Forum Inovasi Teknologi Akuakultur 2010

ABSTRAK PRESENTASI ORAL

Forum Inovasi Teknologi Akuakultur 2010

FF 01
PERFORMA IKAN NILA BEST DALAM MEDIA SALINITAS
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: L0ppt =2,1±0,23; W0ppt = 7,0±0.29; B0ppt = 139,8±6.72; L7,5ppt = 2,3±0.06; W7,5ppt = 8,2 ± 0,42; B7,5ppt = 164.3 ± 8,46; L15ppt = 2.3 ± 0,21; W15ppt 7.8 ± 0,45; B15ppt = 155,6 ± 8,95. Pengamatan setelah 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-50ppt: 4,0±0,34; 3-515ppt: 4,8±0,27; 5-80ppt: 7,4±0,35; 5-815ppt: 9,2±0,98. Pengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
KATA KUNCI: nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
PENGUJIAN LANGSUNG EMPAT STRAIN IKAN NILA (Oreochromis niloticus) PADA SALINITAS 40‰
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen (LT50) dengan 8 ulangan dari masing-masing strain. Analisa data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata LT50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT 50

Forum Inovasi Teknologi Akuakultur 2010

FF 03
PENGGUNAAN Saccharomyces Cereviceae PADA FERMENTASI PAKAN BUATAN UNTUK MENINGKATKAN PERTUMBUHAN NILA MERAH (Oreochromis Niloticus)
Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan, Universitas Padjadjaran

ABSTRAK
Penelitian ditujukan untuk menentukan persentase terbaik dari S. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. cereviceae sebagai perlakuan dan lima kali ulangan. Sebagai perlakuan adalah A0 (tanpa penambagan S. cereviceae); A1 (penambahan S. cereviceae 1%), A2 (penambahan S. cereviceae 2%), dan A3 (penambahan S. cereviceae 3%). Hasil penelitian menunjukkan penggunaan S. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. Pertumbuhan terbaik diperoleh pada penambahan S. cereviceae sebesar 2%
KATA KUNCI: Saccaromyces cereviceae, fermentasi, pakan buatan, nila merah

FF 04
ANALISIS KERAGAMAN GENETIK LIMA POPULASI NILA HITAM (Oreochromis sp.) DENGAN ANALISA SIDIK RAGAM RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD)
Iskandariah, Otong Zenal Arifin, dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi, Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. Populasi yang diamati meliputi jenis nila BEST, Nirwana, Gesit, lokal Kuningan, dan lokal Bogor. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD), dengan menggunakan primer OPA-03, OPA-04, OPC-14, dan OPC-15. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13.3333%–46.6667%, dengan nilai heterozigositas 0.0351–0.1952 dan jarak genetik antar populasi 0.1765– 0.5797.
KATA KUNCI: RAPD, genetik, populasi, ikan nila, Oreochromis

titer antibodinya menurun.01%. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. XY.1 mL/ekor. Genotipe XX mencirikan betina dan XY untuk jantan. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. S. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). Perlakuan dengan injeksi sel utuh S. Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. titer antibodi. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. agalactiae secara intra peritoneal pada ikan uji sebanyak 0. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Untuk kontrol. Oreochromis niloticus Angela Mariana Lusiastuti*). Pada perkembangannya. limfosit perlakuan tidak berbeda nyata dengan kontrol. Pada uji tantang setelah minggu keenam. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA.Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. Pada akhir pendederan dilakukan identifikasi jenis kelamin. dan differensial leukosit dilakukan analisa sidik ragam (Anova). Budidaya Perairan. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. Selain ditentukan secara genotipe. tidak cukup untuk memberikan protektif terhadap S. Komar Sumantadinata**). dan YY melalui evaluasi nisbah kelamin yang dihasilkan. seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. genotipe. diferensiasi kelamin.81% dan 83. 106. Tetapi setelah uji tantang. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. ikan uji disuntik dengan PBS. agalactiae pada tingkat kepadatan 108. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. ikan nila .55% sedangkan genotipe XY dan YY masing-masing sebesar 79. SR). 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga. XY. 106. yaitu genotype XX. Hasil yang diperoleh bahwa sel utuh (whole cell) S. Kata kunci : Ikan nila. Sukamandi **) Dept. Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. agalactiae. KATA KUNCI: vaksin sel utuh. pengukuran bobot individu rata-rata dan penghitungan sintasan. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. agalactiae. Uni Purwaningsih*). DAN YY Didik Ariyanto*). Data sintasan (Survival Rate. Fakultas Perikanan dan Ilmu Kelautan.

dengan variasi perbedaan kepadatan bakteri vaksin (A=108. Selain itu. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. adalah septikemia dan meningoencephalitis. terutama dalam hal manajemen pemberian pakan. TDS. Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. keramba jaring apung (KJA). Angela Mariana Lusiastuti. Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. NH3. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. Danau Maninjau. D=102 cfu/mL dan E=kontrol).5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. Anjang Bangun Prasetio. DO. KATA KUNCI: manajemen pakan. turbiditas. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. pH. lingkungan perairan . Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0.5). BOD. B=106. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). Selain itu. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. NO3. serta data status kegiatan budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. total nitrogen. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. pemanasan.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. karena pada kondisi perairan yang kurang baik akan menyebabkan stres pada ikan. ortofosfat dan total fosfat. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. kecerahan. Pemberian pakan tidak boleh berlebihan. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. KATA KUNCI: Streptococcus agalictiae. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. dan Joni Haryadi Pusat Riset Perikanan Budidaya. melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. C=104. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. NO2.

48%). Fakultas Perikanan dan Ilmu Kelautan. Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia). Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. tebal (-1. lebar (0.53 % bt/hari. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. tebal. KATA KUNCI: heterosis. oreochromis niloticus .20%.35% bt/hari.21%). Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49. SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2. tinggi (3.22%).94%). tebal (0. persilangan. Komar Sumantadinata**). Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. bobot) dan sintasan.82%).74%).Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*). dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan sintasan(1. Sukamandi **) Dept. IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi.87%) dan sintasan (0. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4. tidak berbeda nyata (P<0. Nunuk Listiyowati.80%.48% bt/hari dan 2. Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (-2. bobot (-2. Budidaya Perairan.65%).64% bobot badan (bt)/hari.06%).44%). bobot ( -2. sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74. sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2.05) bila dibandingkan dengan dua populasi lainya. Parameter yang diamati meliputi keragaan pertumbuhan (panjang. Sukamandi selama lima bulan. tinggi.

Konfirmasi taksonomis hingga level spesies isolat bakteri S. 2. vaksin. KATA KUNCI: toksisitas. dan 96 jam. dan sonikasi. Hasil penapisan menunjukkan bahwa bakteri S.6578–2. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S.08 g. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis. 3.5805).1295).3354 (3. ikan nila .8090) dan benih ikan nila 5. 48.0930). 72.5094 (2.1100).9421 mg/L (1.7504). Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila. 72. 3. Data diolah dengan analisis probit program LC50. iniae (N2O).6799–13. Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar. Hasil penelitian menunjukan bahwa Nilai LC50 24.4227– 4. N17O. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung. dan nilai terbesar dimiliki oleh bakteri S. streptococciasis. 48. KATA KUNCI: penapisan. Bogor. NK1) dan 1 isolat S. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). dan 96 jam terhadap benih ikan mas adalah 4. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran.6297–0. N14G.8532).9823–4. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1. 0. 1.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar.55±0.5480).13 dan 1.8101–1. benih ikan. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak. pemanasan. dan 96 jam. agalactiae (N3M. uji stabilitas dan LC50–24. iniae (N2O).7138 mg/L (0.0839(2. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration (LC50) 24. Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan.9237(0. 48. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah.0678 (1. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN. agalactiae (N4M) memiliki nilai LD50 terkecil.6904– 5.81±0.7877–2. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin. Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp. N4M. 0. agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik.0430 (4. Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan.

0 g. dompet. KATA KUNCI: bahan penyamak kron. lemas.0–3.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi.184. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih. simetris. kekuatan regang (kemuluran) 66. suhu kerut 88°C. pembesaran. kerapu sunu . liat. 40. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut.66%. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. dan 15% . kakap putih. namun sintasannya masih rendah yaitu sekitar 1%–3%. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak.46 N/ cm2 atau 222. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa Tenggara Barat. tas.00–08. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. dan 80 ekor/m3 selama 5 bulan masingmasing mencapai ukuran 127. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi.94%.5 kg. Waktu pemijahannya sekitar jam 24. Nusa Tenggara Timur. kadar lemak 6. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20.00. Ikan ini mudah terserang parasit seperti cryptocarion. 10%. karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih. Telur yang ada dalam kolektor dapat diambil jam 07. untuk dijadikan kulit tersamak. KATA KUNCI: pembenihan.93% dan kadar Cr2O3 1. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g. 103. kekuatan jahit 1.53 N/cm atau 138.76 kg/cm2. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek. sarung tangan. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek. benedinia. Pembenihan ikan ini mulai berkembang di sekitar Gondol.00 sampai jam 03. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu.12 kg/cm. yang merupakan limbah perikanan dari perusahaan filet ikan. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi). kambing. Selain itu. Sulawesi.00 pagi hari. dan Sumatera. dan corak permukaannya spesifik. kadar air 13. garmen.62%. kadar abu 2. Ikan ini relatif sensitif dengan perubahan lingkungan.354. dan 102. sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1.5 g.2 g. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya.97% sehingga sangat prospektif untuk dijadikan barang-barang kerajinan kulit. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. kambing dan ikan pari yaitu berisi. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. Dalam pembesaran. dan sebagainya. dan cacing. kekuatan tarik 2.

dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. jumlah kejutan 5. mikroinjeksi. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. KATA KUNCI: transfeksi. lama kejut 30 ms. 2. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. ikan kerapu tikus . mikroinjeksi. dan 20 µg/ mL. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. Namun demikian. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. dan 3 detik. Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. 10 µg/mL. Cromileptes altivelis Slamet Subyakto*). Situbondo **) Fakultas Perikanan dan Kelautan. Alimuddin***). hormon pertumbuhan. dan Gemi Triastutik*) *) Balai Budidaya Air Payau. Komar Sumantadinata***). Rustidja**). di antaranya Indonesia. M. Metode elektroporasi dilakukan dengan voltase 50 V. Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. mikroinjeksi. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang.1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. elektroporasi. transfer gen. Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. jarak waktu antar kejutan 0. Sasmito Jati****). sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. Ratu Siti Aliah*****). Irvan Faizal*****). Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit.

Salah satu faktor yang berperan adalah lingkungan pemeliharaan.00%) yang baik bagi benih kerapu sunu. selanjutnya perlakuan C (64. oksigen .19%) harian serta laju pertumbuhan bobot badan spesifik (6. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. Peubah yang diamati adalah sintasan. Sampling dilakukan setiap minggu. efisiensi pakan. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0. dan 15% dari total biomassa benih. KATA KUNCI: larva kerapu sunu.25) dan efisiensi pakan (80. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3.69 g dan panjang total awal 3.39±0. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU. Materi yang digunakan adalah larva kerapu sunu sebanyak 4. serta terakhir perlakuan D (47. laju pertumbuhan harian. laju pertumbuhan spesifik.20-4.35 mm). Nilai pertambahan panjang tertinggi A (72.19%) dan panjang total spesifik (1. D (kontrol).02%) serta nisbah konversi pakan (1.20 cm. Pakan yang digunakan adalah pakan pelet komersial. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus). laju pertumbuhan bobot badan harian (10. pertumbuhan panjang larva. B (oksigen).73%) dan panjang total (9.000 ekor/bak. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut. Namun.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut.95 mm). Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan. Kendala yang dihadapi terutama terjadi pada stadia awal.69 mm).68 g) dan panjang total (6. optimasi pakan. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan. nisbah konversi pakan.31±0. probiotik. yaitu 5%.42±0. KATA KUNCI: benih kerapu sunu. dan efisiensi pakan pada benih kerapu sunu.52±0.86 mm). dan kualitas air.35 cm). Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen). dan perlakuan B (63.90±0. pertumbuhan.50-0. Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva. Pemberian pakan dilakukan tiga kali sehari. C (probiotik). Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu.19±0. 10%. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan.

/mL dan mulai umur 17 hari diberikan nauplii Artemia. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C.96 mg. kerapu macan .5 ± 4. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol. KATA KUNCI: pakan buatan. Perlakuan C: 5 kali/hari pada umur 7-20 hari. mencapai ukuran panjang total pada perlakuan A: 24. imunstimulan.04 ± 0. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut. Anak Agung Ketut Alit. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0.68 mm. perlakuan B adalah 6. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian.65%.03% dan perlakuan C adalah 8. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN. Perlakuan B: 4 kali/hari pada umur 7-20 hari.12 mg dan C: 211.95 mg. KATA KUNCI: Epinephelus fuscoguttatus. aktivitas lisosim sebesar 1. Mulai larva umur 2 hari diberikan Nannochloropsis sp. serta bobot badan pada perlakuan A: 192. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. sedangkan kontrol hanya disuntik dengan PBS.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular. larva kerapu macan.57 mm. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari. indeks fagositik sebesar 1. B: 196. dengan kepadatan 1.50%. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind.5 ± 2.62%.0x105 sell/mL. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari. infeksi. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19. Gondol ABSTRAK Ikan kerapu macan.55 mm dan C: 26. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6.87 cm dan sintasan setelah diuji tantang sebesar 72.87. Perlakuan A dan B tidak berbeda nyata.08 ± 1. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L.62 ± 2.20 ± 0. Bejo Slamet. terutama infeksi virus. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari. B: 24. Epinephelus fuscoguttatus Irwan Setyadi.81 ± 0. Des Roza.1 ± 2.00%.08 ± 2.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun nonspesifik ikan kerapu macan. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny. Masing-masing perlakuan diulang 3 kali.

KATA KUNCI: kerapu bebek (Humpback grouper). pembenihan. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. KATA KUNCI: efisiensi. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp. panjang. dengan sintasan 6. pada bak A : ikan rucah + cumi-cumi + vitamin. konsentrat mempunyai sintasan 19. generasi kedua (F-2). Setiap bulan dilakukan pengamatan pertumbuhan bobot.10% dan panjang total 21. pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari. Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. perkembangan oosit . sedangkan pada bak B : pakan pelet kering.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya. konsentrat yang bisa dibeli di pasaran. kerapu bebek (Cromileptes altivelis). Sampai dengan bulan Oktober telah berhasil memijah. Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. dan dilihat perkembangan oositnya. Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. yang kurang baik. Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk.72% dan panjang total 18. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor.86 mm.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp.

17. Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. Sampel larva diambil pada umur 1. Ketut Mahardika. 4. manajemen air media pemeliharaan dan manajemen pakan. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin. 2.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. pemeliharaan dilakukan hingga yuwana (2 bulan). Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. Selain itu. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. produksi massal . 5. Tangki pemeliharaan yang digunakan ukuran 8-10 m3. 15. histologi. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor. 3. KATA KUNCI: pemeliharaan larva. 20.8%-41. mutu benih kerapu. Tetapi tingkat sintasan yang didapatkan masih rendah. Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. Cromileptes altivelis Yasmina Nirmala Asih. 25. 7. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). 10. 13. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). dan 32 hari setelah menetas masingmasing sebanyak 10-20 ekor. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D-15). KATA KUNCI: kerapu bebek. organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Indah Mastuti. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29.

dan siklus kedua menggunakan larva dengan kekebalan bawaan. catfish seed. KATA KUNCI: innate immunity. Oleh karena itu. 15% (P>0. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. Pakan diberikan 2 kali secara “adlibitum”. Ketut Suwirya. Kematian larva umumnya terjadi pada hari keempat. Sumber protein utama pada pakan adalah tepung ikan. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. Lies Emmawati*). Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. Hasil penelitian menunjukkan bahwa nilai bobot akhir. I Nyoman Adiasmara Giri. di lain pihak hasil tangkapan cenderung menurun. Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. siklus pertama.05). laju pertumbuhan spesifik. akibat serangan penyakit dan kondisi media. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. KATA KUNCI: protein sel tunggal. Pangasius hypophthalmus . 10%. dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. Oleh karena itu. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut.Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. survival rate. Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR). Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). 5%. dan ketiga menggunakan larva tanpa kekebalan bawaan. Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. perlu alternatif lain sebagai substitusi tepung ikan. 10%.4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan.651 ekor benih untuk setiap induknya. Salah satu sumber protein alternatif adalah protein sel tunggal (PST). Pakan penelitian berupa pelet kering dengan kandungan PST 0%. Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. (pakan kontrol). Tingkat kematian larva dapat mencapai 40%–80%. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar.797–457. dan 20% dalam pakan. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. pertambahan bobot. 15%.

