SOAL-SOAL BIOLOGI

BIOLOGI SEL DAN MOLEKULER 1. Pada organisme manakah berikut ini respirasi aerob terjadi? I Mammalia II. Tumbuhan tinggi A. hanya I B. hanya II C. hanya I dan III D. hanya II dan III E. I, II dan III

III. Protozoa

2. Struktur lipid mengandung semua hal berikut ini, kecuali…. A. gugus karboksil D. molekul asam lemak B. struktur dasar CH2O E. gugus OH C. molekul gliserol 3. RNA ditemukan pada.... A. nukleus saja B. sitoplasma saja C. nukleus dan sitoplasma D. protein E. asam amino 4. Selama proses respirasi, energi dipindahkan dari molekul glukosa ke molekul.... D. ATP A. ACTH E. BCG B. DNA C. RNA 5. Ribosom terlibat pada semua dari berikut ini kecuali A. Pembentukan ikatan peptida B. Aminoasilasi dari tRNA C. Pengikatan faktor protein selama elongasi D. Pengikatan aminoasil tRNA pada mRNA E. Pengikatan mRNA pada kodon inisiasi 6. Suatu galur E. coli yang tidak memiliki DNA polymerase I akan mengalami defisiensi dalam…..DNA D. degradasi A. perbaikan E. transkripsi B. metilasi C. penggabungan 7. Penyelesaian fase S dari siklus sel suatu sel mammalia ditandai dengan berikut ini kecuali A. Kandungan histon per sel dua kali lipat dibanding ketika sel berada pada G1 B. Pada DNA yang mengalami replikasi, basa-basa nitrogen yang baru terbentuk berpasangan dengan basa-basa parental C. Setiap kromosom yang mengalami replikasi memiliki empat telomer D. Sister chromatids berpisah dari satu sama lain E. Nukleus mengandung jumlah DNA yang ekivalen dengan suatu sel tetraploid yang berada pada G1
1   

20% A. Jumlah basa timin sama dengan jumlah basa pirimidin. kecuali : A. Bentuk-bentuk bakteri adalah sebagai berikut. Cincin kontraktil pada sel-sel hewan yang membelah 10. Mikrovili dari intestinal brush border E. Oomycota C. terminator E. 20% G c. rusaknya rantai tunggal C. 23% T. dimer pirimidin E. 16% C. telomer C. dan 24% G. b. dimer purin A. 30% T. Ascomycota A. 37% T. Struktur terspesialisasi yang berada pada ujung kromosom eukariot disebut D. Eubacteria E. transposisi B. Ujung 3’ adalah gugus fosfat E. kecuali A. Orientasi kedua rantai berlawanan arah (antiparalel) D. Monotrika C. 24% G MIKROBIOLOGI 1. 30% A. Flagella bakteria B. kinetokor B. sentromer A. long terminal repeat (LTR) 11. D. DNA berbentuk heliks ganda dan linier C. Tipe flagella pada bakteri adalah sebagai berikut. Atrika 3. Tidak semua urutan basa dalam DNA adalah gen 12. Ragi Saccharomyces cerevisiae diklasifikasikan dalam : D. Diketahui bahwa salah satu rantai dari DNA terdiri atas 23% A. 16% C. delesi basa 9. Zygomycota 2. Basil E. 37% T. Amphitrika A. Berikut pernyataan yang tidak benar mengenai DNA pada inti sel eukariot adalah…… A. Basidiomycota B. 16% C. Politrika B. 20% C. 23% A. 20% G e. Serat tegang dari fibroblast D. Kokoid B. 24% G a. 30% C. Sarcina D. Spiral 2    . Komposisi basa dalam rantai DNA tersebut d. Filamen aktin dijumpai pada berikut ini. Sarkomer sel-sel otot rangka C. Kerusakan umum yang dijumpai pada DNA setelah pendedahan terhadap sinar ultraviolet adalah…. Lofotrika E. kecuali : D. tidak dapat ditentukan. 30% T. 37% A.8. B. Pseudo C.

