P. 1


|Views: 2,159|Likes:
Published by Imam Nurhakim

More info:

Published by: Imam Nurhakim on Oct 02, 2010
Copyright:Attribution Non-commercial


Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less





Forum Inovasi Teknologi Akuakultur 2010


Forum Inovasi Teknologi Akuakultur 2010

FF 01
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: L0ppt =2,1±0,23; W0ppt = 7,0±0.29; B0ppt = 139,8±6.72; L7,5ppt = 2,3±0.06; W7,5ppt = 8,2 ± 0,42; B7,5ppt = 164.3 ± 8,46; L15ppt = 2.3 ± 0,21; W15ppt 7.8 ± 0,45; B15ppt = 155,6 ± 8,95. Pengamatan setelah 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-50ppt: 4,0±0,34; 3-515ppt: 4,8±0,27; 5-80ppt: 7,4±0,35; 5-815ppt: 9,2±0,98. Pengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
KATA KUNCI: nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen (LT50) dengan 8 ulangan dari masing-masing strain. Analisa data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata LT50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT 50

Forum Inovasi Teknologi Akuakultur 2010

FF 03
Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan, Universitas Padjadjaran

Penelitian ditujukan untuk menentukan persentase terbaik dari S. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. cereviceae sebagai perlakuan dan lima kali ulangan. Sebagai perlakuan adalah A0 (tanpa penambagan S. cereviceae); A1 (penambahan S. cereviceae 1%), A2 (penambahan S. cereviceae 2%), dan A3 (penambahan S. cereviceae 3%). Hasil penelitian menunjukkan penggunaan S. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. Pertumbuhan terbaik diperoleh pada penambahan S. cereviceae sebesar 2%
KATA KUNCI: Saccaromyces cereviceae, fermentasi, pakan buatan, nila merah

FF 04
Iskandariah, Otong Zenal Arifin, dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi, Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. Populasi yang diamati meliputi jenis nila BEST, Nirwana, Gesit, lokal Kuningan, dan lokal Bogor. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD), dengan menggunakan primer OPA-03, OPA-04, OPC-14, dan OPC-15. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13.3333%–46.6667%, dengan nilai heterozigositas 0.0351–0.1952 dan jarak genetik antar populasi 0.1765– 0.5797.
KATA KUNCI: RAPD, genetik, populasi, ikan nila, Oreochromis

Uni Purwaningsih*). Fakultas Perikanan dan Ilmu Kelautan. 106. 106. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. yaitu genotype XX. agalactiae secara intra peritoneal pada ikan uji sebanyak 0. ikan uji disuntik dengan PBS. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. Sukamandi **) Dept. XY.Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. Perlakuan dengan injeksi sel utuh S. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). Kata kunci : Ikan nila. titer antibodi. tidak cukup untuk memberikan protektif terhadap S. Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. Tetapi setelah uji tantang. diferensiasi kelamin. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. genotipe. ikan nila . pengukuran bobot individu rata-rata dan penghitungan sintasan. agalactiae pada tingkat kepadatan 108. titer antibodinya menurun. SR). DAN YY Didik Ariyanto*). Selain ditentukan secara genotipe. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. Pada akhir pendederan dilakukan identifikasi jenis kelamin. Komar Sumantadinata**). seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. Hasil yang diperoleh bahwa sel utuh (whole cell) S. agalactiae. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. Budidaya Perairan. KATA KUNCI: vaksin sel utuh. limfosit perlakuan tidak berbeda nyata dengan kontrol. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. Untuk kontrol. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. Pada uji tantang setelah minggu keenam. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. Pada perkembangannya. Oreochromis niloticus Angela Mariana Lusiastuti*). Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. S.81% dan 83. XY. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA.55% sedangkan genotipe XY dan YY masing-masing sebesar 79. dan YY melalui evaluasi nisbah kelamin yang dihasilkan.01%. Data sintasan (Survival Rate. Genotipe XX mencirikan betina dan XY untuk jantan. agalactiae. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY.1 mL/ekor. Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. dan differensial leukosit dilakukan analisa sidik ragam (Anova). 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga.

dengan variasi perbedaan kepadatan bakteri vaksin (A=108. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. D=102 cfu/mL dan E=kontrol). dan Joni Haryadi Pusat Riset Perikanan Budidaya. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. C=104. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. B=106. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. serta data status kegiatan budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. Selain itu. NO2.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. NO3. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. KATA KUNCI: manajemen pakan.5). adalah septikemia dan meningoencephalitis. Danau Maninjau. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. keramba jaring apung (KJA). 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. kecerahan. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. Anjang Bangun Prasetio. Pemberian pakan tidak boleh berlebihan. KATA KUNCI: Streptococcus agalictiae. total nitrogen. turbiditas. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. pH. karena pada kondisi perairan yang kurang baik akan menyebabkan stres pada ikan. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium).5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. pemanasan. DO. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. NH3. ortofosfat dan total fosfat. Selain itu. Angela Mariana Lusiastuti. BOD. TDS. lingkungan perairan . terutama dalam hal manajemen pemberian pakan. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini.

bobot ( -2.06%).87%) dan sintasan (0. tinggi (3. tidak berbeda nyata (P<0.82%).48% bt/hari dan 2.80%. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat. Komar Sumantadinata**). dan sintasan(1. tinggi. Sukamandi **) Dept. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4.74%). SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2.22%). Parameter yang diamati meliputi keragaan pertumbuhan (panjang. sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2. Sukamandi selama lima bulan. IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi. KATA KUNCI: heterosis.35% bt/hari. lebar (0.48%). tebal. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. persilangan. sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74.53 % bt/hari. Nunuk Listiyowati. Fakultas Perikanan dan Ilmu Kelautan.05) bila dibandingkan dengan dua populasi lainya. tebal (-1. Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. bobot (-2. oreochromis niloticus .20%.44%). tebal (0.94%). Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (-2. bobot) dan sintasan. Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia).Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*).65%). Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Budidaya Perairan.21%).64% bobot badan (bt)/hari.

5094 (2. dan nilai terbesar dimiliki oleh bakteri S. 3. uji stabilitas dan LC50–24. agalactiae (N4M) memiliki nilai LD50 terkecil.7504). Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). dan 96 jam terhadap benih ikan mas adalah 4. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah. dan 96 jam. NK1) dan 1 isolat S. iniae (N2O). Hasil penapisan menunjukkan bahwa bakteri S. 3. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN. pemanasan. ikan nila . vaksin.0430 (4.81±0. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis.8090) dan benih ikan nila 5. 0.0839(2.6904– 5.6799–13. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration (LC50) 24.1100).5480). 2. 48. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin.6297–0. KATA KUNCI: penapisan.5805). Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung. 72. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S.08 g. N4M. Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan.4227– 4. N17O.1295). 72. streptococciasis. SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA.7138 mg/L (0.3354 (3. agalactiae (N3M.8101–1. benih ikan. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak. Hasil penelitian menunjukan bahwa Nilai LC50 24. agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik. KATA KUNCI: toksisitas. Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar. dan sonikasi. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1.13 dan 1. Data diolah dengan analisis probit program LC50. 0. 48. 1. 48.55±0. Konfirmasi taksonomis hingga level spesies isolat bakteri S. Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan. iniae (N2O). Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp.8532).6578–2.9421 mg/L (1.9823–4.0930).7877–2. Bogor. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar. dan 96 jam. N14G.9237(0.0678 (1.

Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. garmen. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya.184. tas. KATA KUNCI: bahan penyamak kron. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek. kadar abu 2. 10%. suhu kerut 88°C. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa Tenggara Barat. kakap putih. Waktu pemijahannya sekitar jam 24.12 kg/cm. dan 15% . kambing dan ikan pari yaitu berisi. dan corak permukaannya spesifik. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. dan sebagainya. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. Selain itu. kekuatan regang (kemuluran) 66. namun sintasannya masih rendah yaitu sekitar 1%–3%. untuk dijadikan kulit tersamak.46 N/ cm2 atau 222. kadar air 13. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. simetris. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. yang merupakan limbah perikanan dari perusahaan filet ikan.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Sulawesi.76 kg/cm2. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat. Telur yang ada dalam kolektor dapat diambil jam 07. pembesaran. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. dan 102. 40. Ikan ini relatif sensitif dengan perubahan lingkungan. kekuatan jahit 1. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu. sarung tangan. kekuatan tarik 2. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek.94%.354. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20. kambing. Ikan ini mudah terserang parasit seperti cryptocarion. dan 80 ekor/m3 selama 5 bulan masingmasing mencapai ukuran 127.00. karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi.53 N/cm atau 138. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi). juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia. 103.0–3.66%. KATA KUNCI: pembenihan. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1. dompet. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. dan Sumatera.62%. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan.93% dan kadar Cr2O3 1. Nusa Tenggara Timur. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi.97% sehingga sangat prospektif untuk dijadikan barang-barang kerajinan kulit. benedinia.2 g.5 kg. kerapu sunu . dan cacing.5 g. kadar lemak 6.0 g.00 sampai jam 03.00 pagi hari. lemas.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi.00–08. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih. Dalam pembesaran. Pembenihan ikan ini mulai berkembang di sekitar Gondol. liat.

sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. Metode elektroporasi dilakukan dengan voltase 50 V. Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. mikroinjeksi. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. Namun demikian.1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. mikroinjeksi. Irvan Faizal*****). transfer gen. 2. Rustidja**). Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. dan 20 µg/ mL. ikan kerapu tikus . jumlah kejutan 5.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. Komar Sumantadinata***). Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. Situbondo **) Fakultas Perikanan dan Kelautan. dan Gemi Triastutik*) *) Balai Budidaya Air Payau. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. Sasmito Jati****). Ratu Siti Aliah*****). elektroporasi. di antaranya Indonesia. M. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. KATA KUNCI: transfeksi. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. hormon pertumbuhan. lama kejut 30 ms. dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. jarak waktu antar kejutan 0. Alimuddin***). Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. dan 3 detik. Cromileptes altivelis Slamet Subyakto*). DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). 10 µg/mL. mikroinjeksi.

42±0.50-0. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU. Namun.73%) dan panjang total (9. serta terakhir perlakuan D (47.31±0. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal.25) dan efisiensi pakan (80. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu.19±0. selanjutnya perlakuan C (64. yaitu 5%.19%) harian serta laju pertumbuhan bobot badan spesifik (6. nisbah konversi pakan.69 g dan panjang total awal 3. efisiensi pakan.20-4. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0. dan kualitas air. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen).02%) serta nisbah konversi pakan (1.35 cm). optimasi pakan. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. Salah satu faktor yang berperan adalah lingkungan pemeliharaan.69 mm).20 cm. Sampling dilakukan setiap minggu. 10%.19%) dan panjang total spesifik (1. pertumbuhan panjang larva. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus). pertumbuhan.68 g) dan panjang total (6. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3. Nilai pertambahan panjang tertinggi A (72. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. probiotik. laju pertumbuhan spesifik. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan. Pemberian pakan dilakukan tiga kali sehari. B (oksigen). Pakan yang digunakan adalah pakan pelet komersial.86 mm). Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan. Kendala yang dihadapi terutama terjadi pada stadia awal.95 mm). dan 15% dari total biomassa benih.000 ekor/bak. dan perlakuan B (63.35 mm).Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut. Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva. laju pertumbuhan bobot badan harian (10. dan efisiensi pakan pada benih kerapu sunu. C (probiotik). KATA KUNCI: larva kerapu sunu. Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan.00%) yang baik bagi benih kerapu sunu. Materi yang digunakan adalah larva kerapu sunu sebanyak 4. KATA KUNCI: benih kerapu sunu. D (kontrol). Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan. Peubah yang diamati adalah sintasan.90±0. laju pertumbuhan harian.52±0.39±0. oksigen .

KATA KUNCI: Epinephelus fuscoguttatus. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L.03% dan perlakuan C adalah 8.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular. kerapu macan . Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun nonspesifik ikan kerapu macan.57 mm.87. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan.68 mm. serta bobot badan pada perlakuan A: 192. Anak Agung Ketut Alit.0x105 sell/mL.08 ± 1.00%. terutama infeksi virus. KATA KUNCI: pakan buatan. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN.50%./mL dan mulai umur 17 hari diberikan nauplii Artemia. perlakuan B adalah 6. aktivitas lisosim sebesar 1.5 ± 2. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind.04 ± 0.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN. mencapai ukuran panjang total pada perlakuan A: 24.1 ± 2.55 mm dan C: 26. Masing-masing perlakuan diulang 3 kali. B: 196. larva kerapu macan. infeksi. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut.5 ± 4.81 ± 0. Perlakuan B: 4 kali/hari pada umur 7-20 hari. B: 24. Epinephelus fuscoguttatus Irwan Setyadi.96 mg.08 ± 2. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian. Mulai larva umur 2 hari diberikan Nannochloropsis sp.65%. sedangkan kontrol hanya disuntik dengan PBS. indeks fagositik sebesar 1.12 mg dan C: 211. Perlakuan C: 5 kali/hari pada umur 7-20 hari.62 ± 2. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang. Perlakuan A dan B tidak berbeda nyata. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido. Des Roza. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari.20 ± 0.87 cm dan sintasan setelah diuji tantang sebesar 72. imunstimulan. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Gondol ABSTRAK Ikan kerapu macan. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. dengan kepadatan 1. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol. Bejo Slamet. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan.95 mg.62%.

kerapu bebek (Cromileptes altivelis).86 mm. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen. panjang. Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. Sampai dengan bulan Oktober telah berhasil memijah. pembenihan. Setiap bulan dilakukan pengamatan pertumbuhan bobot.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. perkembangan oosit . Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu. Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. konsentrat yang bisa dibeli di pasaran. yang kurang baik.72% dan panjang total 18. Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. dengan sintasan 6. pada bak A : ikan rucah + cumi-cumi + vitamin. generasi kedua (F-2). Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. dan dilihat perkembangan oositnya. KATA KUNCI: kerapu bebek (Humpback grouper). masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor. pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari. sedangkan pada bak B : pakan pelet kering. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah.10% dan panjang total 21. KATA KUNCI: efisiensi. konsentrat mempunyai sintasan 19.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp.

lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor. 25. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D-15). KATA KUNCI: kerapu bebek. Tetapi tingkat sintasan yang didapatkan masih rendah. 2. 10. Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. produksi massal . dan 32 hari setelah menetas masingmasing sebanyak 10-20 ekor. 15. Cromileptes altivelis Yasmina Nirmala Asih. 3. Ketut Mahardika. Indah Mastuti. 13. Selain itu. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). Sampel larva diambil pada umur 1. Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. KATA KUNCI: pemeliharaan larva. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. 4. 5. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. mutu benih kerapu. 7. Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. 17. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. 20. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin.8%-41. Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. manajemen air media pemeliharaan dan manajemen pakan.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. histologi. Tangki pemeliharaan yang digunakan ukuran 8-10 m3. pemeliharaan dilakukan hingga yuwana (2 bulan).

akibat serangan penyakit dan kondisi media. Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. KATA KUNCI: innate immunity. dan siklus kedua menggunakan larva dengan kekebalan bawaan. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. laju pertumbuhan spesifik. Kematian larva umumnya terjadi pada hari keempat. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. di lain pihak hasil tangkapan cenderung menurun. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. siklus pertama. Pakan diberikan 2 kali secara “adlibitum”. 15%. Salah satu sumber protein alternatif adalah protein sel tunggal (PST). Oleh karena itu. Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir.05). I Nyoman Adiasmara Giri. Sumber protein utama pada pakan adalah tepung ikan.651 ekor benih untuk setiap induknya. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. catfish seed. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. Ketut Suwirya. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. 15% (P>0. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. dan ketiga menggunakan larva tanpa kekebalan bawaan. survival rate. (pakan kontrol). Hasil penelitian menunjukkan bahwa nilai bobot akhir. Tingkat kematian larva dapat mencapai 40%–80%.797–457. KATA KUNCI: protein sel tunggal. dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. perlu alternatif lain sebagai substitusi tepung ikan.4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. 10%. Pakan penelitian berupa pelet kering dengan kandungan PST 0%. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. dan 20% dalam pakan. pertambahan bobot. 10%. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). 5%. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. Lies Emmawati*). Pangasius hypophthalmus . Oleh karena itu. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR). Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity).Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi.

benih.46% per hari.75±0.674±2. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. (B) 2‰. sintasan serta beberapa parameter kualitas air. Ikan uji yang digunakan berukuran 2 ± 0.92 cm). ikan patin. Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan.2%). pakan C (98.25±0. Pangasius hypopthalmus Mohamad Amin. Ade Dwi Sasanti.1%). Dade Jubaedah. Parameter yang diamati adalah laju pertumbuhan panjang badan.35±0.5 g/ekor.07 cm).3%). Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter. Pakan diberikan 3 kali sehari secara at satiation.4%) berbeda nyata lebih tinggi dibanding pakan E (68.8%). dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm. Analisis data dilakukan secara deskriptif. dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan.0%).114±0.010±0. yang dilanjutkan dengan uji Tukey. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰.910±0. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak).00%). dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor. Pangasius djambal. KATA KUNCI: fitase .17% per hari menjadi 1. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal. Data diperoleh dianalisis sidik ragam. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.763±0. Ikan patin sebayak 15 ekor. dan (C) 3‰ dengan tiga kali ulangan. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32. kemudian salinitas 3‰ (4.4%).93%) dan terendah salinitas 3‰ (25. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). pakan B (82.14%).49 cm). sedangkan laju pertumbuhan panjang harian meningkat dari 1.1%) berbeda nyata lebih tinggi dibanding pakan D (97. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan. KATA KUNCI: salinitas.32% per hari menjadi 4.764±3. Kecernaan P pakan B (98. diikuti salinitas 2‰ (28. Kecernaan protein juga meningkat akibat penambahan enzim fitase.1%) dan pakan E (95. C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati. selama 30 hari.884±2.13% per hari.223±0.204±0. dan salinitas 1‰ (3.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN. Kecernaan protein tertinggi berturut-turut pakan C (82. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin. dan sintasan . pakan A (82. Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4. dan A (98.3%) dan pakan D (80. Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3. D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase).140±0.

