SOAL-SOAL BIOLOGI

BIOLOGI SEL DAN MOLEKULER 1. Pada organisme manakah berikut ini respirasi aerob terjadi? I Mammalia II. Tumbuhan tinggi A. hanya I B. hanya II C. hanya I dan III D. hanya II dan III E. I, II dan III

III. Protozoa

2. Struktur lipid mengandung semua hal berikut ini, kecuali…. A. gugus karboksil D. molekul asam lemak B. struktur dasar CH2O E. gugus OH C. molekul gliserol 3. RNA ditemukan pada.... A. nukleus saja B. sitoplasma saja C. nukleus dan sitoplasma D. protein E. asam amino 4. Selama proses respirasi, energi dipindahkan dari molekul glukosa ke molekul.... D. ATP A. ACTH E. BCG B. DNA C. RNA 5. Ribosom terlibat pada semua dari berikut ini kecuali A. Pembentukan ikatan peptida B. Aminoasilasi dari tRNA C. Pengikatan faktor protein selama elongasi D. Pengikatan aminoasil tRNA pada mRNA E. Pengikatan mRNA pada kodon inisiasi 6. Suatu galur E. coli yang tidak memiliki DNA polymerase I akan mengalami defisiensi dalam…..DNA D. degradasi A. perbaikan E. transkripsi B. metilasi C. penggabungan 7. Penyelesaian fase S dari siklus sel suatu sel mammalia ditandai dengan berikut ini kecuali A. Kandungan histon per sel dua kali lipat dibanding ketika sel berada pada G1 B. Pada DNA yang mengalami replikasi, basa-basa nitrogen yang baru terbentuk berpasangan dengan basa-basa parental C. Setiap kromosom yang mengalami replikasi memiliki empat telomer D. Sister chromatids berpisah dari satu sama lain E. Nukleus mengandung jumlah DNA yang ekivalen dengan suatu sel tetraploid yang berada pada G1
1   

kecuali A. Lofotrika E. 16% C. rusaknya rantai tunggal C. Atrika 3. Eubacteria E. Orientasi kedua rantai berlawanan arah (antiparalel) D. 37% A. Basidiomycota B. Komposisi basa dalam rantai DNA tersebut d. 20% G c. Kerusakan umum yang dijumpai pada DNA setelah pendedahan terhadap sinar ultraviolet adalah…. Ragi Saccharomyces cerevisiae diklasifikasikan dalam : D.8. Berikut pernyataan yang tidak benar mengenai DNA pada inti sel eukariot adalah…… A. 23% A. dan 24% G. Zygomycota 2. 20% A. Filamen aktin dijumpai pada berikut ini. DNA berbentuk heliks ganda dan linier C. 30% C. long terminal repeat (LTR) 11. Struktur terspesialisasi yang berada pada ujung kromosom eukariot disebut D. Tidak semua urutan basa dalam DNA adalah gen 12. b. 30% T. Ascomycota A. Pseudo C. 24% G a. 20% G e. Jumlah basa timin sama dengan jumlah basa pirimidin. Flagella bakteria B. telomer C. kinetokor B. 24% G MIKROBIOLOGI 1. 30% T. Sarcina D. 23% T. 37% T. D. delesi basa 9. Spiral 2    . 30% A. Sarkomer sel-sel otot rangka C. Kokoid B. kecuali : A. 16% C. dimer pirimidin E. terminator E. kecuali : D. 20% C. Cincin kontraktil pada sel-sel hewan yang membelah 10. Monotrika C. Diketahui bahwa salah satu rantai dari DNA terdiri atas 23% A. Mikrovili dari intestinal brush border E. sentromer A. tidak dapat ditentukan. Ujung 3’ adalah gugus fosfat E. dimer purin A. B. Amphitrika A. 16% C. Oomycota C. Bentuk-bentuk bakteri adalah sebagai berikut. 37% T. Serat tegang dari fibroblast D. Politrika B. transposisi B. Basil E. Tipe flagella pada bakteri adalah sebagai berikut.

