Forum Inovasi Teknologi Akuakultur 2010


Forum Inovasi Teknologi Akuakultur 2010

FF 01
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: L0ppt =2,1±0,23; W0ppt = 7,0±0.29; B0ppt = 139,8±6.72; L7,5ppt = 2,3±0.06; W7,5ppt = 8,2 ± 0,42; B7,5ppt = 164.3 ± 8,46; L15ppt = 2.3 ± 0,21; W15ppt 7.8 ± 0,45; B15ppt = 155,6 ± 8,95. Pengamatan setelah 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-50ppt: 4,0±0,34; 3-515ppt: 4,8±0,27; 5-80ppt: 7,4±0,35; 5-815ppt: 9,2±0,98. Pengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
KATA KUNCI: nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen (LT50) dengan 8 ulangan dari masing-masing strain. Analisa data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata LT50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT 50

Forum Inovasi Teknologi Akuakultur 2010

FF 03
Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan, Universitas Padjadjaran

Penelitian ditujukan untuk menentukan persentase terbaik dari S. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. cereviceae sebagai perlakuan dan lima kali ulangan. Sebagai perlakuan adalah A0 (tanpa penambagan S. cereviceae); A1 (penambahan S. cereviceae 1%), A2 (penambahan S. cereviceae 2%), dan A3 (penambahan S. cereviceae 3%). Hasil penelitian menunjukkan penggunaan S. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. Pertumbuhan terbaik diperoleh pada penambahan S. cereviceae sebesar 2%
KATA KUNCI: Saccaromyces cereviceae, fermentasi, pakan buatan, nila merah

FF 04
Iskandariah, Otong Zenal Arifin, dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi, Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. Populasi yang diamati meliputi jenis nila BEST, Nirwana, Gesit, lokal Kuningan, dan lokal Bogor. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD), dengan menggunakan primer OPA-03, OPA-04, OPC-14, dan OPC-15. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13.3333%–46.6667%, dengan nilai heterozigositas 0.0351–0.1952 dan jarak genetik antar populasi 0.1765– 0.5797.
KATA KUNCI: RAPD, genetik, populasi, ikan nila, Oreochromis

agalactiae. Untuk kontrol. pengukuran bobot individu rata-rata dan penghitungan sintasan. Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. Perlakuan dengan injeksi sel utuh S. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. Pada perkembangannya. KATA KUNCI: vaksin sel utuh. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY.81% dan 83. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. XY. genotipe. Kata kunci : Ikan nila.55% sedangkan genotipe XY dan YY masing-masing sebesar 79. yaitu genotype XX. Budidaya Perairan. Data sintasan (Survival Rate. Uni Purwaningsih*). Genotipe XX mencirikan betina dan XY untuk jantan. limfosit perlakuan tidak berbeda nyata dengan kontrol. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. SR).Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. diferensiasi kelamin. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. dan differensial leukosit dilakukan analisa sidik ragam (Anova). Fakultas Perikanan dan Ilmu Kelautan. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. 106. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. 106. agalactiae pada tingkat kepadatan 108. Selain ditentukan secara genotipe. XY. Oreochromis niloticus Angela Mariana Lusiastuti*). Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. Komar Sumantadinata**). dan YY melalui evaluasi nisbah kelamin yang dihasilkan. ikan uji disuntik dengan PBS. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). Tetapi setelah uji tantang. Sukamandi **) Dept.1 mL/ekor. titer antibodi. DAN YY Didik Ariyanto*).01%. tidak cukup untuk memberikan protektif terhadap S. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga. ikan nila . agalactiae. Pada uji tantang setelah minggu keenam. titer antibodinya menurun. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. Hasil yang diperoleh bahwa sel utuh (whole cell) S. Pada akhir pendederan dilakukan identifikasi jenis kelamin. S. agalactiae secara intra peritoneal pada ikan uji sebanyak 0.

ortofosfat dan total fosfat. dengan variasi perbedaan kepadatan bakteri vaksin (A=108. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. DO. B=106. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. total nitrogen. dan Joni Haryadi Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. KATA KUNCI: Streptococcus agalictiae. Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. TDS. adalah septikemia dan meningoencephalitis. NO2. Angela Mariana Lusiastuti. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. D=102 cfu/mL dan E=kontrol). Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. C=104. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. BOD. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. Anjang Bangun Prasetio. terutama dalam hal manajemen pemberian pakan. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. NH3. kecerahan. Danau Maninjau. KATA KUNCI: manajemen pakan. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). turbiditas. Pemberian pakan tidak boleh berlebihan. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. Selain itu. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan.5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. pemanasan. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. serta data status kegiatan budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. karena pada kondisi perairan yang kurang baik akan menyebabkan stres pada ikan. lingkungan perairan . Selain itu. pH. keramba jaring apung (KJA). Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. NO3.5).

Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (-2. bobot (-2. Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*). Parameter yang diamati meliputi keragaan pertumbuhan (panjang. oreochromis niloticus . Nunuk Listiyowati. Budidaya Perairan.44%).48%). Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia).06%). dan sintasan(1. lebar (0. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. KATA KUNCI: heterosis. tidak berbeda nyata (P<0.87%) dan sintasan (0. sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2.53 % bt/hari. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4. tebal (0. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat.74%). Sukamandi selama lima bulan.20%. tinggi. Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49.35% bt/hari. bobot) dan sintasan. tinggi (3.65%). Sukamandi **) Dept.22%).94%). IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi. bobot ( -2. Komar Sumantadinata**).64% bobot badan (bt)/hari.82%). persilangan.80%. Fakultas Perikanan dan Ilmu Kelautan. tebal. tebal (-1.48% bt/hari dan 2.05) bila dibandingkan dengan dua populasi lainya.21%). SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2.

SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA. dan 96 jam. pemanasan.1295).7877–2. 72. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1.0430 (4. iniae (N2O).7138 mg/L (0. agalactiae (N3M. Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp. dan 96 jam.9823–4. 0. Hasil penapisan menunjukkan bahwa bakteri S. 1. ikan nila .8101–1. KATA KUNCI: toksisitas. dan sonikasi. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN. benih ikan. iniae (N2O). 48.0930). Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar. Hasil penelitian menunjukan bahwa Nilai LC50 24. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine).6799–13.8090) dan benih ikan nila 5.6578–2. KATA KUNCI: penapisan. dan nilai terbesar dimiliki oleh bakteri S. Bogor. 3. Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan.8532). Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan. vaksin. 48.6904– 5. streptococciasis.5094 (2.1100). Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak.13 dan 1. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila. 72.7504). NK1) dan 1 isolat S. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. agalactiae (N4M) memiliki nilai LD50 terkecil.9421 mg/L (1. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran.08 g.0678 (1.3354 (3. dan 96 jam terhadap benih ikan mas adalah 4. 48.0839(2. Konfirmasi taksonomis hingga level spesies isolat bakteri S.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration (LC50) 24.5805).4227– 4. uji stabilitas dan LC50–24.55±0.6297–0. 3. agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik. N14G. 2. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah. N4M. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin. Data diolah dengan analisis probit program LC50. N17O.5480).9237(0. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis. 0.81±0.

46 N/ cm2 atau 222.94%. dan cacing.00. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih. pembesaran. karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. yang merupakan limbah perikanan dari perusahaan filet ikan. kadar abu 2. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak. kekuatan regang (kemuluran) 66. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih. dan sebagainya. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia. 103. kadar air 13.62%. sarung tangan. Ikan ini mudah terserang parasit seperti cryptocarion. suhu kerut 88°C.76 kg/cm2. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali.93% dan kadar Cr2O3 1. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek.00 sampai jam 03. Ikan ini relatif sensitif dengan perubahan lingkungan. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. Sulawesi. kekuatan jahit 1. Dalam pembesaran. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. KATA KUNCI: pembenihan.12 kg/cm.53 N/cm atau 138.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi.97% sehingga sangat prospektif untuk dijadikan barang-barang kerajinan kulit.184. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu. kekuatan tarik 2. kadar lemak 6. namun sintasannya masih rendah yaitu sekitar 1%–3%.2 g. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. garmen. simetris. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa Tenggara Barat.00 pagi hari.5 g. KATA KUNCI: bahan penyamak kron. dan 15% . kambing dan ikan pari yaitu berisi. Telur yang ada dalam kolektor dapat diambil jam 07. Waktu pemijahannya sekitar jam 24. tas. lemas. 10%. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1. liat. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi. dompet. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. 40. dan 80 ekor/m3 selama 5 bulan masingmasing mencapai ukuran 127. kakap putih.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.00–08. dan corak permukaannya spesifik. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. dan Sumatera.0 g. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. Nusa Tenggara Timur.354. Pembenihan ikan ini mulai berkembang di sekitar Gondol.66%. kambing. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan.0–3. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g.5 kg. dan 102. untuk dijadikan kulit tersamak. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi). sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. kerapu sunu . Selain itu. benedinia.

hormon pertumbuhan. dan Gemi Triastutik*) *) Balai Budidaya Air Payau. Metode elektroporasi dilakukan dengan voltase 50 V. KATA KUNCI: transfeksi. dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. Komar Sumantadinata***). namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. dan 20 µg/ mL. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. mikroinjeksi. Situbondo **) Fakultas Perikanan dan Kelautan. 10 µg/mL. elektroporasi. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. lama kejut 30 ms. jarak waktu antar kejutan 0. Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. mikroinjeksi. mikroinjeksi. Irvan Faizal*****). transfer gen. Cromileptes altivelis Slamet Subyakto*). di antaranya Indonesia.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). ikan kerapu tikus . Rustidja**).1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. Sasmito Jati****). Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. 2. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. Namun demikian. jumlah kejutan 5. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. dan 3 detik. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. Ratu Siti Aliah*****). Alimuddin***). M.

D (kontrol).19%) dan panjang total spesifik (1.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut. probiotik. Namun. Nilai pertambahan panjang tertinggi A (72. Sampling dilakukan setiap minggu.95 mm). laju pertumbuhan bobot badan harian (10.39±0.35 mm).02%) serta nisbah konversi pakan (1. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3.50-0. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu.69 g dan panjang total awal 3. 10%. efisiensi pakan.19±0. laju pertumbuhan harian. Pakan yang digunakan adalah pakan pelet komersial. Salah satu faktor yang berperan adalah lingkungan pemeliharaan. serta terakhir perlakuan D (47.86 mm). pertumbuhan panjang larva.31±0. Pemberian pakan dilakukan tiga kali sehari. dan efisiensi pakan pada benih kerapu sunu. dan 15% dari total biomassa benih. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan.20 cm. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus).25) dan efisiensi pakan (80.90±0. nisbah konversi pakan.69 mm). B (oksigen). dan kualitas air. Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva. Materi yang digunakan adalah larva kerapu sunu sebanyak 4.00%) yang baik bagi benih kerapu sunu. Kendala yang dihadapi terutama terjadi pada stadia awal. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen). Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0. selanjutnya perlakuan C (64. pertumbuhan. laju pertumbuhan spesifik.20-4. yaitu 5%. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU.19%) harian serta laju pertumbuhan bobot badan spesifik (6. KATA KUNCI: larva kerapu sunu. optimasi pakan. C (probiotik). Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan. oksigen . Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan. KATA KUNCI: benih kerapu sunu. dan perlakuan B (63. Peubah yang diamati adalah sintasan.68 g) dan panjang total (6.73%) dan panjang total (9.000 ekor/bak.52±0.42±0.35 cm). Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan.

Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan. Mulai larva umur 2 hari diberikan Nannochloropsis sp. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19. Anak Agung Ketut Alit.08 ± 1. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari.00%.03% dan perlakuan C adalah 8. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C./mL dan mulai umur 17 hari diberikan nauplii Artemia. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny.04 ± 0.95 mg.12 mg dan C: 211. kerapu macan . Masing-masing perlakuan diulang 3 kali. aktivitas lisosim sebesar 1. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN. Perlakuan C: 5 kali/hari pada umur 7-20 hari. KATA KUNCI: Epinephelus fuscoguttatus.81 ± 0.1 ± 2. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari. indeks fagositik sebesar 1.08 ± 2. terutama infeksi virus.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6. B: 196. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari.20 ± 0. Perlakuan B: 4 kali/hari pada umur 7-20 hari. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0. imunstimulan. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Bejo Slamet. Perlakuan A dan B tidak berbeda nyata.65%. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L. Epinephelus fuscoguttatus Irwan Setyadi.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol.50%.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN. Des Roza.55 mm dan C: 26.0x105 sell/mL. perlakuan B adalah 6. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Ikan kerapu macan. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster.68 mm. sedangkan kontrol hanya disuntik dengan PBS.5 ± 4. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan.96 mg. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun nonspesifik ikan kerapu macan. mencapai ukuran panjang total pada perlakuan A: 24. KATA KUNCI: pakan buatan.87. B: 24.62%. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian. dengan kepadatan 1. serta bobot badan pada perlakuan A: 192.5 ± 2.62 ± 2. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut. larva kerapu macan.57 mm. infeksi.87 cm dan sintasan setelah diuji tantang sebesar 72.

Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen. KATA KUNCI: efisiensi. generasi kedua (F-2). pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari. pembenihan. Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir. yang kurang baik.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. KATA KUNCI: kerapu bebek (Humpback grouper). Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. panjang.72% dan panjang total 18. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. dengan sintasan 6. Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu.10% dan panjang total 21. Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. dan dilihat perkembangan oositnya. kerapu bebek (Cromileptes altivelis). konsentrat yang bisa dibeli di pasaran. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. sedangkan pada bak B : pakan pelet kering. pada bak A : ikan rucah + cumi-cumi + vitamin. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. perkembangan oosit . Setiap bulan dilakukan pengamatan pertumbuhan bobot. dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp.86 mm. Sampai dengan bulan Oktober telah berhasil memijah. Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. konsentrat mempunyai sintasan 19.

histologi. dan 32 hari setelah menetas masingmasing sebanyak 10-20 ekor. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi).8%-41. 3. manajemen air media pemeliharaan dan manajemen pakan.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. Cromileptes altivelis Yasmina Nirmala Asih. 2. 25. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. 20. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. Sampel larva diambil pada umur 1. 10. Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. Tangki pemeliharaan yang digunakan ukuran 8-10 m3. 15. 4. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor. Selain itu. KATA KUNCI: kerapu bebek. 13. KATA KUNCI: pemeliharaan larva. organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. Tetapi tingkat sintasan yang didapatkan masih rendah. 17. Ketut Mahardika. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D-15). 5. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3).Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. Indah Mastuti. 7. mutu benih kerapu. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. produksi massal . Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin. pemeliharaan dilakukan hingga yuwana (2 bulan).

Sumber protein utama pada pakan adalah tepung ikan. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. Tingkat kematian larva dapat mencapai 40%–80%. akibat serangan penyakit dan kondisi media. Ketut Suwirya. dan 20% dalam pakan. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). dan ketiga menggunakan larva tanpa kekebalan bawaan. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). siklus pertama.4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. catfish seed. Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. 15%. pertambahan bobot. Pangasius hypophthalmus .Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). Salah satu sumber protein alternatif adalah protein sel tunggal (PST). Oleh karena itu. tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. 15% (P>0. perlu alternatif lain sebagai substitusi tepung ikan. dan siklus kedua menggunakan larva dengan kekebalan bawaan. 10%. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Kematian larva umumnya terjadi pada hari keempat. (pakan kontrol). dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya.797–457. KATA KUNCI: innate immunity. di lain pihak hasil tangkapan cenderung menurun. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR). 5%. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. I Nyoman Adiasmara Giri. Lies Emmawati*). Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. 10%. Hasil penelitian menunjukkan bahwa nilai bobot akhir.05). Oleh karena itu.651 ekor benih untuk setiap induknya. Pakan penelitian berupa pelet kering dengan kandungan PST 0%. survival rate. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. Pakan diberikan 2 kali secara “adlibitum”. laju pertumbuhan spesifik. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. KATA KUNCI: protein sel tunggal.

14%).884±2.910±0. dan A (98.92 cm).204±0. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal.46% per hari. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan.13% per hari. KATA KUNCI: fitase .07 cm). kemudian salinitas 3‰ (4. diikuti salinitas 2‰ (28. Ikan uji yang digunakan berukuran 2 ± 0. selama 30 hari.763±0.5 g/ekor. yang dilanjutkan dengan uji Tukey.93%) dan terendah salinitas 3‰ (25. pakan B (82. Analisis data dilakukan secara deskriptif. C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati.1%). ikan patin. Kecernaan P pakan B (98.114±0. Pakan diberikan 3 kali sehari secara at satiation. Parameter yang diamati adalah laju pertumbuhan panjang badan. Pangasius hypopthalmus Mohamad Amin.2%).4%). dan sintasan . Kecernaan protein tertinggi berturut-turut pakan C (82.17% per hari menjadi 1. Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3. dan salinitas 1‰ (3.3%). pakan A (82. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak).32% per hari menjadi 4.49 cm). Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN.8%). Ikan patin sebayak 15 ekor.674±2. Kecernaan protein juga meningkat akibat penambahan enzim fitase.1%) berbeda nyata lebih tinggi dibanding pakan D (97.4%) berbeda nyata lebih tinggi dibanding pakan E (68.3%) dan pakan D (80.25±0.140±0. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32. Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter.75±0. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik).0%). (B) 2‰. KATA KUNCI: salinitas. Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4.223±0. Ade Dwi Sasanti.00%). pakan C (98. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm. dan (C) 3‰ dengan tiga kali ulangan. Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan. sedangkan laju pertumbuhan panjang harian meningkat dari 1. Dade Jubaedah. dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan. Data diperoleh dianalisis sidik ragam. D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase).010±0. dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor.1%) dan pakan E (95.35±0. sintasan serta beberapa parameter kualitas air. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰. Pangasius djambal.764±3. benih. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan.

Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam.5-26.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia. namun perlakuan B (7 ekor/m2) memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95.51 g dan 11. dan C (613. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut.2%).7% rendahnya sintasan ini diduga karena adanya faktor hama. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4. B (7 ekor/m2). Pemupukan. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4.74±0. lahan marjinal . nila.5%-9. Pupuk anorganik + organik + probiotik dan C. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. Larva yang ditebar berumur 20 jam setelah menetas. betok. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam. B (660 g). yaitu antara 13. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. predator yaitu antara lain: Ikan liar (gabus. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan. belut.37 cm C 16. B. Kata kunci: Intensifikasi. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo.49±1. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan dan sintasan ikan. Pupuk anorganik + organik. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masing-masing perlakuan: A.5). penetasan telur dan pemeliharaan larva di kolam. Pupuk anorganik + organik yang difermentasi + Probiotik.9%).26 cm. Pemberian pakan dengan pelet apung sebanyak 5% per hari.2%. 0. Jika luas gambut Indonesia adalah 20 juta ha. Akmal.12 g dan 3. Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut.27±0.19±0. dan C (10 ekor/m2) dengan 3 kali ulangan.5 juta ha (rata-rata 20 juta ha). sintasan ikan. dan Syafrudin Balai Budidaya Air Tawar. 0.60±10. KATA KUNCI: budidaya. pengecekan induk. B (95. dan C (95. Patin Siam.7. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk.08 g dan 3. Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah. ikan patin. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia. udang liar) serta jenis serangga air. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2).42±0. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g). Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan. pemijahan.3 g) dan SR perlakuan A (91. Padat tebar larva yang digunakan adalah 100 ekor/m2. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. komposisi pakan alami kolam.31 cm B. sepat. Sularto.

17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3.80%. dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3. diikuti dengan kepadatan 10 ekor/m2 (92. Kata kunci: padat tebar.5 m. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari.45 g). Sifat biologi pertumbuhannya belum banyak diketahui. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%. 10. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin.76 cm dan 2. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt.18) dan terendah pada 10 ekor/m2 (1. pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela. Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan.60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97. sedangkan petakan kedua ditebar sebanyak 2. Padat tebar yang digunakan adalah 5. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3. JAWA TENGAH Ongko Praseno*).000 ekor atau kepadatan 10 ekor/m2. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2.46 g).76%). dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya. pertumbuhan. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda.30%). Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95. dan Sularto***) *) Pusat Riset Perikanan Budidaya. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES.54 g dan panjang awal antara 10.10%/hari.47 g). Evi Tahapari. 15 ekor/m2 (70. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99.74 g) dan 20 ekor/m2 (61. Percobaan dilakukan selama 100 hari pemeliharaan. Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih.06%) dan terendah pada kepadatan 20 ekor/m2 (7. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8.71). Jakarta **) Balai Riset Perikanan Bididaya Air Tawar. di samping itu. pertumbuhan. nasutus . salinitas.36 cm.09 cm dan 1. Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1. Zafril Imran Azwar**).52%) dan terendah pada 20 ekor/m2 (91.000 ekor atau kepadatan 5 ekor/m2. Evi Tahapari***).43–11. KATA KUNCI: patin pasupati. 15 dan 20 ekor/m2 dengan bobot awal antara 15.70–20.

dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0.001 mg/L. Parameter yang diamati adalah insidensi dan sintasannya. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 109. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan.67%). Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. Pengamatan dilakukan selama 15 hari setelah perlakuan. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Bogor ***) Pusat Riset Perikanan Budidaya. (B) 0.002 mg/L (4. Nurbakti Listyanto*). Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0. Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah.003 mg/L dengan tiga kali ulangan. kemudian perlakuan dosis 0.33%) dan terendah perlakuan dosis 0. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*). Ikan uji yang digunakan berukuran 3–4 inci.002 mg/L (83. dosis. Kata kunci: uji tantang Aeromonas hydrophila. 10 ekor/L.67%). 107. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif.60 ± 0. sintasan. yaitu: cara perendaman dan cara penyuntikan intraperitonial. dan kontrol. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. Ikan uji yang digunakan berukuran 1–2 inci. intraperitonial. Sukamandi.001 mg/L (4. diikuti dosis 0.14 cm).002 mg/ L. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. Angela Mariana Lusiana**). dan 15 ekor/L.003 mg/L (81. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. dan (C) 0. dan kontrol (placebo). Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109.35 cm). sebagai perlakuan yaitu: (A) 0. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar.003 mg/L (4. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air. Probiotik diberikan dengan dosis yang berbeda.35 ± 0. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air.49 cm). Analisis data dilakukan secara deskriptif. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo. 108. Jakarta **) Balai Besar Riset Perikanan Budidaya Laut.001 mg/L (86. dan pertumbuhan . 108.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*). 106. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. Perlakuan kedua adalah padat tebar: 5 ekor/L. benih. kemudian dosis 0. Evi Tahapari*). Uji tantang dilakukan dengan dua cara. KATA KUNCI: probiotik.55 ± 0. perendaman. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal.

50% ampas tahu:50% tapioka. Ke dalam wadah ditebar ikan patin ukuran 11.250–1. Derajat penetasan patin nasutus berkisar 44.850 µm. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu.03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai.700–4.900 µm. substitusi protein 2. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. Bambang Iswanto. yakni pengamatan perkembangan gonad dan fertilisasi.41±0. yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. KATA KUNCI: fermentasi. Penelitin ini terdiri atas dua tahap.000 µm. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar.130–22. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. rearing.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11. substitusi protein 4. Zafril Imran Azwar. ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad.16%–79. tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm. ampas tahu. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. Aspergillus niger. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus. substitusi protein 0% (kontrol) (pakan A).58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4. Perkembangan oosit patin nasutus bersifat sinkronis grup.700 µm. KATA KUNCI oosit.03% (pakan C). dan tahap 5 (atresis) dengan diameter oosit 300–1. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. Pangasius nasutus . Upaya pengembangan patin nasutus memerlukan informasi-informasi biologi-reproduksi berkaitan dengan kapasitas produksinya. tahap 3 (granula kuning telur) dengan diameter oosit 700–1. Ukuran panjang total larva yang baru menetas berkisar 3. artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur.05% dengan lama inkubasi 22–25 jam. dan 25% ampas tahu:75% tapioka.04% (pakan D).52% (pakan B). larva. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu. 75% ampas tahu:25% tapioka. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. hatching. dan substitusi protein 6.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati.

88. dengan kantung kuning telur berukuran 0. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0.84 g/ekor dan terendah A.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin.01±0.56 cm/ekor.58%.45 g/ekor. nasutus . menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20. larva. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE.1. 0.10–1. 2. 25% zeolit + 75% bioball. diikuti perlakuan B. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa.14 mm. 100% zeolit B.42. dan D. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi. B. pertumbuhan.20 mm. masing-masing perlakuan diulang sebanyak empat kali. hibrida. 79. 0. 75.28%.54 cm). siam.34±0. C.35 cm/ekor dan A. 88.23%. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A. 89. tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus. C. 4.75% dan terendah perlakuan A.30ab.1±0. 1. Kata kunci: embriogenesis.25 g/ekor. C. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var.60 cm/ekor. 2. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1. 0.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. 95. berukuran panjang total 3. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian.71±0. C.67%.98±0. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi. B.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam. dengan kantung kuning telur berukuran 0. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi.03±0. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER. KATA KUNCI: patin albino.31ab. jambal.20. 91.62 g) dan panjang (2. 4. diikuti perlakuan C. sedangkan patin hibrida siam-jambal sebesar -4. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A.30a.69 cm/ekor diikuti B. 1.33%. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat.13 mm. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi.42±0. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D.01±0.24) x 103. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut. dan D.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias.08 mm3 yang terserap 50% pada umur 30 jam dan habis terserap pada umur 60 jam. C. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya. 50% zeolit + 50% bioball dan D.6±0. berukuran panjang total 3.89±0. 1.64±0. 75% zeolit + 25% bioball. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa.02 g/ekor. 1. B. 92. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D.43b.27a. biofilter. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih.47±0.

Untuk menentukan total limbah N termasuk eksresi amonia. KATA KUNCI: feed digestibility. 21% dan 26%.2 kg/ha/musim. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau.2% untuk bahan kering. Enang Harris**). KATA KUNCI: pengelolaan. milk fish. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng.76 g N untuk pakan berprotein 21%.28% untuk pakan berprotein 26%. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). Pakan tersebut digiling ulang. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. heterotrof bakteria . padat penebaran udang windu. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur. Neltje Nobertine Palinggi*). ikan bandeng. N waste. Maros **) Fakultas Perikanan dan Ilmu Kelautan. lalu ditambahkan kromium oksida (Cr2O3) sebagai indikator kecernaan.2%–78. Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2. dan 3. produksi. lama ikan bandeng digelondongkan.1% untuk C-organik. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone.6%–90. Hasil penelitian menunjukkan bahwa.27 g N untuk pakan berprotein 17%. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya. Akhmad Mustafa. 2. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. Oleh karena itu. Eddy Supriyono**). Dedi Jusadi**). Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok). tambak. Oleh karena itu. 88.0% untuk protein dan 81. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein pakan yaitu 2.990 kg/ha/musim dengan rata-rata 292. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. Jika bioflok terbentuk. dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%.6%–83. lama pemeliharaan ikan bandeng.

Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). Penyusun utama bioflok ini adalah bakteri heterotrof.726 ha dan yang layak untuk budidaya sekitar 6. Pada tahun yang sama. (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL.54% per tahun kurun waktu tahun 2005–2009. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. growing. Oleh karena itu. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS.000 ton dan mengalami kenaikan sebesar 14. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12. bandeng. Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia.) cenderung meningkatkan kandungan asam amino bioflok. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. KATA KUNCI: Heterotrofic bakteria.975 ha. kendala. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. Molase digunakan sebagai sumber Corganik. opsi kebijakan . Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475.66% dari tahun-tahun sebelumnya. dan Pekalongan. Khususnya di wilayah Pantai Utara yaitu Kendal. Dedi Jusadi**). (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. Penambahan inokulasi bakteri komersial (Bacillus sp. Hatim Albasri.250 ton. dan Rasidi Pusat Riset Perikanan Budidaya. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol. Pati. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L. DAN PEKALONGAN ) Anjang Bangun Prasetio. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. Enang Harris**). Eddy Supriyono**).000 ton dan mengalami kenaikan rata-rata 13. KATA KUNCI: budidaya. PATI. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya.

rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0.03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi. mikroinjeksi. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi. GFP.63±10.33±3.0%).34±1. Ekspresi gen gfp tidak tampak lagi pada saat telur menetas.0%) dan yang terendah â-aktin-GFP (3. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp.33±1. ikan lele . Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10. Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein.Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN. DKH-e yang diinjeksi dengan â-aktin-GFP (25.65%. DKH-e dihitung sebelum telur menetas.34%) dan DP (63. Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji.65%) dan heat shock-GFP (18.0±10.66%) relatif sama.67%.66±1. keratinGFP. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20. DP untuk â-aktin-GFP. sedangkan DP dihitung ketika semua telur telah menetas. dan heat shock-GFP berturut-turut adalah 20. sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik. HEAT SHOCK DAN KERATIN PADA IKAN LELE.00±3.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel.00±1. Fakultas Perikanan dan Ilmu Kelautan. Alimuddin**). 18. Hasil penelitian menunjukkan bahwa DKH-e (63. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi.****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan. dan 15. Konstruksi gen dalam bentuk plasmid mBA-gfp.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur. dan Utut Widyastuti***). menyusul heat shock-GFP (10.0%). Komar Sumantadinata**). Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan.33%. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA). FMIPA. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi. Gusrina*).3±0. KATA KUNCI: promoter.00±1. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. keratin-GFP (21. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. Clarias sp. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi.67%).0±0. Data dianalisis secara deskriptif.

23% kadar abu tak larut asam. KATA KUNCI: kecernaan pakan. KATA KUNCi: A. 0.41 mg/L) dengan dosis efektif 250 mg/L.34% kadar air. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang. Taukhid. pakan tenggelam.. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%.74±1. 39. bahan aktif. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0.47±4.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB. 1. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. Kandungan bahan aktif hasil pengekstrasian pegagan segar. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif). dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus).15%) dibandingkan dengan pakan tenggelam (yakni 79.39% kadar asiaticosid. Bak diisi air sebanyak 100 liter.05).39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak. pakan terapung .83% kadar sari dalam alkohol. hydrophila. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi. pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. pagi dan sore. 6.33% kadar sari dalam air.71±2.623. aerasi. Melalui penambahan aerasi. 24.37% kadar abu. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo. 5. Rita Febrianti.05) dari 79. ikan lele dumbo (Clarias gariepinus). UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani.25% sehingga tidak berbeda nyata dengan pakan terapung. Pada perlakuan tanpa aerasi. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara.47±4.53% menjadi 92. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus).53%) (P<0. hydrophila menjadi penyakit endemis di Indonesia. pegagan Centella asiatical [L] Urb. Angela Mariana Lusiastuti. Pemberian pakan sebesar 5% dari biomassa per harinya.30±2. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5. Feces yang dihasilkan diambil setiap hari. Ikan lele dumbo berukuran 41. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan.

Sulasy Rohmi. KATA KUNCI: maggot.8 m.10 g sebanyak 40 ekor. dan perkembangan gonad). Setiap perlakuan dengan 3 ulangan.33±0. fermentasi. dan 30 g/40 liter masingmasing diulang 3 kali. reproduksi.7 cm mencapai TKG III.83% tidak memperlihat perbedaan dengan perlakuan kontrol. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9. 19.85%. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0. penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7. bloodworm.56%. Laju pertumbuhan spesifik.28%. amonia.1 cm. lele dumbo FF 46 ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA Tutik Kadarini. Siti Subandiyah. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar. namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25. 20. dan molase. formulasi. dan 25. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. panjang. dari perlakuan kontrol.96%.0 m x 1. dan karbondioksida).92%. 10.0 m x 0. pH. kualitas air (suhu. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. dan dirancang sistem resirkulasi. 7. dan Darti Satyani Balai Riset Budidaya Ikan Hias ABSTRAK Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. dan gonad . Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. Jenis pakan berupa cacing tubifex. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2. Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3.81% dalam formulasi pakan.Forum Inovasi Teknologi Akuakultur 2010 FF 45 PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus) Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. dan penurunan lemak 61. alkalinitas. KATA KUNCI: gurame coklat. oksigen. Parameter yang diamati sintasan dan pertumbuhan (bobot.3–3.8–4.90%. dan cuk yang diberikan diselang-seling secara adlibitum. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11. 13. Wadah percobaan yang digunakan adalah bak beton ukuran 1. tapioka. ikan. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol).

Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2. dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Mycobacterium fortuitum. produksi telur per sarang. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92. Mycobacteriosis. daun sente. Dari hasil penelitian menunjukkan bahwa di daerah Blitar.86%. pakan buatan. Pakan yang diberikan berupa daun sente sebanyak 3. dan 14% sesuai dengan label pada kemasan masing-masing.09). Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa. dan injuk sebagai bahan pembuat sarang.75 buah. yaitu di Jawa timur (Blitar dan Tukung Agung). sehingga petani tidak mengalami banyak kerugian. Induk gurami yang digunakan berbobot 2-3 kg/ekor. dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. Perlakuan yang diterapkan adalah kadar protein 38%. 33%.Forum Inovasi Teknologi Akuakultur 2010 FF 47 APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang. dan tingkat fertilitas telur yang dihasilkan. namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0.94% (P=0. Pemberian pakan tambahan dengan kadar protein 38%. Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp.05%.546 butir dan 2.5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. Lamanto. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. Sukamandi ABSTRAK Ikan gurame termasuk ikan dengan fekunditas rendah. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente. penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat.13 buah) dan hanya daun sente (0.88 buah. biokimia. PCR FF 48 PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI Bambang Gunadi.5 buah).730 butir. 14% dan kontrol yakni masing-masing 79. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. keragaan reproduksi . Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0. 4. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang). yakni 0. Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0. 33%. Jakarta ABSTRAK Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan.23% dibandingkan dengan pemberian pakan dengan kadar protein 33%. KATA KUNCI: fish TB.) DI JAWA Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. dan 71.26). yaitu seperti daun talas. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum.774 butir per sarang. Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman.351 butir. KATA KUNCI: ikan gurame. Masing-masing perlakuan mempunyai 2 ulangan. lebih rendah dibandingkan dengan yang diberikan pakan tambahan berkadar protein 33%. 28.

Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp.05) dengan perlakuan lainnya. dedak padi. 4. Retensi protein dedak padi fermentasi. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan berbeda nyata (P<0. Retensi lemak tertinggi (35. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. yang menunjukkan terbentuknya plasmid rekombinan.3’). Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. dan 6 hari. dan pada Silver carp sebesar 1123 bp. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. dedak polar. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar. dedak padi fermentasi. dan selanjutnya polar dan dedak padi. dan polar fermentasi. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. dan polar fermentasi berbeda nyata (P<0. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas. dengan padat penebaran ikan uji 30 ekor per akuarium. protein efisiensi rasio. dan koloni berwarna biru tidak mengandung DNA sisipan. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. pertambahan bobot relatif.02% sedangkan kandungan lemaknya turun 13.14% dan kadar lemaknya turun sebesar 19. retensi lemak.33%.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG. Sintasan ikan uji berkisar antara 96. mud carp sebesar 1127 bp. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari. Kadar protein polar naik 38. Parameter yang diuji meliputi bobot akhir rata-rata.05) dengan dedak padi tanpa fermentasi.47 g/ekor. Kandungan protein dedak padi naik 19. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi. Bogor dan terdiri atas dua tahap. Reza Samsudin. polar. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ –GATGAAACTCGAGTAGCCCTTGCTCTTC.28%. polar. oligosporus yaitu 2. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. Wadah percobaan yang digunakan yaitu akuarium volume 100 L.67%–100%. oligosphorus. retensi protein. fermentasi. dan sintasan. ikan mas .Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. KATA KUNCI: R. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar. dengan ditandai tumbuhnya koloni transforman berwarna putih.

Parameter yang diuji adalah kualitas air terutama kandungan ammonia. Di mana satu di antaranya di desain sebagai kolam akuaponik. Ongko Praseno. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. pertumbuhan. Penelitian telah dilaksanakan dari bulan Nopember 2009—Pebruari 2010.41 g/hari. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. kemudian ikan mas galur kuningan sebesar 1. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. dengan lokasi penelitian di Desa Kronjo. serta keramba jaring apung di danau maupun waduk. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. ukuran panen. dengan padat tebar 20 ekor/m3.25 kali lebih besar dibanding pada kolam konvensional. Benih ikan mas ukuran 18.86 g/hari. KATA KUNCI: ammonia. sedangkan yang lainnya sebagai kolam konvensional. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan. salinitas rendah.64 kali lebih banyak dengan ukuran panen 1. dan ikan mas galur majalaya sebesar 0. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. sintasan. Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. KATA KUNCI: ikan mas. tambak . Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. ukuran panen. Provinsi Banten. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. karena akhirakhir ini banyak lahan yang tidak digunakan (marginal). Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan. sawah. Sutrisno*). akuaponik.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*).28 g/ ekor yang digunakan sebagai hewan uji. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. Kabupaten Tangerang.15 g/hari. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. wildan. Achmad Sudradjat. Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. dan parameter kualitas air yang lain dianalisis secara deskriptif. Data setiap sampling dijadikan ulangan. Sedangkan sintasan. Lilis Sofiarsih*).

KATA KUNCI: survival rate.067mg) serta kelangsungan hidup (12. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. dapat dikembangkan di bak terkontrol maupun di KJA.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam.58 cm dan 17. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien. cobia larvae. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. Siti Zuhriyyah. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. Afifah. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian. kemudian diberikan sebagai pakan larva. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. KATA KUNCI: artemia nauplii.07%) relatif lebih tinggi dari pada perlakuan B dan C. lasted time feeding . memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. (B) umur 10 hari dan (C) umur 15 hari. fry performance. Hasil penelitian menunjukkan bahwa pertumbuhan panjang. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat. serta mempunyai respons yang baik terhadap pakan buatan.42%. Siti Zuhriyyah Musthofa. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. Masing-masing perlakuan diulang 3 kali. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva.

plasma nutfah . termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Lucky Marzuki Nasution*). budidaya. Herno Minjoyo*). sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. Stakeholder. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera.Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. KATA KUNCI: cobia. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. KATA KUNCI: ikan hias. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. Lebih dari 100 spesies.

dan pertambahan panjang total sebesar 1.. Depok ABSTRAK Deformity (dysmorphism. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. karena belum banyak yang membudidayakannya.. multifocal granuloma . dan yang terendah Moina. Afrika. dan selalu berusaha mendekati sumber oksigen (aerator). sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. virus). pakan alami. Deformity dapat disebabkan oleh : mutasi genetic. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias. Eni Kusrini*). diam dan kepalanya menyembul tepat di bawah permukaan badan air. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp.226 g. dengan 6 kali ulangan.778 cm. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. KATA KUNCI: deformity. Artemia sp. pertumbuhan. kondisi daya dukung lingkungan yang terus menurun. granuloma. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. Peacock bass ini akhirnya berenangnya jadi terbalik. peacock bass. infeksi penyakit (cacing. laju pertumbuhan harian sebesar 32.586%. diikuti Artemia. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh. Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. Tubifex sp. bakteri. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. KATA KUNCI: Synodontis nigriventris.Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*). Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. dan Tubifex sp.

Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. zat pemicu warna. Selama penelitian. Jhon Harianto Hutapea. Rainbow Papua . 20 ekor/bak. 60 ekor/bak. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. Hasil penelitian menunjukkan. T2. yaitu : astaxanthin. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai Sulawesi Tengah.87 ± 0. Variabel yang diamati meliputi. Bastiar Nur. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati. induk diberi pakan berupa naupli artemia/artemia pra dewasa. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. T3. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: banggai cardinal fish. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. wortel dan tepung kepala udang.9 ± 0. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF).3 cm dan bobot 2. dan Ahmad Musa Balai Riset Budidaya Ikan Hias. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. udang jembret (mysids) dan larva nyamuk.Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. 40 ekor/bak. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. KATA KUNCI: maggot. Hewan uji yang digunakan berukuran panjang total 5. density.50 g. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana.

KATA KUNCI: benih botia.5 cm dan panjang tertinggi sebesar 3. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian.5 cm (ukuran ekspor).67% namun tidak berbeda nyata dengan perlakuan AB (55%). dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar. Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari.05).05). Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. KO (air kontrol+oksitetrasiklin). hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. larva Tetraodon palembangensis . AB (aqua+blitz ich). Nina Meilisza. pertumbuhan panjang. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis).5 m dan tinggi air 40 cm. 55. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. 20. Sintasan terendah dihasilkan oleh perlakuan KB sebesar 51. 70. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1.0 cm dan bobot rata-rata 0. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. Selama pemeliharaan. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich). KF (air kontrol+formalin). namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis. KO (76. oksitetrasiklin. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0.67%). ukuran ekspor 1 inci (2. dan 105 dan dianalisis secara deskriptif.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.0 cm. 35. Masing-masing perlakuan dilakukan dengan 3 ulangan.33%.5 x 0. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. sintasan.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari.009 gram. namun tidak berbeda nyata dengan perlakuan AO (81. dan blitz ich) akan dilakukan melalui rancangan faktorial. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. AO (aqua+oksitetrasiklin). Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0. I Wayan Subamia. KF (71.67%).67%). sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0.5 x 0.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. AF (aqua+formalin). KATA KUNCI: prophylaksis. media air. Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. Pada akhir penelitian (hari ke 105).6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.

Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina. masa inkubasi . polypterus senegalus albino. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0.). Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73. Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. tiger catfish (Platysoma sp. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol. daya tetas telur 80.). Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias.31% dan menghasilkan larva normal sebanyak 218 ekor. perkembangan embrio. Asep Permana. dan Bastiar Nur Balai Riset Budidaya Ikan Hias. aligator (Lepisosteus oculatus).6°C–29.15%.).) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar.75 mL/kg untuk induk betina di bagian intraperitoneal. Depok ABSTRAK Ikan palmas (Polypterus sp. Pemijahan tersebut terdiri atas seleksi induk. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27. memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan. penyuntikan hormon. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy. inkubasi telur dan perawatan larva. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. antara lain sinodontis (Synodontys sp. KATA KUNCI: Neocaridina heteropoda. albino) masih sulit untuk memijah dalam wadah terkontrol. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur.4°C. pembuahan. Asep Permana. KATA KUNCI: palmas albino. SR (0-10 hari) 83. namun belum banyak diketahui data embriologinya. Ikan palmas jenis albino (Polypterus senegalus var. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. platidoras (Platydoras sp).91%.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. dan red-fin shark (Ephalzeorhynchos sp. sehingga produksinya masih mengandalkan impor dari luar negeri.5 ml/kg untuk induk jantan dan 0. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan.

Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah. panjang 40– 60 cm.1630 g dan dua ekor induk jantan yang berukuran panjang 1. oocyt . Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor. sedang induk jantan belum ada yang mengandung sperma. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32.042 pg/mL. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya).7–1.725 pg/mL. KATA KUNCI: induk. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungaisungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya.5 cm dengan bobot 0. Rendy Ginanjar. Asep Permana. Tutik Kadarini. LHRH 100 mg dan testosteron 50 mg (B). dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka. Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm. dan Darti Satyani Balai Riset Budidaya Ikan Hias. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana.3–2. Udang diberi pakan berupa moina beku sekali dalam setiap hari.0488–0.1272–0. Pada ikan yang baru di domestikasi. Rina Hirnawati. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai. hormon. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96. Kepadatan 10 ekor induk dengan bobot 65–600 g. KATA KUNCI: Neocaridina heteropoda. Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi. dipelihara selama 6 bulan. Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A).9 cm dengan bobot 0. matang gonad. LHRH 50 mg dan testosteron 50 mg (C). budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2.0518 g. implantasi. murah dan aplikatif.

Based on LSD test. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. The concluded that the optimum dose to produce male guppy is 50 mL/L. The proportions test showed dose 50 mL/L have significant different to control. carotenoid. suhu. because of residual effects to human caused cancer. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam. as the curative effort is not applicable. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. KEYWORDS: honey. The research was conducted experimental with completely randomized design. guppy fish . Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2.07 ± 9. and 75 mL/L. the alternative masculinization application of natural substance like honey. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit. 25 mL/L. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan. kemudian dipisahkan antara tangkai dan kelopaknya. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. but between treatments not significant different. male. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control). chrysin. yeast (30–800 mg/kg) dan sumber lainnya. The result showed that the percentage of male guppy at 50 mL/ L is 64. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method.6%). the treatments gave significant different with control. Honey is a natural substance which have crysin. 50 mL/L. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya.71%.000-4. Therefore.05 significant level. The observation to sexual secondary characteristic guppy can be observed at least two months old.000 mg/kg). KATA KUNCI: bunga tai kotok.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias.

975 butir/ekor. diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%. diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%.05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0. pakan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. jumlah telur. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut. pemijahan. Maros ABSTRAK Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. substitusi. rasio (1:3) jumlah induk memijah 35 ekor.4 g dengan padat tebar 15 ekor/keramba. jumlah telur 129. diameter telur. daya tetas telur FF 70 SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG.837–344. Induk dipelihara dalam 8 buah bak berukuran 1. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus).0 m dengan kepadatan 24 ekor/bak.5 m x 1. jumlah telur 272. semua induk secara individu dalam keadaan TKG=O. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. KATA KUNCI: tepung ikan. Maros ABSTRAK Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang.pada induk beronang.Forum Inovasi Teknologi Akuakultur 2010 FF 69 PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau. Pada awal percobaan.534–393. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap.5 m x 1. Peubah biologis yang diamati meliputi: jumlah induk memijah. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&). Siganus guttatus Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. diameter telur.837 butir/ekor. jumlah telur 227. jumlah telur. dan 2:1(B&:@&). 1:2 (B&:@&). Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama. dan daya tetas telur. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22.945–350. diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor. Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. KATA KUNCI: Siganus guttatus. rasio (1:2) jumlah induk memijah 30 ekor. B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan.333 butir/ekor.05±6.140 butir/ekor. jumlah telur 237. tepung rumput laut. guttatus . Lama penelitian berlangsung selama 6 bulan.865–335. 1:3 (B&:@&). S.05) dengan rasio efisiensi proteinnya.

100. salinitas rendah. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Tingkat total ammonium terlarut dalam air laut produksi masal N.1 kg dan sintasan 11. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. marine chlorella.2. produksi 81. penebaran dilakukan setelah satu bulan dari penebaran tokolan. oculata dengan NaOH dosis 75. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. produksi 78. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2.n pengapuran sebanyak 175 kg/petak.2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. Pemeliharaan dilakukan selama tiga bulan. tokolan. Gondol ABSTRAK Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Karawang. pada bulan pertama udang tidak diberi pakan. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. KATA KUNCI: pakan alami. oculata 13. yaitu pertambahan berat rata-rata 230 g. Sebelum penebaran. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368. dilakukan pengolahan tanah tambak.3–8. yaitu menggunakan tingkat teknologi tradisional plus.6%) dengan rasio DHA/EPA hanya 0. oculata relatif rendah (3. KATA KUNCI: udang windu.2%. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34.Forum Inovasi Teknologi Akuakultur 2010 FF 71 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. Dengan teknologi yang diterapkan. Penelitian ini dilakukan pada tambak di daerah Betok Mati.5–50 m3 dengan rata-rata kepadatan akhir N. Nannochloropsis oculata. Empat petak tambak masing-masing berukuran 3. sedangkan pada dua bulan berikutnya diberi pakan pelet udang. kemudian dikeringkan sekitar satu minggu.1±0.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. oculata relatif tinggi (4. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1.04 juta sel/mL dan rotifer 186±5. Idil Ardi. rotifer Brachionus rotundiformis.500 m2 digunakan untuk percobaan. Setelah dua hari.5 g. Dari pemeliharaan udang selama tiga bulan. 427. Pemadatan (flokulasi) N. semi-continuous system . Karawang FF 72 PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut. dan Wartono Hadie Pusat Riset Perikanan Budidaya. Kecamatan Cilebar.8 kg dan kelangsungan hidup 100%.

budidaya. Siganus guttatus FF 74 ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA Lies Emmawati Hadie Pusat Riset Perikanan Budidaya. pertumbuhan.3 ± 10. KATA KUNCI: kadar lemak.79 g/ekor. karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. 9%. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global.00.00). Jika tidak ada efek rumah kaca. sintasan.67 cm/ ekor dan bobot 155.05) terhadap pertumbuhan dan sintasan ikan beronang. Hasil penelitian menunjukkan bahwa kadar lemak 5%. (B) 9%. 11.0 m x 2. ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. ikan langka. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global.00. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%. dan 17. Jakarta ABSTRAK Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. Maros ABSTRAK Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi. plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. Wadah penelitian yang digunakan adalah jaring berukuran 1.0 m x 1. yang ditempatkan pada keramba jaring apung di laut. Permasalahan ini perlu dipikirkan solusinya. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. dan 13% dalam pakan berpengaruh tidak nyata (P<0.2 ± 0.Forum Inovasi Teknologi Akuakultur 2010 FF 73 PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus) Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau. dan (C) 13%. masingmasing terdiri atas 3 ulangan. juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. konservasi . Pemberian pakan dilakukan 3 kali/hari (pukul 08. Padahal dalam upaya peningkatan produktivitas perikanan budidaya.0 m. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). suhu dipermukaan bumi akan turun secara drastis. KATA KUNCI: pemuliaan. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia.

Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. parasit . mas koki.59 ha. Pulau Kambunong. Gyrodatylus spp.Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. Chiclidae. neon tetra. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. budidaya laut. kedalaman. kapiat albino.41 ha dan kurang sesuai 52. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. (Copepoda) dan Centrocestus sp. (Dinoflagelata). Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. fosfat. kecepatan arus. nitrat. Oleh karena itu. Trematoda). Pulau Bekengkeng. Dari Sampel yang diperiksa 33. salinitas. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. dan besi. arah arus. 98% terinfeksi parasit. (Monogenea). Kualitas air perairan yang diukur adalah: pH. dan Tanjung Dapuran. sympilum dan Characidae. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. perairan Kalukku. Synodontis. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. penyakit. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. keramba jaring apung. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. (metacercaria. Argulus sp. dan Dactylogyrus spp.18 ha. Red Fin Albino. dan Ichthyophthirius multifiliis (Ciliata). Trichodina sp. perairan Papalan. KATA KUNCI: ikan hias air tawar. KATA KUNCI: kesesuaian lahan.18 ha yang terdiri dari sangat sesuai seluas 133. sirip. Sampel ikan hias antara lain dari golongan cyprinidae. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. Akhmad Mustafa. cukup sesuai 512. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. cat fish. 2009. dan platydoras. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. kecerahan. dan insang.

dan Zn dalam air dan daging ikan. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. CD. identifikasi dan analisis data serta pelaporan. Organofosfat. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. Tahapan penelitian meliputi: penentuan lokasi. Cd. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. zona 2 Purwakarta. pestisida. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan. dan Karbamat. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. Piretroid. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. muara Sungai Citarum.86 ton/bulan. Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. serta debit air dari muara sungai yang masuk ke perairan waduk. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. Variabel yang diamati adalah konsentrasi kandungan Pb.88 mg/L/kg daging ikan. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. badan air Sungai Citarum dan Sungai Cimeta. inlet. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: logam berat. muara Sungai Cisokan. Contoh yang diambil berupa air. Perairan Waduk Cirata sudah tercemar oleh parameter Zn. pengambilan contoh. sedimen (lumpur/tanah). Cd. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1.98 ton/bulan. preparasi. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. batas daerah bahaya. pencemaran.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. Cd. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. residu .8214 ton/bulan dan 1. KATA KUNCI: lahan perikanan budidaya. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet.

