Genetika, Substansi Genetika dan Evolusi

1. Diketahui mRNA memiliki urutan basa N : AUGGCUAGGCUAUAAAUGCGA UCCGAUUGA. Bila sintesis protein dimulai dari urutan basa N paling kiri, maka polipetida yang akan terbentuk A. satu macam B. dua macam C. tiga macam D. empat macam E. lima macam 2. Pernyataan berikut yang berkaitan dengan teori Lamarck adalah..... 1) lingkungan berpengaruhi terhadap proses evolusi organisme 2) makhluk hidup beradaptasi melalui organ tubuhnya 3) perubahan organ tubuh diwariskan kepada keturunannya 4) seleksi alam memacu kepunahan organisme 3. Mutasi gen akan berpengaruh pada hal berikut, KECUALI .. A. urutan nukleotida B. terjemahan asam amino C. panjang polipetida D. jumlah pasangan basa E. jumlah kromosom 4. Sepasang suami istri bertengkar memasalahkan salah seorang anaknya yang bergolongan darah O, sedangkan suami istri tersebut masing-masing bergolongan darah A dan B. Penjelasan yang dapat anda berikan adalah .... (1) istri A heterozigotik dan suami B homozigotik (2) istri B heterozigotik dan suami A heterozigotik (3) istri A homozigotik dan suami B heterozigotik

(4) istri A heterozigotik dan suami B heterozigotik 5. Teori abiogenesis runtuh karena percobaan yang dilakukan oleh .... A. Aristoteles B. Harold Urey C. Louis Pasteur D. Alexander Oparin E. Anthonie van Leeuwenhoek 6. Perkawinan lalat buah warna abu-abu, sayap panjang dengan lalat buah warna hitam, sayap pendek. Memperoleh keturunan lalat buah dengan fenotip warna abu-abu, sayap panjang dan warna hitam, sayap pendek. Keadaan demikian dapat terjadi karena adanya peristiwa .... A. dominansi B. gagal berpisah C. gen terikat sempurna D. gen terikat tidak sempurna E. epistatis 7. Hemofilia adalah kelainan genetik yang disebabkan oleh gen resesif yang terpaut kromosom X. Seorang anak laki-laki hemofilia dapat lahir dari perkawinan .... (1) ayah normal, ibu normal heterozigotik (2) ayah normal, ibu hemofilia karier (3) ayah normal, ibu normal karier (4) ayah hemofilia, ibu normal homozigotik 8. Louis Pasteur menumbangkan teori generatio spontanea dengan memuaskan karena percobaannya yang menggunakan A. potongan daging B. kaldu ayam C. tabung ditutup rapat D. botol berbentuk leher angsa E. tabung ditutup kasa

25% E. Jika urutan basa pita DNA yang ditranskripsi adalah 3' GTSAT 5' maka urutan basa dalam RNA duta hasil transkripsi adalah . A. masing-masing membawa sifat albino..3164 11.. A. Kalau marmot dari keturunan F 1 terbentuk dikawinkan dengan yang berbulu albino halus maka keturunannya yang berbulu hitam kasar adalah sebanyak . 3' GTSAT 5' C. Lamarck C. Penemuan fosil pada berbagai lapisan bumi yang dapat menerangkan adanya evolusi dengan jelas adalah fosil . 5' SAGUA 3' E.9.0625 D. kuda E. 56% C. 12.. Daun kaktus yang tereduksi seperti duri-duri merupakan suatu bentuk penyesuaian terhadap lingkungan hidup di daerah gurun. 15. A. 3' SAGUA 5' D. 0. dinosaurus D.5000 C.2500 B. 6% 16. Morgan E. Wallace B. 37% D. SEBAB Gen penyebab buta warna terdapat di dalam kromosom X dan bersifat resesif. gajah 17. 0. 0.... kaldu ayam C. Sutton D. Seorang laki-laki berpenglihatan normal menikah dengan seorang wanita buta warna. potongan daging B.. SEBAB Asam amino yang dihasilkan dari percobaan Stanley Miller merupakan senyawa penyusun dasar kehidupan. A. 3' TAGTA 5' B. Bila suami istri tersebut merencanakan mempunyai anak 4 orang. (1) Louis Pasteur (2) Lazaro Spallanzani (3) Francesco Redi (4) Aristoteles . Sepasang suami istri normal.. A.0039 E.... maka semua anak laki-lakinya akan buta warna. kemungkinannya bahwa semua anaknya tidak albino adalah. Pada marmot. 5' TAGTA 3' 14. 75% B. Louis Pasteur menumbangkan teori generatio spontanea dengan memuaskan karena percobaannya yang menggunakan ... Pendapat tersebut sejalan dengan yang dikemukakan oleh .. 0. 0.. kera B.. A. botol berbentuk leher angsa E. 13. Teori-teori tentang biogenesis didukung oleh .. Marmot yang berbulu hitam kasar dikawinkan dengan yang berbulu albino halus menghasilkan keturunan F 1 yang semuanya berbulu hitam kasar . Darwin 10. warna bulu hitam dominan terhadap albino dan bulu kasar dominan terhadap bulu halus. tabung ditutup rapat D. manusia C. tabung ditutup kain kasa. Hasil percobaan Stanley Miller membuktikan bahwa makhluk hidup berasal dari benda tidak hidup.

(f)sirip dada ikan. (c)kaki depan kuda. (d)tangan manusia... pindah silang B. kriptomeri . 373 C. (1) a b (2) c d (3) e . respons terhadap rangsangan D. Adaptasi adalah contoh kegiatan makhluk hidup dalam melakukan. sitoplasma E. nukleus B. perkembangbiakan E. Louis Pasteur menggunakan pipa berleher angsa yang bertujuan agar . misalnya dari 9 : 3 : 3 : 1 menjadi 9 : 3 : 4 disebut . ayah adalah karier E. A. ibu adalah karier D. pasangan organ yang homolog adalah . Dari organ-organ tersebut. A.. Pernikahan antara wanita dan laki-laki yang keduanya berpenglihatan normal menghasilkan seorang anak laki-laki yang buta warna dan dua anak perempuan berpenglihatan normal.18.. hipostasis C. pertumbuhan dan perkembangan B. 400 25. (b)sayap kelelawar . 388 E. ibu adalah homozigot resesif C. Untuk membantah teori generatio spontanea dari Spallanzani. Dalam masyarakat A yang berpenduduk 10.000 orang terdapat 4 orang albino. polimeri E. lokus kromosom C. Berapa orang pembawa sifat albino pada masyarakat tersebut? A. ibu adalah homozigot dominan B. 20. gerak aktif 19. ayah adalah homozigot 24. (e) kaki depan kadal. Dari kasus ini dapat diketahui bahwa A.f (4) a f 22. 392 D.. 350 B. anabolisme dan katabolisme C. (1) tidak ada mikroorganisme di dalam pipa (2) mikroorganisme terperangkap dalam pipa (3) air kaldu tidak berhubungan dengan udara (4) air kaldu dapat berhubungan dengan udara luar 21. epistasis D. Gen terdapat pada A. protoplasma 23.. sel bakteri mampu menghasilkan hormon insulin SEBAB Gen pembentuk insulin pada sel pankreas manusia dapat disisipkan pada plasmid bakteri secara teknik penyisipan gen.. Berikut ini disajikan sejumlah organ pada Vertebrata yaitu: (a)sirip anjing laut. Dengan teknik penyisipan gen pembentuk insulin. Penyimpangan perbandingan fenotip F1 pada persilangan dengan dua sifat beda. kromosom D.

Sign up to vote on this title
UsefulNot useful