Suatu pedoman yang dipakai untuk mengungkapkan suatu agen penyebab penyakit 8. Penyebab fenomena ini adalah D. Mikroorganisme tertentu selalu penyebab penyakit tertentu B. setelah 2 jam bila 0. Diatoms A. Postulat Koch adalah : A. Rusaknya membran plasma A.4. Dinding sel suatu bakteri gram negatif D. Memanaskan tanah untuk membunuh semua sel vegetatif dan kemudian memungkinkan semua spora dari organisme ini untuk “berkecambah” dan tumbuh D. Dinding sel suatu bakteri gram positif B. Absorbsi air E. Anda mengambil suatu kultur mikroba dan memfraksinasinya menjadi beberapa komponen.. Perubahan pada ekspresi gen B. Inkubasi bakteri gram negatif dengan lisozim pada medium isotonik menyebabkan bakteri berbentuk batang menjadi berbentuk bulat (spherical) . dan asam teichoat maupun asam lipoteichoat. D. 6 7. Suatu prosedur laboratorium yang memungkinkan diperolehnya kembali mikroorganisme penyebab penyakit D. 2 E.25% sel awal mati? 5. Suatu cara yang mudah untuk mengisolasi spesies Bacillus dan Clostridium secara spesifik dari tanah adalah dengan: A. Protozoa B. yang tidak dapat menghasilkan ATP sendiri adalah . Komponen ini merupakan : A. Glikogen C. D. Destruksi sitoskeleton 10. setelah 1 jam? b. Dinding sel suatu ragi 6. 8 A. 4 C. Bakteri C. Menumbuhkannya pada suhu sangat rendah E. Berapa banyaknya sel yang ada pada 1 liter kultur ini: a. jumlah bakteri individual yang ada pada mulanya adalah. Menumbuhkannya secara aerobik pada medium yang mengandung glukosa B. Menumbuhkannya pada suhu tinggi C. Destruksi dinding sel C. acetylglucosamin. Delapan koloni bakteri tampak pada plat agar setelah 24 jam.. Metoda yang ditemukan oleh Koch untuk memurnikan mikroba C. Virus 9. Suatu kultur bakteri diawali dengan 4 sel bakteri per ml pada medium pengaya dengan fase lag 1 jam dan waktu generasi 20 menit. setelah 2 jam? c. 8 juta B.. Dari kelompok organisme di bawah ini. Menumbuhkannya secara anaerobik pada medium yang mengandung glukosa 3    . Membran sitoplasma E. berbagai L dan D asam amino. Salah satu komponen mengandung molekul berikut ini: asam acetylmuramat. Lichenes E.

Bakteri penyebab tetanus hanya dapat dibunuh dengan pemanasan yang lama di atas titik didih. jantung saja C. mengatur transkripsi dengan mengaktifkan atau menginaktifkan produksi dari protein represor E. mengkode urutan asam amino pada laktase C. mengatur translasi dari mRNA D. memiliki dinding sel yang mengandung peptidoglikan B. Transkripsi gen X dikendalikan oleh transkripsi faktor A.. otot saja E.. material dari sel manusia di masukan ke dalam bakteri. otot. Dalam usaha untuk mengklon protein manusia.. intron yang dilepaskan dari protein mRNA yang di transkripsi dan belum diproses 4    . Dari tiga jaringan ini. entropi reaksi E. konstanta kesetimbangan C. Material yang berasal dari sel manusia tersebut adalah... rRNA dan tRNA yang dipergunakan selama proses translasi C. Suatu enzim yang mengkatalisis reaksi A A. melindungi diri sendiri dengan menyekresikan antibiotik C. panas reaksi B. 1 1. menghasilkan endospora 12. dan otak B. A.. Gen X ditranskripsi hanya ketika faktor A difosforilasi. A.. mengatur replikasi DNA dengan mengaktifkan atau menginaktifkan protein induser 3. autotrof E.11. Hal ini mengindikasikan bahwa bakteri tetanus…. protein yang mentraskripsi mRNA di inti D. kesetimbangan konsentrasi A D. protein mRNA yang ditemukan di sitoplasma E.. mensekresikan endotoksin D. Lac operon.. Data pada distribusi jaringan dari faktor A dan aktivitas dari suatu protein kinase dan protein fosfatase spesifik untuk faktor A ditunjukkan pada tabel di atas. gen X akan ditranskripsi pada D. A. Segmen DNA yang mengkode mRNA yang di transkripsi B. otak saja 2. otak dan jantung saja A. laju dari kedua reaksi maju dan balik B merubah… BIOTEKNOLOGI Gunakanlah tabel berikut untuk menjawab pertanyaan no. ditemukan di sel eukariot B. jantung.

