Genetika, Substansi Genetika dan Evolusi

1. Diketahui mRNA memiliki urutan basa N : AUGGCUAGGCUAUAAAUGCGA UCCGAUUGA. Bila sintesis protein dimulai dari urutan basa N paling kiri, maka polipetida yang akan terbentuk A. satu macam B. dua macam C. tiga macam D. empat macam E. lima macam 2. Pernyataan berikut yang berkaitan dengan teori Lamarck adalah..... 1) lingkungan berpengaruhi terhadap proses evolusi organisme 2) makhluk hidup beradaptasi melalui organ tubuhnya 3) perubahan organ tubuh diwariskan kepada keturunannya 4) seleksi alam memacu kepunahan organisme 3. Mutasi gen akan berpengaruh pada hal berikut, KECUALI .. A. urutan nukleotida B. terjemahan asam amino C. panjang polipetida D. jumlah pasangan basa E. jumlah kromosom 4. Sepasang suami istri bertengkar memasalahkan salah seorang anaknya yang bergolongan darah O, sedangkan suami istri tersebut masing-masing bergolongan darah A dan B. Penjelasan yang dapat anda berikan adalah .... (1) istri A heterozigotik dan suami B homozigotik (2) istri B heterozigotik dan suami A heterozigotik (3) istri A homozigotik dan suami B heterozigotik

(4) istri A heterozigotik dan suami B heterozigotik 5. Teori abiogenesis runtuh karena percobaan yang dilakukan oleh .... A. Aristoteles B. Harold Urey C. Louis Pasteur D. Alexander Oparin E. Anthonie van Leeuwenhoek 6. Perkawinan lalat buah warna abu-abu, sayap panjang dengan lalat buah warna hitam, sayap pendek. Memperoleh keturunan lalat buah dengan fenotip warna abu-abu, sayap panjang dan warna hitam, sayap pendek. Keadaan demikian dapat terjadi karena adanya peristiwa .... A. dominansi B. gagal berpisah C. gen terikat sempurna D. gen terikat tidak sempurna E. epistatis 7. Hemofilia adalah kelainan genetik yang disebabkan oleh gen resesif yang terpaut kromosom X. Seorang anak laki-laki hemofilia dapat lahir dari perkawinan .... (1) ayah normal, ibu normal heterozigotik (2) ayah normal, ibu hemofilia karier (3) ayah normal, ibu normal karier (4) ayah hemofilia, ibu normal homozigotik 8. Louis Pasteur menumbangkan teori generatio spontanea dengan memuaskan karena percobaannya yang menggunakan A. potongan daging B. kaldu ayam C. tabung ditutup rapat D. botol berbentuk leher angsa E. tabung ditutup kasa

56% C. 3' TAGTA 5' B. masing-masing membawa sifat albino. A. A..0039 E.. Marmot yang berbulu hitam kasar dikawinkan dengan yang berbulu albino halus menghasilkan keturunan F 1 yang semuanya berbulu hitam kasar .2500 B.. SEBAB Gen penyebab buta warna terdapat di dalam kromosom X dan bersifat resesif. A. warna bulu hitam dominan terhadap albino dan bulu kasar dominan terhadap bulu halus. 12. Hasil percobaan Stanley Miller membuktikan bahwa makhluk hidup berasal dari benda tidak hidup... manusia C.. kemungkinannya bahwa semua anaknya tidak albino adalah. 15. gajah 17. Wallace B. Sepasang suami istri normal... Kalau marmot dari keturunan F 1 terbentuk dikawinkan dengan yang berbulu albino halus maka keturunannya yang berbulu hitam kasar adalah sebanyak . tabung ditutup kain kasa. Pendapat tersebut sejalan dengan yang dikemukakan oleh .. 0. potongan daging B. 3' GTSAT 5' C. Daun kaktus yang tereduksi seperti duri-duri merupakan suatu bentuk penyesuaian terhadap lingkungan hidup di daerah gurun. maka semua anak laki-lakinya akan buta warna. tabung ditutup rapat D. 25% E. 5' SAGUA 3' E. 0. Bila suami istri tersebut merencanakan mempunyai anak 4 orang.. SEBAB Asam amino yang dihasilkan dari percobaan Stanley Miller merupakan senyawa penyusun dasar kehidupan. botol berbentuk leher angsa E. Seorang laki-laki berpenglihatan normal menikah dengan seorang wanita buta warna.. 13. 5' TAGTA 3' 14. Teori-teori tentang biogenesis didukung oleh . dinosaurus D. Sutton D. 75% B. Morgan E. 0. Lamarck C. Louis Pasteur menumbangkan teori generatio spontanea dengan memuaskan karena percobaannya yang menggunakan . 0. kuda E... kera B. Darwin 10..9. Penemuan fosil pada berbagai lapisan bumi yang dapat menerangkan adanya evolusi dengan jelas adalah fosil . A.. 3' SAGUA 5' D.. 0.. 6% 16. 37% D. A. (1) Louis Pasteur (2) Lazaro Spallanzani (3) Francesco Redi (4) Aristoteles .3164 11. Pada marmot. kaldu ayam C. Jika urutan basa pita DNA yang ditranskripsi adalah 3' GTSAT 5' maka urutan basa dalam RNA duta hasil transkripsi adalah .0625 D. A.5000 C.

(1) a b (2) c d (3) e . kromosom D. protoplasma 23. misalnya dari 9 : 3 : 3 : 1 menjadi 9 : 3 : 4 disebut . Berapa orang pembawa sifat albino pada masyarakat tersebut? A. nukleus B.. Untuk membantah teori generatio spontanea dari Spallanzani. respons terhadap rangsangan D. Dari kasus ini dapat diketahui bahwa A. ibu adalah karier D. sel bakteri mampu menghasilkan hormon insulin SEBAB Gen pembentuk insulin pada sel pankreas manusia dapat disisipkan pada plasmid bakteri secara teknik penyisipan gen. (c)kaki depan kuda. gerak aktif 19. ibu adalah homozigot dominan B.18. Penyimpangan perbandingan fenotip F1 pada persilangan dengan dua sifat beda. Adaptasi adalah contoh kegiatan makhluk hidup dalam melakukan. hipostasis C... Dalam masyarakat A yang berpenduduk 10. perkembangbiakan E. Dari organ-organ tersebut. (b)sayap kelelawar . Louis Pasteur menggunakan pipa berleher angsa yang bertujuan agar . 350 B. Gen terdapat pada A. pindah silang B. kriptomeri . (1) tidak ada mikroorganisme di dalam pipa (2) mikroorganisme terperangkap dalam pipa (3) air kaldu tidak berhubungan dengan udara (4) air kaldu dapat berhubungan dengan udara luar 21.f (4) a f 22. A. pertumbuhan dan perkembangan B. 400 25. 20. pasangan organ yang homolog adalah . ibu adalah homozigot resesif C. Dengan teknik penyisipan gen pembentuk insulin. polimeri E. epistasis D. Pernikahan antara wanita dan laki-laki yang keduanya berpenglihatan normal menghasilkan seorang anak laki-laki yang buta warna dan dua anak perempuan berpenglihatan normal. 373 C. (d)tangan manusia. 388 E.. ayah adalah homozigot 24. A. (e) kaki depan kadal. anabolisme dan katabolisme C. (f)sirip dada ikan.000 orang terdapat 4 orang albino. Berikut ini disajikan sejumlah organ pada Vertebrata yaitu: (a)sirip anjing laut.. ayah adalah karier E. sitoplasma E. lokus kromosom C. 392 D...