Genetika, Substansi Genetika dan Evolusi

1. Diketahui mRNA memiliki urutan basa N : AUGGCUAGGCUAUAAAUGCGA UCCGAUUGA. Bila sintesis protein dimulai dari urutan basa N paling kiri, maka polipetida yang akan terbentuk A. satu macam B. dua macam C. tiga macam D. empat macam E. lima macam 2. Pernyataan berikut yang berkaitan dengan teori Lamarck adalah..... 1) lingkungan berpengaruhi terhadap proses evolusi organisme 2) makhluk hidup beradaptasi melalui organ tubuhnya 3) perubahan organ tubuh diwariskan kepada keturunannya 4) seleksi alam memacu kepunahan organisme 3. Mutasi gen akan berpengaruh pada hal berikut, KECUALI .. A. urutan nukleotida B. terjemahan asam amino C. panjang polipetida D. jumlah pasangan basa E. jumlah kromosom 4. Sepasang suami istri bertengkar memasalahkan salah seorang anaknya yang bergolongan darah O, sedangkan suami istri tersebut masing-masing bergolongan darah A dan B. Penjelasan yang dapat anda berikan adalah .... (1) istri A heterozigotik dan suami B homozigotik (2) istri B heterozigotik dan suami A heterozigotik (3) istri A homozigotik dan suami B heterozigotik

(4) istri A heterozigotik dan suami B heterozigotik 5. Teori abiogenesis runtuh karena percobaan yang dilakukan oleh .... A. Aristoteles B. Harold Urey C. Louis Pasteur D. Alexander Oparin E. Anthonie van Leeuwenhoek 6. Perkawinan lalat buah warna abu-abu, sayap panjang dengan lalat buah warna hitam, sayap pendek. Memperoleh keturunan lalat buah dengan fenotip warna abu-abu, sayap panjang dan warna hitam, sayap pendek. Keadaan demikian dapat terjadi karena adanya peristiwa .... A. dominansi B. gagal berpisah C. gen terikat sempurna D. gen terikat tidak sempurna E. epistatis 7. Hemofilia adalah kelainan genetik yang disebabkan oleh gen resesif yang terpaut kromosom X. Seorang anak laki-laki hemofilia dapat lahir dari perkawinan .... (1) ayah normal, ibu normal heterozigotik (2) ayah normal, ibu hemofilia karier (3) ayah normal, ibu normal karier (4) ayah hemofilia, ibu normal homozigotik 8. Louis Pasteur menumbangkan teori generatio spontanea dengan memuaskan karena percobaannya yang menggunakan A. potongan daging B. kaldu ayam C. tabung ditutup rapat D. botol berbentuk leher angsa E. tabung ditutup kasa

tabung ditutup kain kasa. Lamarck C. Hasil percobaan Stanley Miller membuktikan bahwa makhluk hidup berasal dari benda tidak hidup.3164 11. masing-masing membawa sifat albino. A. Seorang laki-laki berpenglihatan normal menikah dengan seorang wanita buta warna.. A. kaldu ayam C... kera B... SEBAB Gen penyebab buta warna terdapat di dalam kromosom X dan bersifat resesif. botol berbentuk leher angsa E. warna bulu hitam dominan terhadap albino dan bulu kasar dominan terhadap bulu halus.... 0. Pendapat tersebut sejalan dengan yang dikemukakan oleh . A. manusia C. 13. 25% E. A. Kalau marmot dari keturunan F 1 terbentuk dikawinkan dengan yang berbulu albino halus maka keturunannya yang berbulu hitam kasar adalah sebanyak .. potongan daging B. Louis Pasteur menumbangkan teori generatio spontanea dengan memuaskan karena percobaannya yang menggunakan .. 0. kemungkinannya bahwa semua anaknya tidak albino adalah. Sutton D...5000 C. 15. 0. 56% C. gajah 17.2500 B. tabung ditutup rapat D.9. Bila suami istri tersebut merencanakan mempunyai anak 4 orang. 6% 16. Sepasang suami istri normal. 5' SAGUA 3' E. 0... 3' GTSAT 5' C. 3' SAGUA 5' D. Darwin 10.. maka semua anak laki-lakinya akan buta warna. Marmot yang berbulu hitam kasar dikawinkan dengan yang berbulu albino halus menghasilkan keturunan F 1 yang semuanya berbulu hitam kasar .. 5' TAGTA 3' 14. SEBAB Asam amino yang dihasilkan dari percobaan Stanley Miller merupakan senyawa penyusun dasar kehidupan. 12.. A. Teori-teori tentang biogenesis didukung oleh . Daun kaktus yang tereduksi seperti duri-duri merupakan suatu bentuk penyesuaian terhadap lingkungan hidup di daerah gurun. Jika urutan basa pita DNA yang ditranskripsi adalah 3' GTSAT 5' maka urutan basa dalam RNA duta hasil transkripsi adalah . 37% D. dinosaurus D. Morgan E.0039 E. 3' TAGTA 5' B. 0. 75% B.0625 D. Pada marmot. (1) Louis Pasteur (2) Lazaro Spallanzani (3) Francesco Redi (4) Aristoteles . A. Penemuan fosil pada berbagai lapisan bumi yang dapat menerangkan adanya evolusi dengan jelas adalah fosil . Wallace B. kuda E.

f (4) a f 22.. epistasis D. (c)kaki depan kuda. protoplasma 23. sel bakteri mampu menghasilkan hormon insulin SEBAB Gen pembentuk insulin pada sel pankreas manusia dapat disisipkan pada plasmid bakteri secara teknik penyisipan gen. (1) tidak ada mikroorganisme di dalam pipa (2) mikroorganisme terperangkap dalam pipa (3) air kaldu tidak berhubungan dengan udara (4) air kaldu dapat berhubungan dengan udara luar 21. ayah adalah homozigot 24... Penyimpangan perbandingan fenotip F1 pada persilangan dengan dua sifat beda.. ibu adalah karier D.000 orang terdapat 4 orang albino. ibu adalah homozigot dominan B. Dengan teknik penyisipan gen pembentuk insulin. Gen terdapat pada A. (e) kaki depan kadal. (d)tangan manusia. gerak aktif 19. Dari organ-organ tersebut. 400 25. respons terhadap rangsangan D. anabolisme dan katabolisme C. kromosom D. 392 D. lokus kromosom C. Berapa orang pembawa sifat albino pada masyarakat tersebut? A. Pernikahan antara wanita dan laki-laki yang keduanya berpenglihatan normal menghasilkan seorang anak laki-laki yang buta warna dan dua anak perempuan berpenglihatan normal. 388 E. Louis Pasteur menggunakan pipa berleher angsa yang bertujuan agar . pertumbuhan dan perkembangan B. hipostasis C. ayah adalah karier E. polimeri E.. Dalam masyarakat A yang berpenduduk 10.. Dari kasus ini dapat diketahui bahwa A. misalnya dari 9 : 3 : 3 : 1 menjadi 9 : 3 : 4 disebut . (1) a b (2) c d (3) e . sitoplasma E. 350 B. Berikut ini disajikan sejumlah organ pada Vertebrata yaitu: (a)sirip anjing laut. perkembangbiakan E. (b)sayap kelelawar . (f)sirip dada ikan. Untuk membantah teori generatio spontanea dari Spallanzani. A. pindah silang B. 373 C. kriptomeri . nukleus B. ibu adalah homozigot resesif C.. 20. A. pasangan organ yang homolog adalah .18. Adaptasi adalah contoh kegiatan makhluk hidup dalam melakukan.

Sign up to vote on this title
UsefulNot useful