BAB XV GENETIKA POPULASI • Populasi Mendelian • Frekuensi Genotipe dan Frekuensi Alel • Polimorfisme Lokus sebagai Indeks Keanekaragaman

Genetik • Hukum Keseimbangan Hardy-Weinberg • Perubahan Frekuensi Alel BAB XV. GENETIKA POPULASI Pola pewarisan suatu sifat tidak selalu dapat dipelajari melalui percobaan persilangan buatan. Pada tanaman keras atau hewan-hewan dengan daur hidup panjang seperti gajah, misalnya, suatu persilangan baru akan memberikan hasil yang dapat dianalisis setelah kurun waktu yang sangat lama. Demikian pula, untuk mempelajari pola pewarisan sifat tertentu pada manusia jelas tidak mungkin dilakukan percobaan persilangan. Pola pewarisan sifat pada organisme-organisme semacam itu harus dianalisis menggunakan data hasil pengamatan langsung pada populasi yang ada. Seluk-beluk pewarisan sifat pada tingkat populasi dipelajari pada cabang genetika yang disebut genetika populasi. Ruang lingkup genetika populasi secara garis besar oleh beberapa penulis dikatakan terdiri atas dua bagian, yaitu (1) deduksi prinsip-prinsip Mendel pada tingkat populasi, dan (2) mekanisme pewarisan sifat kuantitatif. Bagian yang kedua ini berkaitan dengan penjelasan pada Bab XIV bahwa analisis genetik sifat-sifat kuantitatif hanya dapat dilakukan pada tingkat populasi karena individu tidak informatif. Namun, beberapa penulis lainnya, seperti halnya Bab XV ini, menyebutkan bahwa materi yang dibahas dalam genetika populasi hanya meliputi deduksi prinsip-prinsip Mendel pada tingkat populasi. Populasi dalam arti Genetika Untuk mempelajari pola pewarisan sifat pada tingkat populasi terlebih dahulu perlu difahami pengertian populasi dalam arti genetika atau lazim disebut juga populasi Mendelian. Populasi mendelian ialah sekelompok individu suatu spesies yang bereproduksi secara seksual, hidup di tempat tertentu pada saat yang sama, dan di antara mereka terjadi perkawinan (interbreeding) sehingga masing-masing akan memberikan kontribusi genetik ke dalam lungkang gen (gene pool), yaitu sekumpulan informasi genetik yang dibawa oleh semua individu di dalam populasi. Deskripsi susunan genetik suatu populasi mendelian dapat diperoleh apabila kita mengetahui macam genotipe yang ada dan juga banyaknya masing-masing genotipe tersebut. Sebagai contoh, di dalam populasi tertentu terdapat tiga macam genotipe, yaitu AA, Aa, dan aa. Maka, proporsi atau persentase genotipe AA, Aa, dan aa akan menggambarkan susunan genetik populasi tempat mereka berada. Adapun nilai proporsi atau persentase genotipe tersebut dikenal dengan istilah frekuensi genotipe. Jadi, frekuensi genotipe dapat dikatakan sebagai proporsi atau persentase genotipe tertentu di dalam suatu populasi. Dengan perkataan lain, dapat juga didefinisikan bahwa frekuensi genotipe adalah proporsi atau persentase individu di dalam suatu populasi yang tergolong ke dalam genotipe tertentu. Pada contoh di atas jika banyaknya genotipe AA, Aa, dan aa masing-masing 30, 50, dan 20 individu, maka frekuensi genotipe AA = 0,30 (30%), Aa = 0,50 (50%), dan aa = 0,20 (20%). Di samping dengan melihat macam dan jumlah genotipenya, susunan genetik suatu populasi dapat juga dideskripsi atas dasar keberadaan gennya. Hal ini karena populasi dalam arti genetika, seperti telah dikatakan di atas, bukan sekedar kumpulan individu, melainkan kumpulan individu yang dapat melangsungkan perkawinan sehingga terjadi transmisi gen

dari generasi ke generasi. Dalam proses transmisi ini, genotipe tetua (parental) akan dibongkar dan dirakit kembali menjadi genotipe keturunannya melalui segregasi dan rekombinasi gen-gen yang dibawa oleh tiap gamet yang terbentuk, sementara gen-gen itu sendiri akan mengalami kesinambungan (kontinyuitas). Dengan demikian, deskripsi susunan genetik populasi dilihat dari gen-gen yang terdapat di dalamnya sebenarnya justru lebih bermakna bila dibandingkan dengan tinjauan dari genotipenya. Susunan genetik suatu populasi ditinjau dari gen-gen yang ada dinyatakan sebagai frekuensi gen, atau disebut juga frekuensi alel, yaitu proporsi atau persentase alel tertentu pada suatu lokus. Jika kita gunakan contoh perhitungan frekuensi genotipe tersebut di atas, maka frekuensi alelnya dapat dihitung sebagai berikut. AA Aa aa Total Banyaknya individu 30 50 20 100 Banyaknya alel A 60 50 - 110 Banyaknya alel a - 50 40 90 Karena di dalam tiap individu AA terdapat dua buah alel A, maka di dalam populasi yang mempunyai 30 individu AA terdapat 60 alel A. Demikian juga, karena tiap individu Aa membawa sebuah alel A, maka populasi yang mempunyai 50 individu Aa akan membawa 50 alel A. Sementara itu, pada individu aa dengan sendirinya tidak terdapat alel A, sehingga secara keseluruhan banyaknya alel A di dalam populasi tersebut adalah 60 + 50 + 0 = 110. Dengan cara yang sama dapat dihitung banyaknya alel a di dalam populasi, yaitu 0 + 50 + 40 = 90. Oleh karena itu, frekuensi alel A = 110/200 = 0,55 (55%), sedang frekuensi a = 90/200 = 0,45 (45%). Frekuensi alel berkisar dari 0 hingga 1. Suatu populasi yang mempunyai alel dengan frekuensi = 1 dikatakan mengalami fiksasi untuk alel tersebut. Hubungan matematika antara frekuensi genotipe dan frekuensi alel Seandainya di dalam suatu populasi terdapat genotipe AA, Aa, dan aa, masing-masing dengan frekuensi sebesar P, H, dan Q, sementara diketahui bahwa frekuensi alel A dan a masing-masing adalah p dan q, maka antara frekuensi genotipe dan frekuensi alel terdapat hubungan matematika sebagai berikut. p = P + ½ H dan q = Q + ½ H Dalam hal ini P + H + Q = 1 dan p + q = 1. Agar diperoleh gambaran yang lebih jelas mengenai hubungan tersebut, kita perhatikan contoh perhitungan berikut ini. Data frekuensi golongan darah sistem MN pada orang Eskimo di Greenland menurut Mourant (1954) menunjukkan bahwa frekuensi golongan darah M, MN, dan N masingmasing sebesar 83,5 %, 15,6%, dan 0,9% dari 569 sampel individu. Kita telah mengetahui pada Bab II bagian alel ganda bahwa genotipe golongan darah M, MN, dan N masing-masing adalah IMIM, IMIN, dan ININ. Maka, dari data frekuensi genotipe tersebut dapat dihitung besarnya frekuensi alel IM dan IN. Frekuensi alel IM = 83,5% + ½ (15,6%) = 91,3%, sedang frekuensi alel IN = 0,9% + ½ (15,6%) = 8,7%. Hasil perhitungan frekuensi alel dapat digunakan untuk menentukan sifat lokus tempat alel tersebut berada. Suatu lokus dikatakan bersifat polimorfik jika frekuensi alelnya yang terbesar sama atau kurang dari 0,95. Sebaliknya, suatu lokus dikatakan bersifat monomorfik jika frekuensi alelnya yang terbesar melebihi 0,95. Jadi, pada contoh golongan darah sistem MN tersebut lokus yang ditempati oleh alel IM dan IN adalah lokus polimorfik karena frekuensi alel terbesarnya ( IM = 91,3%), masih lebih kecil dari 0,95. Proporsi lokus polimorfik pada suatu populasi sering kali digunakan sebagai salah satu indeks keanekaragaman genetik. Nilai lainnya yang juga sering digunakan sebagai indeks keanekaragaman genetik suatu populasi adalah heterozigositas rata-rata atau frekuensi heterozigot (H) rata-rata. Pada contoh di atas besarnya nilai H untuk lokus MN adalah 15,6%.

Seandainya dapat diperoleh nilai H untuk lokus-lokus yang lain, maka dapat dihitung nilai heterozigositas rata-rata pada populasi tersebut. Perhitungan frekuensi alel menggunakan data elektroforesis Frekuensi alel pada suatu populasi spesies organisme dapat dihitung atas dasar data elektroforesis protein/enzim atau zimogram yang menampilkan pita-pita sebagai gambaran mobililitas masing-masing polipeptida penyusun protein (Gambar 15.1). Elektroforesis merupakan teknik pemisahan molekul yang berbeda-beda ukuran dan muatan listriknya. Oleh karena itu, molekul-molekul yang akan dipisahkan tersebut harus bermuatan listrik seperti halnya protein dan DNA. Jarak migrasi (cm) 4 3 2 1 Individu 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Genotipe CL LL LL CL CL CL LL CL CL CL LL CL LL LL CL Gambar 15.1. Zimogram esterase dari ikan sidat (Anguilla sp) di kawasan Segara Anakan, Cilacap (Sumber : Susanto, 2003) Prinsip kerja elektroforesis secara garis besar dapat dijelaskan sebagai berikut. Sampel ditempatkan pada salah satu ujung media berupa gel, kemudian kedua ujung gel tersebut diberi aliran listrik selama beberapa jam sehingga komponen-komponen penyusun sampel akan bergerak menuju kutub yang muatan listriknya berlawanan dengannya. Kecepatan gerakan (mobilitas) tiap komponen ini akan berbeda-beda sesuai dengan ukuran molekulnya. Makin besar ukuran molekul, makin lambat gerakannya. Akibatnya, dalam satuan waktu yang sama molekul berukuran besar akan menempuh jarak migrasi yang lebih pendek daripada jarak migrasi molekul berukuran kecil. Pola pita seperti pada zimogram esterase di atas sebenarnya merupakan gambaran fenotipe, bukan genotipe. Namun, analisis variasi fenotipe terhadap kebanyakan enzim pada berbagai macam organisme sering kali dapat memberikan dasar genetik secara sederhana. Seperti diketahui, tiap enzim dapat mengandung sebuah polipeptida atau lebih dengan susunan asam amino yang berbeda sehingga menghasilkan fenotipe berupa pita-pita dengan mobilitas yang berbeda. Variasi fenotipe ini disebabkan oleh perbedaan alel yang menyusun genotipe. Jika alel-alel yang menyebabkan perbedaan polipeptida pada enzim tertentu terletak pada suatu lokus, maka bentuk alternatif enzim yang diekspresikannya dikenal sebagai alozim. Alel yang mengatur alozim biasanya bersifat kodominan, yang berarti dalam keadaan heterozigot kedua-duanya akan diekspresikan. Dengan demikian, individu pada Gambar 15.1 yang menampilkan pita lambat dan pita cepat (nomor 1, 4, 5, 6, 8, 9, 10, 12, dan 15) memiliki genotipe heterozigot, yaitu CL (C=cepat; L=lambat). Sementara itu, individu yang hanya menampilkan pita lambat (nomor 2, 3, 7, 11, 13, dan 14) adalah homozigot LL. Begitu pula individu dengan hanya satu pita cepat (kebetulan pada zimogram tersebut tidak ada) dikatakan mempunyai genotipe homozigot CC. Dari data genotipe yang diturunkan dari data variasi fenotipe tersebut, kita dengan mudah dapat menghitung baik frekuensi genotipe maupun frekuensi alelnya. Frekuensi genotipe CC, CL, dan LL masing-masing adalah 0, 9/15, dan 6/15. Frekuensi alel C = 0 + ½ (9/15) = 9/30, sedang frekuensi alel L = 6/15 + ½ (9/15) = 21/30. Hukum Keseimbangan Hardy-Weinberg Populasi mendelian yang berukuran besar sangat memungkinkan terjadinya kawin acak

H. Aa.. Artinya. frekuensi gamet a sama dengan frekuensi alel a (q). Hardy. Kembali kita misalkan bahwa pada generasi tetua terdapat genotipe AA. Dengan berlangsungnya kawin acak. Prinsip ini dirumuskan oleh G.Weinberg. Tabel 15. Sementara itu. masingmasing dengan frekuensi P. dan q2. Dari populasi generasi tetua ini akan dihasilkan dua macam gamet. baik dengan genotipe yang sama maupun berbeda dengannya. Deduksi terhadap hukum keseimbangan Hardy-Weinberg meliputi tiga langkah. frekuensi alel akan senantiasa konstan dari generasi ke generasi. dan (3) dari genotipe zigot kepada frekuensi alel pada generasi keturunan. Frekuensi gamet A sama dengan frekuensi alel A (p). 2pq. yakni AA. Dengan perkatan lain.H. sedang individu tt tidak. Begitu juga. tiap individu memiliki peluang yang sama untuk bertemu dengan individu lain. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel autosomal Kemampuan sesesorang untuk merasakan zat kimia feniltiokarbamid (PTC) disebabkan oleh alel autosomal dominan T. Pembentukan zigot pada kawin acak Gamet-gamet dan frekuensinya A (p) a (q) Gamet-gamet dan frekuensinya A (p) AA (p2) Aa (pq) a (q) Aa (pq) aa (q2) Oleh karena frekuensi genotipe zigot telah didapatkan. ahli matematika dari Inggris.1 terlihat bahwa tiga macam genotipe zigot akan terbentuk. dan W. (2) dari penggabungan gamet-gamet kepada genotipe zigot yang dibentuk. Frekuensi alel a = q2 + ½ (2pq) = q2 + pq = q (p + q) = q. Secara lebih rinci ketiga langkah ini dapat dijelaskan sebagai berikut. Dengan adanya sistem kawin acak ini. sehingga selanjutnya dikenal sebagai hukum keseimbangan Hardy-Weinberg.1. dan seleksi. maka frekuensi alel pada populasi zigot atau populasi generasi keturunan dapat dihitung. Dengan demikian. zigot-zigot yang terbentuk akan memilki frekuensi genotipe sebagai hasil kali frekuensi gamet yang bergabung. Individu dengan genotipe TT dan Tt dapat merasakan PTC. dan Q. dan aa.(panmiksia) di antara individu-individu anggotanya. Di samping kawin acak. yaitu A dan a. Fekuensi alel A = p2 + ½ (2pq) = p2 + pq = p (p + q) = p. maka terjadi penggabungan gamet A dan a secara acak pula. ada persyaratan lain yang harus dipenuhi bagi berlakunya hukum keseimbangan Hardy-Weinberg. mutasi. yaitu (1) dari tetua kepada gamet-gamet yang dihasilkannya. Pada suatu pengujian terhadap 228 orang diperoleh bahwa hanya . dapat dilihat bahwa frekuensi alel pada generasi keturunan sama dengan frekuensi alel pada generasi tetua. masing-masing dengan frekuensi p2. Aa. yaitu tidak terjadi migrasi. Oleh karena itu. terjadinya peristiwa-peristiwa ini serta sistem kawin yang tidak acak akan mengakibatkan perubahan frekuensi alel. Pada Tabel 15. sedang frekuensi alel a adalah q. frekuensi alel A adalah p. dokter dari Jerman. dan aa.

