P. 1
Soal-Soal Biologi

Soal-Soal Biologi

|Views: 47|Likes:
Published by Purwanti Widhy

More info:

Published by: Purwanti Widhy on Apr 15, 2011
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

04/15/2011

pdf

text

original

SOAL-SOAL BIOLOGI

BIOLOGI SEL DAN MOLEKULER 1. Pada organisme manakah berikut ini respirasi aerob terjadi? I Mammalia II. Tumbuhan tinggi A. hanya I B. hanya II C. hanya I dan III D. hanya II dan III E. I, II dan III

III. Protozoa

2. Struktur lipid mengandung semua hal berikut ini, kecuali…. A. gugus karboksil D. molekul asam lemak B. struktur dasar CH2O E. gugus OH C. molekul gliserol 3. RNA ditemukan pada.... A. nukleus saja B. sitoplasma saja C. nukleus dan sitoplasma D. protein E. asam amino 4. Selama proses respirasi, energi dipindahkan dari molekul glukosa ke molekul.... D. ATP A. ACTH E. BCG B. DNA C. RNA 5. Ribosom terlibat pada semua dari berikut ini kecuali A. Pembentukan ikatan peptida B. Aminoasilasi dari tRNA C. Pengikatan faktor protein selama elongasi D. Pengikatan aminoasil tRNA pada mRNA E. Pengikatan mRNA pada kodon inisiasi 6. Suatu galur E. coli yang tidak memiliki DNA polymerase I akan mengalami defisiensi dalam…..DNA D. degradasi A. perbaikan E. transkripsi B. metilasi C. penggabungan 7. Penyelesaian fase S dari siklus sel suatu sel mammalia ditandai dengan berikut ini kecuali A. Kandungan histon per sel dua kali lipat dibanding ketika sel berada pada G1 B. Pada DNA yang mengalami replikasi, basa-basa nitrogen yang baru terbentuk berpasangan dengan basa-basa parental C. Setiap kromosom yang mengalami replikasi memiliki empat telomer D. Sister chromatids berpisah dari satu sama lain E. Nukleus mengandung jumlah DNA yang ekivalen dengan suatu sel tetraploid yang berada pada G1
1   

Ascomycota A. dimer pirimidin E. Amphitrika A. Ragi Saccharomyces cerevisiae diklasifikasikan dalam : D. Bentuk-bentuk bakteri adalah sebagai berikut. tidak dapat ditentukan. 37% A. telomer C. Basil E. 24% G MIKROBIOLOGI 1. kinetokor B. 37% T. b. Komposisi basa dalam rantai DNA tersebut d. Politrika B. Sarcina D. Zygomycota 2. kecuali : A. Pseudo C. Mikrovili dari intestinal brush border E. Eubacteria E. B. Orientasi kedua rantai berlawanan arah (antiparalel) D. 30% T. 16% C. 37% T. Spiral 2    . 20% G c. Cincin kontraktil pada sel-sel hewan yang membelah 10. 30% T. Tipe flagella pada bakteri adalah sebagai berikut. delesi basa 9. Flagella bakteria B. 20% C. Struktur terspesialisasi yang berada pada ujung kromosom eukariot disebut D. 20% A. Ujung 3’ adalah gugus fosfat E. dimer purin A. D. 24% G a. Tidak semua urutan basa dalam DNA adalah gen 12. Berikut pernyataan yang tidak benar mengenai DNA pada inti sel eukariot adalah…… A. 16% C. DNA berbentuk heliks ganda dan linier C. 30% C. 16% C. Basidiomycota B. long terminal repeat (LTR) 11. Diketahui bahwa salah satu rantai dari DNA terdiri atas 23% A. Atrika 3. Kokoid B. Filamen aktin dijumpai pada berikut ini. Monotrika C. Lofotrika E. Kerusakan umum yang dijumpai pada DNA setelah pendedahan terhadap sinar ultraviolet adalah…. Oomycota C. sentromer A. Jumlah basa timin sama dengan jumlah basa pirimidin. terminator E. kecuali A. 20% G e. rusaknya rantai tunggal C. 23% A. 30% A.8. transposisi B. dan 24% G. Sarkomer sel-sel otot rangka C. 23% T. Serat tegang dari fibroblast D. kecuali : D.

