SOAL-SOAL BIOLOGI

BIOLOGI SEL DAN MOLEKULER 1. Pada organisme manakah berikut ini respirasi aerob terjadi? I Mammalia II. Tumbuhan tinggi A. hanya I B. hanya II C. hanya I dan III D. hanya II dan III E. I, II dan III

III. Protozoa

2. Struktur lipid mengandung semua hal berikut ini, kecuali…. A. gugus karboksil D. molekul asam lemak B. struktur dasar CH2O E. gugus OH C. molekul gliserol 3. RNA ditemukan pada.... A. nukleus saja B. sitoplasma saja C. nukleus dan sitoplasma D. protein E. asam amino 4. Selama proses respirasi, energi dipindahkan dari molekul glukosa ke molekul.... D. ATP A. ACTH E. BCG B. DNA C. RNA 5. Ribosom terlibat pada semua dari berikut ini kecuali A. Pembentukan ikatan peptida B. Aminoasilasi dari tRNA C. Pengikatan faktor protein selama elongasi D. Pengikatan aminoasil tRNA pada mRNA E. Pengikatan mRNA pada kodon inisiasi 6. Suatu galur E. coli yang tidak memiliki DNA polymerase I akan mengalami defisiensi dalam…..DNA D. degradasi A. perbaikan E. transkripsi B. metilasi C. penggabungan 7. Penyelesaian fase S dari siklus sel suatu sel mammalia ditandai dengan berikut ini kecuali A. Kandungan histon per sel dua kali lipat dibanding ketika sel berada pada G1 B. Pada DNA yang mengalami replikasi, basa-basa nitrogen yang baru terbentuk berpasangan dengan basa-basa parental C. Setiap kromosom yang mengalami replikasi memiliki empat telomer D. Sister chromatids berpisah dari satu sama lain E. Nukleus mengandung jumlah DNA yang ekivalen dengan suatu sel tetraploid yang berada pada G1
1   

Komposisi basa dalam rantai DNA tersebut d. B. 30% C. Mikrovili dari intestinal brush border E. delesi basa 9. 20% G e. Flagella bakteria B. Berikut pernyataan yang tidak benar mengenai DNA pada inti sel eukariot adalah…… A. Atrika 3. kecuali A. 20% A. Ragi Saccharomyces cerevisiae diklasifikasikan dalam : D. 37% T. dimer purin A. Basidiomycota B. Orientasi kedua rantai berlawanan arah (antiparalel) D. Ujung 3’ adalah gugus fosfat E. long terminal repeat (LTR) 11. Serat tegang dari fibroblast D. dan 24% G. kinetokor B. kecuali : D. transposisi B. Cincin kontraktil pada sel-sel hewan yang membelah 10. Eubacteria E. b. 16% C. 24% G a. D. 16% C. Ascomycota A. 30% T. 37% T. Pseudo C. Jumlah basa timin sama dengan jumlah basa pirimidin. 30% A. Basil E. Filamen aktin dijumpai pada berikut ini. Kokoid B. Amphitrika A. dimer pirimidin E. telomer C. Spiral 2    . Sarkomer sel-sel otot rangka C. 23% A. 20% C. 24% G MIKROBIOLOGI 1. Zygomycota 2. rusaknya rantai tunggal C. terminator E. Kerusakan umum yang dijumpai pada DNA setelah pendedahan terhadap sinar ultraviolet adalah…. Bentuk-bentuk bakteri adalah sebagai berikut. Monotrika C. Struktur terspesialisasi yang berada pada ujung kromosom eukariot disebut D. 20% G c. 23% T. Politrika B. Lofotrika E. Oomycota C.8. Tidak semua urutan basa dalam DNA adalah gen 12. kecuali : A. DNA berbentuk heliks ganda dan linier C. sentromer A. tidak dapat ditentukan. Sarcina D. Tipe flagella pada bakteri adalah sebagai berikut. 30% T. 37% A. 16% C. Diketahui bahwa salah satu rantai dari DNA terdiri atas 23% A.

