhan. Pakan diberikan at satiation. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon). kecernaan total dan kecernaan protein masingmasing 26.00.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN. retensi lemak (RL).6 kkal GE/g). FCR 1. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB). C/ P rasio 16. K ATA KUNCI: protein optimal. namun kurang diimbangi dengan penyediaan pakan yang sesuai. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum. C/P rasio 13. kecernaan total. pertumbuhan relatif (PR). Sintasan antara 73. sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0. B (protein 31%. M. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13. RL dan RP masing-masing 26. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH. Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media.4–2.INTENSIF DI TAMBAK Abdul Mansyur.05) terhadap pertambahan berat mutlak.5. Fakultas Perikanan dan Ilmu Kelautan. 11.00. sintasan.39%.69%.5%.7%–1130. Namun. D (protein 35%.5%–62. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0. salinitas 24–25 ppt. Litopenaeus vannamei .4%–94. suhu 28°C–30°C. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7.2% serta WS berkisar antara 49. dan 23.1 kkal GE/g). rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi . C/P rasio 14. fotoperiod dibuat 12 jam terang–gelap.1% dan 65. laju pertumbuhan harian. kecernaan protein.4. C (protein 33%. Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%.00. C/P rasio 15. Ing Mokoginta**) dan Dedy Yaniharto***) *) **) Balai Riset Perikanan Tawar. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan.71%–22.2 kkal GE/g).intensif. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan).

IMNV dan PvNV . Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. KATA KUNCI: enzim. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. protein haemolimph dan ekspresi enzim (GPI. KATA KUNCI: Litopenaeus vannamei. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. SPF. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. L. Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. IHHNV. TSV. Haryanti*). SOD. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal.Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). and SP) pada udang yang sehat. EST. Lila Gardenia. dan moribund. Gondol Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. belum dapat diyakinkan secara pasti bahwa ekspresi EST. toleran. dan SP mampu berdiri sendiri. MBV. toleran. hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. SOD. EST. PGM. SOD. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. WSSV. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. SOD. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terus-menerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). dan SP. Untuk mengetahui jenis virus yang menyerang udang tersebut maka. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). PGM. Namun demikian. toleran dan terinfeksi TSV. Taura Syndrome Virus. dan Rustidja**) *) **) Balai Besar Riset Perikanan Budiaya Laut. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). Semua gejala tersebut diduga akibat adanya serangan virus.

Barito. dan D) 2 J : 4 B. Penelitian dilakukan dengan rancangan acak lengkap. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. Pada sistem tersebut kematian induk relatif rendah. 2%. 0. 25%. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan. dan 0. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%. dan D. berturut-turut 0. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Ciasem. Sebagai perlakuan adalah rasio jantan-betina. Musi.42 mm.20 g. 0. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. Penelitian meliputi pembenihan. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. diberikan pada pagi dan sore.25 g. diikuti perlakuan D. C.25 m2/ekor induk. 6. Imron. dan 9. rasio kelamin.5% berturut-turut untuk perlakuan A. 0. udang galah . berturut-turut 27%. Asahan. khususnya rasio jantan-betina. C) 2J : 2 B. dan pembesaran. yang dilakukan selama 5 bulan. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. KATA KUNCI: mortalitas. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). B) 1 J : 2 B. pendederan II. berdasarkan nilai heterosis yang didapat. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. dengan lama pengujian 8 minggu. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. B.27 mm. A dan B. pertumbuhan. yang meliputi pertambahan panjang dan bobot. dan 13%. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan.21 g. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. yaitu 0%. 0. Namun demikian.5%.31 mm. pendederan I. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Romy Suprapto. pemijahan. KATA KUNCI: genetik. beserta persilangannya. dengan sistem resirkulasi. dan tidak berbeda nyata antar perlakuan. persilangan. reproduksi.

(4.0±1. KATA KUNCI: bawang putih. sintasan (SR) dan perkembangan larva (LSI). Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan.5%.8±7. crossbreeding. Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰.4 mm) dan populasi inbreeding (21. dan D.00% dan 3. yaitu inbreeding. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan.0%) dan populasi inbreeding (25. Pada karakter pertumbuhan. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74. KATA KUNCI: inbreeding. (0 cfu/mL). (0 cfu/mL). Sukamandi. Perlakuan yang diberikan yaitu A (kontrol. namun tidak berbeda nyata (P>0.5% dan 3. Hasil penelitian menunjukkan bahwa pada karakter sintasan. 52. 45. Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah. Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi. dan D. formalin. keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. desinfektan. keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. 47. B (perendaman dalam larutan formalin 250 mg/L). Dinar Soelistyawati**). 37. Hewan uji yang digunakan adalah larva udang galah umur dua hari. (8.92. merupakan langkah bio-security. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. B. **) Jurusan Budidaya. B. Tiga tipe persilangan.05) terhadap kelimpahan bakteri.4 x 103 cfu/mL) . larva udang galah. C (perendaman dalam larutan ekstrak daun sirih). dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. outbreeding. dengan nilai sebagai berikut: A.5 x 103).4%) diikuti oleh populasi hasil crossbreeding (57.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*). Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah.8±1. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C.4 mm).6±21.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan. Harry Wuwungan**).7 mm) diikuti oleh populasi hasil outbreeding (21. Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya.0. tanpa penambahan desinfektan).93. Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan.5±28.93.8±1.83% dan 3. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0. sirih. 4. C. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan budidaya dapat dioptimalkan. C. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan. . yaitu A. dan D (perendaman dalam larutan ekstrak bawang putih).0%). Fakultas Perikanan dan Ilmu Kelautan.

Forum Inovasi Teknologi Akuakultur 2010

K 21
VARIASI FENOTIP UDANG GALAH (Macrobrachium rosenbergii) DARI POPULASI PERAIRAN KARAWANG, PELABUHAN RATU, DAN BONE
Eni Kusrini*), Lies Emmawati**), dan Wartono Hadie**)
*)

Balai Riset Budidaya Perikanan Ikan Hias, Depok
*)

Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang), Pelabuhan Ratu, dan Bone. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air,Karawang dengan Pelabuhan Ratu lebih dekat. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu.
KATA KUNCI: udang galah, populasi, jarak genetik

K 22
PEMELIHARAAN LARVA UDANG PAMA (Penaeus semisulcatus) DENGAN KEPADATAN BERBEDA
Muslimin, Sulaeman, Andi Tenriulo, dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. semisucatus) dengan kepadatan berbeda. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau, Maros dengan panjang awal mysis adalah 100-190 milimikron. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm, diameter 15 cm dan Volume 3 L. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm, lebar 40 cm, dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut, maka ditambahkan pemanas/heater suhu 30°C. Hewan uji ini ditebar dengan kepadatan berbeda. Perlakuan yang diujicobakan adalah: A. Kepadatan larva 25 ekor/L; B. Kepadatan larva 50 ekor/L; C. Kepadatan larva 75 ekor/L; D. Kepadatan larva 100 ekor/L; E. Kepadatan larva 125 ekor/L; dan F. Kepadatan larva 150 ekor/L. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap, di mana masing-masing perlakuan di ulang tiga kali. Jenis pakan yang diberikan berupa pakan alami chetoceros, artemia, dan pakan buatan. Pemberian pakan dilakukan setiap pagi dan sore (08.00 dan 16.00 wita). Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0,05) terhadap laju sintasan dan pertumbuhan larva udang pama. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%, (B) 32%, (C) 31%, (E) 24%, (D) 16%, dan (F) 10%.
KATA KUNCI: kepadatan, larva udang pama, sintasan dan pertumbuhan

Forum Inovasi Teknologi Akuakultur 2010

K 23
ESTIMASI PADAT TEBAR UDANG PAMA Penaeus semisulcatus BERDASARKAN TINGKAT KONSUMSI OKSIGEN
Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1.446–6.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan. Wadah percobaan yang digunakan adalah bentik jar (chamber), yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. Oksigen terlarut diukur dengan alat pengukur O2 (TPSTM Model WP-82 DO meters). Data laju respirasi selama proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. Ver.1.2. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan, dengan kisaran tingkat konsumsi oksigen 0,26–7,27 mg/g/jam. Kisaran kelarutan oksigen pada awal penelitian adalah 3,14–7,9 mg/L dan setelah 1 jam pengukuran 0,03–0,48 mg/L dan kontrol tetap berkisar 4 mg/L. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4,0235 g adalah 15,65 g/m3.
KATA KUNCI: udang pama, padat tebar, estimasi

K 24
POLIKULTUR KEPITING BAKAU (Scylla serrata) DAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN METODE TEBAR YANG BERBEDA
Sulaeman, Aan Fibro Widodo, dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan, akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP), BRPBAP, Maros. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0,18±0,03 g, panjang karapas 4,6±0,1 mm dan lebar karapas 5,9±0,1 mm. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar); B (metode gantung); dan C (gabungan antara keduanya). Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0,05) terhadap pertumbuhan bobot mutlak, bobot harian, pertumbuhan panjang dan lebar karapas mutlak dan harian, tetapi berpengaruh nyata (P<0,05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66,96 %; 58,17 kg/250 m2, disusul perlakuan C: 64,06; 44,95 kg/250 m2 dan terendah pada perlakuan B: 60,58%; 40,52 kg/250 m2.
KATA KUNCI: kepiting bakau, metode sebar, polikultur, rumput laut