Diatoms A. Menumbuhkannya pada suhu sangat rendah E. dan asam teichoat maupun asam lipoteichoat. Bakteri C. Dinding sel suatu ragi 6. Destruksi sitoskeleton 10.. Dinding sel suatu bakteri gram negatif D. Absorbsi air E. Menumbuhkannya secara aerobik pada medium yang mengandung glukosa B. setelah 2 jam bila 0. Suatu pedoman yang dipakai untuk mengungkapkan suatu agen penyebab penyakit 8. Dari kelompok organisme di bawah ini. acetylglucosamin. D. Protozoa B. yang tidak dapat menghasilkan ATP sendiri adalah . Penyebab fenomena ini adalah D.4.. setelah 2 jam? c. Glikogen C. 8 juta B. Mikroorganisme tertentu selalu penyebab penyakit tertentu B.25% sel awal mati? 5. Lichenes E. Delapan koloni bakteri tampak pada plat agar setelah 24 jam. Rusaknya membran plasma A. Komponen ini merupakan : A. 4 C. Anda mengambil suatu kultur mikroba dan memfraksinasinya menjadi beberapa komponen. jumlah bakteri individual yang ada pada mulanya adalah. Menumbuhkannya secara anaerobik pada medium yang mengandung glukosa 3    . berbagai L dan D asam amino. Postulat Koch adalah : A. 6 7. Perubahan pada ekspresi gen B. Metoda yang ditemukan oleh Koch untuk memurnikan mikroba C. 2 E. Suatu prosedur laboratorium yang memungkinkan diperolehnya kembali mikroorganisme penyebab penyakit D. Virus 9. Menumbuhkannya pada suhu tinggi C. Inkubasi bakteri gram negatif dengan lisozim pada medium isotonik menyebabkan bakteri berbentuk batang menjadi berbentuk bulat (spherical) . Dinding sel suatu bakteri gram positif B. Suatu kultur bakteri diawali dengan 4 sel bakteri per ml pada medium pengaya dengan fase lag 1 jam dan waktu generasi 20 menit.. Salah satu komponen mengandung molekul berikut ini: asam acetylmuramat. 8 A. D. Berapa banyaknya sel yang ada pada 1 liter kultur ini: a. Suatu cara yang mudah untuk mengisolasi spesies Bacillus dan Clostridium secara spesifik dari tanah adalah dengan: A. Destruksi dinding sel C. Memanaskan tanah untuk membunuh semua sel vegetatif dan kemudian memungkinkan semua spora dari organisme ini untuk “berkecambah” dan tumbuh D. Membran sitoplasma E. setelah 1 jam? b.

Bakteri penyebab tetanus hanya dapat dibunuh dengan pemanasan yang lama di atas titik didih. menghasilkan endospora 12. gen X akan ditranskripsi pada D. protein yang mentraskripsi mRNA di inti D. intron yang dilepaskan dari protein mRNA yang di transkripsi dan belum diproses 4    .. dan otak B. Gen X ditranskripsi hanya ketika faktor A difosforilasi... otot saja E. melindungi diri sendiri dengan menyekresikan antibiotik C. rRNA dan tRNA yang dipergunakan selama proses translasi C. laju dari kedua reaksi maju dan balik B merubah… BIOTEKNOLOGI Gunakanlah tabel berikut untuk menjawab pertanyaan no. Dari tiga jaringan ini. A.. Material yang berasal dari sel manusia tersebut adalah. Hal ini mengindikasikan bahwa bakteri tetanus….11. mengkode urutan asam amino pada laktase C. Transkripsi gen X dikendalikan oleh transkripsi faktor A. jantung saja C. entropi reaksi E.. Lac operon. Segmen DNA yang mengkode mRNA yang di transkripsi B. otak dan jantung saja A. Data pada distribusi jaringan dari faktor A dan aktivitas dari suatu protein kinase dan protein fosfatase spesifik untuk faktor A ditunjukkan pada tabel di atas.. mensekresikan endotoksin D. panas reaksi B. konstanta kesetimbangan C. autotrof E. otak saja 2. 1 1.. kesetimbangan konsentrasi A D. mengatur transkripsi dengan mengaktifkan atau menginaktifkan produksi dari protein represor E. material dari sel manusia di masukan ke dalam bakteri. ditemukan di sel eukariot B. A. mengatur replikasi DNA dengan mengaktifkan atau menginaktifkan protein induser 3. A. mengatur translasi dari mRNA D. protein mRNA yang ditemukan di sitoplasma E.. otot. jantung. Suatu enzim yang mengkatalisis reaksi A A. Dalam usaha untuk mengklon protein manusia.. memiliki dinding sel yang mengandung peptidoglikan B.

