SOAL-SOAL BIOLOGI

BIOLOGI SEL DAN MOLEKULER 1. Pada organisme manakah berikut ini respirasi aerob terjadi? I Mammalia II. Tumbuhan tinggi A. hanya I B. hanya II C. hanya I dan III D. hanya II dan III E. I, II dan III

III. Protozoa

2. Struktur lipid mengandung semua hal berikut ini, kecuali…. A. gugus karboksil D. molekul asam lemak B. struktur dasar CH2O E. gugus OH C. molekul gliserol 3. RNA ditemukan pada.... A. nukleus saja B. sitoplasma saja C. nukleus dan sitoplasma D. protein E. asam amino 4. Selama proses respirasi, energi dipindahkan dari molekul glukosa ke molekul.... D. ATP A. ACTH E. BCG B. DNA C. RNA 5. Ribosom terlibat pada semua dari berikut ini kecuali A. Pembentukan ikatan peptida B. Aminoasilasi dari tRNA C. Pengikatan faktor protein selama elongasi D. Pengikatan aminoasil tRNA pada mRNA E. Pengikatan mRNA pada kodon inisiasi 6. Suatu galur E. coli yang tidak memiliki DNA polymerase I akan mengalami defisiensi dalam…..DNA D. degradasi A. perbaikan E. transkripsi B. metilasi C. penggabungan 7. Penyelesaian fase S dari siklus sel suatu sel mammalia ditandai dengan berikut ini kecuali A. Kandungan histon per sel dua kali lipat dibanding ketika sel berada pada G1 B. Pada DNA yang mengalami replikasi, basa-basa nitrogen yang baru terbentuk berpasangan dengan basa-basa parental C. Setiap kromosom yang mengalami replikasi memiliki empat telomer D. Sister chromatids berpisah dari satu sama lain E. Nukleus mengandung jumlah DNA yang ekivalen dengan suatu sel tetraploid yang berada pada G1
1   

Ascomycota A. 24% G MIKROBIOLOGI 1. 20% G e. Ujung 3’ adalah gugus fosfat E. Spiral 2    . 16% C. Eubacteria E. Sarkomer sel-sel otot rangka C. Monotrika C. Orientasi kedua rantai berlawanan arah (antiparalel) D. Struktur terspesialisasi yang berada pada ujung kromosom eukariot disebut D. Lofotrika E. kinetokor B. Pseudo C. B. Bentuk-bentuk bakteri adalah sebagai berikut. Tidak semua urutan basa dalam DNA adalah gen 12. 20% C. Sarcina D. kecuali : A. 30% A. Kerusakan umum yang dijumpai pada DNA setelah pendedahan terhadap sinar ultraviolet adalah…. dan 24% G.8. 20% G c. 16% C. telomer C. Diketahui bahwa salah satu rantai dari DNA terdiri atas 23% A. Serat tegang dari fibroblast D. rusaknya rantai tunggal C. Tipe flagella pada bakteri adalah sebagai berikut. Oomycota C. Kokoid B. Mikrovili dari intestinal brush border E. 24% G a. dimer pirimidin E. Basil E. DNA berbentuk heliks ganda dan linier C. 37% T. dimer purin A. 30% C. 37% A. transposisi B. long terminal repeat (LTR) 11. sentromer A. 30% T. 23% T. terminator E. Cincin kontraktil pada sel-sel hewan yang membelah 10. 30% T. b. kecuali A. 37% T. Filamen aktin dijumpai pada berikut ini. D. Zygomycota 2. Politrika B. Flagella bakteria B. 16% C. delesi basa 9. Jumlah basa timin sama dengan jumlah basa pirimidin. kecuali : D. Komposisi basa dalam rantai DNA tersebut d. Ragi Saccharomyces cerevisiae diklasifikasikan dalam : D. tidak dapat ditentukan. 20% A. 23% A. Atrika 3. Berikut pernyataan yang tidak benar mengenai DNA pada inti sel eukariot adalah…… A. Basidiomycota B. Amphitrika A.