Polymerase chain reaction (PCR) D. Pada temperatur di bawah titik leleh untai DNA komplementer.. adalah suatu teknologi yang menggabungkan gen dari sumber yang berbeda kemudian mentransfernya ke sel dimana gen tersebut akan diekspresikan. Eastern blotting C. Southern blotting 9.. Manakah hasil pemotongan yang tepat dari enzim tersebut? 5. Urutan basa yang sangat kompleks yang menjadi sederhana ketika suhu dinaikkan E.. Northern blotting A. 6. Mampu menyerap sinar UV lebih banyak dibandingkan dengan temperatur di atas titik lelehnya.4. Eastern blotting B. Metode yang digunakan untuk mendeteksi DNA adalah … D. 2) …………. Western blotting E. Eastern blotting B. Rantai tunggal oleh denaturasi pada suhu yang lebih rendah B. Northern blotting B. ……… …….. Metode yang digunakan untuk mendeteksi suatu protein adalah … D.. Polymerase chain reaction (PCR) E. Di alam. Polymerase chain reaction (PCR) E. Perhatikan diagram dibawah ini! Tanda panah pada diagram menunjukkan tempat pemotongan dari enzim Tag I. dan 3) ………. Western blotting C.…. Kinetik hibridisasi double helix DNA sangat berhubungan dengan urutan basa nitrogen pada helix tersebut. maka kebanyakan DNA … A. Western blotting C. Northern blotting A. Southern blotting 5    . Metode yang digunakan untuk mendeteksi RNA adalah … A. gen bakteri dapat ditransfer dari satu sel ke sel lainnya melalui 3 proses yaitu 1) ……………. 7. Hibridisasi untuk membentuk untai yang lebih panjang dan stabil D. Rantai ganda akibat kuatnya ikatan hydrogen C. Southern blotting 8.

1 E. 3 B. ERA I B... MEM II D. CRO I C. Urutan DNA manusia: ATATCGTAATGTTGGTG. CRO I. Ket: Urutan DNA yang digarisbawahi menunjukkan gen yang akan diklon Urutan enzim restriksi ERA I: GTAAATG CRO I: CAGGAC MEM II: GCCG 10. Enzim manakah yang seharusnya digunakan untuk memasukkan urutan DNA manusia ke dalam plasmid bakteri? A. CRO I dan ERA I E.. Mengapa enzim restriksi yang terdapat pada suatu sel tidak merusak DNA sel tersebut meskipun sel tersebut memiliki urutan yang mampu dikenali oleh enzim restriksinya? ……………………………………………………………………………………………… ……………………………………………………………………………………………… 6    . dan MEM II 12. Berapa banyak sisi restriksi yang terdapat pada urutan plasmid bakteri? A. Lebih dari 3 C. Plasmid bakteri dengan urutan: ATCCCA… 1000 nukleotida… …ATTAAGGCCTTACAGGACCCCGGAATGAGAGTA ATGGGCTATTCAGGTA … 200 nukleotida lagi.10-11 tentang rekayasa genetik. . Tidak ada D..500 nukloetida.Gunakan petunjuk berikut ini untuk menjawab pertanyaan No.GTGTCAGGACGGGTGAAAGCCAGGACGCCGAATCG… 5000 nukleotida lagi. ERA I. 2 11.

. selama tiga hari terakhir... C. E. C. selama tiga hari pertama. pada hari ke delapan. peningkatan suhu dan pergerakan udara. D. pada hari ke tiga.. ikatan pembuluh B. ujung akar tersebut akan memanjang dan menghasilkan akar sekunder. C.. D. laju pertumbuhan setelah hari ke delapan memiliki laju yang sama dengan hari sebelumnya. 5. D. pada akhir hari ke sepuluh.ANATOMI DAN FISIOLOGI TUMBUHAN 1. suhunya dipertahankan 37°C secara konstan. peningkatan kelembaban dan suhu. E. Peningkatan terkecil pada pertumbuhan dicapai. meristem D. pada akhir hari ke tiga. A. peningkatan suhu saja. Hasilnya dipetakan pada grafik berikut.. A. selama tiga hari pertengahan. A. lentisel C. B. B. Grafik akan menunjukkan garis lurus jika. larutan nutrien kemudian ditambah dengan hormon pertumbuhan akar. pada akhir hari pertama. Seorang peneliti melakukan pengukuran harian terhadap akar tomat pada suhu 33°C-35°C dengan cara ini. A. Suatu teknik yang telah disempurnakan digunakan untuk memotong ujung akar dan menempatkannya pada larutan nutrien steril.. Laju transpirasi suatu pohon kemungkinan akan meningkat seiring dengan. B.. pada waktu yang tidak ditunjukkan B. D.. E. peningkatan kelembaban dan pergerakan udara. pada akhir hari ke delapan.. A. kambium 7    . Dalam kondisi suhu yang diatur... 4... 3. Ujung akar tidak menunjukkan adanya pertumbuhan. Struktur yang menghantarkan materi ke seluruh tubuh tanaman disebut. 2. oleh grafik. C. pertumbuhan pada dua hari pertama identik.. ujung akar memanjang dengan laju yang sama setiap hari. E. peningkatan kelembaban dan penurunan suhu.