Northern blotting A. ……… ……. Kinetik hibridisasi double helix DNA sangat berhubungan dengan urutan basa nitrogen pada helix tersebut. Perhatikan diagram dibawah ini! Tanda panah pada diagram menunjukkan tempat pemotongan dari enzim Tag I. Urutan basa yang sangat kompleks yang menjadi sederhana ketika suhu dinaikkan E. adalah suatu teknologi yang menggabungkan gen dari sumber yang berbeda kemudian mentransfernya ke sel dimana gen tersebut akan diekspresikan. Western blotting C.4. Western blotting C. 2) …………. Di alam. Rantai ganda akibat kuatnya ikatan hydrogen C. Eastern blotting C.. 7.. Northern blotting B. Southern blotting 9. Polymerase chain reaction (PCR) E. 6. Polymerase chain reaction (PCR) E. Hibridisasi untuk membentuk untai yang lebih panjang dan stabil D. Pada temperatur di bawah titik leleh untai DNA komplementer. Metode yang digunakan untuk mendeteksi RNA adalah … A. Manakah hasil pemotongan yang tepat dari enzim tersebut? 5. Southern blotting 8. Eastern blotting B. Metode yang digunakan untuk mendeteksi suatu protein adalah … D. Southern blotting 5    .. Metode yang digunakan untuk mendeteksi DNA adalah … D. Rantai tunggal oleh denaturasi pada suhu yang lebih rendah B. gen bakteri dapat ditransfer dari satu sel ke sel lainnya melalui 3 proses yaitu 1) ……………. dan 3) ………. Mampu menyerap sinar UV lebih banyak dibandingkan dengan temperatur di atas titik lelehnya.…. Western blotting E. maka kebanyakan DNA … A. Polymerase chain reaction (PCR) D.. Northern blotting A.. Eastern blotting B.

Ket: Urutan DNA yang digarisbawahi menunjukkan gen yang akan diklon Urutan enzim restriksi ERA I: GTAAATG CRO I: CAGGAC MEM II: GCCG 10.GTGTCAGGACGGGTGAAAGCCAGGACGCCGAATCG… 5000 nukleotida lagi. Urutan DNA manusia: ATATCGTAATGTTGGTG.Gunakan petunjuk berikut ini untuk menjawab pertanyaan No.500 nukloetida. 2 11.10-11 tentang rekayasa genetik. 3 B. dan MEM II 12. Mengapa enzim restriksi yang terdapat pada suatu sel tidak merusak DNA sel tersebut meskipun sel tersebut memiliki urutan yang mampu dikenali oleh enzim restriksinya? ……………………………………………………………………………………………… ……………………………………………………………………………………………… 6    . Enzim manakah yang seharusnya digunakan untuk memasukkan urutan DNA manusia ke dalam plasmid bakteri? A.. ERA I.. Lebih dari 3 C. Plasmid bakteri dengan urutan: ATCCCA… 1000 nukleotida… …ATTAAGGCCTTACAGGACCCCGGAATGAGAGTA ATGGGCTATTCAGGTA … 200 nukleotida lagi. . Tidak ada D. MEM II D. CRO I C. Berapa banyak sisi restriksi yang terdapat pada urutan plasmid bakteri? A.. 1 E. ERA I B. CRO I. CRO I dan ERA I E..

pada hari ke tiga. D. lentisel C. ikatan pembuluh B. Peningkatan terkecil pada pertumbuhan dicapai. 4.. Hasilnya dipetakan pada grafik berikut. E. selama tiga hari pertama.. Grafik akan menunjukkan garis lurus jika. peningkatan suhu dan pergerakan udara. Seorang peneliti melakukan pengukuran harian terhadap akar tomat pada suhu 33°C-35°C dengan cara ini. peningkatan kelembaban dan pergerakan udara.. ujung akar memanjang dengan laju yang sama setiap hari. ujung akar tersebut akan memanjang dan menghasilkan akar sekunder. D. A. B. Struktur yang menghantarkan materi ke seluruh tubuh tanaman disebut. meristem D.. 5.. larutan nutrien kemudian ditambah dengan hormon pertumbuhan akar. A. A. pada akhir hari pertama. pada akhir hari ke tiga. Ujung akar tidak menunjukkan adanya pertumbuhan.ANATOMI DAN FISIOLOGI TUMBUHAN 1.. C.. A. suhunya dipertahankan 37°C secara konstan.. Dalam kondisi suhu yang diatur. 2. pada hari ke delapan. pada akhir hari ke delapan.. 3.. peningkatan kelembaban dan penurunan suhu. pertumbuhan pada dua hari pertama identik... A. C. peningkatan suhu saja. E. D. E. pada waktu yang tidak ditunjukkan B. B. B. C. laju pertumbuhan setelah hari ke delapan memiliki laju yang sama dengan hari sebelumnya.. D.. Suatu teknik yang telah disempurnakan digunakan untuk memotong ujung akar dan menempatkannya pada larutan nutrien steril. oleh grafik. C. selama tiga hari pertengahan. Laju transpirasi suatu pohon kemungkinan akan meningkat seiring dengan. selama tiga hari terakhir. peningkatan kelembaban dan suhu. E.. kambium 7    . pada akhir hari ke sepuluh.