Menumbuhkannya secara anaerobik pada medium yang mengandung glukosa 3    . setelah 1 jam? b.. Metoda yang ditemukan oleh Koch untuk memurnikan mikroba C.25% sel awal mati? 5. Menumbuhkannya pada suhu tinggi C. Menumbuhkannya secara aerobik pada medium yang mengandung glukosa B. Dinding sel suatu ragi 6. Menumbuhkannya pada suhu sangat rendah E. Lichenes E. Virus 9. 8 juta B. setelah 2 jam bila 0.. dan asam teichoat maupun asam lipoteichoat. Absorbsi air E. setelah 2 jam? c. 4 C. Suatu prosedur laboratorium yang memungkinkan diperolehnya kembali mikroorganisme penyebab penyakit D. Protozoa B. Mikroorganisme tertentu selalu penyebab penyakit tertentu B. Destruksi dinding sel C. Membran sitoplasma E.4. Perubahan pada ekspresi gen B. Dinding sel suatu bakteri gram negatif D. berbagai L dan D asam amino. Glikogen C. 8 A. Salah satu komponen mengandung molekul berikut ini: asam acetylmuramat. Dari kelompok organisme di bawah ini. jumlah bakteri individual yang ada pada mulanya adalah. Delapan koloni bakteri tampak pada plat agar setelah 24 jam. D. acetylglucosamin. Suatu cara yang mudah untuk mengisolasi spesies Bacillus dan Clostridium secara spesifik dari tanah adalah dengan: A. Postulat Koch adalah : A. Rusaknya membran plasma A. Penyebab fenomena ini adalah D. 6 7. 2 E. Komponen ini merupakan : A. Destruksi sitoskeleton 10. yang tidak dapat menghasilkan ATP sendiri adalah . Diatoms A. Berapa banyaknya sel yang ada pada 1 liter kultur ini: a. Memanaskan tanah untuk membunuh semua sel vegetatif dan kemudian memungkinkan semua spora dari organisme ini untuk “berkecambah” dan tumbuh D. Suatu pedoman yang dipakai untuk mengungkapkan suatu agen penyebab penyakit 8. D. Dinding sel suatu bakteri gram positif B. Anda mengambil suatu kultur mikroba dan memfraksinasinya menjadi beberapa komponen. Suatu kultur bakteri diawali dengan 4 sel bakteri per ml pada medium pengaya dengan fase lag 1 jam dan waktu generasi 20 menit. Bakteri C.. Inkubasi bakteri gram negatif dengan lisozim pada medium isotonik menyebabkan bakteri berbentuk batang menjadi berbentuk bulat (spherical) .

memiliki dinding sel yang mengandung peptidoglikan B. A. Bakteri penyebab tetanus hanya dapat dibunuh dengan pemanasan yang lama di atas titik didih. A.. ditemukan di sel eukariot B.. Lac operon. intron yang dilepaskan dari protein mRNA yang di transkripsi dan belum diproses 4    . jantung saja C. Hal ini mengindikasikan bahwa bakteri tetanus…. melindungi diri sendiri dengan menyekresikan antibiotik C. menghasilkan endospora 12.. rRNA dan tRNA yang dipergunakan selama proses translasi C.. protein mRNA yang ditemukan di sitoplasma E. mengatur replikasi DNA dengan mengaktifkan atau menginaktifkan protein induser 3. dan otak B. laju dari kedua reaksi maju dan balik B merubah… BIOTEKNOLOGI Gunakanlah tabel berikut untuk menjawab pertanyaan no. autotrof E. otak saja 2. Dalam usaha untuk mengklon protein manusia. Segmen DNA yang mengkode mRNA yang di transkripsi B. jantung. konstanta kesetimbangan C. Dari tiga jaringan ini. protein yang mentraskripsi mRNA di inti D. mengatur translasi dari mRNA D. otak dan jantung saja A. Suatu enzim yang mengkatalisis reaksi A A. entropi reaksi E. Material yang berasal dari sel manusia tersebut adalah.11. mengatur transkripsi dengan mengaktifkan atau menginaktifkan produksi dari protein represor E.. Gen X ditranskripsi hanya ketika faktor A difosforilasi. kesetimbangan konsentrasi A D. Data pada distribusi jaringan dari faktor A dan aktivitas dari suatu protein kinase dan protein fosfatase spesifik untuk faktor A ditunjukkan pada tabel di atas. material dari sel manusia di masukan ke dalam bakteri.. otot saja E. Transkripsi gen X dikendalikan oleh transkripsi faktor A. panas reaksi B.. 1 1. mensekresikan endotoksin D. otot.. gen X akan ditranskripsi pada D. mengkode urutan asam amino pada laktase C. A..