berdifusi dari darah ibu ke darah embrio di dalam plasenta. hanya ketika fotosintesis tidak sedang berjalan. pindah ke embrio karena darah ibu bercampur dengan darah embrio di dalam plasenta.... epidermis D. C. memasuki uterus melalui perut ibu. Tumbuhnya daun menuju cahaya dihasilkan dari. 2. A.. Produksi estrogen merangsang pembuntukan gamet untuk reproduksi seksual. A. A. D. hanya ketika fotosintesis sedang berjalan..E. Sel-sel pembuat makanan pada tumbuhan terletak di. C. karbon dioksida C. Hipotalamus mengurangi masukan TSH ke pituitary.. E.. sel penjaga C. stomata B. 8    . epidermis 6. xilem D.. A. C. B.. konsentrasi auksin yang sama pada seluruh sisi batang. Kadar oksigen di dalam darah berhubungan dengan detak jantung. floem E. D.. konsentrasi auksin yang lebih besar pada bagian yang terkena cahaya.. B. mempengaruhi ovulasi.. karbon dioksida dan air E.. jaringan spons B. ANATOMI DAN FISIOLOGI HEWAN 1. hanya pada malam hari. oksigen dan air 10. kayu 7. rambut akar E. pembuluh C. fototropisme negatif. embrionya berada dalam resiko karena racun-racun tersebut dapat. hanya pada siang hari.. tumbuhan hijau menyerap. A. 9.. Kambium terletak di dekat. D. siang dan malam. D. A. Ketika wanita hamil mengkonsumsi alkohol dan nikotin. Jumlah karbon dioksida di dalam daran meningkat dengan olah raga. konsentrasi auksin yang lebih besar pada bagian yang terlindungi. Selama respirasi. geotropisme positif.. B. oksigen D. B. xilem dan floem 8. E.. Produksi urin memungkinkan untuk ekskresi buangan sel. air B. Pernyataan manakah yang menggambarkan mekanisme umpan balik yang melibatkan kelenjar tiroid? A. Tumbuhan hijau melakukan respirasi. E. C..

Sekret yang mencerna karbohidrat dan protein adalah. medulla E. D. D. kecuali. diafragma 10... Penyakit darah Rh dapat terjadi apabila ibu dengan Rh negatif.. 9    .. memakan terlalu banyak makanan berkalori tinggi D. Kondisi kelebihan berat badan dapat disebabkan oleh faktor-faktor berikut.. ligamen A. mengatur komposisi kimia darah. C. B. D... tidak olah raga C.. getah lambung A. kekurangan besi dalam diet E. mengumpulkan urin setelah mengalir melalui uretra. kantung udara D. memecah sel darah merah untuk membentuk buangan nitrogen. C. D... gangguan kelenjar tiroid 4. C. ptialin E. bronki C... gagal membentuk antibodi. 8. pepsin 9. Pada hari yang lembab. terdapat lebih sedikit evaporasi keringat. memiliki bayi Rh positif B. B.E.. memiliki bayi Rh negatif.. harus mengganti darahnya. permukaan kulit terlalu kering. Formasi blastula – formasi gastrula – formasi mesoderm – pembelahan – formasi otot. tendon C. menyerap makanan yang dicerna dari dalam usus halus. A. A. D. kulit mengekskresikan garam dalam jumlah yang lebih besar. B.. getah pankreas B. Pembelahan – formasi blastula – formasi mesoderm – formasi gastrula – formasi otot. Pembelahan – formasi blastula – formasi gastrula – formasi mesoderm – formasi otot. 3. berdifusi ke dalam air susu ibu yang akan diminum oleh bayi.. 5.. A. C.. tulang lengan atas manusia. Manakah berikut ini yang mewakili urutan normal tahap-tahap perkembangan embrio? A. paru-paru B. ekstensor 7. Pembelahan – formasi blastula – formasi otot – formasi gastrula – formasi mesoderm. E. 6. Humerus. jaringan rawan E. A. keringat mengevaporasi dengan cepat. Formasi gastrula – formasi blastula – formasi mesoderm – pembelahan – formasi otot. orang merasa tidak nyaman karena. dihubungkan secara langsung dengan tulang lengan lainnya oleh. makan berlebih B. A. mengalami eritroblastosis. jaringan adiposa B. ia lebih banyak berkeringat. Fungsi utama nefron adalah untuk. E. D. E. saliva C. Laju pernapasan dikendalikan oleh. E. membentuk urea dari produk-produk buangan hasil metabolisme protein...

