SOAL-SOAL BIOLOGI

BIOLOGI SEL DAN MOLEKULER 1. Pada organisme manakah berikut ini respirasi aerob terjadi? I Mammalia II. Tumbuhan tinggi A. hanya I B. hanya II C. hanya I dan III D. hanya II dan III E. I, II dan III

III. Protozoa

2. Struktur lipid mengandung semua hal berikut ini, kecuali…. A. gugus karboksil D. molekul asam lemak B. struktur dasar CH2O E. gugus OH C. molekul gliserol 3. RNA ditemukan pada.... A. nukleus saja B. sitoplasma saja C. nukleus dan sitoplasma D. protein E. asam amino 4. Selama proses respirasi, energi dipindahkan dari molekul glukosa ke molekul.... D. ATP A. ACTH E. BCG B. DNA C. RNA 5. Ribosom terlibat pada semua dari berikut ini kecuali A. Pembentukan ikatan peptida B. Aminoasilasi dari tRNA C. Pengikatan faktor protein selama elongasi D. Pengikatan aminoasil tRNA pada mRNA E. Pengikatan mRNA pada kodon inisiasi 6. Suatu galur E. coli yang tidak memiliki DNA polymerase I akan mengalami defisiensi dalam…..DNA D. degradasi A. perbaikan E. transkripsi B. metilasi C. penggabungan 7. Penyelesaian fase S dari siklus sel suatu sel mammalia ditandai dengan berikut ini kecuali A. Kandungan histon per sel dua kali lipat dibanding ketika sel berada pada G1 B. Pada DNA yang mengalami replikasi, basa-basa nitrogen yang baru terbentuk berpasangan dengan basa-basa parental C. Setiap kromosom yang mengalami replikasi memiliki empat telomer D. Sister chromatids berpisah dari satu sama lain E. Nukleus mengandung jumlah DNA yang ekivalen dengan suatu sel tetraploid yang berada pada G1
1   

kecuali A. 16% C. Monotrika C. 16% C. dimer purin A. Atrika 3. 30% A. tidak dapat ditentukan. DNA berbentuk heliks ganda dan linier C. Basil E. Ascomycota A. Jumlah basa timin sama dengan jumlah basa pirimidin. Kerusakan umum yang dijumpai pada DNA setelah pendedahan terhadap sinar ultraviolet adalah…. Politrika B. Diketahui bahwa salah satu rantai dari DNA terdiri atas 23% A. Flagella bakteria B.8. Eubacteria E. 30% C. 16% C. kinetokor B. Berikut pernyataan yang tidak benar mengenai DNA pada inti sel eukariot adalah…… A. 37% T. Orientasi kedua rantai berlawanan arah (antiparalel) D. Sarkomer sel-sel otot rangka C. kecuali : D. 30% T. rusaknya rantai tunggal C. Kokoid B. Cincin kontraktil pada sel-sel hewan yang membelah 10. 23% T. telomer C. dimer pirimidin E. 20% G c. Ujung 3’ adalah gugus fosfat E. 24% G MIKROBIOLOGI 1. Oomycota C. B. 23% A. Amphitrika A. kecuali : A. sentromer A. D. Tidak semua urutan basa dalam DNA adalah gen 12. Sarcina D. Serat tegang dari fibroblast D. Tipe flagella pada bakteri adalah sebagai berikut. 20% C. Bentuk-bentuk bakteri adalah sebagai berikut. 20% A. Struktur terspesialisasi yang berada pada ujung kromosom eukariot disebut D. transposisi B. Komposisi basa dalam rantai DNA tersebut d. Lofotrika E. Basidiomycota B. Filamen aktin dijumpai pada berikut ini. delesi basa 9. long terminal repeat (LTR) 11. dan 24% G. 24% G a. Spiral 2    . b. 37% A. terminator E. Mikrovili dari intestinal brush border E. Zygomycota 2. 37% T. 30% T. 20% G e. Ragi Saccharomyces cerevisiae diklasifikasikan dalam : D. Pseudo C.

