P. 1
Ekspresi Gen

Ekspresi Gen

|Views: 642|Likes:
Published by Khoerotun Nisa'

More info:

Published by: Khoerotun Nisa' on Jul 24, 2011
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

04/09/2013

pdf

text

original

EKSPRESI HETEROLOGUS GEN INTERFERON ALFA 2 MANUSIA: ISOLASI, KLONING, DAN SEKUENSING

YEMIMA SURYANI

JURUSAN KIMIA FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM INSTITUT PERTANIAN BOGOR BOGOR

2001

RINGKASAN
YEMIMA SURYANI. Ekspresi Heterologus Gen Interferon Alfa 2 Manusia: Isolasi, Kloning, dan Sekuensing Gen Interferon Alfa Manusia (Heterologous Expression of Interferon Alpha 2 Gene: Isolation, Cloning, and Sequencing). Dibimbing oleh SULlSTlYANI, I MADE ARTIKA, dan HERAWATISUDOYO. Interferon alfa 2 manusia (Hu-IFNo:.2) merupakan zat antivirus dan antitumor yang Lelah diakui penggunaannya untuk mengobati berbagai penyakit keganasan dan penyakit akibat virus. Penggunaannya di Indonesia masih terbatas karena harga obar ini di luar jangkauan kernampuan masyarakat. Penelitian ini bertujuan mengisolasi gen Hu-IFNu2 yang pada akhirnya akan diekspresikan untuk tujuan produksi protein IFNo:.2 dalam skala industri, Penelitian diawali dengan studi bioinformatika untuk menentukan urutan nukleotida gen Hu-IFNo:.2 dan daerah sekitarnya. Data yang diperoleh digunakan sebagai landasan dalam merancang sepasang primer yang digunakan untuk mengisolasi gen tersebut dari DNA genom manusia dengan teknik peR (Polymerase Chain Reaction). Dari proses ini diperoleh fragmen DNA berukuran 797 ph yang merupakan kandidat gen Hu-IFNo:.2• Fragmen DNA disisipkan ke dalam vektor pGEM®-T, dilanjutkan dengan transformasi ke dalam sel E. coli. Dari sepuluh koloni transforrnan yang plasmidnya diisolasi dan ukuran insert-ivy» diperiksa dengan teknik peR, ternyata sernbilan koloni memiliki ukuran insert yang sesuai (1.047 pb). Urutan nukleotida kandidat gen Hu-IFNu2 tersebut diperiksa menggunakan Big Dye Terminator Cycle Sequencing Ready Reaction Kit (ABI) serta dianalisis menggunakan Automatic DNA Sequencer AB! Prism 377. Hasil analisis menunjukkan bahwa bcnar gen yang diisolasi rnerupakan gen Hu-IFNo:.2• Gcn ini siap untuk disubklon ke dalam suatu vekror ckspresi untuk mcnghasilkan protein 1FNcx2.

THE SHEPHeRD's PSALM

The Lord is my shepherd; I shall not want. He maketh me to lie down in green pastures: He leadeth me beside the still waters. He restoreth my soul: he leadeth me in the paths of righthousness for his name's sake. Yea, though I walk through the valley of the shadow of death, I will fear no evil: For thou art with me; thy rod and thy staff they comfort me. Thou preparest a table before me in the presence of mine enemies: thou antoinest my head with oil; my cup runneth over. Surely goodness and mercy shall follow me all the days of my life: and I will dwell in the house of the Lord forever.
\

Psalm 23

DAN SEKUENSING YEMIMA SURYANI Skripsi sebagai salah satu syarat untuk mernperoleh Sarjana Sains pada Program Studi Kimia gelar JURUSAN KIMIA FAKULTAS MATEMATIKA DAN ILMU PENGETAHUAN ALAM INSTITUT PERTANIAN BOGOR BOGOR 2001 .EKSPRESI HETEROLOGUS GEN INTERFERON ALFA 2 MANUSIA: ISOLASI. KLONING.

11'.D Pernbimbing II Pernbimbing III Tanggal lulus: I 7. Ph.1 Made Artika. Kloning.. Ph.: Ekspresi Heterologus Gen Interferon Alfa 2 Manusia: Isolasi. dan Sekuensing Nama : Yernima Suryani NIM : 001497047 Judul Menyetujui. M. AUG 2001 .Sc.D.

Jakarta dan pada tahun 2001 penulis melaksanakan penelitian di Lembaga Biologi Molekul Eijkman. Selarna mengikuti perkuliahan penulis pernah menjadi asisten mata kuliah Kimia Dasar I pada tahun ajaran 1999/2000. .RIWAYATHIDUP Penulis dilahirkan di Jakarta pada tanggal 16 April 1979 sebagai anak tunggal dari pasangan Adi Suryono dan Jusijanti. Kimia Dasar II pada tahun ajaran 1999/2000. Pada tahun 1997 penulis lulus dari SMU Kristen I Jakarta dan pad a tahun yang sama penulis masuk IPB pada Fakultas MIPA Program Studi Kimia melalui jalur Undangan Seleksi Masuk IPB (USMI). Pad a tahun 2000 penulis melaksanakan praktik lap~ngan di Badan Tennga Nuklir Nasional Pasar Jumat. Jakarta. dan Biokimia I pada tahun ajaran 200012001.

dr. bimbingan yang berharga bagi penulis.. kasih. I Made Artika M. Oge. Dodi.Sc. Yadi. mama. Debby. mengizinkan M. Ph. Di samping itu ungkapan terima kasih ini juga diberikan kepada Kak Anna. Benny. Herawati Sudoyo. Kloning. dan Rahel untuk scgala doa. dan seluruh star Lembaga Eijkrnan alas bantuan dan sarannya.. antara lain Prof. Terima kasih penulis ucapkan kepada berbagai pihak yang Lelah membantu penyelesaian karya ilmiah ini. dan sernua ternan angkatan 34 alas segala dukungan dan persahabatannya.App.. dan drh. Sangkot Marzuki. Semoga karya ilmiah ini dapat bcrmanfaat. Ph. Penelitian seluruhnya didanai oleh Lembaga Biologi Molekul Eijkman.D selaku Direktur Lembaga Eijkman yang telah penulis rnelakukan penelitian.D. Selain itu penults juga mcngucapkan tcrima kasih kepada Eva. Kak Helena.Sc. Kristi. Jakarta. dan dukungannya.. Eno. Ph. If. Ungkapan terirna kasih juga disampaikan kcpada papa.S. M.D. sehingga karya ilmiah ini bisa diselesaikan dengan baik. Iskandar. Ph.PRAKATA Puji dan syukur penulis panjatkan ke hadirat Bapa yang Maim Kasih atas segala karunia-Nya. Jakarta.D.D selaku pembimbing yang ban yak memberi saran dan M. Penelitian ini yang berjudul Ekspresi Heterologus Gen dilaksanakan lIll Interferon Alfa 2 Manusia: Isolasi. Puji. Sulistiyani. Juli 200 I Yemima Suryani . dan Sekuensing Gen Inteferon Alfa 2 Manusia dad bulan Februari sampai Mei 2001 di Lembaga Biologi Molekul Eijkman.

.................................... 2 .................................................. HASIL DAN PEMBAHASAN Isolasi DNA Genom: Kadar dan Keruurnian DNA.............................................. ................................ .... .............. ..................................... 3 PolymeraseChainReactioll......................... Deteksi Prod uk peR dengan Elektroforesis Gel Agarosa......................... ................. 9 9 9 10 10 10 II I1 12 14 16 17 17 17 20 ......... Saran....................... Studi Bioinformatika..... .......... Kloning................................. Sekuensing...................... DAFTAR PUSTAKA................................................................. Amplifikasi Gen Interferon Alfa 2 Manusia.. Halaman ~ viii VIII \......................................................................DAFTARISI DAFfAR TABEL.......................... Ligasi Produk peR dengan Vektor pGEM®-T............................. LAMPI RAN .... ...................................................................................... 7 I) 8 8 9 PolymeraseChainReaction..................................... KESIMPULAN DAN SARAN Kesimpulan..................... coli...................................... ........... ....... SeJeksi dan Isolasi Plasmid Rekombinan. DAFTAR GAMBAR.......................... PENDAHULUAN TINJAUAN PUSTAKA Interferon Struktur dan Keragaman Gen Interferon Manusia.......... ..................... .................................................................. Pengukuran Kadar dan Kemurnian DNA........... .................... DAFTAR LAMPIRAN. .......................... Kloning........................... .................... ........... ...... Sekuensing.............................................................................. BAHAN DAN METODE Bahan 3 4 6 7 Peralatan Garis Besar Kcgiatan............. Sekuensing Hasil Kloning......... Pemurnian Produk peR " ......................... . ... Transforrnasi ke daIam SeI E. ......................... Interferon Alfa 2....111 .................. . Isolasi DNA Genom..............

..... Hasil konfirrnasi sekuens sampel dengan standar Y 11834............. Stratcgi amplifikasi gen 1FNa2......................................... 2........ Tahapan reaksi pad a teknik Polymerase Chain ReactiOIl.... Contoh pernisahun fragmcn-Iragmcn DNA clan sckuensnya....... Daftar primer yang digunakan... 2........... Diagram alir metode penelitian IFNA 2........... DAFTAR GAMBAR Halaman 4 4 5 7 I............................... Program peR untuk sekuensing.............. ....................... L 3.......................................................................................................... ................... 4... Hasil amplifikasi DNA sampel dengan primer IF-2 dan IR-2 pada 3 suhu annealing ... Perhitungan kadar dan kemurnian DNA............ Klasifikasi interferon....... 5........... .... 4.... 7.......... . b....... Tahapan teknik kloning. ...................... 13 15 16 16 17 II.... Perbandingan sekuens sampel dengan sekuens standar 1FNa2 IFNo:...... 8......... a.... Cawan petri berisi medium LB yang mengandung ampisiIin..............DAFTAR TABEL Halarnan 2 2 I................................ 9............. Daerah pertemuan antara vektor pGEM®-T dengan salah satu ujung insert 14. Ciri-ciri urnum gen IFN manusia.. Elektroforegram hasil perunutan sekuens gcn IFNa2dengan primer IF-2.... dan X-gal 12.................... 3..... Hasil PCR sepuluh koloni 13......... 5...2 dan IFNaz c ........... 12 10..... 8 6.................................. Program PCR untuk amplifikasi gcn IFNA 2............................. Konsrruksi plasmid pGEM®-T.. Perbandingan sebagian sekuens IFN~ dengan sebagian sekuens IFNa yang lain. DAFTAR LAMPIRAN Halaman 20 21 22 23 24 I. Program PCR untuk konfirmasi ukuran 9 I! II insert plasmid rckombinan........ IPTG.......

....6.. 25 26 . Sekuens keseluruhan IFNa2 hasil isolasi........................ Urutan nukleotida gen Hu-1FNa2 dan asam amino yang disandinya. 7......