4 C. Memanaskan tanah untuk membunuh semua sel vegetatif dan kemudian memungkinkan semua spora dari organisme ini untuk “berkecambah” dan tumbuh D. Dinding sel suatu ragi 6. Suatu prosedur laboratorium yang memungkinkan diperolehnya kembali mikroorganisme penyebab penyakit D. Menumbuhkannya pada suhu tinggi C. Menumbuhkannya pada suhu sangat rendah E.. Anda mengambil suatu kultur mikroba dan memfraksinasinya menjadi beberapa komponen. Suatu cara yang mudah untuk mengisolasi spesies Bacillus dan Clostridium secara spesifik dari tanah adalah dengan: A.. setelah 2 jam? c. Protozoa B. Penyebab fenomena ini adalah D. Virus 9.25% sel awal mati? 5. Bakteri C. 2 E.4. Membran sitoplasma E. Komponen ini merupakan : A. Rusaknya membran plasma A. Dinding sel suatu bakteri gram positif B. Delapan koloni bakteri tampak pada plat agar setelah 24 jam. Menumbuhkannya secara anaerobik pada medium yang mengandung glukosa 3    . Metoda yang ditemukan oleh Koch untuk memurnikan mikroba C. berbagai L dan D asam amino. yang tidak dapat menghasilkan ATP sendiri adalah . Dari kelompok organisme di bawah ini. jumlah bakteri individual yang ada pada mulanya adalah.. Suatu pedoman yang dipakai untuk mengungkapkan suatu agen penyebab penyakit 8. Dinding sel suatu bakteri gram negatif D. Inkubasi bakteri gram negatif dengan lisozim pada medium isotonik menyebabkan bakteri berbentuk batang menjadi berbentuk bulat (spherical) . Mikroorganisme tertentu selalu penyebab penyakit tertentu B. Berapa banyaknya sel yang ada pada 1 liter kultur ini: a. dan asam teichoat maupun asam lipoteichoat. Glikogen C. Lichenes E. acetylglucosamin. Suatu kultur bakteri diawali dengan 4 sel bakteri per ml pada medium pengaya dengan fase lag 1 jam dan waktu generasi 20 menit. 6 7. Salah satu komponen mengandung molekul berikut ini: asam acetylmuramat. Menumbuhkannya secara aerobik pada medium yang mengandung glukosa B. Diatoms A. Destruksi dinding sel C. Destruksi sitoskeleton 10. Postulat Koch adalah : A. 8 juta B. setelah 2 jam bila 0. Absorbsi air E. 8 A. setelah 1 jam? b. D. Perubahan pada ekspresi gen B. D.

. laju dari kedua reaksi maju dan balik B merubah… BIOTEKNOLOGI Gunakanlah tabel berikut untuk menjawab pertanyaan no. rRNA dan tRNA yang dipergunakan selama proses translasi C. mengatur transkripsi dengan mengaktifkan atau menginaktifkan produksi dari protein represor E. otak saja 2. kesetimbangan konsentrasi A D.. intron yang dilepaskan dari protein mRNA yang di transkripsi dan belum diproses 4    . Dalam usaha untuk mengklon protein manusia. mensekresikan endotoksin D. mengatur translasi dari mRNA D. panas reaksi B.. Dari tiga jaringan ini.. otot.11. entropi reaksi E.. autotrof E. melindungi diri sendiri dengan menyekresikan antibiotik C. protein mRNA yang ditemukan di sitoplasma E. Bakteri penyebab tetanus hanya dapat dibunuh dengan pemanasan yang lama di atas titik didih. A. gen X akan ditranskripsi pada D. Gen X ditranskripsi hanya ketika faktor A difosforilasi. Hal ini mengindikasikan bahwa bakteri tetanus…. Material yang berasal dari sel manusia tersebut adalah. 1 1.... Lac operon. protein yang mentraskripsi mRNA di inti D. konstanta kesetimbangan C. Transkripsi gen X dikendalikan oleh transkripsi faktor A. material dari sel manusia di masukan ke dalam bakteri. Data pada distribusi jaringan dari faktor A dan aktivitas dari suatu protein kinase dan protein fosfatase spesifik untuk faktor A ditunjukkan pada tabel di atas. jantung.. memiliki dinding sel yang mengandung peptidoglikan B. ditemukan di sel eukariot B. jantung saja C. dan otak B. mengkode urutan asam amino pada laktase C. otot saja E. A. otak dan jantung saja A. Segmen DNA yang mengkode mRNA yang di transkripsi B. mengatur replikasi DNA dengan mengaktifkan atau menginaktifkan protein induser 3. menghasilkan endospora 12. A. Suatu enzim yang mengkatalisis reaksi A A.