/L. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies. Pelabuhan Ratu.75–4887. A. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa.nebulosa .Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp.17-9. Maleber.83.marmorata dan (4. dan Protozoa. pada region mitokondria 16SRNA. dan Desmiceae dari zooplankton ditemukan jenis Rotifer. Dinophyceae. A. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias.12–3. dan Cadas Bodas. selanjutnya digunakan untuk analisa genetik. fitoplankton. Sukabumi.71–19. indeks dominansi (C) = 0.35). Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur. Palumbon. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik. PELABUHAN RATU. KATA KUNCI: komunitas. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi./L dan zooplankton berkisar antara 93. dan nilai kemerataan (E) = 0.) DI PERAIRAN SUNGAI CIMANDIRI. Cyanophyceae. (13. Copepoda.52) dikelompokan pada jenis A. Sungai Cimandiri. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor. dikelompokan pada jenis A. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393. dan sebanyak 150 ekor disimpan dalam alkohol absolut. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. dan 4–6 m. KATA KUNCI: Glass eel.5 ind.65–0.75– 993. nebulosa. Ciputri.33. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton. bicolor bicolor.31.75 ind. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2.072–0. A. Patok Batas.7) dikelompokan jenis A. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. Bacillariophyceae.n. 2–4. bicolor.marmorata.

Pemberian pakan awal di mulai saat larva berumur D-2—D-10. Gondol **) Mahasiswa Universitas Gadjah Mada. pola pemangsaan FF 82 KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT Mulyasari*).. KATA KUNCI: ikan nilem.94 g. pakan awal. Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya ABSTRAK Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. 21.27 mm. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10. Jogjakarta ABSTRAK Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). kuning telur) dan 3 ulangan.Forum Inovasi Teknologi Akuakultur 2010 FF 81 POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN Afifah*). dan 1790%) dan C (11. B. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan. terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. selanjutnya secara periodik 5 hari sampai dengan D-30. sirip dada (pectoral fin).10 g. 25.97%) dibanding perlakuan A (10. dan 21. Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL). KATA KUNCI: larva ikan kuwe. 27.20 g.01 mm. Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan. meristik . Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan. Dinar Tri Soelistyowati**). Titiek Aslianti*). gonad kerang. Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. dan 17.99 mm. adalah dengan program pemuliaan. dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut. dan C.dan inter-populasi ikan nilem di Jawa Barat. sirip perut (ventral fin). namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.17%). Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. dan sirip anal (anal fin). Osteochilus hasselti. rotifer. Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin).

Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. ikan patin . Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. Ikan dipelihara selama 40 hari. Jakarta ABSTRAK Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. serta sintasan ikan. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. protein. pertumbuhan. pakan buatan. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%.05) yaitu sebesar 1.500. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin.3 g/ekor.000.-–Rp 7. KABUPATEN BATANG) Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Balai Riset Perikanan Budidaya Air Tawar.800.-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6.-/kg.56%. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya. dan 20%. Bogor ABSTRAK Pakan memegang peranan penting dalam budidaya ikan nilem. Ikan uji yang digunakan adalah ikan nilem dengan bobot ratarata 5. bahan baku lokal. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0. Parameter yang diamati yaitu pertumbuhan spesifik. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. 19%. konversi pakan. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari. KATA KUNCI: efisiensi usaha. pakan FF 84 EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Bogor.000.05). Penelitian dilakukan di Kabupaten Brebes dan Batang. KATA KUNCI: nilem.0±0. Harga pakan hanya Rp 2.-–Rp 3. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0.Forum Inovasi Teknologi Akuakultur 2010 FF 83 EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. Metode penelitian dilakukan secara studi kasus.

Gunawan.30) dan laju pertumbuhan spesifik (merah: 0. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. tengadak.19. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2. genetika . Irwan Setiadi.6±0.7±0. ikan tuna sirip kuning. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda.8 m) dan bak fiberglass berbentuk oval volume 2.57±0. Irin Iriana Kusmini. hitam: 0. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari.Forum Inovasi Teknologi Akuakultur 2010 FF 85 PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN Jhon Harianto Hutapea. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir. hitam: 5.06. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit.1±0. Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk.7 m. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. Bogor ABSTRAK Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. sintasan FF 86 KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON Gleni Hasan Huwoyon. KATA KUNCI: warna.02. dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari.20).8±1. Barbonymus schwanenfeldii. warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut.02). KATA KUNCI: penanganan calon induk. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi.1 m3 (lebar 1. dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut. Pada beberapa jenis ikan.65±0.5 m3 (diameter 2 m dan tinggi 0. Gondol ABSTRAK Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg).1 m dan tinggi 0.4 m dengan panjang 2. pertumbuhan mutlak (merah: 6. hitam: 1. Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali.

urea.00% khamir laut. bahan kering. dan energi di antara perlakuan berbeda nyata (P<0. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator.5% molasses + 0. dan abu di antara perlakuan tidak berbeda nyata (P>0. Berdasarkan hasil penelitian.02% khamir laut. dan TSP.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan.05). Hasil penelitian menunjukkan bahwa: pH. pupuk . BETN. gula.5% molasses + 0. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia).08% khamir laut. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan.06% khamir laut.5% molasses + 0. E = Daun mengkudu + 2. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0.05).01). sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu. daun mengkudu. B = Daun mengkudu + 2. Setelah 5 hari dipanen. Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. R4 = Daun mengkudu + 2.04% khamir laut. serat kasar. R3 = Daun mengkudu + 2.5% molasses + 0. KATA KUNCI: khamir laut. lemak kasar.5% molasses + 0. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2. silase. protein kasar. Jepara. Setelah kering.

Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau.000 ind. Perlakuan B.5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA.1 ton/ha/16 mg menjadi 1. penggunaan sarana produksi yang ramah lingkungan.000 ekor/ha) dan rumput laut (1 ton/ha). KATA KUNCI: biofilter. rumput laut (2 ton/ha) dan tiram (20. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik. udang windu. tambak marjinal . Erfan Andi Hendradjat. rumput laut (2 ton/ha) dan tiram (40.48 kg/ha. bandeng (3.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59.000 ekor/ha. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara. Pada akhir penelitian diperoleh sintasan 63. rumput laut. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram.000.-/musim tanam dengan B/C rasio 2. di mana termasuk cara budidaya udang.000 ekor/ha). ditebari bandeng (10. BL542 bulan III. petak I ditebari bandeng (10.977.73% dengan produksi sebesar 217. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Sulawesi Selatan. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu.000 ekor/ha) dan rumput laut (1 ton/ha). Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I.46% dengan produksi udang windu sebesar 249. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10. KATA KUNCI: udang windu.000 ind/ha) dan petak II. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40./ha) dan petak II : bandeng (3. CBIB. MY1112 bulan II. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal.000 ekor/ha). KABUPATEN TAKALAR Muharijadi Atmomarsono. Brata Pantjara.07. serta manajemen pakan dan air secara benar.

05) pada akhir penelitian. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39.7 kg/ha/90 hari). (C2) probiotik komersial dengan dosis pakan 50%. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. production. sintasan. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masing-masing 3 kali dan lama pemeliharaan 10 minggu. PO4. kandungan BOT di atas 30 mg/L. dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. Maros. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66.8% dan 228. KATA KUNCI: probiotik. Balai Riset Perikanan Budidaya Air Payau. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. dan C) Kontrol (tanpa probiotik). Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. dan total Vibrio. survival rate.11%. (D2) kontrol 2. diikuti perlakuan kombinasi probiotik A (50. terutama salinitas yang mencapai 56 ppt. Penelitian dilakukan di laboratorium basah. air laut salinitas 28 ppt sebanyak 15 L. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). total bakteri. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. dosis pakan. Nurbaya. Nurbaya. (C1) probiotik komersial dengan dosis pakan 100%. Sintasan udang windu tertinggi didapatkan pada perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60. NH3. Penelitian dilaksanakan selama 90 hari. Muliani. Hasil penelitian menunjukkan. B) Pergiliran probiotik BT951 bulan I.7 kg/ha/90 hari). NO3. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan NH3 selama penelitian relatif lebih tinggi pada perlakuan yang tidak menggunakan probiotik dengan dosis pakan 100%.05% dan 298. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. Pengamatan sintasan udang windu dilakukan pada akhir penelitian. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah. KATA KUNCI: probiotic bacteria. MY1112 bulan II.7 kg/ha/90 hari). dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. BL542 bulan III. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial. menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. udang windu .35% dan 448. Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. NO2. Oleh karena itu. tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani.

Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan.4 ha. rumput laut dan ikan bandeng adalah perlakuan B (10. sintasan.masing-masing dengan dua kali ulangan.5% dengan produksi 19.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1. masing-masing terdiri atas 2 ulangan. 31) yang ditebar pada masing-masing tambak adalah 10. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha). udang windu.7 kg. produksi . Sintasan dan produksi udang windu dan ikan bandeng masingmasing adalah 66. Maros selama 90 Hari.9 kg dan secara finansial memberikan keuntungan sebesar Rp 11.0%. Selama pemeliharan tidak diberi pakan. serta 99. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP.000 ek/ha bandeng) menunjukkan hasil yang terbaik.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya. ikan bandeng. Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha). kesehatan. Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). KATA KUNCI: probiotik. Sampling dilakukan 30 hari sekali selama 90 hari. namun belum mampu menurunkan kandungan amoniak dalam media budidaya. rumput laut. dan pertumbuhan udang serta aman bagi konsumen.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus).572. Tjaronge. baik pada air maupun pada dasar tanah tambak.500 m2 dengan kedalaman 80 cm.9% dan 33. M. Oleh karena itu. Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari. yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0.000 ekor/ha (1 ekor/m2). Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau. dan kontrol (tanpa aplikasi probiotik). Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2.000 ekor/ha). Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya.-/ha /90 hari. KATA KUNCI: multitropik. produksi. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok.000. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp.8% dan 63. Tokolan udang windu (PL.

Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Alimuddin**).Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. 3 hari. uji tantang. 12 jam. yang sampai saat ini belum bisa diatasi secara secara tuntas. 4 hari. IPB. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi. Bunga Rante Tampangallo. 1 hari. Maros Departemen Budidaya Perairan. KATA KUNCI: promoter. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. Komar Sumantadinata**). Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter.05) dibandingkan dengan kontrol.3% dan tidak berbeda nyata (P>0. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. Ketika ditantang dengan WSSV. ekspresi gen. EGFP. udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. gen PmAV menunjukkan respons meningkat (up-regulation). udang windu . dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Aan Fibro Widodo. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. Sukenda**). KATA KUNCI: ekspresi. termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). Promoter dikatakan aktif apabila gen penanda dapat terekspresi. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV.0%). transfeksi. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. Syarifuddin Tonnek. Selain itu. 2 hari. Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. danAndi Tenriulo*) **) **) Balai Riset Perikanan Budidaya Air Payau. Fakultas Perikanan dan Ilmu Kelautan. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR.1%) serta tanpa transfeksi (49. gen anti virus. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan.

Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. Setelah pengujian. KATA KUNCI: White Spot Syndrom Virus (WSSV). sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. cepat dan akurat. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. Antibodi monoklonal memiliki kespesifikan yang tinggi. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. serta berpeluang untuk digunakan secara langsung di lapangan. monodon dengan melihat gejala klinis dan studi histopatologi. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. karena relatif mudah dan murah. antibodi monoklonal . Pewarnaan jaringan menggunakan Hematoxilin eosin. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. khususnya ELISA. Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. Nurhidayah. dan disertai ulserasi lapisan mukosa epitel. serta epidemi penyakit di lapangan. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. Teknik serologi. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. KATA KUNCI: ELISA. menyeleksi. Penelitian dilakukan untuk membuat. Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. White Spot Syndrome Virus (WSSV). Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama.

31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya. KATA KUNCI: growth.120). menggunakan 4 petak masing masing berukuran 4.45 g/ekor dan ditebar kepadatan 100 ekor/bak.masing-masing perlakuan diulang tiga kali. Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei). Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1. Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6.102 CFU/mL.51).9). Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12).034) berbeda nyata (P<0.0±149. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari.5±88. produksi (2087. Takalar. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0.257±0.05) dengan perlakuan A (1. karena berpengaruh terhadap pertumbuhan. KATA KUNCI: udang vaname. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%. namun terbatas pada golongan masyarakat menengah keatas (padat modal). Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi. Riset ini dilaksanakan di tambak Punaga. sintasan.18235 mg/L) dibandingkan dengan perlakuan A (0. dan kepadatan benur dan tokolan adalah 50 ekor/m2. feed. Instalasi BRPBAP.Setiap perlakuan dengan 2 ulangan.7 m sebanyak 9 buah.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10. Budidaya ini berkembang dengan teknologi intensif.234). dan efisiensi biaya produksi. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun.258). survival rate.048). Selama pemeliharan 85 hari. Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan.0328 mg/L) pada akhir penelitian. tokolan.085±0. dan (B) pembesaran dengan tebar tokolan (PL 27). sintasan (90.096±0. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak. Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah. kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0.05) terhadap pertumbuhan. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%.Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.549±0. produksi (1831. namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan.114±0. Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei). rasio konversi pakan dan produksi udang vaname.000 m2/petak. sintasan ( 92. sintasan. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. 829. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B).. dan pemeliharaan berlangsung 80 hari di tambak. RKP pada pembesaran udang vaname teknologi intensif. Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau. benur. and L vannamei . budidaya udang intensif.83±8.

19.71%–22.6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik. 11. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI . Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0. C (protein 33%.8 kkal GE/g). JKP 59.6 kkal GE/g). retensi lemak (RL). sintasan.029–2.4–2. Ing Mokoginta**) dan Dedy Yaniharto***) *) **) Balai Riset Perikanan Tawar.intensif.1 g. salinitas 24–25 ppt. Bobot yuwana yang ditebar rata-rata 0. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). dan 23. ekskresi amonia dan stabilitas pakan.5 g/ekor dengan kepadatan 10 ekor per akuarium.7%. sintasan. C/P rasio 15. 5 kali sehari pada pukul 07. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an.4.5%. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4. jumlah konsumsi pakan (JKP). dan E atau komersial (protein 40. pertumbuhan.1% dan 65.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Namun. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0. M.00. dan pH 8. Litopenaeus vannamei .000 m2. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname. Selama pemeliharaan. Pakan diberikan at satiation.2%. produksi. D (protein 35%. yuwana. Jakarta Utara. Sintasan antara 73. Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%. FCR 1. suhu 28°C–30°C.00. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13.5 kkal GE/g). C/P rasio 11. C/P rasio 13. kecernaan total dan kecernaan protein masingmasing 26.9%–68. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH.00. 15. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0.00.2–78. laju pertumbuhan harian. pertumbuhan relatif (PR). Perlakuan terdiri atas pakan A (protein 29%. RL dan RP masing-masing 26. Penelitian dilakukan di tambak percobaan Punaga Takalar.2 kkal GE/g).05) terhadap pertambahan berat mutlak.8% dan 11. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0.5%–36. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum.4%. Hidayat Suryanto Suwoyo. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. Bogor Departemen Budidaya Perairan. kecernaan protein. Agus Suprayudi**). Litopenaeus vannamei Deisi Heptarina*).1 kkal GE/g).0–8.05). sedangkan ekskresi amonia antara 1. B (protein 31%.69%. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon).7%–1130. retensi protein (RP).05).Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu.2% serta WS berkisar antara 49.39%. sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya. C/ P rasio 16. C/P rasio 14. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7.5%–62. rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi .INTENSIF DI TAMBAK Abdul Mansyur. kecernaan total.4%–94.3%–86. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB). namun kurang diimbangi dengan penyediaan pakan yang sesuai. fotoperiod dibuat 12 jam terang–gelap.5. Kisaran nilai masing-masing parameter tersebut adalah.00.9%–79. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan. konversi pakan (FCR).464 mg/kg tubuh/jam. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan. K ATA KUNCI: protein optimal. Fakultas Perikanan dan Ilmu Kelautan. Kemudian dilanjutkan uji kecernaan. PR 532.

Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. dan SP. EST. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. Untuk mengetahui jenis virus yang menyerang udang tersebut maka.Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). SOD. dan SP mampu berdiri sendiri. Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. Haryanti*). SOD. Taura Syndrome Virus. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). IMNV dan PvNV . L. belum dapat diyakinkan secara pasti bahwa ekspresi EST. SPF. PGM. Semua gejala tersebut diduga akibat adanya serangan virus. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. dan moribund. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. protein haemolimph dan ekspresi enzim (GPI. Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. SOD. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. toleran. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terus-menerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). IHHNV. TSV. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . dan Rustidja**) *) **) Balai Besar Riset Perikanan Budiaya Laut. MBV. SOD. PGM.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). toleran. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. EST. Lila Gardenia. KATA KUNCI: Litopenaeus vannamei. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. toleran dan terinfeksi TSV. and SP) pada udang yang sehat. WSSV. Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. Gondol Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. Namun demikian. KATA KUNCI: enzim.

Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. 2%. pemijahan. dan 9. beserta persilangannya. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Imron. dan pembesaran. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. Barito. 25%. diberikan pada pagi dan sore. dan D. Namun demikian. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. 0. yang dilakukan selama 5 bulan. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. B. 6. berturut-turut 0.25 m2/ekor induk. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. diikuti perlakuan D. 0. udang galah .42 mm. Ciasem. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. yaitu 0%. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). Romy Suprapto. khususnya rasio jantan-betina. dan tidak berbeda nyata antar perlakuan.27 mm. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. berturut-turut 27%.5%. Sebagai perlakuan adalah rasio jantan-betina. 0.25 g. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal.31 mm. persilangan. pendederan II. yang meliputi pertambahan panjang dan bobot.20 g.5% berturut-turut untuk perlakuan A. berdasarkan nilai heterosis yang didapat. KATA KUNCI: genetik. dengan lama pengujian 8 minggu. KATA KUNCI: mortalitas. Musi. pendederan I. pertumbuhan.21 g. A dan B. B) 1 J : 2 B. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. reproduksi. dan 13%. rasio kelamin. Asahan. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%. dan 0. Pada sistem tersebut kematian induk relatif rendah.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. Penelitian meliputi pembenihan. C. dan D) 2 J : 4 B. C) 2J : 2 B. 0. dengan sistem resirkulasi. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. Penelitian dilakukan dengan rancangan acak lengkap.

**) Jurusan Budidaya.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan. (4. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan.8±1.05) terhadap kelimpahan bakteri.0. B.4%) diikuti oleh populasi hasil crossbreeding (57.93. larva udang galah. B (perendaman dalam larutan formalin 250 mg/L).93.00% dan 3. formalin. 52. Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi. C.92. yaitu A. namun tidak berbeda nyata (P>0. outbreeding. KATA KUNCI: bawang putih.4 mm). sirih. Fakultas Perikanan dan Ilmu Kelautan.6±21. C.5% dan 3. dan D. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah. C (perendaman dalam larutan ekstrak daun sirih).5±28. keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74. Pada karakter pertumbuhan. . Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰.8±7. (0 cfu/mL). 4. tanpa penambahan desinfektan).7 mm) diikuti oleh populasi hasil outbreeding (21. B.5 x 103). desinfektan. merupakan langkah bio-security. 47. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan.0±1. (0 cfu/mL). 45. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan.0%) dan populasi inbreeding (25.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah.8±1. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya. Sukamandi. KATA KUNCI: inbreeding. dengan nilai sebagai berikut: A. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan. dan D. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0. Dinar Soelistyawati**). dan D (perendaman dalam larutan ekstrak bawang putih). Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan. yaitu inbreeding. keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Hewan uji yang digunakan adalah larva udang galah umur dua hari. Harry Wuwungan**). Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah.5%. (8. crossbreeding. Hasil penelitian menunjukkan bahwa pada karakter sintasan.4 x 103 cfu/mL) . sintasan (SR) dan perkembangan larva (LSI).0%).4 mm) dan populasi inbreeding (21.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*). Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan. Tiga tipe persilangan. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan budidaya dapat dioptimalkan.83% dan 3. Perlakuan yang diberikan yaitu A (kontrol. 37.

Forum Inovasi Teknologi Akuakultur 2010

K 21
Eni Kusrini*), Lies Emmawati**), dan Wartono Hadie**)

Balai Riset Budidaya Perikanan Ikan Hias, Depok

Pusat Riset Perikanan Budidaya, Jakarta

Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang), Pelabuhan Ratu, dan Bone. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air,Karawang dengan Pelabuhan Ratu lebih dekat. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu.
KATA KUNCI: udang galah, populasi, jarak genetik

K 22
Muslimin, Sulaeman, Andi Tenriulo, dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau, Maros

Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. semisucatus) dengan kepadatan berbeda. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau, Maros dengan panjang awal mysis adalah 100-190 milimikron. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm, diameter 15 cm dan Volume 3 L. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm, lebar 40 cm, dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut, maka ditambahkan pemanas/heater suhu 30°C. Hewan uji ini ditebar dengan kepadatan berbeda. Perlakuan yang diujicobakan adalah: A. Kepadatan larva 25 ekor/L; B. Kepadatan larva 50 ekor/L; C. Kepadatan larva 75 ekor/L; D. Kepadatan larva 100 ekor/L; E. Kepadatan larva 125 ekor/L; dan F. Kepadatan larva 150 ekor/L. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap, di mana masing-masing perlakuan di ulang tiga kali. Jenis pakan yang diberikan berupa pakan alami chetoceros, artemia, dan pakan buatan. Pemberian pakan dilakukan setiap pagi dan sore (08.00 dan 16.00 wita). Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0,05) terhadap laju sintasan dan pertumbuhan larva udang pama. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%, (B) 32%, (C) 31%, (E) 24%, (D) 16%, dan (F) 10%.
KATA KUNCI: kepadatan, larva udang pama, sintasan dan pertumbuhan

Forum Inovasi Teknologi Akuakultur 2010

K 23
Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1.446–6.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan. Wadah percobaan yang digunakan adalah bentik jar (chamber), yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. Oksigen terlarut diukur dengan alat pengukur O2 (TPSTM Model WP-82 DO meters). Data laju respirasi selama proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. Ver.1.2. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan, dengan kisaran tingkat konsumsi oksigen 0,26–7,27 mg/g/jam. Kisaran kelarutan oksigen pada awal penelitian adalah 3,14–7,9 mg/L dan setelah 1 jam pengukuran 0,03–0,48 mg/L dan kontrol tetap berkisar 4 mg/L. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4,0235 g adalah 15,65 g/m3.
KATA KUNCI: udang pama, padat tebar, estimasi

K 24
Sulaeman, Aan Fibro Widodo, dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau, Maros

Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan, akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP), BRPBAP, Maros. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0,18±0,03 g, panjang karapas 4,6±0,1 mm dan lebar karapas 5,9±0,1 mm. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar); B (metode gantung); dan C (gabungan antara keduanya). Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0,05) terhadap pertumbuhan bobot mutlak, bobot harian, pertumbuhan panjang dan lebar karapas mutlak dan harian, tetapi berpengaruh nyata (P<0,05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66,96 %; 58,17 kg/250 m2, disusul perlakuan C: 64,06; 44,95 kg/250 m2 dan terendah pada perlakuan B: 60,58%; 40,52 kg/250 m2.
KATA KUNCI: kepiting bakau, metode sebar, polikultur, rumput laut

Forum Inovasi Teknologi Akuakultur 2010

K 25
Aan Fibro Widodo, Sulaeman, dan Muslimin Balai Riset Perikanan Budidaya Air Payau, Maros

Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp.). Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros, Sulawesi Selatan. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau, yaitu: A (625 ind./mL); B (500 ind./mL); C (375 ind./mL); D (250 ind./mL); dan E (125 ind./mL). Peubah yang diamati adalah laju pemangsaan, sintasan, dan peubah kualitas air. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0,05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. Hasil terbaik diperoleh pada perlakuan A, yaitu kepadatan rotifera 625 ind./mL dengan laju pemangsaan sebesar 259,1667 ind./larva/jam dan sintasan 86,0%.
KATA KUNCI: kepadatan, kepiting bakau, laju pemangsaan, rotifera, zoea

K 26
Supono Budidaya Perairan Universitas Lampung

Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Karena hidup di dasar tambak, jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang, yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang. Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. Selain diatom epipelic, data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0,75), TOM (rs = 0,71), dan nitrat (rs = 0,66), sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0,72), kandungan liat (rs = 0,65), dan kandungan bahan organik (rs = 0,62).
KATA KUNCI: diatom epipelic, tambak udang, kualitas air, kualitas sedimen

benih.0±0. namun kemampuan produksi para pembudidaya hanya sampai 4 inci.9 g. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda. panjang standar. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan.6±10. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. dan panjang total). ragam. Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci.74) dan panjang (7. Bogor. Pertambahan bobot (71. Dianalisis dengan Rancangan Acak Lengkap (RAL). Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci.47) terbaik adalah benih lobster air tawar asal Tangerang. Gleni Hasan Huwoyon.0 cm dan adanya pertambahan bobot sebesar 58. lokasi .72). KATA KUNCI: Cherax quadricarinatus. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot.6-7. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6.6-71.9±9. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2.Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini. panjang standar. dan Tulung Agung). pertumbuhan. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. simpangan baku. dan panjang total tiap individu.

58 m x 0. lebar dan bobot cangkang. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp.05 mm dan 10. B.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria. Sargassum. + Sargassum sp.59±2.92 g dan 219.9 ± 1.. (B) Ulva sp. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41. dan Sargassum sp.44 µg. cottonii 37. (C) Sargassum sp.891.06 g. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto.854. Ibnu Rusdi.23 g dan 121. KATA KUNCI: Haliotis squamata.39 mm dan 10. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut.17 ± 2.44 µg. cottonii : 40. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir. aplikasi teknologi pembesaran . (P<0.18 mm dan 7.31 m. dilakukan dengan menerapkan 4 perlakuan pemberian pakan. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali.52 µg/hari) dan terendah pemberian pakan Sargassum sp. Gracilaria.19 ± 6.44 µm dan 65. + Ulva sp.37 mm. (-5. yaitu: (A) Gracilaria sp.82 µg/hari).44 ± 102.00 µm dan 38. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit. pakan (B)= E. E.06 ± 170.05) antar perlakuan.50 g dan 217.44 µg serta 92. Ulva. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0. + Ulva sp.73 g. yaitu pada perlakuan pemberian pakan Gracilaria sp.. 38.0 ± 0. + Sargassum sp.89 µm dan 38. Riani Rahmawati. dan kombinasi keduanya. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga.68 µg/hari).05). Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30. serta pakan (C)= kombinasi Gracilaria + E. (13.06 µg/hari). (rasio 1:1:1). cottoni.16 g dan -86. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m. Bambang Susanto.80 sampai 31. 73. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon. sangat sesuai dalam memacu pematangan gonad induk abalon H. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0. Ulva sp. Riani Rahmawati. kombinasi Gracilaria sp.39 m x 0.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON.03 ± 1. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0. squamata. I Nyoman Adiasmara Giri.99 mm dan 36. + Ulva sp. Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp. masing-masing 58. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A. (7. dan pakan (C) dengan R² = 0. pakan (B) dengan R² = 0. (13.1 ± 4. dan C berturut-turut adalah 120.73±2.56 ± 48. KATA KUNCI: abalon Haliotis squamata..17 ± 25.613.26 ± 10. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir.39 g.02 g. (D) Kombinasi Gracilaria sp. + Sargassum sp.

80/20% (B). Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan. Nilai variasi genetik induk abalone asal Banten (0.7 cm. Untuk itu. Est-3*. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. dan Ulva sp. KATA KUNCI: abalon Haliotis squamata. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. peluang pasar serta teknik budidayanya yang sederhana. Tatam Sutarmat. 100/0% (A). Est-2*. Kepadatan awal benih abalon adalah 450 ekor per wadah. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air./Ulva sp. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. dan Ulva sp. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. KATA KUNCI: allozyme. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut. dengan bobot awal 2.13) lebih tinggi dibandingkan dengan induk asal Bali (0. Est-4* dan Cah-3*. penjarangan . Hirmawan Tirta Yudha. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. dengan proporsi yang berbeda Gracilaria sp. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. 60/40% memberikan pertumbuhan abalon terbaik. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. Gondol. proporsi pakan. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. Sampel yang digunakan berasal dari Bali dan Banten./Ulva sp. mengingat permintaannya yang cukup tinggi. genetic monitoring. pembesaran.6-3. Setiap perlakuan terdiri atas 2 ulangan.52. Abalon diberi pakan rumput laut Gracilaria sp. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. Pakan dengan proporsi Gracilaria sp. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. dan 60/40% (C) sebagai perlakuan.06).2 g dan panjang cangkang 2. wild. Ibnu Rusdi. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. Est-1*. Gpi*. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. tinggi 22 cm.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin.

Forum Inovasi Teknologi Akuakultur 2010

M 05
Zafran, Indah Mastuti, dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut, Gondol

Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. Karena itu, tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut, Gondol, Bali. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar, yaitu media spesifik untuk bakteri Vibrio. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0,05 µm). Setiap perlakuan diulang 3 kali. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1, isolat-2, dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13,33%; 18,33%; dan 21,67%; sedangkan mortalitas pada kelompok kontrol hanya 3,33%.
KATA KUNCI: abalon, Haliotis squamata, vibriosis, Vibrio cincinnatiensis, uji patogenisitas

M 06
Sudewi, Apri I. Supii, dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut, Gondol

Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan. Namun, masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan. Perlakuan yang diberikan adalah ukuran tebar 3,44±0,44 mm (perlakuan A); 10,85±0,1 mm (perlakuan B); dan 20,36±0,55 mm (perlakuan C). Parameter yang diamati adalah laju pertumbuhan harian dan sintasan. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0,44±0,01 mm/hari (perlakuan A); 0,46±0,03 mm/hari (perlakuan B) dan 0,30±0,01 mm/hari (perlakuan C). Laju pertumbuhan lebar cangkang 0,37±0,01 mm/hari (perlakuan A); 0,4±0,03 mm/hari (perlakuan B) dan 0,27±0,00 mm/hari (perlakuan C). Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0,05) dibandingkan dengan perlakuan C. Sintasan yang diperoleh untuk perlakuan A, B, dan C berturut-turut 37,16%; 71,69%; dan 46,42%. Oleh karena itu, untuk memperoleh pertumbuhan dan sintasan yang baik, penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm.
KATA KUNCI: Pinctada maxima, pertumbuhan, sintasan, ukuran awal spat

Forum Inovasi Teknologi Akuakultur 2010

M 07
Apri I. Supii*), Ida Ayu Astarini**), dan Sudewi*)

Balai Besar Riset Perikanan Budidaya Laut, Gondol

Fakultas MIPA Universitas Udayana

Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan, pada tingkat nasional, regional maupun lokal. Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Berdasarkan hasil pengkajian, secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari, Sumber Sari, Teluk Awen, dan Teluk Rabu. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara, akan tetapi jika diinginkan, budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. Pantai Pengambengan khususnya, tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai.
KATA KUNCI: potensi kelautan, tiram mutiara, Pinctada maxima, Jembrana

Forum Inovasi Teknologi Akuakultur 2010

LL 1
Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau, Maros

Produksi rumput laut ditargetkan meningkat dari 2,6 juta ton per tahun sekarang ini menjadi 7,6 juta ton per tahun pada 2014, sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. Umumnya pembudidaya rumput laut, Kappaphycus sp. mengaplikasikan metode long line, di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut, Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan, yakni 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m, di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masing-masing dengan 3 kali ulangan. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver. 3,1. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut, K. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m dari permukaan perairan. Oleh karena itu, metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468,75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan.
KATA KUNCI: Kappaphycus alvarezii, pertumbuhan, kandungan keraginan, vertikultur

LL 2
Siti Fadilah, Rosmiati, dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau, Maros

Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. verrucosa. Rumput laut dikumpulkan dari Kabupaten Brebes, Jawa Tengah. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0,1%. Eksplan diinokulasi ke dalam media cair yang diperkaya PES. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker, sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu. Pengamatan panjang tunas, jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81,70%) daripada botol (90,75%). Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2,40 mm pada stoples dan 2,42 mm pada botol. Sedangkan jumlah tunas dalam stoples (7,50) lebih banyak dibandingkan dalam botol (7,03). Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26,70 dibandingkan dalam botol yang hanya 6,20.
KATA KUNCI: botol, kepadatan eksplan, stoples

e). hibridisasi. jumlah kejutan: 4 kali dan interval kejutan: 0. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. KATA KUNCI: Kappaphycus alvarezii.Irvan Faizal****). Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) . ZPT. dan St. Alimuddin**). promoter. Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV.1 second. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%–10%. KATA KUNCI: mutu genetik. Kappaphycus alvarezii Muh.BPPT. Rajamuddin*). Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. daya tahan penyakit.Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT. kappaphycus alvarezii. Balai Riset Perikanan Budidaya Air Payau. puncak jam ketiga – keenam s. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik.e dan stabil setelah jam ke9 sampai ke-12 s. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. Sebagai tahap awal dalam rangka produksi rumput laut transgenik. Utut Widyastuti***). CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12.5 mili/second. transgenesis. Pola ekspresi keempat promoter relatif sama. Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas. ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT. panjang kejutan: 0. Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. Makassar **) Departemen Budidaya Perairan-FPIK. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. Fadilah. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. fusi protoplas . Rosmiati. mulai berpendar jam pertama – kedua setelah elektroporasi (s. Keratin dan b-actin. b-actin. Alias L. cytomegalovirus/ CMV. persentase sel berpendar rata-rata 10%. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. dan sumber karbon yang berbeda. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0.e.