PENDAHULUAN Akhir-akhir ini semakin banyak manusia yang terserang penyakit tumor dan penyakit yang diinduksi oleh virus. Food and Drug Administration sebagai salah satu obat antitumor dan antivirus pada bulan Juni 1986 dan telah banyak diproduksi oleh negara-negara maju (Gutterman. Ketiga fungsi ini berkaitan erat satu sama lain karena dalam rnenjalankan tugasnya. Interferon alfa 2 (IFNu2) merupakan salah satu jcnis protein yang disintesis oleh sistem kekebalan tubuh apabila tubuh terserang virus dan tumor. Jalan keluar yang dapat ditempuh untuk mengatasi rnasalah tersebut adalab swasembada . (995). Selanjutnya 1FNu2 hasil ekspresi dapat dimanfaatkan secara luas untuk mengobati penyakit tumor dan penyakit akibat virus.. sumber daya manusia. Sejak dua dekade terakhir. Zat-zat imun tersebut diharapkan akan rnengobati tepa! pada sasaran dan sesedikit mungkin menimbulkan efek sarnping. menghambat proliferasi sel-sel vertebrata. J 996.z belum dimanfaatkan secara luas di Indonesia. Hasil-hasil penelitian menunjukkan bahwa IFNu2 efektif untuk rnereduksi tumor dan mengobati berbagai macarn jenis penyakit yang diinduksi oleh virus. Mereka berfungsi untuk menghambat replikasi virus yang masuk ke dalam sel. Pada dasarnya IFN merupakan sekelompok protein dan glikoprotein yang diproduksi oleh sel mamalia dalam rangka merespon sejumlah penginduksi (Sattayasai. Manfaat yang diperoleh dari penelitian ini adalah tersedianya gen 1FNu2 dalam vektor pGEM6'-T yang siap untuk dipindahkan (disubklon) ke dalam suatu vektor ekspresi. Adapun tujuan penelitian ini adalah untuk mengisolasi gen IFNu2 dan menyimpannya dalam vektor pGEM. terutama untuk penyakit tumor ganas (kanker). dan konfirrnasi sekuensnya dcngan teknik sekucnsing.S. amplifikasi gen IFNo:z dari DNA genom manusia dengan teknik peR (Polymerase Chain Reaction).z ini adalah penghambatan replikasi virus dan penghancuran sel yang terserang virus atau tumor. AgarwaJa & Kirkwood. dan mengatur respon kekebalan (Stites et al. antara lain adalah keterbatasan teknologi. IFN tidak langsung menyerang virus .IFNu2 di Indonesia. Akibatnya sampai saat ini IFNO'. Pengiriman dan pemasaran IFNu2 dari luar negeri ke Indonesia memerlukan biaya yang sangat mahal. Dcngan demikian diharapkan jumlah penderita penyakit tumor dan penyakit yang disebabkan oleh virus di Indonesia akan berkurang.!i)-T. Penelitian ini rnerupakan tahap awal dari serangkaian peneiitian tentang IFNcxz yang bertujuan untuk rnemproduksi 1FNu2 dengan teknik DNA rekombinasi melalui ekspresi gen 1FNu2 dalam suatu vektor ekspresi. Selain itu biaya yang diperlukan juga cukup mahal. Daya tahan tubuh yang lemah mengakibatkan tubuh mudah terserang penyakit. TINJAUAN PUSTAKA Interferon Interferon (lFN) dipublikasikan pertama kali oleh Isaacs dan Lindenmann pada tahun 1957 dan dinamai oleh mereka berdasarkan kemampuan senyawa tersebut untuk mengganggu replikasi dari berbagai macarn : virus. dan biaya. sehingga sumber daya manusia Indonesia yang menggeluti bidang ini masih terbatas. Swasembada 1FNu2 di' Indonesia selama ini belum diusahakan karen a terdapat beberapa kendala utama.. 1994). Teknologi DNA rekornbinasi yang diperlukan untuk produksi IFNu2 baru dimanfaatkan di Indonesia dalam beberapa tahun terakhir. kloning gen tersebut. 1FNu2 telah diakui oleh U. padahal kebutuhan akan 1FNu2 sernakin meningkat seiring dengan meningkatnya jumlah penderita penyakit tumor dan penyakit yang diinduksi oleh VIruS. 1994). Tahapan penelitian yang dilakukan secara garis besar melipuri isolasi DNA genom rnanusia dari darah vena. Keberhasilan procluksi 1FNuz akan mendukung terciptanya swasembada obat antivirus dan antitumor di Indonesia. 1990). Efek yang ditimbulkan oleh IFNO'. Teknik pengobatan yang digunakan secara luas saat ini belum menunjukkan hasil yang cukup memuaskan karena tingkat kesembuhan penderita penyakit tersebut masih relatif rendah. Salah satu zat irnun yang telah banyak dimanfaatkan di negara-negara maju adalah interferon alfa 2 manusia (Millar et al. para peneliti di negara-negara maju mengembangkan suatu teknik pengobatan menggunakan zat-zat irnun (kekebalan) yang diproduksi oJeh tubuh manusia secara alami pada kondisi tertentu.

yaitu tahan terhadap kondisi asarn dan keduanya menggunakan reseptor yang sama. tetapi hanya gen IFN manusia yang paling banyak diketahui saat ini. . dan IFNy diperoleh dengan teknik kloning. sedangkan IFNy berbeda dengan kedua tipc IFN yang lain karena tidak tahan terhadap kondisi as am dan menggunakan rcscptor yang bcrhcda. tikus. dan IFNy. 1982). schinggu digolongkan ke dalam IFN tipc II. IFN~. IFN juga memiliki efek antitumor. Sel-sel tumor lebih sensitif terhadap IFN dibandingkan dengan sel-sel normal karena kemungkinan besar IFN merupakan tumor supressor yang potensial. coli. Tipe-tipe IFN yang dapat menginduksi efek antivirus dan antitumor pad a sel-sel vertebrata disajikan pada Tabel I. yairu IFNo:. Produk gen ini adalah polipeptida dengan 188 atau 189 asarn amino dengan 23 asam amino pertarnanya merupakan peptida sinyaJ yang bersifat hidrofobik. I. dan IFN~. IFNa. SeIain efek antivirus. IFNro sering dikaitkan dengan IFNa. TabeI 2. Beberapa gen IFN juga dimasukkan ke dalam vektor yang memungkinkan ekspresi gen tersebut di dalam sel rnamalia atau di dalam sel ragi (Gray et al. Gen ini mcnyandi 187 asam amino dengan 21 asarn amino pertamanya merupakan peptida sinyal. Struktur dan Keragaman Gen Interferon Manusla Gen IFN dari beberapa spesies hewan (manusia. dan 6 pseudogcn dengan homologi Sel yang memproduksi Leukosit (kemungkinan Komponen mukrofng) p y Ll mfoblnstoid Sel pad a jaringan padat Stimulus Sel T (dibantu oleh makrofug) anligenik Surnber . Klasifikasi Penginduksi Virus Virus interferon (IFN) 13 gcn IFNa.. sehingga gen IFN tersebut dapat diekspresikan di dalam E. Sampai saat ini hanya satu gen IFN~ manusia yang diternukan. Gen IFNy hanya merniliki sedikit kerniripan dengan gen IFNo:. berkelorupok dalam kromosorn 9 dan tidak memiliki intron (Dijkrnans & Billiau.166 166 146 D 21 20 Krouuisom \) ~ 'Y Kromusosu <) Kromusum 12 Sumbcr: Dijkmans & BilliutI. gen ini juga tidak memiliki intron dan terletak dalarn kromosorn 9. Peptida sinyal ini akan dilepaskan pada saat protein ini ditransportasikan keluar sci rnenghasilkan INFiX yang terdiri dari 165 atau 166 asam amino.. atau disebut pseudogen karena susunannya menyerupai IFNa dan diproduksi oleh Ieukosit (Stites et al. 1985 Antara tahun 1979 dan 1982. kernudian dinyatakan keabsahannya oleh data asam nukleat penyusun masing-rnasing tipe IFN. IFNP. Gen IFNo:. Beberapa karakteristik gen IFN manusia (Hu-IFN) dan protein yang dihasilknnnya disajikan pada Tabcl 2. sekucns DNA manusia yang menyandi kode genetik untuk pernbentukan IFNo:. Tabel Tire IFN CI. sekuens nukleotidanya 85-95% (Lawn et al. sehingga digolongkan sebagai IFN tipe.. Hal ini mencerrninkan kemampuan IFN untuk mengatur ekspresi gengen yang spesifik dan aktivitas metaboIik pacta sel-sel sasaran. Ciri-ciri umum gen IFN manusia Panjung Tipe Jumluh 11111"011 IFN CI mature Protein (au) Gell > 13 Panjang peptida Sinyal (aa) Leuik o 0 3 165. Terdapat tiga jenis lFN. tetapi struktur umum gen IFN~ mirip dengan IFNa. Gen IFNy terletak pada kromosom 12 dan merniliki 3 intron dalam .Dijkmans & Silli!IU. sehingga sel-sel tersebut tidak dapat lagi ditempati oleh virus tersebut. hanya sekitar 45 %. Sarna seperti gen IFNa. melainkan menyerang sel inang yang terinfeksi virus sedernikian rupa.. Teknik kloning tersebut dilakukan dengan cam rnemasukkan gen IFN ke dalam plasmid E. Akibatnya penggolongan pada Tabel 1 yang awalnya hanya didasarkan pada kriteria serologis.. IlJli:'i terdapat Pada genom manusia paling scdikit I.. letapi digolongkan ke dalam kelornpok tersendiri yang disebut sebagai IFNw. coli. 198 I).2 yang rnenginfeksi sel-sel tubuh. I985). dan IFN~ sifatnya mirip. dan sapi) Lelah diklon dan dianalisis. Enam buah pseudogen tersebut kadangkadang tidak digolongkan ke dalam gen IFNa. 1994). Homologi gen IFN~ dengan gen IFNa.

dan perpanjangan rantai DNA bam oleh DNA polimerase dari arah 5' ke 3'. 1FNu2 e diternui pada sejumlah keeil sarnpel « 0. I %). sehingga tcrjadi pcmisahan utas ganda DNA menjadi dua utas tunggal DNA yang merupakan cctakan (template) tempat penempelan primer dan tempat kerja DNA polimerase. Sekuens ketiga subvarian tersebut san gal mirip. 1FNu2 merupakan protein yang terdiri dari 189 asam amino dengan 23 asam amino pertamanya merupakan peptida sinyal. Suhu annealing untuk setiap sekuens DNA sifatnya spesifik dan mcrupakan penentu utama keberhasilan suatu reaksi PCR. Gewert et al. annealing. Tahap ini disebut annealing. Tahap terakhir dari satu siklus PCR adalah tahap ekstensi yang dilakukan pada suhu 72°C. sedangkan pad a 1FNa2 e diisi oleh guanin (0). bergantung kepada jumlah DNA yang diinginkan. Tahap-tahap pada teknik PCR disajikan pada Gambar !. Hasil penelitian yang dilakukan oleh Lee et at. 1989). 200 I). Penggunaan teknik PCR ini dalam bidang biologi rnolekuler sernakin meluas.3 dacrah penyandi protein. (1995) meneliti subvarian 1FNa2 dari DNA genom manusia Afrika dan Afro-Caribian.. Basa nitogen dari nukleotida ke-137 pada IFNu2 a diisi oleh adenin (A). Basa nitrogen dari nukleotida ke-170 pad a 1FNa2 a dan 1FNa2 b diisi oleh adenin (A). kemudian menaikkan dan rnenurunkan suhu campuran secara berulang selarna beberapa jam sampai diperoleh jumlah sekuens DNA yang diinginkan. dan penyembuhan pasien setelah operasi melanoma (Kirkwood et al. Pada awal ditemukannya teknik PCR. 1996). Gen ini menyandi protein dengan 166 asam amino dengan 20 asam amino pertamanya merupakan peptida sinyal. yaitu denaturasi. teknik PCR dilakukan dengan cam mencampurkan sampel DNA dengan primer oligonukleotida. deoksiribonukieotida trifosfat (dNTP). Pada tahap ekstensi terjadi sintesis DNA yang komplernen dengan DNA cetakan. DNA polimerase ini bersifat sangat sensitif terhadap panas dan rusak pada suhu denaturasi utas ganda DNA. Hasil penelitian menunjukkan bahwa 1FNa2 im berperan dalam pengobatan beberapa penyakit. terapi penderita hepatitis C (Colier et al. Hasil penelitian tersebut mendukung hasil penelitian Kaluz et al. Secara ringkas. Polymerase Chain Reaction Teknik Polymerase Chai/l Reaction (PCR) merupakan salah satu teknik utama yang digunakan pada penelitian ini.. Oleh karena itu enzim tersebut . 1992). dan 1FNu2 c) dan IFNu2 b merupakan subvarian yang paling banyak ditemui. Dcnaturasi dilakukan pada suhu 9095°C. 1FNa2 b. Menurut Kaluz et al. Teknik yang menciptakan terobosan baru di bidang genetika ini merupakan suatu leknik arnplifikasi sejurnlah kecil sekuens DNA ill vitro secara sensitif dan spesifik. 1993). pada umumnya antara 25 sampai 40 siklus. Interferon Alfa 2 IFNa2 rnerupakan produk salah satu gen IFNu.. Selanjutnya subu rcaksi diturunkan untuk penernpelan primer oligonukleotida pada sekuens yang komplementer pada molekul DNA cetakan. DNA polimerase yang digunakan berasal dari E. Satu siklus pad a teknik PCR terdiri dari tiga tahap. (1994) dan Lee et at.. Mullis pada tahun 1983. 1998).. Suhu ini merupakan suhu optimum untuk kerja enzim Taq DNA polimerase. tidak rnenggunakan enzim ligase dan primer RNA (Watson et al. Pada dasarnya reaksi PCR mengambil pnnsip replikasi DNA. penernpelan primer. (1995). follicular lymphoma (Solal-Ccligny et al. yaitu bahwa IFNaz mengandung tiga buah subvarian (IFNu2 a. (1995) menggunakan sampeJ darah dari 28. dan enzim terrnostabil Taq DNA polirnerase dalam larutan bufer yang sesuai. chronic myeloid leukimia (Talpaz et al. 1FNa2 b. Kaposi's sarcoma (Borden. 1FNu2 tcrdiri alas tiga buah subvarian. sedangkan pada IFNu2 b dan 1FNa2 e diisi oleh guanin (G). Ketiga tahap tersebut dilakukan berulang kali dalam mesin PCR. 1990). dan 1FNa2 e. coli. sedangkan IFNu2 a tidak ditemui pada populasi ini. Hanya saja pada teknik PCR. antara lain myeloma (Mandelli. yaitu 1FNu2 a. (1994). Penyebabnya adalah kesederhanaan teknik tersebut dan tingginya tingkat kesuksesan amplifikasi sekuens DNA yang diperoleh (Saiki. yaitu pernbukaan rantai DNA utas ganda. Teknik ini diternukan oleh Kary B.000 manusia sehat menunjukkan bahwa gen 1FNa2 b merupakan sub varian yang paling banyak terdapat pada DNA genom sarnpel tersebut. dan ckstcnsi. 1991). Perbedaan sekuens ketiganya terletak pada nukleotida ke-137 dan nukleotida ke-170.