Hibridisasi untuk membentuk untai yang lebih panjang dan stabil D. Western blotting C. 6. Western blotting C.…. Northern blotting A. Pada temperatur di bawah titik leleh untai DNA komplementer. Rantai ganda akibat kuatnya ikatan hydrogen C.. Metode yang digunakan untuk mendeteksi RNA adalah … A.. Perhatikan diagram dibawah ini! Tanda panah pada diagram menunjukkan tempat pemotongan dari enzim Tag I. maka kebanyakan DNA … A. Mampu menyerap sinar UV lebih banyak dibandingkan dengan temperatur di atas titik lelehnya. Metode yang digunakan untuk mendeteksi DNA adalah … D.4. Southern blotting 5    . Northern blotting B. 7. Eastern blotting C. Eastern blotting B. Polymerase chain reaction (PCR) E. Eastern blotting B.. Rantai tunggal oleh denaturasi pada suhu yang lebih rendah B. gen bakteri dapat ditransfer dari satu sel ke sel lainnya melalui 3 proses yaitu 1) …………….. ……… …….. Manakah hasil pemotongan yang tepat dari enzim tersebut? 5. Southern blotting 8. Southern blotting 9. Polymerase chain reaction (PCR) D. Western blotting E. Polymerase chain reaction (PCR) E. 2) …………. Di alam. adalah suatu teknologi yang menggabungkan gen dari sumber yang berbeda kemudian mentransfernya ke sel dimana gen tersebut akan diekspresikan. Northern blotting A. Metode yang digunakan untuk mendeteksi suatu protein adalah … D. Kinetik hibridisasi double helix DNA sangat berhubungan dengan urutan basa nitrogen pada helix tersebut. Urutan basa yang sangat kompleks yang menjadi sederhana ketika suhu dinaikkan E. dan 3) ……….

MEM II D.Gunakan petunjuk berikut ini untuk menjawab pertanyaan No. Tidak ada D. ERA I B. Lebih dari 3 C. .. Enzim manakah yang seharusnya digunakan untuk memasukkan urutan DNA manusia ke dalam plasmid bakteri? A. CRO I dan ERA I E. Plasmid bakteri dengan urutan: ATCCCA… 1000 nukleotida… …ATTAAGGCCTTACAGGACCCCGGAATGAGAGTA ATGGGCTATTCAGGTA … 200 nukleotida lagi. Mengapa enzim restriksi yang terdapat pada suatu sel tidak merusak DNA sel tersebut meskipun sel tersebut memiliki urutan yang mampu dikenali oleh enzim restriksinya? ……………………………………………………………………………………………… ……………………………………………………………………………………………… 6    . 2 11.. 1 E. CRO I. 3 B..500 nukloetida.10-11 tentang rekayasa genetik. Berapa banyak sisi restriksi yang terdapat pada urutan plasmid bakteri? A. ERA I. CRO I C. Ket: Urutan DNA yang digarisbawahi menunjukkan gen yang akan diklon Urutan enzim restriksi ERA I: GTAAATG CRO I: CAGGAC MEM II: GCCG 10.GTGTCAGGACGGGTGAAAGCCAGGACGCCGAATCG… 5000 nukleotida lagi. Urutan DNA manusia: ATATCGTAATGTTGGTG. dan MEM II 12..

A. Struktur yang menghantarkan materi ke seluruh tubuh tanaman disebut.. 3. D. 2. suhunya dipertahankan 37°C secara konstan. kambium 7    . peningkatan kelembaban dan penurunan suhu. pada hari ke delapan.. Laju transpirasi suatu pohon kemungkinan akan meningkat seiring dengan. Suatu teknik yang telah disempurnakan digunakan untuk memotong ujung akar dan menempatkannya pada larutan nutrien steril. selama tiga hari pertengahan. meristem D. Hasilnya dipetakan pada grafik berikut. 5.. C. peningkatan kelembaban dan suhu. pada akhir hari ke sepuluh. laju pertumbuhan setelah hari ke delapan memiliki laju yang sama dengan hari sebelumnya. B... E. pada waktu yang tidak ditunjukkan B. B.. D. E. 4.. Seorang peneliti melakukan pengukuran harian terhadap akar tomat pada suhu 33°C-35°C dengan cara ini. C. pada hari ke tiga. C. D. E. E... D. A.. ujung akar tersebut akan memanjang dan menghasilkan akar sekunder. larutan nutrien kemudian ditambah dengan hormon pertumbuhan akar. pada akhir hari ke tiga. lentisel C. Grafik akan menunjukkan garis lurus jika. peningkatan suhu dan pergerakan udara. Peningkatan terkecil pada pertumbuhan dicapai... Ujung akar tidak menunjukkan adanya pertumbuhan. A. B. selama tiga hari pertama. oleh grafik. peningkatan suhu saja. A. peningkatan kelembaban dan pergerakan udara. ikatan pembuluh B.. pada akhir hari ke delapan. ujung akar memanjang dengan laju yang sama setiap hari. A. pertumbuhan pada dua hari pertama identik. C.. Dalam kondisi suhu yang diatur. selama tiga hari terakhir.ANATOMI DAN FISIOLOGI TUMBUHAN 1. pada akhir hari pertama..