pakan A (82. Kecernaan protein tertinggi berturut-turut pakan C (82.010±0. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32. Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan. C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin. D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase). KATA KUNCI: fitase . Pakan diberikan 3 kali sehari secara at satiation. Parameter yang diamati adalah laju pertumbuhan panjang badan. Pangasius djambal.910±0.93%) dan terendah salinitas 3‰ (25. benih. kemudian salinitas 3‰ (4.0%).3%).92 cm). dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm.32% per hari menjadi 4. Ade Dwi Sasanti. Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter. yang dilanjutkan dengan uji Tukey.2%).00%).1%) dan pakan E (95.140±0. KATA KUNCI: salinitas. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan.204±0. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal. Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4.763±0.13% per hari. pakan C (98.75±0.17% per hari menjadi 1. Analisis data dilakukan secara deskriptif.5 g/ekor. Dade Jubaedah.674±2. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰.8%).4%) berbeda nyata lebih tinggi dibanding pakan E (68.223±0.07 cm). Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.25±0.764±3. selama 30 hari. Ikan patin sebayak 15 ekor.49 cm). sintasan serta beberapa parameter kualitas air. ikan patin. pakan B (82.114±0. Kecernaan protein juga meningkat akibat penambahan enzim fitase. dan (C) 3‰ dengan tiga kali ulangan. Ikan uji yang digunakan berukuran 2 ± 0.3%) dan pakan D (80. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak). dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan. sedangkan laju pertumbuhan panjang harian meningkat dari 1. diikuti salinitas 2‰ (28. Pangasius hypopthalmus Mohamad Amin.1%). Kecernaan P pakan B (98. dan salinitas 1‰ (3. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN. (B) 2‰. Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3.14%).35±0. Data diperoleh dianalisis sidik ragam.46% per hari. dan sintasan .884±2.4%). Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan.1%) berbeda nyata lebih tinggi dibanding pakan D (97. dan A (98.

dan C (613.5 juta ha (rata-rata 20 juta ha). Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia. Pupuk anorganik + organik + probiotik dan C. sintasan ikan. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. ikan patin. Sularto.60±10.5). maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut. Patin Siam. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4. Pupuk anorganik + organik yang difermentasi + Probiotik. namun perlakuan B (7 ekor/m2) memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95.49±1. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam.08 g dan 3.2%. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia. 0. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g). Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan.51 g dan 11. Kata kunci: Intensifikasi. B (660 g). belut.31 cm B.37 cm C 16. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan.5%-9.2%). dan C (10 ekor/m2) dengan 3 kali ulangan. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. yaitu antara 13. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masing-masing perlakuan: A. B (7 ekor/m2). Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. Padat tebar larva yang digunakan adalah 100 ekor/m2.27±0. Akmal. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam.19±0. pengecekan induk. Larva yang ditebar berumur 20 jam setelah menetas. predator yaitu antara lain: Ikan liar (gabus. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan dan sintasan ikan.5-26.26 cm.74±0. 0. Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah. Pemupukan. Pupuk anorganik + organik.12 g dan 3. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. KATA KUNCI: budidaya. pemijahan. udang liar) serta jenis serangga air. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. dan Syafrudin Balai Budidaya Air Tawar. komposisi pakan alami kolam. nila.7% rendahnya sintasan ini diduga karena adanya faktor hama. betok. sepat. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2). dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan C (95.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari. lahan marjinal . Jika luas gambut Indonesia adalah 20 juta ha.7. B. Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11.9%).42±0.3 g) dan SR perlakuan A (91. penetasan telur dan pemeliharaan larva di kolam. Pemberian pakan dengan pelet apung sebanyak 5% per hari. B (95.

76 cm dan 2. Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. pertumbuhan. Padat tebar yang digunakan adalah 5. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8. Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Evi Tahapari***).06%) dan terendah pada kepadatan 20 ekor/m2 (7.60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97. Percobaan dilakukan selama 100 hari pemeliharaan. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Jakarta **) Balai Riset Perikanan Bididaya Air Tawar.47 g). pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela.71). diikuti dengan kepadatan 10 ekor/m2 (92. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES.10%/hari. nasutus . Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3.17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3. dan Sularto***) *) Pusat Riset Perikanan Budidaya.46 g). salinitas. 15 dan 20 ekor/m2 dengan bobot awal antara 15. 15 ekor/m2 (70. Sifat biologi pertumbuhannya belum banyak diketahui. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2.5 m. pertumbuhan. Zafril Imran Azwar**).80%. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin.18) dan terendah pada 10 ekor/m2 (1.45 g).36 cm. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda. 10.74 g) dan 20 ekor/m2 (61.000 ekor atau kepadatan 5 ekor/m2. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari.43–11. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99. Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. sedangkan petakan kedua ditebar sebanyak 2. dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3. di samping itu. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%. Evi Tahapari. KATA KUNCI: patin pasupati.54 g dan panjang awal antara 10. JAWA TENGAH Ongko Praseno*).76%). Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih.70–20.09 cm dan 1. Kata kunci: padat tebar. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95.000 ekor atau kepadatan 10 ekor/m2. Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1.52%) dan terendah pada 20 ekor/m2 (91. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt.30%).

perendaman. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. intraperitonial. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*). Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0. 109. sintasan. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. Parameter yang diamati adalah insidensi dan sintasannya. dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya. Bogor ***) Pusat Riset Perikanan Budidaya.67%). 106.003 mg/L (4. Perlakuan kedua adalah padat tebar: 5 ekor/L.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*).002 mg/L (83. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. dan 15 ekor/L.35 ± 0. Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109.35 cm).001 mg/L (4. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar.002 mg/ L. Ikan uji yang digunakan berukuran 1–2 inci. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan. dan kontrol. (B) 0. sebagai perlakuan yaitu: (A) 0.67%). Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0.003 mg/L (81.60 ± 0. KATA KUNCI: probiotik.14 cm). Kata kunci: uji tantang Aeromonas hydrophila. 108. yaitu: cara perendaman dan cara penyuntikan intraperitonial.001 mg/L (86.49 cm).002 mg/L (4. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal.001 mg/L. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. Probiotik diberikan dengan dosis yang berbeda. kemudian perlakuan dosis 0. Ikan uji yang digunakan berukuran 3–4 inci.33%) dan terendah perlakuan dosis 0. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Analisis data dilakukan secara deskriptif. dan (C) 0. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif. diikuti dosis 0. dan kontrol (placebo). kemudian dosis 0.003 mg/L dengan tiga kali ulangan. Nurbakti Listyanto*). 107. Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air. Sukamandi. Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. benih. Evi Tahapari*). 108. Angela Mariana Lusiana**). dosis. dan pertumbuhan . Jakarta **) Balai Besar Riset Perikanan Budidaya Laut. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air. 10 ekor/L. Uji tantang dilakukan dengan dua cara.55 ± 0. Pengamatan dilakukan selama 15 hari setelah perlakuan.

130–22. dan tahap 5 (atresis) dengan diameter oosit 300–1. dan 25% ampas tahu:75% tapioka.41±0. Aspergillus niger. Zafril Imran Azwar.52% (pakan B). yakni pengamatan perkembangan gonad dan fertilisasi.250–1. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur. Derajat penetasan patin nasutus berkisar 44. tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm. Penelitin ini terdiri atas dua tahap. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu. 75% ampas tahu:25% tapioka. Bambang Iswanto.900 µm. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologi-reproduksi berkaitan dengan kapasitas produksinya. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.700–4. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar.850 µm. ampas tahu. larva. substitusi protein 2. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu. substitusi protein 0% (kontrol) (pakan A). hatching.04% (pakan D). Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger.700 µm. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. 50% ampas tahu:50% tapioka. rearing. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129.05% dengan lama inkubasi 22–25 jam.58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4. artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari.03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai. dan substitusi protein 6.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati. Pangasius nasutus .03 g/ekor dengan kepadatan ikan 20 ekor/akuarium. substitusi protein 4. Ke dalam wadah ditebar ikan patin ukuran 11.16%–79. tahap 3 (granula kuning telur) dengan diameter oosit 700–1. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1.03% (pakan C). KATA KUNCI: fermentasi. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11.000 µm. ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus. Perkembangan oosit patin nasutus bersifat sinkronis grup. Ukuran panjang total larva yang baru menetas berkisar 3. KATA KUNCI oosit.

28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias.47±0. 50% zeolit + 50% bioball dan D. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A. 91.43b.98±0.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. 88.13 mm. siam. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0.34±0. tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus.10–1. 4.33%. 0. larva. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20. 0.45 g/ekor. 95. B.42±0.02 g/ekor. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya.20 mm. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa. biofilter. dengan kantung kuning telur berukuran 0. KATA KUNCI: patin albino. nasutus . 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D. sedangkan patin hibrida siam-jambal sebesar -4. 1. 88. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi. dengan kantung kuning telur berukuran 0. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan. hibrida. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A.35 cm/ekor dan A. berukuran panjang total 3. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian.24) x 103. 79.69 cm/ekor diikuti B. 92. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih. masing-masing perlakuan diulang sebanyak empat kali.89±0. C.75% dan terendah perlakuan A.71±0. 25% zeolit + 75% bioball.1.31ab. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D.23%.62 g) dan panjang (2.20.27a.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin. dan D. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER. 1.60 cm/ekor. 0. 75.03±0. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var.08 mm3 yang terserap 50% pada umur 30 jam dan habis terserap pada umur 60 jam.25 g/ekor. 4. 2. dan D. C.30a.6±0. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A. pertumbuhan. diikuti perlakuan B. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus.54 cm).30ab.67%. berukuran panjang total 3. C. B.84 g/ekor dan terendah A. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi. 100% zeolit B.01±0. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi.01±0. 2. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE. C. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa. Kata kunci: embriogenesis.64±0. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut. B.28%.42.58%. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat. C. 1. 1. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D. 89. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. diikuti perlakuan C.56 cm/ekor.14 mm. jambal. 75% zeolit + 25% bioball.1±0.

KATA KUNCI: feed digestibility.6%–83.2 kg/ha/musim. milk fish. padat penebaran udang windu. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. 88. Oleh karena itu. Untuk menentukan total limbah N termasuk eksresi amonia. lalu ditambahkan kromium oksida (Cr2O3) sebagai indikator kecernaan. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. dan 3. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). Jika bioflok terbentuk. 21% dan 26%. produksi. Pakan tersebut digiling ulang. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur.2% untuk bahan kering. heterotrof bakteria .1% untuk C-organik.990 kg/ha/musim dengan rata-rata 292. Neltje Nobertine Palinggi*). dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. lama ikan bandeng digelondongkan. lama pemeliharaan ikan bandeng. Enang Harris**). Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2.28% untuk pakan berprotein 26%. ikan bandeng. Hasil penelitian menunjukkan bahwa.0% untuk protein dan 81.2%–78. tambak. Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok). dan Anugriati Balai Riset Perikanan Budidaya Air Payau. Maros **) Fakultas Perikanan dan Ilmu Kelautan. N waste. KATA KUNCI: pengelolaan.6%–90. Eddy Supriyono**). dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%.27 g N untuk pakan berprotein 17%. dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya.76 g N untuk pakan berprotein 21%. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone. dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. Oleh karena itu. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). Dedi Jusadi**).Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar. 2. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak. Akhmad Mustafa. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein pakan yaitu 2.

bandeng. DAN PEKALONGAN ) Anjang Bangun Prasetio. Khususnya di wilayah Pantai Utara yaitu Kendal. Oleh karena itu. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L. opsi kebijakan . Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. Eddy Supriyono**).54% per tahun kurun waktu tahun 2005–2009.250 ton. Penambahan inokulasi bakteri komersial (Bacillus sp. Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol).000 ton dan mengalami kenaikan rata-rata 13. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. dan Rasidi Pusat Riset Perikanan Budidaya. kendala. KATA KUNCI: Heterotrofic bakteria.975 ha. Enang Harris**). PATI. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. KATA KUNCI: budidaya.66% dari tahun-tahun sebelumnya. Molase digunakan sebagai sumber Corganik.) cenderung meningkatkan kandungan asam amino bioflok. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau.726 ha dan yang layak untuk budidaya sekitar 6. (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12. Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475.000 ton dan mengalami kenaikan sebesar 14. Hatim Albasri. Penyusun utama bioflok ini adalah bakteri heterotrof. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya. growing. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan. Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya. Pati. dan Pekalongan. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. Dedi Jusadi**). Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL. Pada tahun yang sama.

Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein. Gusrina*). DKH-e dihitung sebelum telur menetas.0±0. Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi.33±1. DP untuk â-aktin-GFP.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur. Konstruksi gen dalam bentuk plasmid mBA-gfp. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA). KATA KUNCI: promoter.3±0.66±1. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout.0%). HEAT SHOCK DAN KERATIN PADA IKAN LELE.33±3.0±10.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik.34±1.00±1.63±10. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0. dan Utut Widyastuti***).0%) dan yang terendah â-aktin-GFP (3. 18. Ekspresi gen gfp tidak tampak lagi pada saat telur menetas. FMIPA. Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji. Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. ikan lele . gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi. mikroinjeksi. menyusul heat shock-GFP (10. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi. sedangkan DP dihitung ketika semua telur telah menetas. keratin-GFP (21. Data dianalisis secara deskriptif. GFP.65%. DKH-e yang diinjeksi dengan â-aktin-GFP (25. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp.66%) relatif sama. Clarias sp. Alimuddin**). Komar Sumantadinata**).33%.67%. keratinGFP. Hasil penelitian menunjukkan bahwa DKH-e (63.34%) dan DP (63.****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan. dan heat shock-GFP berturut-turut adalah 20. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20.0%). Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi. Fakultas Perikanan dan Ilmu Kelautan.Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN. dan 15. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC.03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi.65%) dan heat shock-GFP (18.00±1.00±3.67%). sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi.

53%) (P<0. 1..71±2. Feces yang dihasilkan diambil setiap hari. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna. ikan lele dumbo (Clarias gariepinus). pakan terapung . dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus).37% kadar abu.30±2. Rita Febrianti. pegagan Centella asiatical [L] Urb. hydrophila. 39. KATA KUNCi: A. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus). Pada perlakuan tanpa aerasi. Melalui penambahan aerasi. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif). pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92.47±4.05) dari 79. hydrophila menjadi penyakit endemis di Indonesia. Ikan lele dumbo berukuran 41. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi. 5.39% kadar asiaticosid. Bak diisi air sebanyak 100 liter.33% kadar sari dalam air. KATA KUNCI: kecernaan pakan. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani. 6.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB. Angela Mariana Lusiastuti.74±1.34% kadar air. Taukhid.25% sehingga tidak berbeda nyata dengan pakan terapung. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo. 24.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak.47±4. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. bahan aktif. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0. Pemberian pakan sebesar 5% dari biomassa per harinya. Kandungan bahan aktif hasil pengekstrasian pegagan segar.41 mg/L) dengan dosis efektif 250 mg/L.623. pagi dan sore.53% menjadi 92. aerasi. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5.23% kadar abu tak larut asam.83% kadar sari dalam alkohol. pakan tenggelam. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%.05). 0. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang.15%) dibandingkan dengan pakan tenggelam (yakni 79.

alkalinitas. Laju pertumbuhan spesifik. dan perkembangan gonad).0 m x 0.10 g sebanyak 40 ekor. bloodworm. Wadah percobaan yang digunakan adalah bak beton ukuran 1. oksigen.90%. pH.33±0. dan dirancang sistem resirkulasi.85%.8–4. dan 30 g/40 liter masingmasing diulang 3 kali. Sulasy Rohmi. ikan. dan penurunan lemak 61. 7. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. dan cuk yang diberikan diselang-seling secara adlibitum. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor.92%. reproduksi.56%. dari perlakuan kontrol.83% tidak memperlihat perbedaan dengan perlakuan kontrol. panjang.0 m x 1. kualitas air (suhu. dan molase. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11. namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25. dan 25. 19. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. fermentasi. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2. dan gonad . lele dumbo FF 46 ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA Tutik Kadarini. 20. Jenis pakan berupa cacing tubifex. Siti Subandiyah. formulasi. penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7.28%.Forum Inovasi Teknologi Akuakultur 2010 FF 45 PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus) Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9. KATA KUNCI: gurame coklat. amonia.7 cm mencapai TKG III. dan karbondioksida). dan Darti Satyani Balai Riset Budidaya Ikan Hias ABSTRAK Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0. Setiap perlakuan dengan 3 ulangan. KATA KUNCI: maggot.8 m.1 cm. Parameter yang diamati sintasan dan pertumbuhan (bobot. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. 10.96%. tapioka. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol). Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3. 13.3–3. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar.81% dalam formulasi pakan.

produksi telur per sarang. Lamanto.86%. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang). Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. daun sente. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. 14% dan kontrol yakni masing-masing 79. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan. dan 71. Sukamandi ABSTRAK Ikan gurame termasuk ikan dengan fekunditas rendah. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. sehingga petani tidak mengalami banyak kerugian.75 buah.5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa. dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10. Jakarta ABSTRAK Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0. biokimia. KATA KUNCI: ikan gurame.774 butir per sarang. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. Perlakuan yang diterapkan adalah kadar protein 38%. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92. Dari hasil penelitian menunjukkan bahwa di daerah Blitar.13 buah) dan hanya daun sente (0. 33%. yaitu seperti daun talas. Pakan yang diberikan berupa daun sente sebanyak 3. 33%. yakni 0.09). yaitu di Jawa timur (Blitar dan Tukung Agung). 4. pakan buatan. Pemberian pakan tambahan dengan kadar protein 38%. penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat.5 buah).546 butir dan 2. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi. dan injuk sebagai bahan pembuat sarang. Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman. Mycobacteriosis.23% dibandingkan dengan pemberian pakan dengan kadar protein 33%. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame.94% (P=0.) DI JAWA Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. keragaan reproduksi .05%.351 butir. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0.26). Mycobacterium fortuitum. Induk gurami yang digunakan berbobot 2-3 kg/ekor. 28. KATA KUNCI: fish TB. dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). dan 14% sesuai dengan label pada kemasan masing-masing. Masing-masing perlakuan mempunyai 2 ulangan.88 buah. PCR FF 48 PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI Bambang Gunadi. dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina.Forum Inovasi Teknologi Akuakultur 2010 FF 47 APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC. dan tingkat fertilitas telur yang dihasilkan. lebih rendah dibandingkan dengan yang diberikan pakan tambahan berkadar protein 33%. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang. namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0.730 butir.

yang menunjukkan terbentuknya plasmid rekombinan. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. dan polar fermentasi berbeda nyata (P<0. Bogor dan terdiri atas dua tahap.14% dan kadar lemaknya turun sebesar 19.33%.02% sedangkan kandungan lemaknya turun 13. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ –GATGAAACTCGAGTAGCCCTTGCTCTTC.05) dengan perlakuan lainnya. dedak polar. Sintasan ikan uji berkisar antara 96. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar. polar. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar.05) dengan dedak padi tanpa fermentasi. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T.47 g/ekor. oligosporus yaitu 2. oligosphorus.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. mud carp sebesar 1127 bp. Kandungan protein dedak padi naik 19.67%–100%. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. 4. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. protein efisiensi rasio. dan pada Silver carp sebesar 1123 bp. dedak padi fermentasi. dedak padi. Wadah percobaan yang digunakan yaitu akuarium volume 100 L. dan polar fermentasi. ikan mas . Kadar protein polar naik 38. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG. fermentasi. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Reza Samsudin. dan 6 hari. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. Retensi protein dedak padi fermentasi. KATA KUNCI: R.28%. dan koloni berwarna biru tidak mengandung DNA sisipan. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan berbeda nyata (P<0. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. retensi protein. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari.3’). Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. Retensi lemak tertinggi (35. dan sintasan. retensi lemak. polar. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. dan selanjutnya polar dan dedak padi. dengan padat penebaran ikan uji 30 ekor per akuarium. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). pertambahan bobot relatif. Parameter yang diuji meliputi bobot akhir rata-rata. dengan ditandai tumbuhnya koloni transforman berwarna putih. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama.

Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. salinitas rendah. akuaponik. Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. sintasan. Parameter yang diuji adalah kualitas air terutama kandungan ammonia. karena akhirakhir ini banyak lahan yang tidak digunakan (marginal). Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. sedangkan yang lainnya sebagai kolam konvensional. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. wildan. serta keramba jaring apung di danau maupun waduk. dan ikan mas galur majalaya sebesar 0. KATA KUNCI: ammonia. sawah. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. Benih ikan mas ukuran 18. Di mana satu di antaranya di desain sebagai kolam akuaponik. pertumbuhan.25 kali lebih besar dibanding pada kolam konvensional. ukuran panen. Sedangkan sintasan.64 kali lebih banyak dengan ukuran panen 1.41 g/hari.86 g/hari. Provinsi Banten. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan. dan parameter kualitas air yang lain dianalisis secara deskriptif.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). Lilis Sofiarsih*). Sutrisno*). Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m.28 g/ ekor yang digunakan sebagai hewan uji. Kabupaten Tangerang. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. dengan lokasi penelitian di Desa Kronjo.15 g/hari. dengan padat tebar 20 ekor/m3. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. Ongko Praseno. Penelitian telah dilaksanakan dari bulan Nopember 2009—Pebruari 2010. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. Achmad Sudradjat. ukuran panen. kemudian ikan mas galur kuningan sebesar 1. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1. tambak . dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. KATA KUNCI: ikan mas. Data setiap sampling dijadikan ulangan.

Hasil penelitian menunjukkan bahwa pertumbuhan panjang. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung.42%. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. serta mempunyai respons yang baik terhadap pakan buatan.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas.07%) relatif lebih tinggi dari pada perlakuan B dan C. Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien. Siti Zuhriyyah. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. kemudian diberikan sebagai pakan larva. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. Afifah.58 cm dan 17. dapat dikembangkan di bak terkontrol maupun di KJA. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat. fry performance. KATA KUNCI: artemia nauplii. lasted time feeding . berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. KATA KUNCI: survival rate. Siti Zuhriyyah Musthofa. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi. (B) umur 10 hari dan (C) umur 15 hari. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik. Masing-masing perlakuan diulang 3 kali. cobia larvae.067mg) serta kelangsungan hidup (12.

Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam. Herno Minjoyo*). komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. Stakeholder. sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. Lebih dari 100 spesies. Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. KATA KUNCI: ikan hias. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. Lucky Marzuki Nasution*). Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera.Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera. plasma nutfah . KATA KUNCI: cobia. budidaya.

infeksi penyakit (cacing. pertumbuhan.778 cm. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. peacock bass. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. laju pertumbuhan harian sebesar 32. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. dan yang terendah Moina. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. Deformity dapat disebabkan oleh : mutasi genetic. Eni Kusrini*). Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata. atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh.. Tubifex sp. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. Afrika. kondisi daya dukung lingkungan yang terus menurun. bakteri. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias. granuloma. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama.226 g. virus). Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan. Peacock bass ini akhirnya berenangnya jadi terbalik. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. diam dan kepalanya menyembul tepat di bawah permukaan badan air. karena belum banyak yang membudidayakannya. multifocal granuloma . pakan alami. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. dengan 6 kali ulangan.586%. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. KATA KUNCI: deformity. dan Tubifex sp.. Depok ABSTRAK Deformity (dysmorphism. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias. dan selalu berusaha mendekati sumber oksigen (aerator). KATA KUNCI: Synodontis nigriventris. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. Artemia sp. dan pertambahan panjang total sebesar 1. diikuti Artemia.Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*). DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias.

rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. T3. yaitu : astaxanthin. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. Selama penelitian. Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. 60 ekor/bak. Variabel yang diamati meliputi. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. Rainbow Papua . density. Hewan uji yang digunakan berukuran panjang total 5. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. T2.Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. Hasil penelitian menunjukkan.9 ± 0. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF). KATA KUNCI: banggai cardinal fish.87 ± 0. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. induk diberi pakan berupa naupli artemia/artemia pra dewasa. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai Sulawesi Tengah. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. wortel dan tepung kepala udang. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai.50 g. KATA KUNCI: maggot. udang jembret (mysids) dan larva nyamuk. Bastiar Nur. dan Ahmad Musa Balai Riset Budidaya Ikan Hias.3 cm dan bobot 2. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. 40 ekor/bak. 20 ekor/bak. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati. Jhon Harianto Hutapea. zat pemicu warna.

67%).05). Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. I Wayan Subamia. larva Tetraodon palembangensis . Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air. 20. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. ukuran ekspor 1 inci (2.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.5 cm (ukuran ekspor). 70. KO (76. KATA KUNCI: benih botia. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich). media air.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza. 35. KO (air kontrol+oksitetrasiklin).33%. Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari. namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis. oksitetrasiklin.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin. Sintasan terendah dihasilkan oleh perlakuan KB sebesar 51. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis). AF (aqua+formalin). AO (aqua+oksitetrasiklin). Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian. dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar.5 m dan tinggi air 40 cm. dan blitz ich) akan dilakukan melalui rancangan faktorial.5 cm dan panjang tertinggi sebesar 3. KF (71.67%). dan Lili Sholichah Balai Riset Budidaya Ikan Hias. sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).009 gram. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. pertumbuhan panjang. KATA KUNCI: prophylaksis. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. Masing-masing perlakuan dilakukan dengan 3 ulangan. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. KF (air kontrol+formalin).0 cm dan bobot rata-rata 0. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. 55.05).67%). namun tidak berbeda nyata dengan perlakuan AO (81. sintasan. AB (aqua+blitz ich). ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. Selama pemeliharaan.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. Nina Meilisza.5 x 0. Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium.67% namun tidak berbeda nyata dengan perlakuan AB (55%). Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2.0 cm. Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0.5 x 0. Pada akhir penelitian (hari ke 105). dan 105 dan dianalisis secara deskriptif.

dan Bastiar Nur Balai Riset Budidaya Ikan Hias. namun belum banyak diketahui data embriologinya. Depok ABSTRAK Ikan palmas (Polypterus sp.75 mL/kg untuk induk betina di bagian intraperitoneal.). dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. sehingga produksinya masih mengandalkan impor dari luar negeri. Ikan palmas jenis albino (Polypterus senegalus var. Asep Permana. Pemijahan tersebut terdiri atas seleksi induk.4°C. penyuntikan hormon. antara lain sinodontis (Synodontys sp. pembuahan. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27.5 ml/kg untuk induk jantan dan 0. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73. daya tetas telur 80.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR.). dan red-fin shark (Ephalzeorhynchos sp. SR (0-10 hari) 83.15%. KATA KUNCI: Neocaridina heteropoda. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina. Asep Permana. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol.6°C–29. perkembangan embrio. aligator (Lepisosteus oculatus). hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. masa inkubasi . Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0. Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina. memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan.91%. polypterus senegalus albino. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy. platidoras (Platydoras sp). tiger catfish (Platysoma sp.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar. Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. albino) masih sulit untuk memijah dalam wadah terkontrol. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. inkubasi telur dan perawatan larva.31% dan menghasilkan larva normal sebanyak 218 ekor. KATA KUNCI: palmas albino.).

dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A).042 pg/mL. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor.725 pg/mL. Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96.3–2. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana.7–1. panjang 40– 60 cm. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya). KATA KUNCI: Neocaridina heteropoda. Kepadatan 10 ekor induk dengan bobot 65–600 g. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2.9 cm dengan bobot 0. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungaisungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya. oocyt .1272–0. implantasi. Asep Permana. Rina Hirnawati. dipelihara selama 6 bulan. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32. LHRH 100 mg dan testosteron 50 mg (B). Udang diberi pakan berupa moina beku sekali dalam setiap hari. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air. sedang induk jantan belum ada yang mengandung sperma.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20.1630 g dan dua ekor induk jantan yang berukuran panjang 1. murah dan aplikatif. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. dan Darti Satyani Balai Riset Budidaya Ikan Hias. Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm. KATA KUNCI: induk. hormon. Rendy Ginanjar. budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah.0518 g. dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias.0488–0. matang gonad. Tutik Kadarini. LHRH 50 mg dan testosteron 50 mg (C). Pada ikan yang baru di domestikasi.5 cm dengan bobot 0.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana. Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks.

The concluded that the optimum dose to produce male guppy is 50 mL/L. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2. KATA KUNCI: bunga tai kotok. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. 50 mL/L. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control).07 ± 9.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. carotenoid. because of residual effects to human caused cancer. Honey is a natural substance which have crysin. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam.05 significant level.6%). The result showed that the percentage of male guppy at 50 mL/ L is 64.000-4. male. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method. but between treatments not significant different. The proportions test showed dose 50 mL/L have significant different to control. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization.71%. The observation to sexual secondary characteristic guppy can be observed at least two months old. guppy fish . as the curative effort is not applicable. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron.000 mg/kg). suhu. Based on LSD test.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. yeast (30–800 mg/kg) dan sumber lainnya. the treatments gave significant different with control. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. kemudian dipisahkan antara tangkai dan kelopaknya. Therefore. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan. and 75 mL/L. KEYWORDS: honey. chrysin. The research was conducted experimental with completely randomized design. the alternative masculinization application of natural substance like honey. 25 mL/L.

Siganus guttatus Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). jumlah telur 227. Maros ABSTRAK Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. substitusi. jumlah telur 272. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. jumlah telur 237. Pada awal percobaan. jumlah telur. KATA KUNCI: Siganus guttatus. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&). dan 2:1(B&:@&).05) dengan rasio efisiensi proteinnya.140 butir/ekor. 1:3 (B&:@&). Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22.05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0. jumlah telur. 1:2 (B&:@&). masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap. diameter telur.0 m dengan kepadatan 24 ekor/bak. KATA KUNCI: tepung ikan. pemijahan. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0. Peubah biologis yang diamati meliputi: jumlah induk memijah.945–350. tepung rumput laut. daya tetas telur FF 70 SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG.837 butir/ekor.333 butir/ekor. diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%.975 butir/ekor. S.5 m x 1. guttatus .837–344.05±6.534–393. rasio (1:3) jumlah induk memijah 35 ekor.865–335. diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%. Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan. jumlah telur 129. dan daya tetas telur. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut. rasio (1:2) jumlah induk memijah 30 ekor. diameter telur. Maros ABSTRAK Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. semua induk secara individu dalam keadaan TKG=O. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor.Forum Inovasi Teknologi Akuakultur 2010 FF 69 PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama. pakan ikan beronang. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi.4 g dengan padat tebar 15 ekor/keramba. diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor.pada induk beronang. Induk dipelihara dalam 8 buah bak berukuran 1. Lama penelitian berlangsung selama 6 bulan.5 m x 1.

marine chlorella.6%) dengan rasio DHA/EPA hanya 0.2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. yaitu pertambahan berat rata-rata 230 g.Forum Inovasi Teknologi Akuakultur 2010 FF 71 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan.5 g. Penelitian ini dilakukan pada tambak di daerah Betok Mati. penebaran dilakukan setelah satu bulan dari penebaran tokolan. tokolan. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Dari pemeliharaan udang selama tiga bulan. Pemeliharaan dilakukan selama tiga bulan.8 kg dan kelangsungan hidup 100%. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Karawang.1 kg dan sintasan 11. semi-continuous system . oculata 13.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya.n pengapuran sebanyak 175 kg/petak.5–50 m3 dengan rata-rata kepadatan akhir N. produksi 78. Setelah dua hari. kemudian dikeringkan sekitar satu minggu. KATA KUNCI: udang windu.04 juta sel/mL dan rotifer 186±5. Nannochloropsis oculata. dilakukan pengolahan tanah tambak. dan Wartono Hadie Pusat Riset Perikanan Budidaya. Karawang FF 72 PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut. Idil Ardi. produksi 81. salinitas rendah. 100. Tingkat total ammonium terlarut dalam air laut produksi masal N. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. Gondol ABSTRAK Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali.3–8.2.1±0. dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368. dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. Pemadatan (flokulasi) N. oculata relatif rendah (3. pada bulan pertama udang tidak diberi pakan.500 m2 digunakan untuk percobaan. yaitu menggunakan tingkat teknologi tradisional plus. Sebelum penebaran. oculata dengan NaOH dosis 75. rotifer Brachionus rotundiformis. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Dengan teknologi yang diterapkan. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. Empat petak tambak masing-masing berukuran 3.2%. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1. Kecamatan Cilebar. oculata relatif tinggi (4. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. 427. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. KATA KUNCI: pakan alami.

plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. masingmasing terdiri atas 3 ulangan. Maros ABSTRAK Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi. yang ditempatkan pada keramba jaring apung di laut. ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%. ikan langka.67 cm/ ekor dan bobot 155. 11. Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. budidaya.2 ± 0.05) terhadap pertumbuhan dan sintasan ikan beronang.0 m. dan (C) 13%.00. juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Pemberian pakan dilakukan 3 kali/hari (pukul 08. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia.0 m x 1.79 g/ekor. Jika tidak ada efek rumah kaca. KATA KUNCI: pemuliaan.00).3 ± 10.00. konservasi . Hasil penelitian menunjukkan bahwa kadar lemak 5%. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). KATA KUNCI: kadar lemak. dan 13% dalam pakan berpengaruh tidak nyata (P<0. Padahal dalam upaya peningkatan produktivitas perikanan budidaya. 9%. (B) 9%.0 m x 2. Permasalahan ini perlu dipikirkan solusinya. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. sintasan.Forum Inovasi Teknologi Akuakultur 2010 FF 73 PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus) Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Jakarta ABSTRAK Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. suhu dipermukaan bumi akan turun secara drastis. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global. Wadah penelitian yang digunakan adalah jaring berukuran 1. dan 17. Siganus guttatus FF 74 ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA Lies Emmawati Hadie Pusat Riset Perikanan Budidaya. pertumbuhan. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19.

dan Dactylogyrus spp. 98% terinfeksi parasit. Kualitas air perairan yang diukur adalah: pH. perairan Kalukku. Synodontis.Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. (Monogenea). salinitas. neon tetra. cat fish. Dari Sampel yang diperiksa 33. perairan Papalan. dan platydoras. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. keramba jaring apung. Trematoda). (metacercaria. sympilum dan Characidae. KATA KUNCI: kesesuaian lahan. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698.59 ha. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. Argulus sp. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara.18 ha yang terdiri dari sangat sesuai seluas 133. kecerahan.41 ha dan kurang sesuai 52. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. mas koki.18 ha. Pulau Kambunong. Sampel ikan hias antara lain dari golongan cyprinidae. arah arus. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. (Copepoda) dan Centrocestus sp. Gyrodatylus spp. (Dinoflagelata). parasit . KATA KUNCI: ikan hias air tawar. nitrat. Oleh karena itu. kedalaman. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. 2009. cukup sesuai 512. dan insang. kecepatan arus. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. dan Ichthyophthirius multifiliis (Ciliata). Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. Red Fin Albino. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. fosfat. budidaya laut. Trichodina sp. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. Akhmad Mustafa. Pulau Bekengkeng. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. Chiclidae. dan Tanjung Dapuran. dan besi. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. sirip. kapiat albino. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. penyakit.

Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. muara Sungai Cisokan. Cd. Tahapan penelitian meliputi: penentuan lokasi. preparasi. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. pencemaran. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. Perairan Waduk Cirata sudah tercemar oleh parameter Zn.86 ton/bulan. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. KATA KUNCI: lahan perikanan budidaya. Organofosfat. badan air Sungai Citarum dan Sungai Cimeta. pengambilan contoh. muara Sungai Citarum. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. batas daerah bahaya.98 ton/bulan. Piretroid.8214 ton/bulan dan 1. pestisida. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. residu . Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. Variabel yang diamati adalah konsentrasi kandungan Pb. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan. serta debit air dari muara sungai yang masuk ke perairan waduk.88 mg/L/kg daging ikan. inlet. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. dan Karbamat. identifikasi dan analisis data serta pelaporan. Cd. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. sedimen (lumpur/tanah). dan Zn dalam air dan daging ikan. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. KATA KUNCI: logam berat. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS. Contoh yang diambil berupa air. Cd. CD. zona 2 Purwakarta.

/L dan zooplankton berkisar antara 93. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias.35).072–0.marmorata dan (4. Dinophyceae. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. (13. Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). dan Desmiceae dari zooplankton ditemukan jenis Rotifer. Sukabumi.52) dikelompokan pada jenis A. indeks dominansi (C) = 0. Ciputri. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3.5 ind.75 ind.marmorata. nebulosa. Pelabuhan Ratu. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor. Cyanophyceae. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies. A. dan 4–6 m.75–4887. dan Cadas Bodas. pada region mitokondria 16SRNA. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa. Sungai Cimandiri. selanjutnya digunakan untuk analisa genetik.nebulosa . fitoplankton. Palumbon. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. Patok Batas.31. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat.n. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae. dan sebanyak 150 ekor disimpan dalam alkohol absolut. PELABUHAN RATU. Maleber. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. A. bicolor. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur.83. KATA KUNCI: Glass eel. 2–4. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi./L. dan nilai kemerataan (E) = 0.) DI PERAIRAN SUNGAI CIMANDIRI.12–3.17-9. bicolor bicolor. KATA KUNCI: komunitas.33. dan Protozoa.71–19.7) dikelompokan jenis A.65–0.75– 993. A. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR. dikelompokan pada jenis A. Copepoda. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari. Bacillariophyceae. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu.

Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan. sirip perut (ventral fin). selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). rotifer. dan C. Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra. Osteochilus hasselti.dan inter-populasi ikan nilem di Jawa Barat. Gondol **) Mahasiswa Universitas Gadjah Mada. Titiek Aslianti*).01 mm. sirip dada (pectoral fin).99 mm. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin).27 mm.. dan 1790%) dan C (11. Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan. gonad kerang. KATA KUNCI: ikan nilem. 21. namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe. KATA KUNCI: larva ikan kuwe.10 g. Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan.94 g. terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut. adalah dengan program pemuliaan. 27. dan sirip anal (anal fin). Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata. Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL).Forum Inovasi Teknologi Akuakultur 2010 FF 81 POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN Afifah*). meristik . pakan awal. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat.97%) dibanding perlakuan A (10. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. dan 17. B. Dinar Tri Soelistyowati**). selanjutnya secara periodik 5 hari sampai dengan D-30. Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya ABSTRAK Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan.17%). dan 21.20 g. 25. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. Pemberian pakan awal di mulai saat larva berumur D-2—D-10. Jogjakarta ABSTRAK Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. pola pemangsaan FF 82 KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT Mulyasari*). kuning telur) dan 3 ulangan.

pakan buatan.05). Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi.-–Rp 7. Balai Riset Perikanan Budidaya Air Tawar. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0. Ikan uji yang digunakan adalah ikan nilem dengan bobot ratarata 5. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari.-/kg. dan 20%. Bogor ABSTRAK Pakan memegang peranan penting dalam budidaya ikan nilem.-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. bahan baku lokal. Bogor. pakan FF 84 EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI. Harga pakan hanya Rp 2. Ikan dipelihara selama 40 hari. KABUPATEN BATANG) Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0. serta sintasan ikan.800. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Parameter yang diamati yaitu pertumbuhan spesifik. Jakarta ABSTRAK Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. Penelitian dilakukan di Kabupaten Brebes dan Batang.500.0±0. ikan patin . pertumbuhan. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya.000. Metode penelitian dilakukan secara studi kasus.05) yaitu sebesar 1. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. konversi pakan.3 g/ekor.-–Rp 3.Forum Inovasi Teknologi Akuakultur 2010 FF 83 EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: nilem. protein. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. 19%. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem.56%.000. KATA KUNCI: efisiensi usaha. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan.

hitam: 0. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut.19. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2. genetika . Irin Iriana Kusmini.1 m dan tinggi 0. hitam: 1. Irwan Setiadi.7 m.6±0.8±1. pertumbuhan mutlak (merah: 6.20).1±0.8 m) dan bak fiberglass berbentuk oval volume 2. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari. KATA KUNCI: penanganan calon induk. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari. Pada beberapa jenis ikan. tengadak. dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir.7±0.06. Gunawan. Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Barbonymus schwanenfeldii.Forum Inovasi Teknologi Akuakultur 2010 FF 85 PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN Jhon Harianto Hutapea.02.5 m3 (diameter 2 m dan tinggi 0. Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk.30) dan laju pertumbuhan spesifik (merah: 0. sintasan FF 86 KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON Gleni Hasan Huwoyon. ikan tuna sirip kuning.02). Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2. hitam: 5.57±0.1 m3 (lebar 1. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3.4 m dengan panjang 2. Gondol ABSTRAK Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg). KATA KUNCI: warna.65±0. dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi. Bogor ABSTRAK Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera.

02% khamir laut. Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau.5% molasses + 0.05). protein kasar. urea. R3 = Daun mengkudu + 2. BETN. dan abu di antara perlakuan tidak berbeda nyata (P>0.06% khamir laut. KATA KUNCI: khamir laut. lemak kasar. silase. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan. R4 = Daun mengkudu + 2. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia). dan energi di antara perlakuan berbeda nyata (P<0.5% molasses + 0. pupuk . Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator.00% khamir laut. gula.5% molasses + 0. Setelah 5 hari dipanen. dan TSP.04% khamir laut. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. Berdasarkan hasil penelitian. serat kasar.05). siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu.5% molasses + 0. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan.01).08% khamir laut. Hasil penelitian menunjukkan bahwa: pH. E = Daun mengkudu + 2. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. daun mengkudu. Setelah kering. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0. B = Daun mengkudu + 2. Jepara.5% molasses + 0. bahan kering.

000 ekor/ha. ditebari bandeng (10. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59./ha) dan petak II : bandeng (3. di mana termasuk cara budidaya udang. penggunaan sarana produksi yang ramah lingkungan.000 ekor/ha) dan rumput laut (1 ton/ha).000.5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar.000 ekor/ha). bandeng (3.-/musim tanam dengan B/C rasio 2. Sulawesi Selatan.48 kg/ha.1 ton/ha/16 mg menjadi 1. serta manajemen pakan dan air secara benar. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram. KABUPATEN TAKALAR Muharijadi Atmomarsono.977. petak I ditebari bandeng (10.000 ekor/ha) dan rumput laut (1 ton/ha). MY1112 bulan II. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I. udang windu. rumput laut (2 ton/ha) dan tiram (20.73% dengan produksi sebesar 217.46% dengan produksi udang windu sebesar 249. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara. tambak marjinal .Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA. rumput laut (2 ton/ha) dan tiram (40. CBIB. rumput laut. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram.07. KATA KUNCI: biofilter. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal. Brata Pantjara. Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I. Perlakuan B. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40. Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau. BL542 bulan III. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10.000 ind/ha) dan petak II. KATA KUNCI: udang windu. Pada akhir penelitian diperoleh sintasan 63.000 ekor/ha).000 ind. Erfan Andi Hendradjat.

dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: probiotic bacteria. terutama salinitas yang mencapai 56 ppt. (D2) kontrol 2. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. Nurbaya. NO2. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. (C1) probiotik komersial dengan dosis pakan 100%.7 kg/ha/90 hari). sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). production. Muliani. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masing-masing 3 kali dan lama pemeliharaan 10 minggu. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. survival rate. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak. Nurbaya. BL542 bulan III.35% dan 448. diikuti perlakuan kombinasi probiotik A (50. dan C) Kontrol (tanpa probiotik).8% dan 228. Pengamatan sintasan udang windu dilakukan pada akhir penelitian.7 kg/ha/90 hari).Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. dosis pakan. Hasil penelitian menunjukkan. NO3. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. Sintasan udang windu tertinggi didapatkan pada perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60. Maros.11%. B) Pergiliran probiotik BT951 bulan I.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11. MY1112 bulan II. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. Penelitian dilaksanakan selama 90 hari. Oleh karena itu. PO4. total bakteri.05% dan 298. air laut salinitas 28 ppt sebanyak 15 L. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. (C2) probiotik komersial dengan dosis pakan 50%. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan NH3 selama penelitian relatif lebih tinggi pada perlakuan yang tidak menggunakan probiotik dengan dosis pakan 100%. dan total Vibrio. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah.7 kg/ha/90 hari). tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani. menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. kandungan BOT di atas 30 mg/L. udang windu . Penelitian dilakukan di laboratorium basah. KATA KUNCI: probiotik.05) pada akhir penelitian. sintasan. NH3. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. Balai Riset Perikanan Budidaya Air Payau.

Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya. Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an. namun belum mampu menurunkan kandungan amoniak dalam media budidaya. KATA KUNCI: probiotik. Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. Oleh karena itu. udang windu.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak. rumput laut.8% dan 63.0%. Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81. Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari.4 ha. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha).000 ekor/ha). yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. KATA KUNCI: multitropik. Sintasan dan produksi udang windu dan ikan bandeng masingmasing adalah 66. kesehatan. dan pertumbuhan udang serta aman bagi konsumen. produksi . sintasan. Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau. Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu. Tokolan udang windu (PL.572. Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha).4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13. produksi.9% dan 33. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1. 31) yang ditebar pada masing-masing tambak adalah 10. Tjaronge.500 m2 dengan kedalaman 80 cm. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok.-/ha /90 hari. ikan bandeng.9 kg dan secara finansial memberikan keuntungan sebesar Rp 11. dan kontrol (tanpa aplikasi probiotik).000. masing-masing terdiri atas 2 ulangan.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. M. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. serta 99.000 ek/ha bandeng) menunjukkan hasil yang terbaik.masing-masing dengan dua kali ulangan. Sampling dilakukan 30 hari sekali selama 90 hari. rumput laut dan ikan bandeng adalah perlakuan B (10.000 ekor/ha (1 ekor/m2). Selama pemeliharan tidak diberi pakan.7 kg. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak. baik pada air maupun pada dasar tanah tambak. Maros selama 90 Hari. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana.5% dengan produksi 19. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha). Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan.

Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Bunga Rante Tampangallo.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. Aan Fibro Widodo. Ketika ditantang dengan WSSV. Alimuddin**). dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR.3% dan tidak berbeda nyata (P>0. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. 1 hari. KATA KUNCI: promoter. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. gen PmAV menunjukkan respons meningkat (up-regulation). Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). yang sampai saat ini belum bisa diatasi secara secara tuntas.0%). Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia.1%) serta tanpa transfeksi (49. Maros Departemen Budidaya Perairan. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. danAndi Tenriulo*) **) **) Balai Riset Perikanan Budidaya Air Payau. 4 hari. transfeksi. Komar Sumantadinata**). 12 jam. Fakultas Perikanan dan Ilmu Kelautan. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Promoter dikatakan aktif apabila gen penanda dapat terekspresi. Syarifuddin Tonnek. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. uji tantang. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi.05) dibandingkan dengan kontrol. EGFP. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. gen anti virus. Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. KATA KUNCI: ekspresi. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. IPB. 2 hari. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. Sukenda**). Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). 3 hari. udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. udang windu . Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang.Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. Selain itu. ekspresi gen.

sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. serta berpeluang untuk digunakan secara langsung di lapangan. KATA KUNCI: ELISA. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. dan disertai ulserasi lapisan mukosa epitel. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. White Spot Syndrome Virus (WSSV). karena relatif mudah dan murah. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. menyeleksi. Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. monodon dengan melihat gejala klinis dan studi histopatologi. dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. Penelitian dilakukan untuk membuat. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. khususnya ELISA. Nurhidayah. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. KATA KUNCI: White Spot Syndrom Virus (WSSV). antibodi monoklonal . Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. cepat dan akurat. Teknik serologi. Pewarnaan jaringan menggunakan Hematoxilin eosin. Setelah pengujian. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. serta epidemi penyakit di lapangan. Antibodi monoklonal memiliki kespesifikan yang tinggi.

034) berbeda nyata (P<0. Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei)..257±0. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun. Instalasi BRPBAP. namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan.5±88. Riset ini dilaksanakan di tambak Punaga. feed.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%. sintasan (90. Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi.7 m sebanyak 9 buah. sintasan.18235 mg/L) dibandingkan dengan perlakuan A (0. Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). 829. dan (B) pembesaran dengan tebar tokolan (PL 27). benur. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak.83±8.048). sintasan ( 92.102 CFU/mL.549±0. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0.0328 mg/L) pada akhir penelitian. Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0. dan efisiensi biaya produksi. dan pemeliharaan berlangsung 80 hari di tambak.05) dengan perlakuan A (1.085±0.9). rasio konversi pakan dan produksi udang vaname. tokolan. kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0. menggunakan 4 petak masing masing berukuran 4. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1.45 g/ekor dan ditebar kepadatan 100 ekor/bak.05) terhadap pertumbuhan.Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.234). Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei).120). Budidaya ini berkembang dengan teknologi intensif. produksi (1831.51). Selama pemeliharan 85 hari. namun terbatas pada golongan masyarakat menengah keatas (padat modal). Takalar. produksi (2087. dan kepadatan benur dan tokolan adalah 50 ekor/m2.000 m2/petak. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. survival rate.31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya. Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%. KATA KUNCI: udang vaname.0±149. Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau. sintasan. RKP pada pembesaran udang vaname teknologi intensif. and L vannamei .masing-masing perlakuan diulang tiga kali.258). karena berpengaruh terhadap pertumbuhan.096±0. Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12).Setiap perlakuan dengan 2 ulangan.114±0. KATA KUNCI: growth. budidaya udang intensif.

C (protein 33%. Namun.4%–94.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN.71%–22.0–8. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0. 5 kali sehari pada pukul 07.2%.9%–79. laju pertumbuhan harian.2–78. kecernaan total dan kecernaan protein masingmasing 26. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI . konversi pakan (FCR).000 m2.8% dan 11. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. 19. sintasan. 15.1 g. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0.INTENSIF DI TAMBAK Abdul Mansyur.5%. sintasan. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7. pertumbuhan. C/P rasio 14. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0.05).4.intensif.5%–36. B (protein 31%.3%–86. Litopenaeus vannamei Deisi Heptarina*). Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu. Pakan diberikan at satiation. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0.69%. dan E atau komersial (protein 40. namun kurang diimbangi dengan penyediaan pakan yang sesuai.2 kkal GE/g). suhu 28°C–30°C.4%.5. D (protein 35%. FCR 1.4–2. kecernaan total. ekskresi amonia dan stabilitas pakan. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an. pertumbuhan relatif (PR). C/P rasio 13. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). Hidayat Suryanto Suwoyo. K ATA KUNCI: protein optimal. Litopenaeus vannamei . Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%. Selama pemeliharaan. Perlakuan terdiri atas pakan A (protein 29%. Ing Mokoginta**) dan Dedy Yaniharto***) *) **) Balai Riset Perikanan Tawar. C/P rasio 11. 11. fotoperiod dibuat 12 jam terang–gelap. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. retensi protein (RP). produksi. Agus Suprayudi**).029–2.5 g/ekor dengan kepadatan 10 ekor per akuarium. PR 532. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB).39%. Penelitian dilakukan di tambak percobaan Punaga Takalar. M. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13. salinitas 24–25 ppt. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon).00. C/ P rasio 16.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2.00. Sintasan antara 73.6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik. JKP 59. retensi lemak (RL). Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media. Jakarta Utara. Bobot yuwana yang ditebar rata-rata 0. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan.00. Kisaran nilai masing-masing parameter tersebut adalah.2% serta WS berkisar antara 49. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan. Bogor Departemen Budidaya Perairan.9%–68.6 kkal GE/g). jumlah konsumsi pakan (JKP).1 kkal GE/g). RL dan RP masing-masing 26.1% dan 65.05).464 mg/kg tubuh/jam. Kemudian dilanjutkan uji kecernaan. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum. yuwana.00. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname. Fakultas Perikanan dan Ilmu Kelautan.7%. sedangkan ekskresi amonia antara 1.5 kkal GE/g).7%–1130. dan 23. C/P rasio 15.5%–62. dan pH 8. sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya.05) terhadap pertambahan berat mutlak. rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi .8 kkal GE/g). kecernaan protein.00.