1989). maka ia tidak perlu ditambahkan pada setiap siklus. Penggunaan DNA polimerase E. dan panjang sekuens DNA target yang akan diamplifikasi juga meningkat. Tahapan teknik kloning. memiliki jurnlah purin dan pirirnidin yang seimbang. Teknik ini meliputi tiga tahap. Adanya ori mengakibatkan plasmid dapat bereplikasi sendiri di dalam sel inangnya dan tidak bergantung pada Gambar I. Kloning yang dilakukan pada penelitian ini menggunakan vektor berupa plasmid. 1994).. Pada umumnya panjang primer yang digunakan berkisar antara 20 sarnpai 30 basa.4 harus ditambahkan secara manual untuk setiap siklus. Modifikasi ini mengakibatkan penyederhanaan prosedur karena pelaksanaan peR dapat dilakukan secara autornatis. Selain itu spesifisiras. yaitu plasmid. 1989). Plasmid adalah DNA utas ganda sirkular yang berukuran dari I sampai 250 kb dan memiliki paling sedikit satu ori (origin of replication). transforrnasi. bakteriofag. hasil. dan seleksi (Gambar 2). dan sedikit rnungkin rnerniliki susunan basa yang komplementer (Saiki. Primer oligonukleotida yang digunakan dalam teknik peR hams memenuhi beberapa syarat. . Kloning Klon adalah sekumpulan organisme identik yang berasal dari satu sumber (Alberts et al. Oleh karena kerja Taq DNA polirnerase tidak dipengaruhi oleh suhu denaturasi utas ganda DNA. dan yeast artificial chromosomes (Voet & Voet. yaitu ligasi. Tahapan reaksi pada teknik Polymerase Chain Reaction (peR). Teknik kloning merupakan bagian terpenting dari teknologi DNA rekornbinasi (Sambrook et al. 3'~' ~A3' DNAinsert Klon ~ ~ Annealing Gambar 2. Ligasi adalah pemasukan sekuens DNA yang diinginkan ke dalam suatu vektor. antara lain memiliki susunan basa yang acak. DNA polimerase tersebut dapat tetap aktif sampai suhu 95°C (Saiki et al. 1988). Ligasi menghasilkan produk yang disebut dengan DNA rekombinan. memiliki titik leleh yang hampir mendekati satu sama lain. transforrnasi adalah pemasukan DNA rekombinan ke dalam suatu sel kornpeten. sedangkan seleksi adalah pernilihan sel-sel yang mengandung DNA rekombinan.. sensitivitas. 1994). sehingga tidak terjadi polipurin atau polipirimidin.coli kemudian digantikan oleh DNA polimerase yang dimurnikan dari bakteri terrnofilik Thermus aquaticus (Taq). Hal Ill! berpeluang mengakibatkan terjadinya kesalahan apabila beberapa sampel diamplifikasi seeara simultan.. Ligasi Ligasi adalah pemasukan sekuens DNA yang mengandung gen diinginkan ke dalam DNA genom dari suatu elernen gcnetik yang dapat bereplikasi sendiri (vektor).

Metode mikroinjeksi yang dilakukan dengan menginjeksikan molekul DNA langsung ke dalarn nukleus sci target menggunakan jarum yang sangat runcing dikemukakan oleh Hammer et al. (1990) rnengemukakan cara transforrnasi rnenggunakan penembakan sel target dengan mikroproyektil berkecepatan tinggi. Plasmid yang lazim digunakan dalam teknik kloning adalah plasmid yang berukuran kurang dari 10 kb dan terdapat dalam jumlah yang cukup banyak di dalam satu sel inang (Brown. Seleksi Tahap terakhir pada teknik kloning adalah seleksi sel-sel yang mengandung plasmid rekombinan. sedangkan sel-sel yang mengandung plasmid dapat berkernbang biak dengan baik pada media tersebut. Konstruksi vektor pOEM-T. Pada umumnya plasmid yang digunakan mengandung gen yang menyandi ketahanan terhadap ampisilin. dan beberapa situs pemotongan enzim restriksi. Plasmid ini pada umumnya mengandung satu atau lebih gen yang menyandi ketahanan (resistensi) terhadap antibiotika. Cara lain untuk transformasi dilakukan dengan metode elektroporasi. Proses ini disebut transformasi. misalnya ampisilin. lalu dikejutpanaskan (heat shock) pada suhu 42()C selama 45 detik. Vektor pGEM®-T memiliki dua buah ori. Penggunaan pOEM®-T lebih menguntungkan dibandingkan dengan plasmid yang lain karena plasmid ini bentuknya sirkular terbuka. Transformasi Plasmid rekombinan yang dihasilkan dari hasil ligasi selanjutnya dimasukkan ke dalarn sel kompeten (sel yang telah memperoleh perlakuan kimiawi atau perlakuan fisik tertentu yang meningkatkan kemampuan sel tersebut untuk mengambil DNA). kernudian menggabungkan DNA insert dan plasmid dengan enzim ligase. Kedua basa ini dimanfaatkan untuk berkomplemen dengan ujung-ujung sekuens DNA hasil PCR yang selalu memiliki sebuah basa adenin (A) yang menggantung (overhang). Transforrnasi produk ligasi ke dalam sci kompeten dapat dilakukan dengan cam mencampurkan sci kompeten dengan plasmid DNA dalam larutan kalsium klorida. Ligasi menggunakan plasmid alami pada umumnya dilakukan dengan memo tong plasmid dan DNA yang akan disisipkan (insert) dengan enzim restriksi yang sarna. Mikroproyektil tersebut pada umumnya terbuat dari logarn tungsten atau emas yang diselubungi oleh produk ligasi dan ditembakkan dari penembak partikel. Pada masingmasing ujung plasmid yang terbuka terdapat basa timin (T) yang menggantung (overhang). yaitu transfer DNA melalui Iubang semen tara pada membran sel yang diinduksi oleh pulsa elektrik pendek (Calvin & Hanawalt. Pada penelitian ini vektor yang digunakan berupa plasmid sintetik yang bernama pGEM®-T. Seleksi 101 pada umumnya dilakukan dengan menggunakan media LB yang mengandung antibiotika. gcn ketahanan terhadap ampisilin (Amp'). Metode transformasi yang digunakan pada penelitian ini adalah metode kejut pa~as (heat shocks. . Antibiotika yang ditambahkan ke dalam media LB bergantung pada jenis plasmid yang digunakan.5 kromosom utama sel inang tersebut. misalnya EcoRI. sehingga tidak perlu dipotong dengan enzim restriksi. (1985) sebagai salah satu met ode transforrnasi yang dapat dilakukan terhadap sel hewan. 1988). sehingga sel inang yang mengandung plasmid dapat bertahan dalam lingkungan yang mengandung antibiotika tertentu. Seleksi dengan rnenggunakan media LB- Oambar 3. Sel-sel yang tidak mengandung plasmid tidak akan dapat berkembang biak pada media Lls-antibiotika. Boynton et al. Plasmid ini berukuran 3000 pb dan konstruksinya dapat dilihat pada Gambar 3. 1995). tetrasiklin. sehingga media yang digunakan adalah media LB-ampisilin. basa timin (T) yang menggantung (overhang) di tengah-tengah gen laeZ. (1988) & Daniell et al. dan kloramfenikol. Teknik ini dikenal dengan teknik biolistik dan saat ini telah banyak diterapkan untuk transformasi produk ligasi ke dalam berbagai jenis sel. Selanjutnya plasmid dan DNA insert dilekatkan dengan enzim ligase.

kemudian DNA tersebut didenaturasi dan dibagi ke dalam cmpat tabung reaksi. Apabila sel yang mengandung plasmid rekombinan ditumbuhkan pada media tersebut. I995). sehingga keempat basa terse but .6 ampisilin dapat membedakan sel-sel yang mengandung plasmid dengan sel-sel yang tidak mengandung plasmid. 1977). Sekucnsing Penentuan sekuens DNA atau RNA yang menyandi pembentukan protein dan RNA dikenal dengan teknik sekuensing. Modifikasinya terletak pada penggunaan ddNTP yang bertanda zat fluoresen. DNA utas ganda mula-mula didenaturasi menjadi dua buah utas tunggal. satu jenis ddNTP. tetapi sel yang mengandung plasmid rekombinan akan mati. suatu molekul yang mirip dengan galaktosa dan IPTG (isopropiltiogalaktosida) yang merupakan inducer enzim ~-galaktosidase. DNA yang akan disekuensing dibagi ke dalam empat tabung. Masing-masing tabung direaksikan dengan bahan-bahan yang secara spesifik melernahkan ikatan antara satu atau dua dari empat basa yarig terdapat di dalam DNA. 1978). dan enzim DNA polimerase. kemudian salah satu utas lunggal DNA ditempeli primer yang bertanda radioaktif. Penye!esaian masalah ini dapat dilakukan dengan seleksi plasmid menggunakan aruibiorika kedua atau rnengggunakan blue-white screening. Untuk seleksi menggunakan blue white screening. Masalah yang timbul kemudian adalah memisahkan sel yang mengandung plasmid rekombinan dengan sci yang mengandung plasmid tanpa insert. primer diperpanjang dengan dNTP atau ddNTP yang tersedia. yaitu metode Maxam-Gilbert dan metode Sanger. yaitu plasmid yang mengalami swaligasi (self-ligated vector). Pada metode seleksi dengan antiblotika kedua. sel yang tidak mengandung plasmid rekombinan akan tetap bertumbuh. Pad a metode Maxam-Gilbert. sedangkan metode Sanger didasarkan alas penghambatan sintesis nukleotida akibat adanya persaingan antara dNTP dengan ddNTP. dapat diarnbil kesimpulan bahwa seleksi menggunakan blue white screening akan mernberikan warn a biru untuk sel yang tidak mengandung plasmid rekombinan dan warna putih untuk sel yang mengandung plasmid rekornbinan (Brown. Penempelan ddNTP pada DNA eetakan mengakibatkan penghentian sintesis utas yang komplementer dengan DNA cetakan. Pemisahan fragmen-fragmen tersebut dilakukan dengan gel poliakrilamida (Sanger & Coulson. maka gen laeZ tidak akan diekspresikan dan enzim ~-galaktosidase tidak terbentuk. Metode Maxam-Gilbert didasarkan alas destruksi bas a seeara kimiawi. Masing-masing tabung berisi primer bertanda radioaktif'. Enzim ini akan memeeah X-gal dan menghasilkan senyawa yang berwarna biru. Dua buah metode sekuensing DNA dikembangkan pada tahun I970-an. Metode seleksi dengan antibiotika kcdua diterapkan pada plasmid yang memiliki minimal 2 gen yang menyandi ketahanan Lcrhadap antibiotika. Oleh sebab itu. Reaksi setiap basa dengan zat warna fluoresen tersebut akan memberikan sinyal fluoresensi yang berbeda. maka digunakan media yang mengandung X-gal {5-bromo-4-kloro-3-indolil~-D-galaktopiranosida}. Selanjutnya ditarnbahkan piperidin yang akan mernutus rantai DNA pada ternpat basa yang dilernahkan ikatannya tersebut. Hal ini akan mcnghasilkan sekumpulan fragmen berland a radioaktif yang panjangnya tergantung pada jarak aniara Ietak basa yang dihilangkan dengan ujung molekul yang bcrtand a radioaktif (Maxam & Gilbert. sehingga berbentuk sirku!ar yang dapat pula masuk ke dalam sel kornpeten. J 977). Sekuens DNA dapat dibaca dari hasil pernisahan fragmen-fragmen yang terbentuk pada gel poliakrilamida. Hal ini disebabkan karena ddNTP kehilangan gugus hidroksil pada atom karbon nornor 3 dari komponen gulanya. Penempelan ddNTP pada DNA cetakan sama efisiennya dengan penempelan dNTP pada DNA cetakan tersebut. Akibatnya akan dihasilkan berbagai fragmen bertanda radioaktif yang berbeda-beda panjangnya (Sanger. dan selanjutnya oleh kerja enzim DNA polimerase. Gugus hidroksil 1111 diperlukan untuk penempelan nukleotida berikutnya untuk pernanjangan utas komplcmenter. Metode sekuensing yang banyak dilakukan saat ini adalah metode Sanger yang dirnodifikasi untuk memperbaiki sensitivitas dan efektivitas analisisnya. Metode yang dipilih bergantung pada jenis plasmid yang digunakan. rnaka gen laeZ akan terekspresikan dan enzim ~-galaktosidase akan dihasilkan. Apabila sel yang mengandung plasmid tanpa insert dtumbuhkan pada media tersebut. Pada metode Sanger. DNA yang akan disekuensing ditandai dengan J2p. dNTP.