Pemupukan. Padat tebar larva yang digunakan adalah 100 ekor/m2. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam. Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11. Pupuk anorganik + organik yang difermentasi + Probiotik.9%). namun perlakuan B (7 ekor/m2) memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95. Larva yang ditebar berumur 20 jam setelah menetas. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut. 0.49±1. penetasan telur dan pemeliharaan larva di kolam. pengecekan induk.27±0.7% rendahnya sintasan ini diduga karena adanya faktor hama. sepat.5).60±10. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia. nila. dan C (613. udang liar) serta jenis serangga air. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. Pupuk anorganik + organik + probiotik dan C. B (95.42±0. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. belut. 0.2%). predator yaitu antara lain: Ikan liar (gabus.12 g dan 3. pemijahan. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2).5 juta ha (rata-rata 20 juta ha). Pupuk anorganik + organik. B (7 ekor/m2).3 g) dan SR perlakuan A (91. Akmal. dan C (10 ekor/m2) dengan 3 kali ulangan. Patin Siam. Jika luas gambut Indonesia adalah 20 juta ha. sintasan ikan. B. lahan marjinal . Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4. Kata kunci: Intensifikasi.51 g dan 11. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari. Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut.37 cm C 16.74±0. dan Syafrudin Balai Budidaya Air Tawar. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery.08 g dan 3. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan.26 cm. betok.5%-9. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan dan sintasan ikan. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masing-masing perlakuan: A. yaitu antara 13.2%. komposisi pakan alami kolam. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia.7.19±0. Sularto.31 cm B. B (660 g). Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah. Pemberian pakan dengan pelet apung sebanyak 5% per hari. KATA KUNCI: budidaya. ikan patin.5-26. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g). Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam. dan C (95.

Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. 15 ekor/m2 (70. KATA KUNCI: patin pasupati.000 ekor atau kepadatan 5 ekor/m2.47 g). 15 dan 20 ekor/m2 dengan bobot awal antara 15. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin. 10. Padat tebar yang digunakan adalah 5. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya.46 g).60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97.5 m.06%) dan terendah pada kepadatan 20 ekor/m2 (7. Evi Tahapari***). Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%.17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8. dan Sularto***) *) Pusat Riset Perikanan Budidaya. Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3. pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela. JAWA TENGAH Ongko Praseno*). Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1.76%). nasutus . Evi Tahapari. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Zafril Imran Azwar**). Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan.71). salinitas.36 cm.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES.76 cm dan 2.000 ekor atau kepadatan 10 ekor/m2. Kata kunci: padat tebar.10%/hari. Percobaan dilakukan selama 100 hari pemeliharaan. pertumbuhan.54 g dan panjang awal antara 10. dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3.74 g) dan 20 ekor/m2 (61. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari. Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih. Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.30%). diikuti dengan kepadatan 10 ekor/m2 (92. Sifat biologi pertumbuhannya belum banyak diketahui. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95. di samping itu.80%.18) dan terendah pada 10 ekor/m2 (1. Jakarta **) Balai Riset Perikanan Bididaya Air Tawar.45 g).43–11.52%) dan terendah pada 20 ekor/m2 (91.70–20. sedangkan petakan kedua ditebar sebanyak 2. pertumbuhan.09 cm dan 1.

Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan. sebagai perlakuan yaitu: (A) 0.67%). Parameter yang diamati adalah insidensi dan sintasannya. Ikan uji yang digunakan berukuran 1–2 inci. Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109. Perlakuan kedua adalah padat tebar: 5 ekor/L. sintasan. Pengamatan dilakukan selama 15 hari setelah perlakuan. dosis. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. Uji tantang dilakukan dengan dua cara. dan pertumbuhan . Kata kunci: uji tantang Aeromonas hydrophila.002 mg/L (4.002 mg/L (83.35 cm). Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*).001 mg/L.003 mg/L (81.002 mg/ L.003 mg/L (4. dan 15 ekor/L. dan (C) 0.67%). yaitu: cara perendaman dan cara penyuntikan intraperitonial. dan kontrol (placebo). dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air. Sukamandi. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. Evi Tahapari*). Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. 109.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*).60 ± 0. perendaman.003 mg/L dengan tiga kali ulangan. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar.49 cm). 106.14 cm). 108. kemudian perlakuan dosis 0. 108. 10 ekor/L. diikuti dosis 0.001 mg/L (4. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal. KATA KUNCI: probiotik.35 ± 0.001 mg/L (86.55 ± 0.33%) dan terendah perlakuan dosis 0. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif. 107. intraperitonial. Angela Mariana Lusiana**). Jakarta **) Balai Besar Riset Perikanan Budidaya Laut. dan kontrol. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. kemudian dosis 0. Ikan uji yang digunakan berukuran 3–4 inci. Bogor ***) Pusat Riset Perikanan Budidaya. (B) 0. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo. benih. Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0. Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. Probiotik diberikan dengan dosis yang berbeda. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. Analisis data dilakukan secara deskriptif. Nurbakti Listyanto*).

03% (pakan C). dan substitusi protein 6. larva. 75% ampas tahu:25% tapioka. substitusi protein 2. Zafril Imran Azwar.41±0. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129.05% dengan lama inkubasi 22–25 jam.000 µm.700–4. rearing. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu. Penelitin ini terdiri atas dua tahap. tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm. ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad. Bambang Iswanto. Ke dalam wadah ditebar ikan patin ukuran 11.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium. dan 25% ampas tahu:75% tapioka.03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar. Pangasius nasutus .900 µm.16%–79. ampas tahu. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu. substitusi protein 4. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. dan tahap 5 (atresis) dengan diameter oosit 300–1. Perkembangan oosit patin nasutus bersifat sinkronis grup. KATA KUNCI: fermentasi.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologi-reproduksi berkaitan dengan kapasitas produksinya. 50% ampas tahu:50% tapioka. Derajat penetasan patin nasutus berkisar 44. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar.58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4. KATA KUNCI oosit. tahap 3 (granula kuning telur) dengan diameter oosit 700–1. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm.04% (pakan D). artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai. yakni pengamatan perkembangan gonad dan fertilisasi. hatching. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. substitusi protein 0% (kontrol) (pakan A). tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus.130–22. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut.250–1.700 µm. Ukuran panjang total larva yang baru menetas berkisar 3.850 µm.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11. Aspergillus niger.52% (pakan B). dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.

masing-masing perlakuan diulang sebanyak empat kali. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat. diikuti perlakuan C. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A. sedangkan patin hibrida siam-jambal sebesar -4.43b. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER. 1. dengan kantung kuning telur berukuran 0.64±0.34±0. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var. dan D. C.03±0.10–1. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi. KATA KUNCI: patin albino.47±0. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan.14 mm. 79.56 cm/ekor.42±0. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE.31ab. diikuti perlakuan B.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam. berukuran panjang total 3. 100% zeolit B.24) x 103. hibrida.01±0.20 mm. C. dengan kantung kuning telur berukuran 0. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20. biofilter.67%. 88. 75.45 g/ekor. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus.08 mm3 yang terserap 50% pada umur 30 jam dan habis terserap pada umur 60 jam. 4. 1.1±0. jambal. B.42.6±0.1. B.71±0. 89.20. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa.98±0.35 cm/ekor dan A.58%.60 cm/ekor.27a.62 g) dan panjang (2. tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus. dan D. nasutus . 0. 95. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut. pertumbuhan. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1. siam. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D.89±0. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi.75% dan terendah perlakuan A. larva. 4. C.33%. 50% zeolit + 50% bioball dan D. C.23%. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D.69 cm/ekor diikuti B.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin. B. 75% zeolit + 25% bioball. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0. 2. 92.84 g/ekor dan terendah A. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A. Kata kunci: embriogenesis. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER.13 mm. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa.30a. C. 88. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian. berukuran panjang total 3.02 g/ekor. 1.30ab. 0.25 g/ekor.28%.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias. 91.01±0. 25% zeolit + 75% bioball. 1. 0. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D.54 cm). Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi. 2.

dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone.2%–78. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar.76 g N untuk pakan berprotein 21%. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. Pakan tersebut digiling ulang. lama pemeliharaan ikan bandeng. lama ikan bandeng digelondongkan. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. lalu ditambahkan kromium oksida (Cr2O3) sebagai indikator kecernaan. milk fish. diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%. Hasil penelitian menunjukkan bahwa. 2. dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. Eddy Supriyono**).990 kg/ha/musim dengan rata-rata 292. padat penebaran udang windu. Untuk menentukan total limbah N termasuk eksresi amonia. dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati.0% untuk protein dan 81. dan 3. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. 88. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. Maros **) Fakultas Perikanan dan Ilmu Kelautan. Oleh karena itu.6%–90. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok. produksi. KATA KUNCI: feed digestibility.27 g N untuk pakan berprotein 17%.1% untuk C-organik. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). N waste. KATA KUNCI: pengelolaan. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein pakan yaitu 2. Neltje Nobertine Palinggi*). 21% dan 26%.6%–83. tambak. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak. Akhmad Mustafa. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Oleh karena itu.2% untuk bahan kering.2 kg/ha/musim. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok). ikan bandeng.28% untuk pakan berprotein 26%. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. Jika bioflok terbentuk. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. Enang Harris**). heterotrof bakteria . dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. Dedi Jusadi**).

Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. opsi kebijakan .250 ton. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan.726 ha dan yang layak untuk budidaya sekitar 6. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau.975 ha. Molase digunakan sebagai sumber Corganik. bandeng. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). kendala. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. KATA KUNCI: Heterotrofic bakteria. dan Rasidi Pusat Riset Perikanan Budidaya. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. growing. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia.000 ton dan mengalami kenaikan sebesar 14. Hatim Albasri. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L.54% per tahun kurun waktu tahun 2005–2009. Dedi Jusadi**). (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12. KATA KUNCI: budidaya. Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya. Oleh karena itu. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. Khususnya di wilayah Pantai Utara yaitu Kendal. dan Pekalongan. Eddy Supriyono**). (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. DAN PEKALONGAN ) Anjang Bangun Prasetio. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. Penyusun utama bioflok ini adalah bakteri heterotrof. Penambahan inokulasi bakteri komersial (Bacillus sp. Pada tahun yang sama.66% dari tahun-tahun sebelumnya. Pati.000 ton dan mengalami kenaikan rata-rata 13. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). PATI. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL.) cenderung meningkatkan kandungan asam amino bioflok. Enang Harris**).

Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA). KATA KUNCI: promoter.0%). Gusrina*).) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. sedangkan DP dihitung ketika semua telur telah menetas.34±1.63±10.67%. keratin-GFP (21.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel.00±1.0%) dan yang terendah â-aktin-GFP (3. Hasil penelitian menunjukkan bahwa DKH-e (63. DKH-e yang diinjeksi dengan â-aktin-GFP (25. 18. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. Clarias sp. Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji. Data dianalisis secara deskriptif. GFP. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi. dan heat shock-GFP berturut-turut adalah 20. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi.33%.0±0. dan Utut Widyastuti***). Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung.66±1. Fakultas Perikanan dan Ilmu Kelautan.Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi. mikroinjeksi. keratinGFP. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan.0%). sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0. DP untuk â-aktin-GFP.67%).33±1.****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan.03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi. Komar Sumantadinata**). Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi.00±1. Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10. DKH-e dihitung sebelum telur menetas. ikan lele .00±3. HEAT SHOCK DAN KERATIN PADA IKAN LELE. Konstruksi gen dalam bentuk plasmid mBA-gfp.3±0. Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein.65%) dan heat shock-GFP (18. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi. menyusul heat shock-GFP (10. Ekspresi gen gfp tidak tampak lagi pada saat telur menetas.34%) dan DP (63.0±10. Alimuddin**). dan 15.33±3. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp.65%.66%) relatif sama. FMIPA.

KATA KUNCi: A. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang.37% kadar abu. Kandungan bahan aktif hasil pengekstrasian pegagan segar. Taukhid. pakan tenggelam.15%) dibandingkan dengan pakan tenggelam (yakni 79.71±2.23% kadar abu tak larut asam.30±2.41 mg/L) dengan dosis efektif 250 mg/L. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo. Ikan lele dumbo berukuran 41. Feces yang dihasilkan diambil setiap hari.. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus). 39. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif). pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan.25% sehingga tidak berbeda nyata dengan pakan terapung. pagi dan sore. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani.53% menjadi 92. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi. hydrophila menjadi penyakit endemis di Indonesia. ikan lele dumbo (Clarias gariepinus). aerasi.05) dari 79. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0. 0. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna. Angela Mariana Lusiastuti. 24. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus).53%) (P<0. hydrophila. Rita Febrianti. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. bahan aktif.47±4. 1. Bak diisi air sebanyak 100 liter.34% kadar air. 5. Melalui penambahan aerasi. 6.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak.74±1. pegagan Centella asiatical [L] Urb. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5.83% kadar sari dalam alkohol. Pemberian pakan sebesar 5% dari biomassa per harinya.39% kadar asiaticosid. Pada perlakuan tanpa aerasi.47±4.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB. pakan terapung .623.05).33% kadar sari dalam air. KATA KUNCI: kecernaan pakan.

Parameter yang diamati sintasan dan pertumbuhan (bobot. namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25. tapioka.90%. fermentasi. dan Darti Satyani Balai Riset Budidaya Ikan Hias ABSTRAK Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9. amonia. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol). dan perkembangan gonad). dan 30 g/40 liter masingmasing diulang 3 kali. Jenis pakan berupa cacing tubifex. lele dumbo FF 46 ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA Tutik Kadarini. 19.10 g sebanyak 40 ekor. bloodworm. Wadah percobaan yang digunakan adalah bak beton ukuran 1. 13. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan.Forum Inovasi Teknologi Akuakultur 2010 FF 45 PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus) Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. kualitas air (suhu. Sulasy Rohmi. Siti Subandiyah. dan cuk yang diberikan diselang-seling secara adlibitum. dan gonad . formulasi. dan dirancang sistem resirkulasi. 7.56%. Laju pertumbuhan spesifik. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0.96%. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. 20. dan molase. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11.92%.3–3. dan penurunan lemak 61.33±0. panjang. KATA KUNCI: gurame coklat. oksigen.1 cm.0 m x 1. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2.83% tidak memperlihat perbedaan dengan perlakuan kontrol.8–4. penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7.85%. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium.7 cm mencapai TKG III.8 m. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. dan karbondioksida). dan 25.0 m x 0. dari perlakuan kontrol.81% dalam formulasi pakan. 10. ikan. KATA KUNCI: maggot. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar. Setiap perlakuan dengan 3 ulangan. reproduksi. alkalinitas. Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3.28%. pH.