. hanya ketika fotosintesis tidak sedang berjalan. Hipotalamus mengurangi masukan TSH ke pituitary. hanya ketika fotosintesis sedang berjalan. C. sel penjaga C. D. rambut akar E. B.. Sel-sel pembuat makanan pada tumbuhan terletak di. B. 9. konsentrasi auksin yang lebih besar pada bagian yang terlindungi.. D. memasuki uterus melalui perut ibu. Produksi urin memungkinkan untuk ekskresi buangan sel.. fototropisme negatif. Selama respirasi. air B. embrionya berada dalam resiko karena racun-racun tersebut dapat. karbon dioksida dan air E..... siang dan malam. B.. B. E. stomata B. 2. hanya pada malam hari. epidermis D. Pernyataan manakah yang menggambarkan mekanisme umpan balik yang melibatkan kelenjar tiroid? A. Kambium terletak di dekat.. C. A. hanya pada siang hari. E.. pembuluh C. E. oksigen D. Jumlah karbon dioksida di dalam daran meningkat dengan olah raga. Tumbuhan hijau melakukan respirasi. D. mempengaruhi ovulasi. geotropisme positif. karbon dioksida C. floem E. epidermis 6. Tumbuhnya daun menuju cahaya dihasilkan dari. Produksi estrogen merangsang pembuntukan gamet untuk reproduksi seksual. 8    . oksigen dan air 10. A.. jaringan spons B. C. A. Kadar oksigen di dalam darah berhubungan dengan detak jantung. Ketika wanita hamil mengkonsumsi alkohol dan nikotin... berdifusi dari darah ibu ke darah embrio di dalam plasenta. xilem dan floem 8. kayu 7.... konsentrasi auksin yang lebih besar pada bagian yang terkena cahaya. D. A. pindah ke embrio karena darah ibu bercampur dengan darah embrio di dalam plasenta. xilem D.. ANATOMI DAN FISIOLOGI HEWAN 1. A. A. konsentrasi auksin yang sama pada seluruh sisi batang. tumbuhan hijau menyerap. C.E.

mengalami eritroblastosis. kekurangan besi dalam diet E.. getah pankreas B. ligamen A. mengumpulkan urin setelah mengalir melalui uretra.. A. B. 5. tidak olah raga C. C. getah lambung A. A. tendon C.. B. berdifusi ke dalam air susu ibu yang akan diminum oleh bayi.. kulit mengekskresikan garam dalam jumlah yang lebih besar. orang merasa tidak nyaman karena. D. Fungsi utama nefron adalah untuk. jaringan adiposa B.. E. harus mengganti darahnya. Sekret yang mencerna karbohidrat dan protein adalah. 6. E. Humerus. kantung udara D.. E.. 3.. Pembelahan – formasi blastula – formasi otot – formasi gastrula – formasi mesoderm. terdapat lebih sedikit evaporasi keringat. B.. permukaan kulit terlalu kering. 9    .. menyerap makanan yang dicerna dari dalam usus halus. C. E. diafragma 10. memiliki bayi Rh negatif. memakan terlalu banyak makanan berkalori tinggi D. D. jaringan rawan E. D. keringat mengevaporasi dengan cepat. Kondisi kelebihan berat badan dapat disebabkan oleh faktor-faktor berikut. 8. C. memecah sel darah merah untuk membentuk buangan nitrogen. paru-paru B. Pembelahan – formasi blastula – formasi mesoderm – formasi gastrula – formasi otot. A. Formasi gastrula – formasi blastula – formasi mesoderm – pembelahan – formasi otot. ekstensor 7. Penyakit darah Rh dapat terjadi apabila ibu dengan Rh negatif... gangguan kelenjar tiroid 4. kecuali. D. mengatur komposisi kimia darah... ptialin E. Laju pernapasan dikendalikan oleh. ia lebih banyak berkeringat.. A.. makan berlebih B. dihubungkan secara langsung dengan tulang lengan lainnya oleh. pepsin 9. tulang lengan atas manusia.. D. saliva C. A.. Formasi blastula – formasi gastrula – formasi mesoderm – pembelahan – formasi otot.. memiliki bayi Rh positif B. bronki C. medulla E.. Manakah berikut ini yang mewakili urutan normal tahap-tahap perkembangan embrio? A. membentuk urea dari produk-produk buangan hasil metabolisme protein. Pembelahan – formasi blastula – formasi gastrula – formasi mesoderm – formasi otot. gagal membentuk antibodi. D. C.E. Pada hari yang lembab.