Pada jenis kelamin ini tiap individu hanya membawa sebuah alel untuk masing-masing lokus pada kromosom X-nya. yaitu q = 2/3 qm + 1/3 qt = 1/3 (2 qm + qt) = 1/3 (2Q + H + S). Dari 160 orang ini dapat dihitung individu yang bergenotipe TT dan Tt sebagai berikut. Seperti telah kita bicarakan pada Bab II. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel rangkai X Telah kita ketahui bahwa pada manusia dan beberapa spesies organisme lainnya dikenal adanya jenis kelamin homogametik (XX) dan heterogametik (XY). yang semuanya dapat merasakan PTC. Dengan demikian.55) = 0.50.2. Demikian pula. AB. frekuensi I0 = √ 205/500 = 0. jumlah frekuensi A dan O = p2 + 2pr + r2 = (p + r)2 = (1 – q) 2 sehingga akar kuadrat frekuensi A + O = 1 – q. 73 golongan B. yaitu p = 2/3 pm + 1/3 pt = 1/3 (2 pm + pt) = 1/3 (2P + H + R). Jika TT dijumlahkan dengan Tt. Banyaknya individu yang bergenotipe TT = 0. dan r. frekuensi genotipe TT = (0. yakni p2 + 2pr. 205 O.64. dari data frekuensi golongan darah (fenotipe) dapat dihitung besarnya frekuensi alel.50 x 228 = 114. yang merupakan akar kuadrat frekuensi O. dari 500 mahasiswa Fakultas Biologi Unsoed diketahui 196 orang bergolongan darah A.20.11. Kontribusi alel sebanyak 2/3 bagian oleh individu homogametik disebabkan oleh keberadaan dua buah kromosom X pada individu tersebut. Misalnya. sedang individu yang bergenotipe Tt = 0.30 = 0. Sebaliknya. Dengan cara yang sama dapat dihitung pula frekuensi alel a pada seluruh populasi.160 di antaranya yang dapat merasakan PTC.55 dan frekuensi alel T = 1 – 0. Frekuensi golongan darah A adalah penjumlahan frekuensi genotipe IA IA dan IA I0 .55 = 0. sedang frekuensi genotipe Tt = 2(0.45)(0.45. Dengan cara yang sama dapat diperoleh frekuensi alel IA (p) = 1 – √(73 + 205)/500 = 0. yaitu IA. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel ganda Salah satu contoh alel ganda yang sering dikemukakan adalah alel pengatur golongan darah sistem ABO pada manusia. Jadi. dan O pada suatu populasi dapat dicari dari sebaran frekuensi tersebut. sementara individu heterogametik memberikan . Individu yang tidak dapat merasakan PTC (genotipe tt) jumlahnya 228 – 160 = 68 sehingga frekuensi genotipe tt = 68/228 = 0. q. maka sebaran frekuensi genotipenya = (p + q + r)2 = p2 + 2pq + 2pr + q2 + 2qr + q2. Agar lebih jelas dapat dilihat Tabel 15. sistem ini diatur oleh tiga buah alel. Selanjutnya. Alel yang langsung dapat dihitung frekuensinya adalah I0 . IB. frekuensi golongan darah B. Selanjutnya. Tabel 15.25.2 berikut ini. pada jenis kelamin heterogametik formula tersebut tidak berlaku karena frekuensi alel rangkai X benar-benar sama dengan frekuensi genotipe. Jika frekuensi ketiga alel tersebut masing-masing adalah p.45)2 = 0. dan 26 AB.20 x 228 =46. Dengan mudah dapat diperoleh frekuensi alel t = √ 0. Pada jenis kelamin homogametik hubungan matematika antara frekuensi alel yang terdapat pada kromosom X (rangkai X) dan frekuensi genotipenya mengikuti formula seperti pada autosom. dan I0. maka diperoleh individu sebanyak 160 orang. Namun.30. frekuensi IB (q) = 1 – akar kuadrat frekuensi A + O = 1 – √(196 + 205)/500 = 0. Hubungan matematika antara fekuensi alel rangkai X dan frekuensi genotipe Homogametik Heterogametik Genotipe AA Aa aa A a Frekuensi genotipe P H Q R S Alel A a A a Frekuensi alel pm = P + ½H qm = Q + ½H pt = R qt = S pm = frekuensi alel A pada individu homogametik qm = frekuensi alel a pada individu homogametik pt = frekuensi alel A pada individu heterogametik qt = frekuensi alel a pada individu heterogametik Untuk seluruh populasi frekuensi alel A dapat dihitung.

Oleh karena itu. Hubungan matematika antara laju mutasi dan perubahan frekuensi alel dapat dirumuskan seperti pada contoh berikut ini. sering kali digunakan untuk menjelaskan adanya perbedaan frekuensi alel tertentu di antara berbagai populasi. Sekarang kita dapat menghitung frekuensi alel B pada seluruh populasi.12. Sementara itu.02 + 0. Ketika dicapai keseimbangan di antara kedua arah mutasi tersebut nilai ∆p dan ∆q adalah 0. di dalam suatu populasi terdapat alel A dan a. individu-individu mutan biasanya mempunyai daya hidup (viabilitas). Dari kenyataan tersebut di atas dapat dimengerti bahwa mutasi hanya akan memberikan pengaruh nyata terhadap perubahan frekuensi alel jika mutasi berlangsung berulang kali (recurrent mutation) dan mutan yang dihasilkan memiliki kemampuan untuk beradaptasi dengan lingkungan yang ada.88. yaitu R = 311 / (311+42) = 0.82 + 0.02. vqo = upo.11.12) = 0. atau secara umum vq = up. kuantifikasi migrasi dalam bentuk laju migrasi (lazim dilambangkan sebagai m). Sebaliknya. Misalnya. masing-masing dengan frekuensi awal po dan qo. 7 betina kuning (bb). maka . Di antara populasi kucing jantan frekuensi genotipe B. 311 kucing jantan hitam (B). dan juga tingkat kesuburan (fertilitas). dan 42 jantan kuning (b). pn – P = (po – P)(1 – m)n pn = frekuensi alel pada populasi yang diamati setelah n generasi migrasi P = frekuensi alel pada populasi migran po = frekuensi alel pada populasi awal (sebelum terjadi migrasi) m = laju migrasi n = jumlah generasi Mutasi Faktor lain yang dapat menyebabkan terjadinya perubahan frekuensi alel adalah mutasi. laju mutasi alel a menjadi A adalah v. Misalnya. Hal ini berarti bahwa peristiwa migrasi akan menyebabkan terjadinya perubahan frekuensi alel.0. yaitu S = 42 / (311+42) = 0.16 dan frekuensi genotipe bb (Q) = 7 / (277+54+7) = 0. Namun. sedang frekuensi genotipe b. Lebih jauh.08 atau 8%. Selain itu. Mutasi berlangsung dari A ke a dengan laju mutasi sebesar u. 54 betina tortoise shell (Bb).kontribusi alel 1/3 bagian karena hanya mempunyai sebuah kromosom X. misalnya perbedaan frekuensi golongan darah sistem ABO yang terlihat sangat nyata antara ras yang satu dan lainnya. Secara matematika. maka dikatakan bahwa laju migrasinya 0. Dengan demikian. Hal ini terutama karena laju mutasi yang umumnya terlalu rendah untuk dapat menyebabkan terjadinya perubahan frekuensi alel. yaitu P = 277 / (277+54+7) = 0. Laju migrasi dapat didefinisikan sebagai proporsi atau persentase alel tertentu di dalam suatu populasi yang digantikan oleh alel migran pada tiap generasi. yaitu q = 1/3 (2. dan frekuensi alel b pada seluruh populasi. frekuensi genotipe Bb (H) = 54 / (277+54+7) = 0. hubungan antara perubahan frekuensi alel dan laju migrasi dapat dilihat sebagai persamaan berikut ini. dalam suatu populasi terdapat 277 ekor kucing betina berwarna hitam (BB). Dari data ini dapat dihitung frekuensi genotipe BB pada populasi kucing betina.82. yang rendah. peristiwa yang sangat mendasari proses evolusi ini sebenarnya tidak begitu nyata pengaruhnya dalam perubahan frekuensi alel. perubahan frekuensi alel A akibat mutasi adalah ∆p = vqo – upo. Sebagai contoh perhitungan frekuensi alel rangkai X dapat dikemukakan alel rangkai X yang mengatur warna tortoise shell pada kucing.89. jika pada tiap generasi sebanyak 80 dari 1000 ekor ikan normal digantikan oleh ikan albino. sedang perubahan frekuensi alel a akibat mutasi adalah ∆q = upo – vqo. Jika persamaan ini dielaborasi. yaitu p = 1/3 (2. Migrasi Di atas telah disebutkan bahwa migrasi merupakan salah satu syarat yang harus dipenuhi bagi berlakunya hukum keseimbangan Hardy-Weinberg.88) = 0.0.16 + 0. Sebagai contoh.16 + 0.

Proporsi pengurangan kontribusi genetik suatu genotipe bila dibandingkan dengan kontribusi genetik genotipe baku disebut koefisien seleksi (s) genotipe tersebut. dan aa. atau disebut juga genotipe baku. sedang pada kondisi dominansi penuh (Gambar 15. sementara untuk genotipe-genotipe lainnya nilai fitnes relatif besarnya kurang dari 1.2 a dan b) genotipe Aa memberikan kontribusi genetik yang lebih kecil bila dibandingkan dengan kontribusi genotipe baku (AA).2 c) genotipe ini memberikan kontribusi genetik sama besar dengan kontribusi genotipe AA. Namun.2 berikut ini. aa Aa AA (1-s) (1-½s) 1 a) aa Aa AA (1-s) (1-½s) 1 b) aa AA/Aa (1-s) 1 c) aa AA Aa (1-s2) (1-s1) 1 d) Fitnes relatif Gambar 15. Proporsi atau persentase kontribusi genetik suatu individu kepada generasi berikutnya dikenal sebagai fitnes relatif atau nilai seleksi individu tersebut. genotipe Aa menjadi genotipe baku dan kontribusi genetiknya justru lebih besar daripada kontribusi genotipe AA. Dengan perkataan lain. dikatakan memiliki nilai fitnes relatif sama dengan 1. Genotipe superior di dalam suatu populasi. Berbagai kondisi dominansi dilihat dari nilai fitnes relatifnya a) Semi dominansi b) Dominansi parsial c) Dominansi penuh d) Overdominansi Pada kondisi semi dominansi dan dominansi parsial (Gambar 15. Namun. Kembali kita misalkan bahwa di dalam suatu populasi terdapat genotipe AA. kenyataan yang sebenarnya sering dijumpai tidaklah demikian. Individu-individu dapat memberikan kontribusi genetik yang berbeda karena mereka mempunyai daya hidup dan tingkat kesuburan yang berbeda. Bahkan pada kondisi overdominansi. Individu dengan genotipe homozigot HbSHbS akan mengalami pengkristalan molekul hemoglobin.akan didapatkan p = v/(u + v) dan q = u/(u + v). Kondisi dominansi ketiga genotipe ini berdasarkan atas nilai fitnes relatifnya dapat dilihat pada Gambar 15. Nilai fitnes relatif berkisar antara 0 dan 1. sehingga individu ini akan menderita anemia berat dan biasanya meninggal pada usia muda. Dominansi heterozigot (kondisi overdominansi) ini dapat dijumpai misalnya pada kasus resistensi individu karier anemia bulan sabit (sickle cell anemia) terhadap penyakit malaria. Seleksi Sebegitu jauh kita mengasumsikan bahwa semua individu di dalam populasi akan memberikan kontribusi jumlah keturunan yang sama kepada generasi berikutnya. individu heterozigot HbSHbA justru memiliki ketahanan yang lebih tinggi terhadap . nilai fitnes relatif genotipe ini adalah 1 – s. dan eritrositnya berbentuk seperti bulan sabit.2. Aa.

Genotipe AA Aa aa Total Frekuensi awal p2 2pq q2 1 Fitnes relatif 1 1 1 – s Kontribusi genetik p2 2pq q2(1 – s ) 1 – sq2 Terlihat bahwa kontribusi genetik total mejadi lebih kecil dari 1 karena genotipe aa mempunyai nilai fitnes relatif 1 – s. perubahan frekuensi alel dapat dihitung sebagai berikut. genotipe HbSHbA merupakan genotipe baku (fitnes relatif = 1).infeksi parasit penyebab malaria bila dibandingkan dengan individu normal (HbAHbA). Sebaliknya. perkawinan asortatif negatif dan silang luar akan meningkatkan frekuensi genotipe heterozigot. Setelah persamaan ini kita elaborasi akan didapatkan ∆q = – sq2( 1 – q) / 1 – sq2. Perkawinan asortatif positif dan silang dalam akan meningkatkan frekuensi genotipe homozigot. Pada kondisi dominansi penuh. sedang silang luar adalah perkawinan di antara individu-individu yang secara genetik tidak memiliki hubungan kekerabatan. Jika perubahan frekuensi alel a dilambangkan dengan ∆q. yaitu silang dalam (inbreeding) dan silang luar (outbreeding). ada sistem kawin tidak acak yang dikenal sebagai perkawinan asortatif. 3/8 aa. dan 1/4 bagian. baik AA maupun aa. perkawinan asortatif adalah sistem kawin tidak acak yang didasarkan atas fenotipe. Aa. Sebaliknya. Genotipe homozigot untuk suatu lokus tertentu – jika kita berbicara individu normal diploid – . dan (1/4+1/8) aa atau 3/8 AA. 1/2. Silang dalam Contoh silang dalam yang paling ekstrim dapat dilihat pada tanaman yang melakukan penyerbukan sendiri. maka ∆q = q1 – q = q2(1 – s ) + pq / 1-sq2 – q. Jika dilihat dari segi fenotipe. genotipe Aa akan berkurang menjadi 1/4 bagian sehingga populasi generasi ketiga akan terdiri atas (1/4+1/8) AA. Sistem Kawin Tidak Acak Faktor lain yang meyebabkan gangguan keseimbangan Hardy-Weinberg adalah sistem kawin tidak acak (non random mating). sampai dengan generasi ketiga saja sudah terlihat bahwa frekuensi genotipe homozigot. misalnya. pada perkawinan asortatif negatif individu-individu yang mempunyai fenotipe berbeda cenderung untuk lebih sering bertemu bila dibandingkan dengan individu-individu dengan fenotipe yang sama. Perubahan frekuensi alel akibat seleksi berlangsung sesuai dengan kondisi dominansi yang ada. Pada perkawinan asortatif positif individu-individu yang mempunyai fenotipe sama cenderung untuk lebih sering bertemu bila dibandingkan dengan individu-individu dengan fenotipe berbeda. Katakanlah generasi pertama suatu populasi tanaman menyerbuk sendiri hanya terdiri atas individu-individu dengan genotipe Aa. Di tempat-tempat yang menjadi endemi penyakit malaria. Untuk kondisi dominansi yang lain besarnya perubahan frekuensi alel akibat seleksi dapat dirumuskan dengan cara seperti di atas. Dari rumus hubungan matematika antara frekuensi alel dan frekuensi genotipe dapat dihitung besarnya frekuensi alel a setelah seleksi. mengalami peningkatan. Dengan demikian. sedang individu normal HbAHbA mempunyai nilai fitnes relatif kurang dari 1. sedang frekuensi heterozigot Aa berkurang. Sebaliknya. Silang dalam adalah perkawinan di antara individu-individu yang secara genetik memiliki hubungan kekerabatan. Dengan perkataan lain. 1/4 Aa. dan aa masing-masing sebanyak 1/4. Di samping perkawinan asortatif ada pula sistem kawin tidak acak yang tidak memandang fenotipe individu tetapi dilihat dari hubungan genetiknya. yaitu q1 = q2(1 – s ) + pq / 1-sq2. Sistem kawin semacam ini dapat dibedakan menjadi dua macam. maka pada generasi kedua dari seluruh populasi akan terdapat genotipe AA. Oleh karena terjadi penyerbukan sendiri di antara genotipe Aa. 1/4 Aa. Perkawinan asortatif dapat berupa perkawinan asortatif positif atau asortatif negatif (disasortatif). Pada generasi ketiga genotipe AA dan aa akan bertambah 1/8 bagian yang berasal dari segregasi genotipe Aa pada generasi kedua.

Loop adalah jalan yang menghubungkan kedua orang tua C D X (C dan D) melewati leluhur bersama (A dan B). individu A kawin dengan B menghasilkan dua anak. Perubahan frekuensi alel yang disebabkan oleh terjadinya silang dalam dapat dihitung dari perubahan frekuensi genotipe seperti pada Tabel 15.3. maka kedua alel tersebut dikatakan seasal atau identik (identical by descent).3.Contoh diagram silsilah *Hitung jumlah individu yang terdapat pada tiap loop sebagai nilai n. Frekuensi tersebut ternyata sama dengan frekuensi genotipe hasil kawin acak. Persamaan di antara dua alel pada genotipe homozigot dapat terjadi dengan dua kemungkinan. * Hitung nilai F dengan rumus : F = Σ (½)n(1 + FA) n = jumlah individu yang terdapat pada tiap loop (pada soal ini terdapat 3 individu. yaitu C dan D. Nilai F sama dengan 0 apabila kedua alel pada individu homozigot tidak mempunyai asal. Pertama. Aa. pada individu X besarnya ¼. kakak beradik C dan D kawin. mereka secara fungsional sama sehingga menghasilkan fenotipe yang sama pula. makin cepat diperoleh tingkat homozigositas yang tinggi.3. Koefisien silang dalam individu X dapat dihitung sebagai berikut.mempunyai dua buah alel yang sama pada lokus tersebut. maka frekuensi genotipe AA.usul yang sama atau merupakan hasil kawin acak. baik A maupun B. Sebagai gambaran. dan q2 . Aa. Kemungkinan kedua. Gambar 15. dan biasanya dilambangkan dengan F. 2 pq. A B * Hitung jumlah loop. nilai F sama dengan 1 apabila kedua alel sepenuhnya merupakan alel identik atau berasal dari leluhur bersama (common ancestor) yang sangat dekat. sedang individu heterozigot tidak . Hal ini berarti di dalam populasi hanya tinggal individu homozigot. Jika nilai F = 1. baik pada loop CAD maupun CBD) FA = koefisien silang dalam leluhur bersama (pada soal ini FA dan FB masing-masing sama dengan 0 karena dianggap sebagai individu hasil kawin acak) Dengan demikian. yaitu CAD dan CBD. Untuk menggambarkan besarnya peluang bahwa dua buah alel yang sama pada individu homozigot merupakan alel identik digunakan suatu nilai yang disebut sebagai koefisien silang dalam (inbreeding coefficient). Jika hal ini yang terjadi. mempunyai anak X. Peningkatan homozigositas akibat silang dalam dapat menimbulkan tekanan silang dalam (inbreeding depression) apabila di antara alel-alel identik yang bertemu terdapat sejumlah alel resesif yang kurang menguntungkan. maka frekuensi genotipe AA. Tabel 15. dan aa masing-masing adalah p2. Misalnya.3. 0. Sebaliknya. mereka berasal dari hasil replikasi sebuah alel pada generasi sebelumnya. Dua alel semacam ini dikatakan sebagai alel serupa (alike in state). Frekuensi genotipe hasil kawin acak dan silang dalam Genotipe Frekuensi Kawin acak Silang dalam AA p2 p2 (1 – F) + pF Aa 2 pq 2 pq (1 – F) aa q2 q2 (1 – F) + qF Jika nilai F = 0. sementara perkawinan antara saudara kandung baru mencapainya pada generasi keenam belas. Hal ini berarti bahwa peluang bertemunya alel-alel identik yang berasal dari leluhur bersama. nilai F individu X (FX) pada contoh soal tersebut di atas adalah (½)3(1 + 0) + (½)3(1 + 0) = ¼. dan aa masing-masing menjadi p. Selanjutnya. Pada soal ini terdapat dua X loop. Makin besar nilai F. dan q. Nilai ini besarnya berkisar dari 0 hingga 1. pembuahan sendiri dapat mencapai homozigositas 100% pada generasi keenam. Besarnya nilai F dapat dihitung dari diagram silsilah seperti contoh pada Gambar 15.