Southern blotting 5    .. Metode yang digunakan untuk mendeteksi suatu protein adalah … D. Urutan basa yang sangat kompleks yang menjadi sederhana ketika suhu dinaikkan E. maka kebanyakan DNA … A. Rantai tunggal oleh denaturasi pada suhu yang lebih rendah B. Di alam. Pada temperatur di bawah titik leleh untai DNA komplementer. Polymerase chain reaction (PCR) E. Northern blotting A. 6. gen bakteri dapat ditransfer dari satu sel ke sel lainnya melalui 3 proses yaitu 1) ……………..4. adalah suatu teknologi yang menggabungkan gen dari sumber yang berbeda kemudian mentransfernya ke sel dimana gen tersebut akan diekspresikan. Northern blotting B.. Southern blotting 8. Rantai ganda akibat kuatnya ikatan hydrogen C. Eastern blotting B. Kinetik hibridisasi double helix DNA sangat berhubungan dengan urutan basa nitrogen pada helix tersebut. ……… ……. Southern blotting 9. Western blotting E. Eastern blotting C. Mampu menyerap sinar UV lebih banyak dibandingkan dengan temperatur di atas titik lelehnya. 7. Polymerase chain reaction (PCR) D. Polymerase chain reaction (PCR) E. Western blotting C. Western blotting C. Eastern blotting B. Manakah hasil pemotongan yang tepat dari enzim tersebut? 5. Metode yang digunakan untuk mendeteksi RNA adalah … A.. 2) …………. Perhatikan diagram dibawah ini! Tanda panah pada diagram menunjukkan tempat pemotongan dari enzim Tag I.. Metode yang digunakan untuk mendeteksi DNA adalah … D.…. dan 3) ………. Hibridisasi untuk membentuk untai yang lebih panjang dan stabil D. Northern blotting A.

Urutan DNA manusia: ATATCGTAATGTTGGTG. MEM II D. Tidak ada D.. ERA I.10-11 tentang rekayasa genetik. Berapa banyak sisi restriksi yang terdapat pada urutan plasmid bakteri? A. Enzim manakah yang seharusnya digunakan untuk memasukkan urutan DNA manusia ke dalam plasmid bakteri? A.500 nukloetida. ERA I B. Plasmid bakteri dengan urutan: ATCCCA… 1000 nukleotida… …ATTAAGGCCTTACAGGACCCCGGAATGAGAGTA ATGGGCTATTCAGGTA … 200 nukleotida lagi. CRO I dan ERA I E.. CRO I C.Gunakan petunjuk berikut ini untuk menjawab pertanyaan No. Ket: Urutan DNA yang digarisbawahi menunjukkan gen yang akan diklon Urutan enzim restriksi ERA I: GTAAATG CRO I: CAGGAC MEM II: GCCG 10.. Mengapa enzim restriksi yang terdapat pada suatu sel tidak merusak DNA sel tersebut meskipun sel tersebut memiliki urutan yang mampu dikenali oleh enzim restriksinya? ……………………………………………………………………………………………… ……………………………………………………………………………………………… 6    . 3 B. .. Lebih dari 3 C. 2 11.GTGTCAGGACGGGTGAAAGCCAGGACGCCGAATCG… 5000 nukleotida lagi. CRO I. 1 E. dan MEM II 12.

pada akhir hari ke tiga. A. A. E. C. peningkatan kelembaban dan suhu. 4. E... pertumbuhan pada dua hari pertama identik. peningkatan suhu saja.. B. pada waktu yang tidak ditunjukkan B. 2. laju pertumbuhan setelah hari ke delapan memiliki laju yang sama dengan hari sebelumnya. Dalam kondisi suhu yang diatur. Ujung akar tidak menunjukkan adanya pertumbuhan. E. A. ikatan pembuluh B. pada hari ke tiga. C. D. selama tiga hari terakhir.ANATOMI DAN FISIOLOGI TUMBUHAN 1. suhunya dipertahankan 37°C secara konstan.. pada hari ke delapan. Seorang peneliti melakukan pengukuran harian terhadap akar tomat pada suhu 33°C-35°C dengan cara ini. pada akhir hari ke delapan. B. Suatu teknik yang telah disempurnakan digunakan untuk memotong ujung akar dan menempatkannya pada larutan nutrien steril. ujung akar tersebut akan memanjang dan menghasilkan akar sekunder. lentisel C. Laju transpirasi suatu pohon kemungkinan akan meningkat seiring dengan. ujung akar memanjang dengan laju yang sama setiap hari.. pada akhir hari ke sepuluh. pada akhir hari pertama. C. C. Grafik akan menunjukkan garis lurus jika. 5. 3.. D. selama tiga hari pertengahan. A. Peningkatan terkecil pada pertumbuhan dicapai. meristem D.. peningkatan kelembaban dan pergerakan udara.. kambium 7    .. oleh grafik. larutan nutrien kemudian ditambah dengan hormon pertumbuhan akar. selama tiga hari pertama. Struktur yang menghantarkan materi ke seluruh tubuh tanaman disebut. Hasilnya dipetakan pada grafik berikut. peningkatan kelembaban dan penurunan suhu. B. A.. D.... D. E... peningkatan suhu dan pergerakan udara.