I Nyoman Radiarta. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. pembudidaya rumput laut. rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. KATA KUNCI: rumput laut. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. SIG. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. kondisi sosek-ekonomi. Pandeglang . Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. khususnya di Kecamatan Sumur. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. Untuk itu. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. Kabupaten Pandeglang. Rekomendasi pencegahan penyakit. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. taman nasional ujung kulon. dan status wilayah kawasan. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. Pada umumnya. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). Erlania. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. konservasi dan wisata).

pengggantian media dilakukan setiap minggu dengan komposisi media yang sama. dan 1.0:1. Perkembangan sel-sel embriogenik diamati pada kultur cair. embrio somatik. adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus.6%. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii.6%.8%. Rajamuddin*). Pada media cair. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan. Makassar **) Balai Riset Perikanan Budidaya Air Payau.1 mg/L) dengan konsentrasi agar (0. Pada tahap regenerasi massa sel embriogenik. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan.0% menghasilkan persentase induksi kalus tertinggi (90%). rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0. Pemeliharaan dilakukan selama 8 minggu. embriogenesis somatik .6% dan 0.0:0. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. kalus.8%). 0. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. morfologi.0 mg/L.0 mg/L.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm). Alias L. Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen. KATA KUNCI: keragaman.0:0.5:0. pada rasio IAA: kinetin (0.4%.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. Ridwan*). KATA KUNCI : Kappaphycus alvarezii. Andi Asdar Jaya*). dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis. 1. Pada tahap induksi kalus.8% dan 1. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio.5%). perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0.2 mg/L) dengan konsentrasi agar media induksi (0.4 mg/L.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%. dan 0.5 mm dapat dicapai dalam satu bulan kultur. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh. Rosmiati. 0.0%. 0. Tahap (2) adalah regenerasi massa sel embriogenik somatik. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid. 1. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0.0 mg/L.1:1. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau. dan 2.

Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn 85%. crakers. rasa. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. A-1 (15% tepung rumput laut dan 85% tepung terigu). Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. 01-2973–1992 dan SII 0177–1990. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini.780.143. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. A-2 (30% tepung rumput laut dan 70% tepung terigu). Hasnawi. produksi pada tahun 2008 sebesar 750 ton. gizi. protein. aroma. abu. Mery Sukmiwati. uji organoleptik . yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). KATA KUNCI: rumput laut. Parameter mutunya adalah kandungan zat gizi (air. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. rumput laut. KATA KUNCI: strategi pengembangan. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam program-program pokok pengembangan. dan karbohidrat) dan uji organoleptik.13 ha dan 3. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. kadar abu. denga metode budidaya tali panjang (long line).24 ha. dan berpengaruh nyata terhadap rupa dan tekstur. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. lemak. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air.

Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei.60 dan 36. Program ArcView 3.09 dan 90. SIG. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia. Kebutuhan kapur CaCO3 untuk tambak di Kabupaten Mamuju berkisar antara 1. pHFOX. tambak. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra ALOS AVNIR-2 akuisisi 28 Juli 2009. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. S POS .36 dan 3. analisis spasial. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai SPOS tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat dan berkelanjutan.15 dan 19. inderaja.71 g/cm3 dengan rata-rata 0. Maluku . Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. Maros ABSTRAK Kabupaten Mamuju. KATA KUNCI: budidaya laut. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan. bahan organik dan berat volume tanah.02% serta 44. Penelitian ini bertujuan untuk melakukan analisis spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG).02. Kebutuhan kapur didasarkan pada nilai SPOS tanah dengan mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur. namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI SPOS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet.2 digunakan untuk pembuatan peta distribusi SPOS tanah.29 ton/ha dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju. ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting. infrastruktur (jalan) dan sebaran penduduk. pirit. tanah. SKCl. Peubah kualitas tanah yang diukur adalah: pHF. Adang Saputra.32 dan 113. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. KATA KUNCI: kebutuhan kapur. Rachmansyah. klorofil-a dan suhu permukaan laut). Kapur pertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur. SPOS.78% sehingga memiliki faktor konversi berturut-turut sebesar 2.28% dengan rata-rata 7. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. Oleh karena itu. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan.614%.884 g/cm3 dan SPOS tanah berkisar antara 0. Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95. Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta.30 dan 1. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan. SP.

rumput laut. rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara. KATA KUNCI: produktivitas tambak. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. tambak terbengkalai. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). analisis location quotient. bandeng LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). dan Sularto***) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Adang Saputra**). Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. dan analisis usaha perikanan. udang dan bandeng. dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Jakarta **) Pusat Riset Perikanan Budidaya. Hatim Albasri**). Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. konversi pakan serta pertumbuhan yang cukup baik. peningkatan pendapatan.400 m2 selama 3 bulan pemeliharaan. KATA KUNCI: minapolitan. analisis komoditas unggulan dan andalan. udang. Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). Kabupaten Brebes . Evi Tahapari***). Introduksi kaji terap dilakukan dilahan seluas 2. Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. ikan patin. Di samping itu. Wartono Hadie**). analisis komoditas. Sukamandi *) ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. Jakarta **) Pusat Riset Perikanan Budidaya.

pesisir. kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. sagu (Metroxylon sagu).25 m dan 0. nipah. SKCl. rumput. tanpa vegetasi. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. pirit. pHFOX dan potensial redoks.75 m. sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. karbon organik. dan Kamariah Balai Riset Perikanan Budidaya Air Payau. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). Pada kedalaman 0-0. Al dan tekstur. bakau.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. N-total. nipah. Kualitas tanah yang diukur langsung di lapangan adalah pHF. Hasil penelitian menunjukkan bahwa. pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent.50-0. kelapa (Cocos nucifera). paku laut (Acrostichum aureum). Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. rumput. A. TSA. TAA. penutup/penggunaan lahan. campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. PO4. pHOX. bakau. TPA. Marsambuana Pirzan. Oleh karena itu. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan.50-0. masingmasing pada kedalaman tanah 0-0. rumput. SP. Pada kedalaman 0. bakau (Rhizophora apiculata). padi (Oryza sativa). SPOS.75 m tanah vegetasi api-api. nipah (Nypa fruticans). Kabupaten Mamuju . sagu. sedangkan yang dianalisis di laboratorium adalah pHKCl. KATA KUNCI: keragaman. Fe.25 m tanah jenis penutup/penggunaan lahan api-api. Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah. tanah.

peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50. Data sekunder yang diperoleh berupa data iklim.047 dengan rata-rata 6.272 ha). tersebar di wilayah pesisir Kecamatan Sungai Pinyuh. kualitas air. tambak. Oleh karena itu. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. Pada umumnya yang tergolong sangat sesuai (114. KATA KUNCI: klorofil. nitrat. oksigen terlarut. dan bahan organik total. Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil. amonia. sedangkan yang kurang sesuai (213.398 µg/L. nitrat. data sekunder. terdapat di Kecamatan Segedong dan Siantan. Sulawesi Barat . salinitas. walaupun dengan model regresi yang berbeda. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. dianalisis secara spasial dengan metode PATTERN menggunakan SIG. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. KALIMANTAN BARAT Utojo. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. amonia.000. pH. Akhmad Mustafa. pH. dan fosfat. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik.077 ha. tambak. nitrit. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. sedangkan peubah bebas adalah suhu. Data lapangan (fisiko-kimia air dan tanah). Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut.046 dan 22. cukup sesuai (168. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil. Mempawah Hilir dan Mempawah Timur.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497. KATA KUNCI: kesesuaian lahan. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. nitrit.000.819 ha). Sungai Kunyit. fosfat.986 ha). dan data citra satelit digital.

Tidak terdapat perbedaan nyata (P>0. Jakarta. KATA KUNCI: makrobentos. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6. Proses pengayakan termasuk penyeleksian. dan penghitungan dilakukan di laboratorium. kolam. kecerahan.0 sel/mL. Analisis data dilakukan secara deskriptif untuk komposisi jenis. minyak nabati . Kultur ini ditempatkan diluar ruangan.02–8. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9. total bahan organik (TOM). Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4. dengan menggunakan cara modifikasi (Banerjee et al. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis.75). Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8. 2002 dan Dayananda et al. identifikasi. Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan. 2006). penghitungan kelimpahan. Parameter kualitas air yang diamati adalah suhu.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. pupuk....5 mg/L.60% menggunakan perlakuan pelarut hexana. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. kemudian 6. ekstraksi. dan 6:3. KATA KUNCI: mikroalga. 5:4. Analisis kandungan minyak nabati Dunaliella sp. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. dilakukan di dalam bakbak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp. dan BOD5. BRPBAT. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP.. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. pH. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0. Bogor. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Chironomus sp.). Spesies dominan adalah Limnaea sp. DO. dan Nematoda. indeks diversitas dan keseragaman spesies. Dunaliella.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda. Kultivasi Dunaliella sp. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5.

33 sel/mL pada sistem indoor dan 7. KATA KUNCI: kepadatan. dengan skor 19. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. salinitas. rawan pangan.65/hari pada outdoor. dan pH. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. 02 sel/mL pada sistem outdoor. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B.25/ hari pada indoor dan 3. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. Berdasarkan perhitungan statistik ANOVA. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. Pengolahan data dilakukan secara deskriptif. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. salah satunya adalah Desa Merakan di daerah Jawa Timur. KATA KUNCI: ketahanan pangan. Metode penelitian menggunakan metode survei. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. braunii. laju pertumbuhan. Botryococcus braunii .37.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12. Departemen Pertanian. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat.

sehingga AH-26 merupakan isolat yang pathogen. profitabilitas. tes katalase dan oksidase dilakukan sebelum uji PCR. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. aerolysin dan primer spesifik . Bakteri merupakan salah satu penyebab penyakit pada ikan. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. dan Balai Budidaya Laut (BBL) Ambon. KATA KUNCI: unit usaha. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. Sedangkan dengan menggunakan spesifik primer. Isti Koesharyani. penanganan aspek teknis. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. pengelolaan bisnis. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. penanganan aspek teknis. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. kemungkinan merupakan strain yang tidak pathogen. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. Uji awal berupa pengecatan gram. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. pembudidayaan. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. Infeksi bakteri. uji PCR. KATA KUNCI: Aeromonas hydrophila. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya.

Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A). Waduk Cirata .masing perlakuan 5 kali ulangan.91. Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. kedalaman 2 meter (B).86-0. Ani Widiyati. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar. yaitu 4423.Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m). namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae. kedalaman 3 meter(C) dan kedalaman 4 meter (D).Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti. Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. KATA KUNCI: kedalaman.81 (ind/cm2) dan 0. Masing. periphyton. Winarlin.

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

Masingmasing perlakuan menggunakan 2 ulangan. telah banyak menginfeksi ikan nila. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas.Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. KATA KUNCI: strain. responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. Sidi Asih***). salinitas. sintasan. Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. lebar 40 cm. Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. Hary Krettiawan*). Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. Bogor ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. Jakarta Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. Majalaya. 8 ppt (6–10 ppt). dan 12 ppt (11–15 ppt). KATA KUNCI: streptococcosis. Cianjur Wildan. ikan mas. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. sintasan terendah didapatkan pada salinitas 12 ppt. pertumbuhan . Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). dan tinggi 40 cm dengan ketinggian air 15 cm. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*). Akuarium yang digunakan berukuran panjang 60 cm. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. dan Achmad Sudradjat*) **) *) Pusat Riset Perikanan Budidaya. dan Sutisna Kuningan. ikan nila.

berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan. termasuk jenis ikan karnivor. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4. pakan. dan kalimantan. anakan ikan nila . Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya. dengan jangka waktu pengembalian modal selama 3. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain.64 sedangkan FCR total sebesar 1. KATA KUCI: ikan belida. ekonomi. Iwan Malhani Al’Wazan. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. Jakarta ABSTRAK Ikan karnivor. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan. Pemeliharaan ikan belida dilakukan di kolam. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan SeptemberNovember 2009.53. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september . Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. Dalam hal dukungan dana permodalan. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya. ikan belida yang banyak hidup di perairan umum Sumatera. yang diberi sekat jaring nilon hita. KATA KUNCI: budidaya. Jawa.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan.36.20 siklus dan nilai RC ratio sebesar 1.

pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) **) Pusat Riset Perikanan Budidaya. Dalam kegiatan budidaya ikan. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. pelet maggot . kurang lebih 60% pengeluaran berasal dari pakan. yang dikenal dengan nama PKM (palm kernel meal). Jakarta Balai Riset Perikanan Budidaya Air Tawar. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. palm kernal meal. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. jaring tancap dan keramba jaring apung. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. Budidaya ikan nila dapat dilakukan di kolam. Untuk menguasai teknologi domestikasinya. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva. KATA KUNCI: ikan belida. KATA KUNCI: ikan nila. Selama proses adaptasi pada kolam pemeliharaan. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma.

25 – 1. sedangkan kontrol hanya disuntik dengan PBS. 05. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4).150.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. 95 – 2. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. Masing-masing perlakuan diulang 3 kali. baik disebabkan oleh infeksi virus.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. Epinephelus fuscoguttatus. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). penyakit infeksi . dan 200 ekor/m³. Padat penebaran yang digunakan sebagai perlakuan adalah 100. Rasio konversi pakan 1. sintasan. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. KATA KUNCI: vaksin bakteri. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia. 65 g/ ekor. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. 05) tidak mempengaruhi sintasan. bakteri maupun berbagai jenis parasit.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Pendederan ikan kerapu macan. Fris Johnny. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bakbak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. dan Zafran Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: pertumbuhan. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut.

pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma.000 butir. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya. Plectropoma laevis. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad. Kualitas telur yang dihasilkan relatif masih fluktuatif.000 butir. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet.004. aspek biologi reproduksi . Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3. Apri I. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut. dan pada induk asal alam 20-92 % dengan SAI 2. dan (B) Induk asal alam. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan.240.20. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 .80.520 µm. KATA KUNCI: kerapu raja sunu. indeks somatik gonad dan diameter oocytnya. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³. Tridjoko.25-4.450. Ketut Suwirya. Agus Priyono. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. dengan jumlah 8% biomass/hari. Supii.

pertambahan berat. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. tengadak albino. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). dan N. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. Himawan Tirta Yudha. total biomass dan biaya pakan.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. Rudy Gustiano. pertumbuhan. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. tawes . sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. (1988). Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat.A. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. pertambahan berat. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. konversi pakan. KATA KUNCI: truss morfometrik. Peubah yang diamati adalah sintasan. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi. dibandingkan dengan perlakuan lainnya. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. Giri Balai Besar Riset Perikanan Budidaya Laut. Hasil penelitian menunjukkan bahwa laju pertumbuhan. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. dengan periode pemeliharaan120 hari. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. Kata kunci : Jaring apung. ikan tengadak.

4%) pada kolam substrat 1 (pasir. Kisaran persentase efektivitas penyisihan TN (28%– 58.82%).36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0. Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi.4–0. amonia (20. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan. tumbuhan air.33%).5%–66. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7. karbofuran. Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat. amonia (0.081–0.7–1.67%). khususnya ikan.Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar.5 mg/L). nitrogen.). yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air). karena di samping harus efektif terhadap hama tanaman padi. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat). Perlakuan pada penelitian ini terdiri atas dua perlakuan.lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8.3 mg/L). akut.8 mg/L).681mg/L) dan nitrat (0. amonia (42. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan.5–14. dan nitrat (11. Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen. Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi.82%).11%–44.5%–90. Sintasan (93. dan nitrat (37.32 %). Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0.05). Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya.303–1.849 mg/L) dan nitrat (0. pemakaian insektisida perlu dilakukan secara selektif. dan Scirpus sp. Untuk itu. kronis .05) dibandingkan kolam ikan kontrol (82. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar.58%). Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air. KATA KUNCI: substrat. yaitu TN (42. kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur.5 mg/L). KATA KUNCI: toksisitas.86%–85. produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan. Typha sp. amonia (0. juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut.14%–92.