86%. biokimia. Lamanto. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92.546 butir dan 2.5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. 14% dan kontrol yakni masing-masing 79. penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat.351 butir. daun sente. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2. dan 71. yaitu seperti daun talas.26). Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman. dan injuk sebagai bahan pembuat sarang. 33%. 28. KATA KUNCI: ikan gurame. Pemberian pakan tambahan dengan kadar protein 38%. 33%.23% dibandingkan dengan pemberian pakan dengan kadar protein 33%. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi. PCR FF 48 PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI Bambang Gunadi. namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. 4. Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp.88 buah. Masing-masing perlakuan mempunyai 2 ulangan. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang.94% (P=0. dan tingkat fertilitas telur yang dihasilkan. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa.774 butir per sarang. pakan buatan.13 buah) dan hanya daun sente (0. Induk gurami yang digunakan berbobot 2-3 kg/ekor. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. lebih rendah dibandingkan dengan yang diberikan pakan tambahan berkadar protein 33%. Mycobacteriosis. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame.75 buah. dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina.09).) DI JAWA Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. produksi telur per sarang. dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. Pakan yang diberikan berupa daun sente sebanyak 3. Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). yaitu di Jawa timur (Blitar dan Tukung Agung). yakni 0. keragaan reproduksi . Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente.5 buah). sehingga petani tidak mengalami banyak kerugian. dan 14% sesuai dengan label pada kemasan masing-masing. dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0.Forum Inovasi Teknologi Akuakultur 2010 FF 47 APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan. KATA KUNCI: fish TB. Mycobacterium fortuitum. Jakarta ABSTRAK Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. Perlakuan yang diterapkan adalah kadar protein 38%. Sukamandi ABSTRAK Ikan gurame termasuk ikan dengan fekunditas rendah. Pemberian pakan hanya daun sente diterapkan sebagai kontrol.05%. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang). Dari hasil penelitian menunjukkan bahwa di daerah Blitar.730 butir.

oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar. dan polar fermentasi berbeda nyata (P<0. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). dengan ditandai tumbuhnya koloni transforman berwarna putih. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi.47 g/ekor. pertambahan bobot relatif. dan koloni berwarna biru tidak mengandung DNA sisipan.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan berbeda nyata (P<0. Retensi protein dedak padi fermentasi.67%–100%. polar. Bogor dan terdiri atas dua tahap.05) dengan perlakuan lainnya. polar. retensi lemak. dedak padi. dedak padi fermentasi. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG. Kadar protein polar naik 38. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas. mud carp sebesar 1127 bp. dan 6 hari. fermentasi. Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T. dan polar fermentasi.3’). yang menunjukkan terbentuknya plasmid rekombinan. retensi protein. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5. 4. protein efisiensi rasio.05) dengan dedak padi tanpa fermentasi. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ –GATGAAACTCGAGTAGCCCTTGCTCTTC. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. KATA KUNCI: R.02% sedangkan kandungan lemaknya turun 13. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda.28%. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. Retensi lemak tertinggi (35. dedak polar. oligosphorus. Kandungan protein dedak padi naik 19. Wadah percobaan yang digunakan yaitu akuarium volume 100 L. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. dan sintasan. dengan padat penebaran ikan uji 30 ekor per akuarium. dan selanjutnya polar dan dedak padi.14% dan kadar lemaknya turun sebesar 19. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari. dan pada Silver carp sebesar 1123 bp. ikan mas . Sintasan ikan uji berkisar antara 96. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. Parameter yang diuji meliputi bobot akhir rata-rata.33%. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar. oligosporus yaitu 2. Reza Samsudin. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R.

Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. sawah. akuaponik. Lilis Sofiarsih*). Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. dengan padat tebar 20 ekor/m3.25 kali lebih besar dibanding pada kolam konvensional. Data setiap sampling dijadikan ulangan. Benih ikan mas ukuran 18. Penelitian telah dilaksanakan dari bulan Nopember 2009—Pebruari 2010. dan ikan mas galur majalaya sebesar 0. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. Provinsi Banten. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. Sedangkan sintasan. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1. Kabupaten Tangerang. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. Di mana satu di antaranya di desain sebagai kolam akuaponik. tambak . Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. serta keramba jaring apung di danau maupun waduk.28 g/ ekor yang digunakan sebagai hewan uji. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%.15 g/hari. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan. Achmad Sudradjat. sedangkan yang lainnya sebagai kolam konvensional. ukuran panen. Sutrisno*). karena akhirakhir ini banyak lahan yang tidak digunakan (marginal).41 g/hari.86 g/hari. Parameter yang diuji adalah kualitas air terutama kandungan ammonia. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. dengan lokasi penelitian di Desa Kronjo. salinitas rendah. Ongko Praseno. wildan. KATA KUNCI: ammonia. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. dan parameter kualitas air yang lain dianalisis secara deskriptif. kemudian ikan mas galur kuningan sebesar 1. KATA KUNCI: ikan mas. pertumbuhan. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. ukuran panen. sintasan.64 kali lebih banyak dengan ukuran panen 1. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2.

dan Afifah Balai Besar Riset Perikanan Budidaya Laut.067mg) serta kelangsungan hidup (12.42%. Siti Zuhriyyah Musthofa. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata. Hasil penelitian menunjukkan bahwa pertumbuhan panjang. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. dapat dikembangkan di bak terkontrol maupun di KJA. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi. Masing-masing perlakuan diulang 3 kali. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. kemudian diberikan sebagai pakan larva. Siti Zuhriyyah. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian. fry performance. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. serta mempunyai respons yang baik terhadap pakan buatan. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya. Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva.58 cm dan 17. (B) umur 10 hari dan (C) umur 15 hari. KATA KUNCI: artemia nauplii. cobia larvae.07%) relatif lebih tinggi dari pada perlakuan B dan C.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat. Afifah. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. lasted time feeding . Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: survival rate. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari).

sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. budidaya. Lebih dari 100 spesies. Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam. dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. KATA KUNCI: cobia. plasma nutfah . Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. KATA KUNCI: ikan hias.Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. Stakeholder. Herno Minjoyo*). Lucky Marzuki Nasution*). Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera.

Eni Kusrini*). Afrika. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya.226 g. kondisi daya dukung lingkungan yang terus menurun. laju pertumbuhan harian sebesar 32. pertumbuhan. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. diam dan kepalanya menyembul tepat di bawah permukaan badan air. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. peacock bass. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias. granuloma. infeksi penyakit (cacing. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. pakan alami. Depok ABSTRAK Deformity (dysmorphism. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. bakteri. virus).Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*). atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. dan selalu berusaha mendekati sumber oksigen (aerator). Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia. dan yang terendah Moina. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan.. diikuti Artemia. karena belum banyak yang membudidayakannya. Tubifex sp. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. KATA KUNCI: Synodontis nigriventris. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass.. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias. multifocal granuloma . Artemia sp. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. Peacock bass ini akhirnya berenangnya jadi terbalik. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias.586%. Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata. dan Tubifex sp.778 cm. Deformity dapat disebabkan oleh : mutasi genetic. dan pertambahan panjang total sebesar 1. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. dengan 6 kali ulangan. KATA KUNCI: deformity.

Jhon Harianto Hutapea. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3.50 g.87 ± 0. KATA KUNCI: banggai cardinal fish. Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. 20 ekor/bak. Rainbow Papua . juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. 60 ekor/bak.9 ± 0. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai Sulawesi Tengah. 40 ekor/bak. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF). T2. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. wortel dan tepung kepala udang. udang jembret (mysids) dan larva nyamuk. zat pemicu warna. yaitu : astaxanthin. induk diberi pakan berupa naupli artemia/artemia pra dewasa.Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. Hasil penelitian menunjukkan. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. Selama penelitian. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak.3 cm dan bobot 2. Hewan uji yang digunakan berukuran panjang total 5. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. density. dan Ahmad Musa Balai Riset Budidaya Ikan Hias. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. Bastiar Nur. T3. Variabel yang diamati meliputi. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. KATA KUNCI: maggot. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange.

5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok.009 gram. Selama pemeliharaan.05).05). 70. sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis). Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. Pada akhir penelitian (hari ke 105). KO (air kontrol+oksitetrasiklin). Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air. KF (air kontrol+formalin). KO (76. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2.33%. Sintasan terendah dihasilkan oleh perlakuan KB sebesar 51.5 x 0. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. Masing-masing perlakuan dilakukan dengan 3 ulangan. sintasan. namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis. dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar.67%). 20. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. I Wayan Subamia. ukuran ekspor 1 inci (2. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. dan Lili Sholichah Balai Riset Budidaya Ikan Hias.0 cm dan bobot rata-rata 0. Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium. larva Tetraodon palembangensis . dan blitz ich) akan dilakukan melalui rancangan faktorial.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.5 m dan tinggi air 40 cm. KATA KUNCI: prophylaksis. namun tidak berbeda nyata dengan perlakuan AO (81. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich). KATA KUNCI: benih botia.67%). pertumbuhan panjang. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2.67% namun tidak berbeda nyata dengan perlakuan AB (55%). AB (aqua+blitz ich). oksitetrasiklin. dan 105 dan dianalisis secara deskriptif. media air. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian. Nina Meilisza.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza. 55. Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari.5 cm dan panjang tertinggi sebesar 3. Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin. AF (aqua+formalin). AO (aqua+oksitetrasiklin).67%).6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. KF (71. 35. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1.0 cm.5 cm (ukuran ekspor). lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2.5 x 0.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.

). KATA KUNCI: palmas albino. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27. aligator (Lepisosteus oculatus). pembuahan.75 mL/kg untuk induk betina di bagian intraperitoneal. inkubasi telur dan perawatan larva. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy.). sehingga produksinya masih mengandalkan impor dari luar negeri. Asep Permana. memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. namun belum banyak diketahui data embriologinya. hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur.4°C. Pemijahan tersebut terdiri atas seleksi induk. antara lain sinodontis (Synodontys sp. penyuntikan hormon.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar.5 ml/kg untuk induk jantan dan 0. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0. Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. perkembangan embrio. platidoras (Platydoras sp). KATA KUNCI: Neocaridina heteropoda.91%. daya tetas telur 80. Ikan palmas jenis albino (Polypterus senegalus var. dan red-fin shark (Ephalzeorhynchos sp. dan Bastiar Nur Balai Riset Budidaya Ikan Hias.6°C–29.15%. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil.). Asep Permana. albino) masih sulit untuk memijah dalam wadah terkontrol. Depok ABSTRAK Ikan palmas (Polypterus sp.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol. polypterus senegalus albino. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan. tiger catfish (Platysoma sp. SR (0-10 hari) 83. masa inkubasi . Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias.31% dan menghasilkan larva normal sebanyak 218 ekor.

budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah. Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks.1630 g dan dua ekor induk jantan yang berukuran panjang 1. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air.0488–0. oocyt . Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi. Udang diberi pakan berupa moina beku sekali dalam setiap hari.9 cm dengan bobot 0. dipelihara selama 6 bulan. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2. dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32.0518 g.5 cm dengan bobot 0. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai.725 pg/mL. murah dan aplikatif. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A). Rina Hirnawati.3–2. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka.042 pg/mL. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. KATA KUNCI: Neocaridina heteropoda. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungaisungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya.1272–0. LHRH 100 mg dan testosteron 50 mg (B). Pada ikan yang baru di domestikasi. Tutik Kadarini. matang gonad. KATA KUNCI: induk. Kepadatan 10 ekor induk dengan bobot 65–600 g. dan Darti Satyani Balai Riset Budidaya Ikan Hias. implantasi.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana. sedang induk jantan belum ada yang mengandung sperma. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor. hormon.7–1. panjang 40– 60 cm. Asep Permana. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya). Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. Rendy Ginanjar. LHRH 50 mg dan testosteron 50 mg (C).

KEYWORDS: honey. The result showed that the percentage of male guppy at 50 mL/ L is 64. The research was conducted experimental with completely randomized design. and 75 mL/L. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method. male. guppy fish . The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control). but between treatments not significant different. the alternative masculinization application of natural substance like honey. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp. as the curative effort is not applicable.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. Therefore. Based on LSD test. yeast (30–800 mg/kg) dan sumber lainnya. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. 25 mL/L. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. carotenoid.000-4. because of residual effects to human caused cancer. The observation to sexual secondary characteristic guppy can be observed at least two months old.71%. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. KATA KUNCI: bunga tai kotok. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0.07 ± 9.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias. The proportions test showed dose 50 mL/L have significant different to control. the treatments gave significant different with control. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian.000 mg/kg). kemudian dipisahkan antara tangkai dan kelopaknya. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan.6%). suhu. The concluded that the optimum dose to produce male guppy is 50 mL/L.05 significant level. chrysin. Honey is a natural substance which have crysin. 50 mL/L. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias.

tepung rumput laut.837 butir/ekor. KATA KUNCI: Siganus guttatus. Peubah biologis yang diamati meliputi: jumlah induk memijah. diameter telur. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama. diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%. 1:3 (B&:@&). daya tetas telur FF 70 SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut. jumlah telur 227.5 m x 1. Maros ABSTRAK Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang. S. B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%.5 m x 1. guttatus . Siganus guttatus Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0. jumlah telur 129. Induk dipelihara dalam 8 buah bak berukuran 1. dan 2:1(B&:@&).945–350.4 g dengan padat tebar 15 ekor/keramba. jumlah telur 272. KATA KUNCI: tepung ikan.pada induk beronang.333 butir/ekor. Maros ABSTRAK Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. rasio (1:2) jumlah induk memijah 30 ekor. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). pakan ikan beronang.0 m dengan kepadatan 24 ekor/bak. Pada awal percobaan.05) dengan rasio efisiensi proteinnya. Lama penelitian berlangsung selama 6 bulan. jumlah telur 237. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap.140 butir/ekor. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor.975 butir/ekor.Forum Inovasi Teknologi Akuakultur 2010 FF 69 PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau. semua induk secara individu dalam keadaan TKG=O. Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. jumlah telur. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22. diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor.05±6. jumlah telur. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. pemijahan. substitusi. rasio (1:3) jumlah induk memijah 35 ekor. dan daya tetas telur. diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%. diameter telur.865–335. 1:2 (B&:@&). Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&).837–344.534–393.

6%) dengan rasio DHA/EPA hanya 0. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. oculata 13.n pengapuran sebanyak 175 kg/petak. Pemadatan (flokulasi) N. Karawang. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Idil Ardi. yaitu pertambahan berat rata-rata 230 g.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. salinitas rendah.3–8. Setelah dua hari. oculata relatif rendah (3. produksi 78. Penelitian ini dilakukan pada tambak di daerah Betok Mati.1 kg dan sintasan 11. pada bulan pertama udang tidak diberi pakan. dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. Sebelum penebaran. Dari pemeliharaan udang selama tiga bulan. Dengan teknologi yang diterapkan. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. penebaran dilakukan setelah satu bulan dari penebaran tokolan. Tingkat total ammonium terlarut dalam air laut produksi masal N.04 juta sel/mL dan rotifer 186±5. dan Wartono Hadie Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. produksi 81. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. 427.2. sedangkan pada dua bulan berikutnya diberi pakan pelet udang. dilakukan pengolahan tanah tambak. kemudian dikeringkan sekitar satu minggu.8 kg dan kelangsungan hidup 100%. Pemeliharaan dilakukan selama tiga bulan.1±0. Empat petak tambak masing-masing berukuran 3. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1.5–50 m3 dengan rata-rata kepadatan akhir N.5 g. oculata relatif tinggi (4. oculata dengan NaOH dosis 75. dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368.500 m2 digunakan untuk percobaan. Karawang FF 72 PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut. yaitu menggunakan tingkat teknologi tradisional plus. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Kecamatan Cilebar. Nannochloropsis oculata. tokolan. semi-continuous system .2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. KATA KUNCI: udang windu. Gondol ABSTRAK Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. KATA KUNCI: pakan alami. rotifer Brachionus rotundiformis. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34.Forum Inovasi Teknologi Akuakultur 2010 FF 71 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. 100.2%. marine chlorella.

Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19.3 ± 10.00). Wadah penelitian yang digunakan adalah jaring berukuran 1.67 cm/ ekor dan bobot 155. Siganus guttatus FF 74 ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA Lies Emmawati Hadie Pusat Riset Perikanan Budidaya. plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. Permasalahan ini perlu dipikirkan solusinya. dan 17. (B) 9%. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). dan 13% dalam pakan berpengaruh tidak nyata (P<0. Maros ABSTRAK Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi.0 m x 2. Padahal dalam upaya peningkatan produktivitas perikanan budidaya. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. ikan langka.00. masingmasing terdiri atas 3 ulangan. 11. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia. Hasil penelitian menunjukkan bahwa kadar lemak 5%. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. suhu dipermukaan bumi akan turun secara drastis. ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. KATA KUNCI: kadar lemak. sintasan. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global. Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. pertumbuhan. karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. yang ditempatkan pada keramba jaring apung di laut. konservasi .79 g/ekor. 9%. budidaya.0 m x 1.0 m. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%. Pemberian pakan dilakukan 3 kali/hari (pukul 08. KATA KUNCI: pemuliaan.2 ± 0. dan (C) 13%.05) terhadap pertumbuhan dan sintasan ikan beronang. juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Jika tidak ada efek rumah kaca.Forum Inovasi Teknologi Akuakultur 2010 FF 73 PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus) Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau. Jakarta ABSTRAK Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi.00.

fosfat. 98% terinfeksi parasit. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. Akhmad Mustafa. dan besi. Trematoda). perairan Kalukku. (metacercaria. Synodontis. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. dan Tanjung Dapuran.Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009.18 ha yang terdiri dari sangat sesuai seluas 133. 2009. kapiat albino. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. nitrat. Kualitas air perairan yang diukur adalah: pH. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. KATA KUNCI: kesesuaian lahan. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. Sampel ikan hias antara lain dari golongan cyprinidae. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. kedalaman. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. Gyrodatylus spp. (Copepoda) dan Centrocestus sp. salinitas. KATA KUNCI: ikan hias air tawar. cukup sesuai 512. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. dan Dactylogyrus spp. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. (Dinoflagelata). Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. Oleh karena itu. Pulau Bekengkeng.59 ha. sympilum dan Characidae. keramba jaring apung. (Monogenea). penyakit.18 ha. Argulus sp. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. perairan Papalan. sirip. Red Fin Albino. mas koki. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. parasit . budidaya laut. Chiclidae. dan platydoras. neon tetra. dan insang. cat fish. dan Ichthyophthirius multifiliis (Ciliata). Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember.41 ha dan kurang sesuai 52. Trichodina sp. kecerahan. kecepatan arus. arah arus. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. Pulau Kambunong. Dari Sampel yang diperiksa 33.

identifikasi dan analisis data serta pelaporan. batas daerah bahaya. residu . pencemaran. dan Zn dalam air dan daging ikan. muara Sungai Citarum.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. sedimen (lumpur/tanah). Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. preparasi. serta debit air dari muara sungai yang masuk ke perairan waduk. zona 2 Purwakarta. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5.98 ton/bulan. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. Piretroid. Cd. pengambilan contoh. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. Organofosfat. inlet. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. Perairan Waduk Cirata sudah tercemar oleh parameter Zn. Tahapan penelitian meliputi: penentuan lokasi. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. pestisida. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. muara Sungai Cisokan. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. badan air Sungai Citarum dan Sungai Cimeta. KATA KUNCI: lahan perikanan budidaya. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. Contoh yang diambil berupa air. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. Cd. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS. KATA KUNCI: logam berat. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42.86 ton/bulan. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. Variabel yang diamati adalah konsentrasi kandungan Pb.8214 ton/bulan dan 1. CD. dan Karbamat. Cd.88 mg/L/kg daging ikan.