natrium asetat.. dan X-gaL Bahan yang digunakan untuk isolasi plasmid adalah Larutan I (Tris-HCl pH 7. microwave (Nasional).. ampisilin (100 1l1/IllI).25%.. Gel: G T A . isopropanol. dan kamera UV (Bio Rad Gel Doc 1000)..5.0.N. GIIIIIIlIII> ..09 M. . Konfirrnasi hasil kloning dilakukan dengan teknik PCR. Iarutan fcnolkloroforrn (I: 1). dan IR-2.. sctiap sampel hanya perlu direaksikan satu kali (tidak perlu dilakukan pernisahan antara basa yang saru dengan yang lainnya) dan hasilnya dapal dipisahkan dengan baik oleh gel poliakrilamida. 15% sukrosa). IPTG. yaitu primer M 13-1' dan M 13-r.. Elektroforesis gel agarosa dilakukan untuk memeriksa hasil PCR... loading buffer (50 mg/ml blue dekstran dalam larutan EDT A 25 mM yang rnengandung dimetilforrnamida dengan nisbah 1:5). EDTA I mM). ... akuabides steril. medium Luria Bertani (LB) cair steril yang terdiri dari bacto tripton.. etanol 70 %. sedangkan untuk elektroforesis gel agarosa adalah perangkat elektroforesis (Bio Rad). Tris-HCI 100 mM pH 8. Larutan II (0.. sehingga bahan yang digunakan sama scperti bahan PCR umum hanya primer yang digunakan berbeda. enzim ligase. .. ready mix (AmpIiTaq. dan bufer... .... SP6. Contoh hasil pemisahan fragrnen[ragmen DNA dengan gel poliakrilamida dan pernbacaan sekuensnya disajikan pada Gambar 4.. dan RNase. sedangkan bahan yang digunakan untuk PCR adalah bufer PCR (KCI 500 mM. -. ammonium asetat 5 M. dNTP.. Untuk sekuensing digunakan Automatic DNA Sequencer ABlPrism 377 (Perkin EImer).. . BAHAN DAN METODE Bahan Bahan yang digunakan untuk isolasi DNA adalah sampel darah vena manusia... loading buffer (bromfenol biru 0. dan sepasang primer 40 pmol. etanol absolut. dan etidium bromida. dengan metode ini. gel agarosa 1%. "'6 "'6 . TEMED (N. Peralatan lain yang digunakan adalah tabung mikrofuge . dNTP 10 mM. 1% SDS).. sedangkan bahan yang digunakan untuk tahap transforrnasi dan tahap seleksi adalah sel Ecoli kompeten DH5a. Oleh karena itu. RNase 5 mg/ml.. TBE. primer T7.. <IIIIiIIIIII> II n T C G C C T GCGAATGCGTCCACAACGCTACAGGTG GCGAATGCGlCCACAACGCTACAGGT GCGAAlGCGTCCACAACGCTACAGG GCGAAT6CGTCCACAACGCTACAG GCGAATGCGTCCACAACGCTACA GCGAATGCGTCCACAACGCTAC GCGAATGCGTCCACAACGCTA GCGAATGCGTCCACAACGCT GCGAATGCGTCCACAACGC GCGAATGCGTCCACAACG GCGAATGCGTCCACAAC GCGRATGCGTCCACAII GCGRATGC6TCCACII GCGAATGCGTCCAC GCGAATGCGTCCn GCGAATGCGTCC GCGARTGCGTC GCGAATGCGT GCGAATGCG QCGAATGC GCGAAlG GCGAAT Gambar 4. dan ddNTP yang telah diberi senyawa fluoresens). . Iarutan pelisis sel darah putih. NaCl. Teknik kloning dilakukan dalarn tiga tahap.. .N'N'tetrametilenetilendiamina) dan APS (amonium persulfat) 10%. akrilamida 40%. MgCh 50 mM. . Contoh hasil pemisahan fragmenfragmen DNA dan sekuensnya. larutan pelisis sel darah merah. Tris-HC! 10 mM pH 8.7 dapat dibedakan. etanol 70%. Bahan yang digunakan untuk sekuensing adalah perangkat pcmurnian QIAquick (Qiagen). etano] absolut. larutan TBE (Tris-borat 0. bufcr TE.. Peralatan Peralatan yang digunakan untuk PCR adalah thermocycler peR (GeneAmp® PCR System 9700 Perkin Elmer) dan tabung PCR 50 Ill.2 M NaOH.. Taq DNA polimerase 5 unit/p. dan LB padat yang tersusun dari bahan yang sama seperti LB cair hanya terdapat penambahan bacto agar. -C . -G .l.4). IF-2. sedangkan kolom QlAquick (Qiagen) digunakan untuk pemurnian produk PCR dan plasmid basil isolasi.5... sukrosa 40% (w/v)). bacto yeast extract. Spektrofotometer (Ultraspsec IIlPharmacia) digunakan untuk mengukur kadar dan kemurnian DNA.. 10 mM EDTA. Bahan yang digunakan untuk tahap ligasi adalah vektor pGEM®-T..X174 DNA/Hae III. Lannan III (3 M Na asetat pH 4.... akuabides steril... Adapun bahan yang digunakan untuk elektroforesis gel agarosa tersebut adalah agarosa tipe II (Sigma). EDTA 0.. standar DNA q.6 dalam asam asctat glasial).002 M pH 8. dan buffer TE (TrisHellO mM pH 8. C A T C G C 11 ..0).

sentrifuse (eppendorf ripe 5403. Ukuran insert dalam plasmid hasil isolasi dikonfirmasi kembali menggunakan PCR. lalu dikocok dengan pipet transfer sampai larutannya homogen. Selanjutnya dua buah plasmid hasil isolasi yang mcnunjukkan ukuran insert yang tepat dianalisis dengan teknik sekuensing agar diketahui urutan nukleotidanya. maka DNA ini kemudian dimurnikan dari komponen-komponen reaksi PCR dengan menggunakan perangkat QIAquick. tabung falcon. Hasil pemurnian disisipkan ke dalam vektor pGEM®. pornpa vakum (BioRad). untuk sintesis sepasang primer untuk sekuens gcn IFNo:z dengan teknik Isolasi DNA ini diawali dengan studi bioinforrnatika yang bertujuan untuk memperoleh DNA manusia yang rnengkode IFNa. studi bioinformatika tersebut digunakan untuk mensintesis sepasang primer yang diperlukan untuk rnengisolasi sekuens IFNa. Sebanyak 5 III RNAse (5 mg/ml) ditambahkan ke dalam tabung. Hasil sekuens Seleksi Isolasi plasmid rekombinan Gambar 5. Secara keseluruhan metode penelitian disajikan pada Gambar 5.d larutan pelisis sel darah putih lx. dan X-gal selama semalam. dengan mctode kejut panas (heat shackedi.T melalui reaksi ligasi. IPTG. speed vac (Shelby).nlm..z· alir metode penelitian Isolasi DNA Genom DNA genom diisolasi dari darah vena. Garis Besar Kegiatan Pcnelitian digunakan amplifikasi PCR. Darah vena sebanyak 5 lUI dimasukkan ke dalam tabung . Sel-sel tertransformasi till kemudian ditumbuhkan pada media agar LB yang mengandung ampisilin. Plasmid DNA rekombinan hasil kloning diseleksi.2. Hasil studi ini < . Supernatannya dibuang dan peletnya diberi 1. incubator shaker (New Brunswick Scientific). penangas air (Forma Scientific). coli DH5a. kemudian diinkubasi selama 10 menit pada suhu kamar sambil diaduk beberapa kali. Apabila hasil analisis ini menunjukkan fragrnen DNA diinginkan (yang menyandi gen IFNa(2).gov. Diagram IFNa. inkubator (Thermolyne). dan tipe 54l5C berpendingin. Sorvall" MC J2V. lalu diaduk beberapa kali. lalu diisolasi dengan reknik miniprep.250 I.8 (eppendorf). Selanjutnya produk PCR dipisahkan dengan elektroforesis gel agarosa. pipet mikro (eppendorf). Langkah !Ill diulang 2-3 kali sampai supernatannya jernih. Inkubasi pada suhu Studi Bioinformatika Studi bioinformatika yang dilakukan pada awa! penelitian bertujuan untuk rnernperoleh sekuens DNA yang mengkode IFNo:2 Studi ini dilakukan melalui penelusuran di internet pada situs Gene Bank National Center for Biotechnology Information (NCB I) dengan alarnat www ncbi. DNA genom diisolasi dari darah vena manusia dcngan metode Bohringer Maneheim. Du Pont).500 rpm selama 10 menit.? dari DNA genom dengan teknik PCR. dan vortex (Thermolyne). Tabung berisi sampel selanjutnya disentrifugasi pad a 1. DNA hasil isolasi ini digunakan sebagai DNA cetakan untuk PCR.falcon 50 ml yang berisi IS ml larutan pelisis sel darah merah I x. sehingga menghasilkan plasmid rekombinan yang selanjutnya ditransformasikan ke dalam sel bakteri E.nih.

Dalam hal ini dilakukan optirnasi suhu annealing agar dihasilkan produk yang optimum. DNA hasil isolasi ini disimpan pada suhu -20°C.000 rpm. Gel agarosa dibuat dengan cara melarutkan 0. (1988). kemudian dimasukkan ke dalam sumursurnur tempat aplikasi sampel. Jumlah siklus yang digunakan untuk mengarnplifikasi gen 1FNa2 adalah 30 siklus. Perbanyakan fragrnen DNA yang mengkode gen 1FNu2 secara in vitro dilakukan dengan menggunakan pasangan primer oligonukleotida sintetik yang membatasi daerah di luar gen tersebut. Setelah kering.9 3i'c dilakukan selama 15 menit pada penangas air.165 III etanol 70 %. Pemurnian Produk peR nm. 94°CI 94°C 5:00: 1:00 I I I I I I I I I 54-56°C I.O(} Garnbar 6. Tahap denaturasi dilakukan selama 1 menit pada suhu 94°C. dan lahar ekstensi dilakukan selama I menit pada 72°C. tahap annealing dilakukan selama I menit Pemurnian produk PCR dilakukan untuk menghilangkan sisa-sisa primer dan pereaksi lain pada proses PCR.25 g agarosa dalam 25 1111 bufer TBE rnclalui pemanasan dengan oven microwave. Elektroforesis dijalankan pada tegangan 80 V selama 48 rnenit. Sebanyak [0 )11 sampel DNA dicampur dengan 2 )11 loading bufer. sedangkan pada siklus terakhir dilakukan pemanjangan waktu ekstensi selama [0 rnenit (Gambar 6). gel dimasukkan ke dalam perangkat elektroforesis yang berisi larutan bufer TBE I x . Setelah beku. kemudian gel dibiarkan membeku selama setengah jam atau lebih. annealing. Selanjutnya Iarutan gel dituang ke dalam wadah cetakan gel horizontal dengan sejumlah sumur tcmpat aplikasi sampel.5 Jll etidium bromida ditarnbahkan ke dalam larutan gel agarosa tersebut. 4°C selama 15 menit. Kadar larutan DNA diukur dengan spektrofotomcter pada panjang gelombang 260 Deteksi Produk PCR dengan Elektroforesis Gel Agarosa Prod uk PCR diperiksa dengan tcknik clektroforesis gel agarosa. Untuk rnembandingkan hasil yang diperoleh digunakan standar DNA ~X174 DNA/Hac III. Pcngukuran DNA Kadar dan Kemurnian DNA pada suhu 54-56°C. Metode yang digunakan untuk teknik PCR ini adalah metode Saiki et al. Ialu dikeringkan pad a suhu kamar sclama [ jam. Pembuatan campuran reaksi ini semuanya dilakukan dalam keadaan dingin. PCR untuk amplifikasi gen yang diperoleh diukur kadar dan kernurniannya bcrdasarkan mctodc Sambrook et al.5 III Taq DNA polimerase dalam akuabides steri!. 1 )11dNTP lO mM.5 )11 primer IR-l 40 pmol. 0. Komposisi bahan yang diperlukan untuk 50 )11volume reaksi dalam tabung PCR adalah 2 )11sampel DNA. yaitu denaturasi. Kemurnian larutan DNA dihitung dengan mernbandingkan absorbanss pada panjang gelombang 260 nm dengan absorbanss pada panjang gelornbang 280 nm. Prod uk PCR dilarutkan dalam bufer . Pradenaturasi dilakukan selama 5 menit. DNA dilarutkan dalam bufer TE dan diinkubasi pada suhu 37°C selama dua jam. Supcrnatannya dituang ke tabung baru yang berisi 3850 111 isopropanol dan dikocok sampai DNA-nya terlihat. 4°C selama 5 menit.5 JlI primer IF-l 40 pmol.5 )11MgCl2 50 mM. (1989). Satu siklus PCR terdiri dari tiga tahapan. Polymerase Chain Reaction (peR) Gen 1FNu2 dikeluarkan dari DNA genom rnanusia dengan teknik Polymerase Chain Reaction (PCR). Supernatannya dibuang dan DNA dibilas dengan 4. 0.S III buffer PCR lax. Tabung disentrifugasi lagi pada kecepatan 3000 rpm. Untuk mengendapkan protein dilakukan penambahan 833 Jll amonium asetat 5 M ke dalam tabung. Sentrifugasi dilakukan pada kecepatan 3. Visualisasi pita DNA dilakukan dengan lampu UV pada panjang gelombang 300 nm. Pasangan primer yang digunakan adalah IF-2 dan IR-2 (Lampi ran 1). Program 1FNa2. Hasil visualisasi kemudian direkam dengan menggunakan kamera UV. kemudian tabung di-vortcx sarnpai larutan yang terbentuk terlihat seperti susu. Pemurnian dilakukan dengan menggunakan perangkat QlAquick PCR purification. 1. lalu sebanyak 2. dan 0. dan ekstensi.