Trichodina.00–6. dan Polymerase Chain Reaction . Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. dan darah.00 mg/L. Sensitivitas teknik diagnosa terhadap bakteri target.000. (d) garam 4. gurame. dan Quadriacanthus kobiensis serta menimbulkan kematian. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. Dactylogyrus. Ada beberapa bahan nabati dan alami yang dapat digunakan. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp. sedangkan preparat histopatologi diambil dari organ hati. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. Mycobacterium fortuitum. Ketujuh perlakuan itu yaitu: (a) biji teh 10. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10. KATA KUNCI: mycobacteriosis. dan limpa. (b) biji teh 15.00 mg/L.00–20. Oleh karena itu. yaitu M1: T39 (GCGAACGGGTGAGTAACACG) dan T13 (TGCACACAGGCCACAAGGGA). Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan. KATA KUNCI: ekstoparasit. Gyrodactylus. limpa. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis.00 mg/ L. Hasil penelitian menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi.00 mg/L dan garam 4. Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum.000. serbuk biji teh dan garam. sehingga upaya pengendaliannya sering terlambat. (c) biji teh 20. dan primer M2: PreT43 (AATGGGCGCAAGCCTGATG) dan T531 (ACCGCTACACCAGGAAT) digunakan pada penelitian ini. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar.00 mg/L. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. yang telah dikembangkan oleh beberapa peneliti.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar. ginjal. Pada riset ini. selanjutnya dibandingkan dengan teknik diagnosa melalui uji biokimia dan histopatologis. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya.00 mg/L. Mycobacterium fortuitum PADA IKAN GURAME. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain–Jenssen. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy). (e) garam 5. Dua pasang primer.00 mg/L efektif untuk memberantas Trichodina dan monogenea.000.00 mg/L (g) kontrol. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati. (f) garam 6.

dan 2. efisiensi pakan. tepung bungkil kopra. 1. efisiensi pakan. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. C.V.000. Bogor. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra. rasio efisiensi protein. pertumbuhan.15±5. substitusi. dan tingkat sintasan. B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai.000 unit fitase/kg pakan. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan.60±0. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap.73 g dengan padat tebar 15 ekor/keramba. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem. 1. dan sintasan ikan beronang.500 dan 2. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau. 500. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG. guttatus .) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. Hasil penelitian menunjukkan bahwa penggunaan fitase 1. pakan ikan beronang.45 g/ekor. Balai Riset Perikanan Budidaya Air Tawar. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan.500. nilem. namun nilai ini tidak berbeda nyata dengan 1. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang.05). KATA KUNCI: fitase.000 unit/kg pakan. Cijeruk dengan bobot rata-rata 8. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap. S.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti. KATA KUNCI: tepung bungkil kedelai. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. Parameter yang diamati yaitu laju pertumbuhan spesifik.05) terhadap pertumbuhan. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22.

Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan. lebar karapas dan sintasan (P>0. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass. KATA KUNCI: budidaya bandeng.02 g.850. Tjaronge Balai Riset Perikanan Budidaya Air Payau. sintasan .2 mm dan bobot 0. tambak. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis.Variabel yang diamati adalah pertumbuhan lebar karapas. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm.). pertumbuhan. Maros selama 40 Hari.526. B. 50% ikan rucah + 50% pelet.04 ± 0.2 ± 0.-/tahun/ha. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M. 100% pakan buatan/pelet dan C. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus). Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak. 100% ikan rucah jenis ikan tembang (Clupea sp. KATA KUNCI: pakan rucah. bobot dan sintasan serta kualitas air. rajungan.05) dengan perlakuan yang lain. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap. pelet. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur). Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana.

100.5 cm) . masing-masing mencapai 986.9 dan 1154 kg/ha. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. Erfan Andi Hendradjat. bandeng. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2.816%. pertumbuhan panjang. 70. Selama pemeliharaan.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B). Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. ampas tahu.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.0 cm.-. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran.5 ton/ha.5 x 0. dan 105 dan dianalisis secara deskriptif.43. Oleh karena itu. B/C rasio 1. Padat penebaran bandeng pada masingmasing perlakuan adalah 15. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. Produksi bandeng pada perlakuan A dan B.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. KATA KUNCI: pupuk organik.98 g/ekor menjadi 232. Sintasan bandeng pada perlakuan A dan B. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh. masing-masing mencapai 56.009 gram. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. KATA KUNCI: benih botia.5 cm (ukuran ekspor).5 cm dan panjang tertinggi sebesar 3.5 x 0. Pada akhir penelitian (hari ke 105). dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. masing-masing dengan dosis 2. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B). Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.467. pupuk kandang dan dedak. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. Nina Meilisza. 20. produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1.0 cm dan bobot rata-rata 0.5 m dan tinggi air 40 cm.625% dan 60. ukuran ekspor 1 inchi (2. 35. 55.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.

Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali. Agus Priyadi*). memberikan pengaruh yang berbeda nyata (P<0. gonad.. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi. (B) Culex sp. Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal.0. 12. namun tidak berbeda nyata (P>0. (A) Chironomus sp.00 dan 16. Gigih Setia Wibawa*).00. dan Culex sp. pH 6.98 ± 0.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat.09 g dan pertambahan panjang total rata-rata sebesar 0.Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya.05) terhadap pertambahan bobot rata-rata ikan.0 – 8.00 dengan metode pemberian sekenyangnya (adlibitum)..8 (sebagai kontrol).) Eni Kusrini*). Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5.5 – 5. Hasil penelitian menunjukkan bahwa perlakuan pH 7.24 cm. memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp. Depok. KATA KUNCI: Benih ikan pelangi. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp. pendederan.9 dan pH 7. Pakan diberikan tiga kali sehari yaitu pada pukul 8..50 ± 0. dengan pertambahan bobot rata-rata sebesar 0.32 ± 0. KATA KUNCI: Melanotaenia sp. Selama 45 hari pemeliharaan. dan (C) Tubifex sp.01 g dan panjang total rata-rata 3. dan Irsyaphiani Insan**) *) **) Balai Riset Budidaya Ikan Hias. pH air pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar.0-8.05) terhadap rata-rata pertambahan panjang total dan sintasannya.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. Depok Pusat Riset Perikanan Budidaya. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. ikan diberi perlakuan pemberian pakan alami yang berbeda. Rendy Ginanjar.0 – 6. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian. Jakarta ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar.85 ± 0. pertumbuhan. sintasan . pakan alami.

Asep Permana*). 96. Marendra Gladiyakti**) *) **) Balai Riset Budidaya Ikan Hias. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. Pakan yang diberikan selama penelitian adalah nauplii artemia. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. 96. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. ketersediaan pakan dan padat penebaran. 95.67%.13±0.02 cm dengan bobot 0. 96. C. KATA KUNCI: Metynnis hypsauchen. dan Jacques Slembrouck**) **) *) Balai Riset Budidaya Ikan Hias Depok. Indonesia Institute Recherche Pour Le Developpement. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*). tetapi berpengaruh nyata (p<0. KATA KUNCI: ikan botia. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). padat tebar. D. Depok Universitas Diponegoro.81%. Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. B (2 ekor/L). Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi. Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan. Lili Sholichah*).05) terhadap pertumbuhan. B. B. D. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara. 35 ekor/liter. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). C. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia. Prancis ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter.07%. sintasan.02 g. pertumbuhan.67 mm. 25 ekor/liter. Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari. 30 ekor/liter dan E.45%.22±0. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi.22% dan E. 15 ekor/liter. padat tebar . Sintasan dari masing-masing perlakuan adalah sebagai berikut: A. 97. Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan. resirkulasi. Ikan uji yang digunakan adalah benih berukuran panjang 2. Rendy Ginanjar*). 20 ekor/liter.

Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. 2) unit pengolahan pakan dan 3) unit budidaya. Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. kolam budidaya dan manajement budidaya yang baik. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. salinitas dan arus. Ikan Sidat (Anguilla sp. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. air tersedia dalam jumah yang cukup. biokonversi. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. Ikan migrasi. lunar. memiliki bak kultur. bahan pakan seperti vitamin dan dedak. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. Unit produksi maggot memiliki prasyaratan sebagai berikut. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. Migrasi terbagi menjadi migrasi vertical dan horizontal. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. KATA KUNCI: Phenotipic plasticity. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. temperature. Unit budidaya ikan memiliki prasyarat sebagai berikut. fisiologi dan tingkah laku dalam merespon perubahan lingkungan. KATA KUNCI: maggot. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. area penjemuran atau alat pengeringan pakan (drying). Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. Kawasan Mina Pakan Mandiri. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). ketersediaan pakan dan pemasaran.) . Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. propinsi Jambi. Unit pengolah pakan memiliki prasyarat sebagai berikut. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. memiliki mesin pelet. memiliki bak untuk restokin. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. dan homing atau reproduksi. sedangkan factor eksternal yaitu. makanan.

nila BEST (Bogor Enhancement Strain of Tilapia). dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan. Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. nila merah (Red NIFI). terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). jarak genetik.16 mM.h-1 dan 0.40 mM dan 0. reduksi nitrat . Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi. Oreochromis niloticus . Persilangan. Kata kunci: denitrifikasi.mossambicus).26% – 63. untuk mengamati variasi genetik benih persilangan ikan nila.h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O. mossambicus) Nunuk Listiyowati. dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi. juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut. Aktivitas reduksi nitrat terjadi dari awal inkubasi. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan dengan Pseudomonas aeruginosa. Sukamandi. Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. mujair (O. nitrogen anorganik.mossambicus). Kata kunci: Randomly Amplified Polymorphic DNA (RAPD). terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&).17 mM. Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD).15%). NIRWANA (nila ras wanayasa). Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST.Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.236 – 0. tetapi yang menghasilkan benih hanya 15 populasi. Ikan yang di gunakan adalah hasil persilangan 4 strain. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. Didik Ariyanto.28 mM.560). pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*). Hasil dari persentase polimorfik (berkisar 5. Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik. Iman Rusmana**). Jarak genetik 15 populasi persilangan berkisar (0. Selain itu.

Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. rasio inti sel:sitoplasma yang besar. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral.74% menjadi 5. KATA KUNCI: Bacillus sp.. Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia.91% menjadi 15. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952).8%.37% setelah proses fermentasi. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. nutrisi dan serat kasar . inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. 6 hari (D3). kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1).) Priadi Setyawan1). fermentasi. Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. Isdy Sulistyo2). Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi.09% menjadi 4. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma. UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 4 hari (D2).37% dan meningkatkan kadar protein dari 13. sebagai bahan baku pakan ikan patin. Osphronemus goramy. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. Sukamandi **) Universitas Jenderal Soedirman. PGC terdistribusi secara berkelompok di bagian ventral. Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC. KATA KUNCI: PGC. Pada tahap pembentukan mata. bungkil sawit. menurunkan lemak bungkil sawit dari 14. distibusi.

Bogor ****) Balai Riset Budidaya Ikan Hias.Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: UPR. sebagai materi kegiatan tahun mendatang. pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi. Eni Kusrini****). integrasi. dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk. sex reversal. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal. di antaranya daerah Bogor dan Subang. Wartono Hadie**). 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya.. salah satunya melalui Catfish Club Indonesia. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran. kluster penetasan telur. patin. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. Jakarta **) Pusat Riset Perikanan Budidaya. jantan fungsional. dan kluster pemeliharaan larva dan benih. Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. betina homogamet . Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik. dan Labuan (Merak). Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. Angela M. kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. Pengambilan data melalui responden dilakukan dengan cara purposive sampling. demikian juga ditinjau dari segi higienis dan kesehatan benih. dengan masing-masing hatchery terpisah lokasinya. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. Perbedaan dari kedua sistem ini adalah sifat produksinya. setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. Depok ABSTRAK Ikan patin (Pangasius sp. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. KATA KUNCI: ikan nilem. Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. Tipe integrasi bersifat soliter.1994). Subang. Lusiastuti***). Jakarta ***) . dkk.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP.

Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva).2 gram. oksigen terlarut/DO. pH.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui. KATA KUNCI: seleksi generasi. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. ikan mas strain rajadanu . Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). kepadatan. M H Fariddudin A. Anang H K. sintasan dan kualitas air (meliputi suhu. Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. 15 butir/ liter perlakuan (I). amonia. Agus Priyono. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar.57 % dalam satu generasi. Diketahui estimasi nilai heritabilitas rata-rata h²(S+D) = 0. pertumbuhan. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. KATA KUNCI: sintasan. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva.27 pada ukuran konsumsi dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19. dan nitrit). memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut. 10 butir/liter (perlakuan H). intensitas cahaya.1.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. salinitas. Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia.

Survei dilakukan di beberapa daerah yaitu Cianjur. Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus). Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik.dan Tasikmalaya. eksplorasi. bakteri probiotik. penanggulangan. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). Klaten. penyakit streptococcosis . dan Lila Gardenia Pusat Riset Perikanan Budidaya. KATA KUNCI: antibakteri.Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. Hambali Supriyadi. karena mampu menghambat pertumbuhan bakteri Streptococcus iniae.

di perairan Panimbang Kabupaten Pandeglang.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. Erlania. Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. KATA KUNCI: kerang hijau. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. Untuk menjamin keberlangsungan usaha budidaya kerang hijau. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. Teluk Lada. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. Secara umum. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. Provinsi Banten. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. Kabupaten Pandeglang. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. budidaya laut. Pandeglang . Kabupaten Pandeglang. SIG. Hatim Albasri. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG).

BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. sedangkan dari kelompok protozoa adalah Epistylis sp. Ikhsan Khasani**). serta UPR yang mengembangkan usaha perbenihan udang galah. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). manajemen. BBUG Klungkung. Carchecium sp. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset. KATA KUNCI: udang.).Forum Inovasi Teknologi Akuakultur 2010 pK 01 1. dan diferensial hemosit..) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Vorticella sp.. Zoopthalmium sp.. BBAP Samas-Yogya(Jateng). Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. tembakau (Tobacum nikotiana) . Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro. Bali. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas. Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. Jateng. kelompok kedua adalah penghasil benih. dan Jatim. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya. tingkat sintasan.Bali. Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. kelompok kedua adalah BBU Pamarican (Jabar).Yogyakarta. dan kelompok ketiga ialah pembudidaya. tingkat kesembuhan. padahal permintaan cukup besar..). dan kelompok ketiga ialah pembudidaya. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP. Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya. Retna Utami**)..Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. kelompok kedua adalah penghasil benih. STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*). Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. KATA KUNCI: huna (Cherax sp.42%. dan Spiranura sp. induk. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp. dan Opercularia plikatilis. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76. Bali. Imron**). Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk.UPU Probolinggo (Jatim). Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP Samas. Parameter yang diamati meliputi pemeriksaan parasit. Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro.Wartono Hadie*).

KATA KUNCI: vaname. KATA KUNCI: udang windu. dan Wartono Hadie Pusat Riset Perikanan Budidaya. Pemeliharaan dilakukan selama tiga bulan. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. yaitu pertambahan berat rata-rata 230 g.n pengapuran sebanyak 175 kg/petak. Sebelum penebaran. Setelah dua hari. pengapuran dan pemupukan. yaitu menggunakan tingkat teknologi tradisional plus. namun berbeda tidak nyata (P>0.1 kg dan kelangsungan hidup 11. tokolan.84 kg/ha. pada bulan pertama udang tidak diberi pakan. Hewan uji yang digunakan adalah udang vaname PL-48. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. survival rate. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. produksi 81. Dari pemeliharaan udang selama tiga bulan. polikultur. Gracilaria verrucosa. namun polikultur udang vaname dan rumput laut masih kurang informasinya. dilakukan pengolahan tanah tambak.6 kg/ha.500 m2 digunakan untuk percobaan. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan.8 kg dan kelangsungan hidup 100 %.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. penebaran dilakukan setelah satu bulan dari penebaran tokolan. Empat petak tambak masing-masing berukuran 3. produksi 78. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2. produksi . Idil Ardi. sedangkan pada dua bulan berikutnya diberi pakan pellet udang.5 g. pemberantasan hama.000 kg/ha rumput laut. Kecamatan Cilebar. kemudian dikeringkan sekitar satu minggu. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak.22% dan 72. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang. Karawang. Dengan teknologi yang diterapkan. pengeringan. salinitas rendah. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah.66% dan 108. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. masing-masing dengan dua ulangan.2 %. Penelitian ini dilakukan pada tambak di daerah Betok Mati.

Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. dan perlakuan D = tanpa sumber karbohidrat. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. Hal tersebut perlu mendapat dukungan dari penelitian. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. kotoran. Dinophyceae. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. 25. pelakuan B = sagu. KATA KUNCI: tepung tapioka. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0.6 m sebanyak 12 buah. dan Rotatoria. dan metabolit udang.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. udang windu . Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. Pada budidaya udang vaname pola tradisional plus. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. indeks keseragaman menunjukkan komunitas plankton pada perlakuan D relatif lebih merata dibanding perlakuan lainnya.3 g dengan padat tebar 50 ekor/bak. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. pola tradisional. indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. Pada budidaya udang windu intensif. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka. KATA KUNCI: plankton. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. pola intensif. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. Polychaeta. probiotik. masing-masing dengan 3 ulangan. perlakuan C = tapioka. menggunakan bak kayu ukuran 1 m x 1 m x 0. dan Cyanophyceae.05) terhadap kelimpahan dan jumlah jenis plankton.

dan indeks dominasi plankton selama pemeliharaan udang windu. B = 2 mg/L.427).780) dan indeks dominansi (0.000 ekor/petak). BOT. suhu. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. tambak . KATA KUNCI: probiotik. sintasan. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. pH. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. indeks keseragaman. Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. udang windu. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. setiap 15 hari. namun berpengaruh tidak nyata (P>0.689–0. pertumbuhan. NO3. dan Pleurosigma dari Kelas Bacillariophyceae.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. sintasan. NO2. Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing-masing: indeks keragaman (1. serta Oscillatoria dari kelas Cyanophyceae. dan produksi udang vaname.5 m dengan volume air 400 L. C = 4 mg/L. Abdul Malik Tangko. Hasil penelitian menunjukkan perlakuan berpengaruh tidak nyata (P>0. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. indeks keseragaman (0. Nitzschia. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin.199–1. dan perlakuan C = dedak padi halus. Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas. Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0.362). PO4. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. oksigen terlarut. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. KATA KUNCI: dinamika plankton. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0. perlakuan B = kotoran sapi. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea.05) terhadap jmlah jenis dan kelimpahan plankton. Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2.05) pada sintasan dan produksi udang vaname.324–0. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname. pupuk organik. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton.05) terhadap pertumbuhan udang vaname. indeks keragaman. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang.