Diatoms A. Menumbuhkannya pada suhu sangat rendah E. D. Berapa banyaknya sel yang ada pada 1 liter kultur ini: a. Delapan koloni bakteri tampak pada plat agar setelah 24 jam. setelah 1 jam? b. Dinding sel suatu ragi 6. Destruksi sitoskeleton 10.. acetylglucosamin. Suatu kultur bakteri diawali dengan 4 sel bakteri per ml pada medium pengaya dengan fase lag 1 jam dan waktu generasi 20 menit. Dinding sel suatu bakteri gram positif B. Absorbsi air E. berbagai L dan D asam amino. Dari kelompok organisme di bawah ini. Membran sitoplasma E. Bakteri C. Komponen ini merupakan : A. Suatu cara yang mudah untuk mengisolasi spesies Bacillus dan Clostridium secara spesifik dari tanah adalah dengan: A. 8 juta B. Mikroorganisme tertentu selalu penyebab penyakit tertentu B.25% sel awal mati? 5. D. jumlah bakteri individual yang ada pada mulanya adalah. Suatu prosedur laboratorium yang memungkinkan diperolehnya kembali mikroorganisme penyebab penyakit D.4. Rusaknya membran plasma A. Memanaskan tanah untuk membunuh semua sel vegetatif dan kemudian memungkinkan semua spora dari organisme ini untuk “berkecambah” dan tumbuh D. 2 E. Suatu pedoman yang dipakai untuk mengungkapkan suatu agen penyebab penyakit 8. Perubahan pada ekspresi gen B. Virus 9.. Penyebab fenomena ini adalah D. 4 C. setelah 2 jam? c. Menumbuhkannya secara aerobik pada medium yang mengandung glukosa B. setelah 2 jam bila 0. Metoda yang ditemukan oleh Koch untuk memurnikan mikroba C. Protozoa B. Postulat Koch adalah : A.. Menumbuhkannya secara anaerobik pada medium yang mengandung glukosa 3    . Dinding sel suatu bakteri gram negatif D. yang tidak dapat menghasilkan ATP sendiri adalah . Menumbuhkannya pada suhu tinggi C. Lichenes E. Inkubasi bakteri gram negatif dengan lisozim pada medium isotonik menyebabkan bakteri berbentuk batang menjadi berbentuk bulat (spherical) . 6 7. Destruksi dinding sel C. Salah satu komponen mengandung molekul berikut ini: asam acetylmuramat. Anda mengambil suatu kultur mikroba dan memfraksinasinya menjadi beberapa komponen. Glikogen C. 8 A. dan asam teichoat maupun asam lipoteichoat.

jantung. gen X akan ditranskripsi pada D. laju dari kedua reaksi maju dan balik B merubah… BIOTEKNOLOGI Gunakanlah tabel berikut untuk menjawab pertanyaan no. otak saja 2... Lac operon. material dari sel manusia di masukan ke dalam bakteri. konstanta kesetimbangan C. memiliki dinding sel yang mengandung peptidoglikan B. melindungi diri sendiri dengan menyekresikan antibiotik C.. Dalam usaha untuk mengklon protein manusia. mengkode urutan asam amino pada laktase C. Gen X ditranskripsi hanya ketika faktor A difosforilasi. ditemukan di sel eukariot B. A.. dan otak B. intron yang dilepaskan dari protein mRNA yang di transkripsi dan belum diproses 4    . autotrof E. Bakteri penyebab tetanus hanya dapat dibunuh dengan pemanasan yang lama di atas titik didih. Dari tiga jaringan ini.. Hal ini mengindikasikan bahwa bakteri tetanus…. A.11. menghasilkan endospora 12. protein yang mentraskripsi mRNA di inti D. otot. mengatur transkripsi dengan mengaktifkan atau menginaktifkan produksi dari protein represor E. entropi reaksi E.. Transkripsi gen X dikendalikan oleh transkripsi faktor A. protein mRNA yang ditemukan di sitoplasma E... mengatur translasi dari mRNA D. Suatu enzim yang mengkatalisis reaksi A A. otak dan jantung saja A. jantung saja C. Segmen DNA yang mengkode mRNA yang di transkripsi B. mensekresikan endotoksin D. mengatur replikasi DNA dengan mengaktifkan atau menginaktifkan protein induser 3. Data pada distribusi jaringan dari faktor A dan aktivitas dari suatu protein kinase dan protein fosfatase spesifik untuk faktor A ditunjukkan pada tabel di atas. kesetimbangan konsentrasi A D. panas reaksi B. Material yang berasal dari sel manusia tersebut adalah. 1 1. A.. otot saja E. rRNA dan tRNA yang dipergunakan selama proses translasi C.