Ciputri.marmorata. dan nilai kemerataan (E) = 0. dan sebanyak 150 ekor disimpan dalam alkohol absolut. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. dan Protozoa. A. fitoplankton. indeks dominansi (C) = 0. dikelompokan pada jenis A. KATA KUNCI: komunitas. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton.71–19. Pelabuhan Ratu.) DI PERAIRAN SUNGAI CIMANDIRI. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR./L dan zooplankton berkisar antara 93. dan Cadas Bodas. Bacillariophyceae. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393.17-9. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae.75 ind.12–3.5 ind. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa. Palumbon. Sungai Cimandiri. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi./L. Sukabumi. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies. (13. A.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. Cyanophyceae. pada region mitokondria 16SRNA.31. Dinophyceae.072–0. Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. bicolor bicolor.7) dikelompokan jenis A.33.n. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri. dan 4–6 m. Copepoda.65–0.marmorata dan (4. Patok Batas. A. Maleber.75–4887. PELABUHAN RATU.52) dikelompokan pada jenis A. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur.35). KATA KUNCI: Glass eel. selanjutnya digunakan untuk analisa genetik. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu.83.nebulosa .75– 993. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias. 2–4. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. bicolor. nebulosa. dan Desmiceae dari zooplankton ditemukan jenis Rotifer. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat.

Osteochilus hasselti. dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut. 21. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan. KATA KUNCI: larva ikan kuwe. 25. Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan. Dinar Tri Soelistyowati**). terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. B. Gondol **) Mahasiswa Universitas Gadjah Mada. pakan awal. 27. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). kuning telur) dan 3 ulangan. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10.01 mm. KATA KUNCI: ikan nilem. selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30).99 mm. Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata. dan 21. dan C. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin). Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra. sirip dada (pectoral fin).10 g. Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan. rotifer.27 mm. Pemberian pakan awal di mulai saat larva berumur D-2—D-10. Titiek Aslianti*). dan sirip anal (anal fin)..dan inter-populasi ikan nilem di Jawa Barat. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat.97%) dibanding perlakuan A (10. Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL). selanjutnya secara periodik 5 hari sampai dengan D-30. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. gonad kerang. Jogjakarta ABSTRAK Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. pola pemangsaan FF 82 KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT Mulyasari*).94 g.20 g.17%). Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya ABSTRAK Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. meristik . namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.Forum Inovasi Teknologi Akuakultur 2010 FF 81 POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN Afifah*). adalah dengan program pemuliaan. dan 1790%) dan C (11. sirip perut (ventral fin). dan 17.

Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%. protein.-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6. Balai Riset Perikanan Budidaya Air Tawar. Bogor ABSTRAK Pakan memegang peranan penting dalam budidaya ikan nilem. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari.000. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan.-–Rp 7. Ikan dipelihara selama 40 hari.Forum Inovasi Teknologi Akuakultur 2010 FF 83 EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. Metode penelitian dilakukan secara studi kasus.56%. pakan buatan. 19%.0±0. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. konversi pakan.-–Rp 3.05) yaitu sebesar 1.000. Jakarta ABSTRAK Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009.05). Harga pakan hanya Rp 2.500. serta sintasan ikan. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya.800. KATA KUNCI: nilem. Bogor. Penelitian dilakukan di Kabupaten Brebes dan Batang. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. KABUPATEN BATANG) Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. pakan FF 84 EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI. Parameter yang diamati yaitu pertumbuhan spesifik. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. pertumbuhan. KATA KUNCI: efisiensi usaha. ikan patin . Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0. Ikan uji yang digunakan adalah ikan nilem dengan bobot ratarata 5. bahan baku lokal.3 g/ekor.-/kg. dan 20%.

6±0. KATA KUNCI: warna.06. sintasan FF 86 KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON Gleni Hasan Huwoyon. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. Irin Iriana Kusmini. Irwan Setiadi. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. genetika .Forum Inovasi Teknologi Akuakultur 2010 FF 85 PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN Jhon Harianto Hutapea.8±1.02).1 m dan tinggi 0. KATA KUNCI: penanganan calon induk. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari. ikan tuna sirip kuning.4 m dengan panjang 2. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis.57±0. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir. Gunawan.7 m.1±0. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut. Barbonymus schwanenfeldii. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). pertumbuhan mutlak (merah: 6.30) dan laju pertumbuhan spesifik (merah: 0.7±0. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2. dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi. Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk. Pada beberapa jenis ikan. Bogor ABSTRAK Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. tengadak.02. Gondol ABSTRAK Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg). Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari.20). hitam: 5.1 m3 (lebar 1.65±0. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2. hitam: 0.5 m3 (diameter 2 m dan tinggi 0. Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut.8 m) dan bak fiberglass berbentuk oval volume 2.19. hitam: 1.

08% khamir laut. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia).00% khamir laut. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. dan energi di antara perlakuan berbeda nyata (P<0.5% molasses + 0.5% molasses + 0. Setelah 5 hari dipanen.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl.05).5% molasses + 0. Hasil penelitian menunjukkan bahwa: pH. KATA KUNCI: khamir laut. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2.04% khamir laut. dan abu di antara perlakuan tidak berbeda nyata (P>0. R4 = Daun mengkudu + 2. gula. pupuk . dan TSP. lemak kasar. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu. Berdasarkan hasil penelitian.5% molasses + 0.5% molasses + 0. bahan kering.02% khamir laut. Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau. Setelah kering. E = Daun mengkudu + 2. silase. serat kasar. BETN. R3 = Daun mengkudu + 2. Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator. protein kasar. urea.06% khamir laut.05). Jepara. B = Daun mengkudu + 2.01). sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan. daun mengkudu.

48 kg/ha.000 ind. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10./ha) dan petak II : bandeng (3. Brata Pantjara. di mana termasuk cara budidaya udang. rumput laut. MY1112 bulan II. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen.46% dengan produksi udang windu sebesar 249.000 ekor/ha) dan rumput laut (1 ton/ha). Erfan Andi Hendradjat. ditebari bandeng (10. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu. penggunaan sarana produksi yang ramah lingkungan. tambak marjinal .73% dengan produksi sebesar 217.1 ton/ha/16 mg menjadi 1. KATA KUNCI: udang windu. BL542 bulan III. KABUPATEN TAKALAR Muharijadi Atmomarsono.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA.000. CBIB. petak I ditebari bandeng (10. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I.07. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik. bandeng (3.000 ekor/ha).000 ind/ha) dan petak II.977. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara. rumput laut (2 ton/ha) dan tiram (20. Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I.000 ekor/ha. rumput laut (2 ton/ha) dan tiram (40.000 ekor/ha) dan rumput laut (1 ton/ha).5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar. udang windu. Sulawesi Selatan. Perlakuan B. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40.-/musim tanam dengan B/C rasio 2. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau. KATA KUNCI: biofilter.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59. Pada akhir penelitian diperoleh sintasan 63. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. serta manajemen pakan dan air secara benar.000 ekor/ha). dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal.

NO2. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2.35% dan 448. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. PO4. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan NH3 selama penelitian relatif lebih tinggi pada perlakuan yang tidak menggunakan probiotik dengan dosis pakan 100%. air laut salinitas 28 ppt sebanyak 15 L.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. (C2) probiotik komersial dengan dosis pakan 50%. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%. Nurbaya. B) Pergiliran probiotik BT951 bulan I. NH3. terutama salinitas yang mencapai 56 ppt. BL542 bulan III. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. Penelitian dilaksanakan selama 90 hari. KATA KUNCI: probiotic bacteria. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial.7 kg/ha/90 hari). sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0. dan C) Kontrol (tanpa probiotik). total bakteri. Penelitian dilakukan di laboratorium basah. Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. Pengamatan sintasan udang windu dilakukan pada akhir penelitian. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak.05% dan 298.7 kg/ha/90 hari). Sintasan udang windu tertinggi didapatkan pada perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60. Balai Riset Perikanan Budidaya Air Payau.8% dan 228. KATA KUNCI: probiotik. Nurbaya. tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masing-masing 3 kali dan lama pemeliharaan 10 minggu. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. Hasil penelitian menunjukkan. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. (D2) kontrol 2. dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. Muliani. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. NO3. kandungan BOT di atas 30 mg/L. Oleh karena itu. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah. diikuti perlakuan kombinasi probiotik A (50. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. Maros. dosis pakan. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. sintasan. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11. survival rate.11%. dan total Vibrio. production. MY1112 bulan II. udang windu . (C1) probiotik komersial dengan dosis pakan 100%.7 kg/ha/90 hari).05) pada akhir penelitian.

produksi . sintasan. KATA KUNCI: multitropik. kesehatan. Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari.9 kg dan secara finansial memberikan keuntungan sebesar Rp 11.0%. Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). udang windu. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.4 ha. produksi. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha).572. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok. rumput laut dan ikan bandeng adalah perlakuan B (10.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1. Tjaronge.7 kg. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak.8% dan 63.000 ekor/ha (1 ekor/m2). Selama pemeliharan tidak diberi pakan. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. Sintasan dan produksi udang windu dan ikan bandeng masingmasing adalah 66. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau. Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha). baik pada air maupun pada dasar tanah tambak. dan pertumbuhan udang serta aman bagi konsumen. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13. dan kontrol (tanpa aplikasi probiotik). Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. Oleh karena itu.masing-masing dengan dua kali ulangan. ikan bandeng. M. namun belum mampu menurunkan kandungan amoniak dalam media budidaya.000 ek/ha bandeng) menunjukkan hasil yang terbaik.000.-/ha /90 hari. Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari. Tokolan udang windu (PL.500 m2 dengan kedalaman 80 cm. Sampling dilakukan 30 hari sekali selama 90 hari. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. rumput laut. serta 99. masing-masing terdiri atas 2 ulangan. Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu. yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak.9% dan 33.000 ekor/ha). KATA KUNCI: probiotik.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana.5% dengan produksi 19. 31) yang ditebar pada masing-masing tambak adalah 10. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81. Maros selama 90 Hari.

KATA KUNCI: ekspresi. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. Ketika ditantang dengan WSSV. Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia. Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. 1 hari. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR.1%) serta tanpa transfeksi (49. Bunga Rante Tampangallo. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. 12 jam. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). Selain itu. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. 4 hari. gen anti virus. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. Sukenda**). Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. EGFP. Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi.3% dan tidak berbeda nyata (P>0. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. 3 hari. Aan Fibro Widodo.0%). danAndi Tenriulo*) **) **) Balai Riset Perikanan Budidaya Air Payau. Syarifuddin Tonnek.Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. KATA KUNCI: promoter. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. udang windu . Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. ekspresi gen. Fakultas Perikanan dan Ilmu Kelautan. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. uji tantang. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. Komar Sumantadinata**). IPB. Promoter dikatakan aktif apabila gen penanda dapat terekspresi. Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. Maros Departemen Budidaya Perairan. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39.05) dibandingkan dengan kontrol. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. gen PmAV menunjukkan respons meningkat (up-regulation). Alimuddin**). udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. yang sampai saat ini belum bisa diatasi secara secara tuntas. 2 hari. transfeksi.

serta berpeluang untuk digunakan secara langsung di lapangan. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. antibodi monoklonal . KATA KUNCI: White Spot Syndrom Virus (WSSV). pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. dan disertai ulserasi lapisan mukosa epitel. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). Nurhidayah. karena relatif mudah dan murah. Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. White Spot Syndrome Virus (WSSV). khususnya ELISA. monodon dengan melihat gejala klinis dan studi histopatologi. Antibodi monoklonal memiliki kespesifikan yang tinggi. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. Teknik serologi. Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. Pewarnaan jaringan menggunakan Hematoxilin eosin. Penelitian dilakukan untuk membuat. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. Setelah pengujian. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. cepat dan akurat. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. menyeleksi. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. KATA KUNCI: ELISA. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. serta epidemi penyakit di lapangan.

Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.05) dengan perlakuan A (1. Selama pemeliharan 85 hari.085±0.120).257±0. KATA KUNCI: udang vaname. benur.7 m sebanyak 9 buah.258). Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau.05) terhadap pertumbuhan. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11. feed. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%. namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0.31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya. produksi (1831. Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12). Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6. sintasan (90. sintasan.096±0. RKP pada pembesaran udang vaname teknologi intensif. namun terbatas pada golongan masyarakat menengah keatas (padat modal). dan kepadatan benur dan tokolan adalah 50 ekor/m2. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1.18235 mg/L) dibandingkan dengan perlakuan A (0.83±8.234).masing-masing perlakuan diulang tiga kali. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0..034) berbeda nyata (P<0. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak.102 CFU/mL.0±149.51).114±0. KATA KUNCI: growth. Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). produksi (2087. Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan. rasio konversi pakan dan produksi udang vaname. tokolan. Riset ini dilaksanakan di tambak Punaga. Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah.45 g/ekor dan ditebar kepadatan 100 ekor/bak.5±88. Takalar.0328 mg/L) pada akhir penelitian. dan pemeliharaan berlangsung 80 hari di tambak.000 m2/petak. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei).549±0. menggunakan 4 petak masing masing berukuran 4. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari. dan (B) pembesaran dengan tebar tokolan (PL 27). Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10.9). kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0. and L vannamei .048). survival rate. Instalasi BRPBAP. Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei). budidaya udang intensif. sintasan. Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi. Budidaya ini berkembang dengan teknologi intensif. karena berpengaruh terhadap pertumbuhan. 829.Setiap perlakuan dengan 2 ulangan. sintasan ( 92. dan efisiensi biaya produksi.

00. dan pH 8. 11. jumlah konsumsi pakan (JKP).1% dan 65.464 mg/kg tubuh/jam. namun kurang diimbangi dengan penyediaan pakan yang sesuai.7%.05) terhadap pertambahan berat mutlak.69%. dan E atau komersial (protein 40.2%. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4.4%. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0. Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media. 15.39%.INTENSIF DI TAMBAK Abdul Mansyur. kecernaan total dan kecernaan protein masingmasing 26. suhu 28°C–30°C. konversi pakan (FCR). FCR 1. dan 23.5 g/ekor dengan kepadatan 10 ekor per akuarium. retensi protein (RP). Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13.0–8. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.1 g. B (protein 31%.8 kkal GE/g). kecernaan protein. Litopenaeus vannamei . Sintasan antara 73.2% serta WS berkisar antara 49. Bogor Departemen Budidaya Perairan. rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi .4. pertumbuhan relatif (PR). sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya. sedangkan ekskresi amonia antara 1. pertumbuhan. K ATA KUNCI: protein optimal.9%–68. retensi lemak (RL). salinitas 24–25 ppt.2 kkal GE/g).8% dan 11. Agus Suprayudi**).4%–94. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan. 19. C/P rasio 13. C (protein 33%.9%–79.029–2. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum. 5 kali sehari pada pukul 07.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu. produksi.5%–36. C/P rasio 11. Litopenaeus vannamei Deisi Heptarina*). Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB). PR 532.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2.00. Hidayat Suryanto Suwoyo.5 kkal GE/g). Fakultas Perikanan dan Ilmu Kelautan. Namun. Bobot yuwana yang ditebar rata-rata 0.1 kkal GE/g). yuwana. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon). Perlakuan terdiri atas pakan A (protein 29%. Kisaran nilai masing-masing parameter tersebut adalah. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0. Pakan diberikan at satiation. C/ P rasio 16. C/P rasio 14.4–2. D (protein 35%.3%–86. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI . dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). Jakarta Utara.7%–1130. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an.5.6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik. Selama pemeliharaan.5%–62. RL dan RP masing-masing 26. sintasan.intensif. Kemudian dilanjutkan uji kecernaan. M.00. sintasan.000 m2.5%. Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%.00.05). laju pertumbuhan harian. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH. fotoperiod dibuat 12 jam terang–gelap. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7. ekskresi amonia dan stabilitas pakan. Penelitian dilakukan di tambak percobaan Punaga Takalar.71%–22. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname. C/P rasio 15.00.05).2–78. Ing Mokoginta**) dan Dedy Yaniharto***) *) **) Balai Riset Perikanan Tawar. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan. JKP 59.6 kkal GE/g). kecernaan total.

hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. Untuk mengetahui jenis virus yang menyerang udang tersebut maka. PGM. WSSV. Taura Syndrome Virus. toleran. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. IMNV dan PvNV . Namun demikian. TSV. dan moribund. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . KATA KUNCI: enzim. Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. and SP) pada udang yang sehat. EST. KATA KUNCI: Litopenaeus vannamei. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. L. EST. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. MBV. Haryanti*). SOD. protein haemolimph dan ekspresi enzim (GPI. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). SOD. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. dan Rustidja**) *) **) Balai Besar Riset Perikanan Budiaya Laut. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. dan SP. Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. Lila Gardenia.Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. SPF. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. belum dapat diyakinkan secara pasti bahwa ekspresi EST. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). toleran dan terinfeksi TSV. SOD. Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. dan SP mampu berdiri sendiri. IHHNV. toleran. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. Gondol Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terus-menerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). Semua gejala tersebut diduga akibat adanya serangan virus. SOD. PGM.