.GENETIKA Soal 1-2. Dua ekor ayam disilangkan dan diperoleh keturunan sebagai berikut: 10 walnut dan 3 rose. Apabila pasangan keluarga tersebut berharap memiliki 3 anak lelaki.7% B. A. Tentukan jenis penyimpangan hukum mendel pada persilangan diatas... IB..56% 10    . IA... karena pada saat itu jumlah kromosom hasil pembelahan adalah setengah dari jumlah kromosom sel induk. Apabila seseorang memiliki alel IAIB di dalam tubuhnya maka orang tersebut memiliki golongan darah AB.. 4... Sifat ini diatur oleh tiga gen (ABC) yang apabila berada pada keadaan homozigot dominan untuk ketiga gen akan menghasilkan warna jingga. 4.. 1.1. Inkomplit dominan B. D.. Tentukan genotip dari induk yang berwarna jingga. Warna pada kembang sepatu merupakan sifat yang diturunkan secara poligeni.. Namun apa bila kedua sifat terletak pada kromosom yang sama maka hasil persilangan F1-nya adalah. 75 bunga jingga 27 bunga merah 23 bunga kuning 8 bunga hijau 1. Hasil persilangan F1 pada persilangan dihibrid yang dilakukan Mendel menghasilkan perbandingan 9. Kriptomeri A.. B-S.. RrPP dan RRPp C. rrPp dan RRPp B. Berdasarkan keterangan diatas. Epistasis C. Interaksi alel 6. RrPp dan rrPP 7.. IO.3. D. maka peluang keluarga tersebut memiliki dua anak laki-laki normal dan satu buta warna adalah. 2. RrPP dan rrpp E. Kodominan E. 9:7 B. Bunga jingga disilangkan dengan bunga hijau menghasilkan jumlah keturunan sebagai berikut. Sifat alel IAIB dalam pembentukan golongan darah AB disebut. Proses pengubahan dari diploid menjadi haploid terjadi setelah meosis 2. 1:1 C.. 9:3:4 5. Seorang ibu carrier terhadap sifat buta warna menikah dengan laki-laki normal. 12:3:1 A. A. tetap 9:3:3:1 E. rrPP dan rrPp D. Pada golongan darah terdapat tiga jenis alel. 3.3. dan jika berada dalam keadaan homozigot resesif untuk ketiga gen maka warna bunga menjadi putih. Gen A merupakan gen yang mengkode bahan baku untuk pigmen yang bisa diubah menjadi berbagai warna. maka genotip dari kedua induk adalah. Hal ini terjadi karena semua sifat terletak pada kromosom yang berbeda.

7 fenotip B. 4 fenotip C. Kedua gen bersifat kodominan.4 D. Populasi dengan alel T dan t yang seimbang memiliki 36% individu dalam populasi dengan fenotip resesif. 182 ekor pendek mata merah. Seekor lalat yang heterozigot terhadap kedua sifat disilangkan dengan lalat yang homozigot resesif untuk kedua sifat.5% E.6 11. Berdasarkan keterangan tersebut tentukanlah jumlah fenotip dari hasil persilangan kedua labu tersebut! D. 0. Tentukanlah frekuensi alel IA pada populasi tersebut.4.C. Berdasarkan informasi diatas maka pernyataan berikut yang benar adalah. kondisi lingkungan kembali normal. E. 9 fenotip A. Gen yang mengatur panjang sayap dan warna mata terletak pada kromosom yang terpisah C. Gen yang mengatur warna mata terpaut kromosom seks sedangkan gen yang mengatur panjang sayap terletak pada autosom D.7 E. 0. 5 fenotip 9. Berapa frekuensi alel T setelah satu generasi? A. Labu dengan genotip AABbcc memiliki berat buah 27 gr sedangkan labu dengan genotip AaBBCc memiliki berat buah 30 gr. 10. B. 6. Gen yang mengatur panjang sayap dan dan warna mata terletak pada kromosom yang sama B.25% D. 12.7. 0. E.58. C. 0.2 C. Tiba-tiba kondisi lingkungan berubah dan menyebabkan kematian dari semua individu yang homozigot dominan sebelum mencapai usia dewasa. 33 ekor sayap pendek mata coklat.75% 8.. Hasil persilangannya adalah sebagai berikut: 180 ekor sayap panjang mata coklat.. 0. 35 ekor sayap panjang ekor sayap panjang mata merah. 0. 11    . Setelah kejadian tersebut. 0. Pada suatu populasi yang terdiri atas 1000 penduduk diketahui bahwa jumlah orang yang bergolongan darah O adalah adalah 16% dari jumlah penduduk dan jumlah penduduk yang bergolongan darah AB dan B masing-masing adalah 100 dan 90 orang.26. A. 0. Berat buah labu ditentukan oleh beberapa gen yang dikenal dengan istilah poligeni. A. tidak dapat ditentukan D.. 18. 6 fenotip E. Pada lalat buah diketahui bahwa sayap panjang (V) dominan terhadap sayap pendek (v) dan mata merah (M) dominan terhadap mata coklat (m).5 B. 0. Kedua gen terpaut dan pada saat pembentukan gamet terjadi peristiwa pindah silang.