Lichenes E. Perubahan pada ekspresi gen B.25% sel awal mati? 5. yang tidak dapat menghasilkan ATP sendiri adalah .4. Berapa banyaknya sel yang ada pada 1 liter kultur ini: a. Anda mengambil suatu kultur mikroba dan memfraksinasinya menjadi beberapa komponen. acetylglucosamin. Rusaknya membran plasma A. berbagai L dan D asam amino. Glikogen C. Komponen ini merupakan : A. Destruksi dinding sel C. Delapan koloni bakteri tampak pada plat agar setelah 24 jam. Suatu pedoman yang dipakai untuk mengungkapkan suatu agen penyebab penyakit 8. Suatu kultur bakteri diawali dengan 4 sel bakteri per ml pada medium pengaya dengan fase lag 1 jam dan waktu generasi 20 menit. Dinding sel suatu bakteri gram negatif D. setelah 1 jam? b. Menumbuhkannya secara anaerobik pada medium yang mengandung glukosa 3    . Menumbuhkannya pada suhu sangat rendah E. Dinding sel suatu bakteri gram positif B. 2 E. Postulat Koch adalah : A. Mikroorganisme tertentu selalu penyebab penyakit tertentu B. Penyebab fenomena ini adalah D. 6 7. 4 C. Protozoa B. D. Bakteri C. Metoda yang ditemukan oleh Koch untuk memurnikan mikroba C. Suatu prosedur laboratorium yang memungkinkan diperolehnya kembali mikroorganisme penyebab penyakit D. Memanaskan tanah untuk membunuh semua sel vegetatif dan kemudian memungkinkan semua spora dari organisme ini untuk “berkecambah” dan tumbuh D. dan asam teichoat maupun asam lipoteichoat. Dinding sel suatu ragi 6. Salah satu komponen mengandung molekul berikut ini: asam acetylmuramat. Absorbsi air E. Membran sitoplasma E. 8 A. Dari kelompok organisme di bawah ini. setelah 2 jam bila 0. Menumbuhkannya secara aerobik pada medium yang mengandung glukosa B. Destruksi sitoskeleton 10. Inkubasi bakteri gram negatif dengan lisozim pada medium isotonik menyebabkan bakteri berbentuk batang menjadi berbentuk bulat (spherical) .. 8 juta B.. Suatu cara yang mudah untuk mengisolasi spesies Bacillus dan Clostridium secara spesifik dari tanah adalah dengan: A. setelah 2 jam? c. Menumbuhkannya pada suhu tinggi C.. Diatoms A. D. Virus 9. jumlah bakteri individual yang ada pada mulanya adalah.

otot. mensekresikan endotoksin D..11. dan otak B. jantung. entropi reaksi E. ditemukan di sel eukariot B. melindungi diri sendiri dengan menyekresikan antibiotik C... menghasilkan endospora 12. Material yang berasal dari sel manusia tersebut adalah. mengatur translasi dari mRNA D. otak dan jantung saja A. A. protein mRNA yang ditemukan di sitoplasma E. mengkode urutan asam amino pada laktase C. memiliki dinding sel yang mengandung peptidoglikan B.. Gen X ditranskripsi hanya ketika faktor A difosforilasi. Lac operon. konstanta kesetimbangan C. jantung saja C.. otak saja 2. Transkripsi gen X dikendalikan oleh transkripsi faktor A. autotrof E. protein yang mentraskripsi mRNA di inti D.. Bakteri penyebab tetanus hanya dapat dibunuh dengan pemanasan yang lama di atas titik didih.. laju dari kedua reaksi maju dan balik B merubah… BIOTEKNOLOGI Gunakanlah tabel berikut untuk menjawab pertanyaan no. 1 1... Suatu enzim yang mengkatalisis reaksi A A. A. Dari tiga jaringan ini. gen X akan ditranskripsi pada D. rRNA dan tRNA yang dipergunakan selama proses translasi C. mengatur replikasi DNA dengan mengaktifkan atau menginaktifkan protein induser 3. Dalam usaha untuk mengklon protein manusia. mengatur transkripsi dengan mengaktifkan atau menginaktifkan produksi dari protein represor E. intron yang dilepaskan dari protein mRNA yang di transkripsi dan belum diproses 4    . panas reaksi B. Segmen DNA yang mengkode mRNA yang di transkripsi B. material dari sel manusia di masukan ke dalam bakteri. Hal ini mengindikasikan bahwa bakteri tetanus…. A. otot saja E. Data pada distribusi jaringan dari faktor A dan aktivitas dari suatu protein kinase dan protein fosfatase spesifik untuk faktor A ditunjukkan pada tabel di atas. kesetimbangan konsentrasi A D.