. tetap 9:3:3:1 E. Bunga jingga disilangkan dengan bunga hijau menghasilkan jumlah keturunan sebagai berikut. Kriptomeri A. 3. IO. 4. 12:3:1 A. A. Tentukan jenis penyimpangan hukum mendel pada persilangan diatas. D.3. RrPP dan RRPp C. Berdasarkan keterangan diatas. IA. Warna pada kembang sepatu merupakan sifat yang diturunkan secara poligeni. maka peluang keluarga tersebut memiliki dua anak laki-laki normal dan satu buta warna adalah. 1. maka genotip dari kedua induk adalah. Apabila seseorang memiliki alel IAIB di dalam tubuhnya maka orang tersebut memiliki golongan darah AB.. 75 bunga jingga 27 bunga merah 23 bunga kuning 8 bunga hijau 1. rrPP dan rrPp D... 2. Seorang ibu carrier terhadap sifat buta warna menikah dengan laki-laki normal. Kodominan E. 9:7 B. 4.. Proses pengubahan dari diploid menjadi haploid terjadi setelah meosis 2.56% 10    . 1:1 C. Apabila pasangan keluarga tersebut berharap memiliki 3 anak lelaki. 9:3:4 5.. RrPP dan rrpp E. Interaksi alel 6.. B-S.. Gen A merupakan gen yang mengkode bahan baku untuk pigmen yang bisa diubah menjadi berbagai warna. D. Epistasis C..GENETIKA Soal 1-2. Tentukan genotip dari induk yang berwarna jingga. rrPp dan RRPp B.1. dan jika berada dalam keadaan homozigot resesif untuk ketiga gen maka warna bunga menjadi putih...7% B. Pada golongan darah terdapat tiga jenis alel. Inkomplit dominan B.. A.. Namun apa bila kedua sifat terletak pada kromosom yang sama maka hasil persilangan F1-nya adalah. Hal ini terjadi karena semua sifat terletak pada kromosom yang berbeda. karena pada saat itu jumlah kromosom hasil pembelahan adalah setengah dari jumlah kromosom sel induk.. Sifat ini diatur oleh tiga gen (ABC) yang apabila berada pada keadaan homozigot dominan untuk ketiga gen akan menghasilkan warna jingga.3... Hasil persilangan F1 pada persilangan dihibrid yang dilakukan Mendel menghasilkan perbandingan 9. IB. RrPp dan rrPP 7. Dua ekor ayam disilangkan dan diperoleh keturunan sebagai berikut: 10 walnut dan 3 rose. Sifat alel IAIB dalam pembentukan golongan darah AB disebut.

6.7. Kedua gen terpaut dan pada saat pembentukan gamet terjadi peristiwa pindah silang.. 10. 0. 0.4 D. Gen yang mengatur panjang sayap dan dan warna mata terletak pada kromosom yang sama B.58. E. 12.4. Labu dengan genotip AABbcc memiliki berat buah 27 gr sedangkan labu dengan genotip AaBBCc memiliki berat buah 30 gr. Tiba-tiba kondisi lingkungan berubah dan menyebabkan kematian dari semua individu yang homozigot dominan sebelum mencapai usia dewasa.25% D. 0. Berdasarkan keterangan tersebut tentukanlah jumlah fenotip dari hasil persilangan kedua labu tersebut! D. Kedua gen bersifat kodominan. E. A. 0. 6 fenotip E. 0. Tentukanlah frekuensi alel IA pada populasi tersebut.. 33 ekor sayap pendek mata coklat.5% E. 0.75% 8. 9 fenotip A. Seekor lalat yang heterozigot terhadap kedua sifat disilangkan dengan lalat yang homozigot resesif untuk kedua sifat. 0. Pada lalat buah diketahui bahwa sayap panjang (V) dominan terhadap sayap pendek (v) dan mata merah (M) dominan terhadap mata coklat (m). Gen yang mengatur warna mata terpaut kromosom seks sedangkan gen yang mengatur panjang sayap terletak pada autosom D. tidak dapat ditentukan D.26. C. Setelah kejadian tersebut.6 11. Berapa frekuensi alel T setelah satu generasi? A. 7 fenotip B. Hasil persilangannya adalah sebagai berikut: 180 ekor sayap panjang mata coklat. 18. Pada suatu populasi yang terdiri atas 1000 penduduk diketahui bahwa jumlah orang yang bergolongan darah O adalah adalah 16% dari jumlah penduduk dan jumlah penduduk yang bergolongan darah AB dan B masing-masing adalah 100 dan 90 orang. 5 fenotip 9.C. Berdasarkan informasi diatas maka pernyataan berikut yang benar adalah. kondisi lingkungan kembali normal. 0. A.2 C. Gen yang mengatur panjang sayap dan warna mata terletak pada kromosom yang terpisah C. 4 fenotip C. 0. Populasi dengan alel T dan t yang seimbang memiliki 36% individu dalam populasi dengan fenotip resesif. 182 ekor pendek mata merah.5 B.7 E. 11    . 35 ekor sayap panjang ekor sayap panjang mata merah. Berat buah labu ditentukan oleh beberapa gen yang dikenal dengan istilah poligeni.. B.