C) 2J : 2 B. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro. Namun demikian. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA).5%. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji. pertumbuhan. pendederan I. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. dan 9.42 mm. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. pendederan II. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 6.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. Musi. pemijahan. Asahan. Penelitian dilakukan dengan rancangan acak lengkap. dan D. beserta persilangannya. Imron. yang meliputi pertambahan panjang dan bobot. dan 13%. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. B. 2%. khususnya rasio jantan-betina. B) 1 J : 2 B. yang dilakukan selama 5 bulan. C. berdasarkan nilai heterosis yang didapat. diikuti perlakuan D. Sebagai perlakuan adalah rasio jantan-betina. dan tidak berbeda nyata antar perlakuan. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0.25 m2/ekor induk. 0. dan D) 2 J : 4 B. 25%. 0. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Romy Suprapto. KATA KUNCI: genetik. persilangan.21 g. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah.5% berturut-turut untuk perlakuan A. dengan lama pengujian 8 minggu.27 mm. yaitu 0%. diberikan pada pagi dan sore. reproduksi. Ciasem.31 mm. KATA KUNCI: mortalitas.20 g. 0. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. dengan sistem resirkulasi. berturut-turut 0. dan 0. rasio kelamin. Penelitian meliputi pembenihan. berturut-turut 27%. Barito. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. dan pembesaran. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. A dan B. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. udang galah . 0. Pada sistem tersebut kematian induk relatif rendah.25 g. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%.

Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya. Hasil penelitian menunjukkan bahwa pada karakter sintasan.5 x 103). yaitu A. B (perendaman dalam larutan formalin 250 mg/L).93.4 x 103 cfu/mL) .93. dan D. 45. 52. crossbreeding. tanpa penambahan desinfektan). 37. keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*).4 mm) dan populasi inbreeding (21.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. **) Jurusan Budidaya.5±28.7 mm) diikuti oleh populasi hasil outbreeding (21. Hewan uji yang digunakan adalah larva udang galah umur dua hari.0±1. outbreeding. Sukamandi. yaitu inbreeding.8±1. Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi. desinfektan. formalin. KATA KUNCI: bawang putih. (0 cfu/mL). Perlakuan yang diberikan yaitu A (kontrol. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C.83% dan 3. KATA KUNCI: inbreeding. Harry Wuwungan**). keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24. Tiga tipe persilangan.92. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan.05) terhadap kelimpahan bakteri. 4. Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰.8±7. dengan nilai sebagai berikut: A.0%).5% dan 3. Dinar Soelistyawati**). dan D (perendaman dalam larutan ekstrak bawang putih). Fakultas Perikanan dan Ilmu Kelautan. larva udang galah. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah.6±21. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. (0 cfu/mL). Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan. sirih.5%.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan. namun tidak berbeda nyata (P>0. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan budidaya dapat dioptimalkan. dan D. . Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan.4%) diikuti oleh populasi hasil crossbreeding (57.00% dan 3. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74. merupakan langkah bio-security. (8. Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0. Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan. 47.0. Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan. B. Pada karakter pertumbuhan.4 mm). sintasan (SR) dan perkembangan larva (LSI).0%) dan populasi inbreeding (25. B. C. (4. C. C (perendaman dalam larutan ekstrak daun sirih).8±1.

Forum Inovasi Teknologi Akuakultur 2010

K 21
Eni Kusrini*), Lies Emmawati**), dan Wartono Hadie**)

Balai Riset Budidaya Perikanan Ikan Hias, Depok

Pusat Riset Perikanan Budidaya, Jakarta

Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang), Pelabuhan Ratu, dan Bone. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air,Karawang dengan Pelabuhan Ratu lebih dekat. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu.
KATA KUNCI: udang galah, populasi, jarak genetik

K 22
Muslimin, Sulaeman, Andi Tenriulo, dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau, Maros

Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. semisucatus) dengan kepadatan berbeda. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau, Maros dengan panjang awal mysis adalah 100-190 milimikron. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm, diameter 15 cm dan Volume 3 L. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm, lebar 40 cm, dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut, maka ditambahkan pemanas/heater suhu 30°C. Hewan uji ini ditebar dengan kepadatan berbeda. Perlakuan yang diujicobakan adalah: A. Kepadatan larva 25 ekor/L; B. Kepadatan larva 50 ekor/L; C. Kepadatan larva 75 ekor/L; D. Kepadatan larva 100 ekor/L; E. Kepadatan larva 125 ekor/L; dan F. Kepadatan larva 150 ekor/L. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap, di mana masing-masing perlakuan di ulang tiga kali. Jenis pakan yang diberikan berupa pakan alami chetoceros, artemia, dan pakan buatan. Pemberian pakan dilakukan setiap pagi dan sore (08.00 dan 16.00 wita). Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0,05) terhadap laju sintasan dan pertumbuhan larva udang pama. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%, (B) 32%, (C) 31%, (E) 24%, (D) 16%, dan (F) 10%.
KATA KUNCI: kepadatan, larva udang pama, sintasan dan pertumbuhan

Forum Inovasi Teknologi Akuakultur 2010

K 23
Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1.446–6.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan. Wadah percobaan yang digunakan adalah bentik jar (chamber), yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. Oksigen terlarut diukur dengan alat pengukur O2 (TPSTM Model WP-82 DO meters). Data laju respirasi selama proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. Ver.1.2. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan, dengan kisaran tingkat konsumsi oksigen 0,26–7,27 mg/g/jam. Kisaran kelarutan oksigen pada awal penelitian adalah 3,14–7,9 mg/L dan setelah 1 jam pengukuran 0,03–0,48 mg/L dan kontrol tetap berkisar 4 mg/L. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4,0235 g adalah 15,65 g/m3.
KATA KUNCI: udang pama, padat tebar, estimasi

K 24
Sulaeman, Aan Fibro Widodo, dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau, Maros

Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan, akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP), BRPBAP, Maros. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0,18±0,03 g, panjang karapas 4,6±0,1 mm dan lebar karapas 5,9±0,1 mm. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar); B (metode gantung); dan C (gabungan antara keduanya). Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0,05) terhadap pertumbuhan bobot mutlak, bobot harian, pertumbuhan panjang dan lebar karapas mutlak dan harian, tetapi berpengaruh nyata (P<0,05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66,96 %; 58,17 kg/250 m2, disusul perlakuan C: 64,06; 44,95 kg/250 m2 dan terendah pada perlakuan B: 60,58%; 40,52 kg/250 m2.
KATA KUNCI: kepiting bakau, metode sebar, polikultur, rumput laut

Forum Inovasi Teknologi Akuakultur 2010

K 25
Aan Fibro Widodo, Sulaeman, dan Muslimin Balai Riset Perikanan Budidaya Air Payau, Maros

Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp.). Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros, Sulawesi Selatan. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau, yaitu: A (625 ind./mL); B (500 ind./mL); C (375 ind./mL); D (250 ind./mL); dan E (125 ind./mL). Peubah yang diamati adalah laju pemangsaan, sintasan, dan peubah kualitas air. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0,05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. Hasil terbaik diperoleh pada perlakuan A, yaitu kepadatan rotifera 625 ind./mL dengan laju pemangsaan sebesar 259,1667 ind./larva/jam dan sintasan 86,0%.
KATA KUNCI: kepadatan, kepiting bakau, laju pemangsaan, rotifera, zoea

K 26
Supono Budidaya Perairan Universitas Lampung

Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Karena hidup di dasar tambak, jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang, yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang. Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. Selain diatom epipelic, data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0,75), TOM (rs = 0,71), dan nitrat (rs = 0,66), sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0,72), kandungan liat (rs = 0,65), dan kandungan bahan organik (rs = 0,62).
KATA KUNCI: diatom epipelic, tambak udang, kualitas air, kualitas sedimen

Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci.6±10. dan panjang total tiap individu. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. KATA KUNCI: Cherax quadricarinatus. dan Tulung Agung). Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6.72). Gleni Hasan Huwoyon. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda. Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan.74) dan panjang (7. dan panjang total). sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2. Dianalisis dengan Rancangan Acak Lengkap (RAL). dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. Pertambahan bobot (71. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. benih.6-7. panjang standar. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot.0±0.Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini. simpangan baku. pertumbuhan. lokasi .9 g. Bogor. ragam.47) terbaik adalah benih lobster air tawar asal Tangerang. panjang standar.9±9. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang.6-71. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar.0 cm dan adanya pertambahan bobot sebesar 58. namun kemampuan produksi para pembudidaya hanya sampai 4 inci.

(B) Ulva sp.0 ± 0. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41. (7. masing-masing 58.39 g.06 g.73±2.9 ± 1.44 µm dan 65.59±2.56 ± 48.. B. cottonii : 40. Ulva.37 mm. I Nyoman Adiasmara Giri. (D) Kombinasi Gracilaria sp.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria.92 g dan 219. KATA KUNCI: Haliotis squamata. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir.39 mm dan 10. Riani Rahmawati.17 ± 25.80 sampai 31.05) antar perlakuan.17 ± 2. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga. pakan (B)= E. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali. aplikasi teknologi pembesaran . Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto.854.23 g dan 121..68 µg/hari).44 µg serta 92. dan C berturut-turut adalah 120.39 m x 0.05 mm dan 10.26 ± 10. Riani Rahmawati.1 ± 4.89 µm dan 38.00 µm dan 38.73 g. pakan (B) dengan R² = 0. (rasio 1:1:1). Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp. Sargassum.44 µg. Gracilaria.31 m. dan kombinasi keduanya. + Ulva sp. Ibnu Rusdi.99 mm dan 36. dan pakan (C) dengan R² = 0. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0.44 ± 102. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir. (C) Sargassum sp. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0. (13. sangat sesuai dalam memacu pematangan gonad induk abalon H. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang. Bambang Susanto. + Ulva sp.06 ± 170. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30. (P<0. KATA KUNCI: abalon Haliotis squamata. dan Sargassum sp..19 ± 6.05). + Sargassum sp. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A.613.891. + Ulva sp.44 µg. 38.50 g dan 217.52 µg/hari) dan terendah pemberian pakan Sargassum sp. + Sargassum sp. cottonii 37. cottoni. kombinasi Gracilaria sp. Ulva sp. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi.16 g dan -86.02 g. Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp.58 m x 0. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit.18 mm dan 7. + Sargassum sp. yaitu: (A) Gracilaria sp.06 µg/hari).82 µg/hari). yaitu pada perlakuan pemberian pakan Gracilaria sp. 73. squamata. lebar dan bobot cangkang. E. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut. serta pakan (C)= kombinasi Gracilaria + E. (-5. (13. dilakukan dengan menerapkan 4 perlakuan pemberian pakan. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON.03 ± 1. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon.

offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. Tatam Sutarmat. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri.13) lebih tinggi dibandingkan dengan induk asal Bali (0. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. Est-4* dan Cah-3*. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal.06). dengan bobot awal 2. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. mengingat permintaannya yang cukup tinggi. Nilai variasi genetik induk abalone asal Banten (0. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya.52. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. Est-1*. Pakan dengan proporsi Gracilaria sp. dengan proporsi yang berbeda Gracilaria sp. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %.6-3. pembesaran. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. dan Ulva sp. Kepadatan awal benih abalon adalah 450 ekor per wadah. KATA KUNCI: allozyme. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin. Setiap perlakuan terdiri atas 2 ulangan. dan 60/40% (C) sebagai perlakuan./Ulva sp. 60/40% memberikan pertumbuhan abalon terbaik. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. Gondol. Gpi*./Ulva sp. penjarangan . Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. dan Ulva sp.2 g dan panjang cangkang 2. Sampel yang digunakan berasal dari Bali dan Banten. Hirmawan Tirta Yudha. Untuk itu.7 cm. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. proporsi pakan. KATA KUNCI: abalon Haliotis squamata. genetic monitoring. 80/20% (B). peluang pasar serta teknik budidayanya yang sederhana. Est-3*. 100/0% (A). wild. Ibnu Rusdi. tinggi 22 cm. Est-2*. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. Abalon diberi pakan rumput laut Gracilaria sp.

Forum Inovasi Teknologi Akuakultur 2010

M 05
Zafran, Indah Mastuti, dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut, Gondol

Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. Karena itu, tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut, Gondol, Bali. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar, yaitu media spesifik untuk bakteri Vibrio. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0,05 µm). Setiap perlakuan diulang 3 kali. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1, isolat-2, dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13,33%; 18,33%; dan 21,67%; sedangkan mortalitas pada kelompok kontrol hanya 3,33%.
KATA KUNCI: abalon, Haliotis squamata, vibriosis, Vibrio cincinnatiensis, uji patogenisitas

M 06
Sudewi, Apri I. Supii, dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut, Gondol

Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan. Namun, masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan. Perlakuan yang diberikan adalah ukuran tebar 3,44±0,44 mm (perlakuan A); 10,85±0,1 mm (perlakuan B); dan 20,36±0,55 mm (perlakuan C). Parameter yang diamati adalah laju pertumbuhan harian dan sintasan. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0,44±0,01 mm/hari (perlakuan A); 0,46±0,03 mm/hari (perlakuan B) dan 0,30±0,01 mm/hari (perlakuan C). Laju pertumbuhan lebar cangkang 0,37±0,01 mm/hari (perlakuan A); 0,4±0,03 mm/hari (perlakuan B) dan 0,27±0,00 mm/hari (perlakuan C). Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0,05) dibandingkan dengan perlakuan C. Sintasan yang diperoleh untuk perlakuan A, B, dan C berturut-turut 37,16%; 71,69%; dan 46,42%. Oleh karena itu, untuk memperoleh pertumbuhan dan sintasan yang baik, penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm.
KATA KUNCI: Pinctada maxima, pertumbuhan, sintasan, ukuran awal spat

Forum Inovasi Teknologi Akuakultur 2010

M 07
Apri I. Supii*), Ida Ayu Astarini**), dan Sudewi*)

Balai Besar Riset Perikanan Budidaya Laut, Gondol

Fakultas MIPA Universitas Udayana

Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan, pada tingkat nasional, regional maupun lokal. Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Berdasarkan hasil pengkajian, secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari, Sumber Sari, Teluk Awen, dan Teluk Rabu. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara, akan tetapi jika diinginkan, budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. Pantai Pengambengan khususnya, tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai.
KATA KUNCI: potensi kelautan, tiram mutiara, Pinctada maxima, Jembrana

Forum Inovasi Teknologi Akuakultur 2010

LL 1
Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau, Maros

Produksi rumput laut ditargetkan meningkat dari 2,6 juta ton per tahun sekarang ini menjadi 7,6 juta ton per tahun pada 2014, sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. Umumnya pembudidaya rumput laut, Kappaphycus sp. mengaplikasikan metode long line, di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut, Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan, yakni 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m, di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masing-masing dengan 3 kali ulangan. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver. 3,1. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut, K. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m dari permukaan perairan. Oleh karena itu, metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468,75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan.
KATA KUNCI: Kappaphycus alvarezii, pertumbuhan, kandungan keraginan, vertikultur

LL 2
Siti Fadilah, Rosmiati, dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau, Maros

Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. verrucosa. Rumput laut dikumpulkan dari Kabupaten Brebes, Jawa Tengah. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0,1%. Eksplan diinokulasi ke dalam media cair yang diperkaya PES. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker, sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu. Pengamatan panjang tunas, jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81,70%) daripada botol (90,75%). Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2,40 mm pada stoples dan 2,42 mm pada botol. Sedangkan jumlah tunas dalam stoples (7,50) lebih banyak dibandingkan dalam botol (7,03). Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26,70 dibandingkan dalam botol yang hanya 6,20.
KATA KUNCI: botol, kepadatan eksplan, stoples

KATA KUNCI: Kappaphycus alvarezii. Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas. Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. Alias L. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. hibridisasi. mulai berpendar jam pertama – kedua setelah elektroporasi (s. transgenesis.1 second. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Kappaphycus alvarezii Muh. promoter. Utut Widyastuti***). Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12. Keratin dan b-actin. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda.e dan stabil setelah jam ke9 sampai ke-12 s. ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT. dan St. KATA KUNCI: mutu genetik. fusi protoplas . Rajamuddin*).e). Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid.e. panjang kejutan: 0.5 mili/second. Fadilah. Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) .Irvan Faizal****). Makassar **) Departemen Budidaya Perairan-FPIK. Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV. dan sumber karbon yang berbeda. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik. kappaphycus alvarezii. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. persentase sel berpendar rata-rata 10%. Balai Riset Perikanan Budidaya Air Payau. cytomegalovirus/ CMV. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0. ZPT. Alimuddin**). Pola ekspresi keempat promoter relatif sama. dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. jumlah kejutan: 4 kali dan interval kejutan: 0. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%–10%. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah.Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT. Rosmiati. daya tahan penyakit.BPPT. puncak jam ketiga – keenam s. Sebagai tahap awal dalam rangka produksi rumput laut transgenik. b-actin.