. Northern blotting B. Polymerase chain reaction (PCR) E. Metode yang digunakan untuk mendeteksi RNA adalah … A. adalah suatu teknologi yang menggabungkan gen dari sumber yang berbeda kemudian mentransfernya ke sel dimana gen tersebut akan diekspresikan. Eastern blotting C. Kinetik hibridisasi double helix DNA sangat berhubungan dengan urutan basa nitrogen pada helix tersebut. 2) …………. Western blotting C. maka kebanyakan DNA … A. Urutan basa yang sangat kompleks yang menjadi sederhana ketika suhu dinaikkan E.…. Perhatikan diagram dibawah ini! Tanda panah pada diagram menunjukkan tempat pemotongan dari enzim Tag I. gen bakteri dapat ditransfer dari satu sel ke sel lainnya melalui 3 proses yaitu 1) …………….. Western blotting C.. ……… ……. Rantai tunggal oleh denaturasi pada suhu yang lebih rendah B. Mampu menyerap sinar UV lebih banyak dibandingkan dengan temperatur di atas titik lelehnya. Northern blotting A. Polymerase chain reaction (PCR) D.4. 6. Southern blotting 5    . Eastern blotting B. Manakah hasil pemotongan yang tepat dari enzim tersebut? 5. Hibridisasi untuk membentuk untai yang lebih panjang dan stabil D.. Di alam. 7. Eastern blotting B.. Northern blotting A. Southern blotting 9. Rantai ganda akibat kuatnya ikatan hydrogen C. Polymerase chain reaction (PCR) E. Western blotting E. Metode yang digunakan untuk mendeteksi suatu protein adalah … D. dan 3) ………. Pada temperatur di bawah titik leleh untai DNA komplementer. Metode yang digunakan untuk mendeteksi DNA adalah … D. Southern blotting 8.

.10-11 tentang rekayasa genetik. MEM II D.500 nukloetida. ERA I. . Ket: Urutan DNA yang digarisbawahi menunjukkan gen yang akan diklon Urutan enzim restriksi ERA I: GTAAATG CRO I: CAGGAC MEM II: GCCG 10.GTGTCAGGACGGGTGAAAGCCAGGACGCCGAATCG… 5000 nukleotida lagi. Enzim manakah yang seharusnya digunakan untuk memasukkan urutan DNA manusia ke dalam plasmid bakteri? A.. 3 B.Gunakan petunjuk berikut ini untuk menjawab pertanyaan No. CRO I dan ERA I E. Tidak ada D. Lebih dari 3 C. 2 11.. CRO I C.. dan MEM II 12. 1 E. Plasmid bakteri dengan urutan: ATCCCA… 1000 nukleotida… …ATTAAGGCCTTACAGGACCCCGGAATGAGAGTA ATGGGCTATTCAGGTA … 200 nukleotida lagi. CRO I. Urutan DNA manusia: ATATCGTAATGTTGGTG. Mengapa enzim restriksi yang terdapat pada suatu sel tidak merusak DNA sel tersebut meskipun sel tersebut memiliki urutan yang mampu dikenali oleh enzim restriksinya? ……………………………………………………………………………………………… ……………………………………………………………………………………………… 6    . ERA I B. Berapa banyak sisi restriksi yang terdapat pada urutan plasmid bakteri? A.

ujung akar memanjang dengan laju yang sama setiap hari. Suatu teknik yang telah disempurnakan digunakan untuk memotong ujung akar dan menempatkannya pada larutan nutrien steril. Peningkatan terkecil pada pertumbuhan dicapai. pada akhir hari ke sepuluh. C.. laju pertumbuhan setelah hari ke delapan memiliki laju yang sama dengan hari sebelumnya. Ujung akar tidak menunjukkan adanya pertumbuhan. peningkatan suhu saja.. lentisel C.. ujung akar tersebut akan memanjang dan menghasilkan akar sekunder. D. A. Dalam kondisi suhu yang diatur. selama tiga hari pertengahan. pada akhir hari ke tiga. B. peningkatan kelembaban dan penurunan suhu. Struktur yang menghantarkan materi ke seluruh tubuh tanaman disebut. peningkatan kelembaban dan pergerakan udara. A.. selama tiga hari pertama. E. D.. E. Laju transpirasi suatu pohon kemungkinan akan meningkat seiring dengan.. 5. oleh grafik. peningkatan kelembaban dan suhu. 2. Seorang peneliti melakukan pengukuran harian terhadap akar tomat pada suhu 33°C-35°C dengan cara ini... E. 4.. D. ikatan pembuluh B... meristem D. 3. peningkatan suhu dan pergerakan udara. A. Grafik akan menunjukkan garis lurus jika. D. pada akhir hari pertama. pada akhir hari ke delapan. A. C.. pertumbuhan pada dua hari pertama identik. larutan nutrien kemudian ditambah dengan hormon pertumbuhan akar. pada hari ke tiga. E. Hasilnya dipetakan pada grafik berikut.. A. kambium 7    . pada hari ke delapan.. B. pada waktu yang tidak ditunjukkan B. C. C.. suhunya dipertahankan 37°C secara konstan. B.ANATOMI DAN FISIOLOGI TUMBUHAN 1. selama tiga hari terakhir.