000 rpm selama 3 menit. Transformasi Sel E. Setelah itu disimpan dalam es selama 5 menit.000 rpm pada suhu 4°C selama 5 menit. 40 pmol. Pelet yang diperoleh dicuci dengan etanol 70 0/0. dicampur dengan 800 III media LB cair. Sebanyak 5 III prod uk ligasi dicampur dengan 50 III sci E.000 rpm pada suhu 4°C selama 15 rnenit.· Kolom dipindahkan ke dalam tabung eppendorf mikrofuge 1. Plasmid hasil isolasi kernudian diperiksa ukuran insert-eye dengan teknik PCR. lalu disentrifugasi pada kecepatan 14. I III vektor pGEM®-T. Supcrnatannya kcmudian dibuang dan peletnya disuspcnsikan kernbali dalarn 100 III Larutan I dan diinkubasi dalam es sclama 5 rncnit.5 III enzirn Taq DNA polimerase. Senlrifugasi dilakukan selarna I menit pada kccepatan 14.000 rpm selama 2 menit dan ± 750 III supernatannya dibuang. Lapisan alas dipindahkan ke dalarn tabung eppendorf baru. SeJanjutnya ke dalam kolom ditambahkan 0. lulu diinkubasi lagi dalam es selama 5 menit. cawan petri ditutup dengan parafilm dan disimpan dalam peudingin (40Q. I III DNA ligase T4. Suspensi sel dipekatkan dengan sentrifugasi pada kecepatan 12. dan penanaman suspensi sel pada media ini dilakukan pada kondisi steril. lalu kolom disentrifugasi kembali pada kecepatan 12. I ". digunakan kontrol negatif yang diperlakukan sama seperti sampel. dan 0.5 III primer MI3-!.5 ml. 1983). Setelah disentrifugasi pada kccepatan 14. 5 III bufer PCR lOx.75 ml bufer PE.000 rpm. Coli koloni sel-sel transform an. IPTG. Campuran reaksi tersebut kemudian diinkubasi sernalam pada suhu 4°C (rnesin PCR). Supernatannya dibuang dan kolorn disentrifugasi kembali pada kecepatan 14. Setelah inkubasi.-IdNTP 10 mM. Kornposisi bahan dalam satu tabung PCR terdiri dari 21 III ddH20. Suspensi ini disebarkan ke media padat LB yang mengandung arnpisilin. 1. dan X-gal dalam cawan petri sampai rneresap.000 rpm. 20 III plasmid hasil isolasi. kemudian masing-masing koloni ditumbuhkan dalarn media LB cair. kemudian dikeringkan dengan speed vac dan disuspensikan kernbali dalam 50 III buffer TE yang mengandung Rnase. suhu 4°C selarna 10 menit. Program peR yang digunakan untuk . coli kompeten (DH5a).000 rpm selarna satu menit. lalu ke dalam kolom ditarnbahkan 20 III bufer EB. lalu dikejutpanaskan (heat shocked) dalam penangas air 42°C selama 45 detik. sehingga produk PCR yang telah dirnurnikan diperoleh pada tabung eppendorf mikrofuge.5 IIII kultur bakteri yang Lelah diinkubasi selama sernalam dalam media LB cair disentrifugasi pada kecepatan 12. dibiarkan dalam es selama 30 men it. dan 1 III akuabides steriI daJam tabung eppendorf. Langkah yang sama juga dilakukan un(uk kontrol negatif. supematan diekstraksi dengan larutan fenol-kloroform (I: 1). Sel dipccahkan dengan mcnambahkan 200 !!l Larutan II. Plasmid DNA diendapkan dengan penambahan 2 x volume etanol absolut. 0. Peletnya kcmudian disuspensikan dengan sisa supernatannya. dikocok dan didiamkan pada suhu kamar selama 5 men it.10 PB sebanyak 5x voJumenya dan dikocok. kecuali tanpa penambahan prod uk PCR (insert). lalu diinkubasi selama I jam 45 menit dalam incubator shaker pada suhu 37°C pada keeepatan 200 rpm.5 III primer M 13-r 40 prnol.000 rpm selama satu menit. 0. Sebagai pembanding. Larutan plasmid rekombinan selanjutnya disimpan pada suhu "20°C.5 !!I MgCI2 50 mM. lalu diinkubasi semalam pada suhu 37°C untuk disentrifugasi kembali pada kecepatan 14. Ligasi Produk peR dengan Vcktor pGEM®-T Ligasi produk PCR dilakukan menurut metode Sambrook et al.. (1989). Sebanyak 1. (1989) dengan cara mencampurkan 7 III produk PCR dengan I III bufer ligase lOx. lalu dimasukkan ke dalam kolom spin QIAquick dan disentrifugasi selama satu men it pada kecepatan J2.000 rpm. SeIanjutnya DNA plasmid rekombinan dari kultur diisolasi dengan prosedur lisis basa yang tcrmodifikasi (Sam brook et al. Pemekatan menumbuhkan Seleksi dan Isolasi Plasmid Rekornbinan Pengujian yang dilakukan untuk memperoleh klon positif (yang rnengandung plasmid rekombinan) diawali dengan mengambil 10 koloni yang dipilih secara acak. lalu Pernasukan plasmid rekombinan ke dalam sel kompeten dilakukan menurut metode Sam brook et al. Selanjulnya 150 III Larutan III dirambahkan ke dalam carnpuran dan eampuran diinkubasi lagi dalam cs selama 5 menit. yaitu debt api. sehingga supernatannya terpisah ke bawah dan dibuang.

Program PCR untuk sekuensing. Pernisahan fragmen-fragmen DNA dilakukan dengan elektroforesis poliakrilamida (PAGE) (Sanger. Untuk pemisahan dengan . . juga ditambahkan larutan NaCI 5 M sebanyak 0. Program PCR yang digunakan untuk sekuensing disajikan pada Gambar 8. Campuran tersebut diamplifikasi dengan 25 siklus PCR. lalu dengan segera campuran tersebut diinjeksikan ke dalarn pelat elektroforesis dengan menggunakan syringe 50 ml dan dibiarkan sampai membeku. yaitu purifikasi plasmid rekombinan. 25 rnl akuabides steril. hanya saja pada tahap awal. I III primer (SP6 untuk reaksi pertama T7 untuk reaksi kedua. Konsentrasi gel akrilamida yang digunakan adalah 4%.000 rpm pada suhu 4()C selama [0 menit. Prosedur pemurnian plasmid rekombinan sama seperti prosedur pemurnian prod uk PCR. dan IR-2 untuk reaksi keempat) dengan konsentrasi 2 pmol/ul. 0. lalu dipanaskan pada suhu 90 C selama 2 menit dan segera didinginkan dengan es. Gel tersebut dibuat dengan mencampurkan 18 g urea. Carnpuran itu didiamkan dalam es selama 5 mcnit. I I I I I Gambar 7. reaksi ketiga menggunakan primer IF-2. etanol presipitasi.2 x volume sampel. 3 III ready mix (mengandung AmpliTag ™ dan dNTP yang telah dilabel fluaresens). kemudian dihornogenkan dengan vortex. dan daya laser 40 MW selama 7 jam. selain ditambahkan bufer PB.elektroforesis akrilamida. 5 ml stok akrilarnida 40%. 1977). perbandingan 10:25: I. kemudian disentrifugasi pad a kecepatan 12. reaksi yang kedua menggunakan primer T7. dan ekstensi dilakukan pada suhu 60°C selama 4 menit. IF-2 untuk reaksi ketiga.25 mikron dan pornpa vakum selama 10 menit.05 D 60DC I 4:001 00 Sekuensing dilakukan dalam em pat tahap. daya 50 W. dan reaksi keempat menggunakan primer IR-2. DNA hasil presipitasi dilarutkan dalam 3 J!l loading buffer. DNA yang diperoleh disirnpan pada suhu _20De. Program PCR untuk konfirrnasi ukuran insert plasmid rekombinan. Selanjutnya ke dalam campuran tersebut ditambahkan TBE dan akuabides sampai volumenya 50 m!. PCR sckuensing. 1978). Hasil PCR dipresipitasi dengan etanol absolut dan I J. Purifikasi plasmid rekombinan dilakukan dengan perangkat QIAquick PCi: purification. Reaksi pertama menggunakan primer SP6. PCR sekuensing dilakukan dengan empat macam reaksi. kemudian disentrifugasi dengan kecepatan 12. Keernpat reaksi tersebut dibedakan dari jenis primer yang digunakan. suhu 51°C. annealing dilakukan pada suhu 50°C selama 5 detik. Pelet dikeringkan dengan speed vac selama 7 menit. Campuran tersebut dilarutkan selama 10 menit dan disaring menggunakan filter 0. dan pernisahan fragmen-fragmen DNA dengan elektroforesis gel poliakrilamida (Sanger. Denaturasi dilakukan pada suhu 96°C selama 10 detik.5 g campuran resin.11natrium asetat 3 M pH 4. Selanjutnya dipilih dua klan plasmid rekombinan untuk digunakan pada analisis sekuensing.l1 APS [0% dan 35 J. Campuran reaksi untuk PCR sekuensing adalah I III larutan plasmid rekombinan hasil purifikasi (dari klan positif). Selanjutnya larutan tersebut dimasukkan ke dalam sumur-sumur gel dan e1ektroforesis dijalankan pada tegangan 1 kV.11 TEMED ditambahkan ke dalam campuran.[[ konfirmasi ukuran insert plasmid rekornbinan disajikan oleh Gambar 7. Supernatan dibuang dan peletnya dicuci dengan 250 III etanol 70 %. Pada tahap awal dilakukan pradenaturasi selama 3 menit. Hasil Kloning 3:00 l 0: 10 1 1 1 1 1 1 Sekucnsing 50 C 0. Buffer yang digunakan sebagai jernbatan kanduksi adalah TBE.11 akuabides. Sebanyak 250 J. dan 5 J.000 rpm pada suhu 4°C selama 20 menit.6 dengan Gambar 8.