epidermis D. fototropisme negatif. stomata B. C.. pembuluh C. pindah ke embrio karena darah ibu bercampur dengan darah embrio di dalam plasenta. konsentrasi auksin yang lebih besar pada bagian yang terlindungi. rambut akar E. embrionya berada dalam resiko karena racun-racun tersebut dapat. C. D. B.. karbon dioksida dan air E. B. Kambium terletak di dekat. Kadar oksigen di dalam darah berhubungan dengan detak jantung. oksigen dan air 10. Produksi urin memungkinkan untuk ekskresi buangan sel. konsentrasi auksin yang sama pada seluruh sisi batang. kayu 7. hanya ketika fotosintesis sedang berjalan.. tumbuhan hijau menyerap. hanya pada siang hari.. xilem dan floem 8.. Produksi estrogen merangsang pembuntukan gamet untuk reproduksi seksual. E. B. Jumlah karbon dioksida di dalam daran meningkat dengan olah raga. 8    .. ANATOMI DAN FISIOLOGI HEWAN 1. Pernyataan manakah yang menggambarkan mekanisme umpan balik yang melibatkan kelenjar tiroid? A. geotropisme positif. konsentrasi auksin yang lebih besar pada bagian yang terkena cahaya. D. jaringan spons B.. epidermis 6.. A.. A. C. Tumbuhnya daun menuju cahaya dihasilkan dari.. D. air B. 9. siang dan malam. 2. xilem D. oksigen D. A. E. mempengaruhi ovulasi. E.. Selama respirasi. sel penjaga C. A.E. hanya pada malam hari. berdifusi dari darah ibu ke darah embrio di dalam plasenta... Hipotalamus mengurangi masukan TSH ke pituitary... B. A. Tumbuhan hijau melakukan respirasi. C. D. karbon dioksida C. A.. Ketika wanita hamil mengkonsumsi alkohol dan nikotin. Sel-sel pembuat makanan pada tumbuhan terletak di. memasuki uterus melalui perut ibu. hanya ketika fotosintesis tidak sedang berjalan.. floem E..

C. Formasi blastula – formasi gastrula – formasi mesoderm – pembelahan – formasi otot. ia lebih banyak berkeringat. 5. E.. jaringan rawan E. B.. 6. berdifusi ke dalam air susu ibu yang akan diminum oleh bayi.. Pembelahan – formasi blastula – formasi otot – formasi gastrula – formasi mesoderm. A. A. ptialin E. orang merasa tidak nyaman karena. mengumpulkan urin setelah mengalir melalui uretra. ekstensor 7. permukaan kulit terlalu kering. D. dihubungkan secara langsung dengan tulang lengan lainnya oleh. B.. memecah sel darah merah untuk membentuk buangan nitrogen. tendon C. 8. getah lambung A.E. Manakah berikut ini yang mewakili urutan normal tahap-tahap perkembangan embrio? A. kulit mengekskresikan garam dalam jumlah yang lebih besar. kekurangan besi dalam diet E. Sekret yang mencerna karbohidrat dan protein adalah. Penyakit darah Rh dapat terjadi apabila ibu dengan Rh negatif. makan berlebih B. bronki C. Fungsi utama nefron adalah untuk. Humerus. 9    . medulla E.. mengalami eritroblastosis. D. A. D. gangguan kelenjar tiroid 4. C. Laju pernapasan dikendalikan oleh.. tidak olah raga C.. Pembelahan – formasi blastula – formasi mesoderm – formasi gastrula – formasi otot. kantung udara D. jaringan adiposa B. terdapat lebih sedikit evaporasi keringat. harus mengganti darahnya.. D. D. C... Pada hari yang lembab... A. 3. D.. memiliki bayi Rh negatif. mengatur komposisi kimia darah. gagal membentuk antibodi. B. Kondisi kelebihan berat badan dapat disebabkan oleh faktor-faktor berikut. menyerap makanan yang dicerna dari dalam usus halus. E. pepsin 9. keringat mengevaporasi dengan cepat. Formasi gastrula – formasi blastula – formasi mesoderm – pembelahan – formasi otot. A. saliva C.. memiliki bayi Rh positif B. E. kecuali.. paru-paru B.. Pembelahan – formasi blastula – formasi gastrula – formasi mesoderm – formasi otot... getah pankreas B.. ligamen A.. memakan terlalu banyak makanan berkalori tinggi D. tulang lengan atas manusia. E. C. membentuk urea dari produk-produk buangan hasil metabolisme protein. diafragma 10.