E. D.. A. pindah ke embrio karena darah ibu bercampur dengan darah embrio di dalam plasenta. geotropisme positif. oksigen dan air 10. xilem D. D. D. Tumbuhnya daun menuju cahaya dihasilkan dari. 8    . Ketika wanita hamil mengkonsumsi alkohol dan nikotin. E.. hanya pada siang hari. B. oksigen D. A. D. karbon dioksida dan air E. C. xilem dan floem 8. jaringan spons B. hanya pada malam hari. Produksi estrogen merangsang pembuntukan gamet untuk reproduksi seksual. embrionya berada dalam resiko karena racun-racun tersebut dapat. Jumlah karbon dioksida di dalam daran meningkat dengan olah raga. Selama respirasi. A. epidermis 6. Kambium terletak di dekat..E. Kadar oksigen di dalam darah berhubungan dengan detak jantung.. kayu 7.. memasuki uterus melalui perut ibu. epidermis D. B. karbon dioksida C. Hipotalamus mengurangi masukan TSH ke pituitary... 2. hanya ketika fotosintesis sedang berjalan. stomata B. berdifusi dari darah ibu ke darah embrio di dalam plasenta.. hanya ketika fotosintesis tidak sedang berjalan. C. A. Tumbuhan hijau melakukan respirasi... B. air B.. B. Sel-sel pembuat makanan pada tumbuhan terletak di. konsentrasi auksin yang lebih besar pada bagian yang terlindungi... Produksi urin memungkinkan untuk ekskresi buangan sel. C.. fototropisme negatif. tumbuhan hijau menyerap. 9. A. A. sel penjaga C. pembuluh C. C. rambut akar E. floem E.. ANATOMI DAN FISIOLOGI HEWAN 1. konsentrasi auksin yang lebih besar pada bagian yang terkena cahaya. konsentrasi auksin yang sama pada seluruh sisi batang. E. Pernyataan manakah yang menggambarkan mekanisme umpan balik yang melibatkan kelenjar tiroid? A.... mempengaruhi ovulasi. siang dan malam.

. Pada hari yang lembab. bronki C. dihubungkan secara langsung dengan tulang lengan lainnya oleh. Sekret yang mencerna karbohidrat dan protein adalah. ekstensor 7. tulang lengan atas manusia. A. Pembelahan – formasi blastula – formasi mesoderm – formasi gastrula – formasi otot. D. ptialin E.. Formasi blastula – formasi gastrula – formasi mesoderm – pembelahan – formasi otot. Kondisi kelebihan berat badan dapat disebabkan oleh faktor-faktor berikut. kecuali. 3.. permukaan kulit terlalu kering. getah pankreas B.. saliva C. C. A. jaringan adiposa B. kekurangan besi dalam diet E. getah lambung A. E.. kantung udara D. B. makan berlebih B.. paru-paru B. Manakah berikut ini yang mewakili urutan normal tahap-tahap perkembangan embrio? A..E. memakan terlalu banyak makanan berkalori tinggi D.. diafragma 10. C. memiliki bayi Rh negatif. A. mengalami eritroblastosis. Pembelahan – formasi blastula – formasi otot – formasi gastrula – formasi mesoderm. jaringan rawan E. D. tendon C. harus mengganti darahnya. berdifusi ke dalam air susu ibu yang akan diminum oleh bayi. memecah sel darah merah untuk membentuk buangan nitrogen. memiliki bayi Rh positif B. keringat mengevaporasi dengan cepat. Formasi gastrula – formasi blastula – formasi mesoderm – pembelahan – formasi otot. pepsin 9. D. 8. E. A. ligamen A. D.. B. gagal membentuk antibodi. C. kulit mengekskresikan garam dalam jumlah yang lebih besar... D. medulla E. gangguan kelenjar tiroid 4.. D. tidak olah raga C. ia lebih banyak berkeringat. mengumpulkan urin setelah mengalir melalui uretra. terdapat lebih sedikit evaporasi keringat. membentuk urea dari produk-produk buangan hasil metabolisme protein.... Pembelahan – formasi blastula – formasi gastrula – formasi mesoderm – formasi otot.. E. E.. Fungsi utama nefron adalah untuk. 9    . C. Laju pernapasan dikendalikan oleh.. 6.. B. menyerap makanan yang dicerna dari dalam usus halus. mengatur komposisi kimia darah. orang merasa tidak nyaman karena. 5.. Penyakit darah Rh dapat terjadi apabila ibu dengan Rh negatif. Humerus. A.

