P. 1
Genetika Dan Evolusi

Genetika Dan Evolusi

|Views: 614|Likes:
Published by eipoenya

More info:

Published by: eipoenya on Jun 24, 2011
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as DOCX, PDF, TXT or read online from Scribd
See more
See less

12/21/2012

pdf

text

original

Genetika, Substansi Genetika dan Evolusi

1. Diketahui mRNA memiliki urutan basa N : AUGGCUAGGCUAUAAAUGCGA UCCGAUUGA. Bila sintesis protein dimulai dari urutan basa N paling kiri, maka polipetida yang akan terbentuk A. satu macam B. dua macam C. tiga macam D. empat macam E. lima macam 2. Pernyataan berikut yang berkaitan dengan teori Lamarck adalah..... 1) lingkungan berpengaruhi terhadap proses evolusi organisme 2) makhluk hidup beradaptasi melalui organ tubuhnya 3) perubahan organ tubuh diwariskan kepada keturunannya 4) seleksi alam memacu kepunahan organisme 3. Mutasi gen akan berpengaruh pada hal berikut, KECUALI .. A. urutan nukleotida B. terjemahan asam amino C. panjang polipetida D. jumlah pasangan basa E. jumlah kromosom 4. Sepasang suami istri bertengkar memasalahkan salah seorang anaknya yang bergolongan darah O, sedangkan suami istri tersebut masing-masing bergolongan darah A dan B. Penjelasan yang dapat anda berikan adalah .... (1) istri A heterozigotik dan suami B homozigotik (2) istri B heterozigotik dan suami A heterozigotik (3) istri A homozigotik dan suami B heterozigotik

(4) istri A heterozigotik dan suami B heterozigotik 5. Teori abiogenesis runtuh karena percobaan yang dilakukan oleh .... A. Aristoteles B. Harold Urey C. Louis Pasteur D. Alexander Oparin E. Anthonie van Leeuwenhoek 6. Perkawinan lalat buah warna abu-abu, sayap panjang dengan lalat buah warna hitam, sayap pendek. Memperoleh keturunan lalat buah dengan fenotip warna abu-abu, sayap panjang dan warna hitam, sayap pendek. Keadaan demikian dapat terjadi karena adanya peristiwa .... A. dominansi B. gagal berpisah C. gen terikat sempurna D. gen terikat tidak sempurna E. epistatis 7. Hemofilia adalah kelainan genetik yang disebabkan oleh gen resesif yang terpaut kromosom X. Seorang anak laki-laki hemofilia dapat lahir dari perkawinan .... (1) ayah normal, ibu normal heterozigotik (2) ayah normal, ibu hemofilia karier (3) ayah normal, ibu normal karier (4) ayah hemofilia, ibu normal homozigotik 8. Louis Pasteur menumbangkan teori generatio spontanea dengan memuaskan karena percobaannya yang menggunakan A. potongan daging B. kaldu ayam C. tabung ditutup rapat D. botol berbentuk leher angsa E. tabung ditutup kasa