Apabila seseorang memiliki alel IAIB di dalam tubuhnya maka orang tersebut memiliki golongan darah AB. 75 bunga jingga 27 bunga merah 23 bunga kuning 8 bunga hijau 1. 12:3:1 A. Sifat alel IAIB dalam pembentukan golongan darah AB disebut.3. Bunga jingga disilangkan dengan bunga hijau menghasilkan jumlah keturunan sebagai berikut. rrPp dan RRPp B..56% 10    . D.. B-S. maka peluang keluarga tersebut memiliki dua anak laki-laki normal dan satu buta warna adalah.. Interaksi alel 6. A. 4.. 9:7 B. A. Proses pengubahan dari diploid menjadi haploid terjadi setelah meosis 2. Sifat ini diatur oleh tiga gen (ABC) yang apabila berada pada keadaan homozigot dominan untuk ketiga gen akan menghasilkan warna jingga. Seorang ibu carrier terhadap sifat buta warna menikah dengan laki-laki normal..3. Hal ini terjadi karena semua sifat terletak pada kromosom yang berbeda. RrPP dan rrpp E. rrPP dan rrPp D. 9:3:4 5... Epistasis C. maka genotip dari kedua induk adalah. 1:1 C. RrPp dan rrPP 7. RrPP dan RRPp C.GENETIKA Soal 1-2. Namun apa bila kedua sifat terletak pada kromosom yang sama maka hasil persilangan F1-nya adalah... D. Kodominan E. Apabila pasangan keluarga tersebut berharap memiliki 3 anak lelaki.7% B. Tentukan genotip dari induk yang berwarna jingga. 4. 3. Warna pada kembang sepatu merupakan sifat yang diturunkan secara poligeni.. Inkomplit dominan B.. Pada golongan darah terdapat tiga jenis alel. IO. 2. tetap 9:3:3:1 E.. Kriptomeri A. 1. IA. Gen A merupakan gen yang mengkode bahan baku untuk pigmen yang bisa diubah menjadi berbagai warna. Berdasarkan keterangan diatas.. Dua ekor ayam disilangkan dan diperoleh keturunan sebagai berikut: 10 walnut dan 3 rose.1. Tentukan jenis penyimpangan hukum mendel pada persilangan diatas.. karena pada saat itu jumlah kromosom hasil pembelahan adalah setengah dari jumlah kromosom sel induk. dan jika berada dalam keadaan homozigot resesif untuk ketiga gen maka warna bunga menjadi putih. Hasil persilangan F1 pada persilangan dihibrid yang dilakukan Mendel menghasilkan perbandingan 9. IB...

Kedua gen bersifat kodominan. tidak dapat ditentukan D. 6 fenotip E. Tiba-tiba kondisi lingkungan berubah dan menyebabkan kematian dari semua individu yang homozigot dominan sebelum mencapai usia dewasa. A.4 D.6 11.4. Kedua gen terpaut dan pada saat pembentukan gamet terjadi peristiwa pindah silang.25% D. Gen yang mengatur panjang sayap dan dan warna mata terletak pada kromosom yang sama B. Populasi dengan alel T dan t yang seimbang memiliki 36% individu dalam populasi dengan fenotip resesif. C. E. 0. 0. E. A.. kondisi lingkungan kembali normal. 7 fenotip B..5% E. Berdasarkan keterangan tersebut tentukanlah jumlah fenotip dari hasil persilangan kedua labu tersebut! D. 11    . Pada suatu populasi yang terdiri atas 1000 penduduk diketahui bahwa jumlah orang yang bergolongan darah O adalah adalah 16% dari jumlah penduduk dan jumlah penduduk yang bergolongan darah AB dan B masing-masing adalah 100 dan 90 orang. 0. 33 ekor sayap pendek mata coklat. 182 ekor pendek mata merah. Pada lalat buah diketahui bahwa sayap panjang (V) dominan terhadap sayap pendek (v) dan mata merah (M) dominan terhadap mata coklat (m). Seekor lalat yang heterozigot terhadap kedua sifat disilangkan dengan lalat yang homozigot resesif untuk kedua sifat. Hasil persilangannya adalah sebagai berikut: 180 ekor sayap panjang mata coklat. Setelah kejadian tersebut. Tentukanlah frekuensi alel IA pada populasi tersebut. Berdasarkan informasi diatas maka pernyataan berikut yang benar adalah. Berapa frekuensi alel T setelah satu generasi? A. Labu dengan genotip AABbcc memiliki berat buah 27 gr sedangkan labu dengan genotip AaBBCc memiliki berat buah 30 gr. 35 ekor sayap panjang ekor sayap panjang mata merah. 0. 6.2 C. 9 fenotip A. Berat buah labu ditentukan oleh beberapa gen yang dikenal dengan istilah poligeni.5 B. 0. 18. 12. 0.58. 10.75% 8.C. 0.. 0. Gen yang mengatur panjang sayap dan warna mata terletak pada kromosom yang terpisah C. B.26.7 E.7. 4 fenotip C. 5 fenotip 9. Gen yang mengatur warna mata terpaut kromosom seks sedangkan gen yang mengatur panjang sayap terletak pada autosom D. 0.