. D. Namun apa bila kedua sifat terletak pada kromosom yang sama maka hasil persilangan F1-nya adalah. A. A. RrPP dan rrpp E. Inkomplit dominan B. Bunga jingga disilangkan dengan bunga hijau menghasilkan jumlah keturunan sebagai berikut.. 12:3:1 A.. 3.1.. 9:7 B. 75 bunga jingga 27 bunga merah 23 bunga kuning 8 bunga hijau 1. Pada golongan darah terdapat tiga jenis alel. B-S. 2. IB.. Epistasis C. maka genotip dari kedua induk adalah. Proses pengubahan dari diploid menjadi haploid terjadi setelah meosis 2.56% 10    .3. 1.. Dua ekor ayam disilangkan dan diperoleh keturunan sebagai berikut: 10 walnut dan 3 rose. 4. Hasil persilangan F1 pada persilangan dihibrid yang dilakukan Mendel menghasilkan perbandingan 9.. Gen A merupakan gen yang mengkode bahan baku untuk pigmen yang bisa diubah menjadi berbagai warna. IO.. Kriptomeri A.. karena pada saat itu jumlah kromosom hasil pembelahan adalah setengah dari jumlah kromosom sel induk. Apabila pasangan keluarga tersebut berharap memiliki 3 anak lelaki. tetap 9:3:3:1 E.. Warna pada kembang sepatu merupakan sifat yang diturunkan secara poligeni. 4. D.. Tentukan genotip dari induk yang berwarna jingga. rrPp dan RRPp B.3... Kodominan E. Apabila seseorang memiliki alel IAIB di dalam tubuhnya maka orang tersebut memiliki golongan darah AB. Seorang ibu carrier terhadap sifat buta warna menikah dengan laki-laki normal.GENETIKA Soal 1-2. 1:1 C. rrPP dan rrPp D. Tentukan jenis penyimpangan hukum mendel pada persilangan diatas. RrPp dan rrPP 7. Berdasarkan keterangan diatas. Interaksi alel 6.. Hal ini terjadi karena semua sifat terletak pada kromosom yang berbeda.. RrPP dan RRPp C.7% B. maka peluang keluarga tersebut memiliki dua anak laki-laki normal dan satu buta warna adalah. IA. Sifat ini diatur oleh tiga gen (ABC) yang apabila berada pada keadaan homozigot dominan untuk ketiga gen akan menghasilkan warna jingga.. dan jika berada dalam keadaan homozigot resesif untuk ketiga gen maka warna bunga menjadi putih. Sifat alel IAIB dalam pembentukan golongan darah AB disebut. 9:3:4 5.

kondisi lingkungan kembali normal. Labu dengan genotip AABbcc memiliki berat buah 27 gr sedangkan labu dengan genotip AaBBCc memiliki berat buah 30 gr.58. Tiba-tiba kondisi lingkungan berubah dan menyebabkan kematian dari semua individu yang homozigot dominan sebelum mencapai usia dewasa. 0. Gen yang mengatur panjang sayap dan warna mata terletak pada kromosom yang terpisah C.7 E.6 11. Gen yang mengatur warna mata terpaut kromosom seks sedangkan gen yang mengatur panjang sayap terletak pada autosom D. 7 fenotip B. Berdasarkan informasi diatas maka pernyataan berikut yang benar adalah. 5 fenotip 9. 6 fenotip E. Seekor lalat yang heterozigot terhadap kedua sifat disilangkan dengan lalat yang homozigot resesif untuk kedua sifat. 0.4 D. 0. 6. A. Berat buah labu ditentukan oleh beberapa gen yang dikenal dengan istilah poligeni.4. Populasi dengan alel T dan t yang seimbang memiliki 36% individu dalam populasi dengan fenotip resesif.5% E.C. 18. Pada lalat buah diketahui bahwa sayap panjang (V) dominan terhadap sayap pendek (v) dan mata merah (M) dominan terhadap mata coklat (m). Tentukanlah frekuensi alel IA pada populasi tersebut.. Hasil persilangannya adalah sebagai berikut: 180 ekor sayap panjang mata coklat. 0. B. C. 12. Gen yang mengatur panjang sayap dan dan warna mata terletak pada kromosom yang sama B.. 0. 11    . 0. 4 fenotip C.26. 182 ekor pendek mata merah.7. Kedua gen bersifat kodominan. E.25% D. 0.5 B.2 C. 33 ekor sayap pendek mata coklat. 35 ekor sayap panjang ekor sayap panjang mata merah. Setelah kejadian tersebut. E. Kedua gen terpaut dan pada saat pembentukan gamet terjadi peristiwa pindah silang. A. Berapa frekuensi alel T setelah satu generasi? A. Berdasarkan keterangan tersebut tentukanlah jumlah fenotip dari hasil persilangan kedua labu tersebut! D. 10.. 9 fenotip A. 0. 0.75% 8. Pada suatu populasi yang terdiri atas 1000 penduduk diketahui bahwa jumlah orang yang bergolongan darah O adalah adalah 16% dari jumlah penduduk dan jumlah penduduk yang bergolongan darah AB dan B masing-masing adalah 100 dan 90 orang. tidak dapat ditentukan D.