menikah dengan laki-laki dengan golongan darah AB Rh+. apakah genotip dari orang tua yang menghasilkan 300 keturunan dengan sifat dominan dan 100 keturunan dengan sifat resesif? D. Apabila ia menghasilkan sperma. membesar. 25% C.5% C. Perubahan tersebut diturunkan pada generasi berikutnya. D. AA x Aa C.5% D. 4 E. 0% E.. Seorang wanita bergolongan darah O Rh. Aa x aa A. 75% A. 100% B. Jika seorang wanita yang ayahnya haemofilia menikah dengan laki-laki normal. Aa x Aa B. Berapakan kemungkinan pasangan tersebut memiliki anak laki-laki yang menderita haemofilia? D. 50% 15. Radiasi adaptif D. 8 C. 2 B. Jika anak kedua adalah Rh+ dan bergolongan darah A maka kemungkinan anak ketiga lahir normal adalah 12. Evolusi konvergen E. AA x AA E. Peluang untuk memperoleh anak kedua perempuan dengan golongan darah A dan Rh+ adalah 0% B. tidak dapat ditentukan A.. Probabilitas anak kedua bergolongan darah A dan AB adalah sama E. 16 14. Kesetimbangan Hardy-Weinberg B.. Mendel 2. Apabila anak pertama mereka adalah laki-laki A Rh.” Pendapat tersebut adalah pendapat…. Haemofilia merupakan penyakit menurun yang terpaut seks dan bersifat resesif.12. Wallace A. Spesiasi simpatrik C. Lamarck C. Seorang laki dengan genotip AaBaCCDd (A dengan D terpaut)..maka pernyataan berikut yang tepat adalah. Oparin B. Peluang memperoleh anak kedua perempuan. Darwin E. bergolongan darah B dan Rh+ adalah 12... Pada fenomena manakah berikut ini pengamatan Darwin tentang burung finch di kepulauan Galapagos menjadi contoh klasik? A. AA x aa EVOLUSI 1.. “Suatu struktur diperoleh.. D. A. tereduksi atau hilang melalui penggunaan dan penghentian penggunaan. Ketidakmampuan untuk terbang 12    . Probabilitas anak bergolongan darah O sama dengan Probabilitas anak A dan B 13. maka jumlah gamet yang dapat dibentuknya adalah. Jika A menunjukan alel dominan dan a adalah alel resesif.

III dan VI E.. asal evolusi yang sama. E. tinggi tinggi tinggi 4. asal evolusi yang berbeda. struktur yang memiliki karakter anatomi dasar yang berbeda.. 13    . tidak ada tinggi tinggi C.3. III dan V 7. struktur yang memiliki karakter anatomi dasar yang sama. Seleksi mengarahkan (’directional selection’) ditunjukkan oleh. IV. Seleksi alam bekerja pada individu. C. 5... 5 dan 6. asal evolusi yang berbeda. E. B. Materi genetik dari individu adalah genotip. II dan V 6.. II. Gunakanlah pilihan berikut ini untuk menjawab pertanyaan no. B.. III saja C. II.. V dan VI E. Leher jerapah. Seleksi stabilisasi (’stabilizing selection’) ditunjukkan oleh. Populasi Biston betularia pada waktu revolusi industri. sedangkan yang besar mudah dimangsa burung hantu. tapi dapat digunakan untuk fungsi yang sama. Berikut ini pernyataan yang salah adalah.. VI. A. III. Pada situasi manakah berikut ini evolusi berjalan paling lambat untuk suatu populasi ‘inter-breeding’? migrasi tekanan seleksi variasi karena mutasi A. D. Populasi burung Finch di Galapagos. IV dan V B. Seleksi alam menyebabkan perubahan genetik pada individual. tinggi rendah tinggi D. II dan III C. I. Berat bayi manusia pada waktu lahir. II. III. A. C. tapi dapat digunakan untuk fungsi yang berbeda. V. Evolusi adalah perubahan pada frekuensi alel dari suatu populasi. D... Seleksi alam mengarahkan populasi menjadi lebih sesuai terhadap lingkungannya. IV saja B... tidak ada rendah rendah B. tapi dapat digunakan untuk fungsi yang sama. II dan IV D. Yang dimaksud dengan struktur analog adalah. tinggi tinggi rendah E. I. struktur yang memiliki karakter anatomi dasar yang sama. I. sedangkan materi genetik dari populasi adalah ‘gene pool’. tapi dapat digunakan untuk fungsi yang berbeda. Resistensi DDT pada serangga. Kadal Aristelliger kecil bermasalah dalam mempertahankan teritorinya. V dan VI A. asal evolusi yang sama. tapi dapat digunakan untuk fungsi yang sama. asal evolusi yang berbeda. struktur yang memiliki karakter anatomi dasar yang sama. struktur yang memiliki karakter anatomi dasar yang sama. D. A.