6. budidaya. KATA KUNCI: substrak.05) antara perlakuan substrak tanah tambak. Machluddin Amin. Perlakuan yang diujicobakan dalam penelitian ini adalah A. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau. dan C. Substrak tanah lumpur. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak.24. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau.8±0.5 dan 21. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28. di mana masing-masing perlakuan diulang tiga kali. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka. Substrak tanah tambak. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak.2 cm dan bobot awal 0.01 g.3±1. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari.239. Substrak tanah sawah. udang windu . B. dan substak tanah lumpur. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1. KATA KUNCI: efisiensi. masing-masing dengan dua ulangan.0±5.650. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0.14 dan 2. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda.634. substrak tanah sawah. udang pama. Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan. biaya produksi.sedangkan pada perlakuan A dan B masing-masing 2. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak.03±0.875. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak).. umur pemeliharaan.dan Rp 19. Penelitian dilaksanakan pada tambak ukuran luas 4. biaya pakan pada perlakuan A dan B masing-masing Rp 11.984.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A). di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71.. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau..

Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25. kisaran produksi 12. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20. dengan rata-rata berat 11.4 ± 0. lebih tinggi daripada perlakuan B = 41. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan.64 kg/bak atau rata-rata 11.6 kg/500 m2 = 406 kg/ha. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2. udang vaname.66 kg/bak (7. KATA KUNCI: tepung tapioka.767. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2.7 kg/500 m2 = 320 kg/ha.1 ± 13.0 ± 2.45 kg/bak atau rata-rata 12.28-13. Namun demikian. dengan rata-rata berat 12. masingmasing bak mempunyai ukuran panjang. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan.235 kg/ha). Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan.92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90. lebar dan kedalaman secara berurutan adalah 10 m.15%. 1.61%. salinitas rendah . Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B).998. kisaran produksi 9.7% dan perlakuan C = 36. KATA KUNCI: molase. Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48.7%. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A.3 ± 7. namun tidak berakibat terjadi kematian massal. B). Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. pertumbuhan udang.7%.5 m dan 1 m.2 ± 13. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0.86 kg/bak (8. di mulai setelah satu minggu penebaran.2 kg/500 m2 = 506 kg/ha.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah.325. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C).86 g/ekor. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang. ukuran 80 sampai dengan 96 ekor/kg). Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91.68-13. Maros.975 dan lebih rendah dibandingkan perlakuan B yang mencapai 1.66 g/ekor. Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan. ukuran 84 sampai dengan 89 ekor/kg) dan C (16. fermentasi probiotik. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah.3 ± 5.

Pemberian probiotik A dengan konsentrasi 0.15. pertumbuhan . dan kontrol 66.57 hari .) yang berukuran PL-20. 1995). sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi.75%–68. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz. sedangkan juvenil dan udang dewasa hidup diperairan tawar. dan tiga ulangan. sebagai dasar perbaikan sistem penyediaan larva udang galah.0 mg/L. 85%. dan Rhodobacter sp. Aplikasi probiotik setiap tiga hari sekali. Dengan meneliti dua jenis probiotik. Pemberian probiotik B dengan konsentrasi 5. 5 ‰. kualitas air. P. Pemberian probiotik A dengan konsentrasi 0. Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang. Universitas Padjadjaran. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62. udang windu.4440 g dan kontrol 0. udang galah.25%. B. KATA KUNCI: salinitas.3660 g. Nitrosomonas sp.001 mL/L menghasilkan sintasan sebesar 81. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan. Q. waktu inkubasi. 88%. sebelum diaplikasikan di tambak. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol). Kontrol (tanpa pemberian probiotik B). Masing-masing perlakuan diulang sebanyak empat kali. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. sintasan. B.. 85%.. Tingkat sintasan yang diberi probiotik B berkisar antara 63. Kontrol (tanpa pemberian probiotik A). dan 0‰ sebesar 11.8935 g).. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL). Nitrobacter sp. Pemberian bakteri probiotik A (Bacillus sp. Pemberian probiotik A memberikan pengaruh terhadap rata-rata pertumbuhan mutlak benih udang windu. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan. Parameter yang diukur adalah kualitas air.. Pemberian bakteri dengan konsentrasi 0.). pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F. dan R. sintasan. Pemberian probiotik A dengan konsentrasi 0.3±1. Rata-rata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0. C.4255–0.5 mg/L. diikuti perlakuan 5‰ sebesar 10±0.003 mL/L. dan pertumbuhan udang.75%. laterosporus.002 mL/L.Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. terdiri atas: O. terdiri atas: A. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata.0 hari.5 mg/L. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. Pengaruh perlakuan terhadap sintasan. Penelitian II pengujian probiotik B. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab.6±0. Pemberian probiotik B dengan konsentrasi 7.25%.) dan probiotik B (mengandung bakteri Bacillus polimyxa. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter).001 mL/L.50%. karena secara alamiah larva hidup di periran bersalinitas. pemberian dengan konsentrasi 0. Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata. 10 ‰. dan D. KATA KUNCI: probiotik. Rhodococcus sp.) berpengaruh nyata terhadap sintasan benih udang windu. yaitu probiotik A (mengandung bakteri Bacillus sp.001 mL/L menghasilkan pertumbuhan tertinggi (0. Pemberian probiotik B dengan konsentrasi 2. Penelitian I adalah pengujian probiotik A.

15 ppt. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten.13 cm dan 1. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3).05). sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. dan ukuran templat. KATA KUNCI: pertumbuhan. salinitas. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. KATA KUNCI: Macrobrachium rosenbergii. yaitu templat dengan berat molekul tinggi (1). 10 ppt. sedangkan sintasan pada perlakuan 25 ppt mencapai 61. Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. Guna mendukung prgoram revitalisasi tambak. PCR. udang galah . dan 20 ppt sintasan dari post larva udang galah mencapai 100%.09 cm. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. konsentrasi. dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi. Hasil yang diperoleh adalah pada salinitas 5 ppt.33±0. Selain itu.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH. 10 ppt (kontrol). Sukamandi. diantaranya karakteristik templat DNA genom yang meliputi kemurnian.67%. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. 15 ppt. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau. Ditinjau dari keragaan pertumbuhan. 20 ppt. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 25 ppt.92±0.

Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). Sulaeman. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi.Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. panjang. kepiting lunak . Berdasarkan persentase. pemberian pakan. Pakan diberikan dua kali sehari selama penelitian. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki.05). Sintasan yang diperoleh pada penelitian ini yakni 52%–54. manipulasi lingkungan. baik pertumbuhan bobot. Dari pencapaian bobot ini. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen.66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. Oleh karena itu. Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. KATA KUNCI: pergantian kulit. maupun lebar karapas (P>0. KATA KUNCI: kepiting bakau. perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet. kepiting bakau. Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. dan gabungan keduanya (C).5%. dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. ikan rucah (B).

5 bulan dengan panjang dan bobot masing-masing adalah 8.02 g dengan kepadatan 1 ind. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi. Ikan bandeng yang digunakan adalah gelondongan umur 1./m2.2 g. Dibalik manfaat mangrove yang demikian banyaknya. pertumbuhan. rumput laut dengan kepadatan 1. sintasan. jumlah permudaan 450–500 pohon/ ha. KATA KUNCI: rajungan.0 ± 2.300 pohon/ha dengan rata-rata 1. sintasan. Peubah yang diamati adalah pertumbuhan lebar karapas. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰—4 9‰) mengakibatkan sintasan dan produksi rendah.1±0. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena.7 cm dan 4. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi.100 pohon/ha. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. dan pelestarian alam. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1. tambak bersalinitas tinggi. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1.573. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. restoking kepiting bakau. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari). Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan. dan produksi serta parameter kualitas air. Tambak yang digunakan berukuran 10. KATA KUNCI: kerapatan hutan mangrove. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009.000 ekor/ha ukuran crablet-30. perlindungan.04 ha. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1.2 ± 2. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya.000 m2. Hasnawi. bobot.000–1. Tambak ditebari benih rajungan. produksi . sehingga perlu riset budidaya rajungan pada musim kemarau. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi.05±0. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi.2 mm dan 0.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh. data yang diperoleh dibahas secara deskriptif. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan.

Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). rumput laut. kondisi perairan sangat mendukung pengembangan budidaya rumput laut. DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya. Adang Saputra. bioakumulasi. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. logam berat . Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). Secara umum.03 mg/L. Untuk memfokuskan kegiatan budidaya rumput laut. KATA KUNCI: minapolitan. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. layak. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0. I Nyoman Radiarta. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. Provinsi Gorontalo. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. Anjang Bangun Prasetio. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. cukup layak dan tidak layak. Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). Kappaphycus alvarezii. SIG.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. Secara umum. Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. KATA KUNCI: Danau Maninjau. Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya.

Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet. sedangkan indeks dominansi berkisar antara D=0. kimia. Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. KATA KUNCI: alga perifiton. inlet. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. Subang. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah. Kualitas kimia air untuk pH. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. Sampling air secara regular untuk pengamatan fisika. nitrit.711-2. 20 dan 30. Supii. Indeks keanekaragaman berkisar antara H’=2.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. alga hijau biru dan alga hijau). DO. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom.853. SUBANG Joni Haryadi*). TSS. indeks keseragaman berkisar antara E=0. Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. outlet.814-0. Adi Hanafi. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. GONDOL-BALI Apri I. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. tambak. Subang. Dara Kasih**). dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. dan plankton dilakukan seminggu sekali. BBRPBL Gondol . Perifiton yang terdapat di Tambak Blanakan.076-0. N.085.962. Nitzschia sigma. dan Erlania*) *) Pusat Riset Perikanan Budidaya. KATA KUNCI: kualitas air.

Pengukuran N dan P dilakukan pada ikan dan pakan. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. nila (Oreochromis niloticus) dan bawal (Colossoma sp. serta produksi Moina sp.90. 9. 1. Bogor.dengan produksi Moina sp.89% dan 11. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP .83– 1. akuaponik.53%–15. 1.63% dan 10.17% dan 8. dan bawal adalah 1. 2). P.71%–10.900 g sedimen + 20 g TSP.) di laboratorium. dan keanekaragaman plankton. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP. kelimpahan. dan 1. KATA KUNCI: limbah..16 g. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan. indek dominasi.21%). Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio). limbah hara N dan P . KATA KUNCI: konversi pakan.53%) dan ikan bawal (8. ikan nila. Kusdiarti. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g.87.73–1. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp. Parameter yang diamati adalah jenis.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin. yang terdiri atas: 9 jenis pakan untuk ikan mas.89%–17. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas. Data dianalisis secara deskriptif. Perlakuan adalah pemupukan dengan perbandingan N. dan 3). Panen Moina sp.88–1. yaitu: ikan mas (5.78%). K = 16:20:0.48%–9. Ani Widiyati.23%–6.89.58%–13. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm. ikan nila (3. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP. volume air 500 L. dilakukan pada hari ke-8 sejak dilakukannya penebaran.96 ±1.

6 juta ton per tahun sekarang ini menjadi 7. KATA KUNCI: rumput laut. pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. di laut dan Gracillaria sp. Sukenda***). khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. 4. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani Pong-Masak Balai Riset Perikanan Budidaya Air Payau. pencegahan . N14G (3). namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. Esti Handayani Hardi**). Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. agalactiae. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. agalactiae setelah dilakukan uji Postulat Koch. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). sehingga dapat meminimasi kegagalan panen. N17O (4). Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir. Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. KATA KUNCI: Streptococcus agalactiae. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian. Oleh karena itu.6 juta ton per tahun pada 2014. Hasil yang diperoleh. Produksi rumput laut ditargetkan meningkat dari 2. Oreochromis niloticus. dan NK1 (5) yang berasal dari organ otak. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur. Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S. Isolat 1. mata. Postulat Koch. N4M (2). Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. Bogor Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) **) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah.1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*). hama. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. Budidaya rumput laut khususnya Kappaphycus sp. Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. penyakit. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S.

1113 mg/L. kedalaman 1–40 meter. Syarifuddin Tonnek. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden.33 ha. analisis hierarki proses. pH antara 6. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan.81–6.Indra Jaya Asaad.1–8.0008–0.66°C. Penelitian ini bertujuan untuk mengetahui potensi.95 ha.01169 mg/L. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara.10–36.695. Pengumpulan data primer dilakukan dengan cara wawancara mendalam. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009. kurang sesuai 2.095. kesesuaian rumput laut. Petrus Rani Pong-Masak. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang. bahan organik total 37.09 mg/L. oksigen terlarut 5. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1. Mudian Paena. KATA KUNCI: potensi. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari.02–9.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI. dan Makmur Balai Riset Perikanan Buddidaya Air Payau.820. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka.039–0. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27. demikian pula dengan karakteristik físika dan kimia oseanografinya.37. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya. .32 ha.85 mg/L. besi 0. dengan tingkat kesesuaian lahan sesuai 21. fosfat 0.38–44. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis.0037 mg/L.57°C–30. salinitas 36. suhu 29. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar.610.3 meter. Kabupaten Kepulauan Selayar. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir.90 ppt. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka.0032–0. karakteristik. nitrat 0. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian.30 ha dan tidak sesuai 3.0267–0. KARAKTERISTIK. nitrit <0. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. Kata kunci : Opsi pemanfaatan wilayah pesisir.685 mg/L. Rachman Syah. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir. dan total suspensi <25–80 mg/L.

Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. Kabupaten Pontianak . Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak.Indra Jaya Asaad. salinitas. PO4 dan Fe. Utoyo. Rachman Syah. Cakupan wilayah penelitian meliputi Teluk Hurun. Kata kunci : kualitas perairan. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. tambak. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor. A. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. konduktivitas. Muhammad Chaidir Undu. KATA KUNCI: keramba jaring apung.Indra Jaya Asaad. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. Parameter kualitas perairan yang diamati adalah suhu. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. analisis faktor. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. NH3. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. faktor teknologi budidaya. pH. NO3. dan faktor pasar.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. NO2. kandungan oksigen telarut. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. Makmur. yaitu : faktor infrastruktur dan kondisi perairan.

nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.663 cps. Kelompok kedua ditebar di atas lantai dengan beralaskan waring. kapang) dan rendemen. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. abu. Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik.32%. rendemen. Kadar air.0%.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Rendemen dendeng sidat dengan bumbu kasar sebesar 57. dan rendemennya 37. Selanjutnya.0%.25% dan dendeng dengan bumbu ekstrak sebesar 59.41%. kimiawi (kadar air. dan dijemur di bawah sinar matahari selama 18 jam. KATA KUNCI: pengeringan. dan mutu natrium alginatnya mempunyai kadar air 19. kadar abu.26%. kadar abu 19. kemudian direndam dalam larutan KOH 0. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air. dan pH). setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. viskositas 8. Rumput laut coklat setelah dipanen.97%. dan dijemur di bawah sinar matahari selama 18 jam. dan protein masing-masing sebesar 14. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna. Jakarta **) Pusat Riset Perikanan Budidaya. dendeng. natrium alginat.44%. dan viskositas natrium alginat). rumput laut coklat. dicuci dengan air bersih. protein lemak.46%. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempah-rempah kasar dan halus (ekstrak). Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. terbuka di atas lantai pada suhu ruang (sekitar 30°C). lemak. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk.1% selama 60 menit. abu. dan tekstur) menggunakan skala hedonik.1%. 28. KATA KUNCI: ikan sidat. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). dan 28.04 mgN% dan 6. mikrobiologi (Angka Lempeng Total/ALT. rasa. Sedangkan nilai TVB dan pH masing-masing sebesar 21. TVB.4%. bau. analisis fisika-kimia . dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15. 7. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. Rumput laut coklat dibagi menjadi dua kelompok.

hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. serta ketersediannya dalam skala kecil. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat. prasarana fisik yang kurang mendukung.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi. Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. KATA KUNCI: potensi desa. harga ikan yang tergantung pembeli dan cuaca. pengalaman petani ikan dan Kebijakan Pemerintah. kekurangan modal. polusi air. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. agribisnis perikanan . Faktor pendorong yaitu ketersediaan air yang melimpah. Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. Metode yang digunakan adalah studi kasus. kelembagaan yang menunjang. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. Identifikasi faktor-faktor pendorong maupun faktor-faktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya.

Sign up to vote on this title
UsefulNot useful