Pada umumnya. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. khususnya di Kecamatan Sumur. kondisi sosek-ekonomi. SIG. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. pembudidaya rumput laut. Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. taman nasional ujung kulon. Pandeglang . Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. Untuk itu. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Erlania. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. dan status wilayah kawasan. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). konservasi dan wisata). Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. Kabupaten Pandeglang. Rekomendasi pencegahan penyakit. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. KATA KUNCI: rumput laut. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. I Nyoman Radiarta.

Pemeliharaan dilakukan selama 8 minggu.0 mg/L. pengggantian media dilakukan setiap minggu dengan komposisi media yang sama.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0.0:1. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0.2 mg/L) dengan konsentrasi agar media induksi (0. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep.6% dan 0. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0.8% dan 1. pada rasio IAA: kinetin (0.0 mg/L. Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen. KATA KUNCI : Kappaphycus alvarezii. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis. Andi Asdar Jaya*).5:0.5%).4%. Ridwan*). 1. morfologi. Rajamuddin*). 1. dan 1.8%). Pada tahap regenerasi massa sel embriogenik. 0. dan 0. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid.0:0. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan. KATA KUNCI: keragaman. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan.4 mg/L. Makassar **) Balai Riset Perikanan Budidaya Air Payau. Rosmiati.6%. adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati. 0. Pada tahap induksi kalus.1 mg/L) dengan konsentrasi agar (0.0% menghasilkan persentase induksi kalus tertinggi (90%). embriogenesis somatik . rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0. Pada media cair. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio.8%. Perkembangan sel-sel embriogenik diamati pada kultur cair.0%. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. kalus. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh. dan 2.1:1. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. Alias L.0 mg/L. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. Tahap (2) adalah regenerasi massa sel embriogenik somatik. 0.0:0. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm).5 mm dapat dicapai dalam satu bulan kultur.6%. embrio somatik.

crakers. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. A-2 (30% tepung rumput laut dan 70% tepung terigu). Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. dan berpengaruh nyata terhadap rupa dan tekstur. lemak.24 ha. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. rasa. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. denga metode budidaya tali panjang (long line). produksi pada tahun 2008 sebesar 750 ton. Hasnawi. Mery Sukmiwati.143. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. 01-2973–1992 dan SII 0177–1990. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam program-program pokok pengembangan. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. aroma. rumput laut. protein. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. KATA KUNCI: rumput laut. uji organoleptik . kadar abu.13 ha dan 3. Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. Parameter mutunya adalah kandungan zat gizi (air. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn 85%. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. abu.780.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. KATA KUNCI: strategi pengembangan. Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. A-1 (15% tepung rumput laut dan 85% tepung terigu). gizi. dan karbohidrat) dan uji organoleptik. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No.

Maros ABSTRAK Kabupaten Mamuju. Penelitian ini bertujuan untuk melakukan analisis spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG).15 dan 19. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan. pirit.32 dan 113.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI SPOS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. SPOS.614%. Rachmansyah. Maluku . SIG. Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei.71 g/cm3 dengan rata-rata 0. Peubah kualitas tanah yang diukur adalah: pHF. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan.884 g/cm3 dan SPOS tanah berkisar antara 0.2 digunakan untuk pembuatan peta distribusi SPOS tanah. KATA KUNCI: kebutuhan kapur.28% dengan rata-rata 7. Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan.02% serta 44.78% sehingga memiliki faktor konversi berturut-turut sebesar 2. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra ALOS AVNIR-2 akuisisi 28 Juli 2009. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya.29 ton/ha dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. bahan organik dan berat volume tanah. Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai SPOS tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat dan berkelanjutan. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia. infrastruktur (jalan) dan sebaran penduduk. SKCl.60 dan 36.09 dan 90. Kapur pertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur. inderaja. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. klorofil-a dan suhu permukaan laut). namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. pHFOX. SP. Kebutuhan kapur CaCO3 untuk tambak di Kabupaten Mamuju berkisar antara 1. ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting. Oleh karena itu. tanah. Adang Saputra.36 dan 3. tambak.02.30 dan 1. KATA KUNCI: budidaya laut. analisis spasial. Program ArcView 3. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. S POS . Kebutuhan kapur didasarkan pada nilai SPOS tanah dengan mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur.

Di samping itu. Evi Tahapari***).400 m2 selama 3 bulan pemeliharaan. Hatim Albasri**). peningkatan pendapatan. ikan patin. KATA KUNCI: minapolitan. konversi pakan serta pertumbuhan yang cukup baik. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. analisis komoditas unggulan dan andalan. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan.Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). bandeng LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. Adang Saputra**). Jakarta **) Pusat Riset Perikanan Budidaya. analisis komoditas. tambak terbengkalai. Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara. dan analisis usaha perikanan. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. Introduksi kaji terap dilakukan dilahan seluas 2. udang dan bandeng. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. udang. Wartono Hadie**). Jakarta **) Pusat Riset Perikanan Budidaya. rumput laut. Sukamandi *) ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. dan Sularto***) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. KATA KUNCI: produktivitas tambak. analisis location quotient. Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. Kabupaten Brebes .

Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. tanpa vegetasi. nipah. TSA. padi (Oryza sativa). pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent.75 m tanah vegetasi api-api. pirit. pHFOX dan potensial redoks.25 m dan 0. N-total.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. nipah (Nypa fruticans). PO4. Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. TPA. masingmasing pada kedalaman tanah 0-0. Kabupaten Mamuju . penutup/penggunaan lahan. Hasil penelitian menunjukkan bahwa. KATA KUNCI: keragaman. Pada kedalaman 0.50-0. Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah. sedangkan yang dianalisis di laboratorium adalah pHKCl. Pada kedalaman 0-0. Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. paku laut (Acrostichum aureum). campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. pHOX.25 m tanah jenis penutup/penggunaan lahan api-api. SPOS. sagu (Metroxylon sagu). dan Kamariah Balai Riset Perikanan Budidaya Air Payau. Al dan tekstur. bakau. bakau (Rhizophora apiculata). karbon organik. Oleh karena itu. sagu. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). SP.50-0. Fe. Marsambuana Pirzan. rumput. rumput. SKCl. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). bakau. kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. A. nipah. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. pesisir. Kualitas tanah yang diukur langsung di lapangan adalah pHF. rumput. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. tanah. TAA.75 m. kelapa (Cocos nucifera).

Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat. fosfat. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia.272 ha).046 dan 22. tambak. Sulawesi Barat . Oleh karena itu. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497. Data lapangan (fisiko-kimia air dan tanah). dianalisis secara spasial dengan metode PATTERN menggunakan SIG. amonia. cukup sesuai (168. dan data citra satelit digital. Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil. pH. KALIMANTAN BARAT Utojo. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik.000.819 ha). Mempawah Hilir dan Mempawah Timur. nitrit. KATA KUNCI: klorofil. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. Sungai Kunyit. tambak. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. sedangkan peubah bebas adalah suhu. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). terdapat di Kecamatan Segedong dan Siantan. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. sedangkan yang kurang sesuai (213.077 ha. pH. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut.986 ha). Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil. tersebar di wilayah pesisir Kecamatan Sungai Pinyuh.000. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Data sekunder yang diperoleh berupa data iklim. kualitas air. amonia. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. oksigen terlarut. Pada umumnya yang tergolong sangat sesuai (114.398 µg/L. nitrat. KATA KUNCI: kesesuaian lahan.047 dengan rata-rata 6. Akhmad Mustafa. walaupun dengan model regresi yang berbeda. dan fosfat. dan bahan organik total. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. data sekunder. nitrat. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. nitrit. salinitas.

Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. identifikasi. minyak nabati . Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung. Chironomus sp. Dunaliella. ekstraksi. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter.02–8. Analisis data dilakukan secara deskriptif untuk komposisi jenis. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9.. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda. Analisis kandungan minyak nabati Dunaliella sp.. Kultur ini ditempatkan diluar ruangan. pH. Parameter kualitas air yang diamati adalah suhu. KATA KUNCI: mikroalga. indeks diversitas dan keseragaman spesies. Proses pengayakan termasuk penyeleksian. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan. KATA KUNCI: makrobentos. kemudian 6. Kultivasi Dunaliella sp.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda. 5:4. kecerahan. Bogor.). dan 6:3. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya. Jakarta. Spesies dominan adalah Limnaea sp. pupuk. kolam. dengan menggunakan cara modifikasi (Banerjee et al. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Tidak terdapat perbedaan nyata (P>0. Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8.75). dan BOD5. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. 2002 dan Dayananda et al. dan Nematoda. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis. dan penghitungan dilakukan di laboratorium. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. dilakukan di dalam bakbak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. total bahan organik (TOM).00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6.5 mg/L.60% menggunakan perlakuan pelarut hexana. penghitungan kelimpahan. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5. DO.0 sel/mL.. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0. 2006). BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp. BRPBAT..

Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. Departemen Pertanian. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. salinitas. salah satunya adalah Desa Merakan di daerah Jawa Timur. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. braunii. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan. KATA KUNCI: kepadatan. dan pH. KATA KUNCI: ketahanan pangan. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. Metode penelitian menggunakan metode survei. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Pengolahan data dilakukan secara deskriptif.33 sel/mL pada sistem indoor dan 7. rawan pangan.65/hari pada outdoor. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. Berdasarkan perhitungan statistik ANOVA. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. 02 sel/mL pada sistem outdoor.37.25/ hari pada indoor dan 3. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. Botryococcus braunii . sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. dengan skor 19. laju pertumbuhan.

KATA KUNCI: unit usaha. Uji awal berupa pengecatan gram. Sedangkan dengan menggunakan spesifik primer. kemungkinan merupakan strain yang tidak pathogen. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. Infeksi bakteri. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. KATA KUNCI: Aeromonas hydrophila. Bakteri merupakan salah satu penyebab penyakit pada ikan. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. penanganan aspek teknis. pembudidayaan.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Isti Koesharyani. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. aerolysin dan primer spesifik . yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. profitabilitas. dan Balai Budidaya Laut (BBL) Ambon. penanganan aspek teknis. pengelolaan bisnis. tes katalase dan oksidase dilakukan sebelum uji PCR. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. uji PCR. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. sehingga AH-26 merupakan isolat yang pathogen. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha.

namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae. Masing. Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. periphyton. yaitu 4423.masing perlakuan 5 kali ulangan. Ani Widiyati. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar. Waduk Cirata . Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m). Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat.86-0.81 (ind/cm2) dan 0. Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A). Winarlin. kedalaman 2 meter (B).Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti.91. kedalaman 3 meter(C) dan kedalaman 4 meter (D).Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat. KATA KUNCI: kedalaman.

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

Jakarta Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. Bogor ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. dan Sutisna Kuningan. Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas. sintasan terendah didapatkan pada salinitas 12 ppt. Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. ikan mas. ikan nila. Sidi Asih***). sintasan. dan Achmad Sudradjat*) **) *) Pusat Riset Perikanan Budidaya. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. salinitas. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. Majalaya. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. dan 12 ppt (11–15 ppt). Akuarium yang digunakan berukuran panjang 60 cm. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. Hary Krettiawan*). responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. lebar 40 cm. 8 ppt (6–10 ppt). KATA KUNCI: strain. dan tinggi 40 cm dengan ketinggian air 15 cm. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). Cianjur Wildan.Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. Masingmasing perlakuan menggunakan 2 ulangan. KATA KUNCI: streptococcosis. pertumbuhan . telah banyak menginfeksi ikan nila. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*).

Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september . Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4. KATA KUNCI: budidaya. ekonomi. dan kalimantan. Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya. termasuk jenis ikan karnivor. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan SeptemberNovember 2009.53. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan. dengan jangka waktu pengembalian modal selama 3. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. Jawa.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. yang diberi sekat jaring nilon hita. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan. Jakarta ABSTRAK Ikan karnivor. pakan. ikan belida yang banyak hidup di perairan umum Sumatera. Pemeliharaan ikan belida dilakukan di kolam. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. KATA KUCI: ikan belida. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya.20 siklus dan nilai RC ratio sebesar 1. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. Iwan Malhani Al’Wazan.36. anakan ikan nila . Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. Dalam hal dukungan dana permodalan.64 sedangkan FCR total sebesar 1. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan.

Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. KATA KUNCI: ikan nila. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. Selama proses adaptasi pada kolam pemeliharaan. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. kurang lebih 60% pengeluaran berasal dari pakan. Jakarta Balai Riset Perikanan Budidaya Air Tawar. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. palm kernal meal. pelet maggot . Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. Untuk menguasai teknologi domestikasinya.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) **) Pusat Riset Perikanan Budidaya. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. yang dikenal dengan nama PKM (palm kernel meal). jaring tancap dan keramba jaring apung. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. Dalam kegiatan budidaya ikan. KATA KUNCI: ikan belida. Budidaya ikan nila dapat dilakukan di kolam. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit.

Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. 25 – 1. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. Rasio konversi pakan 1. ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. 05. baik disebabkan oleh infeksi virus. Masing-masing perlakuan diulang 3 kali. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. penyakit infeksi . Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. sintasan. bakteri maupun berbagai jenis parasit. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bakbak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. dan 200 ekor/m³. 65 g/ ekor. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. KATA KUNCI: vaksin bakteri. Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. Padat penebaran yang digunakan sebagai perlakuan adalah 100. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. Fris Johnny. 05) tidak mempengaruhi sintasan. dan Zafran Balai Besar Riset Perikanan Budidaya Laut. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%.150. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). Pendederan ikan kerapu macan. 95 – 2. Epinephelus fuscoguttatus. sedangkan kontrol hanya disuntik dengan PBS. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. KATA KUNCI: pertumbuhan. Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut.

25-4. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. dan pada induk asal alam 20-92 % dengan SAI 2.004. Apri I. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 . Plectropoma laevis.450. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia.520 µm. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix.240. Agus Priyono. Ketut Suwirya.000 butir. Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³. dan (B) Induk asal alam. indeks somatik gonad dan diameter oocytnya.20.80. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan. Tridjoko. Kualitas telur yang dihasilkan relatif masih fluktuatif. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad. Supii.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3.000 butir. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. aspek biologi reproduksi . Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. KATA KUNCI: kerapu raja sunu.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma. dengan jumlah 8% biomass/hari.

dengan periode pemeliharaan120 hari. dibandingkan dengan perlakuan lainnya. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. tawes . Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. Peubah yang diamati adalah sintasan. Kata kunci : Jaring apung. tengadak albino. konversi pakan. pertumbuhan. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi.A. pertambahan berat. Himawan Tirta Yudha. Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. dan N. (1988). ikan tengadak. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. Rudy Gustiano. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). Hasil penelitian menunjukkan bahwa laju pertumbuhan. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. total biomass dan biaya pakan. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. Giri Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: truss morfometrik. pertambahan berat. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik.

meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan.8 mg/L). dan Scirpus sp. Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air.67%). Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen.5%–90. amonia (42. amonia (0. produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar.5 mg/L).82%). karbofuran.58%).14%–92. karena di samping harus efektif terhadap hama tanaman padi.5–14. khususnya ikan.5%–66. Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi. KATA KUNCI: toksisitas. akut. KATA KUNCI: substrat. pemakaian insektisida perlu dilakukan secara selektif. Kisaran persentase efektivitas penyisihan TN (28%– 58. Typha sp. Untuk itu.681mg/L) dan nitrat (0.33%). Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan. Perlakuan pada penelitian ini terdiri atas dua perlakuan. yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air).Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar.7–1. Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi.11%–44. kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur. yaitu TN (42.36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0.05) dibandingkan kolam ikan kontrol (82. kronis . tumbuhan air.4%) pada kolam substrat 1 (pasir. dan nitrat (11.849 mg/L) dan nitrat (0. juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut. amonia (0.86%–85.4–0.05).lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8. Sintasan (93.5 mg/L). Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat). nitrogen.). Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7.32 %). amonia (20.82%).3 mg/L).081–0.303–1. Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan. dan nitrat (37. Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0.

selanjutnya dibandingkan dengan teknik diagnosa melalui uji biokimia dan histopatologis. Oleh karena itu. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy).00 mg/L dan garam 4. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan.00 mg/L. Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. (f) garam 6. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati.00 mg/L. (e) garam 5. Ada beberapa bahan nabati dan alami yang dapat digunakan.000. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp. Trichodina. dan darah. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya. (c) biji teh 20. sedangkan preparat histopatologi diambil dari organ hati. Mycobacterium fortuitum PADA IKAN GURAME. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut. (b) biji teh 15. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain–Jenssen.00 mg/L efektif untuk memberantas Trichodina dan monogenea.000. Dactylogyrus. Sensitivitas teknik diagnosa terhadap bakteri target. dan Quadriacanthus kobiensis serta menimbulkan kematian. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis.00 mg/L (g) kontrol. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10.00–6. sehingga upaya pengendaliannya sering terlambat. Pada riset ini. (d) garam 4.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar. serbuk biji teh dan garam. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar. Ketujuh perlakuan itu yaitu: (a) biji teh 10. Gyrodactylus. Mycobacterium fortuitum.000. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. KATA KUNCI: mycobacteriosis. gurame. dan primer M2: PreT43 (AATGGGCGCAAGCCTGATG) dan T531 (ACCGCTACACCAGGAAT) digunakan pada penelitian ini. Dua pasang primer. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat.00 mg/ L. dan Polymerase Chain Reaction . yaitu M1: T39 (GCGAACGGGTGAGTAACACG) dan T13 (TGCACACAGGCCACAAGGGA). KATA KUNCI: ekstoparasit.00 mg/L. Hasil penelitian menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi. limpa. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies. yang telah dikembangkan oleh beberapa peneliti. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar.00–20. ginjal.00 mg/L. dan limpa.

Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: fitase. dan tingkat sintasan. 500. efisiensi pakan. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG.05) terhadap pertumbuhan.05). Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang. namun nilai ini tidak berbeda nyata dengan 1. dan 2. tepung bungkil kopra. Parameter yang diamati yaitu laju pertumbuhan spesifik. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0. guttatus . 1.000 unit fitase/kg pakan. pakan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. nilem.000. S. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem. Hasil penelitian menunjukkan bahwa penggunaan fitase 1. KATA KUNCI: tepung bungkil kedelai.45 g/ekor.000 unit/kg pakan. efisiensi pakan. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. rasio efisiensi protein.500.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti. substitusi. 1.V. B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai. pertumbuhan. C. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap. Balai Riset Perikanan Budidaya Air Tawar. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. dan sintasan ikan beronang. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai.73 g dengan padat tebar 15 ekor/keramba. Bogor.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0.15±5. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya.60±0.500 dan 2. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Cijeruk dengan bobot rata-rata 8.

pelet. KATA KUNCI: pakan rucah. lebar karapas dan sintasan (P>0.05) dengan perlakuan yang lain. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis. Maros selama 40 Hari.Variabel yang diamati adalah pertumbuhan lebar karapas. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur).526. Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm. Tjaronge Balai Riset Perikanan Budidaya Air Payau. 100% ikan rucah jenis ikan tembang (Clupea sp.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. B. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. bobot dan sintasan serta kualitas air.-/tahun/ha.02 g. 100% pakan buatan/pelet dan C. Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak. 50% ikan rucah + 50% pelet. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus). Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. KATA KUNCI: budidaya bandeng. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap.). Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak.04 ± 0. tambak. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut. sintasan . rajungan.2 mm dan bobot 0.850. pertumbuhan.2 ± 0. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot.

0 cm dan bobot rata-rata 0. Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran. Produksi bandeng pada perlakuan A dan B.5 cm (ukuran ekspor). 55.-.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara.5 m dan tinggi air 40 cm. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1. masing-masing mencapai 56. dan 105 dan dianalisis secara deskriptif. KATA KUNCI: benih botia.625% dan 60.467.5 cm dan panjang tertinggi sebesar 3. 70. ampas tahu. KATA KUNCI: pupuk organik.100. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. 35. pertumbuhan panjang. pupuk kandang dan dedak. 20.009 gram. Sintasan bandeng pada perlakuan A dan B.5 ton/ha.43. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2.5 cm) . Nina Meilisza. Pada akhir penelitian (hari ke 105).5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional. masing-masing dengan dosis 2. Selama pemeliharaan.5 x 0. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. ukuran ekspor 1 inchi (2. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. bandeng. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B).9 dan 1154 kg/ha. Erfan Andi Hendradjat. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif.5 x 0. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).0 cm. B/C rasio 1. Padat penebaran bandeng pada masingmasing perlakuan adalah 15. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh. Oleh karena itu. produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.816%. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari.98 g/ekor menjadi 232.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B). lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. masing-masing mencapai 986.

) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor. Selama 45 hari pemeliharaan. gonad. pendederan. Depok Pusat Riset Perikanan Budidaya. dengan pertambahan bobot rata-rata sebesar 0.01 g dan panjang total rata-rata 3. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp.00. Gigih Setia Wibawa*). Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. ikan diberi perlakuan pemberian pakan alami yang berbeda.00 dengan metode pemberian sekenyangnya (adlibitum). (B) Culex sp.09 g dan pertambahan panjang total rata-rata sebesar 0. pH 6. (A) Chironomus sp. memberikan pengaruh yang berbeda nyata (P<0. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya.0.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar. memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian. KATA KUNCI: Melanotaenia sp.85 ± 0. Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal.98 ± 0.8 (sebagai kontrol).05) terhadap rata-rata pertambahan panjang total dan sintasannya.50 ± 0. Depok. Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali.. pH air pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur.) Eni Kusrini*). Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat. dan Irsyaphiani Insan**) *) **) Balai Riset Budidaya Ikan Hias. Hasil penelitian menunjukkan bahwa perlakuan pH 7. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya. dan Culex sp.Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP. KATA KUNCI: Benih ikan pelangi. pakan alami.00 dan 16. Jakarta ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua.0-8.24 cm.05) terhadap pertambahan bobot rata-rata ikan. sintasan . pertumbuhan.0 – 8. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp. dan (C) Tubifex sp.5 – 5. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula. 12. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp. namun tidak berbeda nyata (P>0.. Agus Priyadi*). dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar.9 dan pH 7.0 – 6. Rendy Ginanjar.32 ± 0.. Pakan diberikan tiga kali sehari yaitu pada pukul 8.

02 g. Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan.67%. 96. pertumbuhan. Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. 95. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). D. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. Rendy Ginanjar*). Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi. padat tebar .22% dan E. 97. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. 15 ekor/liter. Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. Depok Universitas Diponegoro. Ikan uji yang digunakan adalah benih berukuran panjang 2. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. B (2 ekor/L). Sintasan dari masing-masing perlakuan adalah sebagai berikut: A. dan Jacques Slembrouck**) **) *) Balai Riset Budidaya Ikan Hias Depok.81%. KATA KUNCI: Metynnis hypsauchen. Marendra Gladiyakti**) *) **) Balai Riset Budidaya Ikan Hias.45%. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap. Indonesia Institute Recherche Pour Le Developpement.22±0. Asep Permana*). B. KATA KUNCI: ikan botia.07%. tetapi berpengaruh nyata (p<0. Pakan yang diberikan selama penelitian adalah nauplii artemia. Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. ketersediaan pakan dan padat penebaran. C. 35 ekor/liter. 30 ekor/liter dan E. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). Prancis ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. D. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan.05) terhadap pertumbuhan.02 cm dengan bobot 0. B. Lili Sholichah*). 96.67 mm.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*).13±0. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). padat tebar. 25 ekor/liter. Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari. 20 ekor/liter. sintasan. 96. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara. C. resirkulasi. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia.

kolam budidaya dan manajement budidaya yang baik. makanan. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO).) . Unit budidaya ikan memiliki prasyarat sebagai berikut. Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. area penjemuran atau alat pengeringan pakan (drying). Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. memiliki bak kultur. lunar. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. salinitas dan arus. temperature. Kawasan Mina Pakan Mandiri. memiliki bak untuk restokin. propinsi Jambi. Ikan migrasi. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. KATA KUNCI: maggot. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. KATA KUNCI: Phenotipic plasticity. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). 2) unit pengolahan pakan dan 3) unit budidaya. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. Ikan Sidat (Anguilla sp. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. dan homing atau reproduksi. fisiologi dan tingkah laku dalam merespon perubahan lingkungan. biokonversi. ketersediaan pakan dan pemasaran. bahan pakan seperti vitamin dan dedak. air tersedia dalam jumah yang cukup. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. Unit produksi maggot memiliki prasyaratan sebagai berikut. Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. Unit pengolah pakan memiliki prasyarat sebagai berikut. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. sedangkan factor eksternal yaitu. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. Migrasi terbagi menjadi migrasi vertical dan horizontal. memiliki mesin pelet. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting.

dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. mujair (O. Kata kunci: denitrifikasi. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan dengan Pseudomonas aeruginosa. Ikan yang di gunakan adalah hasil persilangan 4 strain. jarak genetik. NIRWANA (nila ras wanayasa).15%). Aktivitas reduksi nitrat terjadi dari awal inkubasi. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan. Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. reduksi nitrat . Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi.h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. nila BEST (Bogor Enhancement Strain of Tilapia). Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0.mossambicus). Iman Rusmana**).26% – 63. Kata kunci: Randomly Amplified Polymorphic DNA (RAPD).40 mM dan 0.h-1 dan 0.236 – 0. Persilangan.17 mM.mossambicus). sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST.560). juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut. dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi. nitrogen anorganik. untuk mengamati variasi genetik benih persilangan ikan nila.28 mM. Hasil dari persentase polimorfik (berkisar 5. Sukamandi. Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*). Jarak genetik 15 populasi persilangan berkisar (0. Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik.Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.16 mM. tetapi yang menghasilkan benih hanya 15 populasi. nila merah (Red NIFI). mossambicus) Nunuk Listiyowati. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. Oreochromis niloticus . Didik Ariyanto. Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD). Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O. terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&). Selain itu.

Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia. bungkil sawit. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral. Pada tahap pembentukan mata. Osphronemus goramy. rasio inti sel:sitoplasma yang besar.37% setelah proses fermentasi. Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC.91% menjadi 15. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. KATA KUNCI: Bacillus sp. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. 6 hari (D3). Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. Isdy Sulistyo2). migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. distibusi.74% menjadi 5. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia.. nutrisi dan serat kasar .) Priadi Setyawan1).Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. sebagai bahan baku pakan ikan patin. ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma.8%. Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952).37% dan meningkatkan kadar protein dari 13. Sukamandi **) Universitas Jenderal Soedirman.09% menjadi 4. PGC terdistribusi secara berkelompok di bagian ventral. UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. 4 hari (D2). kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. KATA KUNCI: PGC. menurunkan lemak bungkil sawit dari 14. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. fermentasi. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional.

di antaranya daerah Bogor dan Subang. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). Eni Kusrini****). jantan fungsional. KATA KUNCI: UPR. Depok ABSTRAK Ikan patin (Pangasius sp. Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. kluster penetasan telur. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. sebagai materi kegiatan tahun mendatang. dkk. patin. Jakarta **) Pusat Riset Perikanan Budidaya. demikian juga ditinjau dari segi higienis dan kesehatan benih.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. Lusiastuti***). Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran. Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. sex reversal. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. integrasi. salah satunya melalui Catfish Club Indonesia.. Tipe integrasi bersifat soliter. dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. dengan masing-masing hatchery terpisah lokasinya. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor. KATA KUNCI: ikan nilem. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP. Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik. Bogor ****) Balai Riset Budidaya Ikan Hias. betina homogamet . Perbedaan dari kedua sistem ini adalah sifat produksinya.1994). dan kluster pemeliharaan larva dan benih. dan Labuan (Merak). setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin.Balai Riset Perikanan Budidaya Air Tawar. Pengambilan data melalui responden dilakukan dengan cara purposive sampling. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi. Angela M. Subang.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. Wartono Hadie**). Jakarta ***) . pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman.

sintasan dan kualitas air (meliputi suhu. M H Fariddudin A. memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva). Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). kepadatan.2 gram. ikan mas strain rajadanu . larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih. pertumbuhan. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. salinitas. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia. Agus Priyono.57 % dalam satu generasi. Anang H K. KATA KUNCI: sintasan. Diketahui estimasi nilai heritabilitas rata-rata h²(S+D) = 0.27 pada ukuran konsumsi dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. 10 butir/liter (perlakuan H).Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. 15 butir/ liter perlakuan (I). KATA KUNCI: seleksi generasi. dan nitrit). intensitas cahaya. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui. pH. oksigen terlarut/DO. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar. Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva.1. amonia.

eksplorasi. dan Lila Gardenia Pusat Riset Perikanan Budidaya. penanggulangan. penyakit streptococcosis . Hambali Supriyadi.dan Tasikmalaya. KATA KUNCI: antibakteri.Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik. Klaten. Survei dilakukan di beberapa daerah yaitu Cianjur. bakteri probiotik. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus).

SIG. Teluk Lada. Pandeglang . Provinsi Banten.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. Untuk menjamin keberlangsungan usaha budidaya kerang hijau. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. Kabupaten Pandeglang. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. Kabupaten Pandeglang. Hatim Albasri. budidaya laut. Erlania. di perairan Panimbang Kabupaten Pandeglang. KATA KUNCI: kerang hijau. Secara umum. Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang.

dan Spiranura sp. tingkat sintasan. dan Jatim.) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas. serta UPR yang mengembangkan usaha perbenihan udang galah.. padahal permintaan cukup besar. Jateng. dan kelompok ketiga ialah pembudidaya. kelompok kedua adalah penghasil benih. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76. Bali. STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*). Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. tembakau (Tobacum nikotiana) ..Forum Inovasi Teknologi Akuakultur 2010 pK 01 1.Wartono Hadie*). Vorticella sp. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya.. BBAP Samas-Yogya(Jateng). Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset. Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan.Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. KATA KUNCI: huna (Cherax sp. Ikhsan Khasani**). Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. induk. Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP Samas. BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro.Yogyakarta. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. Bali. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP. Carchecium sp.Bali.). Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro. Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. BBUG Klungkung. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi.). dan diferensial hemosit. Imron**).42%... Retna Utami**). dan Opercularia plikatilis. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya. KATA KUNCI: udang. kelompok kedua adalah BBU Pamarican (Jabar). Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol. Zoopthalmium sp. sedangkan dari kelompok protozoa adalah Epistylis sp. Parameter yang diamati meliputi pemeriksaan parasit. tingkat kesembuhan.UPU Probolinggo (Jatim). kelompok kedua adalah penghasil benih. dan kelompok ketiga ialah pembudidaya. manajemen.

Karawang. Gracilaria verrucosa.22% dan 72. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. Penelitian ini dilakukan pada tambak di daerah Betok Mati. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Setelah dua hari. Hewan uji yang digunakan adalah udang vaname PL-48. yaitu pertambahan berat rata-rata 230 g. namun polikultur udang vaname dan rumput laut masih kurang informasinya.n pengapuran sebanyak 175 kg/petak. pengapuran dan pemupukan. pengeringan. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2. survival rate. Dengan teknologi yang diterapkan. yaitu menggunakan tingkat teknologi tradisional plus. penebaran dilakukan setelah satu bulan dari penebaran tokolan. salinitas rendah. Idil Ardi.500 m2 digunakan untuk percobaan. pemberantasan hama.66% dan 108.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35. tokolan.5 g. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. Pemeliharaan dilakukan selama tiga bulan. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. dan Wartono Hadie Pusat Riset Perikanan Budidaya.8 kg dan kelangsungan hidup 100 %. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. kemudian dikeringkan sekitar satu minggu. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang.6 kg/ha.84 kg/ha. KATA KUNCI: vaname.2 %. Kecamatan Cilebar. masing-masing dengan dua ulangan. produksi 81.000 kg/ha rumput laut. produksi . dilakukan pengolahan tanah tambak. polikultur. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. namun berbeda tidak nyata (P>0. pada bulan pertama udang tidak diberi pakan. Empat petak tambak masing-masing berukuran 3. Sebelum penebaran. KATA KUNCI: udang windu. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. produksi 78. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. sedangkan pada dua bulan berikutnya diberi pakan pellet udang. Dari pemeliharaan udang selama tiga bulan.1 kg dan kelangsungan hidup 11.

Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. Pada budidaya udang windu intensif. dan metabolit udang. perlakuan C = tapioka. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. dan perlakuan D = tanpa sumber karbohidrat. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. kotoran. KATA KUNCI: tepung tapioka. pola tradisional. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. pola intensif.05) terhadap kelimpahan dan jumlah jenis plankton. Hal tersebut perlu mendapat dukungan dari penelitian. Polychaeta. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. dan Cyanophyceae. dan Rotatoria. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. probiotik. indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0.6 m sebanyak 12 buah. Dinophyceae.3 g dengan padat tebar 50 ekor/bak. masing-masing dengan 3 ulangan. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. pelakuan B = sagu. KATA KUNCI: plankton. indeks keseragaman menunjukkan komunitas plankton pada perlakuan D relatif lebih merata dibanding perlakuan lainnya. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. 25. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. Pada budidaya udang vaname pola tradisional plus. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. menggunakan bak kayu ukuran 1 m x 1 m x 0. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. udang windu .