. siang dan malam. Tumbuhnya daun menuju cahaya dihasilkan dari. D. B. xilem dan floem 8. Sel-sel pembuat makanan pada tumbuhan terletak di. sel penjaga C. Ketika wanita hamil mengkonsumsi alkohol dan nikotin. B. pembuluh C. D. Kadar oksigen di dalam darah berhubungan dengan detak jantung. Hipotalamus mengurangi masukan TSH ke pituitary. berdifusi dari darah ibu ke darah embrio di dalam plasenta. hanya pada siang hari. jaringan spons B. geotropisme positif. C.. D. Pernyataan manakah yang menggambarkan mekanisme umpan balik yang melibatkan kelenjar tiroid? A. E. D... 2. A.. hanya ketika fotosintesis sedang berjalan.. tumbuhan hijau menyerap... air B. oksigen D. stomata B.... C. A. A. ANATOMI DAN FISIOLOGI HEWAN 1. konsentrasi auksin yang lebih besar pada bagian yang terkena cahaya. 8    . hanya pada malam hari. fototropisme negatif. Produksi estrogen merangsang pembuntukan gamet untuk reproduksi seksual. E. Tumbuhan hijau melakukan respirasi. B. mempengaruhi ovulasi... embrionya berada dalam resiko karena racun-racun tersebut dapat. memasuki uterus melalui perut ibu.E. Selama respirasi.. rambut akar E. B. karbon dioksida C. Produksi urin memungkinkan untuk ekskresi buangan sel. A.. hanya ketika fotosintesis tidak sedang berjalan. pindah ke embrio karena darah ibu bercampur dengan darah embrio di dalam plasenta. kayu 7. Kambium terletak di dekat.. Jumlah karbon dioksida di dalam daran meningkat dengan olah raga. E. xilem D. A. C. epidermis D. epidermis 6. A. floem E... konsentrasi auksin yang sama pada seluruh sisi batang. C. 9. oksigen dan air 10. konsentrasi auksin yang lebih besar pada bagian yang terlindungi. karbon dioksida dan air E.

Pada hari yang lembab.. getah pankreas B. 6. memecah sel darah merah untuk membentuk buangan nitrogen. ptialin E. bronki C. D.. D. C. memakan terlalu banyak makanan berkalori tinggi D.. A. paru-paru B.. Laju pernapasan dikendalikan oleh. kulit mengekskresikan garam dalam jumlah yang lebih besar.. diafragma 10.. A. ekstensor 7. jaringan rawan E. dihubungkan secara langsung dengan tulang lengan lainnya oleh. E. harus mengganti darahnya. terdapat lebih sedikit evaporasi keringat... mengumpulkan urin setelah mengalir melalui uretra. mengalami eritroblastosis. makan berlebih B. permukaan kulit terlalu kering.. Sekret yang mencerna karbohidrat dan protein adalah. 3. ia lebih banyak berkeringat. E. saliva C. menyerap makanan yang dicerna dari dalam usus halus. Pembelahan – formasi blastula – formasi mesoderm – formasi gastrula – formasi otot. B. jaringan adiposa B.. gagal membentuk antibodi. Manakah berikut ini yang mewakili urutan normal tahap-tahap perkembangan embrio? A.E. C. gangguan kelenjar tiroid 4... 8. Kondisi kelebihan berat badan dapat disebabkan oleh faktor-faktor berikut. memiliki bayi Rh positif B. A. E. D. orang merasa tidak nyaman karena. A. Penyakit darah Rh dapat terjadi apabila ibu dengan Rh negatif. kekurangan besi dalam diet E.. C. getah lambung A. E. D. mengatur komposisi kimia darah. 5.. D... Pembelahan – formasi blastula – formasi otot – formasi gastrula – formasi mesoderm. Humerus. keringat mengevaporasi dengan cepat.... Fungsi utama nefron adalah untuk. B. kantung udara D. B. berdifusi ke dalam air susu ibu yang akan diminum oleh bayi. Formasi blastula – formasi gastrula – formasi mesoderm – pembelahan – formasi otot. kecuali. memiliki bayi Rh negatif. membentuk urea dari produk-produk buangan hasil metabolisme protein. tulang lengan atas manusia. medulla E. tidak olah raga C. tendon C. ligamen A. pepsin 9.. C. Formasi gastrula – formasi blastula – formasi mesoderm – pembelahan – formasi otot. Pembelahan – formasi blastula – formasi gastrula – formasi mesoderm – formasi otot. D. 9    . A.