KATA KUNCI: Litopenaeus vannamei. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terus-menerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). KATA KUNCI: enzim. dan SP mampu berdiri sendiri. IMNV dan PvNV . Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. dan Rustidja**) *) **) Balai Besar Riset Perikanan Budiaya Laut. PGM. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. Haryanti*). Semua gejala tersebut diduga akibat adanya serangan virus. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). L. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . toleran. EST. EST. Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. TSV. toleran.Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. MBV. and SP) pada udang yang sehat. dan SP. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). SOD. toleran dan terinfeksi TSV. Namun demikian. Untuk mengetahui jenis virus yang menyerang udang tersebut maka. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. Lila Gardenia. PGM. Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. SOD. Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. dan moribund. protein haemolimph dan ekspresi enzim (GPI. SOD. Gondol Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. IHHNV. Taura Syndrome Virus. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. SPF. SOD. belum dapat diyakinkan secara pasti bahwa ekspresi EST. Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. WSSV. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik).

beserta persilangannya. 6. berturut-turut 27%. dan tidak berbeda nyata antar perlakuan. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. pertumbuhan.25 g. 2%. Sebagai perlakuan adalah rasio jantan-betina. Imron. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. dan 0. Penelitian dilakukan dengan rancangan acak lengkap. 0. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal. Asahan. dan D) 2 J : 4 B. dengan sistem resirkulasi.21 g. 0. dan D. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.42 mm. rasio kelamin. KATA KUNCI: mortalitas. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. dengan lama pengujian 8 minggu. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. A dan B. C. diberikan pada pagi dan sore. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan. KATA KUNCI: genetik. Musi. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%.5% berturut-turut untuk perlakuan A. Ciasem. yang meliputi pertambahan panjang dan bobot. Penelitian meliputi pembenihan. B) 1 J : 2 B. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). C) 2J : 2 B. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 25%. 0. Pada sistem tersebut kematian induk relatif rendah.27 mm. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan.25 m2/ekor induk. udang galah . Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. 0. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). B.5%. yang dilakukan selama 5 bulan. dan 9.31 mm. pendederan I. berturut-turut 0. Romy Suprapto. berdasarkan nilai heterosis yang didapat. pendederan II.20 g. pemijahan. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. persilangan. dan pembesaran. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. reproduksi. diikuti perlakuan D. dan 13%. Namun demikian. Barito. yaitu 0%. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. khususnya rasio jantan-betina. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya.

dan D. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah. sirih.8±7. Hewan uji yang digunakan adalah larva udang galah umur dua hari. Fakultas Perikanan dan Ilmu Kelautan.5±28. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan. yaitu inbreeding.0%). 45. **) Jurusan Budidaya. Dinar Soelistyawati**). merupakan langkah bio-security.00% dan 3. C.5 x 103).6±21. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan.4 x 103 cfu/mL) . KATA KUNCI: bawang putih. B. Sukamandi. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan. Harry Wuwungan**). namun tidak berbeda nyata (P>0. sintasan (SR) dan perkembangan larva (LSI). yaitu A. . Pada karakter pertumbuhan. 47. Perlakuan yang diberikan yaitu A (kontrol.5%. tanpa penambahan desinfektan). (4.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan. larva udang galah. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0.0±1.8±1. 52. 37. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C. dan D (perendaman dalam larutan ekstrak bawang putih). KATA KUNCI: inbreeding.4 mm) dan populasi inbreeding (21. keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24. Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰.0. Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi.4 mm).Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*). C (perendaman dalam larutan ekstrak daun sirih). Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah.05) terhadap kelimpahan bakteri. desinfektan. dengan nilai sebagai berikut: A. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan budidaya dapat dioptimalkan.93. 4. dan D. Tiga tipe persilangan.92. (8. outbreeding. crossbreeding. keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. formalin. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. (0 cfu/mL).83% dan 3.93.5% dan 3. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74. B (perendaman dalam larutan formalin 250 mg/L).0%) dan populasi inbreeding (25. C. Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan. (0 cfu/mL).7 mm) diikuti oleh populasi hasil outbreeding (21.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. B. Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.8±1. Hasil penelitian menunjukkan bahwa pada karakter sintasan. Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya.4%) diikuti oleh populasi hasil crossbreeding (57.

Forum Inovasi Teknologi Akuakultur 2010

K 21
VARIASI FENOTIP UDANG GALAH (Macrobrachium rosenbergii) DARI POPULASI PERAIRAN KARAWANG, PELABUHAN RATU, DAN BONE
Eni Kusrini*), Lies Emmawati**), dan Wartono Hadie**)
*)

Balai Riset Budidaya Perikanan Ikan Hias, Depok
*)

Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang), Pelabuhan Ratu, dan Bone. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air,Karawang dengan Pelabuhan Ratu lebih dekat. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu.
KATA KUNCI: udang galah, populasi, jarak genetik

K 22
PEMELIHARAAN LARVA UDANG PAMA (Penaeus semisulcatus) DENGAN KEPADATAN BERBEDA
Muslimin, Sulaeman, Andi Tenriulo, dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. semisucatus) dengan kepadatan berbeda. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau, Maros dengan panjang awal mysis adalah 100-190 milimikron. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm, diameter 15 cm dan Volume 3 L. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm, lebar 40 cm, dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut, maka ditambahkan pemanas/heater suhu 30°C. Hewan uji ini ditebar dengan kepadatan berbeda. Perlakuan yang diujicobakan adalah: A. Kepadatan larva 25 ekor/L; B. Kepadatan larva 50 ekor/L; C. Kepadatan larva 75 ekor/L; D. Kepadatan larva 100 ekor/L; E. Kepadatan larva 125 ekor/L; dan F. Kepadatan larva 150 ekor/L. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap, di mana masing-masing perlakuan di ulang tiga kali. Jenis pakan yang diberikan berupa pakan alami chetoceros, artemia, dan pakan buatan. Pemberian pakan dilakukan setiap pagi dan sore (08.00 dan 16.00 wita). Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0,05) terhadap laju sintasan dan pertumbuhan larva udang pama. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%, (B) 32%, (C) 31%, (E) 24%, (D) 16%, dan (F) 10%.
KATA KUNCI: kepadatan, larva udang pama, sintasan dan pertumbuhan

Forum Inovasi Teknologi Akuakultur 2010

K 23
ESTIMASI PADAT TEBAR UDANG PAMA Penaeus semisulcatus BERDASARKAN TINGKAT KONSUMSI OKSIGEN
Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1.446–6.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan. Wadah percobaan yang digunakan adalah bentik jar (chamber), yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. Oksigen terlarut diukur dengan alat pengukur O2 (TPSTM Model WP-82 DO meters). Data laju respirasi selama proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. Ver.1.2. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan, dengan kisaran tingkat konsumsi oksigen 0,26–7,27 mg/g/jam. Kisaran kelarutan oksigen pada awal penelitian adalah 3,14–7,9 mg/L dan setelah 1 jam pengukuran 0,03–0,48 mg/L dan kontrol tetap berkisar 4 mg/L. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4,0235 g adalah 15,65 g/m3.
KATA KUNCI: udang pama, padat tebar, estimasi

K 24
POLIKULTUR KEPITING BAKAU (Scylla serrata) DAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN METODE TEBAR YANG BERBEDA
Sulaeman, Aan Fibro Widodo, dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan, akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP), BRPBAP, Maros. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0,18±0,03 g, panjang karapas 4,6±0,1 mm dan lebar karapas 5,9±0,1 mm. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar); B (metode gantung); dan C (gabungan antara keduanya). Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0,05) terhadap pertumbuhan bobot mutlak, bobot harian, pertumbuhan panjang dan lebar karapas mutlak dan harian, tetapi berpengaruh nyata (P<0,05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66,96 %; 58,17 kg/250 m2, disusul perlakuan C: 64,06; 44,95 kg/250 m2 dan terendah pada perlakuan B: 60,58%; 40,52 kg/250 m2.
KATA KUNCI: kepiting bakau, metode sebar, polikultur, rumput laut

Forum Inovasi Teknologi Akuakultur 2010

K 25
LAJU PEMANGSAAN LARVA KEPITING BAKAU (Scylla serrata) TERHADAP PAKAN ALAMI ROTIFERA (Brachionus SP.)
Aan Fibro Widodo, Sulaeman, dan Muslimin Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp.). Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros, Sulawesi Selatan. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau, yaitu: A (625 ind./mL); B (500 ind./mL); C (375 ind./mL); D (250 ind./mL); dan E (125 ind./mL). Peubah yang diamati adalah laju pemangsaan, sintasan, dan peubah kualitas air. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0,05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. Hasil terbaik diperoleh pada perlakuan A, yaitu kepadatan rotifera 625 ind./mL dengan laju pemangsaan sebesar 259,1667 ind./larva/jam dan sintasan 86,0%.
KATA KUNCI: kepadatan, kepiting bakau, laju pemangsaan, rotifera, zoea

K 26
ANALISIS DIATOM EPIPELIC SEBAGAI INDIKATOR KUALITAS AIR DAN TANAHUNTUK BUDIDAYA UDANG
Supono Budidaya Perairan Universitas Lampung

ABSTRAK
Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Karena hidup di dasar tambak, jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang, yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang. Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. Selain diatom epipelic, data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0,75), TOM (rs = 0,71), dan nitrat (rs = 0,66), sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0,72), kandungan liat (rs = 0,65), dan kandungan bahan organik (rs = 0,62).
KATA KUNCI: diatom epipelic, tambak udang, kualitas air, kualitas sedimen

Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. Pertambahan bobot (71.0 cm dan adanya pertambahan bobot sebesar 58. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda.9 g. Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci.6±10. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci. Gleni Hasan Huwoyon.6-7.47) terbaik adalah benih lobster air tawar asal Tangerang. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2. simpangan baku.74) dan panjang (7. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan. Bogor.9±9. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot. pertumbuhan. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. panjang standar.0±0. namun kemampuan produksi para pembudidaya hanya sampai 4 inci. benih. lokasi . dan Tulung Agung). dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: Cherax quadricarinatus.6-71.72). Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6. ragam. Dianalisis dengan Rancangan Acak Lengkap (RAL). dan panjang total tiap individu. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang. dan panjang total). panjang standar.Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini.

Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit. + Sargassum sp.05 mm dan 10. dan C berturut-turut adalah 120.44 µg. (D) Kombinasi Gracilaria sp. dan Sargassum sp. + Ulva sp. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41. lebar dan bobot cangkang.05).52 µg/hari) dan terendah pemberian pakan Sargassum sp. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto. masing-masing 58.18 mm dan 7. dan kombinasi keduanya.39 g.68 µg/hari).92 g dan 219. 38.73 g. yaitu: (A) Gracilaria sp. Gracilaria. kombinasi Gracilaria sp. KATA KUNCI: abalon Haliotis squamata.06 ± 170. (-5.1 ± 4. Bambang Susanto. + Ulva sp.. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut.19 ± 6. (13. cottonii : 40.39 m x 0.59±2. 73.00 µm dan 38. (7..9 ± 1. (13. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m. dilakukan dengan menerapkan 4 perlakuan pemberian pakan.854. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi.26 ± 10. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon.16 g dan -86.44 µg serta 92. sangat sesuai dalam memacu pematangan gonad induk abalon H. (P<0.73±2.891. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir.99 mm dan 36.17 ± 2. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata. Ulva. Riani Rahmawati. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0.31 m.06 g. + Ulva sp.17 ± 25.06 µg/hari). dan pakan (C) dengan R² = 0. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga.0 ± 0. + Sargassum sp.613.37 mm.58 m x 0.56 ± 48. squamata.02 g.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A. aplikasi teknologi pembesaran . (C) Sargassum sp. Ibnu Rusdi.44 µm dan 65.. Riani Rahmawati. pakan (B)= E. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang.82 µg/hari). Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0. I Nyoman Adiasmara Giri. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan. KATA KUNCI: Haliotis squamata. Ulva sp. Sargassum. cottonii 37.80 sampai 31. serta pakan (C)= kombinasi Gracilaria + E.03 ± 1. pakan (B) dengan R² = 0. E. + Sargassum sp.44 ± 102.44 µg. (B) Ulva sp.50 g dan 217. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut.39 mm dan 10. B. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp.05) antar perlakuan.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON. cottoni. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0.23 g dan 121. yaitu pada perlakuan pemberian pakan Gracilaria sp.89 µm dan 38. (rasio 1:1:1). Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp.

dan Ulva sp. mengingat permintaannya yang cukup tinggi. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. 60/40% memberikan pertumbuhan abalon terbaik. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air.52. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan.6-3.2 g dan panjang cangkang 2. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. Kepadatan awal benih abalon adalah 450 ekor per wadah. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. wild. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan.06). Setiap perlakuan terdiri atas 2 ulangan. 100/0% (A). Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. proporsi pakan. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. Hirmawan Tirta Yudha. genetic monitoring. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. Est-1*. Gondol. penjarangan . Pakan dengan proporsi Gracilaria sp.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin. KATA KUNCI: abalon Haliotis squamata. Tatam Sutarmat. pembesaran. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. Sampel yang digunakan berasal dari Bali dan Banten. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. dan 60/40% (C) sebagai perlakuan. Abalon diberi pakan rumput laut Gracilaria sp. peluang pasar serta teknik budidayanya yang sederhana. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. Gpi*./Ulva sp.13) lebih tinggi dibandingkan dengan induk asal Bali (0. Ibnu Rusdi. Est-3*. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. dan Ulva sp. dengan proporsi yang berbeda Gracilaria sp. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. Est-4* dan Cah-3*. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. Est-2*. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim./Ulva sp. KATA KUNCI: allozyme. tinggi 22 cm. Untuk itu. 80/20% (B). Nilai variasi genetik induk abalone asal Banten (0. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp.7 cm. dengan bobot awal 2. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri.

Forum Inovasi Teknologi Akuakultur 2010

M 05
ISOLASI, KARAKTERISASI, DAN UJI PATOGENISITAS BAKTERI VIBRIO YANG DIISOLASI DARI LARVA ABALON SAKIT DI HATCHERI
Zafran, Indah Mastuti, dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. Karena itu, tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut, Gondol, Bali. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar, yaitu media spesifik untuk bakteri Vibrio. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0,05 µm). Setiap perlakuan diulang 3 kali. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1, isolat-2, dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13,33%; 18,33%; dan 21,67%; sedangkan mortalitas pada kelompok kontrol hanya 3,33%.
KATA KUNCI: abalon, Haliotis squamata, vibriosis, Vibrio cincinnatiensis, uji patogenisitas

M 06
PENDEDERAN TIRAM MUTIARA (Pinctada maxima) DENGAN PERBEDAAN UKURAN TEBAR AWAL
Sudewi, Apri I. Supii, dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan. Namun, masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan. Perlakuan yang diberikan adalah ukuran tebar 3,44±0,44 mm (perlakuan A); 10,85±0,1 mm (perlakuan B); dan 20,36±0,55 mm (perlakuan C). Parameter yang diamati adalah laju pertumbuhan harian dan sintasan. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0,44±0,01 mm/hari (perlakuan A); 0,46±0,03 mm/hari (perlakuan B) dan 0,30±0,01 mm/hari (perlakuan C). Laju pertumbuhan lebar cangkang 0,37±0,01 mm/hari (perlakuan A); 0,4±0,03 mm/hari (perlakuan B) dan 0,27±0,00 mm/hari (perlakuan C). Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0,05) dibandingkan dengan perlakuan C. Sintasan yang diperoleh untuk perlakuan A, B, dan C berturut-turut 37,16%; 71,69%; dan 46,42%. Oleh karena itu, untuk memperoleh pertumbuhan dan sintasan yang baik, penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm.
KATA KUNCI: Pinctada maxima, pertumbuhan, sintasan, ukuran awal spat

Forum Inovasi Teknologi Akuakultur 2010

M 07
KAJIAN POTENSI KELAUTAN UNTUK BUDIDAYA TIRAM MUTIARA (Pinctada maxima) DI WILAYAH PESISIR KABUPATEN JEMBRANA-BALI
Apri I. Supii*), Ida Ayu Astarini**), dan Sudewi*)
*)

Balai Besar Riset Perikanan Budidaya Laut, Gondol
**)

Fakultas MIPA Universitas Udayana

ABSTRAK
Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan, pada tingkat nasional, regional maupun lokal. Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Berdasarkan hasil pengkajian, secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari, Sumber Sari, Teluk Awen, dan Teluk Rabu. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara, akan tetapi jika diinginkan, budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. Pantai Pengambengan khususnya, tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai.
KATA KUNCI: potensi kelautan, tiram mutiara, Pinctada maxima, Jembrana

Forum Inovasi Teknologi Akuakultur 2010

LL 1
PERFORMANSI PERTUMBUHAN DAN KANDUNGAN KERAGINAN RUMPUT LAUT (Kappaphycus alvarezii) DENGAN APLIKASI METODE BUDIDAYA VERTIKULTUR
Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Produksi rumput laut ditargetkan meningkat dari 2,6 juta ton per tahun sekarang ini menjadi 7,6 juta ton per tahun pada 2014, sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. Umumnya pembudidaya rumput laut, Kappaphycus sp. mengaplikasikan metode long line, di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut, Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan, yakni 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m, di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masing-masing dengan 3 kali ulangan. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver. 3,1. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut, K. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0,3 m; 1 m; 2 m; 3 m; 4 m; dan 5 m dari permukaan perairan. Oleh karena itu, metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468,75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan.
KATA KUNCI: Kappaphycus alvarezii, pertumbuhan, kandungan keraginan, vertikultur

LL 2
PERBANYAKAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN KULTUR JARINGAN MENGGUNAKAN WADAH YANG BERBEDA
Siti Fadilah, Rosmiati, dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. verrucosa. Rumput laut dikumpulkan dari Kabupaten Brebes, Jawa Tengah. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0,1%. Eksplan diinokulasi ke dalam media cair yang diperkaya PES. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker, sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu. Pengamatan panjang tunas, jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81,70%) daripada botol (90,75%). Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2,40 mm pada stoples dan 2,42 mm pada botol. Sedangkan jumlah tunas dalam stoples (7,50) lebih banyak dibandingkan dalam botol (7,03). Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26,70 dibandingkan dalam botol yang hanya 6,20.
KATA KUNCI: botol, kepadatan eksplan, stoples

penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. promoter. b-actin. Alimuddin**). Makassar **) Departemen Budidaya Perairan-FPIK. Alias L. kappaphycus alvarezii. fusi protoplas . KATA KUNCI: mutu genetik. Kappaphycus alvarezii Muh. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. Utut Widyastuti***).e dan stabil setelah jam ke9 sampai ke-12 s. puncak jam ketiga – keenam s. hibridisasi. dan St. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya.BPPT. Pola ekspresi keempat promoter relatif sama. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. panjang kejutan: 0. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik. dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas. Rosmiati.Irvan Faizal****). Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. Sebagai tahap awal dalam rangka produksi rumput laut transgenik. daya tahan penyakit. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%–10%.e). Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) . jumlah kejutan: 4 kali dan interval kejutan: 0.e. mulai berpendar jam pertama – kedua setelah elektroporasi (s. Keratin dan b-actin.Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12.5 mili/second. Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. Balai Riset Perikanan Budidaya Air Payau. Rajamuddin*).1 second. dan sumber karbon yang berbeda. Fadilah. persentase sel berpendar rata-rata 10%. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. transgenesis. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. ZPT. cytomegalovirus/ CMV. KATA KUNCI: Kappaphycus alvarezii.