40 ng/)ll DNA utas tunggal. DNA genom yang dikeluarkan dari dalarn sel darah putih seIanjutnya dipisahkan dari pengotor.12 HASIL DAN PEMBAHASAN Isolasi DNA Genom: Kadar dan Kemurnian DNA Sebagai tahap awal isolasi DNA genom manusia. Sifat larutan pelisis sel darah merah adalah hipotonis. Larutan pelisis sel darah putih mcngandung dua komponcn utarna perusak struktur membran. Nilai ini menunjukkan jumlah DNA yang terdapat dalam larutan sampel. Nilai kernurnian yang rendah menunjukkan bahwa DNA hasil isolasi lerselubungi oleh protein. DNA hasil isolasi diukur kadar dan kemurniannya dengan spektrofotorneter pada panjang gelombang 260 nm dan 280 nm (Tabel 3). Strategi amplifikasi gen 1FNa2.. Penempelan sepasang primer tersebut pada gen 1FNa2 manusia ditunjukkan oleh Gambar 9. sedangkan protein dipisahkan dengan pengendapan olch amonium asetat. Nilai kemurnian DNA hasil isolasi adalah 1. Sambrook et al. Peptida sinyal Gen Hu-IFNO:2 Gambar 9. maka DNA dicuci dengan ctanol 70% (Moore.084. EDTA bcrfungsi untuk rnengkelat lcgam Mg yang rnerupakan salah satu komponen penting penjaga stabilitas membran sel. Nilai ini diperolch dari perbandingan antara absorbans pada panjang gelombang 260 nm dengan absorbans pada panjang gelombang 280 nm. Hasil pengukuran menunjukkan bahwa DNA hasil isolasi memiliki kadar yang eukup tinggi (>500 ng/pJ). yaitu 85-95% (Larnpiran 3). SampeJ yang mcngandung DNA utas ganda. (1989) mengemukakan bahwa I nilai absorbans sebanding dengan 50 ng/)ll DNA utas ganda. Apabila kadar DNA sampel cukup tinggi.0. Seperti yang telah dikemukakan sebelumnya. Dua buah pengo tor utama DNA genom adalah RNA dan protein. maka jumlah DNA cetakan yang digunakan pada tahap peR tidak perlu banyak.05 (Sambrook et (II. untuk memisahkan DNA dari pengotor-pengotor minor. atau 20 ng/)ll oligonukleotida utas tunggal. Sclanjutnya DNA genom dikeluarkan dari sel darah putih dengan penambahan larutan pelisis sci darah putih.75. . DNA kemudian diendapkan dengan isopropanol.048 menunjukkan jumlah protein pengotor yang terdapat dalam larutan tersebut.0 dcngan toleransi sebesar 0. seperti gararn-garam dan molekul-molekul organik keeil. Kadar DNA dalam sampel diperlukan untuk rnemperkirakan jumlah DNA yang digunakan sebagai DNA cetakan dalam tahap peR.. (998).8-2. Pad a tahap akhir. yaitu 840 ng/)ll. Oleh karena itu untuk mengamplifikasi gen tersebut diperlukan sepasang primer yang sangat spesifik supaya gen yang teramplifikasi adalah gen 1FNa2 dan bukan subtipe IFNa yang lain. digunakan Amplifikasi Gen Interferon Alfa 2 Manusia diawali dengan penentuan akan digunakan untuk mengampliflkasi gcn diinginkan. Pemisahan itu dilakukan dengan penambahan Iarutan pelisis sel darah merah yang diikuti dengan sentrifugasi. Primer yang digunakan untuk tahap amplifikasi ini adalah primer IF-2 dan IR-2. Dcgradasi RNA dilakukan dcngan penambahan RNase. Teknik peR primer yang 1. Gen 1FNa2 manusia merupakan salah satu subtipe dari gen IFNa manusia. Karena nilai kcmurnian DNA hasil isolasi mendekati nilai idealnya. DNA dikatakan murni apabila nilai kernurniannya bcrkisar antara 1. sedangkan absorbans sampel pada panjang gelombang 280 nm sebesar 0. 1995). Akibatnya akan tcrjadi penurunan efisiensi amplifikasi DNA pada tahap peR secara drastis. scdangkan ekor nonpolar SDS berfungsi untuk menarik fosfolipid yang merupakan penyusun utama mernbran sel (Brown. sehingga kadar DNA sampel diperoleh dari hasil perkalian antara absorbans pada panjang gel om bang 260 nm dengan faktor pengenceran dan 50 ng/1l1 (Larnpiran 2). DNA ini dapat langsung digunakan pada tahap peR karena tidak terlalu rnempcngaruhi cfisiensi proses peR. 1989). Absorbans sampel pa(ja panjang gelombang 260 nm adalah 0. homologi gen Hu-IFNa sangat tinggi. yaitu EDTA dan SOS. sehingga larutan tersebut akan masuk ke dalarn sel darah mcrah dan mengakibatkan scl terscbut pecah. dilakukan pemisahan an tara sel-sel darah putih dengan sel-sel darah merah karen a DNA genom manusia hanya terdapat di dalam nukleus sel darah putih.

dapat diamati bahwa penaikan suhu annealing akan mengurangi jumlah produk non spesifik yang terbentuk. Dari Gambar 10. dan 10c berturutturut rnenunjukkan basil amplifikasi DNA dengan teknik PCR pada suhu 54°C. b. Oleh karena itu. Pada tcknik PCR. Garnbar a. lOb. Akibatnya produk non spesifik yang dihasilkan dari hasil amplifikasi sulit dibedakan dari produk spesifiknya apabila sekuens gen yang teramplifikasi adalah sesama sekuens gen subtipe IFNa. Penempelan primer IF-2 dan IR-2 pada subtipe IFNa yang lain juga akan menghasilkan produk yang juga berukuran sekitar 797 pb. Hasil amplifikasi gen-gen yang ukurannya berdekatan dapat berkumpul di satu tempat yang sarna. Arnplifikasi gen 1FNu2 dengan primer IF-2 dan IR-2 akan menghasilkan sebuah produk yang berukuran 797 pb. intensitas pita produk spesifik maupun non spesifik yang terbentuk adalah maksimum (Gambar lOb). suhu ini juga dianggap belum optimum. Penentuan suhu annealing didasarkan atas nilai Tm (melting temperature) primer yang digunakan untuk amplifikasi.353 pb 1.353 pb 1.13 M N S b. sehingga suhu annealing merupakan penentu utama keberhasilan amplifikasi. M mcnunjukkan marker atau penanda. dan 56°C (x mcnunjukkan produk non spesifik yang terbentuk. rnencakup daerah yang terlalu luas. Suhu ini dianggap optimum karena pada suhu ini hanya terbentuk produk spesifik dan tidak terbentuk produk non spesifik. SeJain itu. Hasil amplifikasi DNA sarnpel dengan primer IF-2 dan IR-2 pada 3 macam suhu annealing. M N S c. Hasil amplifikasi sampel pada suhu annealing 54 DC menghasilkan pita prod uk spesifik yang intensitasnya cukup tinggi. Ketiga gambar tersebut menjelaskan len lang proses optimasi suhu annealing yang digunakan pada tahap PCR. tetapi intensitas pita prod uk non spesifik tersebut bertambah. Pada suhu tersebut juga terbentuk dua buah . intensitas pita prod uk spesifik yang terbentuk paling rendah bila dibandingkan dengan kedua suhu lainnya. Gambar lOa. M N S a. Hal ini ditunjukkan oleh pita yang cukup tebal an tara 603 pb dan 872 pb. sehingga tidak dapat dipastikan apakah pita itu tersusun dari hasil amplifikasi satu macam gen IFNa at au be be rap a gen IFNa. produk non spesifik yang yang berukuran sekitar 250 pb dan 900 pb (Gambar lOa). Pada suhu 56DC intensitas pita produk spesifik yang terbentuk lebih rendah dibandingkan dengan dua suhu yang lain karena penempelan primer pada DNA cetakan semakin sulit (Gambar IOc). Untuk suhu 55°C. pita produk spesifik yang terbentuk terlalu Iebar. Jumlah produk non spesifik yang terbentuk berkurang (250 pb). produk non spesifik yang berukuran 900 pb sulit dipisahkan dari produk spesifiknya. N menunjukkan kontrol ncgatif. 55°C.078 pb S72pb 603 pb 797 pb x x Gambar 10. Perhitungan Tm untuk primer yang Hasil amplifikasi DNA genom hasil isolasi dengan primer IF-2 dan IR-2 ditunjukkan oleh Gambar 10. Selain itu. tetapi tidak terbentuk produk non spesifik (Gambar 10c). sehingga suhu ini tidak optimum. dan 56DC. Hasil optimasi menunjukkan bahwa suhu annealing yang paling optimum untuk amplifikasi gen 1FNu2 adalah 56°C. 55°C.078 pb 872pb 603 pb 1. suhu denaturasi dan suhu ekstensi pada umumnya tetap. dan c berturut-turut mcnunjukkan hasil amplifikasi pada suhu annealing 54°C. dan S menunjukkan sampeI). x 1. Pada suhu ini.

Kloning Gen hasil amplifikasi dengan PCR harus dipurifikasi terlebih dahulu sebelum diklon. Metode ini dipilih karen a mernbran sel Ecoli mudah dibuka hanya dengan kejutan panas. dan oligonukleotida y~ng panjangnya < 50 pb. sernakin tinggi efisiensi penernpelan primer pada DNA cetakan termasuk penempelan pada sekuens gen yang tidak spesifik. Dengan metode kejut panas ini. yaitu tidak perlu melalui pernotongan dengan enzim restriksi tertentu karena setiap ujung 3' gen hasil arnplifikasi dengan PCR rnemiliki tambahan bas a adenin (A). dan pengotor-pengotor lain yang dapat mengganggu proses kloning. tidak mengadsorbsi protein. Menurut Innis & Gelfand (1990). sedangkan apabila enzirn yang digunakan terlalu sedikit. Cara transformasi yang ditempuh pada penelitian ini adalah metode kejut panas. sehingga dapat diperoleh DNA yang murni. sehingga volume DNA yang dibutuhkan sebagai cetakan pada tahap PCR adalah 2 ~l. sedangkan perhitungan Tm untuk primer yang tersusun oleh ~ 20 basa didasarkan pada metode Breslauer yang dikenal dengan nama nearest neighbor method. keseluruhan kondisi PCR yang digunakan untuk mcngamplifikasi suatu gcn harus dioptimasi. primer dimer.68 ug DNA atau 5. letapi bergan~ung ~epad. RNA. tetapi pad a prakteknya. IPTG. Jumlah molekul DNA yang terkandung dalam I ug sil'. Oleh karena itu jumlah Mg yang tidak tepat akan mengakibatkan timbulnya produk-produk non s~esifik.f/e copy DNA genom manusia adalah 3 x 10'. Kloning diawali dengan memasukkan gen hasil amplifikasi ke dalam vektor pGEM®-T (Iigasi). Selanjutnya plasmid rekombinan tersebut ditransformasikan ke dalam suatu sel E. yaitu 2(A+T) + 4(G+C). Penambahan ini dilakukan oleh enzim Taq DNA polimerase secara autornatis. Komponen lain yang menentukan proses amplifikasi sekuens DNA adalah dNTP dan MgCh.5 Unit/IOO ul larutan.14 tersusun oleh ::. Purifikasi dilakukan densan '" menggunakan kolom silika. sehingga nilai Tm dihitung berdasarkan nearest neighbor method. Magnesium (~g) merupakan komponen yang berperan pentmg pada keseluruhan tahap PCR. bahkan pada utas DNA yang spesifik sekalipun. yaitu mempunyai basa timin (T) yang menggantung (overhang). sedangkan nilai Tm IR-2 adalah 49°C. Ligasi dapat dilakukan secara langsung. Bagaimanapun juga. jumlah bahan yang digunakan pada tahap PCR tidak mutlak. jurnlah DNA yang umum digunakan sebagai DNA cetakan pada tahap PCR adalah se ki uar I O'5 . Keberhasilan tahap transformasi diperiksa dengan cawan petri berisi medium LB yang mengandung ampisilin. coli akan membuka dalam waktu singkat dan siap untuk menerima plasmid rekornbinan yang akan masuk.a sifat dan kondisi gen yang akan diamplifikasi. Apabila enzim yang digunakan terlalu berlebih. sehingga primer hanya akan menernpel pada sekuens gen yang spesifik. maka gen-gen non spesifik akan teramplifikasi. coli kompeten. Kedua primer yang digunakan pada penelitian ini tersusun alas ~ 20 basa. dan X-gal. Sebaliknya suhu annealing yang tinggi akan rnengakibatkan penurunan efisiensi penempelan primer pacta DNA cetakan. enzim. maka jumlah produk yang dihasilkan kurang memadai. Kadar DNA dalam larutan sampel adalah 840 ng/u]. Bahan yang digunakan pada tahap PCR jumlahnya tertentu agar menghasilkan produk spesifik yang optimum. Volume ini sebanding dengan 1. Keempat macam dNTP yang digunakan pada tahap PCR harus mempunyai jumlah yang sebanding supaya tidak terjadi kesalahan penernpelan dNTP pada DNA cetakan.04 x 105 molekul DNA Sementara itu jumlah enzim Taq DNA polimerase yang direkomendasikan untuk PCR oleh Lawyer et.. 20 basa mengacu kepada metode yang dikemukakan oleh Wallace et al. Selain itu metode ini juga sederhana. Akan tetapi suhu annealing yang terlalu tinggi menyebabkan primer sarna sekali tidak dapat menempel pada utas DNA. Secara teoritis suhu annealing adalah 5IDoC di bawah Tm kedua primer. (1989) berkisar antara 12. Ampisilin digunakan untuk menapis sel yang mengandung plasmid dengan sel yang tidak . Dari perhitungan tersebut diperoleh nilai Tm IF-2 adalah 5rC. suhu annealing harus dioptimasi agar prod uk yang terbentuk hanyalah produk yang diinginkan. Sementara itu vektor pGEM®-T memiliki keistimewaan yang penting.al. Oleh karena itu. pori-pori sel E.\0 6 molekul. Hal ini dilakukan untuk menghilangkan sisa-sisa primer. sehingga keduanya dapat sating berkomplemen dan dilekatkan dengan enzim ligase. Silika dimanfaatkan karena dapat mcngadsorbsi DNA pada konscntrasi garam yang tinggi. Semakin rendah suhu annealing. garam.

