
Forum Inovasi Teknologi Akuakultur 2010


Forum Inovasi Teknologi Akuakultur 2010

FF 01
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: L0ppt =2,1±0,23; W0ppt = 7,0±0.29; B0ppt = 139,8±6.72; L7,5ppt = 2,3±0.06; W7,5ppt = 8,2 ± 0,42; B7,5ppt = 164.3 ± 8,46; L15ppt = 2.3 ± 0,21; W15ppt 7.8 ± 0,45; B15ppt = 155,6 ± 8,95. Pengamatan setelah 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-50ppt: 4,0±0,34; 3-515ppt: 4,8±0,27; 5-80ppt: 7,4±0,35; 5-815ppt: 9,2±0,98. Pengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
KATA KUNCI: nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen (LT50) dengan 8 ulangan dari masing-masing strain. Analisa data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata LT50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT 50

Forum Inovasi Teknologi Akuakultur 2010

FF 03
Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan, Universitas Padjadjaran

Penelitian ditujukan untuk menentukan persentase terbaik dari S. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. cereviceae sebagai perlakuan dan lima kali ulangan. Sebagai perlakuan adalah A0 (tanpa penambagan S. cereviceae); A1 (penambahan S. cereviceae 1%), A2 (penambahan S. cereviceae 2%), dan A3 (penambahan S. cereviceae 3%). Hasil penelitian menunjukkan penggunaan S. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. Pertumbuhan terbaik diperoleh pada penambahan S. cereviceae sebesar 2%
KATA KUNCI: Saccaromyces cereviceae, fermentasi, pakan buatan, nila merah

FF 04
Iskandariah, Otong Zenal Arifin, dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi, Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. Populasi yang diamati meliputi jenis nila BEST, Nirwana, Gesit, lokal Kuningan, dan lokal Bogor. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD), dengan menggunakan primer OPA-03, OPA-04, OPC-14, dan OPC-15. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13.3333%–46.6667%, dengan nilai heterozigositas 0.0351–0.1952 dan jarak genetik antar populasi 0.1765– 0.5797.
KATA KUNCI: RAPD, genetik, populasi, ikan nila, Oreochromis

1 mL/ekor. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. DAN YY Didik Ariyanto*). ikan uji disuntik dengan PBS. Budidaya Perairan. Pada uji tantang setelah minggu keenam. Pada perkembangannya. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. agalactiae. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. KATA KUNCI: vaksin sel utuh. ikan nila . Genotipe XX mencirikan betina dan XY untuk jantan.55% sedangkan genotipe XY dan YY masing-masing sebesar 79. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. agalactiae secara intra peritoneal pada ikan uji sebanyak 0. Komar Sumantadinata**). XY. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. S. SR). limfosit perlakuan tidak berbeda nyata dengan kontrol. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. Fakultas Perikanan dan Ilmu Kelautan. agalactiae pada tingkat kepadatan 108. dan YY melalui evaluasi nisbah kelamin yang dihasilkan. Kata kunci : Ikan nila. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. diferensiasi kelamin.Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. yaitu genotype XX. agalactiae. Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. dan differensial leukosit dilakukan analisa sidik ragam (Anova). seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. tidak cukup untuk memberikan protektif terhadap S. titer antibodi. Pada akhir pendederan dilakukan identifikasi jenis kelamin. titer antibodinya menurun. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). Tetapi setelah uji tantang. Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. Selain ditentukan secara genotipe. 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga. Untuk kontrol. 106. genotipe. XY. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis.81% dan 83. Sukamandi **) Dept. 106. pengukuran bobot individu rata-rata dan penghitungan sintasan. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. Perlakuan dengan injeksi sel utuh S. Data sintasan (Survival Rate. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. Oreochromis niloticus Angela Mariana Lusiastuti*). Hasil yang diperoleh bahwa sel utuh (whole cell) S. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.01%. Uni Purwaningsih*).

Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. B=106. dengan variasi perbedaan kepadatan bakteri vaksin (A=108. pH. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. total nitrogen. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. NH3. NO2. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau.5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. Anjang Bangun Prasetio. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). NO3. Selain itu. BOD. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. turbiditas. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. Selain itu. Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. keramba jaring apung (KJA). adalah septikemia dan meningoencephalitis. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. Pemberian pakan tidak boleh berlebihan. melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). karena pada kondisi perairan yang kurang baik akan menyebabkan stres pada ikan. ortofosfat dan total fosfat. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. serta data status kegiatan budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. terutama dalam hal manajemen pemberian pakan. C=104. kecerahan. D=102 cfu/mL dan E=kontrol). TDS.5).Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. dan Joni Haryadi Pusat Riset Perikanan Budidaya. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. DO. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. Angela Mariana Lusiastuti. lingkungan perairan . Danau Maninjau. KATA KUNCI: Streptococcus agalictiae. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. KATA KUNCI: manajemen pakan. pemanasan.

tinggi (3.94%). bobot (-2. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. tebal. sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74. lebar (0. Fakultas Perikanan dan Ilmu Kelautan. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4. tebal (0. tinggi. oreochromis niloticus .Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*). Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (-2.44%).53 % bt/hari.82%). dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.21%). bobot ( -2. KATA KUNCI: heterosis.74%).20%.05) bila dibandingkan dengan dua populasi lainya.65%). Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat.22%). persilangan. Sukamandi **) Dept.80%. Budidaya Perairan.87%) dan sintasan (0. SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2.35% bt/hari. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. bobot) dan sintasan. Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49. Komar Sumantadinata**).64% bobot badan (bt)/hari. tidak berbeda nyata (P<0. sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2. Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia). Nunuk Listiyowati. Parameter yang diamati meliputi keragaan pertumbuhan (panjang. IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi.48%).48% bt/hari dan 2. Sukamandi selama lima bulan. dan sintasan(1. Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. tebal (-1.06%).

KATA KUNCI: toksisitas.81±0. Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan. 2.6578–2.7504).13 dan 1. ikan nila .Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar.5094 (2. 48.7877–2.7138 mg/L (0.3354 (3. N14G. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran.1295). iniae (N2O). Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1.5480). 48. agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik. Hasil penelitian menunjukan bahwa Nilai LC50 24. agalactiae (N3M.8532). KATA KUNCI: penapisan. Data diolah dengan analisis probit program LC50. agalactiae (N4M) memiliki nilai LD50 terkecil.9823–4. N17O. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN.08 g.6904– 5. 1. dan 96 jam. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine).55±0.6297–0. Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp.0678 (1. Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung. 48. N4M. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak. streptococciasis. 0. 72.9237(0. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah. iniae (N2O). Hasil penapisan menunjukkan bahwa bakteri S. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin.0430 (4. dan nilai terbesar dimiliki oleh bakteri S. dan 96 jam terhadap benih ikan mas adalah 4. dan sonikasi. uji stabilitas dan LC50–24. SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA.0839(2.5805). 72. benih ikan.4227– 4.0930). NK1) dan 1 isolat S. 3. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis.9421 mg/L (1. vaksin.8090) dan benih ikan nila 5. Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan.8101–1. dan 96 jam. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. 3. pemanasan.6799–13. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration (LC50) 24. 0. Konfirmasi taksonomis hingga level spesies isolat bakteri S. Bogor.1100).

5 g. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%.00. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek. kakap putih. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa Tenggara Barat.94%. Pembenihan ikan ini mulai berkembang di sekitar Gondol. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. dan 80 ekor/m3 selama 5 bulan masingmasing mencapai ukuran 127. lemas. sarung tangan. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak. kambing.00 sampai jam 03. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi). Dalam pembesaran. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g. KATA KUNCI: bahan penyamak kron. dan 102. kekuatan regang (kemuluran) 66. Nusa Tenggara Timur. Ikan ini relatif sensitif dengan perubahan lingkungan. dompet. kekuatan tarik 2. dan cacing. dan sebagainya. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek. Selain itu. simetris. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia.93% dan kadar Cr2O3 1.00–08.62%. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. kekuatan jahit 1. Sulawesi. Ikan ini mudah terserang parasit seperti cryptocarion.0 g. Telur yang ada dalam kolektor dapat diambil jam 07. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20.0–3. namun sintasannya masih rendah yaitu sekitar 1%–3%. tas. benedinia.76 kg/cm2. garmen. suhu kerut 88°C.12 kg/cm.354. untuk dijadikan kulit tersamak. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih.184. Waktu pemijahannya sekitar jam 24. KATA KUNCI: pembenihan. yang merupakan limbah perikanan dari perusahaan filet ikan. liat.00 pagi hari.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi.66%. kerapu sunu . 40.2 g.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. dan 15% . karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. kambing dan ikan pari yaitu berisi. dan Sumatera. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya. dan corak permukaannya spesifik. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. kadar lemak 6. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. kadar abu 2. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih.97% sehingga sangat prospektif untuk dijadikan barang-barang kerajinan kulit.53 N/cm atau 138. pembesaran.46 N/ cm2 atau 222. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan. 103.5 kg. 10%. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. kadar air 13.

salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. jumlah kejutan 5. elektroporasi. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. Cromileptes altivelis Slamet Subyakto*). di antaranya Indonesia. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. Alimuddin***). DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). Ratu Siti Aliah*****). Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. Irvan Faizal*****). Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). dan 3 detik. transfer gen.1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. KATA KUNCI: transfeksi. dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. mikroinjeksi. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. Namun demikian. M. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. mikroinjeksi. ikan kerapu tikus . Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. Sasmito Jati****). 2. jarak waktu antar kejutan 0. sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. mikroinjeksi. hormon pertumbuhan. Rustidja**). Situbondo **) Fakultas Perikanan dan Kelautan. 10 µg/mL. Metode elektroporasi dilakukan dengan voltase 50 V. dan Gemi Triastutik*) *) Balai Budidaya Air Payau. Komar Sumantadinata***). Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. dan 20 µg/ mL. lama kejut 30 ms.

Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan. B (oksigen). Materi yang digunakan adalah larva kerapu sunu sebanyak 4.35 cm). serta terakhir perlakuan D (47.20 cm. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut. dan kualitas air. dan 15% dari total biomassa benih. laju pertumbuhan spesifik. dan efisiensi pakan pada benih kerapu sunu. KATA KUNCI: benih kerapu sunu. Namun. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0.39±0.19%) harian serta laju pertumbuhan bobot badan spesifik (6. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan. Nilai pertambahan panjang tertinggi A (72.25) dan efisiensi pakan (80. Pakan yang digunakan adalah pakan pelet komersial.86 mm). laju pertumbuhan harian.90±0. pertumbuhan panjang larva. KATA KUNCI: larva kerapu sunu. yaitu 5%. D (kontrol).35 mm).52±0.000 ekor/bak. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal. pertumbuhan.31±0. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU. Salah satu faktor yang berperan adalah lingkungan pemeliharaan.42±0. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. selanjutnya perlakuan C (64. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. 10%. probiotik. nisbah konversi pakan. Pemberian pakan dilakukan tiga kali sehari. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3. oksigen . Kendala yang dihadapi terutama terjadi pada stadia awal. C (probiotik). Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva.20-4. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus). Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen).69 g dan panjang total awal 3. efisiensi pakan.69 mm). Sampling dilakukan setiap minggu.19%) dan panjang total spesifik (1.19±0. optimasi pakan.50-0. dan perlakuan B (63. laju pertumbuhan bobot badan harian (10.95 mm).00%) yang baik bagi benih kerapu sunu.02%) serta nisbah konversi pakan (1.73%) dan panjang total (9. Peubah yang diamati adalah sintasan. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut.68 g) dan panjang total (6.

Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan. Mulai larva umur 2 hari diberikan Nannochloropsis sp. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. serta bobot badan pada perlakuan A: 192. larva kerapu macan. perlakuan B adalah 6.65%. dengan kepadatan 1. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang.96 mg. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari. Perlakuan C: 5 kali/hari pada umur 7-20 hari. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C. Des Roza. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan.62 ± 2.87 cm dan sintasan setelah diuji tantang sebesar 72. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun nonspesifik ikan kerapu macan. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari.5 ± 2.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN.03% dan perlakuan C adalah 8.08 ± 1. B: 196. Perlakuan A dan B tidak berbeda nyata. Bejo Slamet./mL dan mulai umur 17 hari diberikan nauplii Artemia.50%. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido.87. Epinephelus fuscoguttatus Irwan Setyadi. terutama infeksi virus.08 ± 2.12 mg dan C: 211. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN. KATA KUNCI: Epinephelus fuscoguttatus. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari.55 mm dan C: 26. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian. kerapu macan .1 ± 2.00%.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol. Anak Agung Ketut Alit. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut.20 ± 0. B: 24. Masing-masing perlakuan diulang 3 kali. infeksi. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan.57 mm. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting.5 ± 4. indeks fagositik sebesar 1.62%.81 ± 0.68 mm. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. Gondol ABSTRAK Ikan kerapu macan. mencapai ukuran panjang total pada perlakuan A: 24.0x105 sell/mL.95 mg. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6. sedangkan kontrol hanya disuntik dengan PBS. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. aktivitas lisosim sebesar 1.04 ± 0. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19. imunstimulan. Perlakuan B: 4 kali/hari pada umur 7-20 hari. KATA KUNCI: pakan buatan.

Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu. KATA KUNCI: efisiensi. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. konsentrat yang bisa dibeli di pasaran. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir. generasi kedua (F-2). namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah. pembenihan. Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor. perkembangan oosit . dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp. konsentrat mempunyai sintasan 19. Sampai dengan bulan Oktober telah berhasil memijah. dengan sintasan 6. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp. Setiap bulan dilakukan pengamatan pertumbuhan bobot. yang kurang baik. Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. kerapu bebek (Cromileptes altivelis). Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. sedangkan pada bak B : pakan pelet kering. pada bak A : ikan rucah + cumi-cumi + vitamin. pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya. KATA KUNCI: kerapu bebek (Humpback grouper). panjang.10% dan panjang total 21. dan dilihat perkembangan oositnya. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk.72% dan panjang total 18.86 mm.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut.

Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). Selain itu. produksi massal . 25. 13. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D-15). Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. mutu benih kerapu. Tangki pemeliharaan yang digunakan ukuran 8-10 m3. 17. KATA KUNCI: kerapu bebek. pemeliharaan dilakukan hingga yuwana (2 bulan). Cromileptes altivelis Yasmina Nirmala Asih. 5. 10. Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. dan 32 hari setelah menetas masingmasing sebanyak 10-20 ekor. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor. Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. 20. organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. 7. Sampel larva diambil pada umur 1. 4.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. Ketut Mahardika.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. histologi. 2. 3. Tetapi tingkat sintasan yang didapatkan masih rendah. 15. KATA KUNCI: pemeliharaan larva. Indah Mastuti. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas.8%-41. manajemen air media pemeliharaan dan manajemen pakan.

tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. 10%. Pangasius hypophthalmus . Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. 10%. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. survival rate. catfish seed. 15%. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. dan 20% dalam pakan. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). 5%. Oleh karena itu. Oleh karena itu. Hasil penelitian menunjukkan bahwa nilai bobot akhir. Sumber protein utama pada pakan adalah tepung ikan. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. dan siklus kedua menggunakan larva dengan kekebalan bawaan. Pakan penelitian berupa pelet kering dengan kandungan PST 0%. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR). Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). Salah satu sumber protein alternatif adalah protein sel tunggal (PST). (pakan kontrol). Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. Lies Emmawati*). Pakan diberikan 2 kali secara “adlibitum”. Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin.651 ekor benih untuk setiap induknya. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. laju pertumbuhan spesifik. dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya.Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. perlu alternatif lain sebagai substitusi tepung ikan. Ketut Suwirya.05).4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. KATA KUNCI: innate immunity. 15% (P>0. dan ketiga menggunakan larva tanpa kekebalan bawaan. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). siklus pertama. Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. Tingkat kematian larva dapat mencapai 40%–80%.797–457. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. di lain pihak hasil tangkapan cenderung menurun. KATA KUNCI: protein sel tunggal. akibat serangan penyakit dan kondisi media. pertambahan bobot. Kematian larva umumnya terjadi pada hari keempat. I Nyoman Adiasmara Giri.

Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4. Data diperoleh dianalisis sidik ragam. Ikan uji yang digunakan berukuran 2 ± 0.75±0. diikuti salinitas 2‰ (28. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal. C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati. Ikan patin sebayak 15 ekor. Pakan diberikan 3 kali sehari secara at satiation.763±0. dan sintasan . KATA KUNCI: fitase . Pangasius djambal. Dade Jubaedah.3%) dan pakan D (80.49 cm).4%).3%). Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin.140±0.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN. yang dilanjutkan dengan uji Tukey. Analisis data dilakukan secara deskriptif.17% per hari menjadi 1. selama 30 hari.46% per hari. D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase).4%) berbeda nyata lebih tinggi dibanding pakan E (68. kemudian salinitas 3‰ (4.910±0.0%). Ade Dwi Sasanti. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm. Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan. ikan patin. Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter. pakan B (82.1%) dan pakan E (95.5 g/ekor.204±0.32% per hari menjadi 4.35±0.8%). Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3. dan salinitas 1‰ (3. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya.00%). Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan.1%). sedangkan laju pertumbuhan panjang harian meningkat dari 1. KATA KUNCI: salinitas. Parameter yang diamati adalah laju pertumbuhan panjang badan.223±0.884±2. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan. Pangasius hypopthalmus Mohamad Amin. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak). dan (C) 3‰ dengan tiga kali ulangan.93%) dan terendah salinitas 3‰ (25. pakan A (82.764±3.114±0. sintasan serta beberapa parameter kualitas air. pakan C (98.07 cm). Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰. benih. Kecernaan P pakan B (98.674±2. (B) 2‰. Kecernaan protein juga meningkat akibat penambahan enzim fitase.14%). dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor.1%) berbeda nyata lebih tinggi dibanding pakan D (97.13% per hari.92 cm).010±0. Kecernaan protein tertinggi berturut-turut pakan C (82.2%).25±0. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. dan A (98.