Kabupaten Pandeglang. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. Untuk itu. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. SIG. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. Pada umumnya. Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. taman nasional ujung kulon. dan status wilayah kawasan. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. konservasi dan wisata). pembudidaya rumput laut. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. khususnya di Kecamatan Sumur. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. kondisi sosek-ekonomi.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. Rekomendasi pencegahan penyakit. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). KATA KUNCI: rumput laut. Erlania. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. Pandeglang . Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. I Nyoman Radiarta. rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia.

1:1. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%.5%). Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh.0:1. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. Pemeliharaan dilakukan selama 8 minggu. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0. 0.2 mg/L) dengan konsentrasi agar media induksi (0. embrio somatik.6%.0:0.0:0. Andi Asdar Jaya*). KATA KUNCI : Kappaphycus alvarezii. Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen. Pada tahap induksi kalus.5 mm dapat dicapai dalam satu bulan kultur.6%. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii. Tahap (2) adalah regenerasi massa sel embriogenik somatik. morfologi. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0.4 mg/L. 0.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm). adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus.8%). Pada tahap regenerasi massa sel embriogenik. KATA KUNCI: keragaman. Ridwan*).0 mg/L.0 mg/L.1 mg/L) dengan konsentrasi agar (0. Rosmiati.5:0.4%. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis. kalus. embriogenesis somatik .8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0. 1. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0. dan 0.0%. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan. dan 1.0% menghasilkan persentase induksi kalus tertinggi (90%). atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. pengggantian media dilakukan setiap minggu dengan komposisi media yang sama. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau. Alias L. dan 2. 1. Rajamuddin*). Pada media cair. pada rasio IAA: kinetin (0. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik.6% dan 0. Makassar **) Balai Riset Perikanan Budidaya Air Payau.8% dan 1. 0.0 mg/L. Perkembangan sel-sel embriogenik diamati pada kultur cair.8%.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0.

Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. dan karbohidrat) dan uji organoleptik. A-2 (30% tepung rumput laut dan 70% tepung terigu).143. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf.13 ha dan 3. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali.780. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. Mery Sukmiwati. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. dan berpengaruh nyata terhadap rupa dan tekstur. crakers.24 ha. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam program-program pokok pengembangan. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. Parameter mutunya adalah kandungan zat gizi (air. abu. Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. kadar abu.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. KATA KUNCI: rumput laut. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). 01-2973–1992 dan SII 0177–1990. rumput laut. denga metode budidaya tali panjang (long line). gizi. rasa. lemak. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. protein. produksi pada tahun 2008 sebesar 750 ton. aroma. Hasnawi. Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn 85%. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. A-1 (15% tepung rumput laut dan 85% tepung terigu). dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. uji organoleptik . KATA KUNCI: strategi pengembangan.

S POS . Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet. SIG.02% serta 44. namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei. Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95. pHFOX. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai SPOS tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat dan berkelanjutan. inderaja. Kebutuhan kapur CaCO3 untuk tambak di Kabupaten Mamuju berkisar antara 1. Penelitian ini bertujuan untuk melakukan analisis spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG). Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan.614%.32 dan 113. tambak. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0.02. bahan organik dan berat volume tanah.28% dengan rata-rata 7. tanah.2 digunakan untuk pembuatan peta distribusi SPOS tanah.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI SPOS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. klorofil-a dan suhu permukaan laut). Kebutuhan kapur didasarkan pada nilai SPOS tanah dengan mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur. Rachmansyah.29 ton/ha dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju. ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Maluku .71 g/cm3 dengan rata-rata 0. Adang Saputra. SKCl. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra ALOS AVNIR-2 akuisisi 28 Juli 2009.884 g/cm3 dan SPOS tanah berkisar antara 0. analisis spasial.15 dan 19. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku.60 dan 36. Maros ABSTRAK Kabupaten Mamuju. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia. infrastruktur (jalan) dan sebaran penduduk.78% sehingga memiliki faktor konversi berturut-turut sebesar 2. SPOS. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta. Program ArcView 3. Oleh karena itu.30 dan 1. KATA KUNCI: kebutuhan kapur. SP.09 dan 90. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya.36 dan 3. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan. KATA KUNCI: budidaya laut. Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut. Peubah kualitas tanah yang diukur adalah: pHF. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. pirit. Kapur pertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur.

konversi pakan serta pertumbuhan yang cukup baik. rumput laut. Evi Tahapari***). KATA KUNCI: produktivitas tambak. udang. Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. analisis komoditas unggulan dan andalan. Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. bandeng LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. tambak terbengkalai. KATA KUNCI: minapolitan. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. Adang Saputra**). ikan patin. Hatim Albasri**). Di samping itu. udang dan bandeng. Jakarta **) Pusat Riset Perikanan Budidaya. analisis komoditas. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. peningkatan pendapatan. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Wartono Hadie**). Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. Sukamandi *) ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. analisis location quotient. Kabupaten Brebes . rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara.400 m2 selama 3 bulan pemeliharaan. dan analisis usaha perikanan. Jakarta **) Pusat Riset Perikanan Budidaya. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. dan Sularto***) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan.Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). Introduksi kaji terap dilakukan dilahan seluas 2.

75 m tanah vegetasi api-api. Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah.25 m dan 0. nipah (Nypa fruticans). dan Kamariah Balai Riset Perikanan Budidaya Air Payau. sagu. bakau. Oleh karena itu. pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent. karbon organik. Pada kedalaman 0-0. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. pHOX. SPOS. rumput. pHFOX dan potensial redoks. PO4. masingmasing pada kedalaman tanah 0-0. TSA. tanah. nipah. bakau (Rhizophora apiculata). rumput.50-0. N-total. Fe. Hasil penelitian menunjukkan bahwa. Pada kedalaman 0. kelapa (Cocos nucifera). Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah.75 m. KATA KUNCI: keragaman. pirit. tanpa vegetasi. sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. TAA. penutup/penggunaan lahan. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). padi (Oryza sativa). TPA. Kualitas tanah yang diukur langsung di lapangan adalah pHF. Al dan tekstur. sedangkan yang dianalisis di laboratorium adalah pHKCl.50-0. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). SP. pesisir.25 m tanah jenis penutup/penggunaan lahan api-api. bakau. Kabupaten Mamuju . paku laut (Acrostichum aureum). sagu (Metroxylon sagu). nipah. Marsambuana Pirzan. A. Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. SKCl. rumput.

walaupun dengan model regresi yang berbeda. cukup sesuai (168. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. Data sekunder yang diperoleh berupa data iklim.000. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. Data lapangan (fisiko-kimia air dan tanah). Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat.986 ha). sedangkan peubah bebas adalah suhu. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil. amonia.000. dan fosfat. data sekunder.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. Sulawesi Barat . Pada umumnya yang tergolong sangat sesuai (114. nitrat. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497. KALIMANTAN BARAT Utojo. salinitas. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia.398 µg/L. fosfat. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50. dan bahan organik total. Mempawah Hilir dan Mempawah Timur. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a.047 dengan rata-rata 6. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan.272 ha).819 ha). dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. tersebar di wilayah pesisir Kecamatan Sungai Pinyuh. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau.077 ha. pH. nitrit. amonia. oksigen terlarut. pH. Akhmad Mustafa. dan data citra satelit digital.046 dan 22. Oleh karena itu. KATA KUNCI: kesesuaian lahan. sedangkan yang kurang sesuai (213. dianalisis secara spasial dengan metode PATTERN menggunakan SIG. Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil. nitrit. terdapat di Kecamatan Segedong dan Siantan. kualitas air. tambak. KATA KUNCI: klorofil. Sungai Kunyit. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik. nitrat. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). tambak.

dengan menggunakan cara modifikasi (Banerjee et al. Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp. kecerahan. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda. Spesies dominan adalah Limnaea sp. Analisis data dilakukan secara deskriptif untuk komposisi jenis.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. minyak nabati . pupuk. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5. Kultur ini ditempatkan diluar ruangan. Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata..75).0 sel/mL.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. dilakukan di dalam bakbak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. Chironomus sp. Tidak terdapat perbedaan nyata (P>0. Kultivasi Dunaliella sp. Jakarta. dan BOD5. Proses pengayakan termasuk penyeleksian. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4. Bogor.. 5:4. penghitungan kelimpahan. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp. dan 6:3. KATA KUNCI: makrobentos. dan penghitungan dilakukan di laboratorium.60% menggunakan perlakuan pelarut hexana. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan.5 mg/L.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6. ekstraksi. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP. 2006). Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya. BRPBAT. Parameter kualitas air yang diamati adalah suhu. 2002 dan Dayananda et al. indeks diversitas dan keseragaman spesies. KATA KUNCI: mikroalga. kolam. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. Dunaliella.02–8.. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0. pH. DO. kemudian 6. total bahan organik (TOM). Analisis kandungan minyak nabati Dunaliella sp. identifikasi..). diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis. dan Nematoda.

25/ hari pada indoor dan 3. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat.33 sel/mL pada sistem indoor dan 7. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. laju pertumbuhan.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan. dengan skor 19. Metode penelitian menggunakan metode survei. Botryococcus braunii . braunii. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain.37. KATA KUNCI: kepadatan. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. Departemen Pertanian. salah satunya adalah Desa Merakan di daerah Jawa Timur.65/hari pada outdoor. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. KATA KUNCI: ketahanan pangan. salinitas. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. rawan pangan. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12. dan pH. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. Pengolahan data dilakukan secara deskriptif. Berdasarkan perhitungan statistik ANOVA. 02 sel/mL pada sistem outdoor.

uji PCR.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. penanganan aspek teknis. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. sehingga AH-26 merupakan isolat yang pathogen. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. pembudidayaan. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. KATA KUNCI: unit usaha. profitabilitas. dan Balai Budidaya Laut (BBL) Ambon. Bakteri merupakan salah satu penyebab penyakit pada ikan. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. tes katalase dan oksidase dilakukan sebelum uji PCR. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. Uji awal berupa pengecatan gram. KATA KUNCI: Aeromonas hydrophila. penanganan aspek teknis. Isti Koesharyani. Infeksi bakteri. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. aerolysin dan primer spesifik . Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. pengelolaan bisnis. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. kemungkinan merupakan strain yang tidak pathogen. Sedangkan dengan menggunakan spesifik primer.

Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat. Winarlin. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m). kedalaman 2 meter (B). KATA KUNCI: kedalaman. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar. Masing. namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae. periphyton.86-0. Waduk Cirata . Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. kedalaman 3 meter(C) dan kedalaman 4 meter (D).91. Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A).Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti.masing perlakuan 5 kali ulangan.81 (ind/cm2) dan 0. yaitu 4423. Ani Widiyati.

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

sintasan. salinitas. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. dan Sutisna Kuningan. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. Cianjur Wildan. responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. dan Achmad Sudradjat*) **) *) Pusat Riset Perikanan Budidaya. Bogor ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium.Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. telah banyak menginfeksi ikan nila. Sidi Asih***). ikan nila. Jakarta Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. Hary Krettiawan*). dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. sintasan terendah didapatkan pada salinitas 12 ppt. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. pertumbuhan . ikan mas. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. Masingmasing perlakuan menggunakan 2 ulangan. Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. 8 ppt (6–10 ppt). Akuarium yang digunakan berukuran panjang 60 cm. KATA KUNCI: streptococcosis. dan 12 ppt (11–15 ppt). Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. Majalaya. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*). Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas. dan tinggi 40 cm dengan ketinggian air 15 cm. KATA KUNCI: strain. lebar 40 cm.

yang diberi sekat jaring nilon hita. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya. dan kalimantan. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. dengan jangka waktu pengembalian modal selama 3. pakan. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september . Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. Pemeliharaan ikan belida dilakukan di kolam. ekonomi. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan.64 sedangkan FCR total sebesar 1. Dalam hal dukungan dana permodalan. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. Jakarta ABSTRAK Ikan karnivor.36. ikan belida yang banyak hidup di perairan umum Sumatera. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan. KATA KUNCI: budidaya. Iwan Malhani Al’Wazan. KATA KUCI: ikan belida. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya.53.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi.20 siklus dan nilai RC ratio sebesar 1.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. Jawa. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan SeptemberNovember 2009. anakan ikan nila . termasuk jenis ikan karnivor. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya.

yang dikenal dengan nama PKM (palm kernel meal). Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. KATA KUNCI: ikan nila. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) **) Pusat Riset Perikanan Budidaya. palm kernal meal. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. kurang lebih 60% pengeluaran berasal dari pakan. Budidaya ikan nila dapat dilakukan di kolam. jaring tancap dan keramba jaring apung. Untuk menguasai teknologi domestikasinya. Jakarta Balai Riset Perikanan Budidaya Air Tawar. Dalam kegiatan budidaya ikan. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. pelet maggot . KATA KUNCI: ikan belida. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. Selama proses adaptasi pada kolam pemeliharaan. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva.

Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. baik disebabkan oleh infeksi virus. KATA KUNCI: pertumbuhan. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). dan 200 ekor/m³. Rasio konversi pakan 1. Pendederan ikan kerapu macan. Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. 65 g/ ekor. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). 05. dan Zafran Balai Besar Riset Perikanan Budidaya Laut.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. sedangkan kontrol hanya disuntik dengan PBS. 05) tidak mempengaruhi sintasan. Fris Johnny. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. KATA KUNCI: vaksin bakteri. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. Masing-masing perlakuan diulang 3 kali. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. bakteri maupun berbagai jenis parasit. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0.150. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. 95 – 2. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan. Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). 25 – 1. ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. penyakit infeksi . Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. sintasan. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bakbak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. Padat penebaran yang digunakan sebagai perlakuan adalah 100. Epinephelus fuscoguttatus.

Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11.80. Apri I. dan pada induk asal alam 20-92 % dengan SAI 2. Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam. KATA KUNCI: kerapu raja sunu. Ketut Suwirya. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3.20. aspek biologi reproduksi . Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia. dengan jumlah 8% biomass/hari. Agus Priyono. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 . pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. Plectropoma laevis. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan.000 butir. Tridjoko. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. Kualitas telur yang dihasilkan relatif masih fluktuatif.004.000 butir.520 µm. Supii. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2.240.450. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³. indeks somatik gonad dan diameter oocytnya.25-4. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad. dan (B) Induk asal alam.

Peubah yang diamati adalah sintasan. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. pertambahan berat. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). pertumbuhan. tawes . konversi pakan. pertambahan berat. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. KATA KUNCI: truss morfometrik. dan N. dengan periode pemeliharaan120 hari. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. Himawan Tirta Yudha.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. Rudy Gustiano. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. (1988). ikan tengadak. Kata kunci : Jaring apung. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. dibandingkan dengan perlakuan lainnya. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. Hasil penelitian menunjukkan bahwa laju pertumbuhan. total biomass dan biaya pakan. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. Giri Balai Besar Riset Perikanan Budidaya Laut. tengadak albino.A. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung.

juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7. khususnya ikan.05). Untuk itu.82%).lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8. Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat). kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur. amonia (42. dan Scirpus sp. karbofuran. dan nitrat (11.82%).849 mg/L) dan nitrat (0. yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air).5%–66.Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar.5%–90. Kisaran persentase efektivitas penyisihan TN (28%– 58.681mg/L) dan nitrat (0. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar.86%–85. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan. Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi. Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat. yaitu TN (42. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan. Perlakuan pada penelitian ini terdiri atas dua perlakuan. amonia (0.11%–44.05) dibandingkan kolam ikan kontrol (82.3 mg/L).36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0. tumbuhan air. Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi.4%) pada kolam substrat 1 (pasir.33%). amonia (0.14%–92.5 mg/L). KATA KUNCI: toksisitas.5 mg/L). produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar.081–0.5–14. akut. amonia (20. KATA KUNCI: substrat. Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen.32 %).58%). Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0. karena di samping harus efektif terhadap hama tanaman padi. dan nitrat (37.8 mg/L). kronis . Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya.303–1. pemakaian insektisida perlu dilakukan secara selektif.).4–0.7–1.67%). nitrogen. Sintasan (93. Typha sp.