. rrPp dan RRPp B... dan jika berada dalam keadaan homozigot resesif untuk ketiga gen maka warna bunga menjadi putih. Proses pengubahan dari diploid menjadi haploid terjadi setelah meosis 2.GENETIKA Soal 1-2.3. 75 bunga jingga 27 bunga merah 23 bunga kuning 8 bunga hijau 1.. Hasil persilangan F1 pada persilangan dihibrid yang dilakukan Mendel menghasilkan perbandingan 9.. Apabila seseorang memiliki alel IAIB di dalam tubuhnya maka orang tersebut memiliki golongan darah AB. karena pada saat itu jumlah kromosom hasil pembelahan adalah setengah dari jumlah kromosom sel induk. 1... Apabila pasangan keluarga tersebut berharap memiliki 3 anak lelaki. Warna pada kembang sepatu merupakan sifat yang diturunkan secara poligeni.56% 10    . 9:7 B.. IO. IB. maka peluang keluarga tersebut memiliki dua anak laki-laki normal dan satu buta warna adalah. Pada golongan darah terdapat tiga jenis alel. Kriptomeri A.3. Gen A merupakan gen yang mengkode bahan baku untuk pigmen yang bisa diubah menjadi berbagai warna. maka genotip dari kedua induk adalah. A. 3. 12:3:1 A.1.. Dua ekor ayam disilangkan dan diperoleh keturunan sebagai berikut: 10 walnut dan 3 rose. 4. 9:3:4 5. Inkomplit dominan B... 1:1 C.. Seorang ibu carrier terhadap sifat buta warna menikah dengan laki-laki normal. IA. Kodominan E.. 4. RrPP dan RRPp C. D. Tentukan jenis penyimpangan hukum mendel pada persilangan diatas. Interaksi alel 6. Tentukan genotip dari induk yang berwarna jingga. Sifat alel IAIB dalam pembentukan golongan darah AB disebut.. 2. A. RrPp dan rrPP 7.. tetap 9:3:3:1 E. Epistasis C. Sifat ini diatur oleh tiga gen (ABC) yang apabila berada pada keadaan homozigot dominan untuk ketiga gen akan menghasilkan warna jingga. Berdasarkan keterangan diatas. Hal ini terjadi karena semua sifat terletak pada kromosom yang berbeda. B-S. Bunga jingga disilangkan dengan bunga hijau menghasilkan jumlah keturunan sebagai berikut.7% B. D. rrPP dan rrPp D. Namun apa bila kedua sifat terletak pada kromosom yang sama maka hasil persilangan F1-nya adalah.. RrPP dan rrpp E.

5 B. E. 0. 11    . A. 10. 33 ekor sayap pendek mata coklat. Kedua gen bersifat kodominan. Berdasarkan informasi diatas maka pernyataan berikut yang benar adalah.. 4 fenotip C. kondisi lingkungan kembali normal. C.4 D.2 C.. 7 fenotip B. 9 fenotip A. Kedua gen terpaut dan pada saat pembentukan gamet terjadi peristiwa pindah silang.C. 5 fenotip 9.5% E. 0. B. Seekor lalat yang heterozigot terhadap kedua sifat disilangkan dengan lalat yang homozigot resesif untuk kedua sifat. 0. 0.58. 0. Gen yang mengatur warna mata terpaut kromosom seks sedangkan gen yang mengatur panjang sayap terletak pada autosom D. 0. Tentukanlah frekuensi alel IA pada populasi tersebut. Populasi dengan alel T dan t yang seimbang memiliki 36% individu dalam populasi dengan fenotip resesif. 6 fenotip E. 35 ekor sayap panjang ekor sayap panjang mata merah. Gen yang mengatur panjang sayap dan warna mata terletak pada kromosom yang terpisah C. tidak dapat ditentukan D. 182 ekor pendek mata merah. 0. Hasil persilangannya adalah sebagai berikut: 180 ekor sayap panjang mata coklat. 12. 0. Berat buah labu ditentukan oleh beberapa gen yang dikenal dengan istilah poligeni. 6.26. Berapa frekuensi alel T setelah satu generasi? A. Setelah kejadian tersebut. 0. Labu dengan genotip AABbcc memiliki berat buah 27 gr sedangkan labu dengan genotip AaBBCc memiliki berat buah 30 gr. 18. E. Gen yang mengatur panjang sayap dan dan warna mata terletak pada kromosom yang sama B. Pada suatu populasi yang terdiri atas 1000 penduduk diketahui bahwa jumlah orang yang bergolongan darah O adalah adalah 16% dari jumlah penduduk dan jumlah penduduk yang bergolongan darah AB dan B masing-masing adalah 100 dan 90 orang. Pada lalat buah diketahui bahwa sayap panjang (V) dominan terhadap sayap pendek (v) dan mata merah (M) dominan terhadap mata coklat (m).7 E. Berdasarkan keterangan tersebut tentukanlah jumlah fenotip dari hasil persilangan kedua labu tersebut! D.25% D.75% 8. Tiba-tiba kondisi lingkungan berubah dan menyebabkan kematian dari semua individu yang homozigot dominan sebelum mencapai usia dewasa.4.6 11. A.7..