51 g dan 11. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.9%). Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan dan sintasan ikan. Pupuk anorganik + organik + probiotik dan C. B (660 g). Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. dan C (10 ekor/m2) dengan 3 kali ulangan. betok.2%. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. penetasan telur dan pemeliharaan larva di kolam. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. yaitu antara 13. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masing-masing perlakuan: A. ikan patin. udang liar) serta jenis serangga air.7.37 cm C 16. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2). Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. dan Syafrudin Balai Budidaya Air Tawar. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia. lahan marjinal . Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut.60±10. nila.19±0.49±1. Akmal. Kata kunci: Intensifikasi. dan C (95. KATA KUNCI: budidaya.2%). Patin Siam. Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam.3 g) dan SR perlakuan A (91. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan. Sularto. sepat.27±0. Padat tebar larva yang digunakan adalah 100 ekor/m2. Pemberian pakan dengan pelet apung sebanyak 5% per hari. Pupuk anorganik + organik.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari.5-26. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. B (7 ekor/m2). dan C (613.5%-9. predator yaitu antara lain: Ikan liar (gabus.42±0.08 g dan 3. sintasan ikan. Pemupukan. B (95. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g).12 g dan 3. 0.74±0.26 cm. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan.31 cm B. 0. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk. Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah.7% rendahnya sintasan ini diduga karena adanya faktor hama. Jika luas gambut Indonesia adalah 20 juta ha. namun perlakuan B (7 ekor/m2) memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95. Larva yang ditebar berumur 20 jam setelah menetas. pengecekan induk. Pupuk anorganik + organik yang difermentasi + Probiotik. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut. pemijahan. belut. B.5 juta ha (rata-rata 20 juta ha). Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11.5). komposisi pakan alami kolam.

76%).52%) dan terendah pada 20 ekor/m2 (91. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95. Percobaan dilakukan selama 100 hari pemeliharaan.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES. JAWA TENGAH Ongko Praseno*).10%/hari. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin. diikuti dengan kepadatan 10 ekor/m2 (92. Evi Tahapari.5 m. Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. Evi Tahapari***). Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%. nasutus .45 g).30%). Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1. Padat tebar yang digunakan adalah 5. di samping itu. Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.09 cm dan 1.06%) dan terendah pada kepadatan 20 ekor/m2 (7.74 g) dan 20 ekor/m2 (61.54 g dan panjang awal antara 10.76 cm dan 2.47 g). pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela. sedangkan petakan kedua ditebar sebanyak 2.70–20.000 ekor atau kepadatan 10 ekor/m2. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt.60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97. Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih. Jakarta **) Balai Riset Perikanan Bididaya Air Tawar.000 ekor atau kepadatan 5 ekor/m2. 15 dan 20 ekor/m2 dengan bobot awal antara 15.17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya. dan Sularto***) *) Pusat Riset Perikanan Budidaya. pertumbuhan.18) dan terendah pada 10 ekor/m2 (1. Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. 10.80%. Kata kunci: padat tebar. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99. 15 ekor/m2 (70.71). KATA KUNCI: patin pasupati.43–11. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah. dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3.36 cm. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2. salinitas. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari.46 g). pertumbuhan. Sifat biologi pertumbuhannya belum banyak diketahui. Zafril Imran Azwar**).

Perlakuan kedua adalah padat tebar: 5 ekor/L. kemudian dosis 0. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air. dan (C) 0.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*). Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. Kata kunci: uji tantang Aeromonas hydrophila. Parameter yang diamati adalah insidensi dan sintasannya. dosis.003 mg/L (4. 10 ekor/L. diikuti dosis 0.001 mg/L. KATA KUNCI: probiotik. benih. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo.67%). Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0. dan 15 ekor/L. dan kontrol. Ikan uji yang digunakan berukuran 3–4 inci. kemudian perlakuan dosis 0. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. yaitu: cara perendaman dan cara penyuntikan intraperitonial. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan pertumbuhan . Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal. (B) 0. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan. Nurbakti Listyanto*). sintasan.002 mg/L (4.35 cm).67%).002 mg/L (83.001 mg/L (86. Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0. 108. Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar. sebagai perlakuan yaitu: (A) 0. Bogor ***) Pusat Riset Perikanan Budidaya. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.003 mg/L dengan tiga kali ulangan. 107. Pengamatan dilakukan selama 15 hari setelah perlakuan. dan kontrol (placebo). dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya. intraperitonial.001 mg/L (4.49 cm).003 mg/L (81.33%) dan terendah perlakuan dosis 0. Jakarta **) Balai Besar Riset Perikanan Budidaya Laut. Probiotik diberikan dengan dosis yang berbeda. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*). Angela Mariana Lusiana**). Sukamandi. Uji tantang dilakukan dengan dua cara. Ikan uji yang digunakan berukuran 1–2 inci.60 ± 0.14 cm). 109.002 mg/ L.55 ± 0. 108. perendaman. Evi Tahapari*). 106.35 ± 0. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Analisis data dilakukan secara deskriptif. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air.

berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. Ukuran panjang total larva yang baru menetas berkisar 3. artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai.700–4. yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. 50% ampas tahu:50% tapioka. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologi-reproduksi berkaitan dengan kapasitas produksinya.41±0. substitusi protein 2.52% (pakan B). tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm. ampas tahu. yakni pengamatan perkembangan gonad dan fertilisasi. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus. substitusi protein 0% (kontrol) (pakan A).130–22. Ke dalam wadah ditebar ikan patin ukuran 11.58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium. 75% ampas tahu:25% tapioka. dan substitusi protein 6.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati. dan 25% ampas tahu:75% tapioka.250–1.03% (pakan C). Penelitin ini terdiri atas dua tahap. tahap 3 (granula kuning telur) dengan diameter oosit 700–1.900 µm. Perkembangan oosit patin nasutus bersifat sinkronis grup. substitusi protein 4. larva. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin.000 µm. Derajat penetasan patin nasutus berkisar 44.700 µm. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur. Aspergillus niger. Bambang Iswanto. ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11.16%–79. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. KATA KUNCI: fermentasi. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. Zafril Imran Azwar. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129.850 µm. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. hatching. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar.05% dengan lama inkubasi 22–25 jam. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu. dan tahap 5 (atresis) dengan diameter oosit 300–1. Pangasius nasutus .03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai. rearing.04% (pakan D). KATA KUNCI oosit.

45 g/ekor. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih.24) x 103.01±0. 25% zeolit + 75% bioball.47±0. 89.03±0. 1.84 g/ekor dan terendah A. tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus.33%. dengan kantung kuning telur berukuran 0. 75% zeolit + 25% bioball. C.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam. C. dan D. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D.67%.28%. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1.6±0. larva. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var. 0. C.31ab. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat. 4. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER. 92. 2. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE. C.56 cm/ekor. biofilter. 1.1. nasutus .71±0. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya.35 cm/ekor dan A. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa. berukuran panjang total 3.42±0.20. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi. B. hibrida.1±0. 95. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi.64±0. diikuti perlakuan B.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. masing-masing perlakuan diulang sebanyak empat kali.58%.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0. siam.60 cm/ekor.62 g) dan panjang (2. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut.89±0.75% dan terendah perlakuan A. 2.98±0.69 cm/ekor diikuti B. diikuti perlakuan C. C. 1. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian. 1.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A. 0. 75. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A. B. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D. 79. 4. dengan kantung kuning telur berukuran 0.02 g/ekor.30ab. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D.34±0. berukuran panjang total 3. KATA KUNCI: patin albino. 91. sedangkan patin hibrida siam-jambal sebesar -4.01±0. 88. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.23%. jambal.30a. 88.08 mm3 yang terserap 50% pada umur 30 jam dan habis terserap pada umur 60 jam. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER.10–1. Kata kunci: embriogenesis. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus.25 g/ekor. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi. dan D. B.20 mm. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi. 0.13 mm. pertumbuhan.43b. 50% zeolit + 50% bioball dan D. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A.42.54 cm).27a. 100% zeolit B.14 mm.

21% dan 26%. Pakan tersebut digiling ulang.27 g N untuk pakan berprotein 17%. Oleh karena itu. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. ikan bandeng. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. produksi. heterotrof bakteria . dan 3. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Neltje Nobertine Palinggi*).6%–83. Akhmad Mustafa. Dedi Jusadi**).2% untuk bahan kering. Eddy Supriyono**). Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. Oleh karena itu. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2. lama pemeliharaan ikan bandeng. milk fish. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). KATA KUNCI: feed digestibility.0% untuk protein dan 81.6%–90. N waste. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone. Hasil penelitian menunjukkan bahwa. dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur.1% untuk C-organik.76 g N untuk pakan berprotein 21%.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. lalu ditambahkan kromium oksida (Cr2O3) sebagai indikator kecernaan. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. Maros **) Fakultas Perikanan dan Ilmu Kelautan. Jika bioflok terbentuk. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok. Untuk menentukan total limbah N termasuk eksresi amonia. 88. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak.2%–78. 2. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). lama ikan bandeng digelondongkan. dan Anugriati Balai Riset Perikanan Budidaya Air Payau.28% untuk pakan berprotein 26%. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein pakan yaitu 2.2 kg/ha/musim. tambak. diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%.990 kg/ha/musim dengan rata-rata 292. padat penebaran udang windu. Enang Harris**). KATA KUNCI: pengelolaan. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok).

Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol. Penyusun utama bioflok ini adalah bakteri heterotrof. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya.54% per tahun kurun waktu tahun 2005–2009. bandeng. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan. Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya. Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475. Dedi Jusadi**). KATA KUNCI: budidaya.66% dari tahun-tahun sebelumnya. Eddy Supriyono**). Oleh karena itu.000 ton dan mengalami kenaikan rata-rata 13. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L. PATI. dan Rasidi Pusat Riset Perikanan Budidaya. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. dan Pekalongan. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. kendala.726 ha dan yang layak untuk budidaya sekitar 6.) cenderung meningkatkan kandungan asam amino bioflok. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12. (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL. Penambahan inokulasi bakteri komersial (Bacillus sp.000 ton dan mengalami kenaikan sebesar 14.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). KATA KUNCI: Heterotrofic bakteria. Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). Molase digunakan sebagai sumber Corganik.250 ton. (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL.975 ha. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. Enang Harris**). Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng. opsi kebijakan . DAN PEKALONGAN ) Anjang Bangun Prasetio. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. Pada tahun yang sama. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. Pati. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Hatim Albasri. growing. Khususnya di wilayah Pantai Utara yaitu Kendal.

Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi.34%) dan DP (63.67%).65%.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. Hasil penelitian menunjukkan bahwa DKH-e (63.00±1.67%. Data dianalisis secara deskriptif. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi. dan heat shock-GFP berturut-turut adalah 20.03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi. HEAT SHOCK DAN KERATIN PADA IKAN LELE.33%.34±1. Gusrina*).0±0. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan.0%). Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji. menyusul heat shock-GFP (10. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0.66±1. ikan lele . Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi.63±10.0±10. Fakultas Perikanan dan Ilmu Kelautan. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi. Ekspresi gen gfp tidak tampak lagi pada saat telur menetas. DP untuk â-aktin-GFP. Komar Sumantadinata**). GFP. dan 15.33±3.00±1. Clarias sp.65%) dan heat shock-GFP (18. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. sedangkan DP dihitung ketika semua telur telah menetas. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. Alimuddin**). Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA). FMIPA.3±0.Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN. KATA KUNCI: promoter. mikroinjeksi.33±1.****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan. dan Utut Widyastuti***).0%) dan yang terendah â-aktin-GFP (3. keratin-GFP (21.0%). sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik. keratinGFP. Konstruksi gen dalam bentuk plasmid mBA-gfp. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20. Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10. DKH-e dihitung sebelum telur menetas. 18.66%) relatif sama.00±3. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur. DKH-e yang diinjeksi dengan â-aktin-GFP (25.

Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. aerasi.74±1. Pemberian pakan sebesar 5% dari biomassa per harinya.53%) (P<0. Kandungan bahan aktif hasil pengekstrasian pegagan segar. ikan lele dumbo (Clarias gariepinus).. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus). dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. 0.47±4. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang. 6. Ikan lele dumbo berukuran 41.05). bahan aktif. pakan tenggelam. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani.23% kadar abu tak larut asam. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus). Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna.05) dari 79. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%.53% menjadi 92. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5. Angela Mariana Lusiastuti. pegagan Centella asiatical [L] Urb.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB.39% kadar asiaticosid. Feces yang dihasilkan diambil setiap hari. Rita Febrianti. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif). KATA KUNCi: A. pagi dan sore. pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. Taukhid.37% kadar abu.33% kadar sari dalam air. hydrophila menjadi penyakit endemis di Indonesia. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo.15%) dibandingkan dengan pakan tenggelam (yakni 79.83% kadar sari dalam alkohol. pakan terapung .623. Pada perlakuan tanpa aerasi.71±2. 5. 1.47±4. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0.41 mg/L) dengan dosis efektif 250 mg/L.34% kadar air. Bak diisi air sebanyak 100 liter. Melalui penambahan aerasi.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak. hydrophila. 39.30±2.25% sehingga tidak berbeda nyata dengan pakan terapung. 24. KATA KUNCI: kecernaan pakan.

Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11.10 g sebanyak 40 ekor. dan gonad .8–4. pH. dan karbondioksida). tapioka.0 m x 0. Sulasy Rohmi. Siti Subandiyah. formulasi.33±0.Forum Inovasi Teknologi Akuakultur 2010 FF 45 PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus) Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25.90%. Jenis pakan berupa cacing tubifex.8 m.3–3. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. 7. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. oksigen. Laju pertumbuhan spesifik. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9. reproduksi.7 cm mencapai TKG III. fermentasi.96%. penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7. amonia. 10. dan molase. KATA KUNCI: maggot.92%. bloodworm. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2. dan 25. KATA KUNCI: gurame coklat.0 m x 1.85%. kualitas air (suhu.56%. panjang. Setiap perlakuan dengan 3 ulangan. dan perkembangan gonad). Wadah percobaan yang digunakan adalah bak beton ukuran 1.28%. dan 30 g/40 liter masingmasing diulang 3 kali. dan penurunan lemak 61. ikan. 19.1 cm. dan dirancang sistem resirkulasi. dan Darti Satyani Balai Riset Budidaya Ikan Hias ABSTRAK Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. 20. dari perlakuan kontrol. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol). alkalinitas.83% tidak memperlihat perbedaan dengan perlakuan kontrol.81% dalam formulasi pakan. dan cuk yang diberikan diselang-seling secara adlibitum. lele dumbo FF 46 ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA Tutik Kadarini. Parameter yang diamati sintasan dan pertumbuhan (bobot. 13.

Mycobacteriosis. 14% dan kontrol yakni masing-masing 79. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0.86%.26). Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0.05%. Perlakuan yang diterapkan adalah kadar protein 38%. Induk gurami yang digunakan berbobot 2-3 kg/ekor. dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. produksi telur per sarang.13 buah) dan hanya daun sente (0. lebih rendah dibandingkan dengan yang diberikan pakan tambahan berkadar protein 33%. dan injuk sebagai bahan pembuat sarang. 28. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. PCR FF 48 PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI Bambang Gunadi. sehingga petani tidak mengalami banyak kerugian. KATA KUNCI: ikan gurame. yaitu seperti daun talas. Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp.774 butir per sarang. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. daun sente. dan 14% sesuai dengan label pada kemasan masing-masing. Mycobacterium fortuitum.5 buah).) DI JAWA Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya.88 buah. dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10. biokimia. keragaan reproduksi . Sukamandi ABSTRAK Ikan gurame termasuk ikan dengan fekunditas rendah. Dari hasil penelitian menunjukkan bahwa di daerah Blitar. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92.730 butir. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. Lamanto. dan 71. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa.09). namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0. Masing-masing perlakuan mempunyai 2 ulangan. yaitu di Jawa timur (Blitar dan Tukung Agung). Pemberian pakan tambahan dengan kadar protein 38%. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang).Forum Inovasi Teknologi Akuakultur 2010 FF 47 APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC. Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman. dan tingkat fertilitas telur yang dihasilkan. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan.94% (P=0.23% dibandingkan dengan pemberian pakan dengan kadar protein 33%. Pakan yang diberikan berupa daun sente sebanyak 3. Jakarta ABSTRAK Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. Pemberian pakan hanya daun sente diterapkan sebagai kontrol.5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan.75 buah.351 butir. 4. Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. KATA KUNCI: fish TB. 33%. pakan buatan. penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat. yakni 0. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum.546 butir dan 2. 33%.

