Genetika, Substansi Genetika dan Evolusi

1. Diketahui mRNA memiliki urutan basa N : AUGGCUAGGCUAUAAAUGCGA UCCGAUUGA. Bila sintesis protein dimulai dari urutan basa N paling kiri, maka polipetida yang akan terbentuk A. satu macam B. dua macam C. tiga macam D. empat macam E. lima macam 2. Pernyataan berikut yang berkaitan dengan teori Lamarck adalah..... 1) lingkungan berpengaruhi terhadap proses evolusi organisme 2) makhluk hidup beradaptasi melalui organ tubuhnya 3) perubahan organ tubuh diwariskan kepada keturunannya 4) seleksi alam memacu kepunahan organisme 3. Mutasi gen akan berpengaruh pada hal berikut, KECUALI .. A. urutan nukleotida B. terjemahan asam amino C. panjang polipetida D. jumlah pasangan basa E. jumlah kromosom 4. Sepasang suami istri bertengkar memasalahkan salah seorang anaknya yang bergolongan darah O, sedangkan suami istri tersebut masing-masing bergolongan darah A dan B. Penjelasan yang dapat anda berikan adalah .... (1) istri A heterozigotik dan suami B homozigotik (2) istri B heterozigotik dan suami A heterozigotik (3) istri A homozigotik dan suami B heterozigotik

(4) istri A heterozigotik dan suami B heterozigotik 5. Teori abiogenesis runtuh karena percobaan yang dilakukan oleh .... A. Aristoteles B. Harold Urey C. Louis Pasteur D. Alexander Oparin E. Anthonie van Leeuwenhoek 6. Perkawinan lalat buah warna abu-abu, sayap panjang dengan lalat buah warna hitam, sayap pendek. Memperoleh keturunan lalat buah dengan fenotip warna abu-abu, sayap panjang dan warna hitam, sayap pendek. Keadaan demikian dapat terjadi karena adanya peristiwa .... A. dominansi B. gagal berpisah C. gen terikat sempurna D. gen terikat tidak sempurna E. epistatis 7. Hemofilia adalah kelainan genetik yang disebabkan oleh gen resesif yang terpaut kromosom X. Seorang anak laki-laki hemofilia dapat lahir dari perkawinan .... (1) ayah normal, ibu normal heterozigotik (2) ayah normal, ibu hemofilia karier (3) ayah normal, ibu normal karier (4) ayah hemofilia, ibu normal homozigotik 8. Louis Pasteur menumbangkan teori generatio spontanea dengan memuaskan karena percobaannya yang menggunakan A. potongan daging B. kaldu ayam C. tabung ditutup rapat D. botol berbentuk leher angsa E. tabung ditutup kasa

56% C..0039 E. kemungkinannya bahwa semua anaknya tidak albino adalah. SEBAB Gen penyebab buta warna terdapat di dalam kromosom X dan bersifat resesif.9. Sutton D... tabung ditutup kain kasa. Lamarck C. warna bulu hitam dominan terhadap albino dan bulu kasar dominan terhadap bulu halus. Teori-teori tentang biogenesis didukung oleh . Sepasang suami istri normal. Seorang laki-laki berpenglihatan normal menikah dengan seorang wanita buta warna. kera B. potongan daging B. Wallace B. Bila suami istri tersebut merencanakan mempunyai anak 4 orang.. 3' TAGTA 5' B. manusia C. Kalau marmot dari keturunan F 1 terbentuk dikawinkan dengan yang berbulu albino halus maka keturunannya yang berbulu hitam kasar adalah sebanyak . Morgan E.. tabung ditutup rapat D. 0. Hasil percobaan Stanley Miller membuktikan bahwa makhluk hidup berasal dari benda tidak hidup.3164 11. Pada marmot. Penemuan fosil pada berbagai lapisan bumi yang dapat menerangkan adanya evolusi dengan jelas adalah fosil . 0. Louis Pasteur menumbangkan teori generatio spontanea dengan memuaskan karena percobaannya yang menggunakan . 5' SAGUA 3' E. 0. 25% E. 13.. gajah 17. Marmot yang berbulu hitam kasar dikawinkan dengan yang berbulu albino halus menghasilkan keturunan F 1 yang semuanya berbulu hitam kasar . 37% D. botol berbentuk leher angsa E.. 15. A.. A.. maka semua anak laki-lakinya akan buta warna..5000 C. Darwin 10.. kaldu ayam C.. A. 6% 16. Jika urutan basa pita DNA yang ditranskripsi adalah 3' GTSAT 5' maka urutan basa dalam RNA duta hasil transkripsi adalah . (1) Louis Pasteur (2) Lazaro Spallanzani (3) Francesco Redi (4) Aristoteles . masing-masing membawa sifat albino. A. dinosaurus D. 0. 75% B. 3' SAGUA 5' D. 12.. 3' GTSAT 5' C. A.. Pendapat tersebut sejalan dengan yang dikemukakan oleh . Daun kaktus yang tereduksi seperti duri-duri merupakan suatu bentuk penyesuaian terhadap lingkungan hidup di daerah gurun.0625 D... 0.2500 B. SEBAB Asam amino yang dihasilkan dari percobaan Stanley Miller merupakan senyawa penyusun dasar kehidupan. kuda E. 5' TAGTA 3' 14.. A.

A. Gen terdapat pada A. respons terhadap rangsangan D. protoplasma 23. nukleus B.f (4) a f 22. ayah adalah karier E. kromosom D. pertumbuhan dan perkembangan B... perkembangbiakan E. gerak aktif 19. Berikut ini disajikan sejumlah organ pada Vertebrata yaitu: (a)sirip anjing laut. (1) tidak ada mikroorganisme di dalam pipa (2) mikroorganisme terperangkap dalam pipa (3) air kaldu tidak berhubungan dengan udara (4) air kaldu dapat berhubungan dengan udara luar 21. ayah adalah homozigot 24. (e) kaki depan kadal.. anabolisme dan katabolisme C. Dari organ-organ tersebut. 400 25. A. lokus kromosom C. Adaptasi adalah contoh kegiatan makhluk hidup dalam melakukan. misalnya dari 9 : 3 : 3 : 1 menjadi 9 : 3 : 4 disebut . sitoplasma E. Dalam masyarakat A yang berpenduduk 10. epistasis D. 373 C. Dari kasus ini dapat diketahui bahwa A. pindah silang B. (1) a b (2) c d (3) e .18. (c)kaki depan kuda. Penyimpangan perbandingan fenotip F1 pada persilangan dengan dua sifat beda.. ibu adalah homozigot dominan B. 392 D. 350 B.. kriptomeri . sel bakteri mampu menghasilkan hormon insulin SEBAB Gen pembentuk insulin pada sel pankreas manusia dapat disisipkan pada plasmid bakteri secara teknik penyisipan gen. ibu adalah homozigot resesif C. ibu adalah karier D. polimeri E. Berapa orang pembawa sifat albino pada masyarakat tersebut? A. 20. Louis Pasteur menggunakan pipa berleher angsa yang bertujuan agar .000 orang terdapat 4 orang albino. (b)sayap kelelawar . Pernikahan antara wanita dan laki-laki yang keduanya berpenglihatan normal menghasilkan seorang anak laki-laki yang buta warna dan dua anak perempuan berpenglihatan normal. (f)sirip dada ikan.. Untuk membantah teori generatio spontanea dari Spallanzani. pasangan organ yang homolog adalah . (d)tangan manusia. Dengan teknik penyisipan gen pembentuk insulin.. 388 E. hipostasis C.

Sign up to vote on this title
UsefulNot useful