Silang luar Berkebalikan dengan silang dalam. silang luar justru dapat memunculkan individu hibrid dengan sifat-sifat yang lebih baik daripada kedua tetuanya yang homozigot. jika silang dalam dapat menyebabkan terjadinya tekanan silang dalam yang berpengaruh buruk terhadap individu yang dihasilkan. alel B menyebabkan batang menjadi kokoh. Pada silang tiga arah hibrid H digunakan sebagai tetua betina untuk disilangkan lagi dengan galur murni lain sehingga biji hibrid yang dihasilkan akan dibawa oleh tongkol hibrid H yang ukurannya besar. Dalam silang ganda ini. jagung hibrida yang dipasarkan biasanya bukan hasil silang tunggal (single cross) seperti itu. Peristiwa mutasi atau perubahan materi genetik. maka jumlah bijinya menjadi sedikit dan tidak cukup untuk dijual kepada petani. sedang alel b menyebabkan batang lemah. Di samping itu. yang agar dapat melaksanakannya materi genetik harus mempunyai kemampuan untuk melakukan mutasi. MUTASI Fungsi ketiga materi genetik adalah fungsi evolusi. Persilangan antara galur murni AAbb (akar kuat. melainkan hasil silang tiga arah (three-way cross) atau silang ganda (double cross). karena biji hibrid H ini dibawa oleh tongkol tetuanya (A atau B) yang kecil. silang luar akan meningkatkan frekuensi heterozigot.dijumpai lagi. Sementara itu. pada silang ganda hibrid H disilangkan dengan hibrid I hasil silang tunggal antara galur murni C dan D. Misalnya. akan menciptakan variasi genetik yang berguna untuk mengantisipasi perubahan kondisi lingkungan yang sewaktu- . Fenomena keunggulan yang diperlihatkan oleh individu hibrid hasil persilangan dua tetua galur murni (homozigot) disebut sebagai vigor hibrida atau heterosis. Oleh karena itu. Salah satu di antaranya adalah teori dominansi. batang kuat) akan menghasilkan hibrid AaBb yang mempunyai akar dan batang kuat. mendapatkan hibrid H. di samping segregasi dan rekombinasi. sebagai tetua betina dapat digunakan baik hibrid H maupun hibrid I karena kedua-duanya mempunyai tongkol yang besar. Galur murni A disilangkan dengan galur murni B. Agak berbeda dengan silang tiga arah. Namun. 11/03/2009 Posted by zaifbio | Genetika Dasar | 2 Komentar MUTASI BAB XI MUTASI • Pengertian Mutasi • Mekanisme Molekuler Mutasi • Mutasi Spontan dan Mutasi Induksi • Estimasi Laju Mutasi Spontan dengan Metode Clb • Mutagen Kimia dan Fisika • Mekanisme Perbaikan DNA • Mutasi Balik dan Mutasi Penekan • Uji Ames BAB XI. Ada beberapa teori mengenai mekanisme genetik yang menjelaskan terjadinya heterosis. ada alel A yang menyebabkan akar tanaman tumbuh kuat sementara alel a menjadikan akar tanaman lemah. yang pada prinsipnya menyebutkan bahwa alel-alel reseif merugikan yang dibawa oleh masing-masing galur murni akan tertutupi oleh alel dominan pada individu hibrid yang heterozigot. antara lain untuk merakit varietas jagung hibrida. Fenomena heterosis sudah sering sekali dimanfaatkan pada bidang pemuliaan tanaman. batang lemah) dan aaBB (akar lemah.

Alel-alel hasil mutasi somatis tidak akan diwariskan kepada keturunan individu yang mengalaminya karena mutasi ini tidak mempengaruhi sel-sel germinal. Jadi. Substitusi sebuah asam amino oleh asam amino lain yang muatannya sama. yaitu (1) substitusi basa dan (2) perubahan rangka baca akibat adanya penambahan basa (adisi) atau kehilangan . Hemoglobin pada individu dewasa normal terdiri atas dua rantai polipeptida α yang identik dan dua rantai polipeptida β yang identik juga. Contoh yang paling sering dikemukakan adalah perubahan sifat biologi yang terjadi pada molekul hemoglobin. substitusi asam amino yang tidak menghasilkan perubahan sifat protein atau perubahan fenotipik pun dapat dikatakan sebagai mutasi tenang. digantikan atau disubstitusi oleh valin. pada organisme diploid pengaruh mutasi juga bergantung kepada dominansi alel. Substitusi asam glutamat. Hal ini karena pelipatan rantai polipeptida sebagai penentu struktur tiga dimensi molekul protein sangat bergantung kepada interaksi di antara asam-asam amino dengan muatan yang berlawanan. Mekanisme Molekuler Mutasi Meskipun tidak selalu. Namun. mulai dari perubahan kecil yang hanya dapat dideteksi melalui analisis biokimia hingga perubahan pada prosesproses esensial yang dapat mengakibatkan kematian sel atau bahkan organisme yang mengalaminya. perubahan urutan asam amino pada suatu protein dapat menyebabkan perubahan sifat-sifat biologi protein tersebut. Mutasi germinal terjadi pada sel-sel germinal atau sel-sel penghasil gamet. Akan tetapi. Selain itu. Kita mengenal berbagai macam peristiwa mutasi sesuai dengan kriteria yang digunakan untuk mengelompokkannya. Demikian juga. oleh valin. sering kali tidak berpengaruh terhadap struktur molekul protein atau fenotipe individu. yang bermuatan negatif. eritrositnya menjadi lonjong dan mudah pecah. Perubahan atau mutasi basa pada DNA yang tidak menyebabkan substitusi asam amino atau tidak memberikan pengaruh fenotipik dinamakan mutasi tenang (silent mutation). perubahan urutan asam amino tidak selalu menyebabkan perubahan sifat-sifat biologi protein atau menghasilkan fenotipe mutan. Setiap perubahan asam amino disebabkan oleh perubahan urutan basa nukleotida pada molekul DNA. ada tidaknya pengaruh substitusi suatu asam amino terhadap perubahan sifat protein bergantung kepada peran asam amino tersebut dalam struktur dan fungsi protein. Dalam hal ini. yakni asam glutamat. misalnya substitusi histidin oleh lisin. Pada tanaman tingkat tinggi mutasi somatis justru sering kali menghasilkan varietas-varietas yang diinginkan dan untuk perbanyakannya harus dilakukan secara vegetatif. sedangkan mutasi somatis terjadi pada sel-sel selain sel germinal. Jenis sel dan tahap perkembangan individu menentukan besar kecilnya pengaruh mutasi. yaitu individu dengan jaringan normal dan jaringan yang terdiri atas sel-sel somatis mutan. Seperti dikatakan di atas. mengakibatkan perubahan struktur hemoglobin dan juga eritrosit yang membawanya. perubahan sebuah basa pada DNA tidak selamanya disertai oleh substitusi asam amino karena sebuah asam amino dapat disandi oleh lebih dari sebuah triplet kodon (lihat Bab X). Mutasi yang terjadi pada sebuah atau sepasang basa pada DNA disebut sebagai mutasi titik (point mutation). alel mutan resesif tidak akan memunculkan pengaruh fenotipik selama berada di dalam individu heterozigot karena tertutupi oleh alel dominannya yang normal. Pada organisme multiseluler dapat dibedakan antara mutasi germinal dan mutasi somatis. pada penderita anemia bulan sabit (sickle cell anemia) salah satu asam amino pada polipeptida β. Namun. Mekanisme terjadinya mutasi titik ini ada dua macam. yang tidak bermuatan atau netral. Hemoglobin penderita anemia bulan sabit akan mengalami kristalisasi ketika tidak bereaksi dengan oksigen sehingga akan mengendap di pembuluh darah dan menyumbatnya.waktu dapat terjadi. Pengaruh fenotipik yang ditimbulkan oleh mutasi sangat bervariasi. Mutasi somatis akan menyebabkan terbentuknya khimera.

basa (delesi). Mutasi titik yang disebabkan oleh substitusi basa dinamakan mutasi substitusi basa, sedangkan mutasi yang terjadi karena perubahan rangka baca dinamakan mutasi rangka baca (frameshift mutation) seperti telah disinggung pada Bab X. Apabila substitusi basa menyebabkan substitusi asam amino seperti pada kasus hemoglobin anemia bulan sabit, maka mutasinya dinamakan mutasi salah makna (missense mutation). Sementara itu, jika substitusi basa menghasilkan kodon stop, misalnya UAU (tirosin) menjadi UAG (stop), maka mutasinya dinamakan mutasi tanpa makna (nonsense mutation) atau mutasi terminasi rantai (chain termination mutation). Substitusi basa pada sebuah triplet kodon dapat menghasilkan sembilan kemungkinan perubahan triplet kodon karena tiap basa mempunyai tiga kemungkinan substitusi. Sebagai contoh, kodon UAU dapat mengalami substitusi basa menjadi AAU (asparagin), GAU (asam aspartat), CAU (histidin), UUU (fenilalanin), UGU (sistein), UCU (serin), UAA (stop), UAG (stop), dan UAC (tirosin). Kita bisa melihat bahwa perubahan yang terakhir, yakni UAC, tidak menghasilkan substitusi asam amino karena baik UAC maupun UAU menyandi asam amino tirosin. Mutasi substitusi basa dapat dibedakan menjadi dua kelompok, yaitu transisi dan transversi. Pada transisi terjadi substitusi basa purin oleh purin atau substitusi pirimidin oleh pirimidin, sedangkan pada transversi terjadi substitusi purin oleh pirimidin atau pirimidin oleh purin. Secara skema kedua macam substitusi basa tersebut dapat dilihat pada Gambar 11.1. A TC G Gambar 11.1. Skema substitusi basa nukleotida transisi transversi Sementara itu, mutasi rangka baca akan mengakibatkan perubahan rangka baca semua triplet kodon di belakang tempat terjadinya mutasi tersebut. Akan tetapi, adisi atau pun delesi sebanyak kelipatan tiga basa pada umumnya tidak akan menimbulkan pengaruh fenotipik mutasi rangka baca. Demikian pula, seperti dikatakan pada Bab X adisi satu basa yang diimbangi oleh delesi satu basa di tempat lain, atau sebaliknya, akan memperbaiki kembali rangka baca di belakang tempat tersebut. Selain itu, apabila adisi atau delesi terjadi pada daerah yang sangat dekat dengan ujung karboksil suatu protein, maka mutasi rangka baca yang ditimbulkannya tidak akan menyebabkan sintesis protein nonfungsional. Dengan perkataan lain, mutasi tidak memberikan pengaruh fenotipik. Mutasi Spontan Perubahan urutan basa nukleotida berlangsung spontan dan acak. Tidak ada satu pun cara yang dapat digunakan untuk memprediksi saat dan tempat akan terjadinya suatu mutasi. Meskipun demikian, setiap gen dapat dipastikan mengalami mutasi dengan laju tertentu sehingga memungkinkan untuk ditetapkan peluang mutasinya. Artinya, kita dapat menentukan besarnya peluang bagi suatu gen untuk bermutasi sehingga besarnya peluang untuk mendapatkan suatu alel mutan dari gen tersebut di dalam populasi juga dapat dihitung. Terjadinya suatu peristiwa mutasi tidak dapat dikatakan sebagai hasil adaptasi sel atau organisme terhadap kondisi lingkungannya. Kebanyakan mutasi memperlihatkan pengaruh yang sangat bervariasi terhadap tingkat kemampuan adaptasi sel atau organisme, mulai dari netral (sangat adaptable) hingga letal (tidak adaptable). Oleh karena itu, tidak ada korelasi yang nyata antara mutasi dan adaptasi. Namun, pemikiran bahwa mutasi tidak ada sangkut pautnya dengan adaptasi tidak diterima oleh sebagian besar ahli biologi hingga akhir tahun 1940-an ketika Joshua dan Esther Lederberg melalui percobaannya pada bakteri

membuktikan bahwa mutasi bukanlah hasil adaptasi. Dengan teknik yang dinamakan replica plating koloni-koloni bakteri pada kultur awal (master plate) dipindahkan ke medium baru (replica plate) menggunakan velvet steril sehingga posisi setiap koloni pada medium baru akan sama dengan posisinya masing-masing pada kultur awal. Medium baru dibuat dua macam, yaitu medium nonselektif seperti pada kultur awal dan medium selektif yang mengandung lebih kurang 109 fag T1. Hanya koloni-koloni mutan yang resisten terhadap infeksi fag T1 (mutan T1-r) yang dapat tumbuh pada medium selektif ini. Dari percobaan tersebut terlihat bahwa koloni-koloni mutan T1-r yang tumbuh pada medium selektif tidak terbentuk sebagai hasil adaptasi terhadap kehadiran fag T1, tetapi sebenarnya sudah ada semenjak pada kultur awal. Dengan demikian, teknik selektif semacam itu hanya akan menyeleksi mutan-mutan yang telah ada sebelumnya di dalam suatu populasi. master plate transfer replica plate replica plate (medium nonselektif) (medium selektif) Gambar 11.2. Percobaan transfer koloni (replica plating) = koloni mutan T1-r Teknik selektif seperti yang diuraikan di atas memberikan dasar bagi pemahaman tentang munculnya resistensi berbagai populasi hama dan penyakit terhadap senyawa kimia yang digunakan untuk mengendalikannya. Sebagai contoh, sejumlah populasi lalat rumah saat ini nampak sangat resisten terhadap insektisida DDT. Hal ini menunjukkan betapa seleksi telah memunculkan populasi lalat rumah dengan kombinasi mekanisme enzimatik, anatomi, dan perilaku untuk dapat resisten terhadap atau menghindari bahan kimia tersebut. Begitu pula, gejala peningkatan resistensi terhadap antibiotik yang diperlihatkan oleh berbagai macam bakteri penyebab penyakit pada manusia tidak lain merupakan akibat proses seleksi untuk memunculkan dominansi strain-strain mutan tahan antibiotik yang sebenarnya memang telah ada sebelumnya. Laju mutasi Laju mutasi adalah peluang terjadinya mutasi pada sebuah gen dalam satu generasi atau dalam pembentukan satu gamet. Pengukuran laju mutasi penting untuk dilakukan di dalam genetika populasi, studi evolusi, dan analisis pengaruh mutagen lingkungan. Mutasi spontan biasanya merupakan peristiwa yang sangat jarang terjadi sehingga untuk memperkirakan peluang kejadiannya diperlukan populasi yang sangat besar dengan teknik tertentu. Salah satu teknik yang telah digunakan untuk mengukur laju mutasi adalah metode ClB yang ditemukan oleh Herman Muller. Metode ClB mengacu kepada suatu kromosom X lalat Drosophila melanogaster yang memiliki sifat-sifat tertentu. Teknik ini dirancang untuk mendeteksi mutasi yang terjadi pada kromosom X normal. Kromosom X pada metode ClB mempunyai tiga ciri penting, yaitu (1) inversi yang sangat besar (C), yang menghalangi terjadinya pindah silang pada individu betina heterozigot; (2) letal resesif (l); dan (3) marker dominan Bar (B) yang menjadikan mata sempit (lihat Bab VII). Dengan adanya letal resesif, individu jantan dengan kromosom tersebut dan individu betina homozigot tidak akan bertahan hidup. Persilangan pertama dilakukan antara betina heterozigot untuk kromosom ClB dan jantan dengan kromosom X normal. Di antara keturunan yang diperoleh, dipilih individu betina yang mempunyai mata Bar untuk selanjutnya pada persilangan kedua dikawinkan dengan jantan normal. Individu betina dengan mata Bar ini jelas mempunyai genotipe heterozigot