33%. dan selanjutnya polar dan dedak padi. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. Wadah percobaan yang digunakan yaitu akuarium volume 100 L. dengan ditandai tumbuhnya koloni transforman berwarna putih. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen.05) dengan dedak padi tanpa fermentasi. dedak polar. dedak padi fermentasi. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. Reza Samsudin. retensi protein. dan polar fermentasi. dengan padat penebaran ikan uji 30 ekor per akuarium. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. polar.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan berbeda nyata (P<0. retensi lemak. mud carp sebesar 1127 bp. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5.3’). oligosphorus. KATA KUNCI: R. protein efisiensi rasio. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi. Kadar protein polar naik 38. fermentasi.28%. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ –GATGAAACTCGAGTAGCCCTTGCTCTTC.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG.67%–100%. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. ikan mas . dan koloni berwarna biru tidak mengandung DNA sisipan.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T.05) dengan perlakuan lainnya. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. pertambahan bobot relatif. polar. oligosporus yaitu 2. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. dan sintasan. Sintasan ikan uji berkisar antara 96. yang menunjukkan terbentuknya plasmid rekombinan. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. dan 6 hari. Retensi lemak tertinggi (35. Retensi protein dedak padi fermentasi. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi.02% sedangkan kandungan lemaknya turun 13. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas.14% dan kadar lemaknya turun sebesar 19. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp. Parameter yang diuji meliputi bobot akhir rata-rata. 4. Kandungan protein dedak padi naik 19. dedak padi. Bogor dan terdiri atas dua tahap. dan pada Silver carp sebesar 1123 bp. dan polar fermentasi berbeda nyata (P<0.47 g/ekor. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari.

karena akhirakhir ini banyak lahan yang tidak digunakan (marginal). Sedangkan sintasan. ukuran panen. Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. sintasan. dan ikan mas galur majalaya sebesar 0. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia.64 kali lebih banyak dengan ukuran panen 1. salinitas rendah. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. akuaponik. Penelitian telah dilaksanakan dari bulan Nopember 2009—Pebruari 2010.28 g/ ekor yang digunakan sebagai hewan uji. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. sawah. Achmad Sudradjat. sedangkan yang lainnya sebagai kolam konvensional.86 g/hari.15 g/hari. Sutrisno*). apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. ukuran panen. Di mana satu di antaranya di desain sebagai kolam akuaponik. kemudian ikan mas galur kuningan sebesar 1. Ongko Praseno. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. Lilis Sofiarsih*). Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar.41 g/hari. Provinsi Banten.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. tambak . wildan. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1. dengan lokasi penelitian di Desa Kronjo. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. serta keramba jaring apung di danau maupun waduk. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. Kabupaten Tangerang. Benih ikan mas ukuran 18. KATA KUNCI: ikan mas. Data setiap sampling dijadikan ulangan. KATA KUNCI: ammonia. pertumbuhan. dengan padat tebar 20 ekor/m3. dan parameter kualitas air yang lain dianalisis secara deskriptif. Parameter yang diuji adalah kualitas air terutama kandungan ammonia. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2.25 kali lebih besar dibanding pada kolam konvensional.

Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata. Siti Zuhriyyah Musthofa. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian. dapat dikembangkan di bak terkontrol maupun di KJA.067mg) serta kelangsungan hidup (12. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. cobia larvae. Masing-masing perlakuan diulang 3 kali.07%) relatif lebih tinggi dari pada perlakuan B dan C. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam. kemudian diberikan sebagai pakan larva. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung.58 cm dan 17. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2.42%. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat. Hasil penelitian menunjukkan bahwa pertumbuhan panjang. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. (B) umur 10 hari dan (C) umur 15 hari. Afifah. Siti Zuhriyyah. serta mempunyai respons yang baik terhadap pakan buatan. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik. fry performance. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien. dan Afifah Balai Besar Riset Perikanan Budidaya Laut.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). KATA KUNCI: survival rate. memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. lasted time feeding . growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. KATA KUNCI: artemia nauplii.

Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan.Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). plasma nutfah . Herno Minjoyo*). KATA KUNCI: cobia. Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera. KATA KUNCI: ikan hias. Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. Lebih dari 100 spesies. komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Stakeholder. Lucky Marzuki Nasution*). budidaya. dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan.

Peacock bass ini akhirnya berenangnya jadi terbalik. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. diam dan kepalanya menyembul tepat di bawah permukaan badan air. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. peacock bass. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan. KATA KUNCI: Synodontis nigriventris. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. Eni Kusrini*). Depok ABSTRAK Deformity (dysmorphism. Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. dan yang terendah Moina. dan selalu berusaha mendekati sumber oksigen (aerator). Deformity dapat disebabkan oleh : mutasi genetic. dan Tubifex sp.226 g. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. Afrika.778 cm. infeksi penyakit (cacing. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. multifocal granuloma . pertumbuhan. karena belum banyak yang membudidayakannya. Tubifex sp. pakan alami. KATA KUNCI: deformity. bakteri. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh. granuloma. kondisi daya dukung lingkungan yang terus menurun. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias.. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. diikuti Artemia. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS.Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*). Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. laju pertumbuhan harian sebesar 32. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva.586%. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. dengan 6 kali ulangan. Artemia sp. virus). dan pertambahan panjang total sebesar 1..

Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF). T2.Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. yaitu : astaxanthin. zat pemicu warna. wortel dan tepung kepala udang. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. T3. Hewan uji yang digunakan berukuran panjang total 5. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. 20 ekor/bak. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF.50 g.9 ± 0. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm.3 cm dan bobot 2. Bastiar Nur. Jhon Harianto Hutapea. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai Sulawesi Tengah. Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. Hasil penelitian menunjukkan. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. Rainbow Papua . induk diberi pakan berupa naupli artemia/artemia pra dewasa. dan Ahmad Musa Balai Riset Budidaya Ikan Hias. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. Variabel yang diamati meliputi. 40 ekor/bak. 60 ekor/bak. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. KATA KUNCI: maggot. Selama penelitian. KATA KUNCI: banggai cardinal fish. density.87 ± 0. udang jembret (mysids) dan larva nyamuk.

55. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. media air.67%). pertumbuhan panjang.05). AB (aqua+blitz ich). AO (aqua+oksitetrasiklin). 20. sintasan. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air. KATA KUNCI: benih botia.5 x 0.05).6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. dan blitz ich) akan dilakukan melalui rancangan faktorial.5 cm (ukuran ekspor). Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium. ukuran ekspor 1 inci (2. AF (aqua+formalin).5 m dan tinggi air 40 cm.67%). 35. dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich). Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. larva Tetraodon palembangensis . Nina Meilisza.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. KF (71. Pada akhir penelitian (hari ke 105).5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari.009 gram. Masing-masing perlakuan dilakukan dengan 3 ulangan. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis). 70. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. KF (air kontrol+formalin). KATA KUNCI: prophylaksis. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. oksitetrasiklin. namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis. Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0. KO (air kontrol+oksitetrasiklin).0 cm. namun tidak berbeda nyata dengan perlakuan AO (81.67%).33%. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian.0 cm dan bobot rata-rata 0.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza.5 x 0. Selama pemeliharaan. dan 105 dan dianalisis secara deskriptif.5 cm dan panjang tertinggi sebesar 3.67% namun tidak berbeda nyata dengan perlakuan AB (55%). Sintasan terendah dihasilkan oleh perlakuan KB sebesar 51. I Wayan Subamia. KO (76. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. dan Lili Sholichah Balai Riset Budidaya Ikan Hias.

hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur. KATA KUNCI: Neocaridina heteropoda. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan.6°C–29. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin.4°C. masa inkubasi .31% dan menghasilkan larva normal sebanyak 218 ekor.75 mL/kg untuk induk betina di bagian intraperitoneal. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina. perkembangan embrio. inkubasi telur dan perawatan larva. aligator (Lepisosteus oculatus). Depok ABSTRAK Ikan palmas (Polypterus sp. tiger catfish (Platysoma sp. SR (0-10 hari) 83.5 ml/kg untuk induk jantan dan 0. KATA KUNCI: palmas albino. penyuntikan hormon.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy. Asep Permana. Pemijahan tersebut terdiri atas seleksi induk. polypterus senegalus albino. Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias. dan Bastiar Nur Balai Riset Budidaya Ikan Hias. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol. daya tetas telur 80.15%.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. antara lain sinodontis (Synodontys sp. platidoras (Platydoras sp). Asep Permana.91%. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. namun belum banyak diketahui data embriologinya. sehingga produksinya masih mengandalkan impor dari luar negeri. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. pembuahan. Ikan palmas jenis albino (Polypterus senegalus var. memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan.). dan red-fin shark (Ephalzeorhynchos sp. Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73.).). albino) masih sulit untuk memijah dalam wadah terkontrol. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0.

Rina Hirnawati. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungaisungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor. Kepadatan 10 ekor induk dengan bobot 65–600 g. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air. dipelihara selama 6 bulan. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka. implantasi. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai.1630 g dan dua ekor induk jantan yang berukuran panjang 1. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A).5 cm dengan bobot 0. dan Darti Satyani Balai Riset Budidaya Ikan Hias. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya). LHRH 100 mg dan testosteron 50 mg (B). budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah.725 pg/mL. Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm. oocyt . Rendy Ginanjar. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. Pada ikan yang baru di domestikasi. KATA KUNCI: induk.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana.9 cm dengan bobot 0.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20. dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. Asep Permana.1272–0. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah. sedang induk jantan belum ada yang mengandung sperma.042 pg/mL. Udang diberi pakan berupa moina beku sekali dalam setiap hari.3–2. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. Tutik Kadarini. hormon.7–1. KATA KUNCI: Neocaridina heteropoda. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2. LHRH 50 mg dan testosteron 50 mg (C). panjang 40– 60 cm. matang gonad.0518 g. Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks. Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi.0488–0. murah dan aplikatif.

Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2.000 mg/kg). guppy fish . Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. KATA KUNCI: bunga tai kotok. because of residual effects to human caused cancer.6%).71%. The concluded that the optimum dose to produce male guppy is 50 mL/L. carotenoid. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. The research was conducted experimental with completely randomized design. 25 mL/L. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method. The proportions test showed dose 50 mL/L have significant different to control. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan.07 ± 9. Based on LSD test. kemudian dipisahkan antara tangkai dan kelopaknya. male.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. suhu. chrysin. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. yeast (30–800 mg/kg) dan sumber lainnya. the treatments gave significant different with control. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. KEYWORDS: honey. The result showed that the percentage of male guppy at 50 mL/ L is 64. The observation to sexual secondary characteristic guppy can be observed at least two months old. Honey is a natural substance which have crysin. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. and 75 mL/L. the alternative masculinization application of natural substance like honey. but between treatments not significant different. Therefore. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control). as the curative effort is not applicable. 50 mL/L.000-4. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam.05 significant level.

diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor.945–350. substitusi. Maros ABSTRAK Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang. diameter telur. guttatus .05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0.0 m dengan kepadatan 24 ekor/bak. Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor.837–344. KATA KUNCI: tepung ikan. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. Lama penelitian berlangsung selama 6 bulan. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut. 1:3 (B&:@&). Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22.Forum Inovasi Teknologi Akuakultur 2010 FF 69 PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau. diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%. S.865–335. jumlah telur 272. rasio (1:3) jumlah induk memijah 35 ekor.837 butir/ekor. semua induk secara individu dalam keadaan TKG=O. jumlah telur. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah.534–393. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&). pemijahan. diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus).333 butir/ekor. jumlah telur 129. Maros ABSTRAK Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. pakan ikan beronang. diameter telur. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap. 1:2 (B&:@&).975 butir/ekor. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama.05) dengan rasio efisiensi proteinnya. daya tetas telur FF 70 SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0. Siganus guttatus Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. jumlah telur. tepung rumput laut.140 butir/ekor. jumlah telur 227.5 m x 1. Peubah biologis yang diamati meliputi: jumlah induk memijah. dan 2:1(B&:@&). B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor. jumlah telur 237.pada induk beronang. dan daya tetas telur. KATA KUNCI: Siganus guttatus. Induk dipelihara dalam 8 buah bak berukuran 1.05±6.4 g dengan padat tebar 15 ekor/keramba.5 m x 1. rasio (1:2) jumlah induk memijah 30 ekor. Pada awal percobaan.

Gondol ABSTRAK Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali.2. Dari pemeliharaan udang selama tiga bulan. marine chlorella. oculata relatif rendah (3. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Nannochloropsis oculata.1±0. 100. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1. Empat petak tambak masing-masing berukuran 3. sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Pemeliharaan dilakukan selama tiga bulan. Karawang FF 72 PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut. yaitu pertambahan berat rata-rata 230 g. Sebelum penebaran.1 kg dan sintasan 11. Setelah dua hari. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. semi-continuous system . Tingkat total ammonium terlarut dalam air laut produksi masal N. dilakukan pengolahan tanah tambak. Karawang.3–8.6%) dengan rasio DHA/EPA hanya 0. KATA KUNCI: udang windu. Pemadatan (flokulasi) N. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34.8 kg dan kelangsungan hidup 100%. produksi 81.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya.5 g.Forum Inovasi Teknologi Akuakultur 2010 FF 71 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. Kecamatan Cilebar. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368. oculata 13. kemudian dikeringkan sekitar satu minggu. penebaran dilakukan setelah satu bulan dari penebaran tokolan. rotifer Brachionus rotundiformis. oculata relatif tinggi (4.2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. tokolan. 427. produksi 78.2%. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. yaitu menggunakan tingkat teknologi tradisional plus.04 juta sel/mL dan rotifer 186±5. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. dan Wartono Hadie Pusat Riset Perikanan Budidaya.n pengapuran sebanyak 175 kg/petak. Penelitian ini dilakukan pada tambak di daerah Betok Mati. pada bulan pertama udang tidak diberi pakan. salinitas rendah. Idil Ardi. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. KATA KUNCI: pakan alami.5–50 m3 dengan rata-rata kepadatan akhir N. oculata dengan NaOH dosis 75.500 m2 digunakan untuk percobaan. Dengan teknologi yang diterapkan.

79 g/ekor. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. Padahal dalam upaya peningkatan produktivitas perikanan budidaya. suhu dipermukaan bumi akan turun secara drastis. dan 17. sintasan. (B) 9%. dan (C) 13%. konservasi . KATA KUNCI: pemuliaan. Siganus guttatus FF 74 ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA Lies Emmawati Hadie Pusat Riset Perikanan Budidaya. dan 13% dalam pakan berpengaruh tidak nyata (P<0.0 m x 1.3 ± 10.0 m. Jakarta ABSTRAK Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. KATA KUNCI: kadar lemak. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. yang ditempatkan pada keramba jaring apung di laut. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%. plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. Pemberian pakan dilakukan 3 kali/hari (pukul 08. Jika tidak ada efek rumah kaca. ikan langka. karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Wadah penelitian yang digunakan adalah jaring berukuran 1. masingmasing terdiri atas 3 ulangan. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia. budidaya.00.2 ± 0. ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari.0 m x 2.67 cm/ ekor dan bobot 155. Maros ABSTRAK Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi. juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global.Forum Inovasi Teknologi Akuakultur 2010 FF 73 PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus) Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau. pertumbuhan. Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali.00). Hasil penelitian menunjukkan bahwa kadar lemak 5%. Permasalahan ini perlu dipikirkan solusinya. 9%.05) terhadap pertumbuhan dan sintasan ikan beronang. 11.00.

Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. dan insang. Red Fin Albino. KATA KUNCI: kesesuaian lahan. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. Trematoda). Oleh karena itu. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. Kualitas air perairan yang diukur adalah: pH. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. kapiat albino. keramba jaring apung. sympilum dan Characidae. fosfat. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. cat fish. kecerahan. (metacercaria. (Copepoda) dan Centrocestus sp. neon tetra. penyakit. kedalaman. Pulau Bekengkeng. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. dan besi. perairan Papalan. dan platydoras. dan Ichthyophthirius multifiliis (Ciliata). Gyrodatylus spp.Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. (Dinoflagelata). salinitas. Argulus sp. 98% terinfeksi parasit. sirip. budidaya laut. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. kecepatan arus. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. cukup sesuai 512. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698.59 ha. 2009. mas koki. dan Dactylogyrus spp. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. perairan Kalukku. KATA KUNCI: ikan hias air tawar.41 ha dan kurang sesuai 52. Pulau Kambunong. Akhmad Mustafa. Synodontis. Sampel ikan hias antara lain dari golongan cyprinidae. arah arus. Trichodina sp. Chiclidae. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang.18 ha. parasit . Dari Sampel yang diperiksa 33. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut.18 ha yang terdiri dari sangat sesuai seluas 133. (Monogenea). nitrat. dan Tanjung Dapuran.

pestisida.98 ton/bulan. Cd. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. Cd. pencemaran. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. Organofosfat. inlet. muara Sungai Cisokan. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB.8214 ton/bulan dan 1. identifikasi dan analisis data serta pelaporan. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. muara Sungai Citarum. serta debit air dari muara sungai yang masuk ke perairan waduk. dan Karbamat. Variabel yang diamati adalah konsentrasi kandungan Pb. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan.86 ton/bulan. KATA KUNCI: lahan perikanan budidaya. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. Piretroid. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42.88 mg/L/kg daging ikan. preparasi. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. Cd. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. sedimen (lumpur/tanah). Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. dan Zn dalam air dan daging ikan. Contoh yang diambil berupa air. Perairan Waduk Cirata sudah tercemar oleh parameter Zn. residu . badan air Sungai Citarum dan Sungai Cimeta. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. Tahapan penelitian meliputi: penentuan lokasi. batas daerah bahaya. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. CD. zona 2 Purwakarta. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. KATA KUNCI: logam berat. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. pengambilan contoh. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet.