Rantai tunggal oleh denaturasi pada suhu yang lebih rendah B. Di alam. Eastern blotting B. adalah suatu teknologi yang menggabungkan gen dari sumber yang berbeda kemudian mentransfernya ke sel dimana gen tersebut akan diekspresikan. 7. Polymerase chain reaction (PCR) E. Metode yang digunakan untuk mendeteksi suatu protein adalah … D.. Pada temperatur di bawah titik leleh untai DNA komplementer. Eastern blotting C. dan 3) ……….. Southern blotting 8. Polymerase chain reaction (PCR) D.….. gen bakteri dapat ditransfer dari satu sel ke sel lainnya melalui 3 proses yaitu 1) ……………. 6. Manakah hasil pemotongan yang tepat dari enzim tersebut? 5. Eastern blotting B. Rantai ganda akibat kuatnya ikatan hydrogen C. Kinetik hibridisasi double helix DNA sangat berhubungan dengan urutan basa nitrogen pada helix tersebut. Metode yang digunakan untuk mendeteksi RNA adalah … A. maka kebanyakan DNA … A. Polymerase chain reaction (PCR) E.4.. Western blotting C. Southern blotting 9. Metode yang digunakan untuk mendeteksi DNA adalah … D. Hibridisasi untuk membentuk untai yang lebih panjang dan stabil D. Northern blotting A. Mampu menyerap sinar UV lebih banyak dibandingkan dengan temperatur di atas titik lelehnya. Urutan basa yang sangat kompleks yang menjadi sederhana ketika suhu dinaikkan E. ……… ……. Northern blotting A.. Western blotting E. Southern blotting 5    . Western blotting C. Perhatikan diagram dibawah ini! Tanda panah pada diagram menunjukkan tempat pemotongan dari enzim Tag I. Northern blotting B. 2) ………….

Enzim manakah yang seharusnya digunakan untuk memasukkan urutan DNA manusia ke dalam plasmid bakteri? A. dan MEM II 12. Plasmid bakteri dengan urutan: ATCCCA… 1000 nukleotida… …ATTAAGGCCTTACAGGACCCCGGAATGAGAGTA ATGGGCTATTCAGGTA … 200 nukleotida lagi. Lebih dari 3 C.10-11 tentang rekayasa genetik. MEM II D.. Urutan DNA manusia: ATATCGTAATGTTGGTG. Ket: Urutan DNA yang digarisbawahi menunjukkan gen yang akan diklon Urutan enzim restriksi ERA I: GTAAATG CRO I: CAGGAC MEM II: GCCG 10.. 3 B. 1 E.. ERA I. Berapa banyak sisi restriksi yang terdapat pada urutan plasmid bakteri? A. CRO I C. . 2 11.Gunakan petunjuk berikut ini untuk menjawab pertanyaan No.. ERA I B. CRO I.GTGTCAGGACGGGTGAAAGCCAGGACGCCGAATCG… 5000 nukleotida lagi. Mengapa enzim restriksi yang terdapat pada suatu sel tidak merusak DNA sel tersebut meskipun sel tersebut memiliki urutan yang mampu dikenali oleh enzim restriksinya? ……………………………………………………………………………………………… ……………………………………………………………………………………………… 6    .500 nukloetida. Tidak ada D. CRO I dan ERA I E.

. C. 2. ikatan pembuluh B. Peningkatan terkecil pada pertumbuhan dicapai. B. selama tiga hari pertengahan. A. pada akhir hari pertama... laju pertumbuhan setelah hari ke delapan memiliki laju yang sama dengan hari sebelumnya. peningkatan kelembaban dan penurunan suhu... E. Struktur yang menghantarkan materi ke seluruh tubuh tanaman disebut. A. pada hari ke delapan. ujung akar tersebut akan memanjang dan menghasilkan akar sekunder. kambium 7    . E. E.. D. ujung akar memanjang dengan laju yang sama setiap hari. pada akhir hari ke delapan. 3. pada akhir hari ke sepuluh. C. meristem D... Laju transpirasi suatu pohon kemungkinan akan meningkat seiring dengan.. lentisel C. A. suhunya dipertahankan 37°C secara konstan. Ujung akar tidak menunjukkan adanya pertumbuhan. C. pada waktu yang tidak ditunjukkan B. A. B. D. peningkatan kelembaban dan suhu. D. oleh grafik.. Seorang peneliti melakukan pengukuran harian terhadap akar tomat pada suhu 33°C-35°C dengan cara ini. peningkatan suhu saja. pada akhir hari ke tiga. pada hari ke tiga. Dalam kondisi suhu yang diatur.. Hasilnya dipetakan pada grafik berikut. selama tiga hari terakhir. Suatu teknik yang telah disempurnakan digunakan untuk memotong ujung akar dan menempatkannya pada larutan nutrien steril. E. A. D. larutan nutrien kemudian ditambah dengan hormon pertumbuhan akar.ANATOMI DAN FISIOLOGI TUMBUHAN 1. B. 4. selama tiga hari pertama.... peningkatan kelembaban dan pergerakan udara. C.. 5. Grafik akan menunjukkan garis lurus jika. peningkatan suhu dan pergerakan udara. pertumbuhan pada dua hari pertama identik.