Darwin E. Oparin B. tidak dapat ditentukan A. A. Jika anak kedua adalah Rh+ dan bergolongan darah A maka kemungkinan anak ketiga lahir normal adalah 12.5% C. 25% C. Seorang laki dengan genotip AaBaCCDd (A dengan D terpaut). Probabilitas anak kedua bergolongan darah A dan AB adalah sama E. D. Jika A menunjukan alel dominan dan a adalah alel resesif. 4 E. Peluang untuk memperoleh anak kedua perempuan dengan golongan darah A dan Rh+ adalah 0% B. Radiasi adaptif D.” Pendapat tersebut adalah pendapat…. Pada fenomena manakah berikut ini pengamatan Darwin tentang burung finch di kepulauan Galapagos menjadi contoh klasik? A. Ketidakmampuan untuk terbang 12    . Apabila anak pertama mereka adalah laki-laki A Rh. Perubahan tersebut diturunkan pada generasi berikutnya.12. Aa x aa A.. Probabilitas anak bergolongan darah O sama dengan Probabilitas anak A dan B 13. 16 14.. 75% A. AA x Aa C. Berapakan kemungkinan pasangan tersebut memiliki anak laki-laki yang menderita haemofilia? D. Spesiasi simpatrik C. maka jumlah gamet yang dapat dibentuknya adalah. Kesetimbangan Hardy-Weinberg B.. Apabila ia menghasilkan sperma... Jika seorang wanita yang ayahnya haemofilia menikah dengan laki-laki normal. Lamarck C. tereduksi atau hilang melalui penggunaan dan penghentian penggunaan. Evolusi konvergen E.. bergolongan darah B dan Rh+ adalah 12. D. Seorang wanita bergolongan darah O Rh. 8 C. Peluang memperoleh anak kedua perempuan.. apakah genotip dari orang tua yang menghasilkan 300 keturunan dengan sifat dominan dan 100 keturunan dengan sifat resesif? D. 2 B.5% D.menikah dengan laki-laki dengan golongan darah AB Rh+. Mendel 2. Aa x Aa B. Wallace A. Haemofilia merupakan penyakit menurun yang terpaut seks dan bersifat resesif. AA x AA E. “Suatu struktur diperoleh. 100% B. AA x aa EVOLUSI 1..maka pernyataan berikut yang tepat adalah. 0% E. 50% 15. membesar.

sedangkan yang besar mudah dimangsa burung hantu. Gunakanlah pilihan berikut ini untuk menjawab pertanyaan no. E. Seleksi alam mengarahkan populasi menjadi lebih sesuai terhadap lingkungannya. IV dan V B. IV. tidak ada tinggi tinggi C. A. C. tinggi tinggi rendah E. struktur yang memiliki karakter anatomi dasar yang sama. A. VI.. E. V dan VI E. D. Seleksi stabilisasi (’stabilizing selection’) ditunjukkan oleh. Pada situasi manakah berikut ini evolusi berjalan paling lambat untuk suatu populasi ‘inter-breeding’? migrasi tekanan seleksi variasi karena mutasi A.. A. Kadal Aristelliger kecil bermasalah dalam mempertahankan teritorinya. III. II. Berat bayi manusia pada waktu lahir... IV saja B. II dan III C. Evolusi adalah perubahan pada frekuensi alel dari suatu populasi.. III. Berikut ini pernyataan yang salah adalah. Materi genetik dari individu adalah genotip. struktur yang memiliki karakter anatomi dasar yang berbeda. 5. I. tinggi tinggi tinggi 4. Populasi Biston betularia pada waktu revolusi industri.. asal evolusi yang sama. tapi dapat digunakan untuk fungsi yang sama. B. III dan VI E. asal evolusi yang sama. V. B. Seleksi alam menyebabkan perubahan genetik pada individual. II dan IV D. D. C. tidak ada rendah rendah B.. asal evolusi yang berbeda. asal evolusi yang berbeda.. II dan V 6. tapi dapat digunakan untuk fungsi yang berbeda. V dan VI A. struktur yang memiliki karakter anatomi dasar yang sama. Seleksi alam bekerja pada individu.. Resistensi DDT pada serangga. III saja C. tapi dapat digunakan untuk fungsi yang sama. struktur yang memiliki karakter anatomi dasar yang sama. asal evolusi yang berbeda. tinggi rendah tinggi D. Yang dimaksud dengan struktur analog adalah. Leher jerapah.. I. II. Populasi burung Finch di Galapagos. Seleksi mengarahkan (’directional selection’) ditunjukkan oleh. tapi dapat digunakan untuk fungsi yang sama. 13    .3. struktur yang memiliki karakter anatomi dasar yang sama. II. III dan V 7. D... I. tapi dapat digunakan untuk fungsi yang berbeda. 5 dan 6. sedangkan materi genetik dari populasi adalah ‘gene pool’.