Bacillariophyceae.17-9. (13. 2–4.33. indeks dominansi (C) = 0.65–0. Cyanophyceae. KATA KUNCI: Glass eel. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik. A.nebulosa . PELABUHAN RATU. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton. dan nilai kemerataan (E) = 0.71–19.52) dikelompokan pada jenis A. Ciputri. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR.75–4887. selanjutnya digunakan untuk analisa genetik. dan sebanyak 150 ekor disimpan dalam alkohol absolut./L. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. dan Desmiceae dari zooplankton ditemukan jenis Rotifer. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. bicolor bicolor.n. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari. dan Protozoa.) DI PERAIRAN SUNGAI CIMANDIRI. pada region mitokondria 16SRNA. Pelabuhan Ratu. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. Patok Batas. Dinophyceae.072–0. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies.5 ind. Sungai Cimandiri. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat.75 ind.12–3. dikelompokan pada jenis A. Sukabumi. A. nebulosa. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae.35).83. Copepoda.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar.7) dikelompokan jenis A. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri. dan 4–6 m. Maleber.31. bicolor./L dan zooplankton berkisar antara 93. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu. KATA KUNCI: komunitas.marmorata. Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). A. Palumbon. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393.75– 993. fitoplankton. dan Cadas Bodas.marmorata dan (4.

Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya ABSTRAK Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. Titiek Aslianti*).01 mm. adalah dengan program pemuliaan. selanjutnya secara periodik 5 hari sampai dengan D-30. Osteochilus hasselti. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra. 25. kuning telur) dan 3 ulangan.. selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). 21. sirip perut (ventral fin). Gondol **) Mahasiswa Universitas Gadjah Mada. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan. dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut.20 g. rotifer.27 mm. terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. sirip dada (pectoral fin). dan 21. Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL). dan 17. meristik . Pemberian pakan awal di mulai saat larva berumur D-2—D-10.dan inter-populasi ikan nilem di Jawa Barat. Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata. dan 1790%) dan C (11. KATA KUNCI: ikan nilem. gonad kerang.99 mm.10 g. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan. B. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin). Dinar Tri Soelistyowati**).17%). pola pemangsaan FF 82 KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT Mulyasari*). Jogjakarta ABSTRAK Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. 27.97%) dibanding perlakuan A (10. pakan awal.Forum Inovasi Teknologi Akuakultur 2010 FF 81 POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN Afifah*). dan sirip anal (anal fin). Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2.94 g. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan. Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan. dan C. KATA KUNCI: larva ikan kuwe. namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.

000. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. ikan patin . Metode penelitian dilakukan secara studi kasus. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Parameter yang diamati yaitu pertumbuhan spesifik.-–Rp 7. Bogor ABSTRAK Pakan memegang peranan penting dalam budidaya ikan nilem. serta sintasan ikan. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari.Forum Inovasi Teknologi Akuakultur 2010 FF 83 EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. konversi pakan. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0.000.500. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. pakan FF 84 EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI. pertumbuhan. KATA KUNCI: efisiensi usaha.800. pakan buatan.-/kg. Bogor. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Balai Riset Perikanan Budidaya Air Tawar.56%. 19%.-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. protein.0±0.05). bahan baku lokal.05) yaitu sebesar 1. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Ikan dipelihara selama 40 hari. KABUPATEN BATANG) Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. Penelitian dilakukan di Kabupaten Brebes dan Batang.3 g/ekor. Jakarta ABSTRAK Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. KATA KUNCI: nilem. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0. dan 20%. Ikan uji yang digunakan adalah ikan nilem dengan bobot ratarata 5. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. Harga pakan hanya Rp 2.-–Rp 3.

Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2.1 m dan tinggi 0. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi.6±0. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. KATA KUNCI: penanganan calon induk.65±0. Irwan Setiadi. warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut. Gunawan. ikan tuna sirip kuning. Gondol ABSTRAK Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg).57±0. Pada beberapa jenis ikan. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2. hitam: 1.02). Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. hitam: 5. tengadak.4 m dengan panjang 2.02. sintasan FF 86 KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON Gleni Hasan Huwoyon.1 m3 (lebar 1. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir. Bogor ABSTRAK Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. Barbonymus schwanenfeldii. dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut.1±0. Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. Irin Iriana Kusmini.Forum Inovasi Teknologi Akuakultur 2010 FF 85 PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN Jhon Harianto Hutapea.06.19. dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar.5 m3 (diameter 2 m dan tinggi 0.8±1. pertumbuhan mutlak (merah: 6.30) dan laju pertumbuhan spesifik (merah: 0. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. hitam: 0. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). genetika . KATA KUNCI: warna.8 m) dan bak fiberglass berbentuk oval volume 2.20).7±0.7 m. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari.

Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator.05).Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan. bahan kering. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. B = Daun mengkudu + 2.06% khamir laut.5% molasses + 0. lemak kasar. E = Daun mengkudu + 2. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. pupuk . Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0. dan abu di antara perlakuan tidak berbeda nyata (P>0.5% molasses + 0. BETN. protein kasar.05).5% molasses + 0.5% molasses + 0. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu.00% khamir laut. Hasil penelitian menunjukkan bahwa: pH. R3 = Daun mengkudu + 2. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia). Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2.02% khamir laut.5% molasses + 0.08% khamir laut.04% khamir laut. Setelah kering. dan TSP. gula. KATA KUNCI: khamir laut. urea. Setelah 5 hari dipanen. silase. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan. serat kasar. Jepara. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu. daun mengkudu. Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau. R4 = Daun mengkudu + 2.01). dan energi di antara perlakuan berbeda nyata (P<0. Berdasarkan hasil penelitian.

Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara.5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA. penggunaan sarana produksi yang ramah lingkungan.000 ind. rumput laut.07. Sulawesi Selatan. tambak marjinal . rumput laut (2 ton/ha) dan tiram (20.000.000 ekor/ha) dan rumput laut (1 ton/ha). petak I ditebari bandeng (10. KABUPATEN TAKALAR Muharijadi Atmomarsono.000 ind/ha) dan petak II.000 ekor/ha. Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal. BL542 bulan III.000 ekor/ha). rumput laut (2 ton/ha) dan tiram (40. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. serta manajemen pakan dan air secara benar. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu. Brata Pantjara.46% dengan produksi udang windu sebesar 249.-/musim tanam dengan B/C rasio 2. KATA KUNCI: biofilter. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik. di mana termasuk cara budidaya udang.73% dengan produksi sebesar 217. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10.977. CBIB. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. bandeng (3. Pada akhir penelitian diperoleh sintasan 63. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram. udang windu.1 ton/ha/16 mg menjadi 1. Erfan Andi Hendradjat. KATA KUNCI: udang windu.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59.000 ekor/ha) dan rumput laut (1 ton/ha).000 ekor/ha). Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I. MY1112 bulan II./ha) dan petak II : bandeng (3. Perlakuan B. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram. ditebari bandeng (10.48 kg/ha.

Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial. Hasil penelitian menunjukkan.7 kg/ha/90 hari). NO2.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. production. tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani. KATA KUNCI: probiotik. menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. diikuti perlakuan kombinasi probiotik A (50. Sintasan udang windu tertinggi didapatkan pada perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. dan total Vibrio. Penelitian dilakukan di laboratorium basah. terutama salinitas yang mencapai 56 ppt.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11. MY1112 bulan II. Nurbaya. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol.7 kg/ha/90 hari). dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau. survival rate. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. sintasan. sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0. Penelitian dilaksanakan selama 90 hari. Balai Riset Perikanan Budidaya Air Payau. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak.05) pada akhir penelitian. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. Maros. PO4. Muliani. Oleh karena itu. KATA KUNCI: probiotic bacteria. total bakteri.8% dan 228.05% dan 298. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. kandungan BOT di atas 30 mg/L. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. NH3. Pengamatan sintasan udang windu dilakukan pada akhir penelitian. B) Pergiliran probiotik BT951 bulan I. Nurbaya. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak. BL542 bulan III. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masing-masing 3 kali dan lama pemeliharaan 10 minggu. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. (D2) kontrol 2. udang windu .35% dan 448. (C2) probiotik komersial dengan dosis pakan 50%. dan C) Kontrol (tanpa probiotik). Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana.11%. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah. air laut salinitas 28 ppt sebanyak 15 L. (C1) probiotik komersial dengan dosis pakan 100%. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT.7 kg/ha/90 hari). dosis pakan. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. NO3. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan NH3 selama penelitian relatif lebih tinggi pada perlakuan yang tidak menggunakan probiotik dengan dosis pakan 100%.

9 kg dan secara finansial memberikan keuntungan sebesar Rp 11. Selama pemeliharan tidak diberi pakan. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81. serta 99.masing-masing dengan dua kali ulangan. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an. Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari. KATA KUNCI: multitropik.4 ha.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto. Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu.000. Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). masing-masing terdiri atas 2 ulangan. produksi.000 ek/ha bandeng) menunjukkan hasil yang terbaik. dan pertumbuhan udang serta aman bagi konsumen. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0.5% dengan produksi 19. M. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. rumput laut. rumput laut dan ikan bandeng adalah perlakuan B (10. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp.9% dan 33.-/ha /90 hari. KATA KUNCI: probiotik. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya.000 ekor/ha). udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp. 31) yang ditebar pada masing-masing tambak adalah 10. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha). Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu. sintasan.500 m2 dengan kedalaman 80 cm.8% dan 63. Tokolan udang windu (PL. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok. Sampling dilakukan 30 hari sekali selama 90 hari. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak.0%. Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau. dan kontrol (tanpa aplikasi probiotik). dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. ikan bandeng. Tjaronge. namun belum mampu menurunkan kandungan amoniak dalam media budidaya. Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari.000 ekor/ha (1 ekor/m2). Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha).572. produksi . Maros selama 90 Hari. udang windu. Oleh karena itu. kesehatan.7 kg. baik pada air maupun pada dasar tanah tambak. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1. Sintasan dan produksi udang windu dan ikan bandeng masingmasing adalah 66.

05) dengan perlakuan transfeksi tanpa konstruksi gen (43. gen anti virus. danAndi Tenriulo*) **) **) Balai Riset Perikanan Budidaya Air Payau.1%) serta tanpa transfeksi (49. termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). EGFP. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. Komar Sumantadinata**). 4 hari. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA.Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. 12 jam. 3 hari. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. uji tantang. Bunga Rante Tampangallo. IPB. udang windu . Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi. 1 hari. KATA KUNCI: promoter. Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu.0%). yang sampai saat ini belum bisa diatasi secara secara tuntas.3% dan tidak berbeda nyata (P>0. Maros Departemen Budidaya Perairan. Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. Selain itu. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. Syarifuddin Tonnek. Promoter dikatakan aktif apabila gen penanda dapat terekspresi. Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang.05) dibandingkan dengan kontrol. Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. gen PmAV menunjukkan respons meningkat (up-regulation). Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. Alimuddin**). promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. Aan Fibro Widodo. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. Fakultas Perikanan dan Ilmu Kelautan. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. 2 hari. Sukenda**). Ketika ditantang dengan WSSV. transfeksi. udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. ekspresi gen. KATA KUNCI: ekspresi.

antibodi monoklonal . dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). cepat dan akurat. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. Teknik serologi. Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. menyeleksi. White Spot Syndrome Virus (WSSV). Pewarnaan jaringan menggunakan Hematoxilin eosin. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. khususnya ELISA. serta berpeluang untuk digunakan secara langsung di lapangan. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. Penelitian dilakukan untuk membuat.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. karena relatif mudah dan murah. KATA KUNCI: ELISA. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. Antibodi monoklonal memiliki kespesifikan yang tinggi. sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. monodon dengan melihat gejala klinis dan studi histopatologi. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. Nurhidayah. serta epidemi penyakit di lapangan. KATA KUNCI: White Spot Syndrom Virus (WSSV). sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. dan disertai ulserasi lapisan mukosa epitel. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. Setelah pengujian. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang.

5±88. Riset ini dilaksanakan di tambak Punaga.085±0. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei). udang diberi pakan dosis 50%-5% dari total berat biomassa/hari. dan kepadatan benur dan tokolan adalah 50 ekor/m2.034) berbeda nyata (P<0. sintasan (90. survival rate. Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12). dan efisiensi biaya produksi. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak.51). benur.7 m sebanyak 9 buah.000 m2/petak.258).234). produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau..048). sintasan ( 92. produksi (1831. Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0. namun terbatas pada golongan masyarakat menengah keatas (padat modal).257±0. tokolan.Setiap perlakuan dengan 2 ulangan. KATA KUNCI: udang vaname.masing-masing perlakuan diulang tiga kali. sintasan.0±149. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei).102 CFU/mL.05) terhadap pertumbuhan. Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau. Takalar. feed. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun.120).05) dengan perlakuan A (1. namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan.83±8. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%.9).Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. Selama pemeliharan 85 hari. Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi. Budidaya ini berkembang dengan teknologi intensif.114±0.549±0. karena berpengaruh terhadap pertumbuhan. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0.31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya. Instalasi BRPBAP. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1. dan pemeliharaan berlangsung 80 hari di tambak. kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0. Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah. KATA KUNCI: growth.18235 mg/L) dibandingkan dengan perlakuan A (0. produksi (2087. and L vannamei . Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10. dan (B) pembesaran dengan tebar tokolan (PL 27). sintasan. RKP pada pembesaran udang vaname teknologi intensif. menggunakan 4 petak masing masing berukuran 4. Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6. rasio konversi pakan dan produksi udang vaname. 829.0328 mg/L) pada akhir penelitian. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0.45 g/ekor dan ditebar kepadatan 100 ekor/bak.096±0. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%. budidaya udang intensif.

8% dan 11. Agus Suprayudi**). Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum. kecernaan total. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB).5%–36. Kemudian dilanjutkan uji kecernaan. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI . 19. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4. Fakultas Perikanan dan Ilmu Kelautan. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). Namun. K ATA KUNCI: protein optimal. Sintasan antara 73. konversi pakan (FCR). sedangkan ekskresi amonia antara 1.00.000 m2. B (protein 31%. retensi lemak (RL). C/P rasio 15. Ing Mokoginta**) dan Dedy Yaniharto***) *) **) Balai Riset Perikanan Tawar. retensi protein (RP). Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih.4%–94. Perlakuan terdiri atas pakan A (protein 29%. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0. produksi. sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya.2–78. dan pH 8.00. Litopenaeus vannamei . Litopenaeus vannamei Deisi Heptarina*). PR 532. D (protein 35%. JKP 59. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi .9%–79. sintasan.2% serta WS berkisar antara 49. pertumbuhan.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN. RL dan RP masing-masing 26.69%.5%–62.6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik.5 g/ekor dengan kepadatan 10 ekor per akuarium.05) terhadap pertambahan berat mutlak. namun kurang diimbangi dengan penyediaan pakan yang sesuai. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7. Penelitian dilakukan di tambak percobaan Punaga Takalar.7%–1130. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0.4. Selama pemeliharaan.71%–22.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2.1 g. Jakarta Utara. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu. salinitas 24–25 ppt. dan 23. yuwana. C/ P rasio 16. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname. FCR 1.5.39%. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan.1 kkal GE/g).464 mg/kg tubuh/jam. 5 kali sehari pada pukul 07.1% dan 65. C/P rasio 14.00. Hidayat Suryanto Suwoyo. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an.00.INTENSIF DI TAMBAK Abdul Mansyur. sintasan.2 kkal GE/g).029–2. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. 15. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan.3%–86. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH. kecernaan total dan kecernaan protein masingmasing 26. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13.9%–68. suhu 28°C–30°C. Bobot yuwana yang ditebar rata-rata 0. jumlah konsumsi pakan (JKP). 11. Bogor Departemen Budidaya Perairan.6 kkal GE/g). C/P rasio 11. kecernaan protein. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon).5 kkal GE/g). Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%.4%.5%. Kisaran nilai masing-masing parameter tersebut adalah.2%. dan E atau komersial (protein 40. ekskresi amonia dan stabilitas pakan. pertumbuhan relatif (PR). C/P rasio 13.00.4–2. Pakan diberikan at satiation. M.8 kkal GE/g).05).intensif. laju pertumbuhan harian.05).0–8. fotoperiod dibuat 12 jam terang–gelap. C (protein 33%. Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media.7%.

Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. MBV. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. SOD. protein haemolimph dan ekspresi enzim (GPI. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*).Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. TSV. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. dan moribund. SOD. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. Taura Syndrome Virus. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. L. Lila Gardenia. toleran dan terinfeksi TSV. belum dapat diyakinkan secara pasti bahwa ekspresi EST. PGM. SOD. Haryanti*). Semua gejala tersebut diduga akibat adanya serangan virus. WSSV. SPF. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). toleran. Gondol Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. KATA KUNCI: Litopenaeus vannamei. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. and SP) pada udang yang sehat.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. dan Rustidja**) *) **) Balai Besar Riset Perikanan Budiaya Laut. Untuk mengetahui jenis virus yang menyerang udang tersebut maka. KATA KUNCI: enzim. Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. PGM. SOD. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). dan SP mampu berdiri sendiri. IHHNV. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. dan SP. Namun demikian. EST. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terus-menerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). EST. toleran. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). IMNV dan PvNV .

5%. 0. B. 0. reproduksi. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol.27 mm. pendederan I. dengan lama pengujian 8 minggu. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. khususnya rasio jantan-betina. A dan B. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. pendederan II. yang meliputi pertambahan panjang dan bobot. Asahan. dan 0. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). dan 13%. C. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. Musi. 2%.25 m2/ekor induk. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%. yaitu 0%.20 g. dengan sistem resirkulasi. Namun demikian. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. berdasarkan nilai heterosis yang didapat. dan 9. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan D) 2 J : 4 B. Imron.21 g. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. Penelitian meliputi pembenihan.42 mm. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. dan tidak berbeda nyata antar perlakuan. berturut-turut 0. pertumbuhan. KATA KUNCI: genetik. Ciasem. berturut-turut 27%. pemijahan. dan D. yang dilakukan selama 5 bulan. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal. persilangan. Romy Suprapto. B) 1 J : 2 B. Penelitian dilakukan dengan rancangan acak lengkap. Sebagai perlakuan adalah rasio jantan-betina. Barito.25 g. 0. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro. 25%.31 mm. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. Pada sistem tersebut kematian induk relatif rendah. rasio kelamin. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). beserta persilangannya. dan pembesaran. 6. C) 2J : 2 B. diberikan pada pagi dan sore. diikuti perlakuan D. KATA KUNCI: mortalitas. 0. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. udang galah .5% berturut-turut untuk perlakuan A.

tanpa penambahan desinfektan).93. 47. Dinar Soelistyawati**). Tiga tipe persilangan. B (perendaman dalam larutan formalin 250 mg/L). Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan. yaitu A. (4. keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24. C.5% dan 3.7 mm) diikuti oleh populasi hasil outbreeding (21.4 mm). sirih. KATA KUNCI: inbreeding. Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan.4%) diikuti oleh populasi hasil crossbreeding (57. desinfektan.5±28.4 mm) dan populasi inbreeding (21. B. Harry Wuwungan**).5 x 103).6±21. (0 cfu/mL).0%). C. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 4. outbreeding. Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya. larva udang galah. B.92. merupakan langkah bio-security. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C.93. Sukamandi.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan budidaya dapat dioptimalkan. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰. (8. crossbreeding.0±1. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan.4 x 103 cfu/mL) . dengan nilai sebagai berikut: A. Hewan uji yang digunakan adalah larva udang galah umur dua hari. **) Jurusan Budidaya. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan.0.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan.83% dan 3.0%) dan populasi inbreeding (25. Pada karakter pertumbuhan. C (perendaman dalam larutan ekstrak daun sirih). KATA KUNCI: bawang putih. Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah. dan D. Fakultas Perikanan dan Ilmu Kelautan. Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi. namun tidak berbeda nyata (P>0. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74. dan D. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*). Hasil penelitian menunjukkan bahwa pada karakter sintasan. formalin. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan. yaitu inbreeding. 52.8±1.8±7.00% dan 3. sintasan (SR) dan perkembangan larva (LSI). . Perlakuan yang diberikan yaitu A (kontrol. 45. 37. dan D (perendaman dalam larutan ekstrak bawang putih).05) terhadap kelimpahan bakteri.8±1. (0 cfu/mL).5%.

Forum Inovasi Teknologi Akuakultur 2010

K 21
Eni Kusrini*), Lies Emmawati**), dan Wartono Hadie**)

Balai Riset Budidaya Perikanan Ikan Hias, Depok

Pusat Riset Perikanan Budidaya, Jakarta

Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang), Pelabuhan Ratu, dan Bone. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air,Karawang dengan Pelabuhan Ratu lebih dekat. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu.
KATA KUNCI: udang galah, populasi, jarak genetik

K 22
Muslimin, Sulaeman, Andi Tenriulo, dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau, Maros

Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. semisucatus) dengan kepadatan berbeda. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau, Maros dengan panjang awal mysis adalah 100-190 milimikron. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm, diameter 15 cm dan Volume 3 L. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm, lebar 40 cm, dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut, maka ditambahkan pemanas/heater suhu 30°C. Hewan uji ini ditebar dengan kepadatan berbeda. Perlakuan yang diujicobakan adalah: A. Kepadatan larva 25 ekor/L; B. Kepadatan larva 50 ekor/L; C. Kepadatan larva 75 ekor/L; D. Kepadatan larva 100 ekor/L; E. Kepadatan larva 125 ekor/L; dan F. Kepadatan larva 150 ekor/L. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap, di mana masing-masing perlakuan di ulang tiga kali. Jenis pakan yang diberikan berupa pakan alami chetoceros, artemia, dan pakan buatan. Pemberian pakan dilakukan setiap pagi dan sore (08.00 dan 16.00 wita). Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0,05) terhadap laju sintasan dan pertumbuhan larva udang pama. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%, (B) 32%, (C) 31%, (E) 24%, (D) 16%, dan (F) 10%.
KATA KUNCI: kepadatan, larva udang pama, sintasan dan pertumbuhan

Forum Inovasi Teknologi Akuakultur 2010

K 23
Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1.446–6.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan. Wadah percobaan yang digunakan adalah bentik jar (chamber), yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. Oksigen terlarut diukur dengan alat pengukur O2 (TPSTM Model WP-82 DO meters). Data laju respirasi selama proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. Ver.1.2. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan, dengan kisaran tingkat konsumsi oksigen 0,26–7,27 mg/g/jam. Kisaran kelarutan oksigen pada awal penelitian adalah 3,14–7,9 mg/L dan setelah 1 jam pengukuran 0,03–0,48 mg/L dan kontrol tetap berkisar 4 mg/L. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4,0235 g adalah 15,65 g/m3.
KATA KUNCI: udang pama, padat tebar, estimasi

K 24
Sulaeman, Aan Fibro Widodo, dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau, Maros

Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan, akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP), BRPBAP, Maros. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0,18±0,03 g, panjang karapas 4,6±0,1 mm dan lebar karapas 5,9±0,1 mm. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar); B (metode gantung); dan C (gabungan antara keduanya). Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0,05) terhadap pertumbuhan bobot mutlak, bobot harian, pertumbuhan panjang dan lebar karapas mutlak dan harian, tetapi berpengaruh nyata (P<0,05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66,96 %; 58,17 kg/250 m2, disusul perlakuan C: 64,06; 44,95 kg/250 m2 dan terendah pada perlakuan B: 60,58%; 40,52 kg/250 m2.
KATA KUNCI: kepiting bakau, metode sebar, polikultur, rumput laut

Forum Inovasi Teknologi Akuakultur 2010

K 25
Aan Fibro Widodo, Sulaeman, dan Muslimin Balai Riset Perikanan Budidaya Air Payau, Maros

Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp.). Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros, Sulawesi Selatan. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau, yaitu: A (625 ind./mL); B (500 ind./mL); C (375 ind./mL); D (250 ind./mL); dan E (125 ind./mL). Peubah yang diamati adalah laju pemangsaan, sintasan, dan peubah kualitas air. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0,05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. Hasil terbaik diperoleh pada perlakuan A, yaitu kepadatan rotifera 625 ind./mL dengan laju pemangsaan sebesar 259,1667 ind./larva/jam dan sintasan 86,0%.
KATA KUNCI: kepadatan, kepiting bakau, laju pemangsaan, rotifera, zoea

K 26
Supono Budidaya Perairan Universitas Lampung

Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Karena hidup di dasar tambak, jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang, yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang. Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. Selain diatom epipelic, data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0,75), TOM (rs = 0,71), dan nitrat (rs = 0,66), sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0,72), kandungan liat (rs = 0,65), dan kandungan bahan organik (rs = 0,62).
KATA KUNCI: diatom epipelic, tambak udang, kualitas air, kualitas sedimen

Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. Pertambahan bobot (71.6±10. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. dan Tulung Agung).9±9.72). Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar.47) terbaik adalah benih lobster air tawar asal Tangerang. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda. Gleni Hasan Huwoyon. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang.0 cm dan adanya pertambahan bobot sebesar 58. pertumbuhan. dan panjang total tiap individu.Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini. Bogor. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. panjang standar. namun kemampuan produksi para pembudidaya hanya sampai 4 inci. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6. panjang standar. lokasi . KATA KUNCI: Cherax quadricarinatus. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot.6-7. dan panjang total). Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci.9 g.0±0.6-71. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2. ragam.74) dan panjang (7. Dianalisis dengan Rancangan Acak Lengkap (RAL). Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci. benih. simpangan baku.

50 g dan 217.92 g dan 219. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m. lebar dan bobot cangkang. (B) Ulva sp. Sargassum.80 sampai 31. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali.68 µg/hari). (D) Kombinasi Gracilaria sp.52 µg/hari) dan terendah pemberian pakan Sargassum sp. dan Sargassum sp. pakan (B)= E.44 ± 102.18 mm dan 7. dan pakan (C) dengan R² = 0. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut. + Ulva sp. cottoni.44 µg.. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41..99 mm dan 36. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30.16 g dan -86. 73. KATA KUNCI: Haliotis squamata. aplikasi teknologi pembesaran . dan kombinasi keduanya.44 µm dan 65. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A. + Sargassum sp.39 m x 0. masing-masing 58. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto. dilakukan dengan menerapkan 4 perlakuan pemberian pakan.58 m x 0. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan. I Nyoman Adiasmara Giri. squamata. serta pakan (C)= kombinasi Gracilaria + E. yaitu: (A) Gracilaria sp.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON.06 g.31 m. E.44 µg. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga. KATA KUNCI: abalon Haliotis squamata. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata.0 ± 0. + Ulva sp.613. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir. Riani Rahmawati.05) antar perlakuan. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon.05).39 g. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut.854. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp. (C) Sargassum sp.03 ± 1. sangat sesuai dalam memacu pematangan gonad induk abalon H. kombinasi Gracilaria sp.17 ± 25. (13. + Sargassum sp.05 mm dan 10.23 g dan 121.00 µm dan 38.37 mm. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit.06 µg/hari). Ulva sp.1 ± 4. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir.59±2. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi. (rasio 1:1:1). Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0. Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp. Bambang Susanto. (-5. Gracilaria.73±2.19 ± 6.39 mm dan 10.891. cottonii 37. Ibnu Rusdi. + Sargassum sp. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0.82 µg/hari).44 µg serta 92. pakan (B) dengan R² = 0. (P<0. + Ulva sp.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria. B. cottonii : 40. 38.56 ± 48.06 ± 170. (13.73 g.9 ± 1. Riani Rahmawati..02 g. Ulva.89 µm dan 38.26 ± 10. yaitu pada perlakuan pemberian pakan Gracilaria sp. dan C berturut-turut adalah 120. (7.17 ± 2.

Est-3*. Est-4* dan Cah-3*. proporsi pakan. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut./Ulva sp. Est-1*. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. KATA KUNCI: allozyme. dan Ulva sp.2 g dan panjang cangkang 2.52. 80/20% (B). Nilai variasi genetik induk abalone asal Banten (0. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. Ibnu Rusdi. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan.7 cm. tinggi 22 cm. dan 60/40% (C) sebagai perlakuan./Ulva sp. Setiap perlakuan terdiri atas 2 ulangan. Gpi*. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. dan Ulva sp. peluang pasar serta teknik budidayanya yang sederhana. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. Untuk itu.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin. dengan proporsi yang berbeda Gracilaria sp. Abalon diberi pakan rumput laut Gracilaria sp. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. Pakan dengan proporsi Gracilaria sp. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. Est-2*. genetic monitoring. Kepadatan awal benih abalon adalah 450 ekor per wadah. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. Hirmawan Tirta Yudha. pembesaran. KATA KUNCI: abalon Haliotis squamata. dengan bobot awal 2. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. mengingat permintaannya yang cukup tinggi. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. 60/40% memberikan pertumbuhan abalon terbaik. Sampel yang digunakan berasal dari Bali dan Banten. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. penjarangan . Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan. Tatam Sutarmat. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. Gondol. 100/0% (A). wild.13) lebih tinggi dibandingkan dengan induk asal Bali (0.06).6-3. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan.

Forum Inovasi Teknologi Akuakultur 2010

M 05
Zafran, Indah Mastuti, dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut, Gondol

Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. Karena itu, tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut, Gondol, Bali. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar, yaitu media spesifik untuk bakteri Vibrio. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0,05 µm). Setiap perlakuan diulang 3 kali. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1, isolat-2, dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13,33%; 18,33%; dan 21,67%; sedangkan mortalitas pada kelompok kontrol hanya 3,33%.
KATA KUNCI: abalon, Haliotis squamata, vibriosis, Vibrio cincinnatiensis, uji patogenisitas

M 06
Sudewi, Apri I. Supii, dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut, Gondol

Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan. Namun, masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan. Perlakuan yang diberikan adalah ukuran tebar 3,44±0,44 mm (perlakuan A); 10,85±0,1 mm (perlakuan B); dan 20,36±0,55 mm (perlakuan C). Parameter yang diamati adalah laju pertumbuhan harian dan sintasan. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0,44±0,01 mm/hari (perlakuan A); 0,46±0,03 mm/hari (perlakuan B) dan 0,30±0,01 mm/hari (perlakuan C). Laju pertumbuhan lebar cangkang 0,37±0,01 mm/hari (perlakuan A); 0,4±0,03 mm/hari (perlakuan B) dan 0,27±0,00 mm/hari (perlakuan C). Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0,05) dibandingkan dengan perlakuan C. Sintasan yang diperoleh untuk perlakuan A, B, dan C berturut-turut 37,16%; 71,69%; dan 46,42%. Oleh karena itu, untuk memperoleh pertumbuhan dan sintasan yang baik, penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm.
KATA KUNCI: Pinctada maxima, pertumbuhan, sintasan, ukuran awal spat

Forum Inovasi Teknologi Akuakultur 2010

M 07
Apri I. Supii*), Ida Ayu Astarini**), dan Sudewi*)

Balai Besar Riset Perikanan Budidaya Laut, Gondol

Fakultas MIPA Universitas Udayana

Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan, pada tingkat nasional, regional maupun lokal. Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Berdasarkan hasil pengkajian, secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari, Sumber Sari, Teluk Awen, dan Teluk Rabu. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara, akan tetapi jika diinginkan, budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. Pantai Pengambengan khususnya, tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai.
KATA KUNCI: potensi kelautan, tiram mutiara, Pinctada maxima, Jembrana

Forum Inovasi Teknologi Akuakultur 2010

LL 1
Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau, Maros

Produksi rumput laut ditargetkan meningkat dari 2,6 juta ton per tahun sekarang ini menjadi 7,6 juta ton per tahun pada 2014, sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. Umumnya pembudidaya rumput laut, Kappaphycus sp. mengaplikasikan metode long line, di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut, Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan, yakni 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m, di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masing-masing dengan 3 kali ulangan. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver. 3,1. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut, K. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m dari permukaan perairan. Oleh karena itu, metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468,75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan.
KATA KUNCI: Kappaphycus alvarezii, pertumbuhan, kandungan keraginan, vertikultur

LL 2
Siti Fadilah, Rosmiati, dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau, Maros

Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. verrucosa. Rumput laut dikumpulkan dari Kabupaten Brebes, Jawa Tengah. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0,1%. Eksplan diinokulasi ke dalam media cair yang diperkaya PES. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker, sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu. Pengamatan panjang tunas, jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81,70%) daripada botol (90,75%). Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2,40 mm pada stoples dan 2,42 mm pada botol. Sedangkan jumlah tunas dalam stoples (7,50) lebih banyak dibandingkan dalam botol (7,03). Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26,70 dibandingkan dalam botol yang hanya 6,20.
KATA KUNCI: botol, kepadatan eksplan, stoples

Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%–10%. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. KATA KUNCI: Kappaphycus alvarezii. daya tahan penyakit. dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. dan St. puncak jam ketiga – keenam s. Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) . mulai berpendar jam pertama – kedua setelah elektroporasi (s. Fadilah. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium.1 second. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0. Rajamuddin*). jumlah kejutan: 4 kali dan interval kejutan: 0. Kappaphycus alvarezii Muh.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. dan sumber karbon yang berbeda. Utut Widyastuti***). Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas. Sebagai tahap awal dalam rangka produksi rumput laut transgenik. Alias L. transgenesis. Rosmiati. Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. Balai Riset Perikanan Budidaya Air Payau. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT.Irvan Faizal****). kappaphycus alvarezii.e. Pola ekspresi keempat promoter relatif sama. persentase sel berpendar rata-rata 10%. cytomegalovirus/ CMV.e).5 mili/second.e dan stabil setelah jam ke9 sampai ke-12 s. hibridisasi. KATA KUNCI: mutu genetik. ZPT. Keratin dan b-actin. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. promoter.BPPT. panjang kejutan: 0. fusi protoplas .Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. Makassar **) Departemen Budidaya Perairan-FPIK. Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV. b-actin. Alimuddin**). Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik.

rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. Untuk itu. taman nasional ujung kulon. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. konservasi dan wisata). parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). Pada umumnya. dan status wilayah kawasan. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. pembudidaya rumput laut. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. SIG. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. Rekomendasi pencegahan penyakit. kondisi sosek-ekonomi. KATA KUNCI: rumput laut. Erlania. Pandeglang . Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. Kabupaten Pandeglang. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. khususnya di Kecamatan Sumur.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. I Nyoman Radiarta. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya.