Jika A menunjukan alel dominan dan a adalah alel resesif. Oparin B.. maka jumlah gamet yang dapat dibentuknya adalah.menikah dengan laki-laki dengan golongan darah AB Rh+.5% D. Lamarck C. Wallace A. Radiasi adaptif D. Darwin E. Evolusi konvergen E. tereduksi atau hilang melalui penggunaan dan penghentian penggunaan... membesar. AA x aa EVOLUSI 1. A. Seorang wanita bergolongan darah O Rh. Peluang memperoleh anak kedua perempuan. bergolongan darah B dan Rh+ adalah 12. Probabilitas anak kedua bergolongan darah A dan AB adalah sama E. Jika seorang wanita yang ayahnya haemofilia menikah dengan laki-laki normal. 0% E. 25% C. Ketidakmampuan untuk terbang 12    . Probabilitas anak bergolongan darah O sama dengan Probabilitas anak A dan B 13. apakah genotip dari orang tua yang menghasilkan 300 keturunan dengan sifat dominan dan 100 keturunan dengan sifat resesif? D.. 16 14. 2 B. Spesiasi simpatrik C.maka pernyataan berikut yang tepat adalah. 8 C. Berapakan kemungkinan pasangan tersebut memiliki anak laki-laki yang menderita haemofilia? D.. 4 E. Kesetimbangan Hardy-Weinberg B. Apabila anak pertama mereka adalah laki-laki A Rh. Seorang laki dengan genotip AaBaCCDd (A dengan D terpaut). Aa x Aa B. tidak dapat ditentukan A. AA x AA E. D. AA x Aa C. Pada fenomena manakah berikut ini pengamatan Darwin tentang burung finch di kepulauan Galapagos menjadi contoh klasik? A. Aa x aa A..5% C.. 100% B. 75% A. Perubahan tersebut diturunkan pada generasi berikutnya.. Peluang untuk memperoleh anak kedua perempuan dengan golongan darah A dan Rh+ adalah 0% B. Mendel 2.” Pendapat tersebut adalah pendapat….12. D. 50% 15. “Suatu struktur diperoleh. Haemofilia merupakan penyakit menurun yang terpaut seks dan bersifat resesif. Apabila ia menghasilkan sperma. Jika anak kedua adalah Rh+ dan bergolongan darah A maka kemungkinan anak ketiga lahir normal adalah 12.

II. II dan III C. III. struktur yang memiliki karakter anatomi dasar yang sama. A. Resistensi DDT pada serangga. asal evolusi yang berbeda. tapi dapat digunakan untuk fungsi yang berbeda. Kadal Aristelliger kecil bermasalah dalam mempertahankan teritorinya. 5.. struktur yang memiliki karakter anatomi dasar yang berbeda. I. Seleksi alam bekerja pada individu. D. IV. 13    . Seleksi stabilisasi (’stabilizing selection’) ditunjukkan oleh. IV dan V B. II. Materi genetik dari individu adalah genotip.. II dan IV D.. E. A. tapi dapat digunakan untuk fungsi yang sama. tinggi rendah tinggi D. Seleksi mengarahkan (’directional selection’) ditunjukkan oleh. VI. Berikut ini pernyataan yang salah adalah. 5 dan 6. asal evolusi yang berbeda. V dan VI E.3. asal evolusi yang berbeda. Populasi burung Finch di Galapagos.. C. tinggi tinggi rendah E.. I. sedangkan yang besar mudah dimangsa burung hantu. B. II dan V 6. Seleksi alam mengarahkan populasi menjadi lebih sesuai terhadap lingkungannya. tapi dapat digunakan untuk fungsi yang sama. struktur yang memiliki karakter anatomi dasar yang sama. Populasi Biston betularia pada waktu revolusi industri. III dan VI E. D. Yang dimaksud dengan struktur analog adalah. V dan VI A.. III saja C. Leher jerapah. asal evolusi yang sama.. struktur yang memiliki karakter anatomi dasar yang sama. Seleksi alam menyebabkan perubahan genetik pada individual.. tapi dapat digunakan untuk fungsi yang sama. A. asal evolusi yang sama.. Evolusi adalah perubahan pada frekuensi alel dari suatu populasi. struktur yang memiliki karakter anatomi dasar yang sama. Gunakanlah pilihan berikut ini untuk menjawab pertanyaan no. B. E. II. tinggi tinggi tinggi 4. sedangkan materi genetik dari populasi adalah ‘gene pool’. Pada situasi manakah berikut ini evolusi berjalan paling lambat untuk suatu populasi ‘inter-breeding’? migrasi tekanan seleksi variasi karena mutasi A. D. tapi dapat digunakan untuk fungsi yang berbeda. tidak ada tinggi tinggi C. III dan V 7. IV saja B. C. V. Berat bayi manusia pada waktu lahir.... I. III. tidak ada rendah rendah B.