B.. berdifusi dari darah ibu ke darah embrio di dalam plasenta. epidermis 6.. Jumlah karbon dioksida di dalam daran meningkat dengan olah raga. D. konsentrasi auksin yang sama pada seluruh sisi batang. A. oksigen D. jaringan spons B. C. 9. air B. embrionya berada dalam resiko karena racun-racun tersebut dapat. A. C. xilem dan floem 8. Kambium terletak di dekat. E. sel penjaga C. karbon dioksida C. hanya ketika fotosintesis sedang berjalan. C... hanya pada siang hari. pindah ke embrio karena darah ibu bercampur dengan darah embrio di dalam plasenta... Produksi urin memungkinkan untuk ekskresi buangan sel. siang dan malam.. konsentrasi auksin yang lebih besar pada bagian yang terkena cahaya. A. D. epidermis D.. karbon dioksida dan air E. B.. D.. Tumbuhnya daun menuju cahaya dihasilkan dari.. A. oksigen dan air 10. Produksi estrogen merangsang pembuntukan gamet untuk reproduksi seksual. fototropisme negatif. 8    . Pernyataan manakah yang menggambarkan mekanisme umpan balik yang melibatkan kelenjar tiroid? A.. ANATOMI DAN FISIOLOGI HEWAN 1.. hanya ketika fotosintesis tidak sedang berjalan. konsentrasi auksin yang lebih besar pada bagian yang terlindungi... geotropisme positif. hanya pada malam hari. xilem D. E. A. Sel-sel pembuat makanan pada tumbuhan terletak di. rambut akar E. Hipotalamus mengurangi masukan TSH ke pituitary.. B. Ketika wanita hamil mengkonsumsi alkohol dan nikotin. 2. C. Tumbuhan hijau melakukan respirasi. mempengaruhi ovulasi. floem E. E. B. kayu 7... tumbuhan hijau menyerap. pembuluh C. A. D.E. Selama respirasi. Kadar oksigen di dalam darah berhubungan dengan detak jantung. stomata B. memasuki uterus melalui perut ibu.

Pembelahan – formasi blastula – formasi mesoderm – formasi gastrula – formasi otot. Pembelahan – formasi blastula – formasi gastrula – formasi mesoderm – formasi otot. E... memakan terlalu banyak makanan berkalori tinggi D.. Pembelahan – formasi blastula – formasi otot – formasi gastrula – formasi mesoderm.. Penyakit darah Rh dapat terjadi apabila ibu dengan Rh negatif... memiliki bayi Rh positif B. C. E. kekurangan besi dalam diet E. ia lebih banyak berkeringat. saliva C. mengumpulkan urin setelah mengalir melalui uretra. gagal membentuk antibodi. harus mengganti darahnya. D. ekstensor 7. B. mengatur komposisi kimia darah. Laju pernapasan dikendalikan oleh.E. A. Humerus. tulang lengan atas manusia. tidak olah raga C. 9    . C. dihubungkan secara langsung dengan tulang lengan lainnya oleh. paru-paru B. 5. Manakah berikut ini yang mewakili urutan normal tahap-tahap perkembangan embrio? A. memecah sel darah merah untuk membentuk buangan nitrogen.. D.. Kondisi kelebihan berat badan dapat disebabkan oleh faktor-faktor berikut. A. gangguan kelenjar tiroid 4. kecuali.. A. Formasi blastula – formasi gastrula – formasi mesoderm – pembelahan – formasi otot. kulit mengekskresikan garam dalam jumlah yang lebih besar. 6.. berdifusi ke dalam air susu ibu yang akan diminum oleh bayi. membentuk urea dari produk-produk buangan hasil metabolisme protein. 8. mengalami eritroblastosis. Formasi gastrula – formasi blastula – formasi mesoderm – pembelahan – formasi otot. D. keringat mengevaporasi dengan cepat. bronki C. C. getah lambung A. jaringan rawan E. makan berlebih B.. diafragma 10. B... Pada hari yang lembab. A. D.. pepsin 9. A.. E. tendon C. D. B. Fungsi utama nefron adalah untuk. E.. memiliki bayi Rh negatif. orang merasa tidak nyaman karena.. kantung udara D. jaringan adiposa B.. ptialin E.. C. terdapat lebih sedikit evaporasi keringat. medulla E. permukaan kulit terlalu kering. menyerap makanan yang dicerna dari dalam usus halus. Sekret yang mencerna karbohidrat dan protein adalah. 3.. getah pankreas B. ligamen A. D.