5:0. Perkembangan sel-sel embriogenik diamati pada kultur cair.4%. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid. pengggantian media dilakukan setiap minggu dengan komposisi media yang sama. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan. Andi Asdar Jaya*).8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau.4 mg/L. dan 0.0:0. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio. KATA KUNCI : Kappaphycus alvarezii. Tahap (2) adalah regenerasi massa sel embriogenik somatik. Pada tahap regenerasi massa sel embriogenik. 0. Makassar **) Balai Riset Perikanan Budidaya Air Payau. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh.8%.0 mg/L. dan 1.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm). Pada tahap induksi kalus.0:0.0% menghasilkan persentase induksi kalus tertinggi (90%).1:1. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii. morfologi.0:1. Ridwan*). 1. dan 2.0 mg/L. 0.0%. adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. Alias L. embrio somatik.5%). KATA KUNCI: keragaman.5 mm dapat dicapai dalam satu bulan kultur. 0. 1. Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep.8% dan 1.6%. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0.2 mg/L) dengan konsentrasi agar media induksi (0.6% dan 0. embriogenesis somatik . Rajamuddin*). kalus. Pada media cair. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. pada rasio IAA: kinetin (0.1 mg/L) dengan konsentrasi agar (0. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0.6%.0 mg/L.8%). Rosmiati. Pemeliharaan dilakukan selama 8 minggu. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0.

Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. rasa. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein.13 ha dan 3. produksi pada tahun 2008 sebesar 750 ton. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. Mery Sukmiwati.24 ha. dan karbohidrat) dan uji organoleptik. kadar abu. abu. uji organoleptik . Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No.143. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn 85%. A-1 (15% tepung rumput laut dan 85% tepung terigu). sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam program-program pokok pengembangan. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. KATA KUNCI: strategi pengembangan. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. KATA KUNCI: rumput laut. gizi. lemak. protein. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. crakers. rumput laut.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. Parameter mutunya adalah kandungan zat gizi (air. dan berpengaruh nyata terhadap rupa dan tekstur. Hasnawi. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju.780. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. denga metode budidaya tali panjang (long line). Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. 01-2973–1992 dan SII 0177–1990. aroma. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. A-2 (30% tepung rumput laut dan 70% tepung terigu).

Kebutuhan kapur didasarkan pada nilai SPOS tanah dengan mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur. klorofil-a dan suhu permukaan laut). Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95.15 dan 19. Adang Saputra. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra ALOS AVNIR-2 akuisisi 28 Juli 2009. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet.30 dan 1. SPOS. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia. KATA KUNCI: kebutuhan kapur. S POS . analisis spasial. Maluku .02.884 g/cm3 dan SPOS tanah berkisar antara 0. tanah. dan Anugriati Balai Riset Perikanan Budidaya Air Payau.2 digunakan untuk pembuatan peta distribusi SPOS tanah. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0.29 ton/ha dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju.02% serta 44. SP.28% dengan rata-rata 7.60 dan 36. tambak. Oleh karena itu. infrastruktur (jalan) dan sebaran penduduk. SIG. pirit. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. Peubah kualitas tanah yang diukur adalah: pHF. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Kebutuhan kapur CaCO3 untuk tambak di Kabupaten Mamuju berkisar antara 1. KATA KUNCI: budidaya laut. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei. Rachmansyah.36 dan 3. Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut. inderaja. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan.71 g/cm3 dengan rata-rata 0.614%.78% sehingga memiliki faktor konversi berturut-turut sebesar 2. Penelitian ini bertujuan untuk melakukan analisis spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG). ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting. Program ArcView 3.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI SPOS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai SPOS tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat dan berkelanjutan.09 dan 90. bahan organik dan berat volume tanah. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. Maros ABSTRAK Kabupaten Mamuju. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan. Kapur pertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur.32 dan 113. SKCl. pHFOX.

Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. peningkatan pendapatan. KATA KUNCI: minapolitan. konversi pakan serta pertumbuhan yang cukup baik. udang. Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. Jakarta **) Pusat Riset Perikanan Budidaya. KATA KUNCI: produktivitas tambak. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. dan Sularto***) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. analisis komoditas. bandeng LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara. tambak terbengkalai. Evi Tahapari***). ikan patin. analisis komoditas unggulan dan andalan. rumput laut. Jakarta **) Pusat Riset Perikanan Budidaya. Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. Hatim Albasri**). Hasil dari kaji terap tersebut menunjukkan bahwa sintasan.Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). Wartono Hadie**). Di samping itu.400 m2 selama 3 bulan pemeliharaan. Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). dan analisis usaha perikanan. Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. Adang Saputra**). analisis location quotient. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Introduksi kaji terap dilakukan dilahan seluas 2. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. udang dan bandeng. Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Kabupaten Brebes . Sukamandi *) ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes.

25 m tanah jenis penutup/penggunaan lahan api-api. Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju.50-0.50-0. tanah. pesisir. bakau. karbon organik. kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. masingmasing pada kedalaman tanah 0-0. TSA. sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. KATA KUNCI: keragaman. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). PO4. SKCl. penutup/penggunaan lahan. sedangkan yang dianalisis di laboratorium adalah pHKCl. Marsambuana Pirzan. sagu. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). kelapa (Cocos nucifera). nipah. Pada kedalaman 0. pHOX. nipah. Kualitas tanah yang diukur langsung di lapangan adalah pHF. campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut.75 m. pHFOX dan potensial redoks. SP. nipah (Nypa fruticans). rumput. Fe.25 m dan 0. Oleh karena itu. Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. rumput. Pada kedalaman 0-0. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. N-total. A. pirit.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. paku laut (Acrostichum aureum). Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah. Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. Hasil penelitian menunjukkan bahwa. pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent. Kabupaten Mamuju . tanpa vegetasi. TPA. dan Kamariah Balai Riset Perikanan Budidaya Air Payau. TAA. SPOS. sagu (Metroxylon sagu).75 m tanah vegetasi api-api. bakau. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. padi (Oryza sativa). bakau (Rhizophora apiculata). Al dan tekstur. rumput.

Akhmad Mustafa. Data sekunder yang diperoleh berupa data iklim. Sungai Kunyit. KATA KUNCI: kesesuaian lahan.077 ha. dianalisis secara spasial dengan metode PATTERN menggunakan SIG. KALIMANTAN BARAT Utojo. nitrit. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497. sedangkan peubah bebas adalah suhu. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau.819 ha). pH. dan bahan organik total. amonia.272 ha). kualitas air. Mempawah Hilir dan Mempawah Timur.986 ha).047 dengan rata-rata 6. tambak. Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil.398 µg/L. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. KATA KUNCI: klorofil.000. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. nitrat. oksigen terlarut. salinitas. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. pH. amonia. dan data citra satelit digital. Pada umumnya yang tergolong sangat sesuai (114. dan fosfat. nitrat. cukup sesuai (168. tambak. fosfat. Sulawesi Barat . Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. Data lapangan (fisiko-kimia air dan tanah).Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. walaupun dengan model regresi yang berbeda. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. data sekunder. terdapat di Kecamatan Segedong dan Siantan. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50. nitrit. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat.046 dan 22. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). sedangkan yang kurang sesuai (213. tersebar di wilayah pesisir Kecamatan Sungai Pinyuh.000. Oleh karena itu. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil.

Chironomus sp. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp. Analisis kandungan minyak nabati Dunaliella sp. dan Nematoda. kolam. Tidak terdapat perbedaan nyata (P>0. KATA KUNCI: mikroalga. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda. BRPBAT.. Dunaliella.). 2006). komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP. pH. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. dilakukan di dalam bakbak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung. minyak nabati . dan BOD5... Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. indeks diversitas dan keseragaman spesies. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0.75). Jakarta. DO. Proses pengayakan termasuk penyeleksian.0 sel/mL. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. dan 6:3. Bogor.. Parameter kualitas air yang diamati adalah suhu. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp. pupuk. penghitungan kelimpahan. dengan menggunakan cara modifikasi (Banerjee et al. identifikasi.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6.02–8. kecerahan. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5.60% menggunakan perlakuan pelarut hexana.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. Kultur ini ditempatkan diluar ruangan. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4. total bahan organik (TOM). 2002 dan Dayananda et al. Kultivasi Dunaliella sp. kemudian 6.5 mg/L. ekstraksi. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. dan penghitungan dilakukan di laboratorium. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan. Analisis data dilakukan secara deskriptif untuk komposisi jenis. Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8. Spesies dominan adalah Limnaea sp. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis. KATA KUNCI: makrobentos. 5:4.

Departemen Pertanian. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. dengan skor 19.33 sel/mL pada sistem indoor dan 7. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut.65/hari pada outdoor. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12. KATA KUNCI: kepadatan. 02 sel/mL pada sistem outdoor. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. salah satunya adalah Desa Merakan di daerah Jawa Timur. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. KATA KUNCI: ketahanan pangan. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7.25/ hari pada indoor dan 3. Metode penelitian menggunakan metode survei. rawan pangan. laju pertumbuhan. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Botryococcus braunii . Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. Pengolahan data dilakukan secara deskriptif. salinitas. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. braunii. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan.37. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. dan pH. Berdasarkan perhitungan statistik ANOVA.

sehingga AH-26 merupakan isolat yang pathogen. Bakteri merupakan salah satu penyebab penyakit pada ikan. kemungkinan merupakan strain yang tidak pathogen. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. Infeksi bakteri. profitabilitas. KATA KUNCI: unit usaha. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. pembudidayaan. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. Sedangkan dengan menggunakan spesifik primer. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. dan Balai Budidaya Laut (BBL) Ambon. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. KATA KUNCI: Aeromonas hydrophila. Uji awal berupa pengecatan gram. pengelolaan bisnis. tes katalase dan oksidase dilakukan sebelum uji PCR. penanganan aspek teknis.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. uji PCR. Isti Koesharyani. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. penanganan aspek teknis. aerolysin dan primer spesifik . Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele.

namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae. Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. Waduk Cirata .Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti. kedalaman 3 meter(C) dan kedalaman 4 meter (D). Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. yaitu 4423.masing perlakuan 5 kali ulangan.91. Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A). Winarlin. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar.Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat.86-0. KATA KUNCI: kedalaman. periphyton. Masing. kedalaman 2 meter (B).81 (ind/cm2) dan 0. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m). Ani Widiyati.

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. KATA KUNCI: strain. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas. Bogor ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. dan Achmad Sudradjat*) **) *) Pusat Riset Perikanan Budidaya. lebar 40 cm. sintasan terendah didapatkan pada salinitas 12 ppt. telah banyak menginfeksi ikan nila. Akuarium yang digunakan berukuran panjang 60 cm. 8 ppt (6–10 ppt).Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. KATA KUNCI: streptococcosis. sintasan. Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. dan tinggi 40 cm dengan ketinggian air 15 cm. Masingmasing perlakuan menggunakan 2 ulangan. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. Hary Krettiawan*). Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. ikan nila. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. Cianjur Wildan. ikan mas. dan 12 ppt (11–15 ppt). Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. Jakarta Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). Majalaya. salinitas. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. dan Sutisna Kuningan. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*). Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. Sidi Asih***). pertumbuhan .

Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya. KATA KUCI: ikan belida. Iwan Malhani Al’Wazan. Jakarta ABSTRAK Ikan karnivor. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september .36. Jawa. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4.53. ikan belida yang banyak hidup di perairan umum Sumatera. yang diberi sekat jaring nilon hita.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. KATA KUNCI: budidaya. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. Pemeliharaan ikan belida dilakukan di kolam. ekonomi. anakan ikan nila .64 sedangkan FCR total sebesar 1. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan SeptemberNovember 2009. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. termasuk jenis ikan karnivor. Dalam hal dukungan dana permodalan. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain.20 siklus dan nilai RC ratio sebesar 1. dan kalimantan. pakan.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. dengan jangka waktu pengembalian modal selama 3.

Dalam kegiatan budidaya ikan. KATA KUNCI: ikan nila. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. yang dikenal dengan nama PKM (palm kernel meal). KATA KUNCI: ikan belida. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. jaring tancap dan keramba jaring apung.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) **) Pusat Riset Perikanan Budidaya. kurang lebih 60% pengeluaran berasal dari pakan. palm kernal meal. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. Selama proses adaptasi pada kolam pemeliharaan. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. Untuk menguasai teknologi domestikasinya. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. pelet maggot . Budidaya ikan nila dapat dilakukan di kolam. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. Jakarta Balai Riset Perikanan Budidaya Air Tawar. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim.

1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. 65 g/ ekor. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bakbak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. sintasan. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). dan Zafran Balai Besar Riset Perikanan Budidaya Laut. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). 05) tidak mempengaruhi sintasan. 05. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. penyakit infeksi . bakteri maupun berbagai jenis parasit. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. 25 – 1. Rasio konversi pakan 1. Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. Pendederan ikan kerapu macan. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. sedangkan kontrol hanya disuntik dengan PBS. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. Padat penebaran yang digunakan sebagai perlakuan adalah 100. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. baik disebabkan oleh infeksi virus. dan 200 ekor/m³. Masing-masing perlakuan diulang 3 kali. Fris Johnny. KATA KUNCI: pertumbuhan. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia. KATA KUNCI: vaksin bakteri.150. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. 95 – 2. Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. Epinephelus fuscoguttatus. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0.

Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. Agus Priyono.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma. Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam.004. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. indeks somatik gonad dan diameter oocytnya. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut.25-4. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 . Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56.240.520 µm. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. Ketut Suwirya. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan. KATA KUNCI: kerapu raja sunu. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. Kualitas telur yang dihasilkan relatif masih fluktuatif. aspek biologi reproduksi . Apri I.000 butir. dengan jumlah 8% biomass/hari. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3. Tridjoko.450. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya. dan pada induk asal alam 20-92 % dengan SAI 2. Plectropoma laevis. dan (B) Induk asal alam.20.000 butir.80. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. Supii.

(1988). tawes . Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. ikan tengadak.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. Kata kunci : Jaring apung. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. dibandingkan dengan perlakuan lainnya. Himawan Tirta Yudha.A. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. total biomass dan biaya pakan. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). dan N. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. Rudy Gustiano. Hasil penelitian menunjukkan bahwa laju pertumbuhan. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. pertambahan berat. pertambahan berat. dengan periode pemeliharaan120 hari. tengadak albino. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. Giri Balai Besar Riset Perikanan Budidaya Laut. pertumbuhan. konversi pakan. KATA KUNCI: truss morfometrik. Peubah yang diamati adalah sintasan. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya.

8 mg/L). Kisaran persentase efektivitas penyisihan TN (28%– 58.36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0. amonia (20. yaitu TN (42. Typha sp.82%).4–0. Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen.33%). yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air).5%–90.86%–85. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan.5 mg/L).82%). tumbuhan air. produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar. Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi.5%–66. Perlakuan pada penelitian ini terdiri atas dua perlakuan. pemakaian insektisida perlu dilakukan secara selektif. amonia (0. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7. khususnya ikan. akut. Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya. Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat).32 %). kronis . karena di samping harus efektif terhadap hama tanaman padi.3 mg/L). amonia (0. Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air.05).). kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur.849 mg/L) dan nitrat (0.Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar. Untuk itu.681mg/L) dan nitrat (0. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan. dan nitrat (11. KATA KUNCI: substrat. Sintasan (93.11%–44.14%–92.7–1.5 mg/L).05) dibandingkan kolam ikan kontrol (82.4%) pada kolam substrat 1 (pasir.5–14.lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8.081–0. Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi.303–1. nitrogen. dan nitrat (37. amonia (42. karbofuran. KATA KUNCI: toksisitas. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan.67%). juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut. dan Scirpus sp. Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0.58%).