lumlah koloni pada cawan petri kontrol negatif adalah 9 buah. dipilih sepuluh buah koloni untuk diperiksa ukuran insert-nya dengan teknik peR. Kedua primer ini berjarak sekitar 125 pb dari daerah insert.15 a. oleh karenanya koloni sel yang mengandung plasmid kosong cenderung lebih sedikit jumlahnya dibandingkan dengan koloni sel yang mengandung plasmid rekombinan. IPTG. Gambar 11 menunjukkan cawan petri kontrol negatif dan cawan petri sam pel. dan X-gal. coli. Pada cawan petri tersebut dapat diamati bahwa selain jumlah koloninya sedikit. Gambar a menunjukkan kontrol negatif. dan X-gal. Untuk berswaligasi. Kontrol negatif memperoleh perlakuan yang sarna dengan sampel hanya tidak diberi insert. Swaligasi vektor pGEM®-T agak sulit terjadi karena seperti yang sudah disebutkan di atas. Gen penyandi protein yang resisten terhadap ampisilin terdapat di dalam plasmid. Gambar 12 menunjukkan bahwa sembilan koloni memiliki ukuran insert yang sesuai (1. tetapi mungkin terjadi. Dari ratusan koloni yang berwarna putih. mengandung plasmid.047 pb). koloni yang ada seluruhnya berwarna biru. IPTG. baik cawan petri kontrol negatif. Kenyataan ini menunjukkan bahwa koloni sel yang berisi plasmid kosong jumlahnya lebih sedikit daripada koloni sel yang berisi plasmid rekombinan. sedangkan !PTG dan Xgal digunakan untuk membedakan sel yang mengandung plasmid rekornbinan dengan sel yang mengandung plasmid kosong. Cawan petri berisi medium LB yang mengandung ampisilin. sedangkan jumlah koloni pada cawan petri sampel adalah sekitar 150 buah. Gambar lIb menunjukkan bahwa koloni yang tumbuh pada cawan petri sampel berwarna putih dan biru. sedangkan Gambar b menunjukkan sampei. b. Gambar II. Semua koloni yang tumbuh pada cawan petri. sehingga ukuran produk peR yang diperoleh merupakan penjumlahan ukuran insert dengan jumlah nukleotida dari kedua daerah . sedangkan satu koloni memiliki ukuran yang salah (sekitar 500 bp). Produk peR yang diperoleh tidak berukuran 797 pb karena peR dilakukan dengan menggunakan sepasang primer (MI3) yang terletak pada vektor pGEM®-T. Adapun sel pada umumnya akan menerima plasmid yang berbentuk sirkular. untuk masuk ke dalam sel hams berswaligasi (selfligated vector). maka kedua basa T harus saling berkomplemen. maupun cawan petri sam pel merupakan koloni yang mengandung plasmid karena sel-sel yang tidak mengandung plasmid tidak dapat menghasilkan suatu protein yang dapat merubah arnpisilin menjadi suatu senyawa yang tidak berbahaya bagi E. lumlah koloni yang berwama biru lebih sedikit daripada koloni yang berwarna putih (30 : 70). Gambar lla menunjukkan cawan petri kontrol negatif. Komplemen ini tidak stabil. setiap ujung 3' vektor pGE~ -T terdapat basa timin (T) yang menggantung. Hal ini menunjukkan bahwa tidak terjadi kontaminasi pada kontrol negatif karena semua koloni sel yang terbentuk hanya mangandung plasmid kosong. Secara sepintas dapat pula diamati bahwa jumlah koloni pada cawan petri kontrol negatif jauh lebih sedikit dibandingkan dengan jumlah koloni pada cawan petri sampel. Masing-masing cawan petri tersebut berisi medium LB yang mengandung ampisilin. Plasmid yang tidak berligasi dengan insert.

Pada gambar tersebut ditunjukkan bahwa insert teriigasi dengan vektor pGEM®-T. Produk non spesifik tersebut tidak terekam dengan kamera UV karena konsentrasinya sangat rendah « 50 ng).078 pb 872 pb 1. tetapi ternyata ban yak basa di bagian tengah insert yang tidak dapat terbaca. Oleh karen a itu dimanfaaikanlah primer IF-2 dan IR-2. Plasmid dari masing-masing koloni diisolasi dengan prosedur lisis basa termodifikasi. TI. Hasil peR sepuluh kalani (Memarker. dan IR-2. sedangkan SP6 dimanfaatkan untuk merunut sekuens insert dari belakang.16 primer ke daerah insert. Sekuensing Dari sernbilan buah koloni yang menunjukkan ukuran insert yang tepat. IF-2. 5 6 7 8 10 9 1. Selanjutnya dipurifikasi untuk menghilangkan sisa-sisa bahan yang digunakan dalam isolasi plasmid karen a bahan-bahan tersebut akan rnenimbulkan gangguan pada tahap pernisahan fragmen-fragmen DNA. Adanya sebuah koloni yang berukuran salah menunjukkan bahwa ternyata pada suhu annealing 56°e masih terbentuk produk non spesifik yang berukuran M 2 3 4 sekitar 250 pb. T7 dimanfaatkan untuk merunut sekuens insert dari depan. Dengan dernikian keseluruhan sekuens insert dapat dibaca karena perunutan sekuens insert dengan primer SP6. peR sekuensing dilakukan dengan beberapa primer. Mesin tersebut hanya dapat merunut sekuens suatu gen sampai sekitar 400-500 pb. Keadaan sebaliknya dapat terjadi apabila insert terligasi dengan vektor dalam posisi terbalik. . Gambar 13. (Lampiran 4). T7. oleh karenanya kedua primer terscbut terletak di ujungujung insert. dipilih dua buah koloni untuk disekuensing. IF-2. yaitu dengan membaca sekuens sambungan antara vektor dengan ujung-ujung insert. yaitu SP6. Gambar 13 menunjukkan sebagian elektroferogram hasil sekuensing dengan primer T7. Seharusnya penggunaan SP6 dan T7 dapat digunakan untuk membaca keseluruhan sekuens insert. Pemakaian kedua primer ini bertujuan untuk melihat apakah insert benar-benar terligasi dengan vektor pGEM®-T.047 pb 603 ph 500 pb Garnbar 12. Perunutan sekuens insert perlu dilakukan dengan rnenggunakan kedua primer ini karena kemampuan mesin Automatic DNA Sequencer Abi Prism 377 untuk rnerunut sekuens suatu gen untuk satu reaksi (sebuah primer) terbatas. Ujung T (timin) dari vektor langsung disambung oleh insert. Perunutan sekuens insert menggunakan kedua primer ini sangat baik.353 pb 1. 1-10 =nomor koloni). dan IR-2 saling meJengkapi. Daerah pertemuan antara vektor pGEM-T dengan salah satu ujung insert (ditunjukkan oleh landa'" ). Bagian yang tidak dapat terbaca hanya bagian ujung-ujung insert. Koloni yang dipilih adalah koloni 5 dan koloni 8. Primer IF-2 dan IR-2 merupakan primer yang digunakan untuk mengamplifikasi insert. SP6 dan T7 tersusun dari oligonukleotida yang terletak pada vektor pGEM®-T (terletak di luar insert).

S. 1995. Boynton. 01eh sebab itu pernanfaatan teknik PCR pada penelitian irn sangat menguntungkan. Ng. IFNO:2 b. B. 170:2796-280 l. Sekuens keseluruhan gen hasil isolasi dan urutan asarn amino yang disandi oleh gen 1FNu2 disajikan pada Lampiran 6 dan 7. Science 240: 15341538. D.e.. S. Brown. Oneal. M. Chapman & Hall. High efficiency transformation of bacterial cell by electroporation. Hosler. S. 1995). Calvin. R. KESIMPULAN DAN SARAN Kesimpulan Gen yang diisolasi dari DNA genom rnanusia dengan teknik PCR menggunakan primer IF-2 dan IR-2 merupakan gen 1FNu2. Selanjutnya untuk mengetahui subvarian IFNuz dari gen tersebut. 1988. Shark.. M. Teknik PCR yang digunakan pada peneiitian ini merupakan teknik yang efektif karena dapat digunakan pada berbagai tahap penelitian. Jakate. Gen . konfirmasi ukuran insert. 1994. N. Chloroplast transformation in Chlamydomonas with high velocity microprojectiles. D. Kenyataan ini tidak mengherankan karena IFNO:2 b merupakan subvarian yang paling dorninan (Lee et aI. Garland Publishing. Surg. Perbandingan sekuens sampel dengan IFNuz a. S. Jensen. Hal ini menunjukkan bahwa benar gen yang diisolasi merupakan gen 1FNu2 manusia. Saran Penelitian pendahuluan ini sebaiknya dilanjutkan dengan ekspresi gen Hu-IFNu2 supaya dapat dihasilkan protein IFNO:2 yang berrnanfaat sebagai obat antitumor dan antivirus. Konfirmasi diperoleh dari \1asil sekuensing menggunakan empat buah primer. yaitu adanya basa guanin (G) pada posisi ke-137 dan basa adenin (A) pada posisi ke-170 (Kaluz et al. T. D. Molecular Biology of the Cell. D. A. & P. dan S64991. Gene Cloning An lntroduction. Hanawalt. Hasil sekuensing dikonfirmasi (alignment) dengan standar gen IFNo:z yang terdapat dalam Genllank: dengan kode akses Y1834. Ini dibuktikan oleh ciri khas gen IFNO:2 b yang muncul pada gen sampel. IF-2. M. dan IFNo:z c diperoleh dari Genllank masing-masing dengan kode akses S64979. 1994). 2:365-371. Gretch & D. L. Bacteriol. E. yaitu pada tahap amplifikasi sam pel. Klein & K. ternyata gen yang dipero1eh merupakan sub varian b dari IFNo:2. E. Rosenblate. M. dan IFNo:2c. M. Cotler. A. J. B. Harris. & J. G. Potential uses of interferon alpha 2 as adjuvan therapy in cancer. S. isolasi gen dari DNA genom. Hasilnya menunjukkan bahwa gen hasil isolasi merupakan subvarian b dari IFNo:z. D. Ed.. Lebih spesifik lagi. R. B. J. dan IR-2. P. S64994. 1995. Sulivan. Johnson. maka dilakukan alignment dengan ketiga macam standar sekuens subvarian IFNO:2 yang ada dalam GenBank dengan kode akses S64979. H. H. yaitu primer SP6. J. 137 Sampel IFNA 2b IFNA 2a IFNA 2c 1FNa2 tersebut telah berhasil diklon ke dalam vektor pGEM®-T. D. Daily interferon therapy for hepatitis C virus infection gagaatctctcttttctcctgcttgaaggacagacatg gagaatctctcttttctcctgcttgaaggacagacatg gaaaatctctcttttctcctgcttgaaggacagacatg gagaatctctcmtctcctgcttgaaggacagacgtg 'f 171 'f Gambar 14. New York.17 Sekuens kedua koloni tersebut ternyata sarna persis dengan standar gen IFNO:2 yang terdapat dalam Genliank dengan kode akses Yl1834 (Lampi ran 5). IFNO:2 b. A. W. dan IFNO:2 c disajikan pada Gambar 14. DAFTAR PUSTAKA Alberts. The Oncologist 3: 198-203. 1988. Ed. Randolph-Anderson. dan pada tahap sekuensing. N. Sekuens gen 1FNu2 a.. K. Watson. R. J. Jones. ke-3. Perbandingan sekuens sampel dengan sekuens standar IFNo:z a. Bray. Kaur. K. C. Raff. Robertson. S64994. J. kc-3. Borden. Madras. E. Lewis. W. M. Gene regulation and clinical roles for interferons in neoplastic disease. Roberts & J. 2001. Gillham. 1998. dan S64991. Kirkwood. Agarwala. IFNo:z b. T7.. Ann. Ganger. T.