isolasi perilaku C. E. 10. maka mekanisme isolasi reproduksi ini disebut dengan. identik. D. berbeda. C. B. anak dari kedua pasangan secara genetis kemungkinan. B.. Manakah berikut ini yang merupakan kesamaan antara teori Darwin dan teori Lamarck mengenai evolusi? A. A. karena rendahnya kemungkinan mutasi. isolasi mekanis 9. Jika kembar identik albino menikah dengan kembar identik berambut keriting. C. identik. E. Evolusi mengarahkan organisme menjadi lebih kompleks. D. karena tingginya kemungkinan terjadinya mutasi acak. berbeda. identik. tidak berubah.. Adaptasi merupakan hasil dari penggunaan dan penghentian penggunaa struktur anatomi. karena ‘gene pool’ yang sifatnya umum dari induk.8. kecuali terjadi pindah silang. karena adanya segregasi acak pada waktu meiosis induk. Dua spesies yang berbeda tidak dapat melakukan perkawinan karena adanya mekanisme isolasi reproduktif. Catatan fosil mendukung pendapat bahwa spesies adalah tetap. Adaptasi evolusioner merupakan hasil dari interaksi antara organisme dengan lingkungannya. 14    . isolasi temporal A. Jika spesies yang serupa memiliki perbedaan struktural pada organorgan reproduksinya. D. isolasi gametik E... Adaptasi merupakan hasil dari perbedaan kesuksesan reproduksi. isolasi sterilisasi B...

. D. terjadi di dalam. jumlah individu meningkat. terjadi hanya di musim dingin. Ketika jumlah predator meningkat. mereka menyebabkan myxomatosis bagi bayi-bayi yang baru lahir. 4. E. terdapat indikasi jumlah relatif individu dan jumlah energi yang terlibat pada setiap tingkat. Pada dasar piramid. E. tidak adanya musuh alami menyebabkan mereka berbiak tak terbatas.. E. B. Ketika jumlah mangsa meningkat. B. B. Hubungan yang digambarkan dalam rantai makanan dapat juga diekspresikan sebagai piramid makanan. A. Pada semua tingkat. liang mereka di dalam tanah berbahaya bagi ternak. jumlah predator menurun. Ketika puncak piramid dicapai. mereka memindahkan ‘rabbit fever’ ke kangguru. 2. jumlah mangsa menurun. tidak mungkin. D. Ketika puncak piramid dicapai. C. Perbedaan utamanya adalah.. jumlah individu dan jumlah energi yang terlibat adalah paling besar. Ketika jumlah mangsa menurun. jumlah predator meningkat. jumlah mangsa meningkat.. 15    C.. jumlah individu dan jumlah energi yang terlibat adalah sama. Manakah berikut ini yang mungkin terjadi di dalam suatu ekosistem? A. mereka mengambil nutrisi yang berharga dari tanah. jumlah individu menurun tapi jumlah energinya meningkat. Ketika jumlah predator menurun. Ketika jumlah mangsa meningkat. Pernyataan manakah yang paling baik menyimpulkan hubungan tersebut? A. B. lorong-lorong yang . D. Kelinci menjadi ancaman di Australia karena. dan jumlah energi tetap sama dengan tingkatan lainnya. jumlah individu dan jumlah enrgi yang terlibat adalah paling rendah. Pada khatulistiwa. tipe pertumbuhan taiga. C. A. 3. di dalam piramida makanan. C. jumlah predator meningkat. seperti yang terlihat pada gambar..EKOLOGI 1. Pada dasar piramid.