(f) garam 6.00 mg/L dan garam 4. Mycobacterium fortuitum PADA IKAN GURAME. Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan.00 mg/L. Sensitivitas teknik diagnosa terhadap bakteri target.00 mg/L.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar. yaitu M1: T39 (GCGAACGGGTGAGTAACACG) dan T13 (TGCACACAGGCCACAAGGGA). Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar.00–20. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy). Pada riset ini. Trichodina. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat.000.00 mg/L.00 mg/L (g) kontrol. ginjal.00–6. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya. serbuk biji teh dan garam. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. KATA KUNCI: mycobacteriosis. limpa. dan limpa. Gyrodactylus. Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum. Oleh karena itu. gurame. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif.00 mg/L. Dactylogyrus. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. Ada beberapa bahan nabati dan alami yang dapat digunakan.000. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis. (b) biji teh 15. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. KATA KUNCI: ekstoparasit. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis.00 mg/L efektif untuk memberantas Trichodina dan monogenea. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies. (d) garam 4. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp. Mycobacterium fortuitum. sehingga upaya pengendaliannya sering terlambat. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10. yang telah dikembangkan oleh beberapa peneliti. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut. Hasil penelitian menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi.00 mg/ L. selanjutnya dibandingkan dengan teknik diagnosa melalui uji biokimia dan histopatologis.000. dan primer M2: PreT43 (AATGGGCGCAAGCCTGATG) dan T531 (ACCGCTACACCAGGAAT) digunakan pada penelitian ini. dan darah. Ketujuh perlakuan itu yaitu: (a) biji teh 10. dan Polymerase Chain Reaction . Dua pasang primer. dan Quadriacanthus kobiensis serta menimbulkan kematian. (e) garam 5. sedangkan preparat histopatologi diambil dari organ hati. Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain–Jenssen. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. (c) biji teh 20.

substitusi. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0. Cijeruk dengan bobot rata-rata 8. KATA KUNCI: tepung bungkil kedelai. Bogor. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan. guttatus . B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai.73 g dengan padat tebar 15 ekor/keramba. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. 1. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah.000. rasio efisiensi protein.05). dan tingkat sintasan. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG. Balai Riset Perikanan Budidaya Air Tawar. efisiensi pakan. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. C. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0. 1. namun nilai ini tidak berbeda nyata dengan 1. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. S.500 dan 2. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. dan 2. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22.05) terhadap pertumbuhan. pertumbuhan.000 unit fitase/kg pakan.15±5.V. Hasil penelitian menunjukkan bahwa penggunaan fitase 1. tepung bungkil kopra.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. nilem. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap.500. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0. pakan ikan beronang. Parameter yang diamati yaitu laju pertumbuhan spesifik. dan sintasan ikan beronang. efisiensi pakan. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap.60±0.000 unit/kg pakan. 500. KATA KUNCI: fitase.45 g/ekor. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti.

2 ± 0. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. 100% ikan rucah jenis ikan tembang (Clupea sp. pelet. lebar karapas dan sintasan (P>0.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap. sintasan . Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak.02 g.). Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot. Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif.04 ± 0. rajungan. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut. KATA KUNCI: pakan rucah.-/tahun/ha. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. 50% ikan rucah + 50% pelet. bobot dan sintasan serta kualitas air.850. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus).526. Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan.05) dengan perlakuan yang lain. Maros selama 40 Hari. Tjaronge Balai Riset Perikanan Budidaya Air Payau. pertumbuhan.Variabel yang diamati adalah pertumbuhan lebar karapas. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur). B.2 mm dan bobot 0. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm. 100% pakan buatan/pelet dan C. KATA KUNCI: budidaya bandeng. tambak. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M.

0 cm dan bobot rata-rata 0. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara.43.5 m dan tinggi air 40 cm. 20.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B). Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. dan Lili Sholichah Balai Riset Budidaya Ikan Hias.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. ampas tahu.5 cm) . Padat penebaran bandeng pada masingmasing perlakuan adalah 15.0 cm.5 ton/ha. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional.467. Pada akhir penelitian (hari ke 105). Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2.5 cm dan panjang tertinggi sebesar 3.98 g/ekor menjadi 232. Sintasan bandeng pada perlakuan A dan B. Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10.5 cm (ukuran ekspor). dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. KATA KUNCI: pupuk organik. 35. bandeng. B/C rasio 1. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia.9 dan 1154 kg/ha. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2.625% dan 60. masing-masing mencapai 56. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1.009 gram.816%. KATA KUNCI: benih botia. produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. 70.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).5 x 0.100. Oleh karena itu. Nina Meilisza. Produksi bandeng pada perlakuan A dan B. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B).5 x 0. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. 55. ukuran ekspor 1 inchi (2. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. dan 105 dan dianalisis secara deskriptif. masing-masing mencapai 986. masing-masing dengan dosis 2. pertumbuhan panjang. pupuk kandang dan dedak. Erfan Andi Hendradjat. Selama pemeliharaan.-.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari.

Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula. dan (C) Tubifex sp. Gigih Setia Wibawa*). gonad. Pakan diberikan tiga kali sehari yaitu pada pukul 8.. Rendy Ginanjar. 12. dan Irsyaphiani Insan**) *) **) Balai Riset Budidaya Ikan Hias. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp.98 ± 0.0.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. ikan diberi perlakuan pemberian pakan alami yang berbeda.8 (sebagai kontrol). (B) Culex sp. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi. Hasil penelitian menunjukkan bahwa perlakuan pH 7. Depok. Jakarta ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua. sintasan . memberikan pengaruh yang berbeda nyata (P<0. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar.5 – 5. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. pendederan. namun tidak berbeda nyata (P>0. pH air pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp. pH 6.85 ± 0. Agus Priyadi*).50 ± 0.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat.9 dan pH 7. KATA KUNCI: Melanotaenia sp. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya. Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5.01 g dan panjang total rata-rata 3. Depok Pusat Riset Perikanan Budidaya.00.00 dan 16. KATA KUNCI: Benih ikan pelangi. memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar. dengan pertambahan bobot rata-rata sebesar 0. (A) Chironomus sp.0 – 8. Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal. dan Culex sp..24 cm. Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali.0-8.00 dengan metode pemberian sekenyangnya (adlibitum).) Eni Kusrini*).05) terhadap rata-rata pertambahan panjang total dan sintasannya.09 g dan pertambahan panjang total rata-rata sebesar 0.Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP. pakan alami.32 ± 0.05) terhadap pertambahan bobot rata-rata ikan. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor.0 – 6. Selama 45 hari pemeliharaan.. pertumbuhan.

padat tebar. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap. resirkulasi. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi. Rendy Ginanjar*). D. Ikan uji yang digunakan adalah benih berukuran panjang 2. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). B (2 ekor/L). Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari.13±0. B. B.07%. Prancis ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia.02 g.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*). 30 ekor/liter dan E. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). C. Lili Sholichah*). tetapi berpengaruh nyata (p<0. 20 ekor/liter. 15 ekor/liter. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. pertumbuhan.81%. Sintasan dari masing-masing perlakuan adalah sebagai berikut: A.67 mm. sintasan.02 cm dengan bobot 0. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara.22% dan E.22±0. KATA KUNCI: Metynnis hypsauchen. 96. D. 97. Pakan yang diberikan selama penelitian adalah nauplii artemia. ketersediaan pakan dan padat penebaran. 95. dan Jacques Slembrouck**) **) *) Balai Riset Budidaya Ikan Hias Depok.45%. Marendra Gladiyakti**) *) **) Balai Riset Budidaya Ikan Hias.05) terhadap pertumbuhan. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. Depok Universitas Diponegoro. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. KATA KUNCI: ikan botia. 35 ekor/liter. 25 ekor/liter. Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan. Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9.67%. C. padat tebar . 96. 96. Asep Permana*). Indonesia Institute Recherche Pour Le Developpement.

Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. memiliki bak untuk restokin. propinsi Jambi. KATA KUNCI: maggot. Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. fisiologi dan tingkah laku dalam merespon perubahan lingkungan. biokonversi. dan homing atau reproduksi. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. temperature. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). KATA KUNCI: Phenotipic plasticity. ketersediaan pakan dan pemasaran. kolam budidaya dan manajement budidaya yang baik. Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. Kawasan Mina Pakan Mandiri. Unit pengolah pakan memiliki prasyarat sebagai berikut. makanan.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. 2) unit pengolahan pakan dan 3) unit budidaya. Ikan Sidat (Anguilla sp. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. bahan pakan seperti vitamin dan dedak. salinitas dan arus. area penjemuran atau alat pengeringan pakan (drying). Unit budidaya ikan memiliki prasyarat sebagai berikut. memiliki bak kultur. air tersedia dalam jumah yang cukup. Ikan migrasi. Unit produksi maggot memiliki prasyaratan sebagai berikut. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. Migrasi terbagi menjadi migrasi vertical dan horizontal. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya.) . sedangkan factor eksternal yaitu. memiliki mesin pelet. lunar. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima.

mossambicus). jarak genetik.17 mM. Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). Jarak genetik 15 populasi persilangan berkisar (0. dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. Hasil dari persentase polimorfik (berkisar 5. NIRWANA (nila ras wanayasa).Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*). dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Oreochromis niloticus . Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik. mujair (O.26% – 63. mossambicus) Nunuk Listiyowati. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. tetapi yang menghasilkan benih hanya 15 populasi. Iman Rusmana**).28 mM. Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD). Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan.236 – 0. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. nitrogen anorganik. Persilangan. Selain itu.h-1 dan 0. Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O. juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut.40 mM dan 0. Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. Ikan yang di gunakan adalah hasil persilangan 4 strain.560). Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi. Sukamandi. sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST.mossambicus). Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan. Kata kunci: denitrifikasi. Kata kunci: Randomly Amplified Polymorphic DNA (RAPD). Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi.15%). Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. Didik Ariyanto. untuk mengamati variasi genetik benih persilangan ikan nila. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan dengan Pseudomonas aeruginosa. nila BEST (Bogor Enhancement Strain of Tilapia). nila merah (Red NIFI). terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&). reduksi nitrat . Aktivitas reduksi nitrat terjadi dari awal inkubasi.16 mM. Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi.

sebagai bahan baku pakan ikan patin.37% dan meningkatkan kadar protein dari 13. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia. ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma. Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.8%. Osphronemus goramy.37% setelah proses fermentasi. 4 hari (D2). Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). Sukamandi **) Universitas Jenderal Soedirman. menurunkan lemak bungkil sawit dari 14. 6 hari (D3). KATA KUNCI: PGC. rasio inti sel:sitoplasma yang besar. Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1).) Priadi Setyawan1).91% menjadi 15. nutrisi dan serat kasar . Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. PGC terdistribusi secara berkelompok di bagian ventral. inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit.. Pada tahap pembentukan mata. Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan.09% menjadi 4. distibusi. Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. KATA KUNCI: Bacillus sp. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi.74% menjadi 5. Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. bungkil sawit. fermentasi. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. Isdy Sulistyo2). Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.

kluster penetasan telur. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. salah satunya melalui Catfish Club Indonesia. Eni Kusrini****). Pengambilan data melalui responden dilakukan dengan cara purposive sampling. demikian juga ditinjau dari segi higienis dan kesehatan benih. dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk. integrasi. Bogor ****) Balai Riset Budidaya Ikan Hias.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. dan kluster pemeliharaan larva dan benih. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. Jakarta ***) . KATA KUNCI: UPR.Balai Riset Perikanan Budidaya Air Tawar. dengan masing-masing hatchery terpisah lokasinya. betina homogamet . Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. Jakarta **) Pusat Riset Perikanan Budidaya. Subang. Lusiastuti***). patin. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar.. dkk. Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. Angela M. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). Depok ABSTRAK Ikan patin (Pangasius sp. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. di antaranya daerah Bogor dan Subang. sebagai materi kegiatan tahun mendatang. Tipe integrasi bersifat soliter. dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal. Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran. Wartono Hadie**). Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. Perbedaan dari kedua sistem ini adalah sifat produksinya. sex reversal. KATA KUNCI: ikan nilem. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. dan Labuan (Merak). 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi. setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. jantan fungsional.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP.1994). kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*).

1. amonia. Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat.27 pada ukuran konsumsi dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. sintasan dan kualitas air (meliputi suhu. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva).57 % dalam satu generasi. larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. Agus Priyono. pertumbuhan. oksigen terlarut/DO. ikan mas strain rajadanu . Anang H K. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. KATA KUNCI: sintasan. salinitas. 15 butir/ liter perlakuan (I). dan nitrit). KATA KUNCI: seleksi generasi. pH. intensitas cahaya.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar.2 gram. M H Fariddudin A. kepadatan. 10 butir/liter (perlakuan H). memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut. Diketahui estimasi nilai heritabilitas rata-rata h²(S+D) = 0.

Survei dilakukan di beberapa daerah yaitu Cianjur. Hambali Supriyadi. Klaten. KATA KUNCI: antibakteri. Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik. bakteri probiotik. karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus). Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). penanggulangan. eksplorasi. Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri.Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. dan Lila Gardenia Pusat Riset Perikanan Budidaya.dan Tasikmalaya. penyakit streptococcosis .

Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). Erlania. di perairan Panimbang Kabupaten Pandeglang. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. Kabupaten Pandeglang. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. Kabupaten Pandeglang. Secara umum. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. budidaya laut. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. Untuk menjamin keberlangsungan usaha budidaya kerang hijau. Hatim Albasri. Teluk Lada. Pandeglang . pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. SIG. Provinsi Banten. KATA KUNCI: kerang hijau.

sedangkan dari kelompok protozoa adalah Epistylis sp. tingkat sintasan. Imron**).Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset.Forum Inovasi Teknologi Akuakultur 2010 pK 01 1.42%. dan kelompok ketiga ialah pembudidaya. dan Jatim.).. kelompok kedua adalah penghasil benih. kelompok kedua adalah penghasil benih. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. padahal permintaan cukup besar. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp. BBAP Samas-Yogya(Jateng). dan Opercularia plikatilis. BBUG Klungkung.). serta UPR yang mengembangkan usaha perbenihan udang galah. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP. Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Jateng. Ikhsan Khasani**). Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan. tingkat kesembuhan. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro. dan Spiranura sp. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas.) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76. STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*).Bali. tembakau (Tobacum nikotiana) . Parameter yang diamati meliputi pemeriksaan parasit. manajemen.. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya.Yogyakarta. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya. Vorticella sp. Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. dan diferensial hemosit. Retna Utami**). KATA KUNCI: udang. KATA KUNCI: huna (Cherax sp. Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Carchecium sp. Bali.. dan kelompok ketiga ialah pembudidaya. Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP Samas. kelompok kedua adalah BBU Pamarican (Jabar). Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu.. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE)..UPU Probolinggo (Jatim). Zoopthalmium sp. Bali.Wartono Hadie*). induk. Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro.

Pemeliharaan dilakukan selama tiga bulan. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. masing-masing dengan dua ulangan. Idil Ardi. kemudian dikeringkan sekitar satu minggu. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. yaitu menggunakan tingkat teknologi tradisional plus.84 kg/ha.000 kg/ha rumput laut. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. dan Wartono Hadie Pusat Riset Perikanan Budidaya. Empat petak tambak masing-masing berukuran 3.5 g.500 m2 digunakan untuk percobaan.66% dan 108. salinitas rendah.22% dan 72. Dengan teknologi yang diterapkan. pengapuran dan pemupukan. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. Hewan uji yang digunakan adalah udang vaname PL-48. dilakukan pengolahan tanah tambak. pada bulan pertama udang tidak diberi pakan. sedangkan pada dua bulan berikutnya diberi pakan pellet udang.1 kg dan kelangsungan hidup 11. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. penebaran dilakukan setelah satu bulan dari penebaran tokolan. polikultur. produksi . tokolan. namun polikultur udang vaname dan rumput laut masih kurang informasinya. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. Dari pemeliharaan udang selama tiga bulan. Sebelum penebaran.2 %. Kecamatan Cilebar. Penelitian ini dilakukan pada tambak di daerah Betok Mati. pengeringan. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah.n pengapuran sebanyak 175 kg/petak.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. Karawang. produksi 81.6 kg/ha.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35. survival rate. KATA KUNCI: udang windu.8 kg dan kelangsungan hidup 100 %. produksi 78. namun berbeda tidak nyata (P>0. Setelah dua hari. Gracilaria verrucosa. pemberantasan hama. KATA KUNCI: vaname. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. yaitu pertambahan berat rata-rata 230 g.

indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil.05) terhadap kelimpahan dan jumlah jenis plankton. dan metabolit udang. udang windu . sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. Dinophyceae. masing-masing dengan 3 ulangan. menggunakan bak kayu ukuran 1 m x 1 m x 0. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. Polychaeta. dan perlakuan D = tanpa sumber karbohidrat. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil.3 g dengan padat tebar 50 ekor/bak. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus. dan Cyanophyceae. Hal tersebut perlu mendapat dukungan dari penelitian.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. pola tradisional. pelakuan B = sagu. KATA KUNCI: tepung tapioka. kotoran. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. pola intensif. probiotik. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. indeks keseragaman menunjukkan komunitas plankton pada perlakuan D relatif lebih merata dibanding perlakuan lainnya. Pada budidaya udang windu intensif.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae.6 m sebanyak 12 buah. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. 25. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). dan Rotatoria. Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka. KATA KUNCI: plankton. Pada budidaya udang vaname pola tradisional plus. perlakuan C = tapioka.