Evolusi konvergen E. A. Perubahan tersebut diturunkan pada generasi berikutnya. Aa x Aa B. 25% C. bergolongan darah B dan Rh+ adalah 12. 50% 15. 75% A. D. Peluang memperoleh anak kedua perempuan.. Berapakan kemungkinan pasangan tersebut memiliki anak laki-laki yang menderita haemofilia? D. Peluang untuk memperoleh anak kedua perempuan dengan golongan darah A dan Rh+ adalah 0% B. 0% E. D. AA x AA E.. Radiasi adaptif D.. Oparin B.5% D. Kesetimbangan Hardy-Weinberg B. apakah genotip dari orang tua yang menghasilkan 300 keturunan dengan sifat dominan dan 100 keturunan dengan sifat resesif? D. Jika anak kedua adalah Rh+ dan bergolongan darah A maka kemungkinan anak ketiga lahir normal adalah 12.maka pernyataan berikut yang tepat adalah.” Pendapat tersebut adalah pendapat…. Probabilitas anak bergolongan darah O sama dengan Probabilitas anak A dan B 13.5% C. tereduksi atau hilang melalui penggunaan dan penghentian penggunaan. 2 B.. Ketidakmampuan untuk terbang 12    . Seorang wanita bergolongan darah O Rh. maka jumlah gamet yang dapat dibentuknya adalah. tidak dapat ditentukan A. AA x aa EVOLUSI 1. Jika seorang wanita yang ayahnya haemofilia menikah dengan laki-laki normal. Haemofilia merupakan penyakit menurun yang terpaut seks dan bersifat resesif. Mendel 2. Pada fenomena manakah berikut ini pengamatan Darwin tentang burung finch di kepulauan Galapagos menjadi contoh klasik? A. 4 E. “Suatu struktur diperoleh. AA x Aa C. Lamarck C. Jika A menunjukan alel dominan dan a adalah alel resesif. Wallace A. Aa x aa A.12. Seorang laki dengan genotip AaBaCCDd (A dengan D terpaut). Apabila anak pertama mereka adalah laki-laki A Rh.. 100% B. 8 C.... Spesiasi simpatrik C. Apabila ia menghasilkan sperma. membesar. Probabilitas anak kedua bergolongan darah A dan AB adalah sama E. 16 14. Darwin E.menikah dengan laki-laki dengan golongan darah AB Rh+.

Berikut ini pernyataan yang salah adalah. 5 dan 6. struktur yang memiliki karakter anatomi dasar yang berbeda. C. Seleksi alam bekerja pada individu. struktur yang memiliki karakter anatomi dasar yang sama. Materi genetik dari individu adalah genotip. II dan III C. asal evolusi yang berbeda. V dan VI E. sedangkan materi genetik dari populasi adalah ‘gene pool’. A. struktur yang memiliki karakter anatomi dasar yang sama. D. III. struktur yang memiliki karakter anatomi dasar yang sama. II dan IV D. Leher jerapah. asal evolusi yang sama. II dan V 6.. tidak ada tinggi tinggi C. C.. E. Evolusi adalah perubahan pada frekuensi alel dari suatu populasi. Seleksi alam menyebabkan perubahan genetik pada individual. tinggi tinggi tinggi 4.. I.. D. IV saja B. IV. tapi dapat digunakan untuk fungsi yang sama.. tidak ada rendah rendah B. VI. Berat bayi manusia pada waktu lahir. tapi dapat digunakan untuk fungsi yang sama. asal evolusi yang sama. I. Pada situasi manakah berikut ini evolusi berjalan paling lambat untuk suatu populasi ‘inter-breeding’? migrasi tekanan seleksi variasi karena mutasi A. Resistensi DDT pada serangga. A. Populasi Biston betularia pada waktu revolusi industri. 13    . D. sedangkan yang besar mudah dimangsa burung hantu. II.. Yang dimaksud dengan struktur analog adalah. Populasi burung Finch di Galapagos. tapi dapat digunakan untuk fungsi yang sama.. IV dan V B. tinggi tinggi rendah E. tapi dapat digunakan untuk fungsi yang berbeda. Kadal Aristelliger kecil bermasalah dalam mempertahankan teritorinya. III saja C. tinggi rendah tinggi D. III dan V 7. B.. V dan VI A. 5. E. A. Seleksi stabilisasi (’stabilizing selection’) ditunjukkan oleh. III. Seleksi mengarahkan (’directional selection’) ditunjukkan oleh. II. Gunakanlah pilihan berikut ini untuk menjawab pertanyaan no.. asal evolusi yang berbeda.. asal evolusi yang berbeda. I. Seleksi alam mengarahkan populasi menjadi lebih sesuai terhadap lingkungannya. III dan VI E. B..3. II. struktur yang memiliki karakter anatomi dasar yang sama. V.. tapi dapat digunakan untuk fungsi yang berbeda.