Forum Inovasi Teknologi Akuakultur 2010

K 25
LAJU PEMANGSAAN LARVA KEPITING BAKAU (Scylla serrata) TERHADAP PAKAN ALAMI ROTIFERA (Brachionus SP.)
Aan Fibro Widodo, Sulaeman, dan Muslimin Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp.). Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros, Sulawesi Selatan. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau, yaitu: A (625 ind./mL); B (500 ind./mL); C (375 ind./mL); D (250 ind./mL); dan E (125 ind./mL). Peubah yang diamati adalah laju pemangsaan, sintasan, dan peubah kualitas air. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0,05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. Hasil terbaik diperoleh pada perlakuan A, yaitu kepadatan rotifera 625 ind./mL dengan laju pemangsaan sebesar 259,1667 ind./larva/jam dan sintasan 86,0%.
KATA KUNCI: kepadatan, kepiting bakau, laju pemangsaan, rotifera, zoea

K 26
ANALISIS DIATOM EPIPELIC SEBAGAI INDIKATOR KUALITAS AIR DAN TANAHUNTUK BUDIDAYA UDANG
Supono Budidaya Perairan Universitas Lampung

ABSTRAK
Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Karena hidup di dasar tambak, jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang, yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang. Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. Selain diatom epipelic, data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0,75), TOM (rs = 0,71), dan nitrat (rs = 0,66), sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0,72), kandungan liat (rs = 0,65), dan kandungan bahan organik (rs = 0,62).
KATA KUNCI: diatom epipelic, tambak udang, kualitas air, kualitas sedimen

Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot. panjang standar. namun kemampuan produksi para pembudidaya hanya sampai 4 inci.9 g. Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci. Bogor.74) dan panjang (7. pertumbuhan. lokasi . KATA KUNCI: Cherax quadricarinatus.47) terbaik adalah benih lobster air tawar asal Tangerang. simpangan baku. Dianalisis dengan Rancangan Acak Lengkap (RAL). panjang standar. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2. ragam.0 cm dan adanya pertambahan bobot sebesar 58.6±10. dan panjang total).9±9. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci. Gleni Hasan Huwoyon. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan.Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini. Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan.6-71. dan Tulung Agung). Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang.6-7. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda. dan panjang total tiap individu.72). benih.0±0. Pertambahan bobot (71. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55.

31 m. KATA KUNCI: Haliotis squamata. (C) Sargassum sp. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang. masing-masing 58. Gracilaria. + Ulva sp.50 g dan 217.02 g. yaitu: (A) Gracilaria sp. Ulva.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria.73±2. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut. dan C berturut-turut adalah 120. cottoni. B. dan kombinasi keduanya.19 ± 6.05) antar perlakuan.52 µg/hari) dan terendah pemberian pakan Sargassum sp. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon. pakan (B)= E.891.37 mm. + Sargassum sp. + Ulva sp.92 g dan 219. Ulva sp.06 g.73 g. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir. Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp.44 ± 102.68 µg/hari).00 µm dan 38. yaitu pada perlakuan pemberian pakan Gracilaria sp.06 µg/hari). aplikasi teknologi pembesaran . Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan.23 g dan 121.. (rasio 1:1:1). 73.56 ± 48. 38.44 µm dan 65.39 mm dan 10. Sargassum.59±2. (B) Ulva sp.0 ± 0. Riani Rahmawati.44 µg.854. E. + Ulva sp. kombinasi Gracilaria sp. (13. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30.39 m x 0. dan Sargassum sp.9 ± 1. (P<0. dilakukan dengan menerapkan 4 perlakuan pemberian pakan.26 ± 10.06 ± 170. squamata. (-5.17 ± 2. Bambang Susanto.05). pakan (B) dengan R² = 0. I Nyoman Adiasmara Giri.99 mm dan 36. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali.. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. cottonii : 40.18 mm dan 7. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata. + Sargassum sp.16 g dan -86.89 µm dan 38.613. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m.17 ± 25.58 m x 0. lebar dan bobot cangkang. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit.44 µg serta 92. + Sargassum sp. serta pakan (C)= kombinasi Gracilaria + E. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir.80 sampai 31.03 ± 1.1 ± 4. Riani Rahmawati. dan pakan (C) dengan R² = 0. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A.05 mm dan 10. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41.. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0. sangat sesuai dalam memacu pematangan gonad induk abalon H. (D) Kombinasi Gracilaria sp. cottonii 37. KATA KUNCI: abalon Haliotis squamata. (7.82 µg/hari). Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0. Ibnu Rusdi.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp.44 µg. (13.39 g. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0.

hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery.2 g dan panjang cangkang 2.13) lebih tinggi dibandingkan dengan induk asal Bali (0. Pakan dengan proporsi Gracilaria sp. 60/40% memberikan pertumbuhan abalon terbaik. tinggi 22 cm. Hirmawan Tirta Yudha. KATA KUNCI: allozyme.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin. Tatam Sutarmat. Est-4* dan Cah-3*. Est-2*. Abalon diberi pakan rumput laut Gracilaria sp. dengan bobot awal 2.52. dan Ulva sp. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. Est-3*. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. Est-1*. Untuk itu. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. Kepadatan awal benih abalon adalah 450 ekor per wadah. Ibnu Rusdi. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. 80/20% (B). dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut. genetic monitoring. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air. Nilai variasi genetik induk abalone asal Banten (0. mengingat permintaannya yang cukup tinggi. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. proporsi pakan. KATA KUNCI: abalon Haliotis squamata. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. Gpi*. pembesaran. dengan proporsi yang berbeda Gracilaria sp. Setiap perlakuan terdiri atas 2 ulangan. penjarangan .6-3./Ulva sp. dan 60/40% (C) sebagai perlakuan. 100/0% (A)./Ulva sp. wild. Gondol. Sampel yang digunakan berasal dari Bali dan Banten. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. peluang pasar serta teknik budidayanya yang sederhana.06). dan Ulva sp. Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan.7 cm.

Forum Inovasi Teknologi Akuakultur 2010

M 05
ISOLASI, KARAKTERISASI, DAN UJI PATOGENISITAS BAKTERI VIBRIO YANG DIISOLASI DARI LARVA ABALON SAKIT DI HATCHERI
Zafran, Indah Mastuti, dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. Karena itu, tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut, Gondol, Bali. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar, yaitu media spesifik untuk bakteri Vibrio. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0,05 µm). Setiap perlakuan diulang 3 kali. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1, isolat-2, dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13,33%; 18,33%; dan 21,67%; sedangkan mortalitas pada kelompok kontrol hanya 3,33%.
KATA KUNCI: abalon, Haliotis squamata, vibriosis, Vibrio cincinnatiensis, uji patogenisitas

M 06
PENDEDERAN TIRAM MUTIARA (Pinctada maxima) DENGAN PERBEDAAN UKURAN TEBAR AWAL
Sudewi, Apri I. Supii, dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan. Namun, masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan. Perlakuan yang diberikan adalah ukuran tebar 3,44±0,44 mm (perlakuan A); 10,85±0,1 mm (perlakuan B); dan 20,36±0,55 mm (perlakuan C). Parameter yang diamati adalah laju pertumbuhan harian dan sintasan. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0,44±0,01 mm/hari (perlakuan A); 0,46±0,03 mm/hari (perlakuan B) dan 0,30±0,01 mm/hari (perlakuan C). Laju pertumbuhan lebar cangkang 0,37±0,01 mm/hari (perlakuan A); 0,4±0,03 mm/hari (perlakuan B) dan 0,27±0,00 mm/hari (perlakuan C). Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0,05) dibandingkan dengan perlakuan C. Sintasan yang diperoleh untuk perlakuan A, B, dan C berturut-turut 37,16%; 71,69%; dan 46,42%. Oleh karena itu, untuk memperoleh pertumbuhan dan sintasan yang baik, penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm.
KATA KUNCI: Pinctada maxima, pertumbuhan, sintasan, ukuran awal spat

Forum Inovasi Teknologi Akuakultur 2010

M 07
KAJIAN POTENSI KELAUTAN UNTUK BUDIDAYA TIRAM MUTIARA (Pinctada maxima) DI WILAYAH PESISIR KABUPATEN JEMBRANA-BALI
Apri I. Supii*), Ida Ayu Astarini**), dan Sudewi*)
*)

Balai Besar Riset Perikanan Budidaya Laut, Gondol
**)

Fakultas MIPA Universitas Udayana

ABSTRAK
Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan, pada tingkat nasional, regional maupun lokal. Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Berdasarkan hasil pengkajian, secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari, Sumber Sari, Teluk Awen, dan Teluk Rabu. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara, akan tetapi jika diinginkan, budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. Pantai Pengambengan khususnya, tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai.
KATA KUNCI: potensi kelautan, tiram mutiara, Pinctada maxima, Jembrana