. Oparin B. bergolongan darah B dan Rh+ adalah 12. AA x Aa C.menikah dengan laki-laki dengan golongan darah AB Rh+. 25% C.5% C.5% D. Lamarck C. Darwin E. 0% E.. Radiasi adaptif D.. AA x AA E. membesar. 16 14. D. Jika anak kedua adalah Rh+ dan bergolongan darah A maka kemungkinan anak ketiga lahir normal adalah 12. apakah genotip dari orang tua yang menghasilkan 300 keturunan dengan sifat dominan dan 100 keturunan dengan sifat resesif? D. 100% B. Mendel 2.maka pernyataan berikut yang tepat adalah.12. D. 4 E.” Pendapat tersebut adalah pendapat…. Wallace A... Spesiasi simpatrik C. Apabila ia menghasilkan sperma. Evolusi konvergen E.. 50% 15. Aa x aa A. Probabilitas anak bergolongan darah O sama dengan Probabilitas anak A dan B 13. Seorang laki dengan genotip AaBaCCDd (A dengan D terpaut). Aa x Aa B. Berapakan kemungkinan pasangan tersebut memiliki anak laki-laki yang menderita haemofilia? D. Apabila anak pertama mereka adalah laki-laki A Rh. Kesetimbangan Hardy-Weinberg B. Jika A menunjukan alel dominan dan a adalah alel resesif. 2 B. Perubahan tersebut diturunkan pada generasi berikutnya. Ketidakmampuan untuk terbang 12    . tidak dapat ditentukan A. Probabilitas anak kedua bergolongan darah A dan AB adalah sama E. “Suatu struktur diperoleh. AA x aa EVOLUSI 1. Peluang memperoleh anak kedua perempuan. Pada fenomena manakah berikut ini pengamatan Darwin tentang burung finch di kepulauan Galapagos menjadi contoh klasik? A. tereduksi atau hilang melalui penggunaan dan penghentian penggunaan. Seorang wanita bergolongan darah O Rh. Jika seorang wanita yang ayahnya haemofilia menikah dengan laki-laki normal. Peluang untuk memperoleh anak kedua perempuan dengan golongan darah A dan Rh+ adalah 0% B. 75% A. maka jumlah gamet yang dapat dibentuknya adalah. A... Haemofilia merupakan penyakit menurun yang terpaut seks dan bersifat resesif. 8 C.

Pada situasi manakah berikut ini evolusi berjalan paling lambat untuk suatu populasi ‘inter-breeding’? migrasi tekanan seleksi variasi karena mutasi A. V. asal evolusi yang sama. II dan IV D. I. Populasi Biston betularia pada waktu revolusi industri. Materi genetik dari individu adalah genotip. Leher jerapah... III. C. tidak ada tinggi tinggi C. II.. asal evolusi yang berbeda. D. III. E. A.3. Kadal Aristelliger kecil bermasalah dalam mempertahankan teritorinya. Seleksi mengarahkan (’directional selection’) ditunjukkan oleh. V dan VI E. II dan V 6. V dan VI A. III dan V 7. tinggi tinggi rendah E. Seleksi alam menyebabkan perubahan genetik pada individual. IV dan V B. B. D. tapi dapat digunakan untuk fungsi yang sama. Seleksi alam mengarahkan populasi menjadi lebih sesuai terhadap lingkungannya. Seleksi stabilisasi (’stabilizing selection’) ditunjukkan oleh.. I. 5 dan 6. III dan VI E.. II dan III C. A. sedangkan yang besar mudah dimangsa burung hantu. struktur yang memiliki karakter anatomi dasar yang sama. struktur yang memiliki karakter anatomi dasar yang berbeda. tapi dapat digunakan untuk fungsi yang sama. tapi dapat digunakan untuk fungsi yang berbeda. Resistensi DDT pada serangga. 5. tapi dapat digunakan untuk fungsi yang berbeda. asal evolusi yang sama.. struktur yang memiliki karakter anatomi dasar yang sama. Seleksi alam bekerja pada individu. Yang dimaksud dengan struktur analog adalah. II. B. Evolusi adalah perubahan pada frekuensi alel dari suatu populasi. IV saja B... VI. Populasi burung Finch di Galapagos. struktur yang memiliki karakter anatomi dasar yang sama. asal evolusi yang berbeda. tinggi tinggi tinggi 4.. A. IV. I. sedangkan materi genetik dari populasi adalah ‘gene pool’. tinggi rendah tinggi D. E. Berat bayi manusia pada waktu lahir. Berikut ini pernyataan yang salah adalah... III saja C. tapi dapat digunakan untuk fungsi yang sama. 13    . tidak ada rendah rendah B. C. Gunakanlah pilihan berikut ini untuk menjawab pertanyaan no. asal evolusi yang berbeda.. II. struktur yang memiliki karakter anatomi dasar yang sama. D.