8. Manakah berikut ini yang merupakan kesamaan antara teori Darwin dan teori Lamarck mengenai evolusi? A. berbeda. tidak berubah.. E. Jika kembar identik albino menikah dengan kembar identik berambut keriting. B. anak dari kedua pasangan secara genetis kemungkinan. kecuali terjadi pindah silang. Adaptasi evolusioner merupakan hasil dari interaksi antara organisme dengan lingkungannya.. 14    . D. isolasi sterilisasi B. maka mekanisme isolasi reproduksi ini disebut dengan. D. B. Adaptasi merupakan hasil dari perbedaan kesuksesan reproduksi.. 10... C. Dua spesies yang berbeda tidak dapat melakukan perkawinan karena adanya mekanisme isolasi reproduktif. karena rendahnya kemungkinan mutasi. isolasi mekanis 9. E. identik. isolasi gametik E. Adaptasi merupakan hasil dari penggunaan dan penghentian penggunaa struktur anatomi. karena adanya segregasi acak pada waktu meiosis induk. karena tingginya kemungkinan terjadinya mutasi acak. isolasi perilaku C. Jika spesies yang serupa memiliki perbedaan struktural pada organorgan reproduksinya. Catatan fosil mendukung pendapat bahwa spesies adalah tetap. isolasi temporal A. berbeda. A. D. C. identik. Evolusi mengarahkan organisme menjadi lebih kompleks.. karena ‘gene pool’ yang sifatnya umum dari induk. identik.

mereka memindahkan ‘rabbit fever’ ke kangguru. Hubungan yang digambarkan dalam rantai makanan dapat juga diekspresikan sebagai piramid makanan. E. E. A. Pada khatulistiwa. jumlah individu dan jumlah enrgi yang terlibat adalah paling rendah. dan jumlah energi tetap sama dengan tingkatan lainnya. Ketika jumlah predator meningkat. jumlah mangsa meningkat. lorong-lorong yang . D. C. Pada dasar piramid. D. 4. C.. Kelinci menjadi ancaman di Australia karena. 2.. tidak adanya musuh alami menyebabkan mereka berbiak tak terbatas. Pernyataan manakah yang paling baik menyimpulkan hubungan tersebut? A.EKOLOGI 1. Ketika puncak piramid dicapai. jumlah predator meningkat. jumlah individu dan jumlah energi yang terlibat adalah paling besar. liang mereka di dalam tanah berbahaya bagi ternak. Ketika jumlah mangsa meningkat. Ketika jumlah mangsa meningkat.. A. Ketika jumlah predator menurun. 3. jumlah individu meningkat. jumlah predator meningkat.. E. B. terdapat indikasi jumlah relatif individu dan jumlah energi yang terlibat pada setiap tingkat. 15    C. Pada dasar piramid. jumlah individu menurun tapi jumlah energinya meningkat. jumlah mangsa menurun. D. tidak mungkin. B.. Manakah berikut ini yang mungkin terjadi di dalam suatu ekosistem? A. Perbedaan utamanya adalah. di dalam piramida makanan. B. mereka mengambil nutrisi yang berharga dari tanah. jumlah individu dan jumlah energi yang terlibat adalah sama. seperti yang terlihat pada gambar. Ketika jumlah mangsa menurun. mereka menyebabkan myxomatosis bagi bayi-bayi yang baru lahir. jumlah predator menurun. terjadi hanya di musim dingin. Ketika puncak piramid dicapai. tipe pertumbuhan taiga.. B. Pada semua tingkat. terjadi di dalam. C.