Forum Inovasi Teknologi Akuakultur 2010

LL 1
PERFORMANSI PERTUMBUHAN DAN KANDUNGAN KERAGINAN RUMPUT LAUT (Kappaphycus alvarezii) DENGAN APLIKASI METODE BUDIDAYA VERTIKULTUR
Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Produksi rumput laut ditargetkan meningkat dari 2,6 juta ton per tahun sekarang ini menjadi 7,6 juta ton per tahun pada 2014, sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. Umumnya pembudidaya rumput laut, Kappaphycus sp. mengaplikasikan metode long line, di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut, Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan, yakni 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m, di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masing-masing dengan 3 kali ulangan. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver. 3,1. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut, K. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m dari permukaan perairan. Oleh karena itu, metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468,75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan.
KATA KUNCI: Kappaphycus alvarezii, pertumbuhan, kandungan keraginan, vertikultur

LL 2
PERBANYAKAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN KULTUR JARINGAN MENGGUNAKAN WADAH YANG BERBEDA
Siti Fadilah, Rosmiati, dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. verrucosa. Rumput laut dikumpulkan dari Kabupaten Brebes, Jawa Tengah. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0,1%. Eksplan diinokulasi ke dalam media cair yang diperkaya PES. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker, sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu. Pengamatan panjang tunas, jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81,70%) daripada botol (90,75%). Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2,40 mm pada stoples dan 2,42 mm pada botol. Sedangkan jumlah tunas dalam stoples (7,50) lebih banyak dibandingkan dalam botol (7,03). Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26,70 dibandingkan dalam botol yang hanya 6,20.
KATA KUNCI: botol, kepadatan eksplan, stoples

ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT. Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) . dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. KATA KUNCI: mutu genetik. Alias L. Fadilah. Utut Widyastuti***). Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. promoter. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep.e dan stabil setelah jam ke9 sampai ke-12 s. Balai Riset Perikanan Budidaya Air Payau.Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT. cytomegalovirus/ CMV.BPPT. daya tahan penyakit. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. ZPT. Kappaphycus alvarezii Muh. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0.e). Keratin dan b-actin. Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. hibridisasi. jumlah kejutan: 4 kali dan interval kejutan: 0.Irvan Faizal****). intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%–10%. Makassar **) Departemen Budidaya Perairan-FPIK. Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV. Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. Rosmiati. Pola ekspresi keempat promoter relatif sama. dan sumber karbon yang berbeda. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. b-actin. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm.1 second. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. panjang kejutan: 0. dan St. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati. Rajamuddin*). Sebagai tahap awal dalam rangka produksi rumput laut transgenik. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. fusi protoplas . puncak jam ketiga – keenam s.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12.e. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik. persentase sel berpendar rata-rata 10%. Alimuddin**). Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. kappaphycus alvarezii.5 mili/second. mulai berpendar jam pertama – kedua setelah elektroporasi (s. transgenesis. KATA KUNCI: Kappaphycus alvarezii.

wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang. I Nyoman Radiarta.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. Erlania. Rekomendasi pencegahan penyakit. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. Untuk itu. Kabupaten Pandeglang. Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. kondisi sosek-ekonomi. Pada umumnya. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. taman nasional ujung kulon. dan status wilayah kawasan. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. khususnya di Kecamatan Sumur. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. Pandeglang . konservasi dan wisata). Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. KATA KUNCI: rumput laut. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. SIG. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. pembudidaya rumput laut. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut.

Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh. morfologi. Alias L.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati. Rosmiati. 0. Ridwan*). 0. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. KATA KUNCI: keragaman.8%).0:0. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. Pada tahap induksi kalus. kalus. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%. dan 2. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio.0:1.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm).2 mg/L) dengan konsentrasi agar media induksi (0. dan 0. Pada tahap regenerasi massa sel embriogenik. Tahap (2) adalah regenerasi massa sel embriogenik somatik.1:1.6%. 0. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0. KATA KUNCI : Kappaphycus alvarezii. 1. Perkembangan sel-sel embriogenik diamati pada kultur cair. Makassar **) Balai Riset Perikanan Budidaya Air Payau.4%.8%. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii. Rajamuddin*). 1.5:0. adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan.0 mg/L. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0.0 mg/L.5%).0 mg/L.0% menghasilkan persentase induksi kalus tertinggi (90%). Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen.6%. embriogenesis somatik .4 mg/L. Andi Asdar Jaya*). Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid.6% dan 0.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0. pada rasio IAA: kinetin (0. pengggantian media dilakukan setiap minggu dengan komposisi media yang sama.0%.0:0. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis. embrio somatik. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau.8% dan 1. dan 1. Pemeliharaan dilakukan selama 8 minggu.1 mg/L) dengan konsentrasi agar (0.5 mm dapat dicapai dalam satu bulan kultur. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan. Pada media cair.

01-2973–1992 dan SII 0177–1990. KATA KUNCI: rumput laut.780. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. aroma. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. crakers. A-2 (30% tepung rumput laut dan 70% tepung terigu). Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. produksi pada tahun 2008 sebesar 750 ton. dan berpengaruh nyata terhadap rupa dan tekstur. KATA KUNCI: strategi pengembangan. Parameter mutunya adalah kandungan zat gizi (air.24 ha. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. abu. Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. rumput laut. Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein.143. Hasnawi. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. kadar abu. lemak. dan karbohidrat) dan uji organoleptik.13 ha dan 3. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn 85%. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. A-1 (15% tepung rumput laut dan 85% tepung terigu). memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. gizi. protein. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. denga metode budidaya tali panjang (long line). Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. uji organoleptik . Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. rasa.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam program-program pokok pengembangan. Mery Sukmiwati.

28% dengan rata-rata 7. namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. tambak. SPOS. Kapur pertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur.71 g/cm3 dengan rata-rata 0. Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95. SKCl. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra ALOS AVNIR-2 akuisisi 28 Juli 2009. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta. Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut.29 ton/ha dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan.32 dan 113. S POS . Kebutuhan kapur didasarkan pada nilai SPOS tanah dengan mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur. Adang Saputra.09 dan 90.884 g/cm3 dan SPOS tanah berkisar antara 0.78% sehingga memiliki faktor konversi berturut-turut sebesar 2. Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia. pHFOX. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai SPOS tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat dan berkelanjutan. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan. bahan organik dan berat volume tanah. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. inderaja. klorofil-a dan suhu permukaan laut). KATA KUNCI: budidaya laut. KATA KUNCI: kebutuhan kapur.02% serta 44. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI SPOS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. Maluku . Penelitian ini bertujuan untuk melakukan analisis spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG).02. pirit. Rachmansyah. SIG.60 dan 36. ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. Oleh karena itu. Kebutuhan kapur CaCO3 untuk tambak di Kabupaten Mamuju berkisar antara 1.30 dan 1. Program ArcView 3.36 dan 3. tanah.15 dan 19.2 digunakan untuk pembuatan peta distribusi SPOS tanah. SP.614%. infrastruktur (jalan) dan sebaran penduduk. analisis spasial. Maros ABSTRAK Kabupaten Mamuju. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. Peubah kualitas tanah yang diukur adalah: pHF.

hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. dan analisis usaha perikanan. Introduksi kaji terap dilakukan dilahan seluas 2. rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara. rumput laut. analisis komoditas unggulan dan andalan. Di samping itu. KATA KUNCI: minapolitan. Jakarta **) Pusat Riset Perikanan Budidaya. udang dan bandeng. bandeng LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). konversi pakan serta pertumbuhan yang cukup baik. Hatim Albasri**). Jakarta **) Pusat Riset Perikanan Budidaya. peningkatan pendapatan. Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. analisis komoditas. ikan patin. dan Sularto***) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. analisis location quotient. Evi Tahapari***). Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ).400 m2 selama 3 bulan pemeliharaan. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. KATA KUNCI: produktivitas tambak. dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. udang. tambak terbengkalai. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. Wartono Hadie**).Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). Sukamandi *) ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. Kabupaten Brebes . Adang Saputra**). Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan.

Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. sagu (Metroxylon sagu). pHOX. Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. pHFOX dan potensial redoks. padi (Oryza sativa). tanah. nipah (Nypa fruticans). rumput.50-0. rumput. bakau (Rhizophora apiculata). campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). TAA. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. KATA KUNCI: keragaman.50-0. karbon organik. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. nipah. Al dan tekstur. nipah. sedangkan yang dianalisis di laboratorium adalah pHKCl. campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. Marsambuana Pirzan. masingmasing pada kedalaman tanah 0-0. Kualitas tanah yang diukur langsung di lapangan adalah pHF. penutup/penggunaan lahan. tanpa vegetasi. SP. TSA. bakau. Kabupaten Mamuju . Pada kedalaman 0-0. sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. SKCl. rumput. N-total. Fe.75 m tanah vegetasi api-api. paku laut (Acrostichum aureum). pirit.25 m tanah jenis penutup/penggunaan lahan api-api. pesisir.75 m. Oleh karena itu. kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. kelapa (Cocos nucifera). Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah.25 m dan 0. PO4. dan Kamariah Balai Riset Perikanan Budidaya Air Payau. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). A. bakau. TPA. Hasil penelitian menunjukkan bahwa. sagu. Pada kedalaman 0. pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent. SPOS.

tersebar di wilayah pesisir Kecamatan Sungai Pinyuh. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. nitrat. Data sekunder yang diperoleh berupa data iklim. dan fosfat. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50.000.000. dianalisis secara spasial dengan metode PATTERN menggunakan SIG. nitrat. tambak. Oleh karena itu.398 µg/L. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). Data lapangan (fisiko-kimia air dan tanah). amonia. KATA KUNCI: kesesuaian lahan. KATA KUNCI: klorofil. sedangkan yang kurang sesuai (213. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. dan bahan organik total. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. kualitas air. tambak. Akhmad Mustafa. pH. nitrit. KALIMANTAN BARAT Utojo. terdapat di Kecamatan Segedong dan Siantan. Sungai Kunyit.819 ha). amonia. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. data sekunder. nitrit. Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil. sedangkan peubah bebas adalah suhu.046 dan 22. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia.077 ha. oksigen terlarut. pH. fosfat.047 dengan rata-rata 6. Sulawesi Barat . Mempawah Hilir dan Mempawah Timur. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. walaupun dengan model regresi yang berbeda. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat.272 ha). cukup sesuai (168. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. dan data citra satelit digital. salinitas. Pada umumnya yang tergolong sangat sesuai (114. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil.986 ha).

KATA KUNCI: makrobentos. kolam..02–8. Analisis kandungan minyak nabati Dunaliella sp. Parameter kualitas air yang diamati adalah suhu..0 sel/mL. 5:4. Chironomus sp. penghitungan kelimpahan. kemudian 6. pupuk. total bahan organik (TOM).05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L.75). Bogor. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda. dengan menggunakan cara modifikasi (Banerjee et al. KATA KUNCI: mikroalga. BRPBAT. Tidak terdapat perbedaan nyata (P>0. dan Nematoda. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. Spesies dominan adalah Limnaea sp. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp. dan BOD5.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan.). kecerahan. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung. Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8. Analisis data dilakukan secara deskriptif untuk komposisi jenis. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Kultur ini ditempatkan diluar ruangan. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9. minyak nabati .60% menggunakan perlakuan pelarut hexana. 2006). 2002 dan Dayananda et al. dan penghitungan dilakukan di laboratorium. pH. identifikasi. indeks diversitas dan keseragaman spesies. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5.. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Dunaliella. Kultivasi Dunaliella sp. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. dilakukan di dalam bakbak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. ekstraksi. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0. Jakarta. dan 6:3. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp.. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP.5 mg/L. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya. DO. Proses pengayakan termasuk penyeleksian. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4.

Botryococcus braunii .33 sel/mL pada sistem indoor dan 7. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. Berdasarkan perhitungan statistik ANOVA. rawan pangan. dengan skor 19. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. salah satunya adalah Desa Merakan di daerah Jawa Timur. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan.25/ hari pada indoor dan 3. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. Pengolahan data dilakukan secara deskriptif.65/hari pada outdoor. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. dan pH. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. Departemen Pertanian. KATA KUNCI: kepadatan. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. 02 sel/mL pada sistem outdoor. KATA KUNCI: ketahanan pangan. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12. laju pertumbuhan. salinitas. braunii.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan.37. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. Metode penelitian menggunakan metode survei.

penanganan aspek teknis. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. Isti Koesharyani. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. Infeksi bakteri.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. pengelolaan bisnis. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. Bakteri merupakan salah satu penyebab penyakit pada ikan. kemungkinan merupakan strain yang tidak pathogen. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. tes katalase dan oksidase dilakukan sebelum uji PCR. penanganan aspek teknis. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. pembudidayaan. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. Uji awal berupa pengecatan gram. profitabilitas. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. KATA KUNCI: unit usaha. dan Balai Budidaya Laut (BBL) Ambon. uji PCR. aerolysin dan primer spesifik . Sedangkan dengan menggunakan spesifik primer. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. sehingga AH-26 merupakan isolat yang pathogen. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. KATA KUNCI: Aeromonas hydrophila. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin.

namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae. periphyton. Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman.Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat. Waduk Cirata . kedalaman 3 meter(C) dan kedalaman 4 meter (D).Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti.86-0.masing perlakuan 5 kali ulangan.81 (ind/cm2) dan 0. Masing. kedalaman 2 meter (B). Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar.91. Winarlin. Ani Widiyati. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m). KATA KUNCI: kedalaman. yaitu 4423. Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A).

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. sintasan terendah didapatkan pada salinitas 12 ppt.Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. Masingmasing perlakuan menggunakan 2 ulangan. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. pertumbuhan . Cianjur Wildan. Bogor ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. salinitas. Hary Krettiawan*). Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. ikan nila. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. dan Sutisna Kuningan. lebar 40 cm. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. Jakarta Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. KATA KUNCI: streptococcosis. Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. dan tinggi 40 cm dengan ketinggian air 15 cm. Akuarium yang digunakan berukuran panjang 60 cm. dan Achmad Sudradjat*) **) *) Pusat Riset Perikanan Budidaya. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*). Sidi Asih***). dan 12 ppt (11–15 ppt). telah banyak menginfeksi ikan nila. Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. Majalaya. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. ikan mas. sintasan. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas. KATA KUNCI: strain. 8 ppt (6–10 ppt).

Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. KATA KUNCI: budidaya. Jawa. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. ekonomi. yang diberi sekat jaring nilon hita. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. anakan ikan nila . Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan SeptemberNovember 2009. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan.20 siklus dan nilai RC ratio sebesar 1. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain. Dalam hal dukungan dana permodalan. ikan belida yang banyak hidup di perairan umum Sumatera. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september . perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. Iwan Malhani Al’Wazan.64 sedangkan FCR total sebesar 1.36. dengan jangka waktu pengembalian modal selama 3. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. termasuk jenis ikan karnivor. pakan. dan kalimantan. Jakarta ABSTRAK Ikan karnivor. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4. Pemeliharaan ikan belida dilakukan di kolam. KATA KUCI: ikan belida. Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya.53.

jaring tancap dan keramba jaring apung. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. Jakarta Balai Riset Perikanan Budidaya Air Tawar. Selama proses adaptasi pada kolam pemeliharaan. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. Untuk menguasai teknologi domestikasinya. KATA KUNCI: ikan belida. Budidaya ikan nila dapat dilakukan di kolam. Dalam kegiatan budidaya ikan. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. pelet maggot . pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. yang dikenal dengan nama PKM (palm kernel meal). palm kernal meal. kurang lebih 60% pengeluaran berasal dari pakan. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. KATA KUNCI: ikan nila. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) **) Pusat Riset Perikanan Budidaya. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva.

Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). Masing-masing perlakuan diulang 3 kali. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. 25 – 1. sintasan. bakteri maupun berbagai jenis parasit. 65 g/ ekor. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia. Pendederan ikan kerapu macan. Epinephelus fuscoguttatus. Fris Johnny. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. KATA KUNCI: pertumbuhan.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. dan Zafran Balai Besar Riset Perikanan Budidaya Laut.150. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). 05) tidak mempengaruhi sintasan. KATA KUNCI: vaksin bakteri. Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. Rasio konversi pakan 1. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. sedangkan kontrol hanya disuntik dengan PBS. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bakbak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. 95 – 2. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. 05. baik disebabkan oleh infeksi virus. Padat penebaran yang digunakan sebagai perlakuan adalah 100. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. penyakit infeksi . dan 200 ekor/m³.

Perlakuan dalam penelitian adalah (A) Induk hasil budidaya. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya.000 butir. aspek biologi reproduksi . Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. dengan jumlah 8% biomass/hari. dan pada induk asal alam 20-92 % dengan SAI 2. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. Apri I. dan (B) Induk asal alam. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. KATA KUNCI: kerapu raja sunu. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. indeks somatik gonad dan diameter oocytnya. Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam.004. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 .20.80. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3.25-4. Kualitas telur yang dihasilkan relatif masih fluktuatif. Supii.000 butir. Agus Priyono. Plectropoma laevis. Tridjoko.240. Ketut Suwirya. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³.450. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan.520 µm.

konversi pakan. Himawan Tirta Yudha. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. KATA KUNCI: truss morfometrik. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. tawes .Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. dibandingkan dengan perlakuan lainnya. Rudy Gustiano. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. tengadak albino. Peubah yang diamati adalah sintasan. total biomass dan biaya pakan. pertumbuhan. ikan tengadak. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. dengan periode pemeliharaan120 hari. (1988). pertambahan berat. Kata kunci : Jaring apung. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. Hasil penelitian menunjukkan bahwa laju pertumbuhan. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung.A. dan N. Giri Balai Besar Riset Perikanan Budidaya Laut. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. pertambahan berat. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). Konversi pakan terendah pada pemberian pellet GR pada kelompok A. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi.

Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat.4%) pada kolam substrat 1 (pasir.36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0.05) dibandingkan kolam ikan kontrol (82.081–0.32 %). yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat).4–0. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan. nitrogen. karena di samping harus efektif terhadap hama tanaman padi. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan. Untuk itu. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7.681mg/L) dan nitrat (0. karbofuran.5 mg/L). kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur. dan Scirpus sp.Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar.5%–90.849 mg/L) dan nitrat (0. juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut. Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0. Kisaran persentase efektivitas penyisihan TN (28%– 58.8 mg/L).lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8.86%–85. Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air. Sintasan (93. khususnya ikan. amonia (20. Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi. amonia (0. dan nitrat (11.).5–14. Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi. KATA KUNCI: toksisitas. Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen.33%). Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar. amonia (0.82%). Perlakuan pada penelitian ini terdiri atas dua perlakuan.67%). amonia (42. akut. KATA KUNCI: substrat.303–1. kronis . dan nitrat (37.05).82%).5%–66. produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar.14%–92. Typha sp.7–1.58%). pemakaian insektisida perlu dilakukan secara selektif.5 mg/L). tumbuhan air. yaitu TN (42. yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air).11%–44.3 mg/L).

ginjal. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis. Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut.00 mg/L. Ketujuh perlakuan itu yaitu: (a) biji teh 10. dan limpa. gurame. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. Dua pasang primer. Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya. (f) garam 6.000. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies.00 mg/L (g) kontrol. Ada beberapa bahan nabati dan alami yang dapat digunakan. Hasil penelitian menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi.00 mg/L.00 mg/L. Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum. dan Quadriacanthus kobiensis serta menimbulkan kematian. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. yaitu M1: T39 (GCGAACGGGTGAGTAACACG) dan T13 (TGCACACAGGCCACAAGGGA). Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar. Trichodina. limpa. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10.00–20. dan primer M2: PreT43 (AATGGGCGCAAGCCTGATG) dan T531 (ACCGCTACACCAGGAAT) digunakan pada penelitian ini.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar.000. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy). Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. Mycobacterium fortuitum.00 mg/L dan garam 4. serbuk biji teh dan garam. Pada riset ini. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain–Jenssen.00 mg/L efektif untuk memberantas Trichodina dan monogenea. selanjutnya dibandingkan dengan teknik diagnosa melalui uji biokimia dan histopatologis. (e) garam 5. yang telah dikembangkan oleh beberapa peneliti.000. Gyrodactylus. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp.00 mg/L.00 mg/ L. (b) biji teh 15. dan darah. sedangkan preparat histopatologi diambil dari organ hati.00–6. (d) garam 4. (c) biji teh 20. dan Polymerase Chain Reaction . mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. KATA KUNCI: ekstoparasit. Dactylogyrus. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. Sensitivitas teknik diagnosa terhadap bakteri target. sehingga upaya pengendaliannya sering terlambat. Oleh karena itu. KATA KUNCI: mycobacteriosis. Mycobacterium fortuitum PADA IKAN GURAME.

dan 2.000 unit fitase/kg pakan. dan sintasan ikan beronang. dan tingkat sintasan.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. efisiensi pakan.73 g dengan padat tebar 15 ekor/keramba. nilem. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap. pakan ikan beronang. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan. Hasil penelitian menunjukkan bahwa penggunaan fitase 1.500. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau. Cijeruk dengan bobot rata-rata 8. 1.60±0. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya.000.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0. 500. KATA KUNCI: fitase.05) terhadap pertumbuhan.500 dan 2. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0. 1. guttatus . pertumbuhan. C. substitusi. efisiensi pakan.V. KATA KUNCI: tepung bungkil kedelai. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang. Parameter yang diamati yaitu laju pertumbuhan spesifik.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti. rasio efisiensi protein. Bogor.000 unit/kg pakan.15±5. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai. S. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. tepung bungkil kopra. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan.45 g/ekor. namun nilai ini tidak berbeda nyata dengan 1.05). Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan. Balai Riset Perikanan Budidaya Air Tawar. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0.

Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana.). Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif. Tjaronge Balai Riset Perikanan Budidaya Air Payau. Maros selama 40 Hari. rajungan. Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis. bobot dan sintasan serta kualitas air. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass. tambak. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak. pelet. sintasan . B. 50% ikan rucah + 50% pelet. pertumbuhan.850. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap.04 ± 0.02 g. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus). lebar karapas dan sintasan (P>0. KATA KUNCI: budidaya bandeng. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. KATA KUNCI: pakan rucah.2 ± 0. 100% pakan buatan/pelet dan C. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur).526.Variabel yang diamati adalah pertumbuhan lebar karapas.2 mm dan bobot 0. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm.-/tahun/ha. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut.05) dengan perlakuan yang lain. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot. Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. 100% ikan rucah jenis ikan tembang (Clupea sp.

35. pupuk kandang dan dedak. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. masing-masing mencapai 986. Selama pemeliharaan. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut. pertumbuhan panjang.816%. Oleh karena itu.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B). Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10.5 x 0.5 cm (ukuran ekspor). Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Nina Meilisza. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. dan Lili Sholichah Balai Riset Budidaya Ikan Hias.009 gram. Padat penebaran bandeng pada masingmasing perlakuan adalah 15.-. 20. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2.5 x 0.43. B/C rasio 1. bandeng.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara. Erfan Andi Hendradjat. Produksi bandeng pada perlakuan A dan B.467. ampas tahu.100. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).9 dan 1154 kg/ha.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2.5 ton/ha. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1. Sintasan bandeng pada perlakuan A dan B. Pada akhir penelitian (hari ke 105).5 m dan tinggi air 40 cm. KATA KUNCI: benih botia.0 cm.0 cm dan bobot rata-rata 0. masing-masing mencapai 56. ukuran ekspor 1 inchi (2.625% dan 60. dan 105 dan dianalisis secara deskriptif. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. masing-masing dengan dosis 2. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran. 70. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2.98 g/ekor menjadi 232. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia.5 cm) . 55. KATA KUNCI: pupuk organik. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B). Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2.5 cm dan panjang tertinggi sebesar 3.

5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi.0 – 6.32 ± 0. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi. memberikan pengaruh yang berbeda nyata (P<0. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian.24 cm. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula. Rendy Ginanjar. dan Irsyaphiani Insan**) *) **) Balai Riset Budidaya Ikan Hias. Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali. pakan alami.. pendederan. Pakan diberikan tiga kali sehari yaitu pada pukul 8..0-8. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp. Agus Priyadi*).98 ± 0. Jakarta ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua.. Depok.00. pertumbuhan.50 ± 0.5 – 5. Gigih Setia Wibawa*). Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5.01 g dan panjang total rata-rata 3. pH air pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur. ikan diberi perlakuan pemberian pakan alami yang berbeda.85 ± 0. 12.9 dan pH 7. pH 6. Depok Pusat Riset Perikanan Budidaya. KATA KUNCI: Benih ikan pelangi.0 – 8.05) terhadap rata-rata pertambahan panjang total dan sintasannya.0. gonad. namun tidak berbeda nyata (P>0. dan (C) Tubifex sp. KATA KUNCI: Melanotaenia sp.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor. dengan pertambahan bobot rata-rata sebesar 0. Hasil penelitian menunjukkan bahwa perlakuan pH 7. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya. (B) Culex sp.00 dengan metode pemberian sekenyangnya (adlibitum). Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat.) Eni Kusrini*). memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp. (A) Chironomus sp.05) terhadap pertambahan bobot rata-rata ikan. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. sintasan . dan Culex sp. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar.8 (sebagai kontrol). Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp. Selama 45 hari pemeliharaan.Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP.00 dan 16. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp.09 g dan pertambahan panjang total rata-rata sebesar 0.

padat tebar. dan Jacques Slembrouck**) **) *) Balai Riset Budidaya Ikan Hias Depok. 96. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). C. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap. Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari.07%. tetapi berpengaruh nyata (p<0. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara. Lili Sholichah*). Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. 25 ekor/liter.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*).02 g.45%. B. 15 ekor/liter. B. KATA KUNCI: Metynnis hypsauchen. padat tebar . Sintasan dari masing-masing perlakuan adalah sebagai berikut: A.67%.05) terhadap pertumbuhan.67 mm. ketersediaan pakan dan padat penebaran. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). 20 ekor/liter.02 cm dengan bobot 0. B (2 ekor/L). KATA KUNCI: ikan botia. pertumbuhan. D. Ikan uji yang digunakan adalah benih berukuran panjang 2.81%. D. Depok Universitas Diponegoro. Pakan yang diberikan selama penelitian adalah nauplii artemia. Indonesia Institute Recherche Pour Le Developpement. 96. resirkulasi. C. Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan. Prancis ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi.22% dan E.22±0. Rendy Ginanjar*). 95.13±0. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan. 96. 30 ekor/liter dan E. Marendra Gladiyakti**) *) **) Balai Riset Budidaya Ikan Hias. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). 35 ekor/liter. sintasan. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. Asep Permana*). Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. 97. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia. Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar.

Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. KATA KUNCI: maggot. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. Unit pengolah pakan memiliki prasyarat sebagai berikut. area penjemuran atau alat pengeringan pakan (drying). Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. Migrasi terbagi menjadi migrasi vertical dan horizontal. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. propinsi Jambi. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. bahan pakan seperti vitamin dan dedak. memiliki mesin pelet. memiliki bak untuk restokin. Kawasan Mina Pakan Mandiri. fisiologi dan tingkah laku dalam merespon perubahan lingkungan. Ikan Sidat (Anguilla sp. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima.) . biokonversi.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. dan homing atau reproduksi. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. Unit budidaya ikan memiliki prasyarat sebagai berikut. Unit produksi maggot memiliki prasyaratan sebagai berikut. memiliki bak kultur. ketersediaan pakan dan pemasaran. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. temperature. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. KATA KUNCI: Phenotipic plasticity. air tersedia dalam jumah yang cukup. 2) unit pengolahan pakan dan 3) unit budidaya. lunar. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. kolam budidaya dan manajement budidaya yang baik. Ikan migrasi. Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. makanan. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). salinitas dan arus. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). sedangkan factor eksternal yaitu.

16 mM. dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. Hasil dari persentase polimorfik (berkisar 5.26% – 63.Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif.17 mM. terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&).h-1 dan 0. Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik. tetapi yang menghasilkan benih hanya 15 populasi. dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. mujair (O.28 mM. Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST. Sukamandi. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan. untuk mengamati variasi genetik benih persilangan ikan nila. Ikan yang di gunakan adalah hasil persilangan 4 strain. nitrogen anorganik. Persilangan. reduksi nitrat . nila BEST (Bogor Enhancement Strain of Tilapia). Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O. Aktivitas reduksi nitrat terjadi dari awal inkubasi.236 – 0.mossambicus).mossambicus). Oreochromis niloticus . Didik Ariyanto. jarak genetik. juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut.h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi. Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. mossambicus) Nunuk Listiyowati.560). Jarak genetik 15 populasi persilangan berkisar (0. Iman Rusmana**). nila merah (Red NIFI).40 mM dan 0. Kata kunci: denitrifikasi. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. NIRWANA (nila ras wanayasa).15%). Kata kunci: Randomly Amplified Polymorphic DNA (RAPD). Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD). Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*). Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi. Selain itu. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan dengan Pseudomonas aeruginosa.

37% dan meningkatkan kadar protein dari 13. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.8%. menurunkan lemak bungkil sawit dari 14. Sukamandi **) Universitas Jenderal Soedirman. kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi. Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. Isdy Sulistyo2).. Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). PGC terdistribusi secara berkelompok di bagian ventral. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia.) Priadi Setyawan1).09% menjadi 4. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia. inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm.74% menjadi 5. migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. nutrisi dan serat kasar . Osphronemus goramy. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. KATA KUNCI: Bacillus sp. fermentasi. 4 hari (D2). ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. 6 hari (D3). Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia. Pada tahap pembentukan mata. KATA KUNCI: PGC. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. distibusi. rasio inti sel:sitoplasma yang besar. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral. Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC.91% menjadi 15. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia.37% setelah proses fermentasi. UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. sebagai bahan baku pakan ikan patin. bungkil sawit.

setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik. Depok ABSTRAK Ikan patin (Pangasius sp. dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk. dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Wartono Hadie**). demikian juga ditinjau dari segi higienis dan kesehatan benih. sebagai materi kegiatan tahun mendatang. 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. KATA KUNCI: ikan nilem. kluster penetasan telur. Jakarta **) Pusat Riset Perikanan Budidaya..1994). Angela M. pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP.Balai Riset Perikanan Budidaya Air Tawar. Subang. di antaranya daerah Bogor dan Subang. sex reversal. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. Lusiastuti***). Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. patin. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. dan Labuan (Merak). Pengambilan data melalui responden dilakukan dengan cara purposive sampling. dan kluster pemeliharaan larva dan benih. Jakarta ***) . Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. Bogor ****) Balai Riset Budidaya Ikan Hias. Perbedaan dari kedua sistem ini adalah sifat produksinya. betina homogamet . pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. integrasi. Tipe integrasi bersifat soliter.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). dengan masing-masing hatchery terpisah lokasinya. salah satunya melalui Catfish Club Indonesia. jantan fungsional. Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. KATA KUNCI: UPR. dkk. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor. Eni Kusrini****). benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT).) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi. kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster.

27 pada ukuran konsumsi dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19. pertumbuhan.2 gram. Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. KATA KUNCI: seleksi generasi. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. amonia. pH. Anang H K. Agus Priyono. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). 15 butir/ liter perlakuan (I).1. ikan mas strain rajadanu . Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva). dan nitrit).57 % dalam satu generasi. KATA KUNCI: sintasan. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui. 10 butir/liter (perlakuan H). dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar. intensitas cahaya. larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. salinitas. oksigen terlarut/DO. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. Diketahui estimasi nilai heritabilitas rata-rata h²(S+D) = 0. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut. Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. sintasan dan kualitas air (meliputi suhu. M H Fariddudin A. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. kepadatan.

dan Tasikmalaya. karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. Hambali Supriyadi. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). dan Lila Gardenia Pusat Riset Perikanan Budidaya. Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik. eksplorasi.Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. Survei dilakukan di beberapa daerah yaitu Cianjur. penanggulangan. Klaten. Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. penyakit streptococcosis . KATA KUNCI: antibakteri. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus). bakteri probiotik.

di perairan Panimbang Kabupaten Pandeglang. Teluk Lada. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. Kabupaten Pandeglang. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. budidaya laut. Provinsi Banten.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. Hatim Albasri. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. Erlania. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Pandeglang . Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. KATA KUNCI: kerang hijau. SIG. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. Kabupaten Pandeglang. Secara umum. Untuk menjamin keberlangsungan usaha budidaya kerang hijau.

BBUG Klungkung. tingkat sintasan.. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan.). STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*).) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. kelompok kedua adalah penghasil benih. Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. manajemen.Bali. Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. kelompok kedua adalah BBU Pamarican (Jabar). sedangkan dari kelompok protozoa adalah Epistylis sp. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya.). sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76.. Imron**). KATA KUNCI: udang. Retna Utami**).Forum Inovasi Teknologi Akuakultur 2010 pK 01 1. Jateng. induk. Carchecium sp. Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. KATA KUNCI: huna (Cherax sp. dan kelompok ketiga ialah pembudidaya.. Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset.Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. dan Spiranura sp.Wartono Hadie*). dan Opercularia plikatilis. Parameter yang diamati meliputi pemeriksaan parasit. tembakau (Tobacum nikotiana) .42%. Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol. Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP Samas. Ikhsan Khasani**).Yogyakarta. Bali. Vorticella sp. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas.UPU Probolinggo (Jatim). BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. Bali. dan Jatim. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro. Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan. dan kelompok ketiga ialah pembudidaya. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). serta UPR yang mengembangkan usaha perbenihan udang galah.. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya. tingkat kesembuhan. BBAP Samas-Yogya(Jateng). kelompok kedua adalah penghasil benih. Zoopthalmium sp. dan diferensial hemosit.. padahal permintaan cukup besar. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp.

Idil Ardi.8 kg dan kelangsungan hidup 100 %. KATA KUNCI: udang windu. dilakukan pengolahan tanah tambak. kemudian dikeringkan sekitar satu minggu.22% dan 72.66% dan 108. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. salinitas rendah. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. namun berbeda tidak nyata (P>0. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. produksi . pengapuran dan pemupukan.000 kg/ha rumput laut. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm.84 kg/ha. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. Hewan uji yang digunakan adalah udang vaname PL-48. Empat petak tambak masing-masing berukuran 3.2 %. Sebelum penebaran. tokolan. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2.6 kg/ha. yaitu pertambahan berat rata-rata 230 g. KATA KUNCI: vaname.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35.5 g. Pemeliharaan dilakukan selama tiga bulan.500 m2 digunakan untuk percobaan. dan Wartono Hadie Pusat Riset Perikanan Budidaya. produksi 81. survival rate.n pengapuran sebanyak 175 kg/petak. yaitu menggunakan tingkat teknologi tradisional plus. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. pengeringan. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54. pemberantasan hama. Setelah dua hari. masing-masing dengan dua ulangan. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. Karawang. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. penebaran dilakukan setelah satu bulan dari penebaran tokolan. Gracilaria verrucosa.1 kg dan kelangsungan hidup 11. Kecamatan Cilebar. Dari pemeliharaan udang selama tiga bulan. namun polikultur udang vaname dan rumput laut masih kurang informasinya. Dengan teknologi yang diterapkan. pada bulan pertama udang tidak diberi pakan. sedangkan pada dua bulan berikutnya diberi pakan pellet udang. polikultur. Penelitian ini dilakukan pada tambak di daerah Betok Mati. produksi 78. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak.

probiotik. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. udang windu . Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. KATA KUNCI: plankton. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. KATA KUNCI: tepung tapioka. 25. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. Pada budidaya udang vaname pola tradisional plus. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. dan Rotatoria. pola intensif. dan metabolit udang. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. masing-masing dengan 3 ulangan.6 m sebanyak 12 buah. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. pelakuan B = sagu. pola tradisional. Polychaeta.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil. dan perlakuan D = tanpa sumber karbohidrat. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. Hal tersebut perlu mendapat dukungan dari penelitian. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. Pada budidaya udang windu intensif. dan Cyanophyceae.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka.3 g dengan padat tebar 50 ekor/bak. Dinophyceae. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus. indeks keseragaman menunjukkan komunitas plankton pada perlakuan D relatif lebih merata dibanding perlakuan lainnya. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk.05) terhadap kelimpahan dan jumlah jenis plankton. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. menggunakan bak kayu ukuran 1 m x 1 m x 0. kotoran. perlakuan C = tapioka. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0.

Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2.05) terhadap pertumbuhan udang vaname. Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. serta Oscillatoria dari kelas Cyanophyceae. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. dan produksi udang vaname. Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0. indeks keseragaman (0. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. sintasan. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. KATA KUNCI: probiotik.362). Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing-masing: indeks keragaman (1. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea.000 ekor/petak). pertumbuhan. tambak . C = 4 mg/L. BOT.05) terhadap jmlah jenis dan kelimpahan plankton. suhu. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol.427). NO2. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. oksigen terlarut. udang windu. indeks keragaman. dan indeks dominasi plankton selama pemeliharaan udang windu. setiap 15 hari. Abdul Malik Tangko. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. namun berpengaruh tidak nyata (P>0. dan Pleurosigma dari Kelas Bacillariophyceae. Hasil penelitian menunjukkan perlakuan berpengaruh tidak nyata (P>0.780) dan indeks dominansi (0.5 m dengan volume air 400 L. PO4.05) pada sintasan dan produksi udang vaname. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang. indeks keseragaman. Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas. dan perlakuan C = dedak padi halus. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan.324–0. KATA KUNCI: dinamika plankton. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea. Nitzschia. pupuk organik. sintasan. NO3. B = 2 mg/L. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0. perlakuan B = kotoran sapi.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. pH.689–0. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin.199–1.

Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak.984. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan. Substrak tanah lumpur. Perlakuan yang diujicobakan dalam penelitian ini adalah A.14 dan 2.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2. Machluddin Amin. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1.05) antara perlakuan substrak tanah tambak. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari..2 cm dan bobot awal 0. dan substak tanah lumpur..239. KATA KUNCI: substrak.5 dan 21. Substrak tanah tambak. KATA KUNCI: efisiensi.6. Substrak tanah sawah.. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71. Penelitian dilaksanakan pada tambak ukuran luas 4. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau. B. substrak tanah sawah.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A).sedangkan pada perlakuan A dan B masing-masing 2.01 g. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak). udang windu . Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan.8±0.3±1. masing-masing dengan dua ulangan. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak.dan Rp 19. dan C. biaya produksi. budidaya. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka.650.875. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru. umur pemeliharaan.0±5. udang pama. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau.03±0. di mana masing-masing perlakuan diulang tiga kali.24.634. biaya pakan pada perlakuan A dan B masing-masing Rp 11.

3 ± 7.45 kg/bak atau rata-rata 12. di mulai setelah satu minggu penebaran.1 ± 13. Namun demikian.28-13. udang vaname.7%.4 ± 0. lebih tinggi daripada perlakuan B = 41. KATA KUNCI: molase. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25.7%.61%. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah. KATA KUNCI: tepung tapioka. Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan. Maros.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2. Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan. dengan rata-rata berat 11.998. masingmasing bak mempunyai ukuran panjang. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang.3 ± 5. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan.68-13.767. kisaran produksi 9.5 m dan 1 m.7% dan perlakuan C = 36.86 g/ekor. dengan rata-rata berat 12. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.975 dan lebih rendah dibandingkan perlakuan B yang mencapai 1. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah. 1. ukuran 84 sampai dengan 89 ekor/kg) dan C (16. salinitas rendah .64 kg/bak atau rata-rata 11. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2. B).92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90. kisaran produksi 12. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau.325.86 kg/bak (8. pertumbuhan udang. lebar dan kedalaman secara berurutan adalah 10 m.6 kg/500 m2 = 406 kg/ha. Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48.7 kg/500 m2 = 320 kg/ha. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C).15%.66 kg/bak (7. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A. Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B).2 ± 13.66 g/ekor.0 ± 2. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. namun tidak berakibat terjadi kematian massal. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan.2 kg/500 m2 = 506 kg/ha. ukuran 80 sampai dengan 96 ekor/kg). Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali. fermentasi probiotik.235 kg/ha).

0 mg/L.. Penelitian II pengujian probiotik B.5 mg/L.50%.) dan probiotik B (mengandung bakteri Bacillus polimyxa. sintasan.001 mL/L menghasilkan sintasan sebesar 81.75%–68.4440 g dan kontrol 0. Pemberian bakteri probiotik A (Bacillus sp. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz.. sintasan. udang windu. Rhodococcus sp. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62.0 hari.) yang berukuran PL-20.4255–0. terdiri atas: A. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F. 5 ‰. Q. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan.001 mL/L menghasilkan pertumbuhan tertinggi (0.003 mL/L. diikuti perlakuan 5‰ sebesar 10±0. Kontrol (tanpa pemberian probiotik A).3660 g. Kontrol (tanpa pemberian probiotik B). kualitas air. sebelum diaplikasikan di tambak. Rata-rata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0. karena secara alamiah larva hidup di periran bersalinitas.5 mg/L. dan R. udang galah. 10 ‰..25%. KATA KUNCI: salinitas. Pemberian probiotik A dengan konsentrasi 0.25%. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL). laterosporus. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. waktu inkubasi.75%. 85%. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji. Masing-masing perlakuan diulang sebanyak empat kali. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. Nitrosomonas sp. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan. Parameter yang diukur adalah kualitas air. terdiri atas: O. Penelitian I adalah pengujian probiotik A. B. Pemberian probiotik A dengan konsentrasi 0.002 mL/L. C. 1995). Pemberian probiotik A memberikan pengaruh terhadap rata-rata pertumbuhan mutlak benih udang windu. B. Pemberian probiotik A dengan konsentrasi 0.001 mL/L. Nitrobacter sp. Pemberian bakteri dengan konsentrasi 0. P. sedangkan juvenil dan udang dewasa hidup diperairan tawar. Tingkat sintasan yang diberi probiotik B berkisar antara 63. dan pertumbuhan udang. dan D. yaitu probiotik A (mengandung bakteri Bacillus sp. Pemberian probiotik B dengan konsentrasi 2. dan tiga ulangan.15.) berpengaruh nyata terhadap sintasan benih udang windu. Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata. Pengaruh perlakuan terhadap sintasan.3±1. pemberian dengan konsentrasi 0. Dengan meneliti dua jenis probiotik. Pemberian probiotik B dengan konsentrasi 5. sebagai dasar perbaikan sistem penyediaan larva udang galah.). Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter). Pemberian probiotik B dengan konsentrasi 7.. Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang.57 hari . Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol). Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. pertumbuhan . KATA KUNCI: probiotik. dan 0‰ sebesar 11. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6. dan Rhodobacter sp. sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah. Aplikasi probiotik setiap tiga hari sekali.6±0.8935 g).Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 88%. Universitas Padjadjaran. dan kontrol 66. 85%.

yaitu templat dengan berat molekul tinggi (1). dan 20 ppt sintasan dari post larva udang galah mencapai 100%.33±0. 20 ppt. Sukamandi. pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi. dan ukuran templat. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 15 ppt. diantaranya karakteristik templat DNA genom yang meliputi kemurnian. Ditinjau dari keragaan pertumbuhan. sedangkan sintasan pada perlakuan 25 ppt mencapai 61. KATA KUNCI: pertumbuhan. 15 ppt.05). dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. Selain itu. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. 10 ppt. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3). Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. 10 ppt (kontrol). konsentrasi. Hasil yang diperoleh adalah pada salinitas 5 ppt. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten.92±0.13 cm dan 1. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. Guna mendukung prgoram revitalisasi tambak. udang galah . 25 ppt. PCR. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH.67%. salinitas. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi.09 cm. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. KATA KUNCI: Macrobrachium rosenbergii.

Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. baik pertumbuhan bobot. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. pemberian pakan. Oleh karena itu. KATA KUNCI: kepiting bakau. manipulasi lingkungan. ikan rucah (B). kepiting lunak . maupun lebar karapas (P>0. Sulaeman. Sintasan yang diperoleh pada penelitian ini yakni 52%–54.5%. dan gabungan keduanya (C). dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). Dari pencapaian bobot ini.05).66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. Berdasarkan persentase. Pakan diberikan dua kali sehari selama penelitian. panjang. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan. Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. KATA KUNCI: pergantian kulit.Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. kepiting bakau. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet.

tambak bersalinitas tinggi. restoking kepiting bakau. pertumbuhan.05±0. dan produksi serta parameter kualitas air. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1.04 ha. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi.573. Peubah yang diamati adalah pertumbuhan lebar karapas.7 cm dan 4.300 pohon/ha dengan rata-rata 1. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi. sintasan. KATA KUNCI: kerapatan hutan mangrove. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau. Ikan bandeng yang digunakan adalah gelondongan umur 1. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya.1±0.2 mm dan 0. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa. produksi . Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1.000 m2. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya. Tambak ditebari benih rajungan.000–1. Tambak yang digunakan berukuran 10. sintasan./m2. dan pelestarian alam. KATA KUNCI: rajungan. data yang diperoleh dibahas secara deskriptif. jumlah permudaan 450–500 pohon/ ha. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.5 bulan dengan panjang dan bobot masing-masing adalah 8. bobot. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰—4 9‰) mengakibatkan sintasan dan produksi rendah.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh.2 g.02 g dengan kepadatan 1 ind.0 ± 2. Dibalik manfaat mangrove yang demikian banyaknya.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari). Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. sehingga perlu riset budidaya rajungan pada musim kemarau.2 ± 2.000 ekor/ha ukuran crablet-30. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi. Hasnawi. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan. rumput laut dengan kepadatan 1.100 pohon/ha. perlindungan.

Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Anjang Bangun Prasetio. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. kondisi perairan sangat mendukung pengembangan budidaya rumput laut. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. bioakumulasi. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. Kappaphycus alvarezii. Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya.03 mg/L. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. SIG. rumput laut. Provinsi Gorontalo. Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0. Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). layak. Secara umum. KATA KUNCI: minapolitan. Untuk memfokuskan kegiatan budidaya rumput laut. DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. cukup layak dan tidak layak.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. logam berat . Secara umum. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. KATA KUNCI: Danau Maninjau. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. Adang Saputra. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. I Nyoman Radiarta. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010.

853. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. TSS. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. Sampling air secara regular untuk pengamatan fisika.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. GONDOL-BALI Apri I. Subang. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. outlet. 20 dan 30. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. Supii. Adi Hanafi. SUBANG Joni Haryadi*). Indeks keanekaragaman berkisar antara H’=2. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut.076-0. sedangkan indeks dominansi berkisar antara D=0. Subang. Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. nitrit. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. KATA KUNCI: alga perifiton. BBRPBL Gondol . Perifiton yang terdapat di Tambak Blanakan. Kualitas kimia air untuk pH.962. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10. dan plankton dilakukan seminggu sekali.814-0. Dara Kasih**). DO. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air. N. KATA KUNCI: kualitas air.085. inlet. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet. Nitzschia sigma.711-2. dan Erlania*) *) Pusat Riset Perikanan Budidaya. tambak. indeks keseragaman berkisar antara E=0. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. alga hijau biru dan alga hijau). Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. kimia.

yang terdiri atas: 9 jenis pakan untuk ikan mas. akuaponik. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp.16 g. 1. limbah hara N dan P . 1.. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm.dengan produksi Moina sp.78%). 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP.23%–6. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP . volume air 500 L. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur.53%–15. KATA KUNCI: limbah.87.58%–13. Pengukuran N dan P dilakukan pada ikan dan pakan.21%). Panen Moina sp. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin. ikan nila. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. Ani Widiyati. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung.48%–9.71%–10. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan. indek dominasi. serta produksi Moina sp. P.90.63% dan 10. ikan nila (3. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal. Data dianalisis secara deskriptif. 9. Bogor. 2). dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP. Perlakuan adalah pemupukan dengan perbandingan N.) di laboratorium. KATA KUNCI: konversi pakan.89% dan 11. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan. dan 1. nila (Oreochromis niloticus) dan bawal (Colossoma sp. dan bawal adalah 1. dan 3).17% dan 8.73–1. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio). Parameter yang diamati adalah jenis. dan keanekaragaman plankton.53%) dan ikan bawal (8.900 g sedimen + 20 g TSP.96 ±1. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan. Kusdiarti.89%–17.88–1. yaitu: ikan mas (5.83– 1.89. dilakukan pada hari ke-8 sejak dilakukannya penebaran. K = 16:20:0. kelimpahan. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas.

pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. mata. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir. Budidaya rumput laut khususnya Kappaphycus sp. N4M (2). Kelima isolat bakteri tersebut masing-masing diinjeksikan 0.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*). hama. Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. Esti Handayani Hardi**). tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani Pong-Masak Balai Riset Perikanan Budidaya Air Payau. Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). KATA KUNCI: Streptococcus agalactiae. penyakit. Produksi rumput laut ditargetkan meningkat dari 2.6 juta ton per tahun sekarang ini menjadi 7. Sukenda***).6 juta ton per tahun pada 2014. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S. Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. Bogor Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) **) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. Postulat Koch. N14G (3). dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah. dan NK1 (5) yang berasal dari organ otak. sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. agalactiae setelah dilakukan uji Postulat Koch. Hasil yang diperoleh. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. KATA KUNCI: rumput laut. pencegahan . 4. Isolat 1. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S. Oleh karena itu. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. agalactiae. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. di laut dan Gracillaria sp. sehingga dapat meminimasi kegagalan panen.1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. Oreochromis niloticus. namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. N17O (4). khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur.

85 mg/L. kurang sesuai 2.95 ha.38–44.0037 mg/L. dengan tingkat kesesuaian lahan sesuai 21.81–6. demikian pula dengan karakteristik físika dan kimia oseanografinya. karakteristik.01169 mg/L. Petrus Rani Pong-Masak. kedalaman 1–40 meter. Syarifuddin Tonnek.0267–0. besi 0. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar.10–36. Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir.3 meter. nitrit <0. Kata kunci : Opsi pemanfaatan wilayah pesisir. kesesuaian rumput laut.820. dan total suspensi <25–80 mg/L.02–9. KARAKTERISTIK. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden. dan Makmur Balai Riset Perikanan Buddidaya Air Payau.095. Kabupaten Kepulauan Selayar. Rachman Syah. salinitas 36.32 ha.66°C. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau.37. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder.1113 mg/L. Mudian Paena.90 ppt.0008–0.695. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari. bahan organik total 37. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27. KATA KUNCI: potensi. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang. pH antara 6.039–0. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis. oksigen terlarut 5. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. suhu 29. fosfat 0.610.Indra Jaya Asaad. . Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya.57°C–30. nitrat 0. analisis hierarki proses. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara.09 mg/L. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan.685 mg/L. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka.30 ha dan tidak sesuai 3. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1.33 ha.0032–0. Penelitian ini bertujuan untuk mengetahui potensi. Pengumpulan data primer dilakukan dengan cara wawancara mendalam.1–8.

pH. Muhammad Chaidir Undu. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. Utoyo. salinitas. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor. Cakupan wilayah penelitian meliputi Teluk Hurun. kandungan oksigen telarut. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. PO4 dan Fe. KATA KUNCI: keramba jaring apung. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. analisis faktor.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. NH3. yaitu : faktor infrastruktur dan kondisi perairan. Rachman Syah. lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. faktor teknologi budidaya. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. tambak. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan.Indra Jaya Asaad. konduktivitas. NO3. dan faktor pasar. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. Kabupaten Pontianak . dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. Makmur. Kata kunci : kualitas perairan. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. NO2.Indra Jaya Asaad. Parameter kualitas perairan yang diamati adalah suhu. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. A. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak.

dendeng.04 mgN% dan 6.97%. dan pH). 28. rumput laut coklat. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna. lemak. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. TVB. Rumput laut coklat setelah dipanen. protein lemak. dan viskositas natrium alginat). setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. KATA KUNCI: pengeringan. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air. dan rendemennya 37. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Rendemen dendeng sidat dengan bumbu kasar sebesar 57. Sedangkan nilai TVB dan pH masing-masing sebesar 21. natrium alginat. kimiawi (kadar air.44%. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. dan protein masing-masing sebesar 14. rendemen.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempah-rempah kasar dan halus (ekstrak). Kelompok kedua ditebar di atas lantai dengan beralaskan waring. dan dijemur di bawah sinar matahari selama 18 jam. viskositas 8. Jakarta **) Pusat Riset Perikanan Budidaya. Selanjutnya. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat. 7.4%. Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik.26%. dan 28.0%. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk.663 cps. dicuci dengan air bersih. rasa. dan dijemur di bawah sinar matahari selama 18 jam. kadar abu.0%. analisis fisika-kimia . Kadar air.46%. terbuka di atas lantai pada suhu ruang (sekitar 30°C). bau.1%. kapang) dan rendemen. kemudian direndam dalam larutan KOH 0. dan tekstur) menggunakan skala hedonik. KATA KUNCI: ikan sidat. abu.1% selama 60 menit. Rumput laut coklat dibagi menjadi dua kelompok.25% dan dendeng dengan bumbu ekstrak sebesar 59. dan mutu natrium alginatnya mempunyai kadar air 19. Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. abu.32%.41%. kadar abu 19. mikrobiologi (Angka Lempeng Total/ALT.

Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. polusi air. kelembagaan yang menunjang. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. pengalaman petani ikan dan Kebijakan Pemerintah. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. serta ketersediannya dalam skala kecil. Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. agribisnis perikanan . Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. harga ikan yang tergantung pembeli dan cuaca. kekurangan modal.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. Identifikasi faktor-faktor pendorong maupun faktor-faktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya. KATA KUNCI: potensi desa. prasarana fisik yang kurang mendukung. Metode yang digunakan adalah studi kasus. Faktor pendorong yaitu ketersediaan air yang melimpah. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi.

Sign up to vote on this title
UsefulNot useful