karena menerima kromosom ClB dari tetua betina dan kromosom X normal dari tetua jantannya. Hasil persilangan kedua yang diharapkan adalah dua betina berbanding dengan satu jantan. Ada tidaknya individu jantan hasil persilangan kedua ini digunakan untuk mengestimasi laju mutasi letal resesif. Oleh karena pindah silang pada kromosom X dihalangi oleh adanya inversi (C) pada individu betina, maka semua individu jantan hasil persilangan hanya akan mempunyai genotipe + . Kromosom X pada individu jantan ini berasal dari tetua jantan awal (persilangan pertama). Sementara itu, individu jantan dengan kromosom X ClB selalu mengalami kematian. Meskipun demikian, kadang-kadang pada persilangan kedua tidak diperoleh individu jantan sama sekali. Artinya, individu jantan yang mati tidak hanya yang membawa kromosom ClB, tetapi juga individu yang membawa kromosom X dari tetua jantan awal. Jika hal ini terjadi, kita dapat menyimpulkan bahwa kromosom X pada tetua jantan awal yang semula normal berubah atau bermutasi menjadi kromosom X dengan letal resesif. Dengan menghitung frekuensi terjadinya kematian pada individu jantan yang seharusnya hidup ini, dapat dilakukan estimasi kuantitatif terhadap laju mutasi yang menyebabkan terbentuknya alel letal resesif pada kromosom X. Ternyata, lebih kurang 0,15% kromosom X terlihat mengalami mutasi semacam itu selama spermatogenesis, yang berarti bahwa laju mutasi untuk mendapatkan letal resesif per kromosom X per gamet adalah 1,5 x 10-3. betina Bar ClB + jantan normal ClB ? + ? ClB + letal betina Bar (dipilih untuk disilangkan dengan jantan normal) ClB ? + ClB + ? + ClB ? letal letal jika X-nya membawa letal resesif Gambar 11.3. Metode ClB untuk mengestimasi laju mutasi = kromosom X yang berasal dari tetua jantan pada persilangan pertama Pada metode ClB tidak diketahui laju mutasi gen tertentu karena kita tidak dapat memastikan banyaknya gen pada kromosom X yang apabila mengalami mutasi akan berubah menjadi alel resesif yang mematikan. Namun, semenjak ditemukannya metode ClB berkembang pula sejumlah metode lain untuk mengestimasi laju mutasi pada berbagai organisme. Hasilnya menunjukkan bahwa laju mutasi sangat bervariasi antara gen yang satu dan lainnya. Sebagai contoh, laju mutasi untuk terbentuknya tubuh berwarna kuning pada Drosophila adalah 10-4 per gamet per generasi, sementara laju mutasi untuk terbentuknya resitensi terhadap streptomisin pada E. coli adalah 10-9 per sel per generasi. Asal-mula terjadinya mutasi spontan Ada tiga mekanisme yang paling penting pada mutasi spontan, yaitu (1) kesalahan selama replikasi, (2) perubahan basa nukleotida secara spontan, dan (3) peristiwa-peristiwa yang berkaitan dengan penyisipan (insersi) dan pemotongan (eksisi) unsur-unsur yang dapat

Kadang-kadang ada juga kesalahan pasangan basa yang tidak dikenalinya. Bukti pertama bahwa agen eksternal dapat meningkatkan laju mutasi diperoleh dari penelitian H. Sistem ini dikenal sebagai sistem perbaikan salah pasangan (mismatch repair). pirimidin menjadi pirimidin). Namun. tidaklah sempurna sama sekali. basa tersebut akan membentuk ikatan hidrogen yang benar dengan basa pada untai DNA cetakan sehingga fungsi penyuntingan oleh DNA polimerase tidak dapat mengenalinya.4. Sistem perbaikan salah pasangan akan mengoreksi kesalahan semacam itu. Sistem perbaikan salah pasangan. Kadang-kadang suatu kesalahan replikasi luput dari mekanisme penyuntingan tersebut. maka sistem perbaikan salah pasangan tidak dapat membedakan antara untai cetakan dan untai baru. Hal ini akan menimbulkan mutasi spontan. dengan bantuan enzim Pol I celah ini akan diisi oleh segmen baru yang membawa basa yang telah diperbaiki. Berbeda dengan sistem penyuntingan oleh DNA polimerase. Caranya. timbullah mutasi spontan. Akan tetapi. dan basa timin yang seharusnya sitosin tersebut tidak dilihat sebagai basa yang salah. Sumber mutasi spontan lainnya adalah perubahan basa sitosin yang telah termetilasi menjadi timin karena hilangnya gugus amino. segmen DNA yang membawa basa yang salah dibuang sehingga terdapat celah (gap) di dalam untai DNA.berpindah (transposable elements). Pada Bab IX telah kita bicarakan bahwa enzim Pol I dan Pol III adakalanya membuat kesalahan dengan menyisipkan basa yang salah ketika replikasi DNA sedang berlangsung. seperti halnya mekanisme penyuntingan oleh DNA polimerase. Pada saat penggabungan berlangsung. Mutasi dengan laju yang ditingkatkan ini dinamakan mutasi induksi. . enzim-enzim DNA polimerase ini juga diketahui mempunyai kemampuan untuk memperbaiki kesalahan (proof reading) melalui aktivitas eksonukleasenya dengan cara memotong basa yang salah pada ujung 3’ untai DNA yang sedang dipolimerisasi. Selanjutnya. Agen yang dapat menyebabkan terjadinya mutasi seperti sinar X ini dinamakan mutagen. 5’ GAGTCGAATC 3’ untai cetakan 3’ CTCAGTTTAG 5’ untai baru GAGTCGAATC CTC AG AGTTT segmen dengan perbaikan eksisi basa yang salah GAGTCGAATC CTCAGCTTAG untai yang telah diperbaiki Gambar 11. Akan tetapi. Mekanisme perbaikan salah pasangan Basa-basa tautomerik adakalanya dapat tergabung dengan benar ke dalam molekul DNA. Muller pada tahun 1927 yang memperlihatkan bahwa sinar X dapat menyebabkan mutasi pada Drosophila. jika segmen yang membawa kesalahan basa tersebut telah mengalami metilasi. tetapi mengenali kesalahan basa di dalam untai DNA. sistem perbaikan salah pasangan tidak bekerja pada ujung 3’ untai DNA yang sedang tumbuh. Aktivitas penyuntingan oleh DNA polimerase boleh dikatakan sangat efisien meskipun tidak berarti sempurna benar. ada sistem lain yang berfungsi dalam perbaikan kesalahan replikasi DNA. Dalam hal ini hilangnya gugus amino dari sitosin yang telah termetilasi tidak dapat dikenali oleh sistem perbaikan salah pasangan. Mutasi Induksi Laju mutasi spontan yang sangat rendah ternyata dapat ditingkatkan dengan aplikasi berbagai agen eksternal. Sitosin yang seharusnya berpasangan dengan guanin berubah menjadi timin yang berpasangan dengan adenin sehingga terjadilah mutasi transisi (purin menjadi purin. Jika hal ini terjadi.

Sebagai contoh. Akibatnya. nisbah dTTP terhadap dCTP menjadi sangat tinggi dan frekuensi salah pasangan GT. konsentrasi dTTP akan menentukan konsentrasi ketiga dNTP lainnya untuk keperluan sintesis DNA. maka BU akan berpasangan dengan guanin (GBU). Jika sel yang akan dimutasi ditumbuhkan pada medium yang mengandung BU dalam bentuk keto. bisa juga masuknya sebuah basa analog terkoreksi melalui mekanisme penyuntingan oleh enzim DNA polimerase. Apabila suatu basa analog dapat membentuk ikatan hidrogen dengan dua macam cara. yaitu keto dan enol sehingga dapat membentuk ikatan hidrogen dengan dua macam cara. Penggantian ini belum dapat dikatakan sebagai peristiwa mutasi. Mutasi tautomerik (transisi) akibat basa analog 5-bromourasil Mutagen-mutagen kimia Berbeda dengan basa analog yang hanya bersifat mutagenik ketika DNA sedang melakukan replikasi. maka akan terjadi hambatan dalam sintesis dCTP. maka basa analog ini dikatakan bersifat mutagenik. mutagen kimia dapat mengakibatkan mutasi pada DNA baik yang sedang . dapat mempunyai dua macam bentuk. Artinya. Basa analog Basa analog merupakan senyawa kimia yang struktur molekulnya sangat menyerupai basa nukleotida DNA sehingga dapat menjadi bagian yang menyatu di dalam molekul DNA selama berlangsungnya replikasi normal. jika BU berada dalam bentuk enol. A=T substitusi T oleh BU (keto) A=BU replikasi 1 A=T G=BU pengikatan G oleh BU (enol) replikasi 2 A=T A=T G=C A=BU transisi Gambar 11. dan pada putaran replikasi berikutnya. Jika BU ditambahkan ke dalam medium pertumbuhan. Konsentrasi deoksinukleosida trifofat (dNTP) di dalam sel pada umumnya diatur oleh konsentrasi deoksitimidin trifosfat (dTTP).Semenjak penemuan Muller tersebut. berbagai mutagen fisika dan kimia digunakan untuk meningkatkan laju mutasi. Percobaan-percobaan berikutnya menunjukkan bahwa mekanisme mutagenesis BU dapat terjadi dengan cara lain. keberadaan BU ternyata menyebabkan laju perbaikan menjadi tertinggal oleh laju salah pasangan. maka dTTP akan disintesis dalam jumlah normal tetapi sintesis dCTP akan sangat terhambat. yang seharusnya GC. Dengan demikian. Sementara itu. Namun. Mekanisme penyuntingan dan perbaikan salah pasangan sebenarnya dapat membuang basa timin yang salah berpasangan dengan guanin tersebut. Akan tetapi. Akan tetapi. telah terjadi mutasi tautomerik berupa transisi dari AT ke GC (Gambar 11. molekul DNA yang baru akan mempunyai pasangan basa GC pada posisi yang seharusnya ditempati oleh pasangan basa AT. Hal ini karena suatu basa analog dapat berpasangan dengan basa tertentu pada untai DNA cetakan.5). BU telah menginduksi mutasi tautomerik berupa transisi GC menjadi AT. basa 5-bromourasil (BU) yang diketahui mudah sekali bergabung dengan DNA bakteri dan virus. akan meningkat. Dengan perkataan lain. Pada putaran replikasi berikutnya basa timin pada pasangan GT akan berpasangan dengan adenin sehingga posisi yang seharusnya ditempati oleh GC sekarang diganti dengan AT. Basa ini analog dengan basa timin karena hanya berbeda pada posisi gugus metil yang diganti dengan atom bromium. Dengan mutagen-mutagen ini dapat diperoleh bermacam-macam mutan pada beberapa spesies organisme.5. BU sebagai basa yang analog dengan timin juga dapat menghambat sintesis dCTP. maka selama replikasi DNA adakalanya timin digantikan oleh BU sehingga pasangan basa AT berubah menjadi ABU. Apabila suatu saat dTTP terdapat dalam jumlah yang sangat berlebihan.

Padahal seharusnya pasangan basa pada posisi celah tersebut adalah GC (bukankah yang hilang adalah G?). Alkilasi pada basa G atau T akan menyebabkan terjadinya salah pasangan yang mengarah kepada transisi AT→ GC dan GC → AT. Akibatnya. Apabila DNA yang membawa akridin tadi melakukan replikasi. yang salah satu contohnya adalah proflavin (Bab X). maka replikasi akan terhenti tepat di depan celah dan kemudian dimulai lagi dengan menyisipkan basa adenin pada posisi yang komplementer dengan celah tersebut. Depurinasi tidak selalu bersifat mutagenik karena celah yang terbentuk dengan hilangnya basa purin tadi dapat segera diperbaiki. Iradiasi ultraviolet Sinar ultraviolet (UV) dapat menghasilkan pengaruh. akridin dapat menyisip di antara dua pasangan basa yang berdekatan pada molekul DNA. melainkan mutasi rangka baca.bereplikasi maupun yang tidak sedang bereplikasi. Pengaruh interkalasi terhadap molekul DNA adalah terjadinya perenggangan jarak antara dua pasangan basa yang berurutan. Beberapa di antara mutagen kimia. sitosin. dan guanin menjadi gugus keto (=O) sehingga spesifisitas pengikatan hidrogen pada basa-basa tersebut juga mengalami perubahan. Jika hal ini terjadi.6. setelah replikasi basa adenin di posisi celah tersebut akan berpasangan dengan timin atau terjadi pasangan TA. Akan tetapi. memiliki struktur molekul berupa tiga cincin sehingga sangat menyerupai pasangan basa purin – pirimidin atau pirimidin – purin. Oleh karena itu pada posisi celah tersebut terjadi perubahan dari GC menjadi TA atau purin-pirimidin menjadi pirimidin-purin. Kedua-duanya akan memberikan gugus etil (C2H5) atau sejenisnya kepada basa DNA. deaminasi sitosin yang menghasilkan urasil akan mengakibatkan transisi GC menjadi AT melalui AU. maka untai DNA hasil replikasi akan ada yang mengalami adisi dan ada yang mengalami delesi pada posisi terjadinya interkalasi. O CH2 – CH2 – Cl CH3 – CH2 – O – S – CH3 HN O CH2 – CH2 – Cl etilmetan sulfonat mustard nitrogen Gambar 11. Pengaruh ini disebabkan oleh terjadinya perubahan kimia pada . Namun. beberapa lainnya. Dengan demikian. misalnya agen-agen alkilasi. Dengan struktur yang sangat menyerupai sebuah pasangan basa. HNO2 bekerja sebagai mutagen dengan mengubah gugus amino (NH2) pada basa adenin. Jika HNO2 terbukti sangat bermanfaat pada sistem prokariot. Struktur molekul dua agen alkilasi yang umum digunakan Fenomena lain yang dapat muncul akibat terjadinya alkilasi guanin adalah depurinasi. yaitu hilangnya basa purin yang telah mengalami alkilasi tersebut dari molekul DNA karena patahnya ikatan yang menghubungkannya dengan gula deoksiribosa. Dengan mekanisme serupa. Perubahan ini tidak lain merupakan mutasi tautomerik jenis transversi. Selain itu. Agen alkilasi etilmetan sulfonat (EMS) dan mustard nitrogen merupakan mutagen-mutagen kimia yang banyak digunakan dalam penelitian genetika. pada semua jenis virus dan sel. mutasi yang ditimbulkan bukanlah mutasi tautomerik. Besarnya perenggangan sama dengan tebal molekul akridin. maka agen-agen alkilasi sangat efektif untuk digunakan pada sistem eukariot. menimbulkan perubahan yang sangat khas. misalnya asam nitros (HNO2). garpu replikasi sering kali terlebih dahulu telah mencapai celah tersebut sebelum perbaikan sempat dilakukan. baik letal maupun mutagenik. yang berpasangan dengan sitosin. Hal ini mengakibatkan terjadinya transisi AT menjadi GC melaui HC. Interkalasi Senyawa kimia akridin. Deaminasi adenin akan menghasilkan hipoksantin (H). EMS dapat juga bereaksi dengan A dan C. Peristiwa penyisipan semacam ini dinamakan interkalasi. memberikan pengaruh dengan spektrum yang luas.