Kodominan E. tetap 9:3:3:1 E. Berdasarkan keterangan diatas.GENETIKA Soal 1-2. Tentukan genotip dari induk yang berwarna jingga. 1:1 C.. rrPP dan rrPp D. 12:3:1 A.. IO. Namun apa bila kedua sifat terletak pada kromosom yang sama maka hasil persilangan F1-nya adalah. IB. karena pada saat itu jumlah kromosom hasil pembelahan adalah setengah dari jumlah kromosom sel induk.. Kriptomeri A. dan jika berada dalam keadaan homozigot resesif untuk ketiga gen maka warna bunga menjadi putih.. 3. 1. Epistasis C. IA. maka genotip dari kedua induk adalah. Warna pada kembang sepatu merupakan sifat yang diturunkan secara poligeni. rrPp dan RRPp B. Inkomplit dominan B. Sifat alel IAIB dalam pembentukan golongan darah AB disebut. 75 bunga jingga 27 bunga merah 23 bunga kuning 8 bunga hijau 1. 4. 4. Tentukan jenis penyimpangan hukum mendel pada persilangan diatas. Proses pengubahan dari diploid menjadi haploid terjadi setelah meosis 2..1. maka peluang keluarga tersebut memiliki dua anak laki-laki normal dan satu buta warna adalah. Interaksi alel 6. Sifat ini diatur oleh tiga gen (ABC) yang apabila berada pada keadaan homozigot dominan untuk ketiga gen akan menghasilkan warna jingga.3. Hasil persilangan F1 pada persilangan dihibrid yang dilakukan Mendel menghasilkan perbandingan 9. RrPP dan RRPp C... 9:3:4 5. A. Pada golongan darah terdapat tiga jenis alel. Bunga jingga disilangkan dengan bunga hijau menghasilkan jumlah keturunan sebagai berikut.. Dua ekor ayam disilangkan dan diperoleh keturunan sebagai berikut: 10 walnut dan 3 rose. 9:7 B. Apabila pasangan keluarga tersebut berharap memiliki 3 anak lelaki.. 2. Seorang ibu carrier terhadap sifat buta warna menikah dengan laki-laki normal. B-S. RrPp dan rrPP 7.3.56% 10    ..... Apabila seseorang memiliki alel IAIB di dalam tubuhnya maka orang tersebut memiliki golongan darah AB.. A.. D. D.7% B. Hal ini terjadi karena semua sifat terletak pada kromosom yang berbeda.. Gen A merupakan gen yang mengkode bahan baku untuk pigmen yang bisa diubah menjadi berbagai warna. RrPP dan rrpp E.

Berapa frekuensi alel T setelah satu generasi? A. Hasil persilangannya adalah sebagai berikut: 180 ekor sayap panjang mata coklat. E. Populasi dengan alel T dan t yang seimbang memiliki 36% individu dalam populasi dengan fenotip resesif.75% 8. B. 0. tidak dapat ditentukan D.7. Pada suatu populasi yang terdiri atas 1000 penduduk diketahui bahwa jumlah orang yang bergolongan darah O adalah adalah 16% dari jumlah penduduk dan jumlah penduduk yang bergolongan darah AB dan B masing-masing adalah 100 dan 90 orang. 0. 0. Tiba-tiba kondisi lingkungan berubah dan menyebabkan kematian dari semua individu yang homozigot dominan sebelum mencapai usia dewasa. 0. Berdasarkan informasi diatas maka pernyataan berikut yang benar adalah.5% E. C. 0.C. kondisi lingkungan kembali normal. 35 ekor sayap panjang ekor sayap panjang mata merah. Tentukanlah frekuensi alel IA pada populasi tersebut. Kedua gen bersifat kodominan... Setelah kejadian tersebut. 12. 0. 0.4 D. Berdasarkan keterangan tersebut tentukanlah jumlah fenotip dari hasil persilangan kedua labu tersebut! D. Pada lalat buah diketahui bahwa sayap panjang (V) dominan terhadap sayap pendek (v) dan mata merah (M) dominan terhadap mata coklat (m).. Berat buah labu ditentukan oleh beberapa gen yang dikenal dengan istilah poligeni. 6. 33 ekor sayap pendek mata coklat. A. Labu dengan genotip AABbcc memiliki berat buah 27 gr sedangkan labu dengan genotip AaBBCc memiliki berat buah 30 gr.26. 11    . Kedua gen terpaut dan pada saat pembentukan gamet terjadi peristiwa pindah silang. 7 fenotip B. A. 182 ekor pendek mata merah. E. 5 fenotip 9. 6 fenotip E.5 B.58.6 11. 10. 9 fenotip A.25% D. Seekor lalat yang heterozigot terhadap kedua sifat disilangkan dengan lalat yang homozigot resesif untuk kedua sifat. 0. 0.2 C. Gen yang mengatur panjang sayap dan dan warna mata terletak pada kromosom yang sama B.4. 4 fenotip C. Gen yang mengatur panjang sayap dan warna mata terletak pada kromosom yang terpisah C. 18.7 E. Gen yang mengatur warna mata terpaut kromosom seks sedangkan gen yang mengatur panjang sayap terletak pada autosom D.