tanaman jagung B. mimikri Batesian C. pada akhirnya dapat mengakibatkan terjadinya: A. A dan B benar E. mimikri Müllerian E. A. Tumbuhan yang menghasilkan buah. C. lumut 16    . frekuensi relatif spesies B. Sejenis ulat mempertahankan dirinya dari predator dengan cara membesarkan kepalanya sehingga menyerupai kepala ular yang ganas.. A. di bawah titik beku. Kompetisi antara populasi dua spesies dengan relung (niche) yang hampir sama.. Paku C. kelimpahan relatif spesies C. lebih sedikit menyerap radiasi sinar matahari. Lumut C. kurang stabil. Angiospermae D.... tinggi. 6. eliminasi (penyingkiran) populasi yang kalah bersaing B.D. B. Keanekaragaman spesies dalam suatu komunitas ditentukan oleh: A. Lumut B. lebih stabil. proses koevolusi D. D. jawaban A dan C benar BIOSISTEMATIK 1. paku C.. jawaban A dan B benar E.. Gymnospermae A.... pertahanan aposematik 8. Dibandingkan dengan daratan. D. Gymnospermae B. B dan C benar 7. Angiospermae E.. 5. dan memiliki berkas pembuluh pada batang yang tersusun secara melingkar adalah. suhu bioma laut. A. kekayaan/jumlah spesies D. Alga hijau 3. kamouflase B. Pertahanan seperti ini adalah contoh dari: D. dan generasi sporofit masih menumpang pada generasi gametofit.. merupakan karakter dari. Alga hijau 2. terjadi di gunung-gunung yang E. memiliki kondisi ekstrim yang lebih.. terjadi hanya di gurun. Pertumbuhan biji yang tidak terlindungi oleh ovarium merupakan karakteristik dari. pertahanan mekanis A. Paku E. pembagian sumber daya (resource partitioning) melalui seleksi alam C. memiliki daun dengan tulang daun bercabang membentuk pola menyerupai jala. Generasi gametofit lebih dominan dari generasi sporofit... E..

Liliaceae E. 5 dan Sp. Membandingkan gambar dalam pustaka botani D. D. seorang mahasiswa menemukan beberapa jenis tumbuhan dengan ciri-ciri sebagai berikut : Bentuk hidup pada umumnya herba atau perdu.2 tidak mungkin berkerabat Sp. Salah satu aspek taksonomi yang hanya mengamati karakteristik morfologi saja disebut dengan : A.1 dan Sp. C. 4 berkerabat paling dekat dibandingkan jenis lainnya Sp.2 merupakan organisme yang sama Tidak mungkin ada dendogram seperti ini 6. Membandingkan dengan tumbuhan di Kebun Raya yang telah diketahui namanya C. pinus 4. 3 dan Sp. 6 berkerabat paling dekat Sp. pada beberapa jenis memiliki getah berwarna putih. Menggunakan kunci identifikasi B. Asteraceae 5. angka satu meyatakan kesamaan paling tinggi dan angka nol menyatakan tidak ada karakter yang sama. Euphorbiaceae D.D. Modern taxonomy 17    . Perbungaan tersusun dalam kapitulum yang dilindungi oleh involukrum dan ditemukan dua macam bunga (bunga pita dan bunga tabung) yang berwarna kuning dan ungu. Semua cara di atas dapat dilakukan 7. Omega taxonomy C. Alpha taxonomy B. Membandingkan dengan spesimen awetan di herbarium E.1 dan Sp. filotaksis daun ada yang tersebar dan ada pula yang berhadapan dengan tepi daun bergerigi. Berdasarkan ciri-ciri tersebut. B. Beta Taxonomy D. Di suatu hutan tropis. tanaman kacang E. Tumbuhan-tumbuhan tersebut memiliki macam daun tunggal. Diagram kekerabatan enam jenis tumbuhan dapat dinyatakan dalam dendogram di bawah ini. Jika cabang-cabang pada diagram berikut ini menyatakan kesaman karakter tumbuhan. Identifikasi suatu tumbuhan dapat dilakukan dengan cara: A. Moraceae C. A. maka dendogram berikut menyatakan A. Graminae B.. Sp. beberapa jenis tumbuhan ini tergolong dalam satu suku…………………. E.

Y saja. H & I C.E. A & C B. Spesies manakah yang kemungkinan lebih banyak berhasil/lulus hidup pada berbagai perubahan lingkungan sepanjang masa dari kedua diagram pohon filogeni di bawah ini? A. X & Y E. 18    . C & G   ***  D. Cladistic 8.

Sign up to vote on this title
UsefulNot useful