Fotoreaktivasi Mekanisme perbaikan ini bergantung kepada cahaya. Dengan adanya cahaya.d). DNA yang membawa dimer pada kedua untainya melakukan replikasi (Gambar 11.b). diikuti oleh resintesis segmen DNA baru. yaitu fotoreaktivasi. Pembuangan segmen ini kemudian diikuti oleh sintesis segmen baru yang akan menggantikannya dengan bantuan enzim DNA polimerase I.8. Mekanisme rekombinasi pada prinsipnya merupakan cara untuk menutup celah tersebut menggunakan segmen yang sesuai pada untai DNA cetakan yang membawa dimer. Dengan adanya timin dimer. proses ini diakhiri dengan ligasi segmen yang baru tadi dengan untai DNA.c). segmen yang membawa dimer akan terlepas dari untai DNA. eksisi. ikatan antara timin dan timin akan terputus oleh suatu enzim tertentu.8. Pada waktu yang sama terjadi pemotongan lagi pada segmen yang membawa dimer sehingga segmen ini terlepas dari untai DNA. Akan tetapi. Pada celah yang terbentuk akibat pemotongan tersebut segera terjadi sintesis segmen baru dengan urutan basa yang benar. Seperti pada mekanisme yang pertama. aktivasinya memerlukan spektrum biru cahaya sehingga enzim tersebut hanya bisa bekerja apabila ada cahaya. baik ketika ada cahaya maupun tidak ada cahaya. sekarang kedua untai DNA cetakan selain membawa dimer juga mempunyai celah. Mekanisme SOS Mekanisme perbaikan DNA dengan sistem SOS dapat dilihat sebagai jalan pintas yang memungkinkan replikasi tetap berlangsung meskipun harus melintasi dimer. Akibatnya. khususnya timin dimer. Ada dua mekanisme eksisi yang agak berbeda. Hasilnya berupa . segmen penutup celah akan terligasi dengan sempurna pada masing-masing untai DNA baru (Gambar 11. enzim endonuklease melakukan pemotongan (eksisi) pada dua tempat yang mengapit dimer. pada untai DNA cetakan terdapat segmen yang hilang. kerusakan DNA ini pada umumnya dapat diperbaiki melalui salah satu di antara empat macam mekanisme.8. Ketika DNA polimerase sampai pada suatu dimer. mekanisme ini sering juga dikatakan sebagai rekombinasi pascareplikasi. replikasi DNA akan terhalang pada posisi terjadinya timin dimer tersebut. Jadi.a) sehingga pada waktu garpu replikasi mencapai dimer akan terbentuk celah pada kedua untai DNA yang baru (Gambar 11.basa DNA akibat absorpsi energi dari sinar tersebut. perbaikan kerusakan DNA dengan cara rekombinasi terjadi setelah replikasi berlangsung. yakni di sekitar dimer. Celah akan diisi oleh segmen yang sesuai dari masingmasing untai DNA cetakan yang membawa dimer. Pada mekanisme pertama. rekombinasi. Untuk jelasnya. Eksisi Perbaikan dengan cara eksisi merupakan proses enzimatik bertahap yang diawali dengan pembuangan dimer dari molekul DNA. yaitu saling terikatnya dua molekul timin yang berurutan pada sebuah untai DNA. Akhirnya. dan diakhiri oleh ligasi segmen tersebut dengan untai DNA.8.8. Akibatnya. Akhirnya. Oleh karena itu. dan SOS. Akibatnya. sedangkan kedua untai DNA baru tidak mempunyai celah lagi (Gambar 11. untai DNA hasil polimerisasi akan mempunyai celah pada posisi dimer. maka polimerisasi akan terhenti sejenak untuk kemudian dimulai lagi dari posisi setelah dimer. Sebenarnya enzim tersebut telah mengikat dimer. segmen yang baru tersebut diligasi dengan untai DNA sehingga untai DNA ini sekarang tidak lagi membawa dimer. Pengaruh terbesar yang ditimbulkan oleh iradiasi sinar UV adalah terbentuknya pirimidin dimer. skema mekanisme tersebut dapat dilihat pada Gambar 11. Namun. Rekombinasi Berbeda dengan dua mekanisme yang telah dijelaskan sebelumnya. Pada mekanisme yang kedua pemotongan mula-mula hanya terjadi pada satu tempat.

Mekanisme eksisi untuk memperbaiki DNA Ketika sistem SOS aktif. Hal ini dimaksudkan agar polimerisasi tetap dapat berjalan melintasi dimer. dimer pemotongan di dua tempat pemotongan di satu tempat di sekitar dimer resintesis segmen baru oleh Pol I pemotongan segmen ligasi yang membawa dimer ligasi Gambar 11.7. Ukuran yang paling lazim digunakan adalah rad. karena jumlah dimer di dalam setiap sel yang mengalami iradiasi UV biasanya begitu banyak. Akibatnya. Semua bentuk radiasi pengion akan menyebabkan pengaruh mutagenik dan letal pada virus dan sel. yang didefinisikan sebagai besarnya radiasi yang menyebabkan absorpsi energi sebesar 100 erg pada setiap gram materi.8. β. Frekuensi mutasi yang diinduksi oleh sinar X sebanding dengan dosis radiasi yang diberikan. Pemaparan sebesar 1000 rad meningkatkan . Radiasi pengion meliputi sinar X beserta partikel-partikelnya dan radiasi yang dihasilkan oleh unsur-unsur radioaktif seperti partikel α. Sebagai contoh. a) b) d) c) Gambar 11. mutasi tetap terjadi. kedua adenin ini tidak dapat berpasangan dengan timin karena kedua timin berada dalam bentuk dimer. Pengaruh mutagenik iradiasi UV memang hampir selalu merupakan akibat perbaikan yang rentan terhadap kesalahan. Untai DNA yang baru akan mempunyai dua basa adenin berurutan pada posisi dimer (dalam kasus timin dimer).untai DNA yang utuh tetapi sering kali sangat defektif. Skema mekanisme rekombinasi pascareplikasi = pirimidin dimer = penutupan celah oleh segmen dari untai DNA cetakan yang membawa dimer Radiasi pengion Radiasi pengion mempunyai energi yang begitu besar sehingga molekul air dan senyawa kimia lainnya yang terkena olehnya akan terurai menjadi fragmen-fragmen bermuatan listrik. sistem penyuntingan oleh DNA polimerase III justru menjadi tidak aktif. frekuensi letal resesif pada kromosom X Drosophila meningkat linier sejalan dengan meningkatnya dosis radiasi sinar X. maka sistem perbaikan salah pasangan tidak dapat memperbaiki semua kesalahan yang ada. Dengan sendirinya. Intensitas radiasi pengion dinyatakan secara kuantitatif dengan beberapa macam cara. Sistem penyuntingan tidak dapat memperbaiki kesalahan ini karena tidak aktif. dan sinar γ. mekanisme SOS dapat dikatakan sebagai sistem perbaikan yang rentan terhadap kesalahan. sedangkan sistem perbaikan salah pasangan sebenarnya dapat memperbaikinya. Namun. Oleh karena itu.

Pada prinsipnya perlakuan ini dimaksudkan untuk meningkatkan frekuensi kerusakan kromosom pada sel-sel yang sedang mengalami mitosis. mutasi akan tetap terinduksi. yang disandi oleh gen trpA pada.15% menjadi 3%. semua sel tumor akan rusak. Ada tiga macam kerusakan DNA yang disebabkan oleh radiasi pengion. Mutasi Balik dan Mutasi Penekan Kebanyakan mutasi yang telah kita bicarakan hingga saat ini adalah perubahan dari bentuk alami atau normal ke bentuk mutan. Jika bagian yang tidak dapat dipulihkan bukan merupakan urutan yang esensial. Perubahan glisin menjadi asam glutamat sebenarnya . Salah satu di antara dua polipeptida yang menyusun enzim tersebut adalah polipeptida A yang terdiri atas 268 asam amino. seperti telah disinggung pada Bab X. kerusakan pada kedua untai. inversi. Cara yang pertama telah kita jelaskan pada Bab X. baik intra. dan translokasi. betapapun rendahnya dosis radiasi. Pada Drosophila tidak terdapat ambang bawah dosis pemaparan yang yang tidak menyebabkan mutasi. duplikasi. pada beberapa organisme terdapat sistem yang dapat memperbaiki kerusakan kromosom tersebut meskipun perbaikan yang dilakukan sering mengakibatkan delesi. Oleh karena itu. yaitu (1) perubahan urutan basa pada DNA mutan sehingga benar-benar pulih seperti urutan basa pada fenotipe normalnya dan (2) terjadinya mutasi kedua di suatu tempat lainnya di dalam genom yang mengimbangi atau menekan pengaruh mutasi pertama sehingga mutasi yang kedua tersebut sering disebut sebagai mutasi penekan (suppressor mutation). Penekanan intragenik Pada garis besarnya ada dua macam cara penekanan intragenik. Oleh karena tumor mengandung banyak sekali sel yang mengalami mitosis sementara jaringan normal tidak. yang biasanya bersifat letal. Mekanisme mutasi balik berupa mutasi penekan jauh lebih umum dijumpai daripada mekanisme yang pertama. tidak semua sel tumor mengalami mitosis pada waktu yang sama. Pada cara yang kedua tidak terjadi adisi dan delesi pada urutan basa. iradiasi biasanya dilakukan dengan selang waktu beberapa hari agar sel-sel tumor yang semula sedang beristirahat kemudian melakukan mitosis. Namun. tetapi perubahan suatu asam amino yang mengakibatkan hilangnya aktivitas protein akan diimbangi oleh perubahan asam amino lainnya yang memulihkan aktivitas protein tersebut. Radiasi pengion banyak digunakan dalam terapi tumor. Ada dua mekanisme yang berbeda pada mutasi balik. Kebanyakan mutasi penekan. Pada eukariot radiasi pengion dapat menyebabkan kerusakan kromosom.frekuensi mutasi dari laju mutasi spontan sebesar 0. Diharapkan setelah iradiasi diberikan selama kurun waktu tertentu. Mutasi penekan dapat terjadi di suatu tempat di dalam gen yang sama dengan mutasi pertama yang ditekannya. yaitu kerusakan pada salah satu untai. Akan tetapi. Mutasi semacam ini dinamakan mutasi balik atau reversi. terjadi penekanan intragenik. maka enzim triptofan sintetase menjadi tidak aktif. mutasi penekan dapat juga terjadi di dalam gen yang lain atau bahkan di dalam kromosom yang lain sehingga peristiwanya dinamakan penekanan intergenik. dan perubahan basa nukleotida. tidak dapat sepenuhnya memulihkan mutan ke fenotipe normalnya seperti yang akan diuraikan di bawah ini. Jika asam amino glisin ini berubah menjadi asam glutamat. coli. Akan tetapi. Artinya.maupun intergenik. mutasi dapat juga berlangsung dari bentuk mutan ke bentuk normal. Dengan perkataan lain. Pengaruh mutagenik dan letal yang ditimbulkan oleh radiasi pengion terutama berkaitan dengan kerusakan DNA. Namun. yaitu perbaikan rangka baca dengan kompensasi adisi-delesi sehingga rangka baca yang bergeser sebagian besar dapat dikembalikan seperti semula. maka sel tumor yang dirusak akan jauh lebih banyak daripada sel normal yang dirusak. maka pembacaan rangka baca akan menghasilkan fenotipe normal. Pada strain normal asam amino yang ke-210 adalah glisin. Sebagai contoh dapat dikemukakan penekanan mutasi enzim triptofan sintetase pada E. atau sering dikatakan sebagai mutasi ke depan (forward mutation).

Substitusi ini dapat terjadi dengan empat macam cara. mutasi penekan diberi lambang sup diikuti dengan angka (atau kadang-kadang huruf) yang membedakan penekan yang satu dengan penekan lainnya. yakni UAC dapat berubah menjadi kodon stop UAG. kebanyakan karsinogen juga merupakan mutagen. Contoh yang paling dikenal dapat dilihat pada gen-gen penyandi tRNA. (3) mutasi di luar kala (loop) antikodon yang memungkinkan aminoasil sintetase mengenali tRNA sehingga terjadi asilasi yang menyebabkan tRNA ini membawa asam amino yang lain. yang interaksinya dengan asam amino ke-210 menentukan aktivitas enzim. maka pengaruhnya akan ditekan oleh perubahan glisin menjadi asam glutamat. Sebagai contoh. Mutan-mutan ini gagal untuk membentuk plak (lihat Bab XII) pada strain bakteri standar tetapi dapat membentuk plak pada strain yang mengalami mutasi penekan. Mutasi ini dapat ditekan oleh molekul tRNA mutan yang membawa triptofan dengan antikodon AUC. jika perubahan tirosin menjadi sistein terjadi terlebih dahulu. (2) mutasi pada tRNA yang mengubah sebuah basa di dekat antikodon sehingga tRNA dapat mengenali dua kodon yang berbeda. Penekanan mutasi tanpa makna disebabkan oleh mutasi gen penyandi tRNA sehingga terjadi perubahan antikodon pada tRNA yang memungkinkannya untuk mengenali kodon stop hasil mutasi. Jadi. Pemulihan terjadi karena asam aspartat digantikan oleh alanin (tidak bermuatan). kodon UAG yang seharusnya merupakan kodon stop berubah menjadi kodon yang menyandi triptofan. Dengan tRNA mutan. Mutasi penekan intergenik dapat memulihkan baik mutasi tanpa makna (nonsense) maupun mutasi salah makna (missense). aktivitas enzim pun dapat dipulihkan. atau dengan perkataan lain.tidak menyebabkan inaktivasi enzim secara langsung karena glisin tidak terletak pada tapak aktif. Begitu pula sebaliknya. Dengan demikian. Apabila tirosin berubah menjadi sistein. asam amino normal yang ke-174 adalah tirosin. Namun. Pengaruh yang ditimbulkannya adalah mengubah kekhususan pengenalan kodon pada mRNA oleh antikodon pada tRNA. Mutasi semacam itu pertama kali ditemukan pada strain-strain E. salah satu kodon untuk tirosin. maka struktur pelipatan enzim yang telah berubah karena glisin digantikan oleh asam glutamat justru akan dipulihkan oleh interaksi sistein dengan asam glutamat. Mutasi balik sebagai cara untuk mendeteksi mutagen dan karsinogen Dewasa ini terjadi peningkatan jumlah dan macam bahan kimia yang mencemari lingkungan. perubahan glisin menjadi asam glutamat akan ditekan pengaruhnya oleh perubahan tirosin menjadi sistein. mutasi tRNA telah memulihkan mutasi tanpa makna. Sel yang tidak mempunyai penekan dilambangkan dengan sup0. Sementara itu. uji mutagenesis terhadap bahan-bahan kimia . Pada notasi konvensional. Penekanan intergenik Penekanan intergenik yang paling umum dijumpai adalah penekanan oleh suatu produk mutasi gen terhadap pengaruh mutasi yang ditimbulkan oleh sejumlah gen lainnya. terminasi dapat dibatalkan. Penekanan mutasi salah makna oleh mutasi penekan intergenik antara lain dapat dilihat contohnya pada pemulihan aktivitas protein yang hilang akibat perubahan valin (tidak bermuatan) menjadi asam aspartat (bermuatan negatif). coli yang dapat menekan mutan-mutan fag T4 tertentu. Oleh karena itu. Selain itu. Beberapa di antaranya dikenal potensial sebagai mutagen. Strain yang mengalami mutasi penekan ini ternyata juga dapat menekan mutasi pada sejumlah gen yang terdapat pada genom bakteri sendiri. Antikodon pada molekul tRNA normal yang membawa triptofan adalah AAC. yaitu (1) mutasi antikodon yang memungkinkan tRNA untuk mengenali kodon yang berbeda seperti halnya yang terjadi pada pemulihan mutasi tanpa makna. perubahan ini mengakibatkan perubahan struktur pelipatan enzim sehingga secara tidak langsung akan mempengaruhi tapak aktifnya. Akibatnya. dan (4) mutasi aminoasil sintetase yang kadang-kadang salah mengasilasi tRNA.

Oleh karena beberapa mutagen hanya bekerja pada DNA yang sedang melakukan replikasi. pestisida. Ke dalam medium tersebut kemudian ditambahkan mutagen potensial yang akan diuji. Di dalam uji Ames mutan-mutan bakteri Salmonella typhimurium yang memerlukan pemberian histidin eksternal atau disebut dengan mutan His. tetapi setidak-tidaknya memperlihatkan adanya peluang seperti itu. Frekuensi mutasi balik yang tinggi tidak serta-merta berarti bahwa senyawa yang diuji adalah karsinogen. Mutan-mutan Hismembawa baik mutasi tautomerik maupun mutasi rangka baca. Reaksireaksi enzimatik tersebut terjadi di dalam organ hati hewan dan tidak ada kesepadanannya di dalam sel bakteri. Jadi. 11/03/2009 Posted by zaifbio | Genetika Dasar | 8 Komentar . Apabila bahan kimia yang diuji adalah mutagen atau diubah menjadi mutagen. Analisis kuantitatif terhadap frekuensi mutasi balik dapat dilakukan juga dengan membuat variasi jumlah mutagen potensial tersebut di dalam medium. Peningkatan frekuensi revertan yang tajam apabila dibandingkan dengan frekuensi yang diperoleh di dalam medium tanpa senyawa kimia yang dicurigai tersebut mengindikasikan bahwa senyawa yang diuji adalah mutagen. uji Ames sebenarnya hanya berperan dalam mengurangi jumlah bahan kimia yang harus diuji menggunakan hewan percobaan. tetapi harus melalui beberapa reaksi enzimatik terlebih dahulu sebelum menjadi mutagen. banyak industri terpaksa mereformulasi produk-produknya. Frekuensi mutasi balik ternyata bergantung kepada konsentrasi bahan kimia yang diuji. diikuti dengan penaburan (plating) suatu mutan bakteri dalam jumlah tertentu. Akan tetapi. Fungsi normal enzim-enzim itu adalah melindungi organisme dari berbagai bahan beracun dengan cara mengubahnya menjadi bahan yang tidak beracun. Pemberian fraksi mikrosomal yang berasal dari hati tikus ke dalam medium pertumbuhan bakteri memungkinkan dilakukannya deteksi mutagenisitas. cara seperti tersebut di atas tidak dapat digunakan untuk memperlihatkan mutagenesis sejumlah besar karsinogen yang potensial. Fraksi mikrosomal dari hati tikus disebarkan ke permukaan medium. ketika enzim-enzim itu bertemu dengan bahan kimia tertentu. Cara yang paling sederhana untuk melihat mutagenesis suatu bahan kimia adalah uji mutasi balik menggunakan mutan nutrisional pada bakteri. maka mereka akan mengubah bahan tersebut dari sifatnya yang semula tidak mutagenik menjadi mutagenik. dan pada karsinogen tertentu juga nampak adanya korelasi dengan efektivitasnya pada hewan. Akibat dilakukannya uji Ames. dan kosmetika. Uji Ames saat ini telah banyak digunakan pada beribu-ribu senyawa seperti pengawet makanan. strain-strain bakteri tersebut dibuat menjadi lebih sensitif terhadap mutagenesis dengan menggabungkan beberapa alel mutan yang dapat menginaktifkan sistem perbaikan eksisi dan menjadikannya lebih permiabel terhadap molekul-molekul asing. diikuti dengan penaburan bakteri. maka medium pertumbuhan yang digunakan harus mengandung histidin dalam jumlah yang cukup untuk mendukung beberapa putaran replikasi tetapi tidak cukup untuk memungkinkan terbentuknya koloni yang dapat dilihat. Hal ini karena banyak sekali senyawa kimia yang tidak langsung bersifat mutagenik / karsinogenik. Enzim-enzim tersebut terdapat di dalam komponen sel-sel hati yang dinamakan fraksi mikrosomal. Bukti terakhir tentang karsinogenisitas suatu bahan kimia ditentukan atas dasar hasil uji pembentukan tumor pada hewan-hewan percobaan. maka koloni bakteri akan terbentuk. Banyaknya koloni revertan (fenotipe normal hasil mutasi balik) yang muncul dihitung.semacam ini perlu dilakukan. Perlakuan ini mendasari teknik pemeriksaan karsinogen menggunakan metode yang dinamakan uji Ames.digunakan untuk menguji mutagenisitas senyawa kimia atas dasar mutasi baliknya menjadi His+. Senyawa yang dicurigai potensial sebagai mutagen ditambahkan ke dalam medium padat. Di samping itu. pewarna rambut. Meskipun demikian.