Wallace A. maka jumlah gamet yang dapat dibentuknya adalah. tidak dapat ditentukan A. 25% C. Peluang memperoleh anak kedua perempuan.. 8 C. Aa x aa A... Apabila ia menghasilkan sperma. membesar. Seorang wanita bergolongan darah O Rh.menikah dengan laki-laki dengan golongan darah AB Rh+. Peluang untuk memperoleh anak kedua perempuan dengan golongan darah A dan Rh+ adalah 0% B. Jika A menunjukan alel dominan dan a adalah alel resesif. AA x AA E. Apabila anak pertama mereka adalah laki-laki A Rh.12. Spesiasi simpatrik C. Probabilitas anak bergolongan darah O sama dengan Probabilitas anak A dan B 13.. Radiasi adaptif D. 100% B.. A. AA x aa EVOLUSI 1. Probabilitas anak kedua bergolongan darah A dan AB adalah sama E.maka pernyataan berikut yang tepat adalah. Perubahan tersebut diturunkan pada generasi berikutnya. Berapakan kemungkinan pasangan tersebut memiliki anak laki-laki yang menderita haemofilia? D. Oparin B. Aa x Aa B. 2 B.” Pendapat tersebut adalah pendapat…. Jika seorang wanita yang ayahnya haemofilia menikah dengan laki-laki normal. tereduksi atau hilang melalui penggunaan dan penghentian penggunaan.. 50% 15. Seorang laki dengan genotip AaBaCCDd (A dengan D terpaut). Pada fenomena manakah berikut ini pengamatan Darwin tentang burung finch di kepulauan Galapagos menjadi contoh klasik? A. Evolusi konvergen E. 75% A.5% D. 4 E. Jika anak kedua adalah Rh+ dan bergolongan darah A maka kemungkinan anak ketiga lahir normal adalah 12. D. Darwin E. 16 14. apakah genotip dari orang tua yang menghasilkan 300 keturunan dengan sifat dominan dan 100 keturunan dengan sifat resesif? D.. Ketidakmampuan untuk terbang 12    . AA x Aa C. D. Lamarck C. Haemofilia merupakan penyakit menurun yang terpaut seks dan bersifat resesif. bergolongan darah B dan Rh+ adalah 12. “Suatu struktur diperoleh. Kesetimbangan Hardy-Weinberg B. Mendel 2.5% C.. 0% E.

Gunakanlah pilihan berikut ini untuk menjawab pertanyaan no. Resistensi DDT pada serangga. II dan V 6. struktur yang memiliki karakter anatomi dasar yang sama. Seleksi alam menyebabkan perubahan genetik pada individual. tinggi tinggi rendah E. III saja C. A.. asal evolusi yang berbeda.. E. C. Evolusi adalah perubahan pada frekuensi alel dari suatu populasi. Leher jerapah. tidak ada rendah rendah B. B. III dan VI E. Kadal Aristelliger kecil bermasalah dalam mempertahankan teritorinya.. I. V dan VI E. tapi dapat digunakan untuk fungsi yang sama. III. D. D. 5. Seleksi alam mengarahkan populasi menjadi lebih sesuai terhadap lingkungannya. tapi dapat digunakan untuk fungsi yang berbeda.. IV dan V B. Seleksi mengarahkan (’directional selection’) ditunjukkan oleh. IV. III dan V 7. tidak ada tinggi tinggi C. tinggi tinggi tinggi 4. asal evolusi yang sama.. II. E. IV saja B. Populasi burung Finch di Galapagos. Seleksi stabilisasi (’stabilizing selection’) ditunjukkan oleh. Pada situasi manakah berikut ini evolusi berjalan paling lambat untuk suatu populasi ‘inter-breeding’? migrasi tekanan seleksi variasi karena mutasi A. struktur yang memiliki karakter anatomi dasar yang sama.. Materi genetik dari individu adalah genotip.3. asal evolusi yang berbeda. A. I. Seleksi alam bekerja pada individu. sedangkan yang besar mudah dimangsa burung hantu. III. Yang dimaksud dengan struktur analog adalah. asal evolusi yang berbeda. Berat bayi manusia pada waktu lahir. Populasi Biston betularia pada waktu revolusi industri.. tapi dapat digunakan untuk fungsi yang sama.. tinggi rendah tinggi D. 13    . sedangkan materi genetik dari populasi adalah ‘gene pool’. C. A. I. struktur yang memiliki karakter anatomi dasar yang berbeda.. tapi dapat digunakan untuk fungsi yang sama.. asal evolusi yang sama. tapi dapat digunakan untuk fungsi yang berbeda. II.. II dan III C. struktur yang memiliki karakter anatomi dasar yang sama. D. V. struktur yang memiliki karakter anatomi dasar yang sama. 5 dan 6. B. VI.. II dan IV D. V dan VI A. II. Berikut ini pernyataan yang salah adalah.