berbeda. identik. E. Evolusi mengarahkan organisme menjadi lebih kompleks. isolasi mekanis 9. B. D. 14    . Manakah berikut ini yang merupakan kesamaan antara teori Darwin dan teori Lamarck mengenai evolusi? A. Dua spesies yang berbeda tidak dapat melakukan perkawinan karena adanya mekanisme isolasi reproduktif. tidak berubah. berbeda. Adaptasi merupakan hasil dari perbedaan kesuksesan reproduksi. 10. isolasi sterilisasi B. anak dari kedua pasangan secara genetis kemungkinan. karena ‘gene pool’ yang sifatnya umum dari induk. kecuali terjadi pindah silang. karena tingginya kemungkinan terjadinya mutasi acak. B. Adaptasi evolusioner merupakan hasil dari interaksi antara organisme dengan lingkungannya. D. C.. A. karena adanya segregasi acak pada waktu meiosis induk.. maka mekanisme isolasi reproduksi ini disebut dengan.8. isolasi temporal A. E. isolasi perilaku C.. Jika spesies yang serupa memiliki perbedaan struktural pada organorgan reproduksinya. identik. C. D.... karena rendahnya kemungkinan mutasi. Jika kembar identik albino menikah dengan kembar identik berambut keriting. Adaptasi merupakan hasil dari penggunaan dan penghentian penggunaa struktur anatomi. isolasi gametik E. Catatan fosil mendukung pendapat bahwa spesies adalah tetap. identik.

Manakah berikut ini yang mungkin terjadi di dalam suatu ekosistem? A. seperti yang terlihat pada gambar. 15    C. Perbedaan utamanya adalah. jumlah predator meningkat. Ketika jumlah mangsa meningkat. lorong-lorong yang . B. tidak adanya musuh alami menyebabkan mereka berbiak tak terbatas. tipe pertumbuhan taiga. mereka mengambil nutrisi yang berharga dari tanah.. jumlah individu dan jumlah energi yang terlibat adalah sama. A. Pada semua tingkat. liang mereka di dalam tanah berbahaya bagi ternak. mereka memindahkan ‘rabbit fever’ ke kangguru. terdapat indikasi jumlah relatif individu dan jumlah energi yang terlibat pada setiap tingkat. dan jumlah energi tetap sama dengan tingkatan lainnya. B. D. Ketika jumlah mangsa menurun.. 2. jumlah predator menurun. jumlah individu meningkat. Ketika jumlah mangsa meningkat. C. C. E. mereka menyebabkan myxomatosis bagi bayi-bayi yang baru lahir. Pernyataan manakah yang paling baik menyimpulkan hubungan tersebut? A. B. jumlah individu dan jumlah energi yang terlibat adalah paling besar.. terjadi di dalam. D.. Kelinci menjadi ancaman di Australia karena. E. Pada khatulistiwa. Pada dasar piramid. Ketika jumlah predator meningkat. A. jumlah predator meningkat. B. tidak mungkin. jumlah mangsa menurun. E... 3. terjadi hanya di musim dingin. Ketika puncak piramid dicapai. D. Pada dasar piramid. jumlah individu dan jumlah enrgi yang terlibat adalah paling rendah.EKOLOGI 1. jumlah mangsa meningkat. Ketika jumlah predator menurun. jumlah individu menurun tapi jumlah energinya meningkat. Hubungan yang digambarkan dalam rantai makanan dapat juga diekspresikan sebagai piramid makanan. 4. C. Ketika puncak piramid dicapai. di dalam piramida makanan.