C. kamouflase B. 6.. kelimpahan relatif spesies C. Alga hijau 3.. mimikri Batesian C. Sejenis ulat mempertahankan dirinya dari predator dengan cara membesarkan kepalanya sehingga menyerupai kepala ular yang ganas. A dan B benar E.. pertahanan mekanis A. merupakan karakter dari. lumut 16    . Pertumbuhan biji yang tidak terlindungi oleh ovarium merupakan karakteristik dari. Paku E. Generasi gametofit lebih dominan dari generasi sporofit. pada akhirnya dapat mengakibatkan terjadinya: A. Pertahanan seperti ini adalah contoh dari: D. frekuensi relatif spesies B.. A. B dan C benar 7. terjadi di gunung-gunung yang E. D.. memiliki kondisi ekstrim yang lebih. lebih sedikit menyerap radiasi sinar matahari. Tumbuhan yang menghasilkan buah. tanaman jagung B. paku C. 5. Angiospermae E. Paku C. Lumut C.. A. A. mimikri Müllerian E. lebih stabil.. jawaban A dan C benar BIOSISTEMATIK 1. proses koevolusi D. E. dan memiliki berkas pembuluh pada batang yang tersusun secara melingkar adalah. dan generasi sporofit masih menumpang pada generasi gametofit.. suhu bioma laut. kekayaan/jumlah spesies D. tinggi. terjadi hanya di gurun. pembagian sumber daya (resource partitioning) melalui seleksi alam C.. Kompetisi antara populasi dua spesies dengan relung (niche) yang hampir sama. B. Angiospermae D. Lumut B.. pertahanan aposematik 8. Keanekaragaman spesies dalam suatu komunitas ditentukan oleh: A. Dibandingkan dengan daratan. Gymnospermae A.. Alga hijau 2. di bawah titik beku... memiliki daun dengan tulang daun bercabang membentuk pola menyerupai jala. eliminasi (penyingkiran) populasi yang kalah bersaing B.. jawaban A dan B benar E. Gymnospermae B.. D..D. kurang stabil.

6 berkerabat paling dekat Sp. Graminae B. Liliaceae E. E. maka dendogram berikut menyatakan A. Tumbuhan-tumbuhan tersebut memiliki macam daun tunggal. 4 berkerabat paling dekat dibandingkan jenis lainnya Sp. filotaksis daun ada yang tersebar dan ada pula yang berhadapan dengan tepi daun bergerigi. Membandingkan dengan tumbuhan di Kebun Raya yang telah diketahui namanya C. Berdasarkan ciri-ciri tersebut. Modern taxonomy 17    .1 dan Sp. D. Semua cara di atas dapat dilakukan 7. C. Membandingkan dengan spesimen awetan di herbarium E. Menggunakan kunci identifikasi B. 3 dan Sp. A. pinus 4. tanaman kacang E. 5 dan Sp. Jika cabang-cabang pada diagram berikut ini menyatakan kesaman karakter tumbuhan.2 tidak mungkin berkerabat Sp.2 merupakan organisme yang sama Tidak mungkin ada dendogram seperti ini 6. B. pada beberapa jenis memiliki getah berwarna putih.. Diagram kekerabatan enam jenis tumbuhan dapat dinyatakan dalam dendogram di bawah ini. seorang mahasiswa menemukan beberapa jenis tumbuhan dengan ciri-ciri sebagai berikut : Bentuk hidup pada umumnya herba atau perdu. Perbungaan tersusun dalam kapitulum yang dilindungi oleh involukrum dan ditemukan dua macam bunga (bunga pita dan bunga tabung) yang berwarna kuning dan ungu.1 dan Sp. Omega taxonomy C. Salah satu aspek taksonomi yang hanya mengamati karakteristik morfologi saja disebut dengan : A. Alpha taxonomy B. Beta Taxonomy D. Asteraceae 5. beberapa jenis tumbuhan ini tergolong dalam satu suku…………………. Identifikasi suatu tumbuhan dapat dilakukan dengan cara: A. Euphorbiaceae D. Membandingkan gambar dalam pustaka botani D. Di suatu hutan tropis. Moraceae C.D. angka satu meyatakan kesamaan paling tinggi dan angka nol menyatakan tidak ada karakter yang sama. Sp.

Y saja. Spesies manakah yang kemungkinan lebih banyak berhasil/lulus hidup pada berbagai perubahan lingkungan sepanjang masa dari kedua diagram pohon filogeni di bawah ini? A. H & I C. A & C B. C & G   ***  D.E. 18    . Cladistic 8. X & Y E.

Sign up to vote on this title
UsefulNot useful