Manakah berikut ini yang merupakan kesamaan antara teori Darwin dan teori Lamarck mengenai evolusi? A. D. A. B. Catatan fosil mendukung pendapat bahwa spesies adalah tetap.. isolasi temporal A.. Adaptasi merupakan hasil dari penggunaan dan penghentian penggunaa struktur anatomi. identik. 10. E. isolasi perilaku C.. identik. D. Adaptasi evolusioner merupakan hasil dari interaksi antara organisme dengan lingkungannya. identik. Dua spesies yang berbeda tidak dapat melakukan perkawinan karena adanya mekanisme isolasi reproduktif. kecuali terjadi pindah silang. berbeda. C. karena ‘gene pool’ yang sifatnya umum dari induk. karena adanya segregasi acak pada waktu meiosis induk. D. karena tingginya kemungkinan terjadinya mutasi acak. karena rendahnya kemungkinan mutasi. E. maka mekanisme isolasi reproduksi ini disebut dengan. isolasi sterilisasi B..8. isolasi gametik E. Evolusi mengarahkan organisme menjadi lebih kompleks. berbeda. B.. Jika kembar identik albino menikah dengan kembar identik berambut keriting. anak dari kedua pasangan secara genetis kemungkinan. Adaptasi merupakan hasil dari perbedaan kesuksesan reproduksi. isolasi mekanis 9.. tidak berubah. 14    . C. Jika spesies yang serupa memiliki perbedaan struktural pada organorgan reproduksinya.

mereka memindahkan ‘rabbit fever’ ke kangguru. Ketika puncak piramid dicapai. D. jumlah mangsa meningkat.. jumlah predator menurun. E. Pernyataan manakah yang paling baik menyimpulkan hubungan tersebut? A. di dalam piramida makanan. Hubungan yang digambarkan dalam rantai makanan dapat juga diekspresikan sebagai piramid makanan. Ketika jumlah predator menurun. jumlah individu dan jumlah energi yang terlibat adalah paling besar.EKOLOGI 1. mereka menyebabkan myxomatosis bagi bayi-bayi yang baru lahir. 3. Pada khatulistiwa. Kelinci menjadi ancaman di Australia karena. C. jumlah individu meningkat. tidak adanya musuh alami menyebabkan mereka berbiak tak terbatas. jumlah predator meningkat. C. B.. 4. A. lorong-lorong yang . tipe pertumbuhan taiga. A. Manakah berikut ini yang mungkin terjadi di dalam suatu ekosistem? A.. jumlah individu dan jumlah energi yang terlibat adalah sama. tidak mungkin. C. jumlah individu menurun tapi jumlah energinya meningkat. B. E. jumlah mangsa menurun. terjadi hanya di musim dingin. Ketika jumlah predator meningkat. D. D. Pada semua tingkat. dan jumlah energi tetap sama dengan tingkatan lainnya. B.. B. E. Pada dasar piramid. Pada dasar piramid. Ketika puncak piramid dicapai. mereka mengambil nutrisi yang berharga dari tanah. jumlah predator meningkat. 2. 15    C.. Ketika jumlah mangsa menurun. liang mereka di dalam tanah berbahaya bagi ternak.. jumlah individu dan jumlah enrgi yang terlibat adalah paling rendah. terjadi di dalam. Perbedaan utamanya adalah. Ketika jumlah mangsa meningkat. terdapat indikasi jumlah relatif individu dan jumlah energi yang terlibat pada setiap tingkat. seperti yang terlihat pada gambar. Ketika jumlah mangsa meningkat.