Jika kembar identik albino menikah dengan kembar identik berambut keriting. 10. E. identik. isolasi sterilisasi B.. karena ‘gene pool’ yang sifatnya umum dari induk. Manakah berikut ini yang merupakan kesamaan antara teori Darwin dan teori Lamarck mengenai evolusi? A. isolasi temporal A. anak dari kedua pasangan secara genetis kemungkinan. Jika spesies yang serupa memiliki perbedaan struktural pada organorgan reproduksinya. B. E.. karena adanya segregasi acak pada waktu meiosis induk. Evolusi mengarahkan organisme menjadi lebih kompleks. D. D.. identik. identik.. isolasi gametik E. maka mekanisme isolasi reproduksi ini disebut dengan. Dua spesies yang berbeda tidak dapat melakukan perkawinan karena adanya mekanisme isolasi reproduktif. Catatan fosil mendukung pendapat bahwa spesies adalah tetap. karena rendahnya kemungkinan mutasi.8. A. isolasi perilaku C. B.. tidak berubah. isolasi mekanis 9. kecuali terjadi pindah silang. Adaptasi merupakan hasil dari perbedaan kesuksesan reproduksi. berbeda.. berbeda. D. C. Adaptasi merupakan hasil dari penggunaan dan penghentian penggunaa struktur anatomi. C. 14    . Adaptasi evolusioner merupakan hasil dari interaksi antara organisme dengan lingkungannya. karena tingginya kemungkinan terjadinya mutasi acak.

jumlah predator meningkat.. jumlah mangsa meningkat. Ketika puncak piramid dicapai. jumlah predator menurun. Pada dasar piramid. jumlah individu dan jumlah energi yang terlibat adalah sama. Pada dasar piramid. Ketika jumlah mangsa meningkat. Manakah berikut ini yang mungkin terjadi di dalam suatu ekosistem? A. D.. Pernyataan manakah yang paling baik menyimpulkan hubungan tersebut? A. B. 15    C. dan jumlah energi tetap sama dengan tingkatan lainnya. jumlah individu dan jumlah enrgi yang terlibat adalah paling rendah. E. tidak mungkin. Ketika jumlah mangsa menurun. Ketika jumlah predator meningkat. lorong-lorong yang . A. tidak adanya musuh alami menyebabkan mereka berbiak tak terbatas. mereka menyebabkan myxomatosis bagi bayi-bayi yang baru lahir. Ketika jumlah mangsa meningkat. B.. Perbedaan utamanya adalah. seperti yang terlihat pada gambar. 4. D. Hubungan yang digambarkan dalam rantai makanan dapat juga diekspresikan sebagai piramid makanan. E. jumlah individu menurun tapi jumlah energinya meningkat. B. B. mereka mengambil nutrisi yang berharga dari tanah. terdapat indikasi jumlah relatif individu dan jumlah energi yang terlibat pada setiap tingkat.. A. jumlah individu dan jumlah energi yang terlibat adalah paling besar. C. E. jumlah predator meningkat. Pada khatulistiwa. di dalam piramida makanan.. 3. terjadi hanya di musim dingin. Kelinci menjadi ancaman di Australia karena. terjadi di dalam. jumlah mangsa menurun. Ketika puncak piramid dicapai. Ketika jumlah predator menurun. jumlah individu meningkat. mereka memindahkan ‘rabbit fever’ ke kangguru.EKOLOGI 1. Pada semua tingkat.. 2. liang mereka di dalam tanah berbahaya bagi ternak. D. C. tipe pertumbuhan taiga. C.