5 m dengan volume air 400 L. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. sintasan. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea.000 ekor/petak). pupuk organik.05) terhadap pertumbuhan udang vaname.05) pada sintasan dan produksi udang vaname.780) dan indeks dominansi (0. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. KATA KUNCI: dinamika plankton. B = 2 mg/L. Nitzschia. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname. tambak . Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas. dan indeks dominasi plankton selama pemeliharaan udang windu. dan Pleurosigma dari Kelas Bacillariophyceae. indeks keseragaman (0. udang windu.427). Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing-masing: indeks keragaman (1. Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin. PO4.324–0. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. pH. NO2. Hasil penelitian menunjukkan perlakuan berpengaruh tidak nyata (P>0. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. BOT.689–0. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. oksigen terlarut.05) terhadap jmlah jenis dan kelimpahan plankton. namun berpengaruh tidak nyata (P>0. dan produksi udang vaname. serta Oscillatoria dari kelas Cyanophyceae. NO3. pertumbuhan. suhu. indeks keseragaman. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. perlakuan B = kotoran sapi.362). Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0. KATA KUNCI: probiotik. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. sintasan. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. dan perlakuan C = dedak padi halus.199–1. setiap 15 hari.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. C = 4 mg/L. Abdul Malik Tangko. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. indeks keragaman.

14 dan 2.05) antara perlakuan substrak tanah tambak. dan substak tanah lumpur.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2.24. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru.6. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau. biaya produksi. KATA KUNCI: substrak.8±0. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak. Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan.sedangkan pada perlakuan A dan B masing-masing 2.3±1..dan Rp 19. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda.650. B. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A). Substrak tanah lumpur. Perlakuan yang diujicobakan dalam penelitian ini adalah A. Penelitian dilaksanakan pada tambak ukuran luas 4. di mana masing-masing perlakuan diulang tiga kali. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28.03±0. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan. Machluddin Amin.875.5 dan 21.. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71.01 g.984. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak).2 cm dan bobot awal 0. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1. masing-masing dengan dua ulangan. budidaya. udang pama. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau. udang windu . Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari. substrak tanah sawah. Substrak tanah tambak. dan C. KATA KUNCI: efisiensi. biaya pakan pada perlakuan A dan B masing-masing Rp 11.0±5.239. umur pemeliharaan.634. Substrak tanah sawah. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka..

68-13.5 m dan 1 m. kisaran produksi 12. ukuran 84 sampai dengan 89 ekor/kg) dan C (16. KATA KUNCI: molase.998.2 ± 13. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar.4 ± 0. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan.1 ± 13.7%. masingmasing bak mempunyai ukuran panjang.6 kg/500 m2 = 406 kg/ha.975 dan lebih rendah dibandingkan perlakuan B yang mencapai 1. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. B). Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang.7%. salinitas rendah .66 kg/bak (7.7 kg/500 m2 = 320 kg/ha. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25. lebih tinggi daripada perlakuan B = 41. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91.61%.28-13.7% dan perlakuan C = 36. ukuran 80 sampai dengan 96 ekor/kg).235 kg/ha). Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C).15%. lebar dan kedalaman secara berurutan adalah 10 m. Namun demikian. kisaran produksi 9. Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan. fermentasi probiotik.325.86 g/ekor. 1. Maros.3 ± 5. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau.66 g/ekor.86 kg/bak (8. namun tidak berakibat terjadi kematian massal. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2. Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A. pertumbuhan udang. dengan rata-rata berat 11.45 kg/bak atau rata-rata 12. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah. KATA KUNCI: tepung tapioka. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau.64 kg/bak atau rata-rata 11.0 ± 2. di mulai setelah satu minggu penebaran. dengan rata-rata berat 12. udang vaname.92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90.3 ± 7. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2.767.2 kg/500 m2 = 506 kg/ha. Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B).

Nitrosomonas sp. Rhodococcus sp. sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. udang windu. Kontrol (tanpa pemberian probiotik B). Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji.0 hari.4255–0. dan R. laterosporus. diikuti perlakuan 5‰ sebesar 10±0.003 mL/L.3660 g. Q.) yang berukuran PL-20.57 hari .75%–68. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah.001 mL/L menghasilkan pertumbuhan tertinggi (0. Pemberian bakteri probiotik A (Bacillus sp. sedangkan juvenil dan udang dewasa hidup diperairan tawar. Pemberian probiotik A memberikan pengaruh terhadap rata-rata pertumbuhan mutlak benih udang windu. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol). 10 ‰. dan Rhodobacter sp. 85%. 88%. Aplikasi probiotik setiap tiga hari sekali.. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan. Pemberian probiotik B dengan konsentrasi 2. dan tiga ulangan. Pemberian probiotik A dengan konsentrasi 0. sebagai dasar perbaikan sistem penyediaan larva udang galah. P.75%. Pemberian bakteri dengan konsentrasi 0. Penelitian I adalah pengujian probiotik A.) dan probiotik B (mengandung bakteri Bacillus polimyxa. Dengan meneliti dua jenis probiotik. 5 ‰. waktu inkubasi. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6. Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata. dan kontrol 66. KATA KUNCI: salinitas. Universitas Padjadjaran.. dan 0‰ sebesar 11.5 mg/L. dan D.0 mg/L. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62. kualitas air. Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang.. udang galah.4440 g dan kontrol 0.25%. yaitu probiotik A (mengandung bakteri Bacillus sp. 1995). Tingkat sintasan yang diberi probiotik B berkisar antara 63. dan pertumbuhan udang. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab.8935 g). Pemberian probiotik B dengan konsentrasi 7.) berpengaruh nyata terhadap sintasan benih udang windu. 85%.5 mg/L. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan. Pemberian probiotik B dengan konsentrasi 5. Pengaruh perlakuan terhadap sintasan. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F. terdiri atas: A. B. sintasan. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL). pemberian dengan konsentrasi 0.15.002 mL/L. karena secara alamiah larva hidup di periran bersalinitas. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan.001 mL/L menghasilkan sintasan sebesar 81. Parameter yang diukur adalah kualitas air. Masing-masing perlakuan diulang sebanyak empat kali. terdiri atas: O. Pemberian probiotik A dengan konsentrasi 0. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter). Penelitian II pengujian probiotik B. Kontrol (tanpa pemberian probiotik A).3±1.Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. C.). sebelum diaplikasikan di tambak. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata.6±0. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata.50%. B.. Nitrobacter sp. pertumbuhan . Rata-rata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0.001 mL/L.25%. sintasan. Pemberian probiotik A dengan konsentrasi 0. KATA KUNCI: probiotik. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz.

dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. Hasil yang diperoleh adalah pada salinitas 5 ppt. Guna mendukung prgoram revitalisasi tambak. 25 ppt. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. 10 ppt (kontrol). Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor. 15 ppt.67%. 20 ppt.09 cm. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten.92±0. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. konsentrasi. pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. KATA KUNCI: Macrobrachium rosenbergii. udang galah . template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3).13 cm dan 1. PCR.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0.05). dan ukuran templat. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. salinitas. diantaranya karakteristik templat DNA genom yang meliputi kemurnian. Ditinjau dari keragaan pertumbuhan. yaitu templat dengan berat molekul tinggi (1). dan 20 ppt sintasan dari post larva udang galah mencapai 100%. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna.33±0. Selain itu. KATA KUNCI: pertumbuhan. Sukamandi. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. sedangkan sintasan pada perlakuan 25 ppt mencapai 61. 10 ppt. 15 ppt.

dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. ikan rucah (B).05). tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). Sintasan yang diperoleh pada penelitian ini yakni 52%–54. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen. perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. baik pertumbuhan bobot.5%. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja.66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. pemberian pakan. manipulasi lingkungan. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). Pakan diberikan dua kali sehari selama penelitian. maupun lebar karapas (P>0. Dari pencapaian bobot ini. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. Oleh karena itu. kepiting lunak . kepiting bakau. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. panjang. KATA KUNCI: pergantian kulit. KATA KUNCI: kepiting bakau.Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. dan gabungan keduanya (C). Sulaeman. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan. Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. Berdasarkan persentase.

pengrusakan mangrove juga terus berlangsung oleh berbagai alasan. dan produksi serta parameter kualitas air.04 ha. jumlah permudaan 450–500 pohon/ ha. sehingga perlu riset budidaya rajungan pada musim kemarau./m2. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan. data yang diperoleh dibahas secara deskriptif. tambak bersalinitas tinggi. rumput laut dengan kepadatan 1. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi.05±0.0 ± 2. produksi . KATA KUNCI: kerapatan hutan mangrove.000–1. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi. Peubah yang diamati adalah pertumbuhan lebar karapas. sintasan. restoking kepiting bakau. dan pelestarian alam. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009.2 g. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰—4 9‰) mengakibatkan sintasan dan produksi rendah. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan.5 bulan dengan panjang dan bobot masing-masing adalah 8. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari). Hasnawi.000 ekor/ha ukuran crablet-30. Ikan bandeng yang digunakan adalah gelondongan umur 1. perlindungan.1±0. pertumbuhan. Dibalik manfaat mangrove yang demikian banyaknya. bobot. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau.02 g dengan kepadatan 1 ind. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.300 pohon/ha dengan rata-rata 1. KATA KUNCI: rajungan. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. sintasan. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya.573.2 mm dan 0. Tambak ditebari benih rajungan.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh.100 pohon/ha.000 m2.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Tambak yang digunakan berukuran 10.2 ± 2.7 cm dan 4.

KATA KUNCI: Danau Maninjau. Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). SIG. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010. Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. Kappaphycus alvarezii. DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. rumput laut. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. bioakumulasi. I Nyoman Radiarta. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. Anjang Bangun Prasetio. Adang Saputra. kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. kondisi perairan sangat mendukung pengembangan budidaya rumput laut. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). cukup layak dan tidak layak. Secara umum. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya. KATA KUNCI: minapolitan. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet).03 mg/L. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). Secara umum. Untuk memfokuskan kegiatan budidaya rumput laut. logam berat . Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. Provinsi Gorontalo. layak. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009.

dan plankton dilakukan seminggu sekali. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. Subang. Adi Hanafi. Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan. Kualitas kimia air untuk pH. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah.814-0. TSS. BBRPBL Gondol . Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. Sampling air secara regular untuk pengamatan fisika. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. DO. kimia. indeks keseragaman berkisar antara E=0. SUBANG Joni Haryadi*). Nitzschia sigma. sedangkan indeks dominansi berkisar antara D=0. Indeks keanekaragaman berkisar antara H’=2. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut.962. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air. GONDOL-BALI Apri I. Dara Kasih**).085. dan Erlania*) *) Pusat Riset Perikanan Budidaya.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. Supii. KATA KUNCI: kualitas air. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut.711-2.853. alga hijau biru dan alga hijau). inlet. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah.076-0. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10. N. outlet. Subang. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. tambak. 20 dan 30. nitrit. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. Perifiton yang terdapat di Tambak Blanakan. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. KATA KUNCI: alga perifiton. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali.

Pengukuran N dan P dilakukan pada ikan dan pakan.900 g sedimen + 20 g TSP. serta produksi Moina sp. 9.87.. Ani Widiyati. P. Kusdiarti. kelimpahan. yang terdiri atas: 9 jenis pakan untuk ikan mas.83– 1. indek dominasi. yaitu: ikan mas (5. dilakukan pada hari ke-8 sejak dilakukannya penebaran.71%–10. Perlakuan adalah pemupukan dengan perbandingan N. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp.90. nila (Oreochromis niloticus) dan bawal (Colossoma sp. 1.53%–15. dan 1. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung.89%–17.17% dan 8. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g.96 ±1. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP.53%) dan ikan bawal (8.63% dan 10. dan bawal adalah 1.21%). dan 3). Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas.dengan produksi Moina sp. Bogor. K = 16:20:0. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio). ikan nila.16 g.89% dan 11.89.73–1.88–1. akuaponik. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan. 2). 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal.23%–6. Data dianalisis secara deskriptif. KATA KUNCI: konversi pakan. volume air 500 L. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi.) di laboratorium. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm.48%–9. limbah hara N dan P . dan keanekaragaman plankton. Parameter yang diamati adalah jenis. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan. ikan nila (3.58%–13. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP. Panen Moina sp.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin. 1.78%). setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP . KATA KUNCI: limbah.

Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir. Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. Esti Handayani Hardi**). khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani Pong-Masak Balai Riset Perikanan Budidaya Air Payau. mata. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. Hasil yang diperoleh. KATA KUNCI: rumput laut. sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. sehingga dapat meminimasi kegagalan panen. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S. Bogor Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) **) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur. di laut dan Gracillaria sp. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. Oleh karena itu. agalactiae setelah dilakukan uji Postulat Koch. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S.1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. penyakit. N14G (3). Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. 4. hama. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. Produksi rumput laut ditargetkan meningkat dari 2.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*).6 juta ton per tahun pada 2014. agalactiae. Oreochromis niloticus. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. Sukenda***). Isolat 1. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1).6 juta ton per tahun sekarang ini menjadi 7. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah. dan NK1 (5) yang berasal dari organ otak. Budidaya rumput laut khususnya Kappaphycus sp. Postulat Koch. N4M (2). Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. pencegahan . Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. N17O (4). KATA KUNCI: Streptococcus agalactiae.

Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden. Rachman Syah.81–6. nitrat 0. demikian pula dengan karakteristik físika dan kimia oseanografinya. karakteristik. Petrus Rani Pong-Masak. KARAKTERISTIK.1113 mg/L. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder. besi 0.38–44.Indra Jaya Asaad.02–9. kesesuaian rumput laut. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. suhu 29.33 ha. dan total suspensi <25–80 mg/L. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1.820.90 ppt.37. Syarifuddin Tonnek.66°C.85 mg/L. dengan tingkat kesesuaian lahan sesuai 21.095. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang. . Mudian Paena.0037 mg/L.95 ha. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian. salinitas 36. Kata kunci : Opsi pemanfaatan wilayah pesisir.039–0.09 mg/L.0267–0.1–8. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya.610.0032–0. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir. kedalaman 1–40 meter. bahan organik total 37. KATA KUNCI: potensi. Penelitian ini bertujuan untuk mengetahui potensi.0008–0. oksigen terlarut 5.10–36. fosfat 0. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari.3 meter. pH antara 6. analisis hierarki proses. Pengumpulan data primer dilakukan dengan cara wawancara mendalam. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka. Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI. kurang sesuai 2. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka.30 ha dan tidak sesuai 3.32 ha. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau.57°C–30. Kabupaten Kepulauan Selayar. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis.685 mg/L. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27.695. dan Makmur Balai Riset Perikanan Buddidaya Air Payau.01169 mg/L. nitrit <0.

Makmur. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. Cakupan wilayah penelitian meliputi Teluk Hurun. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. Utoyo. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. dan faktor pasar. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. NO3. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. tambak. PO4 dan Fe. Kabupaten Pontianak .Indra Jaya Asaad. analisis faktor. Rachman Syah. Muhammad Chaidir Undu. konduktivitas. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. Kata kunci : kualitas perairan. lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. kandungan oksigen telarut. NH3. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. pH. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. yaitu : faktor infrastruktur dan kondisi perairan. A. faktor teknologi budidaya. KATA KUNCI: keramba jaring apung. salinitas. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor. Parameter kualitas perairan yang diamati adalah suhu. NO2.Indra Jaya Asaad.

bau.46%. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempah-rempah kasar dan halus (ekstrak). kimiawi (kadar air.04 mgN% dan 6. TVB. Kadar air. dan viskositas natrium alginat).0%.26%. mikrobiologi (Angka Lempeng Total/ALT. dan mutu natrium alginatnya mempunyai kadar air 19. terbuka di atas lantai pada suhu ruang (sekitar 30°C). Sedangkan nilai TVB dan pH masing-masing sebesar 21. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15. KATA KUNCI: ikan sidat. Kelompok kedua ditebar di atas lantai dengan beralaskan waring.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. KATA KUNCI: pengeringan. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). kemudian direndam dalam larutan KOH 0. rendemen. natrium alginat. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk. Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik.97%.0%. dendeng. rasa. Rumput laut coklat dibagi menjadi dua kelompok.32%. abu. setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. Jakarta **) Pusat Riset Perikanan Budidaya. kadar abu.25% dan dendeng dengan bumbu ekstrak sebesar 59. Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. 28. lemak. analisis fisika-kimia . dicuci dengan air bersih. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat. protein lemak. dan tekstur) menggunakan skala hedonik. dan dijemur di bawah sinar matahari selama 18 jam. kadar abu 19. Rumput laut coklat setelah dipanen. abu. dan dijemur di bawah sinar matahari selama 18 jam. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air. kapang) dan rendemen.1%.44%. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna.4%. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. dan rendemennya 37. Rendemen dendeng sidat dengan bumbu kasar sebesar 57.1% selama 60 menit. dan protein masing-masing sebesar 14. dan pH). rumput laut coklat. Selanjutnya. dan 28.663 cps. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya.41%. 7. viskositas 8. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.

kekurangan modal.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Faktor pendorong yaitu ketersediaan air yang melimpah. Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. harga ikan yang tergantung pembeli dan cuaca. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat. prasarana fisik yang kurang mendukung. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). Metode yang digunakan adalah studi kasus. pengalaman petani ikan dan Kebijakan Pemerintah. polusi air. kelembagaan yang menunjang. agribisnis perikanan . Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. serta ketersediannya dalam skala kecil. Identifikasi faktor-faktor pendorong maupun faktor-faktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya. KATA KUNCI: potensi desa. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi.

Sign up to vote on this title
UsefulNot useful