lebih stabil. Kompetisi antara populasi dua spesies dengan relung (niche) yang hampir sama... Alga hijau 2. mimikri Batesian C. proses koevolusi D.. memiliki daun dengan tulang daun bercabang membentuk pola menyerupai jala.. D. B. suhu bioma laut. 5. kelimpahan relatif spesies C. dan generasi sporofit masih menumpang pada generasi gametofit.. Keanekaragaman spesies dalam suatu komunitas ditentukan oleh: A. 6. Dibandingkan dengan daratan. eliminasi (penyingkiran) populasi yang kalah bersaing B.. A dan B benar E. Gymnospermae B. Sejenis ulat mempertahankan dirinya dari predator dengan cara membesarkan kepalanya sehingga menyerupai kepala ular yang ganas. Paku C.. Paku E. tanaman jagung B. A. Tumbuhan yang menghasilkan buah.. jawaban A dan C benar BIOSISTEMATIK 1. di bawah titik beku.. terjadi hanya di gurun. B dan C benar 7. lebih sedikit menyerap radiasi sinar matahari. Angiospermae E.... pertahanan mekanis A. kamouflase B. A. terjadi di gunung-gunung yang E. pertahanan aposematik 8. Lumut C. tinggi. A.. jawaban A dan B benar E. dan memiliki berkas pembuluh pada batang yang tersusun secara melingkar adalah. C.. frekuensi relatif spesies B. Lumut B. paku C. memiliki kondisi ekstrim yang lebih. Pertahanan seperti ini adalah contoh dari: D. E. pada akhirnya dapat mengakibatkan terjadinya: A. Pertumbuhan biji yang tidak terlindungi oleh ovarium merupakan karakteristik dari... Alga hijau 3. Angiospermae D. mimikri Müllerian E.D. pembagian sumber daya (resource partitioning) melalui seleksi alam C. lumut 16    . Gymnospermae A. D. merupakan karakter dari. Generasi gametofit lebih dominan dari generasi sporofit. kekayaan/jumlah spesies D. kurang stabil.

Membandingkan dengan tumbuhan di Kebun Raya yang telah diketahui namanya C. Asteraceae 5. Identifikasi suatu tumbuhan dapat dilakukan dengan cara: A. seorang mahasiswa menemukan beberapa jenis tumbuhan dengan ciri-ciri sebagai berikut : Bentuk hidup pada umumnya herba atau perdu. E. angka satu meyatakan kesamaan paling tinggi dan angka nol menyatakan tidak ada karakter yang sama. pada beberapa jenis memiliki getah berwarna putih. B. Semua cara di atas dapat dilakukan 7.D. A. D. 4 berkerabat paling dekat dibandingkan jenis lainnya Sp. Salah satu aspek taksonomi yang hanya mengamati karakteristik morfologi saja disebut dengan : A. maka dendogram berikut menyatakan A. Alpha taxonomy B. Jika cabang-cabang pada diagram berikut ini menyatakan kesaman karakter tumbuhan. pinus 4. tanaman kacang E. 5 dan Sp. Diagram kekerabatan enam jenis tumbuhan dapat dinyatakan dalam dendogram di bawah ini. Menggunakan kunci identifikasi B. Membandingkan dengan spesimen awetan di herbarium E. Omega taxonomy C. Modern taxonomy 17    . beberapa jenis tumbuhan ini tergolong dalam satu suku…………………. 3 dan Sp. Liliaceae E. Di suatu hutan tropis.. filotaksis daun ada yang tersebar dan ada pula yang berhadapan dengan tepi daun bergerigi. Beta Taxonomy D.2 merupakan organisme yang sama Tidak mungkin ada dendogram seperti ini 6. Graminae B.2 tidak mungkin berkerabat Sp. Moraceae C. Perbungaan tersusun dalam kapitulum yang dilindungi oleh involukrum dan ditemukan dua macam bunga (bunga pita dan bunga tabung) yang berwarna kuning dan ungu. C. Sp.1 dan Sp. 6 berkerabat paling dekat Sp.1 dan Sp. Tumbuhan-tumbuhan tersebut memiliki macam daun tunggal. Berdasarkan ciri-ciri tersebut. Membandingkan gambar dalam pustaka botani D. Euphorbiaceae D.

C & G   ***  D. X & Y E.E. Cladistic 8. 18    . A & C B. Spesies manakah yang kemungkinan lebih banyak berhasil/lulus hidup pada berbagai perubahan lingkungan sepanjang masa dari kedua diagram pohon filogeni di bawah ini? A. H & I C. Y saja.

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->