.. dan memiliki berkas pembuluh pada batang yang tersusun secara melingkar adalah. terjadi di gunung-gunung yang E. kurang stabil. Dibandingkan dengan daratan. tanaman jagung B. kekayaan/jumlah spesies D. pertahanan mekanis A. lebih sedikit menyerap radiasi sinar matahari. merupakan karakter dari. proses koevolusi D. terjadi hanya di gurun. lebih stabil. A. tinggi. kamouflase B. Kompetisi antara populasi dua spesies dengan relung (niche) yang hampir sama. 6..D.. D.. frekuensi relatif spesies B. B dan C benar 7.. Sejenis ulat mempertahankan dirinya dari predator dengan cara membesarkan kepalanya sehingga menyerupai kepala ular yang ganas. mimikri Müllerian E. jawaban A dan B benar E. pertahanan aposematik 8. A dan B benar E. dan generasi sporofit masih menumpang pada generasi gametofit. C. Gymnospermae B. Paku E.. eliminasi (penyingkiran) populasi yang kalah bersaing B. mimikri Batesian C... Angiospermae D. jawaban A dan C benar BIOSISTEMATIK 1. Lumut B. suhu bioma laut. D. Gymnospermae A. memiliki kondisi ekstrim yang lebih. pembagian sumber daya (resource partitioning) melalui seleksi alam C. Alga hijau 2. A. Generasi gametofit lebih dominan dari generasi sporofit. kelimpahan relatif spesies C. E. Angiospermae E. memiliki daun dengan tulang daun bercabang membentuk pola menyerupai jala. Lumut C. Pertumbuhan biji yang tidak terlindungi oleh ovarium merupakan karakteristik dari. 5.. Alga hijau 3. pada akhirnya dapat mengakibatkan terjadinya: A. Tumbuhan yang menghasilkan buah. Pertahanan seperti ini adalah contoh dari: D.. Keanekaragaman spesies dalam suatu komunitas ditentukan oleh: A. paku C.. B.... A. lumut 16    .. Paku C. di bawah titik beku.

Menggunakan kunci identifikasi B. Di suatu hutan tropis. Graminae B. 6 berkerabat paling dekat Sp. beberapa jenis tumbuhan ini tergolong dalam satu suku…………………. filotaksis daun ada yang tersebar dan ada pula yang berhadapan dengan tepi daun bergerigi.D. Semua cara di atas dapat dilakukan 7.2 merupakan organisme yang sama Tidak mungkin ada dendogram seperti ini 6. Identifikasi suatu tumbuhan dapat dilakukan dengan cara: A. 3 dan Sp. seorang mahasiswa menemukan beberapa jenis tumbuhan dengan ciri-ciri sebagai berikut : Bentuk hidup pada umumnya herba atau perdu. tanaman kacang E. Modern taxonomy 17    . 5 dan Sp. Membandingkan gambar dalam pustaka botani D. Salah satu aspek taksonomi yang hanya mengamati karakteristik morfologi saja disebut dengan : A. Membandingkan dengan tumbuhan di Kebun Raya yang telah diketahui namanya C. Jika cabang-cabang pada diagram berikut ini menyatakan kesaman karakter tumbuhan. Asteraceae 5. angka satu meyatakan kesamaan paling tinggi dan angka nol menyatakan tidak ada karakter yang sama. Perbungaan tersusun dalam kapitulum yang dilindungi oleh involukrum dan ditemukan dua macam bunga (bunga pita dan bunga tabung) yang berwarna kuning dan ungu. C. Diagram kekerabatan enam jenis tumbuhan dapat dinyatakan dalam dendogram di bawah ini. B. maka dendogram berikut menyatakan A. Euphorbiaceae D. Omega taxonomy C. pada beberapa jenis memiliki getah berwarna putih. Moraceae C.2 tidak mungkin berkerabat Sp. Membandingkan dengan spesimen awetan di herbarium E. Berdasarkan ciri-ciri tersebut. E. Liliaceae E. Sp. A. Tumbuhan-tumbuhan tersebut memiliki macam daun tunggal. pinus 4..1 dan Sp. 4 berkerabat paling dekat dibandingkan jenis lainnya Sp. Beta Taxonomy D. D.1 dan Sp. Alpha taxonomy B.

Spesies manakah yang kemungkinan lebih banyak berhasil/lulus hidup pada berbagai perubahan lingkungan sepanjang masa dari kedua diagram pohon filogeni di bawah ini? A. Y saja. Cladistic 8.E. A & C B. C & G   ***  D. X & Y E. H & I C. 18    .

Sign up to vote on this title
UsefulNot useful