362).427).324–0. B = 2 mg/L. sintasan.689–0. dan perlakuan C = dedak padi halus. setiap 15 hari. oksigen terlarut.05) terhadap jmlah jenis dan kelimpahan plankton. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang. Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas.000 ekor/petak).780) dan indeks dominansi (0.05) pada sintasan dan produksi udang vaname. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. udang windu.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan perlakuan berpengaruh tidak nyata (P>0. Abdul Malik Tangko. suhu. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. perlakuan B = kotoran sapi. Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0. namun berpengaruh tidak nyata (P>0. Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing-masing: indeks keragaman (1. PO4. C = 4 mg/L. dan produksi udang vaname. BOT. Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. serta Oscillatoria dari kelas Cyanophyceae. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. tambak . pH. dan indeks dominasi plankton selama pemeliharaan udang windu. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname. sintasan. dan Pleurosigma dari Kelas Bacillariophyceae. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. Nitzschia. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. NO3. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. NO2. pupuk organik. indeks keragaman. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin.199–1. Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. indeks keseragaman. indeks keseragaman (0. KATA KUNCI: probiotik.05) terhadap pertumbuhan udang vaname. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau.5 m dengan volume air 400 L. KATA KUNCI: dinamika plankton. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea. pertumbuhan. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea.

000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28.. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71.8±0. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau.14 dan 2. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru.634.01 g.05) antara perlakuan substrak tanah tambak.2 cm dan bobot awal 0.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau.03±0.dan Rp 19.6. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari. Substrak tanah sawah. Penelitian dilaksanakan pada tambak ukuran luas 4.sedangkan pada perlakuan A dan B masing-masing 2. budidaya. Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan.. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka.. biaya produksi.875. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak. KATA KUNCI: substrak. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A). Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak). di mana masing-masing perlakuan diulang tiga kali. biaya pakan pada perlakuan A dan B masing-masing Rp 11. Substrak tanah lumpur. Perlakuan yang diujicobakan dalam penelitian ini adalah A. dan C.24.239.5 dan 21. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan. Substrak tanah tambak. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak. Machluddin Amin. udang windu . Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak.984.3±1. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau. umur pemeliharaan. substrak tanah sawah. udang pama. KATA KUNCI: efisiensi. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak. masing-masing dengan dua ulangan. dan substak tanah lumpur.650.0±5. B.

Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan. ukuran 84 sampai dengan 89 ekor/kg) dan C (16.6 kg/500 m2 = 406 kg/ha. lebar dan kedalaman secara berurutan adalah 10 m. kisaran produksi 9. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B).3 ± 7. kisaran produksi 12.2 ± 13.7%.1 ± 13. dengan rata-rata berat 12. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25.86 kg/bak (8. lebih tinggi daripada perlakuan B = 41.86 g/ekor. Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang. Maros. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau.28-13. ukuran 80 sampai dengan 96 ekor/kg). pertumbuhan udang. Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20.3 ± 5.2 kg/500 m2 = 506 kg/ha.92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah.7%. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar.325. udang vaname.998. salinitas rendah . rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. fermentasi probiotik. B).235 kg/ha). Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan.4 ± 0.975 dan lebih rendah dibandingkan perlakuan B yang mencapai 1. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C). 1.45 kg/bak atau rata-rata 12.64 kg/bak atau rata-rata 11.5 m dan 1 m. masingmasing bak mempunyai ukuran panjang. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah.61%. dengan rata-rata berat 11. KATA KUNCI: tepung tapioka. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2.7% dan perlakuan C = 36. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali.767. di mulai setelah satu minggu penebaran.7 kg/500 m2 = 320 kg/ha.68-13.15%.66 kg/bak (7. KATA KUNCI: molase.66 g/ekor.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. namun tidak berakibat terjadi kematian massal. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah.0 ± 2. Namun demikian.

50%.3660 g. Rata-rata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0. C. dan tiga ulangan. Kontrol (tanpa pemberian probiotik A). pertumbuhan . Pemberian bakteri dengan konsentrasi 0. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan.002 mL/L. sebelum diaplikasikan di tambak. Pemberian probiotik B dengan konsentrasi 5. diikuti perlakuan 5‰ sebesar 10±0..75%. Parameter yang diukur adalah kualitas air. Penelitian II pengujian probiotik B. waktu inkubasi. Q.57 hari ..8935 g).0 mg/L. Pemberian probiotik B dengan konsentrasi 7. laterosporus. Nitrosomonas sp. sintasan. Pemberian probiotik B dengan konsentrasi 2.3±1. Nitrobacter sp. terdiri atas: O. dan 0‰ sebesar 11.5 mg/L.. Masing-masing perlakuan diulang sebanyak empat kali. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan.) dan probiotik B (mengandung bakteri Bacillus polimyxa. 88%. B. yaitu probiotik A (mengandung bakteri Bacillus sp.003 mL/L. 85%. Penelitian I adalah pengujian probiotik A. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab.) yang berukuran PL-20. sedangkan juvenil dan udang dewasa hidup diperairan tawar. dan Rhodobacter sp.4255–0.) berpengaruh nyata terhadap sintasan benih udang windu. dan D.4440 g dan kontrol 0. Pengaruh perlakuan terhadap sintasan. sebagai dasar perbaikan sistem penyediaan larva udang galah. pemberian dengan konsentrasi 0. Dengan meneliti dua jenis probiotik.75%–68.001 mL/L menghasilkan pertumbuhan tertinggi (0. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. Aplikasi probiotik setiap tiga hari sekali. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62.15.001 mL/L. Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang. B. Rhodococcus sp. 1995). sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. 5 ‰.. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz. dan R. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol). udang windu. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter). terdiri atas: A. dan kontrol 66. udang galah.5 mg/L. P. KATA KUNCI: salinitas. Pemberian probiotik A memberikan pengaruh terhadap rata-rata pertumbuhan mutlak benih udang windu. sintasan. KATA KUNCI: probiotik. Tingkat sintasan yang diberi probiotik B berkisar antara 63. 85%. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah. Pemberian probiotik A dengan konsentrasi 0. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL). kualitas air. Pemberian bakteri probiotik A (Bacillus sp. Universitas Padjadjaran. 10 ‰. dan pertumbuhan udang. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan. Pemberian probiotik A dengan konsentrasi 0. Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F.Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.).6±0.25%. karena secara alamiah larva hidup di periran bersalinitas. Kontrol (tanpa pemberian probiotik B).0 hari. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6.25%. Pemberian probiotik A dengan konsentrasi 0.001 mL/L menghasilkan sintasan sebesar 81.

Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. 15 ppt. sedangkan sintasan pada perlakuan 25 ppt mencapai 61. Selain itu.33±0. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. yaitu templat dengan berat molekul tinggi (1). Ditinjau dari keragaan pertumbuhan. 10 ppt (kontrol). dan 20 ppt sintasan dari post larva udang galah mencapai 100%. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional.67%. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.92±0. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29.13 cm dan 1.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 25 ppt. udang galah .09 cm. Guna mendukung prgoram revitalisasi tambak. PCR. 10 ppt. Hasil yang diperoleh adalah pada salinitas 5 ppt. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. salinitas. dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. 20 ppt. dan ukuran templat. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. 15 ppt. Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. diantaranya karakteristik templat DNA genom yang meliputi kemurnian. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor.05). Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. Sukamandi. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3). pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi. KATA KUNCI: pertumbuhan. konsentrasi. KATA KUNCI: Macrobrachium rosenbergii. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau.

66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. KATA KUNCI: pergantian kulit. manipulasi lingkungan. baik pertumbuhan bobot. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet. dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. Pakan diberikan dua kali sehari selama penelitian. maupun lebar karapas (P>0. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). pemberian pakan. panjang. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. Berdasarkan persentase.Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. KATA KUNCI: kepiting bakau. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. Sulaeman. kepiting lunak . Oleh karena itu. Sintasan yang diperoleh pada penelitian ini yakni 52%–54. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). kepiting bakau. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen. Dari pencapaian bobot ini. ikan rucah (B).5%. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. dan gabungan keduanya (C).05). Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan.

5 bulan dengan panjang dan bobot masing-masing adalah 8. Tambak yang digunakan berukuran 10.1±0. dan pelestarian alam.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh.000 ekor/ha ukuran crablet-30. tambak bersalinitas tinggi. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari). serta luas hutan mangrove di Kabupaten Mamuju mencapai 1.05±0.2 ± 2. bobot. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan. data yang diperoleh dibahas secara deskriptif.7 cm dan 4. Peubah yang diamati adalah pertumbuhan lebar karapas.100 pohon/ha. perlindungan. dan produksi serta parameter kualitas air. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi. sintasan. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi. produksi . Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya. Ikan bandeng yang digunakan adalah gelondongan umur 1. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰—4 9‰) mengakibatkan sintasan dan produksi rendah. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan./m2.02 g dengan kepadatan 1 ind. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya.0 ± 2. rumput laut dengan kepadatan 1. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: kerapatan hutan mangrove. Dibalik manfaat mangrove yang demikian banyaknya. jumlah permudaan 450–500 pohon/ ha.300 pohon/ha dengan rata-rata 1. pertumbuhan. sintasan. KATA KUNCI: rajungan. restoking kepiting bakau. Tambak ditebari benih rajungan.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009.000–1.04 ha. sehingga perlu riset budidaya rajungan pada musim kemarau.000 m2. Hasnawi. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau.573. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1.2 g.2 mm dan 0.

bioakumulasi. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). KATA KUNCI: minapolitan. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. cukup layak dan tidak layak. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. Secara umum. Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). logam berat .Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. Anjang Bangun Prasetio. Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Secara umum. Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. layak. rumput laut. Kappaphycus alvarezii. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. Adang Saputra. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. Provinsi Gorontalo.03 mg/L. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). I Nyoman Radiarta. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. kondisi perairan sangat mendukung pengembangan budidaya rumput laut. SIG. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. Untuk memfokuskan kegiatan budidaya rumput laut. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). KATA KUNCI: Danau Maninjau.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010.

Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. Subang. Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. alga hijau biru dan alga hijau). SUBANG Joni Haryadi*). sedangkan indeks dominansi berkisar antara D=0. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. Subang.076-0. Adi Hanafi. Kualitas kimia air untuk pH.085.962. dan Erlania*) *) Pusat Riset Perikanan Budidaya. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan.711-2. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. BBRPBL Gondol . mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. GONDOL-BALI Apri I. nitrit. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air. Sampling air secara regular untuk pengamatan fisika. indeks keseragaman berkisar antara E=0. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. 20 dan 30. outlet. inlet. Indeks keanekaragaman berkisar antara H’=2. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. DO. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. KATA KUNCI: kualitas air. tambak. Nitzschia sigma. Dara Kasih**).853. KATA KUNCI: alga perifiton. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10. kimia. Perifiton yang terdapat di Tambak Blanakan.814-0. dan plankton dilakukan seminggu sekali. N. TSS. Supii.

88–1.) di laboratorium. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP .83– 1.dengan produksi Moina sp. dan bawal adalah 1. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP.73–1.63% dan 10.87. ikan nila. yang terdiri atas: 9 jenis pakan untuk ikan mas. dan 3). yaitu: ikan mas (5. ikan nila (3. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas. K = 16:20:0. nila (Oreochromis niloticus) dan bawal (Colossoma sp.21%). pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. Panen Moina sp.78%). Perlakuan adalah pemupukan dengan perbandingan N.89%–17. Ani Widiyati.89. dan keanekaragaman plankton. Bogor. Parameter yang diamati adalah jenis.90. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal.16 g. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur.23%–6. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan. KATA KUNCI: konversi pakan. 9.17% dan 8.. Pengukuran N dan P dilakukan pada ikan dan pakan.71%–10. indek dominasi.58%–13. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi.89% dan 11. P. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP. 2).900 g sedimen + 20 g TSP. Kusdiarti. dilakukan pada hari ke-8 sejak dilakukannya penebaran. volume air 500 L. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan.96 ±1. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan. serta produksi Moina sp. akuaponik. dan 1. KATA KUNCI: limbah.53%) dan ikan bawal (8.53%–15. 1. 1.48%–9. kelimpahan. Data dianalisis secara deskriptif. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio). limbah hara N dan P . Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin.

yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. Postulat Koch. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*). mata. Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. dan NK1 (5) yang berasal dari organ otak. di laut dan Gracillaria sp. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). pencegahan . Esti Handayani Hardi**). di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. KATA KUNCI: rumput laut. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S. N4M (2). Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. Produksi rumput laut ditargetkan meningkat dari 2. penyakit. agalactiae setelah dilakukan uji Postulat Koch. Oreochromis niloticus. Hasil yang diperoleh. pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. KATA KUNCI: Streptococcus agalactiae. Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir.6 juta ton per tahun pada 2014. sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian.1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah. 4. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur. Budidaya rumput laut khususnya Kappaphycus sp. Bogor Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) **) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. Sukenda***).6 juta ton per tahun sekarang ini menjadi 7. N14G (3). N17O (4). namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. Oleh karena itu. agalactiae. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. sehingga dapat meminimasi kegagalan panen. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. hama. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani Pong-Masak Balai Riset Perikanan Budidaya Air Payau. Isolat 1.

33 ha. Mudian Paena.0008–0.095.0267–0.38–44.30 ha dan tidak sesuai 3. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden. Penelitian ini bertujuan untuk mengetahui potensi.0032–0. bahan organik total 37.66°C. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A.02–9. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan. kesesuaian rumput laut. kedalaman 1–40 meter.610. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: potensi.3 meter.09 mg/L.37.039–0. Kata kunci : Opsi pemanfaatan wilayah pesisir. demikian pula dengan karakteristik físika dan kimia oseanografinya. oksigen terlarut 5. pH antara 6.81–6. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009. Syarifuddin Tonnek.90 ppt. kurang sesuai 2. salinitas 36.32 ha.57°C–30.Indra Jaya Asaad.0037 mg/L. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar.1113 mg/L. Petrus Rani Pong-Masak. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari. nitrat 0. .85 mg/L. KARAKTERISTIK. Kabupaten Kepulauan Selayar. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian. Pengumpulan data primer dilakukan dengan cara wawancara mendalam. fosfat 0. karakteristik. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara. dan Makmur Balai Riset Perikanan Buddidaya Air Payau.95 ha.10–36. besi 0. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis. analisis hierarki proses.820.695. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27. Rachman Syah. Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir. dengan tingkat kesesuaian lahan sesuai 21. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka. dan total suspensi <25–80 mg/L. nitrit <0.01169 mg/L.685 mg/L. suhu 29. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI.1–8. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir.

Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. salinitas. A. yaitu : faktor infrastruktur dan kondisi perairan. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. KATA KUNCI: keramba jaring apung. Kata kunci : kualitas perairan. Utoyo. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. kandungan oksigen telarut. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak.Indra Jaya Asaad. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. Parameter kualitas perairan yang diamati adalah suhu. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. PO4 dan Fe. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. Muhammad Chaidir Undu. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. NH3. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. Rachman Syah. analisis faktor.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. Cakupan wilayah penelitian meliputi Teluk Hurun.Indra Jaya Asaad. tambak. NO2. faktor teknologi budidaya. Makmur. dan faktor pasar. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. pH. Kabupaten Pontianak . NO3. konduktivitas.

dan tekstur) menggunakan skala hedonik. natrium alginat. 28.663 cps. KATA KUNCI: ikan sidat. terbuka di atas lantai pada suhu ruang (sekitar 30°C).97%.0%. protein lemak. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk. Sedangkan nilai TVB dan pH masing-masing sebesar 21. viskositas 8. kimiawi (kadar air.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.1% selama 60 menit. abu. dan 28.32%. dan rendemennya 37. dan dijemur di bawah sinar matahari selama 18 jam.46%. kadar abu 19. bau. dicuci dengan air bersih. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air.44%. Kelompok kedua ditebar di atas lantai dengan beralaskan waring. Selanjutnya. lemak. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15. Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik. Jakarta **) Pusat Riset Perikanan Budidaya. kemudian direndam dalam larutan KOH 0. rendemen.4%. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.41%. rumput laut coklat. Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). mikrobiologi (Angka Lempeng Total/ALT. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempah-rempah kasar dan halus (ekstrak). Rumput laut coklat setelah dipanen.26%.25% dan dendeng dengan bumbu ekstrak sebesar 59. dan dijemur di bawah sinar matahari selama 18 jam. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna. dendeng. rasa. dan viskositas natrium alginat). Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. 7. analisis fisika-kimia .0%. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat. setiap kelompok dikumpulkan dan dibagi menjadi dua bagian.04 mgN% dan 6.1%. Kadar air. Rumput laut coklat dibagi menjadi dua kelompok. Rendemen dendeng sidat dengan bumbu kasar sebesar 57. kapang) dan rendemen. dan mutu natrium alginatnya mempunyai kadar air 19. dan pH). abu. kadar abu. KATA KUNCI: pengeringan. dan protein masing-masing sebesar 14. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. TVB.

harga ikan yang tergantung pembeli dan cuaca. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. kekurangan modal. pengalaman petani ikan dan Kebijakan Pemerintah. prasarana fisik yang kurang mendukung. kelembagaan yang menunjang. agribisnis perikanan . hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. KATA KUNCI: potensi desa. Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. Faktor pendorong yaitu ketersediaan air yang melimpah. Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. Identifikasi faktor-faktor pendorong maupun faktor-faktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya. Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. serta ketersediannya dalam skala kecil. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat. polusi air. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam).Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Metode yang digunakan adalah studi kasus. Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi.

You're Reading a Free Preview

/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->