isolasi gametik E. maka mekanisme isolasi reproduksi ini disebut dengan. karena rendahnya kemungkinan mutasi. Catatan fosil mendukung pendapat bahwa spesies adalah tetap. kecuali terjadi pindah silang.. 10. isolasi perilaku C. Adaptasi evolusioner merupakan hasil dari interaksi antara organisme dengan lingkungannya. B. karena adanya segregasi acak pada waktu meiosis induk. identik. A. Evolusi mengarahkan organisme menjadi lebih kompleks. berbeda. karena ‘gene pool’ yang sifatnya umum dari induk. Adaptasi merupakan hasil dari penggunaan dan penghentian penggunaa struktur anatomi.. isolasi temporal A.8. berbeda. D. Dua spesies yang berbeda tidak dapat melakukan perkawinan karena adanya mekanisme isolasi reproduktif. Manakah berikut ini yang merupakan kesamaan antara teori Darwin dan teori Lamarck mengenai evolusi? A. Jika spesies yang serupa memiliki perbedaan struktural pada organorgan reproduksinya. anak dari kedua pasangan secara genetis kemungkinan. B. identik.. Jika kembar identik albino menikah dengan kembar identik berambut keriting. Adaptasi merupakan hasil dari perbedaan kesuksesan reproduksi.. isolasi sterilisasi B. tidak berubah. E. 14    . D. identik. C.. D. C. karena tingginya kemungkinan terjadinya mutasi acak.. E. isolasi mekanis 9.

dan jumlah energi tetap sama dengan tingkatan lainnya. Manakah berikut ini yang mungkin terjadi di dalam suatu ekosistem? A. liang mereka di dalam tanah berbahaya bagi ternak.. mereka memindahkan ‘rabbit fever’ ke kangguru. di dalam piramida makanan. A. tipe pertumbuhan taiga. Ketika jumlah mangsa menurun.EKOLOGI 1. Perbedaan utamanya adalah. jumlah predator meningkat. Pada khatulistiwa. tidak mungkin. terjadi hanya di musim dingin. E. Hubungan yang digambarkan dalam rantai makanan dapat juga diekspresikan sebagai piramid makanan. lorong-lorong yang . jumlah individu menurun tapi jumlah energinya meningkat. terjadi di dalam. C. jumlah predator meningkat. tidak adanya musuh alami menyebabkan mereka berbiak tak terbatas. mereka mengambil nutrisi yang berharga dari tanah. D. seperti yang terlihat pada gambar.. C. Ketika jumlah mangsa meningkat. 4.. 2. Ketika jumlah predator meningkat. Pernyataan manakah yang paling baik menyimpulkan hubungan tersebut? A. Pada semua tingkat. Kelinci menjadi ancaman di Australia karena.. jumlah predator menurun. terdapat indikasi jumlah relatif individu dan jumlah energi yang terlibat pada setiap tingkat.. jumlah individu meningkat. B. Pada dasar piramid. C. Ketika jumlah predator menurun. Ketika jumlah mangsa meningkat. mereka menyebabkan myxomatosis bagi bayi-bayi yang baru lahir.. E. E. Ketika puncak piramid dicapai. A. 3. D. jumlah mangsa meningkat. Ketika puncak piramid dicapai. Pada dasar piramid. jumlah individu dan jumlah energi yang terlibat adalah paling besar. 15    C. B. B. jumlah mangsa menurun. jumlah individu dan jumlah energi yang terlibat adalah sama. B. D. jumlah individu dan jumlah enrgi yang terlibat adalah paling rendah.