(1) Louis Pasteur (2) Lazaro Spallanzani (3) Francesco Redi (4) Aristoteles . A. SEBAB Gen penyebab buta warna terdapat di dalam kromosom X dan bersifat resesif..3164 11.0039 E. Sepasang suami istri normal.. kemungkinannya bahwa semua anaknya tidak albino adalah. 75% B. 3' GTSAT 5' C. 6% 16. warna bulu hitam dominan terhadap albino dan bulu kasar dominan terhadap bulu halus... kera B. 25% E. Kalau marmot dari keturunan F 1 terbentuk dikawinkan dengan yang berbulu albino halus maka keturunannya yang berbulu hitam kasar adalah sebanyak . 12.. A. 5' TAGTA 3' 14. Morgan E. 0. 0. 5' SAGUA 3' E. masing-masing membawa sifat albino. 37% D.2500 B.9.. Pendapat tersebut sejalan dengan yang dikemukakan oleh .. Teori-teori tentang biogenesis didukung oleh . gajah 17. Bila suami istri tersebut merencanakan mempunyai anak 4 orang.. maka semua anak laki-lakinya akan buta warna. Penemuan fosil pada berbagai lapisan bumi yang dapat menerangkan adanya evolusi dengan jelas adalah fosil .. Wallace B. Seorang laki-laki berpenglihatan normal menikah dengan seorang wanita buta warna. Pada marmot. A. 56% C. A. A. 3' TAGTA 5' B. SEBAB Asam amino yang dihasilkan dari percobaan Stanley Miller merupakan senyawa penyusun dasar kehidupan. dinosaurus D. Louis Pasteur menumbangkan teori generatio spontanea dengan memuaskan karena percobaannya yang menggunakan .. Marmot yang berbulu hitam kasar dikawinkan dengan yang berbulu albino halus menghasilkan keturunan F 1 yang semuanya berbulu hitam kasar .. tabung ditutup kain kasa.. kaldu ayam C. 0.. Lamarck C. 13. kuda E. 0. Darwin 10. botol berbentuk leher angsa E. 0. potongan daging B. 3' SAGUA 5' D. tabung ditutup rapat D... 15. Hasil percobaan Stanley Miller membuktikan bahwa makhluk hidup berasal dari benda tidak hidup. Daun kaktus yang tereduksi seperti duri-duri merupakan suatu bentuk penyesuaian terhadap lingkungan hidup di daerah gurun.5000 C.. manusia C.0625 D.. Sutton D. Jika urutan basa pita DNA yang ditranskripsi adalah 3' GTSAT 5' maka urutan basa dalam RNA duta hasil transkripsi adalah . A.

ibu adalah homozigot dominan B. nukleus B. 350 B. Dengan teknik penyisipan gen pembentuk insulin. pertumbuhan dan perkembangan B. sitoplasma E. A. Louis Pasteur menggunakan pipa berleher angsa yang bertujuan agar . Gen terdapat pada A. ayah adalah homozigot 24. 388 E. (b)sayap kelelawar . pasangan organ yang homolog adalah . 392 D. Adaptasi adalah contoh kegiatan makhluk hidup dalam melakukan. Berapa orang pembawa sifat albino pada masyarakat tersebut? A. Pernikahan antara wanita dan laki-laki yang keduanya berpenglihatan normal menghasilkan seorang anak laki-laki yang buta warna dan dua anak perempuan berpenglihatan normal. epistasis D. Berikut ini disajikan sejumlah organ pada Vertebrata yaitu: (a)sirip anjing laut. pindah silang B. Dalam masyarakat A yang berpenduduk 10. ayah adalah karier E.f (4) a f 22. polimeri E. sel bakteri mampu menghasilkan hormon insulin SEBAB Gen pembentuk insulin pada sel pankreas manusia dapat disisipkan pada plasmid bakteri secara teknik penyisipan gen.. Dari kasus ini dapat diketahui bahwa A. ibu adalah karier D.. lokus kromosom C. anabolisme dan katabolisme C. Untuk membantah teori generatio spontanea dari Spallanzani.18. (e) kaki depan kadal. misalnya dari 9 : 3 : 3 : 1 menjadi 9 : 3 : 4 disebut . (d)tangan manusia. ibu adalah homozigot resesif C. 373 C. perkembangbiakan E. protoplasma 23. kromosom D... respons terhadap rangsangan D. Dari organ-organ tersebut. 400 25. gerak aktif 19. hipostasis C. (c)kaki depan kuda.000 orang terdapat 4 orang albino. Penyimpangan perbandingan fenotip F1 pada persilangan dengan dua sifat beda. (1) tidak ada mikroorganisme di dalam pipa (2) mikroorganisme terperangkap dalam pipa (3) air kaldu tidak berhubungan dengan udara (4) air kaldu dapat berhubungan dengan udara luar 21. A.. (f)sirip dada ikan. 20... (1) a b (2) c d (3) e . kriptomeri .

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->