Pertumbuhan biji yang tidak terlindungi oleh ovarium merupakan karakteristik dari. Angiospermae D. kurang stabil. di bawah titik beku. 5... Keanekaragaman spesies dalam suatu komunitas ditentukan oleh: A.... proses koevolusi D. jawaban A dan C benar BIOSISTEMATIK 1. jawaban A dan B benar E. eliminasi (penyingkiran) populasi yang kalah bersaing B. pertahanan aposematik 8.. merupakan karakter dari. paku C. kelimpahan relatif spesies C. Angiospermae E.D. kamouflase B. A. 6. pada akhirnya dapat mengakibatkan terjadinya: A. frekuensi relatif spesies B. Gymnospermae B. E. Pertahanan seperti ini adalah contoh dari: D. tanaman jagung B.. Sejenis ulat mempertahankan dirinya dari predator dengan cara membesarkan kepalanya sehingga menyerupai kepala ular yang ganas.. pembagian sumber daya (resource partitioning) melalui seleksi alam C. mimikri Batesian C. A dan B benar E.. memiliki kondisi ekstrim yang lebih. Tumbuhan yang menghasilkan buah. Alga hijau 3. Dibandingkan dengan daratan. C. Lumut C.. terjadi hanya di gurun. B dan C benar 7. Paku E. Kompetisi antara populasi dua spesies dengan relung (niche) yang hampir sama. B. Alga hijau 2. Lumut B. Generasi gametofit lebih dominan dari generasi sporofit. Paku C.. memiliki daun dengan tulang daun bercabang membentuk pola menyerupai jala... tinggi. A. dan memiliki berkas pembuluh pada batang yang tersusun secara melingkar adalah. mimikri Müllerian E. suhu bioma laut. lebih sedikit menyerap radiasi sinar matahari. pertahanan mekanis A. D. Gymnospermae A. terjadi di gunung-gunung yang E. kekayaan/jumlah spesies D... lumut 16    . D. A. dan generasi sporofit masih menumpang pada generasi gametofit. lebih stabil..

Sp. Alpha taxonomy B. Omega taxonomy C. Berdasarkan ciri-ciri tersebut. Membandingkan dengan spesimen awetan di herbarium E.2 merupakan organisme yang sama Tidak mungkin ada dendogram seperti ini 6. Diagram kekerabatan enam jenis tumbuhan dapat dinyatakan dalam dendogram di bawah ini.1 dan Sp. Perbungaan tersusun dalam kapitulum yang dilindungi oleh involukrum dan ditemukan dua macam bunga (bunga pita dan bunga tabung) yang berwarna kuning dan ungu. Euphorbiaceae D. seorang mahasiswa menemukan beberapa jenis tumbuhan dengan ciri-ciri sebagai berikut : Bentuk hidup pada umumnya herba atau perdu. Tumbuhan-tumbuhan tersebut memiliki macam daun tunggal. D. A. angka satu meyatakan kesamaan paling tinggi dan angka nol menyatakan tidak ada karakter yang sama. pinus 4. C. Semua cara di atas dapat dilakukan 7. Membandingkan gambar dalam pustaka botani D. tanaman kacang E. 4 berkerabat paling dekat dibandingkan jenis lainnya Sp. B. pada beberapa jenis memiliki getah berwarna putih. Menggunakan kunci identifikasi B. Jika cabang-cabang pada diagram berikut ini menyatakan kesaman karakter tumbuhan. Asteraceae 5. Liliaceae E. 3 dan Sp. Graminae B.1 dan Sp. 6 berkerabat paling dekat Sp.. maka dendogram berikut menyatakan A. Salah satu aspek taksonomi yang hanya mengamati karakteristik morfologi saja disebut dengan : A.2 tidak mungkin berkerabat Sp. Membandingkan dengan tumbuhan di Kebun Raya yang telah diketahui namanya C. Di suatu hutan tropis.D. Beta Taxonomy D. 5 dan Sp. beberapa jenis tumbuhan ini tergolong dalam satu suku…………………. Moraceae C. Modern taxonomy 17    . E. Identifikasi suatu tumbuhan dapat dilakukan dengan cara: A. filotaksis daun ada yang tersebar dan ada pula yang berhadapan dengan tepi daun bergerigi.

H & I C. A & C B. X & Y E. 18    . Y saja. Cladistic 8. C & G   ***  D.E. Spesies manakah yang kemungkinan lebih banyak berhasil/lulus hidup pada berbagai perubahan lingkungan sepanjang masa dari kedua diagram pohon filogeni di bawah ini? A.

Sign up to vote on this title
UsefulNot useful