(e) garam 5. Dua pasang primer. sehingga upaya pengendaliannya sering terlambat. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain–Jenssen. Pada riset ini. Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan. Hasil penelitian menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10.00 mg/L dan garam 4. Dactylogyrus.00 mg/L.00 mg/L (g) kontrol. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar.00–20.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut. Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Mycobacterium fortuitum. (d) garam 4.000. dan Polymerase Chain Reaction . Ketujuh perlakuan itu yaitu: (a) biji teh 10. Gyrodactylus.00 mg/ L. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp.00 mg/L. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. limpa. (c) biji teh 20. Oleh karena itu. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati. (f) garam 6. yaitu M1: T39 (GCGAACGGGTGAGTAACACG) dan T13 (TGCACACAGGCCACAAGGGA). Trichodina.000. ginjal. Sensitivitas teknik diagnosa terhadap bakteri target. sedangkan preparat histopatologi diambil dari organ hati.00 mg/L. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis. KATA KUNCI: mycobacteriosis. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies. dan Quadriacanthus kobiensis serta menimbulkan kematian. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy). KATA KUNCI: ekstoparasit. selanjutnya dibandingkan dengan teknik diagnosa melalui uji biokimia dan histopatologis. dan limpa. gurame. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. dan darah. dan primer M2: PreT43 (AATGGGCGCAAGCCTGATG) dan T531 (ACCGCTACACCAGGAAT) digunakan pada penelitian ini. serbuk biji teh dan garam.00 mg/L efektif untuk memberantas Trichodina dan monogenea. Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum.00 mg/L. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit.00–6. (b) biji teh 15. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. yang telah dikembangkan oleh beberapa peneliti.000. Ada beberapa bahan nabati dan alami yang dapat digunakan. Mycobacterium fortuitum PADA IKAN GURAME.

Bogor. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. nilem. dan tingkat sintasan. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang. pakan ikan beronang. B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya.60±0. 1. masingmasing diulang tiga kali dan di desain dengan rancangan acak lengkap. 500.500. guttatus .500 dan 2.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. tepung bungkil kopra. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem. efisiensi pakan. KATA KUNCI: tepung bungkil kedelai.15±5.73 g dengan padat tebar 15 ekor/keramba. Hasil penelitian menunjukkan bahwa penggunaan fitase 1. substitusi. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan. efisiensi pakan. namun nilai ini tidak berbeda nyata dengan 1. dan 2.000 unit fitase/kg pakan.05).Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti. Cijeruk dengan bobot rata-rata 8.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0. dan sintasan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. C. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22. rasio efisiensi protein.000. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0. 1. S. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. Balai Riset Perikanan Budidaya Air Tawar. Parameter yang diamati yaitu laju pertumbuhan spesifik. KATA KUNCI: fitase.V.05) terhadap pertumbuhan. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG.000 unit/kg pakan.45 g/ekor. pertumbuhan.

bobot dan sintasan serta kualitas air. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm. 50% ikan rucah + 50% pelet. B.Variabel yang diamati adalah pertumbuhan lebar karapas. rajungan. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot.02 g.05) dengan perlakuan yang lain. pertumbuhan. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. sintasan .526. Tjaronge Balai Riset Perikanan Budidaya Air Payau.).2 ± 0. Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak. Maros selama 40 Hari. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis.04 ± 0. lebar karapas dan sintasan (P>0. 100% ikan rucah jenis ikan tembang (Clupea sp. tambak. KATA KUNCI: budidaya bandeng. Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut.-/tahun/ha. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap. 100% pakan buatan/pelet dan C.2 mm dan bobot 0. KATA KUNCI: pakan rucah. Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur). maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass. pelet. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus).850. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana.

ampas tahu. masing-masing mencapai 56.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.43.009 gram. 55. B/C rasio 1. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. KATA KUNCI: benih botia. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. pupuk kandang dan dedak. 35.816%. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran. 20.467. Sintasan bandeng pada perlakuan A dan B. Oleh karena itu. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional. Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10.5 cm) . produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2.9 dan 1154 kg/ha. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. dan 105 dan dianalisis secara deskriptif.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2.5 x 0. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).5 cm (ukuran ekspor). Selama pemeliharaan.5 m dan tinggi air 40 cm. Pada akhir penelitian (hari ke 105). 70. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.5 cm dan panjang tertinggi sebesar 3. pertumbuhan panjang.5 x 0. ukuran ekspor 1 inchi (2.625% dan 60.-. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B). Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. bandeng. KATA KUNCI: pupuk organik.5 ton/ha.98 g/ekor menjadi 232.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B). Erfan Andi Hendradjat.0 cm. Nina Meilisza.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara.100. masing-masing dengan dosis 2.0 cm dan bobot rata-rata 0. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1. Padat penebaran bandeng pada masingmasing perlakuan adalah 15.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari. masing-masing mencapai 986. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Produksi bandeng pada perlakuan A dan B. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0.

Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp. Agus Priyadi*). Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya. KATA KUNCI: Melanotaenia sp.24 cm.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor.00 dan 16. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp.05) terhadap pertambahan bobot rata-rata ikan.32 ± 0.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat.8 (sebagai kontrol). dengan pertambahan bobot rata-rata sebesar 0. pakan alami.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5. memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp. Gigih Setia Wibawa*).5 – 5. ikan diberi perlakuan pemberian pakan alami yang berbeda. dan Culex sp. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian..0-8..0 – 6. Rendy Ginanjar.00.) Eni Kusrini*).00 dengan metode pemberian sekenyangnya (adlibitum). Depok Pusat Riset Perikanan Budidaya. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar.50 ± 0. Depok. KATA KUNCI: Benih ikan pelangi. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp. 12.9 dan pH 7.. dan (C) Tubifex sp. pH 6. Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal. Hasil penelitian menunjukkan bahwa perlakuan pH 7.0 – 8. pendederan. gonad.01 g dan panjang total rata-rata 3. Jakarta ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua. sintasan . Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali. namun tidak berbeda nyata (P>0. pertumbuhan. pH air pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur. Pakan diberikan tiga kali sehari yaitu pada pukul 8. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula.98 ± 0. (A) Chironomus sp.85 ± 0.0. (B) Culex sp. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi.09 g dan pertambahan panjang total rata-rata sebesar 0.Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP.05) terhadap rata-rata pertambahan panjang total dan sintasannya. memberikan pengaruh yang berbeda nyata (P<0. Selama 45 hari pemeliharaan. dan Irsyaphiani Insan**) *) **) Balai Riset Budidaya Ikan Hias.

C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali.02 g. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan.22% dan E.02 cm dengan bobot 0. Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. B (2 ekor/L). Prancis ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan. Asep Permana*). Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. ketersediaan pakan dan padat penebaran. B. sintasan.67%. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap.13±0. Pakan yang diberikan selama penelitian adalah nauplii artemia. pertumbuhan. 95. D. Marendra Gladiyakti**) *) **) Balai Riset Budidaya Ikan Hias. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara. dan Jacques Slembrouck**) **) *) Balai Riset Budidaya Ikan Hias Depok.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*). KATA KUNCI: Metynnis hypsauchen. Ikan uji yang digunakan adalah benih berukuran panjang 2. KATA KUNCI: ikan botia. Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari. Sintasan dari masing-masing perlakuan adalah sebagai berikut: A.05) terhadap pertumbuhan. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. C. C. Depok Universitas Diponegoro. 96.45%. Lili Sholichah*). namun memberikan pengaruh terhadap pertumbuhan panjang larva botia. 96. Rendy Ginanjar*). 96. 20 ekor/liter. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi. 30 ekor/liter dan E. resirkulasi. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). padat tebar .81%. 25 ekor/liter.22±0.67 mm. Indonesia Institute Recherche Pour Le Developpement. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi. 97. Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9.07%. 15 ekor/liter. padat tebar. D. 35 ekor/liter. B. tetapi berpengaruh nyata (p<0.

Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. KATA KUNCI: maggot. ketersediaan pakan dan pemasaran. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. Kawasan Mina Pakan Mandiri. biokonversi. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. Unit pengolah pakan memiliki prasyarat sebagai berikut. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. fisiologi dan tingkah laku dalam merespon perubahan lingkungan. bahan pakan seperti vitamin dan dedak. propinsi Jambi. Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. Ikan Sidat (Anguilla sp. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). Unit produksi maggot memiliki prasyaratan sebagai berikut. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. Ikan migrasi. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. KATA KUNCI: Phenotipic plasticity. temperature. salinitas dan arus. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). sedangkan factor eksternal yaitu. Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. dan homing atau reproduksi. kolam budidaya dan manajement budidaya yang baik. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. lunar. area penjemuran atau alat pengeringan pakan (drying). air tersedia dalam jumah yang cukup.) . memiliki bak untuk restokin. 2) unit pengolahan pakan dan 3) unit budidaya. Migrasi terbagi menjadi migrasi vertical dan horizontal. memiliki mesin pelet. makanan. Unit budidaya ikan memiliki prasyarat sebagai berikut. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. memiliki bak kultur.

jarak genetik. untuk mengamati variasi genetik benih persilangan ikan nila. Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik. Kata kunci: Randomly Amplified Polymorphic DNA (RAPD).Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan dengan Pseudomonas aeruginosa. dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.15%). Oreochromis niloticus . nila merah (Red NIFI).560).236 – 0. Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&).28 mM. mossambicus) Nunuk Listiyowati. dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Aktivitas reduksi nitrat terjadi dari awal inkubasi.h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Jarak genetik 15 populasi persilangan berkisar (0.17 mM. Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. Kata kunci: denitrifikasi. mujair (O.mossambicus). Sukamandi. sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST. nitrogen anorganik. Ikan yang di gunakan adalah hasil persilangan 4 strain. Hasil dari persentase polimorfik (berkisar 5. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*).40 mM dan 0. terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. NIRWANA (nila ras wanayasa). Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan. Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD). dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. reduksi nitrat . Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi.h-1 dan 0. Iman Rusmana**). Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O.mossambicus). Didik Ariyanto. tetapi yang menghasilkan benih hanya 15 populasi.16 mM.26% – 63. Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi. juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut. Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi. Persilangan. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. nila BEST (Bogor Enhancement Strain of Tilapia). Selain itu.

KATA KUNCI: PGC. Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17.09% menjadi 4.8%.. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia.) Priadi Setyawan1). nutrisi dan serat kasar . 6 hari (D3).74% menjadi 5. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma.37% dan meningkatkan kadar protein dari 13. Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). Pada tahap pembentukan mata. KATA KUNCI: Bacillus sp.91% menjadi 15. kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral. 4 hari (D2). UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. menurunkan lemak bungkil sawit dari 14. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. fermentasi. rasio inti sel:sitoplasma yang besar. sebagai bahan baku pakan ikan patin. Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. Isdy Sulistyo2). distibusi. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi. Osphronemus goramy. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp.37% setelah proses fermentasi. bungkil sawit. Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia. Sukamandi **) Universitas Jenderal Soedirman. Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. PGC terdistribusi secara berkelompok di bagian ventral.

kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar.1994). Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi.. sebagai materi kegiatan tahun mendatang.Balai Riset Perikanan Budidaya Air Tawar. pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. Jakarta ***) . KATA KUNCI: UPR. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. Jakarta **) Pusat Riset Perikanan Budidaya. Wartono Hadie**). Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. Depok ABSTRAK Ikan patin (Pangasius sp. sex reversal. 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. Bogor ****) Balai Riset Budidaya Ikan Hias. dan kluster pemeliharaan larva dan benih. salah satunya melalui Catfish Club Indonesia. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. dan Labuan (Merak). Subang. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. Pengambilan data melalui responden dilakukan dengan cara purposive sampling. Eni Kusrini****). Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. Angela M. jantan fungsional. KATA KUNCI: ikan nilem. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). Lusiastuti***). dkk. setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. Perbedaan dari kedua sistem ini adalah sifat produksinya. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor. kluster penetasan telur. integrasi. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. di antaranya daerah Bogor dan Subang. Tipe integrasi bersifat soliter. dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. demikian juga ditinjau dari segi higienis dan kesehatan benih. dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk. Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. betina homogamet . Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. patin. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. dengan masing-masing hatchery terpisah lokasinya.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP.

10 butir/liter (perlakuan H). kepadatan. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva). Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. intensitas cahaya. oksigen terlarut/DO. ikan mas strain rajadanu . KATA KUNCI: seleksi generasi. dan Afifah Balai Besar Riset Perikanan Budidaya Laut.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. 15 butir/ liter perlakuan (I). sintasan dan kualitas air (meliputi suhu. Diketahui estimasi nilai heritabilitas rata-rata h²(S+D) = 0.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui.1. Anang H K. amonia.27 pada ukuran konsumsi dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. Agus Priyono. KATA KUNCI: sintasan.57 % dalam satu generasi. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar. larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih. pH. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. dan nitrit). Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. M H Fariddudin A. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). pertumbuhan. salinitas. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva. memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut.2 gram. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan.

KATA KUNCI: antibakteri. Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik. penanggulangan. karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. Klaten. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). dan Lila Gardenia Pusat Riset Perikanan Budidaya. bakteri probiotik.Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. penyakit streptococcosis . eksplorasi. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus). Hambali Supriyadi.dan Tasikmalaya. Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. Survei dilakukan di beberapa daerah yaitu Cianjur.

Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. Kabupaten Pandeglang. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Erlania. Hatim Albasri. Untuk menjamin keberlangsungan usaha budidaya kerang hijau. Pandeglang . Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. Kabupaten Pandeglang. Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. Teluk Lada. Secara umum.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. budidaya laut. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. KATA KUNCI: kerang hijau. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. SIG. Provinsi Banten. di perairan Panimbang Kabupaten Pandeglang.

Zoopthalmium sp. BBAP Samas-Yogya(Jateng). dan Jatim. dan Opercularia plikatilis. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76. kelompok kedua adalah penghasil benih. BBUG Klungkung. Parameter yang diamati meliputi pemeriksaan parasit. Bali.Wartono Hadie*)..Bali.) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar..UPU Probolinggo (Jatim). Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp. sedangkan dari kelompok protozoa adalah Epistylis sp.. Vorticella sp. Retna Utami**). dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya. dan kelompok ketiga ialah pembudidaya. Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol.Yogyakarta. Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. Carchecium sp. BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. serta UPR yang mengembangkan usaha perbenihan udang galah. Imron**). induk. Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro. dan diferensial hemosit. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya.42%. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi.). Ikhsan Khasani**).). Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*). Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas. KATA KUNCI: udang. tembakau (Tobacum nikotiana) .Forum Inovasi Teknologi Akuakultur 2010 pK 01 1. kelompok kedua adalah penghasil benih. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk.. Jateng. tingkat kesembuhan. padahal permintaan cukup besar. Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP Samas. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro. dan kelompok ketiga ialah pembudidaya. Bali. manajemen. tingkat sintasan. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset.Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak.. KATA KUNCI: huna (Cherax sp. Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan. kelompok kedua adalah BBU Pamarican (Jabar). dan Spiranura sp.

KATA KUNCI: vaname. pada bulan pertama udang tidak diberi pakan. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3.84 kg/ha. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm.5 g. pengeringan. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2.000 kg/ha rumput laut. Setelah dua hari. survival rate. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. yaitu pertambahan berat rata-rata 230 g. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2.66% dan 108. Karawang. polikultur. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Pemeliharaan dilakukan selama tiga bulan. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. dilakukan pengolahan tanah tambak.1 kg dan kelangsungan hidup 11. sedangkan pada dua bulan berikutnya diberi pakan pellet udang. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. penebaran dilakukan setelah satu bulan dari penebaran tokolan.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. produksi 81. yaitu menggunakan tingkat teknologi tradisional plus. Dengan teknologi yang diterapkan. KATA KUNCI: udang windu. Empat petak tambak masing-masing berukuran 3. dan Wartono Hadie Pusat Riset Perikanan Budidaya.n pengapuran sebanyak 175 kg/petak. Hewan uji yang digunakan adalah udang vaname PL-48. namun polikultur udang vaname dan rumput laut masih kurang informasinya. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang. Penelitian ini dilakukan pada tambak di daerah Betok Mati. tokolan.6 kg/ha. kemudian dikeringkan sekitar satu minggu.8 kg dan kelangsungan hidup 100 %. Sebelum penebaran. pengapuran dan pemupukan. salinitas rendah. masing-masing dengan dua ulangan. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. produksi 78. Idil Ardi. Kecamatan Cilebar. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. namun berbeda tidak nyata (P>0. pemberantasan hama. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. Gracilaria verrucosa. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. produksi .2 %. Dari pemeliharaan udang selama tiga bulan.500 m2 digunakan untuk percobaan.22% dan 72. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak.

perlakuan C = tapioka.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. dan Rotatoria. dan Cyanophyceae.05) terhadap kelimpahan dan jumlah jenis plankton. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. masing-masing dengan 3 ulangan. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus. pola tradisional. probiotik. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. menggunakan bak kayu ukuran 1 m x 1 m x 0. Pada budidaya udang vaname pola tradisional plus. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. KATA KUNCI: tepung tapioka. indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. 25. Hal tersebut perlu mendapat dukungan dari penelitian. kotoran. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. pola intensif. KATA KUNCI: plankton. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. indeks keseragaman menunjukkan komunitas plankton pada perlakuan D relatif lebih merata dibanding perlakuan lainnya. Polychaeta. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. dan perlakuan D = tanpa sumber karbohidrat. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Dinophyceae. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari.6 m sebanyak 12 buah. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). dan metabolit udang. Pada budidaya udang windu intensif. udang windu . Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka. pelakuan B = sagu.3 g dengan padat tebar 50 ekor/bak.

dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. indeks keseragaman (0. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin. pH.780) dan indeks dominansi (0. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. dan produksi udang vaname.362).5 m dengan volume air 400 L. dan Pleurosigma dari Kelas Bacillariophyceae. KATA KUNCI: probiotik. PO4. tambak .324–0. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. NO2. Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing-masing: indeks keragaman (1.05) terhadap jmlah jenis dan kelimpahan plankton. suhu. indeks keseragaman. dan perlakuan C = dedak padi halus. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. perlakuan B = kotoran sapi.05) pada sintasan dan produksi udang vaname. pupuk organik. namun berpengaruh tidak nyata (P>0. udang windu. BOT. setiap 15 hari. sintasan. Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas. indeks keragaman. Abdul Malik Tangko. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. C = 4 mg/L. Nitzschia.000 ekor/petak). KATA KUNCI: dinamika plankton. NO3. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. pertumbuhan.689–0. dan indeks dominasi plankton selama pemeliharaan udang windu. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname.427). Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0. Hasil penelitian menunjukkan perlakuan berpengaruh tidak nyata (P>0.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau.05) terhadap pertumbuhan udang vaname. Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea.199–1. oksigen terlarut. sintasan. serta Oscillatoria dari kelas Cyanophyceae. B = 2 mg/L. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula.

umur pemeliharaan. KATA KUNCI: substrak. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0.239. Perlakuan yang diujicobakan dalam penelitian ini adalah A. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan. udang pama. masing-masing dengan dua ulangan.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2. Substrak tanah tambak.24.. biaya produksi. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak. Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan.. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak). udang windu . Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru. budidaya.650. dan substak tanah lumpur. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A)..03±0. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L. Penelitian dilaksanakan pada tambak ukuran luas 4. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71. Substrak tanah sawah. dan C. substrak tanah sawah. KATA KUNCI: efisiensi. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28.01 g. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak.0±5. biaya pakan pada perlakuan A dan B masing-masing Rp 11.2 cm dan bobot awal 0.sedangkan pada perlakuan A dan B masing-masing 2. B. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau.634.05) antara perlakuan substrak tanah tambak.6. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau.875. di mana masing-masing perlakuan diulang tiga kali. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1.14 dan 2.3±1.dan Rp 19. Substrak tanah lumpur. Machluddin Amin.984.5 dan 21. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau.8±0. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak.

1. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali. udang vaname. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau. KATA KUNCI: tepung tapioka.61%. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20. di mulai setelah satu minggu penebaran. masingmasing bak mempunyai ukuran panjang. ukuran 80 sampai dengan 96 ekor/kg). karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar.7%. namun tidak berakibat terjadi kematian massal. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60.64 kg/bak atau rata-rata 11. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan. kisaran produksi 9. Namun demikian.0 ± 2.66 kg/bak (7. Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan.1 ± 13. pertumbuhan udang. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan. Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B). Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25.235 kg/ha).86 g/ekor. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C). salinitas rendah .92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau.975 dan lebih rendah dibandingkan perlakuan B yang mencapai 1. lebar dan kedalaman secara berurutan adalah 10 m.2 kg/500 m2 = 506 kg/ha.2 ± 13.7 kg/500 m2 = 320 kg/ha. fermentasi probiotik.45 kg/bak atau rata-rata 12.6 kg/500 m2 = 406 kg/ha. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.7% dan perlakuan C = 36.7%. B).4 ± 0. Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91.5 m dan 1 m. dengan rata-rata berat 11. dengan rata-rata berat 12. ukuran 84 sampai dengan 89 ekor/kg) dan C (16.998. KATA KUNCI: molase. kisaran produksi 12. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah.28-13.3 ± 5. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A. Maros. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2.86 kg/bak (8. lebih tinggi daripada perlakuan B = 41.767. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah.66 g/ekor.15%.68-13. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah.325.3 ± 7.

udang galah. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL).Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.) dan probiotik B (mengandung bakteri Bacillus polimyxa.57 hari . Rata-rata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah. KATA KUNCI: probiotik. B. udang windu. C. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol).) berpengaruh nyata terhadap sintasan benih udang windu.75%.) yang berukuran PL-20. terdiri atas: A. Nitrosomonas sp. Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata. sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz. Pemberian probiotik B dengan konsentrasi 7. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62. terdiri atas: O. 1995).001 mL/L menghasilkan pertumbuhan tertinggi (0.4255–0. yaitu probiotik A (mengandung bakteri Bacillus sp. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab.3±1. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F.6±0. sedangkan juvenil dan udang dewasa hidup diperairan tawar. sebagai dasar perbaikan sistem penyediaan larva udang galah. Parameter yang diukur adalah kualitas air. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. 10 ‰.50%. B. Pemberian probiotik A memberikan pengaruh terhadap rata-rata pertumbuhan mutlak benih udang windu. waktu inkubasi. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6.001 mL/L menghasilkan sintasan sebesar 81. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter). Aplikasi probiotik setiap tiga hari sekali.5 mg/L. sintasan.4440 g dan kontrol 0.0 mg/L. Penelitian II pengujian probiotik B. P.25%.25%. Nitrobacter sp. Rhodococcus sp. Pemberian bakteri dengan konsentrasi 0. Dengan meneliti dua jenis probiotik. dan 0‰ sebesar 11. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji.3660 g. pemberian dengan konsentrasi 0. KATA KUNCI: salinitas. Universitas Padjadjaran. Tingkat sintasan yang diberi probiotik B berkisar antara 63. Pemberian probiotik A dengan konsentrasi 0.. dan kontrol 66.0 hari. kualitas air. diikuti perlakuan 5‰ sebesar 10±0. Kontrol (tanpa pemberian probiotik A).75%–68. dan R.. Masing-masing perlakuan diulang sebanyak empat kali. Pemberian probiotik A dengan konsentrasi 0.8935 g). karena secara alamiah larva hidup di periran bersalinitas. Pemberian probiotik A dengan konsentrasi 0. pertumbuhan . Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan.15.003 mL/L. Penelitian I adalah pengujian probiotik A. Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. Pemberian bakteri probiotik A (Bacillus sp.5 mg/L. dan D. laterosporus. dan tiga ulangan. Kontrol (tanpa pemberian probiotik B). 5 ‰. Q. Pemberian probiotik B dengan konsentrasi 2. 88%.).001 mL/L. 85%.. sintasan. 85%.. Pengaruh perlakuan terhadap sintasan. Pemberian probiotik B dengan konsentrasi 5. dan Rhodobacter sp. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan. sebelum diaplikasikan di tambak. dan pertumbuhan udang.002 mL/L.

Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten.09 cm. salinitas. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 15 ppt. KATA KUNCI: Macrobrachium rosenbergii. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi.67%. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. yaitu templat dengan berat molekul tinggi (1). dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. KATA KUNCI: pertumbuhan. Guna mendukung prgoram revitalisasi tambak. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. dan 20 ppt sintasan dari post larva udang galah mencapai 100%. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. 10 ppt (kontrol). dan ukuran templat. 10 ppt.33±0. konsentrasi. 25 ppt. 20 ppt. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3). Selain itu. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Hasil yang diperoleh adalah pada salinitas 5 ppt. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH.05). diantaranya karakteristik templat DNA genom yang meliputi kemurnian. udang galah . Ditinjau dari keragaan pertumbuhan. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau. 15 ppt. sedangkan sintasan pada perlakuan 25 ppt mencapai 61. Sukamandi. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. PCR.92±0.13 cm dan 1.

manipulasi lingkungan. Sulaeman. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. KATA KUNCI: kepiting bakau. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). kepiting bakau. KATA KUNCI: pergantian kulit. dan gabungan keduanya (C). Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan. Dari pencapaian bobot ini. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen.05). Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. maupun lebar karapas (P>0. Oleh karena itu. baik pertumbuhan bobot.66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. panjang. pemberian pakan. dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. Pakan diberikan dua kali sehari selama penelitian. ikan rucah (B).Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah.5%. Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet. Sintasan yang diperoleh pada penelitian ini yakni 52%–54. Berdasarkan persentase. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. kepiting lunak .

dan produksi serta parameter kualitas air. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1.300 pohon/ha dengan rata-rata 1. sintasan.5 bulan dengan panjang dan bobot masing-masing adalah 8.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh. bobot.02 g dengan kepadatan 1 ind. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. Ikan bandeng yang digunakan adalah gelondongan umur 1.000–1./m2. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi. Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan. perlindungan. KATA KUNCI: rajungan. pertumbuhan. restoking kepiting bakau. rumput laut dengan kepadatan 1. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan.1±0.0 ± 2.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena.000 ekor/ha ukuran crablet-30. jumlah permudaan 450–500 pohon/ ha. Tambak yang digunakan berukuran 10. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi. sehingga perlu riset budidaya rajungan pada musim kemarau. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari).100 pohon/ha. Hasnawi.04 ha.2 g.573.7 cm dan 4. data yang diperoleh dibahas secara deskriptif. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. tambak bersalinitas tinggi.2 mm dan 0. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa. KATA KUNCI: kerapatan hutan mangrove. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009. Dibalik manfaat mangrove yang demikian banyaknya. Tambak ditebari benih rajungan. dan pelestarian alam.2 ± 2. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰—4 9‰) mengakibatkan sintasan dan produksi rendah.000 m2. Peubah yang diamati adalah pertumbuhan lebar karapas. produksi . sintasan.05±0. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1.

Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. Untuk memfokuskan kegiatan budidaya rumput laut. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0. Secara umum. cukup layak dan tidak layak. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. Provinsi Gorontalo. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. bioakumulasi. kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya. I Nyoman Radiarta. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan.03 mg/L. SIG. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. Secara umum. KATA KUNCI: Danau Maninjau. DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). logam berat . Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010. Adang Saputra. Kappaphycus alvarezii. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. KATA KUNCI: minapolitan. rumput laut. kondisi perairan sangat mendukung pengembangan budidaya rumput laut. layak. Anjang Bangun Prasetio. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut.

Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN.962. sedangkan indeks dominansi berkisar antara D=0. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. Subang.853. Subang. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. TSS. Nitzschia sigma. KATA KUNCI: kualitas air. Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan.076-0. nitrit. tambak. Kualitas kimia air untuk pH. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. Supii.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. SUBANG Joni Haryadi*). N. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. Sampling air secara regular untuk pengamatan fisika. dan plankton dilakukan seminggu sekali. KATA KUNCI: alga perifiton. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. dan Erlania*) *) Pusat Riset Perikanan Budidaya.814-0. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. DO. alga hijau biru dan alga hijau). Perifiton yang terdapat di Tambak Blanakan. GONDOL-BALI Apri I. 20 dan 30. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom.085. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. indeks keseragaman berkisar antara E=0. Dara Kasih**). dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling.711-2. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. outlet. kimia. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. Indeks keanekaragaman berkisar antara H’=2. Adi Hanafi. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. inlet. BBRPBL Gondol .

ikan nila. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan. serta produksi Moina sp. dan 1. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. Data dianalisis secara deskriptif. K = 16:20:0. Pengukuran N dan P dilakukan pada ikan dan pakan.16 g. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan. KATA KUNCI: konversi pakan.63% dan 10. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP. 1. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp. dan 3).89%–17..89. nila (Oreochromis niloticus) dan bawal (Colossoma sp. yang terdiri atas: 9 jenis pakan untuk ikan mas. P. yaitu: ikan mas (5. Ani Widiyati. dan bawal adalah 1. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP.88–1. Bogor. 2).dengan produksi Moina sp. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp.96 ±1. ikan nila (3. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan.90.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin.53%–15.71%–10. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas. 1. volume air 500 L.) di laboratorium.78%).21%). setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP . indek dominasi. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio). Perlakuan adalah pemupukan dengan perbandingan N.87. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm. KATA KUNCI: limbah. dilakukan pada hari ke-8 sejak dilakukannya penebaran. kelimpahan. dan keanekaragaman plankton.48%–9.17% dan 8.900 g sedimen + 20 g TSP.89% dan 11. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal.58%–13. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur.53%) dan ikan bawal (8. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung. Parameter yang diamati adalah jenis. limbah hara N dan P . Panen Moina sp. akuaponik.83– 1. 9. Kusdiarti.73–1.23%–6.

sehingga dapat meminimasi kegagalan panen. Bogor Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) **) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila.6 juta ton per tahun pada 2014. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit.6 juta ton per tahun sekarang ini menjadi 7. N4M (2). Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). penyakit. KATA KUNCI: Streptococcus agalactiae. Isolat 1. agalactiae setelah dilakukan uji Postulat Koch. agalactiae. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani Pong-Masak Balai Riset Perikanan Budidaya Air Payau. dan NK1 (5) yang berasal dari organ otak. Produksi rumput laut ditargetkan meningkat dari 2. KATA KUNCI: rumput laut. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur. N17O (4). pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S. Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. pencegahan . di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*). mata. di laut dan Gracillaria sp. Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir. Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. 4. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. Oreochromis niloticus. Postulat Koch. Sukenda***). Budidaya rumput laut khususnya Kappaphycus sp. Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. Oleh karena itu. sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah.1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. hama. Hasil yang diperoleh. Esti Handayani Hardi**). N14G (3).

Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir. dan total suspensi <25–80 mg/L. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27.66°C. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari.95 ha. Pengumpulan data primer dilakukan dengan cara wawancara mendalam.57°C–30. . nitrat 0.1–8.0032–0. pH antara 6.37. Penelitian ini bertujuan untuk mengetahui potensi. Petrus Rani Pong-Masak. Kabupaten Kepulauan Selayar.02–9. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis.1113 mg/L. analisis hierarki proses.0008–0. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir.81–6. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau.85 mg/L.38–44. Mudian Paena.30 ha dan tidak sesuai 3.01169 mg/L.90 ppt. nitrit <0. besi 0. kesesuaian rumput laut. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden. kedalaman 1–40 meter. oksigen terlarut 5. karakteristik.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI. Rachman Syah. KARAKTERISTIK. fosfat 0.33 ha.10–36. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka.Indra Jaya Asaad. dan Makmur Balai Riset Perikanan Buddidaya Air Payau.610.0037 mg/L. salinitas 36.820. kurang sesuai 2.095. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. KATA KUNCI: potensi. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009.32 ha. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan.0267–0.039–0.09 mg/L. suhu 29.685 mg/L. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang. dengan tingkat kesesuaian lahan sesuai 21. demikian pula dengan karakteristik físika dan kimia oseanografinya. Syarifuddin Tonnek.695. Kata kunci : Opsi pemanfaatan wilayah pesisir.3 meter. bahan organik total 37. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder.

Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. NH3. NO2. Parameter kualitas perairan yang diamati adalah suhu.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. Kabupaten Pontianak . lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. Makmur. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. dan faktor pasar. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. A. salinitas.Indra Jaya Asaad. Kata kunci : kualitas perairan.Indra Jaya Asaad. PO4 dan Fe. konduktivitas. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. Rachman Syah. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. faktor teknologi budidaya. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. KATA KUNCI: keramba jaring apung. kandungan oksigen telarut. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. tambak. Cakupan wilayah penelitian meliputi Teluk Hurun. Utoyo. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. Muhammad Chaidir Undu. NO3. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. pH. yaitu : faktor infrastruktur dan kondisi perairan. analisis faktor.

Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. rasa. terbuka di atas lantai pada suhu ruang (sekitar 30°C). setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna. Sedangkan nilai TVB dan pH masing-masing sebesar 21. KATA KUNCI: pengeringan. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15. dan protein masing-masing sebesar 14. dicuci dengan air bersih.04 mgN% dan 6. Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. abu. mikrobiologi (Angka Lempeng Total/ALT. Selanjutnya. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air.663 cps. Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik. kadar abu 19. Rendemen dendeng sidat dengan bumbu kasar sebesar 57. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempah-rempah kasar dan halus (ekstrak). dan 28. rumput laut coklat. 28.25% dan dendeng dengan bumbu ekstrak sebesar 59.32%. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). viskositas 8. TVB.4%. kimiawi (kadar air. Kadar air. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat.1% selama 60 menit.97%. 7. Rumput laut coklat setelah dipanen. bau. dan mutu natrium alginatnya mempunyai kadar air 19. analisis fisika-kimia .0%.46%.1%. dan tekstur) menggunakan skala hedonik. abu. dan viskositas natrium alginat). KATA KUNCI: ikan sidat.44%. rendemen. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk. kadar abu. dan dijemur di bawah sinar matahari selama 18 jam.26%. protein lemak. kemudian direndam dalam larutan KOH 0. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.41%. kapang) dan rendemen. lemak. Jakarta **) Pusat Riset Perikanan Budidaya. dendeng. Kelompok kedua ditebar di atas lantai dengan beralaskan waring.0%. natrium alginat. dan rendemennya 37. dan pH). Rumput laut coklat dibagi menjadi dua kelompok. dan dijemur di bawah sinar matahari selama 18 jam. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.

Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. pengalaman petani ikan dan Kebijakan Pemerintah. prasarana fisik yang kurang mendukung. Metode yang digunakan adalah studi kasus. serta ketersediannya dalam skala kecil. kelembagaan yang menunjang. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). agribisnis perikanan . polusi air. Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. harga ikan yang tergantung pembeli dan cuaca. kekurangan modal. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. Faktor pendorong yaitu ketersediaan air yang melimpah. KATA KUNCI: potensi desa. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat. Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. Identifikasi faktor-faktor pendorong maupun faktor-faktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya.

Sign up to vote on this title
UsefulNot useful