D. mimikri Müllerian E. lebih sedikit menyerap radiasi sinar matahari. eliminasi (penyingkiran) populasi yang kalah bersaing B. lebih stabil.. Keanekaragaman spesies dalam suatu komunitas ditentukan oleh: A... memiliki daun dengan tulang daun bercabang membentuk pola menyerupai jala. Alga hijau 3. kurang stabil. Tumbuhan yang menghasilkan buah. pembagian sumber daya (resource partitioning) melalui seleksi alam C....D. proses koevolusi D. jawaban A dan B benar E. Lumut C. mimikri Batesian C.. Sejenis ulat mempertahankan dirinya dari predator dengan cara membesarkan kepalanya sehingga menyerupai kepala ular yang ganas. dan generasi sporofit masih menumpang pada generasi gametofit.. Alga hijau 2. A. Gymnospermae A. terjadi di gunung-gunung yang E.. Lumut B.. Angiospermae E.. Paku E. frekuensi relatif spesies B. jawaban A dan C benar BIOSISTEMATIK 1. lumut 16    . Angiospermae D. 6. E. kelimpahan relatif spesies C. pertahanan mekanis A... merupakan karakter dari. 5. Kompetisi antara populasi dua spesies dengan relung (niche) yang hampir sama. B.. A dan B benar E. Gymnospermae B. dan memiliki berkas pembuluh pada batang yang tersusun secara melingkar adalah. paku C. Dibandingkan dengan daratan. Paku C. terjadi hanya di gurun. C. tinggi. tanaman jagung B.. A. kekayaan/jumlah spesies D. kamouflase B. pada akhirnya dapat mengakibatkan terjadinya: A. suhu bioma laut. pertahanan aposematik 8. B dan C benar 7. Generasi gametofit lebih dominan dari generasi sporofit. di bawah titik beku. Pertumbuhan biji yang tidak terlindungi oleh ovarium merupakan karakteristik dari. memiliki kondisi ekstrim yang lebih.. Pertahanan seperti ini adalah contoh dari: D. D. A.

Graminae B. Semua cara di atas dapat dilakukan 7. Alpha taxonomy B. Modern taxonomy 17    . Perbungaan tersusun dalam kapitulum yang dilindungi oleh involukrum dan ditemukan dua macam bunga (bunga pita dan bunga tabung) yang berwarna kuning dan ungu. Salah satu aspek taksonomi yang hanya mengamati karakteristik morfologi saja disebut dengan : A. Membandingkan gambar dalam pustaka botani D. C. beberapa jenis tumbuhan ini tergolong dalam satu suku…………………. tanaman kacang E.2 merupakan organisme yang sama Tidak mungkin ada dendogram seperti ini 6. Jika cabang-cabang pada diagram berikut ini menyatakan kesaman karakter tumbuhan. Asteraceae 5. 4 berkerabat paling dekat dibandingkan jenis lainnya Sp. A. Membandingkan dengan tumbuhan di Kebun Raya yang telah diketahui namanya C. pada beberapa jenis memiliki getah berwarna putih. Beta Taxonomy D. Sp.1 dan Sp.1 dan Sp.D. 3 dan Sp. Omega taxonomy C. Menggunakan kunci identifikasi B. seorang mahasiswa menemukan beberapa jenis tumbuhan dengan ciri-ciri sebagai berikut : Bentuk hidup pada umumnya herba atau perdu. E. filotaksis daun ada yang tersebar dan ada pula yang berhadapan dengan tepi daun bergerigi. 5 dan Sp. angka satu meyatakan kesamaan paling tinggi dan angka nol menyatakan tidak ada karakter yang sama. Moraceae C. D. 6 berkerabat paling dekat Sp. Membandingkan dengan spesimen awetan di herbarium E.2 tidak mungkin berkerabat Sp. Euphorbiaceae D. Tumbuhan-tumbuhan tersebut memiliki macam daun tunggal. pinus 4. B. Diagram kekerabatan enam jenis tumbuhan dapat dinyatakan dalam dendogram di bawah ini. maka dendogram berikut menyatakan A. Identifikasi suatu tumbuhan dapat dilakukan dengan cara: A. Berdasarkan ciri-ciri tersebut. Di suatu hutan tropis. Liliaceae E..

Spesies manakah yang kemungkinan lebih banyak berhasil/lulus hidup pada berbagai perubahan lingkungan sepanjang masa dari kedua diagram pohon filogeni di bawah ini? A. Y saja. Cladistic 8. C & G   ***  D. H & I C. X & Y E.E. 18    . A & C B.