. E. Sci. Gelfand. 1996. G. H. Di dalam 1. Nat!. P. 1977. 1. Detection of rare alelic variants of the interferon-alpha 2 gene in human genomic DNA. J. BioI. Kaluz. 1981. M. 1985. K. Houck. and pigs by microinjection. Ernstoff. E. C. J. Brinster. Cooper. P. Acad. Thurs & J. M. M. A new method for sequencing DNA. Isolation. D. M. 1. Kirkwood. Nielsen. N. S. sheep. Millar. L. Di dalam M. Sci. A. P. A. H. recipients. Department of Biochemistry. 1994. R. Lymphocyte recovery and clinical response in multiple myeloma patients receiving interferon alpha 2 beta after injtensive therapy. Myambo. M.. D. R. Dull. C. A cad. P. Saiki. him. Immunological studies of human interferons a: antibodies with predetermined specificity. A. W. M. Yelverton & P. K. H. Nature 295:503-507. L. Drummond & D. USA 91:1198-1205. Pursel. Elbert. U. Palmiter & R. Expession of human immune interferon cDNA in E. Billian. Gross. J. R. H. Lawn. 264:6427-6437. K. I. Chem. Transient foreign gene expression chloroplast of culture tobacco cells biolistic delivery of chloroplast vector. M. Natl. Daniell. D.. Current Protocol in Molecular Biology: manipulation of DNA. MandeUi. Sci. V. I. M. 1990. Proc. Gill. A. coli and monkey cells. interferon Cytokine Res. Barber. J. Gray & D. . 38:\01-104. 1985. A. S. J. & W. M. Acta Virol. Interferon alpha 2b is the predominant Sattayasai. A. Proc. Proc. 1998. M.. N. Taylor-Papadimitriou (Penyunting). & D. Academic Press. Lewis. Bolt. C. D. Cancer 73:236-240. Br. Optimization of PCR. Gutterman. Sninsky. B. Acad. Wall. Liao & D. Gross. J. B. Lee.. Avvisati & S. A. V. F. Interferon Cytokine Res. 118. R. 1994. White (Penyunting). W. S. 1. N. Cytokine therapeutics: lesson from interferon a. Med. W. Gray. An introduction to the genes of the interferon system. J. Interferon alpha-2b adjuvant therapy of high-risk resected cutaneous melanoma. Innis. 3-12. L. 322: 14301434. A cad. Chou. D. DNA sequence of a major human leukocyte interferon gene. Ullrich. Monash University. K. Lawn. E. C. R. R. Ye. Rexroad.. Gray. D. 1990. 1995. A. E. Goeddcl. Amadori. Sharp. F. Innis. Gelfand. Characterization and Expression in Echericia coli of the DNA polymerase gene from Thermus aquaticus. S. Oxford. & A. USA 87:88-92. Tewari & J. C. Interferon-alpha 2 variants in human genome. 1981. J.. Powles. J. OIlCOI. Strawderman & M. 15:403-406. Oxford University Press. R. M. R. M. A. Interferons Their impact in Biology and Medicine: an introduction to the genes of the interferon system. Australia. Engl. Hammer. Transplantation subvariant detected in human genomic DNAs. K. Tesis. B. Maxam. M. T. Vivekananda. San Diego. Crowe. Lawyer. Testa. M. 15:341349. Hussain. J. John Wiley & Sons. G. in after Proc. Sci. Franke.18 in liver transplant 71:261-266. PCR Protocols A Guide to Methods and Applications. USA 74:560-564. 1990.. H. Natl. 1996. D. 14:7-17.. Vojtassak. H. 1995. N. Maintenance treatment with recombinant interferon alpha 2b in patients with myeloma responding to conventional induction chemotherapy. S. Production of transgenic rabbits. J. V. I. McCandliss. Seeburg. 1990. Clin. Sanford. Nature 315:680-683. D. Gelfand. R. him. Kontsek. D. Nat!. Bell & R.. Brissette. H. Leung. Gibadulinova. Stoffel. Canada. K. R. G. 1989. N. Dijkmans. Fuchsberger & P. N. Gewert. P. J. Tucker. Ni. Moore. & T. K. Gilbert. Kabat. USA 78:5435-5439.

Natl. Erlich.. DNA sequencing with chain-terminating inhibitor. D. I. Watson. Scharf. & J. Sarnbrook.. S. S. 1994. G. A. Voet. F & A. R. London. Engl. Trujillo & J. Stockton Press. 1977. U. Ann. R. 1994. 1993. Kurzrock. D. Brousse. 329:1608-[614. Wilkowski & M. Terr & T. Talpaz. H. Stites. F. [989. Stoffel. Gutterman. Ed. K. Proc. Gelfand.19 Saiki. Sci. G. Mullis & H. Kantarijan. ke-8. 1978. Appleton & Lange. J. G. B. 1992. K. 1988. . R. New York. Cold Spring Harbor Laboratory Press. Zoller. D. Horn. The use of thin acrylamide gels for DNA sequencing. H. Coulson. Recombinant interferon alpha-2b combined with a regimen containing doxorubicin in patient with advanced follicular lymphoma. Science 239:487-494. Lepage & N. R. J. Molecular Cloning A Laboratory Manual. M. ke-2. Norwalk. Acad. J. Ed. PCR Technology Principles & Appplications for DNA Amplification: the design and optimization of the PCR. Ed. Sanger. Fritsch & T. Parslow. Coulson. M. A. R. Sanger. New York. Voet. F. J. Kc-2 . FEBS Lett. Higuchi. USA. Med. E. John Wiley & Sons. D. Med. K. P. Solal-Celigny. Saiki. ke-Z. J. Nicklen & A. P. Biochemistry. S. Ed. R. Intern. 1989. J. Basic and Clinical Immunology. USA 74:54635467.. M. T. N. Interferon-alpha produces sustained cytogenetic responses in chronic mylogenous leukimia. Recombinant DNA. Gilman. Scientific American Books. Maniatis. E. 87: 107-110. Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase.. 1991.. 144:532-538.

LAMPlRAN .

"0 '" A:: ro ·S ·S til 0. u -c 0 < u u0 ~ U < -c 0 f-< ~ f-< M M U M u < u ..l C o. C :.0 p.:l e !oj} .... J-..§ ...:l tlJ} ] e .... 0 0 0 <r... . 10 U e U p. . v-i 0 . uu <r. p::.v:....... 1::: 'U ~ .... '" p::.v:.. .:::J ...5 e '" <!) . ~ i'rl u <C U .::l d ......:l ] ro . 0:1 .. ::g ::g M ... <!) bll ttl btl 'V:. :::... "0 e ro e E 0 '" p::...... U p. ~ . <C E-< E:5 u < 0 '.. . 0:1 .s 0... ~ 0 u <r. ~ 0 ::0 '-"' 0.. N N z z E d ~ . p...s ~ .:l . U< u M M u M <r.. 0 .....I:: ro '0:. 0..!<: o. 0:1 "0 10 .......!<: !l..... 10 ""' <P c ~ E ro 0 <P c E ..:l e ] I:: o. . ..l :..... ttl ttl :. [J') .5 til 0:1 '" ...:::J e B ~ :::.:: 8 0. d ..l [J') .. <!) < -c 0 U E-< u 0 0 f-< 0 f-< U E-< U U u S i'rl t3 8 f-< U ~ u0 u <r. U U E-< U 0 0 0 u <C ~ <I' b 0 i'rl c '" v ..:l << U 0 i'rl 0 0 0 E 0 0 < u <C U U E-< In b i'rl r-:.. N ~ ('f) 1.. .!<: ::l 10 til '0:. <!) '..:: S <C 0.l d :::. uuu < << <r......l . ..E E ] "0 e .. . . e !oo !oj} .!<: :::> N N N N ("<') ("<') N N '1" N N N 0 bb <r.!<: ~ "0 "0 ~ U p..'" $ c o.::l ::r: ::r: C !oJ} 0 c <!) a:: .. 1::: ~ '" .

Kemurnian DNA sampel Kemurnian = A260 nm / A2so nm = 0.75 Sampel 0.21 Lampiran 2.084/ 0.) 1.! A2BOn".048 .048 200 840 I. Perhitungan kadar DNA sampel (ng/ill) KadarDNA = A260nm X faktor pengenceran x 50 ng/ill = = 0. Faktor pengenceran Kadar DNA (ng/p.084 x 200 x 50 ng/il! 840 ng/u! 2.084 0.l) Kemurnian DNA (A26onn. Perhitungan kadar dan kemurnian DNA A2so"".

.

. (c )<{ c<) c<) co c 000 -[ij r.. ) ~ gJ CD .-00 ><{> <D o 0 as (j) .... >....-.. -E . ~q.."<t o o Ql ) ).. Q) .

24 Lampiran 5.8) multiple sekuens sampel dengan standar Y11834 (Sequence CLUSTAL SAMPEL STANDAR sequence alignment ------------------CTTTNAATTCCCTTTG-AACATCNACATNGGCCTTGACCTTGGCTCACCCATTTCAACCAGTCTAGCAGCATCTGCAACATCTACAATGGCCTTGACCTTT * * ** ****** *** ************ ** GCTTTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGAT GCTTTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGAT ************************************************************ SAMPEL STANDAR SAMPEL STANDAR CTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGG CTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGG ************************************************************ AGAATCTCTCTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAG AGAATCTCTCTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAG ************************************************************ TTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAG TTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAG ************************************************************ SAMPEL STANDAR SAMPEL STANDAR SAMPEL STANDAR ATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGAC ATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGAC ************************************************************ AAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGG AAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGG ************************************************************ GTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTTCATTCTGGCTGTGAAGGAAATA GTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCATTCTGGCTGTGA-GGAAATA ************************************* ************** ******* CTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGT CTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGT ************************************************************ TGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAG TGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAG ************************************************************ SAMPEL STANDAR SAMPEL STANDAR SAMPEL STANDAR SAMPEL STANDAR SAMPEL STANDAR AAGTAAGGAATGAAAACTGGTTCAACATGGAAATGATTTTCATTGATTCGTATGCCAGCT AAGTAAGGAATGAAAACTGGTTCAACATGGAAATGATTTTCATTGATTCGTATGCCAGCT ************************************************************ CACCTTTTTATAATCTGCCATTTCAAAGACTCATGGTTCTGCTATGACCATGACACGATT CACCTTTTTATGATCTGCCATTTCAAAGACTCATGTTTCTGCTATGACCATGACACGATT *********** *********************** ************************ TAAATCTTTTCAAATGGTTTTANGAGTATTAATCAACCATTGGATTCAGCTCTTAAGGCA TAAATCTTTTCAAATGTTTTTAGGAGTATTAATCAAC-ATTGTATTCAGCTCTTAAGGCA **************** ***** ************** **** ***************** CTAGTCCC----------CTAGTCCCTTACAGAGGAC ******** SAMPEL STANDAR SAMPEL STANDAR SAMPEL STANDAR . Hasil konfirmasi reference) W (1.

Sekuens keseluruhan IFNCX:1 hasil isolasi III .I I tctagcagca tctgcaacat 40 gctttactgg tggccctcct 80 gctgctctgt gggctgtgat 120 gggtagcagg aggaccttga 160 agaatctctc ttttctcctg 200 220 230 240 I IIII III II II II 1111111111 cttgaaggac tttggcaacc tccatgagat aaaggactca aaattctaca III agacatgact agttccaaaa gatccagcag tctgctgctt ctgaactcta I III .I III II 10 III II II 20 II I 30 IIII II II " IIII I.25 Lampiran 6.I IIII III I II II I IIII I II II I aagcctgtgt cctgatgaag ttccaaagaa gcccttgtgc atctttttct IIII II gatacagggg gtgggggtga cagagactcc 440 gaggactcca ttctggctgt gaggaaatac 480 tcactctcta tctgaaagag aagaaataca 520 ctgggaggtt gtcagagcag aaatcatgag 560 ttgtcaacaa acttgcaaga aagtttaaga 600 640 630 620 610 II III •I II I II aI II II II III I IIII II III I agtaaggaat attgattcgt ttcaaagact aaatcttttc tqttcagctc gaaaactggt atgccagctc catgtttctg aaatgttttt ttaaggcact tcaacatgga acctttttat ctatgaccat aggagtatta agtcccttac aatgattttc 640 gatctgccat 680 gacacgattt 720 atcaacattg 760 agaggac.I 410 I I II .I ttggatttcc ccaggaggag 240 ggctgaaacc atccctgtcc 280 atcttcaatc tcttcagcac 320 gggatgagac cctcctagac 360 ccagcagctg aatgacctgg 400 Lt30 Lt40 420 . 797 . 40 II I I ggctcaccca ctacaatggc ggtgctcagc ctgcctcaaa tgctcctggc 210 III" III tttcaaccag cttgaccttt tgcaagtcaa cccacagcct acagatgagg III aI .

Urutan nukleotida gen Hu-IFNCt.2dan asam amino yang disandinya MALTFALLVALLVLSCK 1 SSC atg gee ttg aee ttt get tta etg gtg gee ete etg gtg etc age tge aag tea age tge SVGCDLPQ THSLGSRRTLML 61 tet gtg ggc tgt gat ctg ect caa aec cae age etg ggt age agg agg ace ttg atg etc LAQMRRJSLFSCLKDR HDFG 121 etg gea eag atg agg aga ate tct ett tte tee tge ttg aag gac aga cat gae ttt gga FPQE 181 EFGNOFQ KAET PVLH ttt eee eag gag gag ttt gge aae eag tte eaa aag get gaa ace ate eet gte ete eat EM I Q Q IF NL FS TKO S S AA W0 241 gag atg ate eag cag ate tte aat etc tte age aca aag gae tea tet get get tgg gat ETLL 0 KFYTELYOOLNDLEA 301 gag aee ete eta gae aaa tte tac aet gaa cte tac eag eag ctg aat gae etg gaa gee CV IOGVGVT ETPLMKE DSIL 361 tgt gtg ata eag ggg gtg ggg gtg aea gag aet eee etg atg aag gag gac tee att etg AVRKYFORI 421 TLYLKE KK YSP get gtg agg aaa tae ttc caa aga ate act etc tat etg aaa gag aag aaa tac age cet CAW 481 EVV RAE 1M RSFSLST NL tgt gee tgg gag gtt gte aga gea gaa ate atg aga tet ttt tet ttg tea aea aac ttg Q 541 ESLRSKE eaa gaa agt tta aga agt aag gaa tga .26 Lampiran 7.

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->