Namun. mulai dari DNA hingga terbentuknya asam amino.1.EKSPRESI GEN BAB X EKSPRESI GEN         Dogma Sentral Genetika Molekuler Perkembangan Konsep tentang Gen Transkripsi Tiga Macam RNA Translasi. tidak semua urutan basa DNA akan diekspresikan menjadi urutan asam amino. Jadi. khususnya pada Prokariot Kode Genetik Mekanisme Pengaturan Ekspresi Gen pada Prokariot Mekanisme Pengaturan Ekspresi Gen pada Eukariot BAB X. dan setiap asam amino pembentukannya disandi (dikode) oleh urutan basa nitrogen di dalam molekul DNA. DNA harus mampu mengatur pertumbuhan dan diferensiasi individu organisme sehingga dihasilkan suatu fenotipe tertentu. Urutan basa DNA yang pada akhirnya menyandi urutan asam amino disebut sebagai gen. dikenal sebagai dogma sentral genetika molekuler. secara kimia gen adalah urutan basa nitrogen tertentu pada molekul DNA yang dapat dieskpresikan melalui tahap-tahap transkripsi dan translasi menjadi urutan asam amino tertentu. Setiap protein tersusun dari sejumlah asam amino dengan urutan tertentu. DNA replikasi RNA transkripsi translasi asam amino Gambar 10. proses tanskripsi dan translasi dapat dilihat sebagai tahaptahap ekspresi urutan basa DNA. Diagram dogma sentral genetika molekuler Perubahan urutan basa di dalam molekul DNA menjadi urutan basa molekul RNA dinamakan transkripsi. Fenotipe organisme sangat ditentukan oleh hasil interaksi protein-protein di dalam sel. . Dengan demikian. EKSPRESI GEN Pada Bab IX telah disebutkan bahwa salah satu fungsi dasar yang harus dijalankan oleh DNA sebagai materi genetik adalah fungsi fenotipik. sedangkan penerjemahan urutan basa RNA menjadi urutan asam amino suatu protein dinamakan translasi. Rangkaian proses ini. Artinya.

Tatum. mempelajari mutasi gen pada jamur Neurospora crassa dengan menumbuhkan berbagai strain mutan hasil iradiasi menggunakan sinar X atau sinar ultraviolet pada medium lengkap dan medium minimal. setiap molekul protein sendiri dapat dilihat sebagai gabungan beberapa subunit yang dinamakan polipeptida. Beadle dan E. Maka. dengan mengorelasikan hasil analisis genetik dengan hasil analisis biokimia terhadap strainstrain mutan Neurospora tersebut dapat diketahui bahwa tiap mutasi menyebabkan hilangnya satu aktivitas enzim. Namun.Di atas telah kita katakan bahwa sejumlah asam amino dengan urutan (sekuens) tertentu akan menyusun sebuah molekul protein. sebuah gula sederhana. disebabkan oleh satu gen mutan resesif. misalnya alkaptonuria. Dalam perkembangan berikutnya. enzim triptofan sintetase pada Escherichia coli terdiri atas dua buah polipeptida. Garrod mempelajari sejumlah penyakit metabolik bawaan pada manusia dan menyimpulkan bahwa setiap gangguan metabolisme bawaan yang menimbulkan penyakit tertentu. Strain tipe liar. Sekitar 50 tahun kemudian dua orang peneliti. Sir Archibald E. dan masing-masing polipeptida merupakan produk gen yang berbeda. setelah diketahui bahwa sebagian besar enzim tersusun dari beberapa polipetida. mengajukan konsep satu gen mutan – satu hambatan metabolisme. Medium minimal adalah medium untuk pertumbuhan mikroorganisme yang hanya mengandung garam-garam anorganik. Garrod. sebagai kontrol. Mutan hasil silang balik dengan nisbah keturunan tipe liar : mutan = 1 : 1 dipastikan sebagai mutan dengan hanya satu kelainan (mutasi). konsep satu gen mutan – satu hambatan metabolisme bergeser menjadi satu gen – satu enzim. W. sedangkan polipeptida β merupakan produk gen trpB. Oleh karena itu. yang untuk mendapatkannya dilakukan silang balik dengan strain tipe liar. sinarX atau sinar uv . mutan yang hanya tumbuh pada medium minimal yang ditambah dengan tiamin adalah mutan yang mengalami mutasi pada gen untuk biosintesis tiamin. dan satu macam vitamin. Dengan cara seperti ini Beadle dan Tatum memperlihatkan bahwa tiap mutasi menyebabkan kebutuhan akan pemberian satu macam faktor pertumbuhan. Sebagai contoh. Mutan yang digunakan adalah mutan dengan hanya satu kelainan. yaitu polipeptida α dan polipeptida β. Sebagai contoh. maka konsep terbaru tentang gen yang dianut hingga kini adalah satu gen – satu polipeptida.L. Strain-strain mutan ini kemudian dianalisis lebih lanjut untuk mengetahui macam faktor pertumbuhan yang diperlukannya dengan cara melakukan variasi penambahannya ke dalam medium minimal. sedangkan strain mutan hanya mampu tumbuh pada medium lengkap. Polipeptida α merupakan produk gen trpA. mampu tumbuh baik pada medium lengkap maupun pada medium minimal. G. muncul pertanyaan tentang hakekat sebuah gen : tiap gen menyandi satu protein ataukah tiap gen menyandi satu polipeptida ? Perkembangan konsep tentang gen dapat diikuti semenjak awal abad ke-20 ketika seorang dokter sekaligus ahli biokimia dari Inggris. Selanjutnya.

sitidin trifosfat (CTP). Diagram percobaan yang memperlihatkan satu gen – satu enzim Transkripsi Tahap pertama ekspresi gen adalah transkripsi atau sintesis molekul RNA dari DNA (gen). Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. melainkan RNA polimerase. Adanya sumber basa nitrogen berupa nukleosida trifosfat. untai DNA pasangannya.OH pada suatu nukleotida bereaksi dengan gugus 5’. Gugus 3’. disebut sebagai pita sens.trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). Hanya saja enzim yang bekerja bukannya DNA polimerase.2. Adanya molekul cetakan berupa untai DNA. 3. Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. Bedanya dengan sumber basa untuk DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi tetapi digantikan oleh urasil. Jadi. Jadi. yaitu 1. guanosin trifosfat (GTP). Sintesis RNA mempunyai ciri-ciri kimiawi yang serupa dengan sintesis DNA. dan uridin trifosfat (UTP). 2.spora seksual konidia tipe liar silang balik medium lengkap medium minimal riboflavin piridoksin tiamin asam pantotenat kholin asam folat asam nukleat niasin inositol Gambar 10. yang mempunyai urutan basa sama dengan urutan basa RNA. 4. sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. Meskipun demikian. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). Sementara itu. Reaksi ini jelas sama dengan reaksi polimerisasi DNA. Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. dan disebut sebagai pita antisens. Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada .

Urutan konsensus akan menunjukkan kepada RNA polimerase tempat dimulainya sintesis. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. urutan penyela 5’ ATTAAAGGCTCCTTTTGGAGCCTTTTTTTT T A A T T T C C G A G GA AA A C C T C G G A A AAA A AA 3’ 5’ 3’ DNA transkripsi . maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 10. yang dinamakan tempat awal polimerisasi. 3. Enzim RNA polimerase mengikat untai DNA cetakan pada suatu daerah yang mempunyai urutan basa tertentu sepanjang 20 hingga 200 basa. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. Pada prokariot urutan konsensusnya adalah TATAAT dan disebut kotak Pribnow. dan juga enzim RNA polimerase. 4. promoter selalu membawa suatu urutan basa yang tetap atau hampir tetap sehingga urutan ini dikatakan sebagai urutan konsensus. Terminasi dapat terjadi oleh dua macam sebab. Baik pada prokariot maupun eukariot. Tahap-tahap transkripsi Transkripsi berlangsung dalam empat tahap. Nukleosida trifosfat pertama akan diletakkan di tempat ini dan sintesis RNA pun segera dimulai. Kekuatan pengikatan RNA polimerase oleh promoter yang berbeda sangat bervariasi. Molekul RNA yang baru saja selesai disintesis. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). inisiasi. Masing-masing akan dijelaskan sebagai berikut. elongasi.3. RNA polimerase akan terikat pada suatu tempat di dekat daerah promoter. segera terlepas dari untai DNA cetakan begitu enzim tersebut mencapai urutan basa pengakhir (terminasi). 2. yaitu pengenalan promoter. Di antara keduanya terminasi diri lebih umum dijumpai. Selama sintesis RNA berlangsung RNA polimerase bergerak di sepanjang molekul DNA cetakan sambil menambahkan nukleotida demi nukleotida kepada untai RNA yang sedang diperpanjang. Hal ini mengakibatkan perbedaan kekuatan ekspresi gen. Daerah ini dinamakan promoter. dan teminasi. yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho).kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. sedangkan pada eukariot urutan konsensusnya adalah TATAAAT dan disebut kotak TATA. Setelah mengalami pengikatan oleh promoter. 1.

yaitu modifikasi kedua ujung transkrip primer dan pembuangan urutan basa pada transkrip primer yang tidak akan ditranslasi (disebut intron).3 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. sedangkan ujung 3’ dimodifikasi dengan urutan poliadenosin (poli A) sepanjang lebih kurang 200 basa. panjang intron yang harus dibuang dapat mencapai 50% hingga 90% dari panjang transkrip primer.U U U C C U C G G A A 5’ A U U G G A G C C U U A U 3’ RNA U U U U U U Gambar 10. Sementara itu. pada prokariot produk langsung transkripsi atau transkrip primernya adalah mRNA (akan dijelaskan di bawah). Hanya saja. promoter dapat mengikat RNA polimerase yang lain. Ujung 5’ dimodifikasi dengan penambahan guanosin dalam ikatan 5’-5’ yang tidak umum hingga terbentuk suatu gugus terminal yang dinamakan cap. segmensegmen sisanya (disebut ekson) segera digabungkan menjadi mRNA. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida. Secara umum mekanisme transkripsi pada prokariot dan eukariot hampir sama. tetapi segmen yang mengandung ujung 5’ (gugus cap) tidak pernah dibuang. sedangkan pada eukariot transkrip primernya harus mengalami prosesing RNA terlebih dahulu sebelum menjadi mRNA. Pembuangan intron dan . Prosesing RNA ini mencakup dua peristiwa. Setelah intron dibuang. Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda.

penggabungan ekson menjadi molekul mRNA dinamakan penyatuan RNA atau RNA splicing. Macam-macam RNA Transkripsi DNA menghasilkan molekul RNA yang kemudian akan mengalami diferensiasi struktur sesuai dengan fungsinya masing-masing. Kita mengenal tiga macam RNA, yaitu 1. RNA duta atau messenger RNA (mRNA), yang mempunyai struktur linier kecuali bagian ujung terminasinya yang berbentuk batang dan kala (Gambar 10.3). Molekul mRNA membawa urutan basa yang sebagian di antaranya akan ditranslasi menjadi urutan asam amino. Urutan basa yang dinamakan urutan penyandi (coding sequences) ini dibaca tiga demi tiga. Artinya, tiap tiga basa akan menyandi pembentukan satu asam amino sehingga tiap tiga basa ini dinamakan triplet kodon. Daftar triplet kodon beserta asam amino yang disandinya dapat dilihat pada Tabel 10.1. Pada prokariot bagian mRNA yang tidak ditranslasi terletak di depan urutan penyandi (disebut pengarah atau leader) dan di antara dua urutan penyandi (disebut spacer sequences atau noncoding sequences). Sementara itu, pada eukariot di samping kedua bagian tadi ada juga bagian di dalam urutan penyandi yang tidak ditranslasi. Bagian inilah yang dinamakan intron seperti telah dijelaskan di atas. Molekul mRNA pada prokariot sering kali membawa sejumlah urutan penyandi bagi beberapa polipeptida yang berbeda. Molekul mRNA seperti ini dinamakan mRNA polisistronik. Dengan adanya mRNA polisistronik, sintesis beberapa protein yang masih terkait satu sama lain dapat diatur dengan lebih efisien karena hanya dibutuhkan satu sinyal. Pada eukariot hampir tidak pernah dijumpai mRNA polisistronik. 2. RNA pemindah atau transfer RNA (tRNA), yang strukturnya mengalami modifikasi hingga berbentuk seperti daun semanggi. Seperti halnya struktur ujung terminasi mRNA, struktur seperti daun semanggi ini terjadi karena adanya urutan palindrom yang diselingi oleh beberapa basa (Gambar 10.4). Pada salah satu kalanya, tRNA membawa tiga buah basa yang komplemeter dengan triplet kodon pada mRNA. Ketiga basa ini dinamakan antikodon. Sementara itu, pada ujung 3’-nya terdapat tempat pengikatan asam amino tertentu. Pengikatan yang membentuk molekul aminoasil-tRNA ini terjadi dengan bantuan enzim aminoasil-tRNA sintetase. Dalam hal ini gugus hidroksil (OH) pada ujung 3’ tRNA terikat sangat kuat dengan gugus karboksil (COOH) asam amino. Macam asam amino yang dibawa ditentukan oleh urutan basa pada antikodon. Jadi, ada beberapa macam aminoasil-tRNA sesuai dengan antikodon dan macam asam amino yang dibawanya. antikodon

5’

3’ (tempat pengikatan asam amino) Gambar 10.4. Diagram struktur tRNA

3. RNA ribosomal atau ribosomal RNA (rRNA), yang strukturnya merupakan bagian struktur ribosom. Lebih kurang separuh struktur kimia ribosom berupa rRNA dan separuh lainnya berupa protein. Molekul rRNA, dan juga tRNA, dapat dikatakan sebagai RNA struktural dan tidak ditranslasi menjadi asam amino/protein. Akan tetapi, mereka adalah bagian mesin sel yang menyintesis protein (lihat uraian tentang translasi di bawah ini). Translasi Bila dibandingkan dengan transkripsi, translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel, maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. Empat puluh hingga 60 molekul tRNA yang berbeda 4. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi, elongasi, dan terminasi polipeptida. Translasi, atau pada hakekatnya sintesis protein, berlangsung di dalam ribosom, suatu struktur organel yang banyak terdapat di dalam sitoplasma. Ribosom terdiri atas dua subunit, besar dan kecil, yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). Pada kebanyakan prokariot ribosom mempunyai ukuran 70S, sedangkan pada eukariot biasanya sekitar 80S. Tiap ribosom mempunyai dua tempat pengikatan tRNA, yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A, sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. 1. Molekul mRNA ditranslasi dengan arah 5’→ 3’, tetapi tidak dari ujung 5’ hingga ujung 3’. 2. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil. Sebagai contoh, sintesis protein yang mempunyai urutan NH2-Met-Pro- . . . -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 10.5. Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. Sementara itu, pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA. Selanjutnya, berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya.

Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh, khususnya pada prokariot, akan diberikan di bawah ini. arah gerakan ribosom

ribosom AUC UAG ACC UGG

aa 5’

aa CUG GGG 3’ mRNA

GAC COOH aa tRNA aa NH2 aa NH2 COOH aminoasil-tRNA

ikatan peptida Gambar 10.5. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus, yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet). Hal ini berarti bahwa sintesis semua polipeptida selalu dimulai dengan metionin. Khusus pada prokariot akan terjadi formilasi

suatu enzim yang terikat pada subunit ribosom 50S. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. Terminasi ditandai oleh terlepasnya mRNA. yaitu RF-1 dan RF-2. Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. Selain itu. dan IF-3). tRNA di tapak P.tRNAala. metionil-tRNAfMet. Sebagai contoh. Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. . kedua subunit ribosom pun memisah. serta sebuah molekul GTP. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. baik pada prokariot maupun eukariot. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. IF-2. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. dan subunit kecil ribosom (30S) dengan bantuan protein IF-1. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom. Kompleks inisiasi pada prokariot terbentuk antara mRNA. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi.tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. Triplet kodon berikutnya. yang melibatkan (1) perpindahan f-met-ala. dan IF-3. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom).gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa f-metionin. IF-2. dan rantai polipeptida dari ribosom. Selain itu. kompleks inisiasi bergabung dengan subunit besar ribosom (50S). Selanjutnya. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasil-tRNAfMet berikutnya yang akan masuk ke tapak A. dan metionil-tRNAfMet terikat pada tapak P. Dengan berlangsungnya kedua proses tersebut secara bersamaan. misalnya penyandi serin. Langkah berikutnya adalah translokasi. ke tapak A memerlukan proteinprotein elongasi EF-Ts dan EF-Tu. Pengikatan aminoasil-tRNAfMet berikutnya. misalnya alanil. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin. Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet).

Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma.1. Basa nitrogen pada mRNA hanya ada empat macam. Transkripsi terjadi di dalam nukleus. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. kombinasi dua basa hanya akan menghasilkan 42 atau 16 macam duplet. Salah satu di antaranya seperti telah kita bicarakan di atas. satu macam asam amino dapat disandi oleh lebih dari satu macam triplet kodon. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. Kode genetik Penetapan triplet kodon pada mRNA sebagai pembawa informasi genetik atau kode genetik yang akan menyandi pembentukan suatu asam amino tertentu berawal dari pemikiran bahwa macam basa nitrogen jauh lebih sedikit daripada macam asam amino. sedangkan asam amino ada 20 macam. melebihi jumlah macam asam amino. Tabel 10. jelas tidak mungkin tiap asam amino disandi oleh satu basa. Oleh karena itu. Kombinasi tiga basa akan menghasilkan 43 atau 64 triplet. sedangkan translasi terjadi di sitoplasma (ribosom).ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn on-turn off) ekspresi gen. Kode genetik Basa I (5’) Basa II U Phe Phe Leu Leu Leu Leu Leu Leu ILe Ile ILe Met Val Val Val Val C Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala A Tyr Tyr Stop Stop His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu G Cys Cys Stop Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly U C A G U C A G U C A G U C A G Basa III (3’) U C A G . Begitu juga. seperti yang akan dijelaskan nanti. juga menjadi sangat efisien. tidak demikian halnya pada eukariot. masih lebih sedikit daripada macam amino yang ada. Namun. yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. Dalam hal ini.

yaitu urutan pembacaan basa-basa nitrogen untuk diterjemahkan menjadi urutan asam amino tertentu. Mutasi yang disebabkan oleh perubahan rangka baca akibat kelebihan atau kekurangan pasangan basa disebut sebagai mutasi rangka baca (frameshift mutation) (lihat Bab XI). suatu molekul yang dapat menyisip di sela-sela pasangan basa nitrogen sehingga kesalahan replikasi DNA dapat terjadi sewaktu-waktu. Jika mutan (hasil mutasi) rangka baca yang diinduksi oleh proflavin ditumbuhkan pada medium yang mengandung proflavin. sekali kita menggunakan tanda + untuk mutan adisi berarti strain + adalah mutan adisi.C. strain + tidak harus selalu mutan adisi. Dengan perkataan lain. mutasi balik terjadi karena efek mutasi awal akibat penambahan basa ditekan oleh mutasi kedua akibat pengurangan basa sehingga mutasi yang kedua ini disebut juga sebagai mutasi penekan (suppressor mutation). Akan tetapi. karena mutasi bersifat acak. ketika kedua strain mutan rIIB yang disilangkan merupakan strain-strain yang diseleksi secara acak (tidak harus mengalami mutasi yang berbeda). sekali kita gunakan tanda + untuk mutan delesi berarti strain + adalah mutan delesi. Mutasi tersebut diinduksi oleh proflavin. Perubahan ini dapat berpengaruh atau tidak berpengaruh terhadap fungsi proteinnya. akan diperoleh beberapa fag tipe liar sehingga mutasi seolah-olah dapat dipulihkan atau terjadi mutasi balik (reverse mutation). menghasilkan DNA yang kelebihan atau kekurangan satu pasangan basa. Protein rIIB pada T4 mempunyai bagian-bagian yang di dalamnya dapat terjadi perubahan urutan asam amino. Begitu pula sebaliknya. Namun. Crick dan kawan-kawannya yang mempelajari mutasi pada lokus rIIB bakteriofag T4. Namun. Hal ini akan menyebabkan perubahan rangka baca (reading frame). maka mekanisme semacam itu kecil sekali kemungkinannya untuk terjadi dan dugaan tersebut nampaknya tidak benar. Hasil ini menunjukkan bahwa strain-strain mutan dapat dibagi menjadi dua kelompok. Rangka baca yang baru ini akan menghasilkan urutan asam amino yang masih sama fungsinya dengan urutan sebelum terjadi mutasi. maka T4 tipe liar akan diperoleh sebagai hasil rekombinasi genetik antara kedua tempat mutasi yang berbeda itu. Pada awalnya mutasi balik diduga karena kelebihan pasangan basa dibuang dari rangka baca yang salah sehingga rangka baca tersebut telah diperbaiki menjadi seperti semula. Dalam hal ini. Jika dua strain mutan T4 yang satu sama lain mengalami mutasi berbeda di dalam bagian protein rIIB disilangkan melalui infeksi campuran pada suatu inang.Keterangan : phe = fenilalanin leu = leusin ile = isoleusin met = metionin val = valin ser = serin pro = prolin thr = treonin ala = alanin tyr = tirosin his = histidin gln = glutamin asn = asparagin lys = lisin asp = asam aspartat glu = asam glutamat cys = sistein trp = triptofan arg = arginin gly = glisin AUG (kodon metionin) dapat menjadi kodon awal (start codon) stop = kodon stop (stop codon) Bukti bahwa kode genetik berupa triplet kodon diperoleh dari hasil penelitian F. ternyata tidak selalu diperoleh tipe liar.H. Crick dan kawan-kawannya menjelaskan bahwa mutasi balik disebabkan oleh hilangnya (delesi) satu pasangan basa lain yang letaknya tidak terlalu jauh dari pasangan basa yang menyisip (adisi). dan strain – tidak harus selalu mutan delesi. yaitu strain + dan strain -. .

. Hal ini memperlihatkan bahwa kode genetik terdiri atas tiga basa. maka persilangan teoretis sesama + atau sesama – akan menghasilkan fenotipe mutan. CCC UAG met phe pro lys gly phe pro stop mRNA tipe liar penambahan pasangan basa A=T (mutasi rangka baca I) AUG AUU UCC CAA AGG GUU U . CCC UAG met ile ser lys gly phe pro stop mRNA ‘tipe liar’ urutan asam urutan asam amino tipe liar amino yang berubah Gambar 10. Pemulihan rangka baca akibat mutasi penekan justru terjadi apabila persilangan dilakukan antara strain + dan strain -. persilangan antara starin + dan – akan menyebabkan terjadinya mutasi penekan (adisi ditekan oleh delesi atau delesi ditekan oleh adisi) atau hanya menghasilkan mutasi pada urutan asam amino yang tidak berpengaruh terhadap fungsi protein sehingga diperoleh fenotipe tipe liar. . . . CCU AG . . . Sementara itu.6. kode genetik berupa duplet. . . . sedangkan persilangan antara sesama + atau sesama – tidak pernah menghasilkan tipe liar. Namun. . Seandainya. . AUG UUU CCC AAA GGG UUU .Persilangan antara strain + dan strain – hanya menghasilkan rekombinasi berupa fenotipe tipe liar. . . rekombinasi antara tiga + atau tiga – akan menghasilkan tipe liar. Hal ini karena persilangan sesama + atau sesama – akan menyebabkan adisi atau delesi ganda sehingga selalu menghasilkan fenotipe mutan. mRNA mutan met ile ser gln arg val leu pengurangan pasangan basa G = G(mutasi rangka baca II) AUG AUU UCC AAA GGG UUU . . maka akan terjadi pemulihan rangka baca hasil persilangan tersebut. kode genetik jelas tidak mungkin terdiri atas dua basa. sesuai dengan hasil kenyataannya. Apabila kode genetik berupa triplet. . Mutasi penekan yang memulihkan rangka baca Oleh karena persilangan sesama + atau sesama – tidak pernah menghasilkan tipe liar. Kenyataannya tidak demikian. . .

urutan yang bila berubah tidak berpengaruh urutan yang bila berubah berpengaruh tipe liar AB CD EF GH IJ KL protein tipe liar +1 AB C1 DE FG HI JK +2 AB CD E2 FG HI JK -1 AB DE FG HI JK LM -2 AB CD FG HI JK LM +1 x +2 AB C1 DE 2F GH IJ KL liar -1 x -2 AB CD EF GH IJ KL liar +1 x -1 AB C1 DE FG HI JK mutan MN OP QR ST UV WX LM NO PQ RS TU VW X protein mutan LM NO PQ RS TU VW X protein mutan NO PQ RS TU VW X NO PQ RS TU VW X MN OP QR ST UV WX protein mutan protein mutan protein tipe MN OP QR ST UV WX protein tipe LM NO PQ RS TU VW X protein a) urutan yang bila berubah tidak berpengaruh urutan yang bila berubah berpengaruh tipe liar ABC DEF GHI JKL protein tipe liar +1 AB1 CDE FGH IJK +2 ABC DE2 FGH IJK +3 ABC DEF GHI J3K +1 x +2 AB1 CDE 2FG HIJ mutan +1 x +2 x +3 AB1 protein tipe liar CDE 2FG HIJ 3KL MNO PQR STU VWX LMN OPQ RST UVW X LMN OPQ RST UVW X LMN OPQ RST UVW X protein mutan protein mutan protein mutan protein KLM NOP QRS TUV WX MNO PQR STU VWX .

di dalam suatu segmen tertentu pada DNA dapat terjadi transkripsi dan translasi urutan basa dengan panjang yang berbeda. Kode genetik bersifat universal. yang artinya bahwa basa ketiga dapat berubah-ubah tanpa selalu disertai perubahan macam asam amino yang disandinya. atau berarti juga DNA. Seandainya dari urutan basa ini hanya digunakan sebuah rangka baca. U. Kemudian. Di samping itu. Diketahuinya sifat wobble bermula dari penemuan basa inosin (I) sebagai basa pertama pada antikodon tRNAala ragi. yang ternyata dapat berpasangan dengan basa A. treonin dapat disandi oleh ACU. Oleh karena tiap kodon terdiri atas tiga buah basa. Sebagai contoh. b) Jika kode genetik berupa triplet. Pengaturan Ekspresi Gen Produk-produk gen tertentu seperti protein ribosomal. 3. dan ACG. mempunyai tiga rangka baca yang berbeda (open reading frame). maka akan terdapat sekitar 1700 asam amino yang dapat disintesis. Diagram persilangan mutan rIIB pada T4 yang memperlihatkan bahwa kode genetik berupa triplet kodon a) Jika kode genetik berupa duplet. maka tiap urutan basa mRNA. tRNA. hasil persilangan teoretis tidak sesuai dengan kenyataan yang diperoleh. ACA. dan urutan basa yang diekspresikan (gen) dapat tumpang tindih satu sama lain. Sifat ini erat kaitannya dengan sifat wobble basa ketiga. Dengan demikian. kode genetik berlaku sama hampir di setiap spesies organisme. Sifat-sifat kode genetik Kode genetik mempunyai sifat-sifat yang akan dijelaskan sebagai berikut. bakteriofag фX174 mempunyai sebuah untai tunggal DNA yang panjangnya lebih kurang hanya 5000 basa. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. maka dari sekitar 1700 asam amino tersebut hanya akan terbentuk 4 hingga 5 buah molekul protein. yaitu bahwa satu macam asam amino dapat disandi oleh lebih dari satu triplet kodon. suatu segmen DNA dapat terdiri atas lebih dari sebuah gen yang saling tumpang tindih (overlapping). hasil persilangan teoretis sesuai dengan kenyataan yang diperoleh. RNA polimerase. rRNA. ACC.b) Gambar 10. 1. bakteriofag фX174 mempunyai 11 protein yang secara keseluruhan terdiri atas 2300 asam amino. Dengan demikian. atau pun C. Gen-gen yang menyandi . jelaslah bahwa dari urutan basa DNA yang ada tidak hanya digunakan sebuah rangka baca. satu antikodon pada tRNA dapat mengenali lebih dari satu macam kodon pada mRNA. Dengan perkataan lain. Kode genetik bersifat degenerate atau redundant. Sebagai contoh. Padahal kenyataannya. 2.7. jika sebuah molekul protein rata-rata tersusun dari 400 asam amino. Artinya.

bagi eukariot mekanisme ini nampaknya tidak terlalu penting karena pada organisme ini sel justru cenderung merespon sinyal-sinyal yang datang dari dalam tubuh. Sebagai contoh. Induksi dan represi pada prokariot Escherichia coli merupakan bakteri yang sering dijadikan model untuk mempelajari berbagai mekanisme genetika molekuler. yaitu (1) mekanisme yang melibatkan penyalapadaman (turn on and turn off) ekspresi gen sebagai respon terhadap perubahan kondisi lingkungan dan (2) sirkit ekspresi gen yang telah terprogram (preprogramed circuits). paling banyak terjadi pada tahap transkripsi. Mekanisme penyalapadaman sangat penting bagi mikroorganisme untuk menyesuaikan diri terhadap perubahan lingkungan yang seringkali terjadi secara tiba-tiba. Peristiwa ini berkenaan dengan laju sintesis enzim. Untuk itu. Sebaliknya. khususnya pada prokariot. bukan dengan aktivitas enzim. Apabila suatu ketika E. yaitu ketika tersedia glukosa sebagai sumber karbon.pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. Selain mempunyai kemampuan untuk memecah suatu molekul (katabolisme). Jadi. coli ditumbuhkan pada medium yang sumber karbonnya bukan glukosa melainkan laktosa. produk suatu gen akan menekan transkripsi gen itu sendiri dan sekaligus memacu transkripsi gen kedua. gen-gen penyandi berbagai enzim yang terlibat dalam pemanfaatan laktosa akan diekspresikan (turned on). Mekanisme pengaturan transkripsi. Pada mekanisme sirkit. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. Namun. atau translasi. sistem sirkulasi akan menjadi penyangga bagi sel terhadap perubahan kondisi lingkungan yang mendadak tersebut. maka enzim pemecah laktosa akan disintesis. sedangkan zat atau molekul yang menyebabkan terjadinya induksi disebut sebagai induser. Sementara itu. bakteri juga dapat menyintesis (anabolisme) berbagai molekul organik yang diperlukan bagi pertumbuhannya. Dalam medium pertumbuhan yang tidak . bukan peningkatan laju sintesisnya. Bakteri ini secara alami hidup di dalam usus besar manusia dengan memanfaatkan sumber karbon yang umumnya berupa glukosa. dalam keadaan normal. Ekspresi gen yang berurutan ini telah terprogram secara genetik sehingga gen-gen tersebut tidak akan dapat diekspresikan di luar urutan. Induksi secara molekuler terjadi pada tingkat transkripsi. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. sesuatu yang tidak biasa dilakukannya. prosesing mRNA. dan di sisi lain. demikian seterusnya. Pada pengaktifan enzim suatu molekul kecil akan terikat pada enzim sehingga akan terjadi peningkatan aktivitas enzim tersebut. secara garis besar dapat dibedakan menjadi dua kategori utama. baik pada prokariot maupun pada eukariot. maka mekanisme tersebut dinamakan sirkit ekspresi gen. Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. produk gen kedua akan menekan transkripsi gen kedua dan memacu transkripsi gen ketiga. Oleh karena urutan ekspresinya berupa sirkit. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. misalnya transkripsi. Salmonella typhimurium mempunyai sejumlah gen yang menyandi enzim-enzim untuk biosintesis triptofan. Sebaliknya. dalam contoh ini laktosa merupakan induser. maka gen-gen tersebut tidak diekspresikan (turned off). Proses yang terjadi ketika ekspresi gen merupakan respon terhadap keberadaan suatu zat di lingkungannya dikenal sebagai induksi.

Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. molekul protein represor yang dihasilkan oleh gen regulator. Seperti halnya induksi. sedangkan pada represi adalah korepresor. atau bahkan tumpang tindih. sedangkan zat yang menyebabkan terjadinya represi disebut sebagai korepresor. Jacob dan J. typhimurium akan mengekspresikan (turned on) gen-gen tersebut. maka gen-gen tersebut tidak perlu diekspresikan (turned off). Jadi. yaitu penghambatan aktivitas enzim akibat pengikatan produk akhir reaksi yang dikatalisis oleh enzim itu sendiri. represi juga terjadi pada tahap transkripsi. tetapi menekan laju sintesisnya. Di luar operon terdapat gen regulator (R) beserta promoternya (PR). S. Monod pada tahun 1961. Akan tetapi. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). Represi tidak menghambat aktivitas enzim. Model operon Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model yang diajukan oleh F. dan gen-gen struktural (GS). Pada kondisi tertentu represor akan berikatan dengan operator. Proses pemadaman (turn off) ekspresi gen sebagai respon terhadap keberadaan suatu zat di lingkungannya dinamakan represi. Represi sering dikacaukan dengan inhibisi umpan balik (feedback inhibition). jika suatu saat ke dalam medium pertumbuhannya ditambahkan triptofan. dengan operator. operator (O). operon PR R PO O GS1 GS2 GS3 represor a) efektor (induser atau korepresor) RNA polimerase induser RNA polimerase berjalan . Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan.mengandung triptofan. menyebabkan terhalangnya transkripsi gen-gen struktural. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. dan molekul efektor. dalam contoh ini triptofan merupakan korepresor. Molekul efektor pada induksi adalah induser.

RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang.8. dengan adanya korepresor. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor. dengan terikatnya represor oleh induser.8 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Pada Gambar 10. gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas. Akan tetapi. Salah satu contohnya adalah operon lac. . transkripsi gen-gen struktural tidak dapat berlangsung. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi. Sebaliknya. Namun. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator.transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 10. Akibatnya. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon. Jadi. Dengan demikian. promoter operon menjadi terbuka bagi RNA polimerase sehingga gengen struktural dapat ditranskripsi dan selanjutnya ditranslasi. Dengan pengikatan ini.

Semua mRNA pada eukariot tingkat tinggi adalah monosistronik. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. Sebagai contoh.Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. Dosis gen dan amplifikasi gen Kebutuhan akan produk-produk gen pada eukariot dapat sangat bervariasi. Selain itu. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. Operon. Operon trp. yaitu hanya membawa urutan sebuah gen struktural. . kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. terindikasi juga bahwa diferensiasi sel sedikit banyak melibatkan ekspresi seperangkat gen yang telah terprogram (preprogramed). Jadi. molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. memegang peran yang sangat penting dalam proses diferensiasi sel. Namun. nampaknya tidak begitu penting pada eukariot. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau mirip operon. kalau pun ada. Untuk menyintesis histon dalam jumlah besar yang dibutuhkan dalam pembentukan kromatin. dan juga prosesing mRNA. Demikian pula. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. Produk gen A dapat 20 kali lebih banyak daripada produk gen B apabila terdapat 20 salinan (kopi) gen A untuk setiap salinan gen B. Dengan perkataan lain. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. ada gen A dan gen B yang ditranskripsi dan ditranslasi dengan efisiensi yang sama. Katakanlah. Contoh yang nyata dapat dilihat pada gen-gen penyandi histon. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. mRNA di dalam selsel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. hormon. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. Untuk memenuhi nisbah kebutuhan ini antara lain dapat ditempuh melalui dosis gen. Beberapa produk gen dibutuhkan dalam jumlah yang jauh lebih besar daripada produk gen lainnya sehingga terdapat nisbah kebutuhan di antara produk-produk gen yang berbeda. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi.

Sebagai contoh. coli. (2) mRNA semiprevalen dengan jumlah salinan lebih dari satu hingga beberapa ratus per sel. Jika waktu yang tersedia untuk melakukan sintesis sejumlah besar protein cukup banyak. Setelah kompleks ini terbentuk biasanya reseptor akan mengalami modifikasi struktur kimia. Molekul rRNA tidak diperlukan lagi ketika oosit telah matang hingga saat terjadinya fertilisasi. Cara lain untuk mengatasi kebutuhan protein tersebut adalah dengan meningkatkan masa hidup mRNA (lihat bagian pengaturan translasi). yaitu peningkatan jumlah gen sebagai respon terhadap sinyal tertentu. Secara garis besar pengaturan transkripsi oleh hormon dimulai dengan masuknya hormon ke dalam sel target melewati membran sel. Namun. dan (3) mRNA superprevalen dengan jumlah salinan beberapa ratus hingga beberapa ribu per sel. yaitu (1) mRNA salinan tunggal (single copy). Pengaturan transkripsi Berdasarkan atas banyaknya salinan di dalam tiap sel. amplifikasi gen terjadi selama perkembangan oosit katak Xenopus laevis. amplifikasi gen sebenarnya tidak perlu dilakukan. mRNA superprevalen biasanya dihasilkan sejalan dengan terjadinya perubahan di dalam suatu tahap perkembangan organisme eukariot. sel-sel prekursor tidak mempunyai gen penyandi rRNA dalam jumlah yang mencukupi untuk sintesis molekul tersebut dalam waktu yang relatif singkat. Padahal. Di sisi lain. Mekanisme kerja hormon dalam mengatur transkripsi eukariot lebih kurang dapat disetarakan dengan induksi pada prokariot. . Jika sebelum amplifikasi ke-600 gen rRNA berada di dalam satu segmen DNA linier. Kita mengetahui bahwa ribosom antara lain terdiri atas molekulmolekul rRNA. Namun. Salah satu pengaruh dosis gen adalah amplifikasi gen. Pembentukan oosit dari prekursornya (oogonium) merupakan proses kompleks yang membutuhkan sejumlah besar sintesis protein. sel-sel eritroblas di dalam sumsum tulang belakang mempunyai sejumlah besar mRNA yang dapat ditranslasi menjadi globin matang. hanya sedikit sekali atau bahkan tidak ada globin yang dihasilkan oleh sel-sel prekursor yang belum berkembang menjadi eritroblas. yang kemudian ditangkap oleh reseptor khusus yang terdapat di dalam sitoplasma sehingga terbentuk kompleks hormon-reseptor. Sementara itu. molekul mRNA dapat dibagi menjadi tiga kelompok. Untuk itu dibutuhkan sejumlah besar ribosom. molekul protein kecil yang dibawa dari sel tertentu menuju ke sel target. Dengan demikian. maka selama dan setelah amplifikasi gen tersebut akan berada di dalam gulungan-gulungan kecil yang mengalami replikasi. sejalan dengan perkembangan oosit terjadi peningkatan jumlah gen rRNA hingga 4000 kali sehingga dari sebanyak 600 gen yang ada pada prekursor akan diperoleh sekitar dua juta gen setelah amplifikasi.kebanyakan sel mempunyai beratus-ratus kali salinan gen histon daripada jumlah salinan gen yang diperlukan untuk replikasi DNA. Oleh karena itu. gen rRNA yang telah begitu banyak disalin kemudian didegradasi kembali oleh berbagai enzim intrasel. kita dapat memastikan adanya suatu mekanisme pengaturan ekspresi gen penyandi mRNA superprevalen pada tahap transkripsi eukariot meskipun hingga kini belum terlalu banyak rincian prosesnya yang dapat diungkapkan. Salah satu regulator yang diketahui berperan dalam transkripsi eukariot adalah hormon. Sebagai contoh. Molekul mRNA salinan tunggal dan semiprevalen masing-masing menyandi enzim dan protein struktural. penetrasi hormon ke dalam sel target dan pengangkutannya ke dalam nukleus merupakan proses yang jauh lebih rumit bila dibandingkan dengan induksi oleh laktosa pada E.

Proses selanjutnya belum banyak diketahui. . tetapi rupanya di dalam nukleus kompleks tersebut. Macam-macam pengaturan tersebut adalah (1) kondisi bahwa mRNA tidak akan ditranslasi sama sekali sebelum datangnya suatu sinyal. laju sintesis protein menjadi sangat rendah. misalnya. Pengaturan pada tahap prosesing mRNA Dua jenis sel yang berbeda dapat membuat protein yang sama tetapi dalam jumlah yang berbeda meskipun transkripsi di dalam kedua sel tersebut terjadi pada gen yang sama. dan (3) pengaturan laju seluruh sintesis protein. (2) pengikatan pada suatu protein efektor. Kelenjar ludah menghasilkan α-amilase lebih banyak daripada yang dihasilkan oleh jaringan hati meskipun gen yang ditranskripsi sama. Telur yang tidak dibuahi secara biologi bersifat statis. Hal ini karena sel-sel atau jaringan lainnya tidak mempunyai reseptor hormon estrogen di dalam sitoplasmanya. sejumlah protein akan disintesis. Pada tikus. (3) aktivasi protein yang terikat DNA. akan mengalami salah satu di antara beberapa peristiwa. melainkan karena terbatasnya ketersediaan suatu unsur yang dinamakan faktor rekrutmen. khususnya pada penyatuan (splicing) mRNA. Fenomena ini seringkali berkaitan dengan adanya molekul-molekul mRNA yang berbeda. Dengan demikian. dan hanya sel-sel oviduktus yang akan menyintesis mRNA tersebut. Contoh induksi transkripsi oleh hormon antara lain dapat dilihat pada stimulasi sintesis ovalbumin pada saluran telur (oviduktus) ayam oleh hormon kelamin estrogen. yaitu (1) pengikatan langsung pada DNA. Namun. sedangkan molekul mRNA yang belum ditranslasi itu dinamakan mRNA tersembunyi (masked mRNA). begitu fertilisasi terjadi. Sel telur ini akan mempertahankan diri untuk tidak mengalami pertumbuhan atau perkembangan. Jadi. Hingga kini belum diketahui hakekat unsur tersebut. Jika ayam disuntik dengan estrogen. yang akan ditranslasi dengan efisiensi berbeda pula. Pengaturan translasi Berbeda dengan translasi mRNA pada prokariot yang terjadi dalam jumlah yang lebih kurang sama. dalam hal ini transkrip primernya sebenarnya sama. ditemukan bahwa perbedaan sintesis enzim α-amilase oleh berbagai mRNA yang berasal dari gen yang sama dapat terjadi karena adanya perbedaan pola pembuangan intron. jaringan-jaringan oviduktus akan memberikan respon berupa sintesis mRNA untuk ovalbumin. (4) inaktivasi represor. tetapi rupanya berperan dalam pembentukan kompleks ribosom-mRNA. Sinyal tersebut tidak lain adalah fertilisasi oleh spermatozoon. Hal ini menunjukkan bahwa di dalam sel telur yang belum dibuahi akan dijumpai sejumlah mRNA yang menantikan datangnya sinyal untuk translasi. Akan tetapi. pada eukariot ada mekanisme pengaturan translasi. atau mungkin hormonnya saja. hal ini bukan akibat kurangnya pasokan mRNA. dan (5) perubahan struktur kromatin agar DNA terbuka bagi enzim RNA polimerase. Sintesis ini akan terus berlanjut selama estrogen diberikan. (2) pengaturan umur (lifetime) molekul mRNA. Pengaturan umur mRNA juga dijumpai pada telur yang belum dibuahi. tetapi kemudian ada perbedaan mekanisme prosesing.Kompleks hormon-reseptor yang termodifikasi kemudian menembus dinding nukleus untuk memasuki nukleus.

11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar MATERI GENETIK BAB IX MATERI GENETIK       Pembuktian DNA sebagai Materi Genetik Pembuktian RNA sebagai Materi Genetik pada Virus Tertentu Model Struktur Molekul DNA menurut Watson-Crick Tiga Fungsi Materi Genetik Replikasi Semi Konservatif Replikasi Θ dan Replikasi Lingkaran Menggulung BAB IX. tetapi ada kondisi yang dapat disetarakan dengannya. MATERI GENETIK Pada tahun 1868 seorang mahasiswa kedokteran di Swedia.F. waktu itu fungsinya sama sekali belum diketahui. Tiap protein ini dapat dilihat sebagai produk satu gen tunggal. Dalam sistem semacam itu urutan penyandi pada masing-masing gen tidak saling dipisahkan oleh kodon stop dan kodon awal. Jadi. Meskipun ternyata asam nukleat selalu dapat diisolasi dari nukleus berbagai macam sel. Zat ini diisolasi dari nukleus sel nanah manusia dan kemudian dikenal dengan nama nuklein atau asam nukleat. konsentrasi suatu jenis molekul antibodi dipertahankan konstan oleh mekanisme inhibisi atau penghambatan diri dalam proses translasi. tetapi dipisahkan oleh urutan asam amino tertentu yang dikenal sebagai tempat pemotongan (cleavage sites) oleh enzim protease tertentu. Sebagai contoh. pada eukariot tidak pernah dijumpai mRNA polisistronik. J. yakni sintesis poliprotein.Sintesis beberapa protein tertentu diatur oleh aktivitas protein itu sendiri terhadap mRNA. Poliprotein adalah polipeptida berukuran besar yang setelah berakhirnya translasi akan terpotong-potong untuk menghasilkan sejumlah molekul protein yang utuh. tetapi bergantian mengikuti suatu urutan. molekul antibodi tersebut berikatan secara khusus dengan molekul mRNA yang menyandinya sehingga inisiasi translasi akan terhambat. menemukan suatu zat kimia bersifat asam yang banyak mengandung nitrogen dan fosfor. Miescher. Sintesis beberapa protein dari satu segmen DNA Pada prokariot terdapat mRNA polisistronik yang menyandi semua produk gen. Sebaliknya. . Tempattempat pemotongan ini tidak akan berfungsi serempak.

Bakteri penyebab penyakit pneumonia ini dapat menyintesis kapsul polisakarida yang akan melindunginya dari mekanisme pertahanan tubuh hewan yang terinfeksi sehingga bersifat virulen (menimbulkan penyakit). Strain mutan ini akan membentuk koloni dengan kenampakan kasar apabila ditumbuhkan pada medium padat. ada pula strain mutan pneumokokus yang kehilangan kemampuan untuk menyintesis kapsul polisakarida sehingga menjadi tidak tahan terhadap sistem kekebalan tubuh hewan inangnya. Sementara itu. Dugaan DNA sebagai materi genetik secara tidak langsung sebenarnya dapat dibuktikan dari kenyataan bahwa hampir semua sel somatis pada spesies tertentu mempunyai kandungan DNA yang selalu tetap. yaitu asam deoksiribonukleat atau deoxyribonucleic acid (DNA) dan asam ribonukleat atau ribonucleic acid (RNA). dan dari organ paru-parunya dapat diisolasi strain S tersebut. Griffith pada tahun 1928 melakukan percobaan infeksi bakteri pneumokokus (Streptococcus pneumonia) pada mencit.Dari hasil analisis kimia yang dilakukan sekitar empat puluh tahun kemudian ditemukan bahwa asam nukleat ada dua macam. Namun. sedangkan kandungan RNA dan proteinnya berbeda-beda antara satu sel dan sel yang lain. nukleus hasil meiosis baik pada tumbuhan maupun hewan mempunyai kandungan DNA separuh kandungan DNA di dalam nukleus sel somatisnya. . Demikian juga. DNA sebagai Materi Genetik Ada dua bukti percobaan yang menunjukkan bahwa DNA adalah materi genetik. pada pertengahan tahun 1940-an terbukti bahwa justru DNA-lah yang merupakan materi genetik pada sebagian besar organisme. Oleh karena itu. Hasil yang mengundang pertanyaan adalah ketika mencit diinfeksi dengan campuran antara strain S yang telah dipanaskan dan strain R yang masih hidup. yang waktu itu telah diketahui sebagai organel pembawa gen (materi genetik). Meskipun demikian. selama bertahun-tahun protein lebih diyakini sebagai materi genetik. dan dari organ paru-parunya dapat diisolasi strain S yang masih hidup. mencit yang diinfeksi dengan strain S yang sebelumnya telah dipanaskan terlebih dahulu akan dapat bertahan hidup. bakteri pneumokokus akan membentuk koloni dengan kenampakan halus mengkilap. sedangkan strain mutannya yang tidak virulen dilambangkan dengan R. Mencit yang diinfeksi dengan pneumokokus S akan mengalami kematian. Jika ditumbuhkan pada medium padat. sementara DNA hanya merupakan kerangka struktur kromosom. Ternyata dengan perlakuan ini mencit mengalami kematian. dan akibatnya tidak bersifat virulen. dalam kurun waktu yang cukup lama fakta semacam itu tidak cukup kuat untuk meyakinkan bahwa DNA adalah materi genetik. Hal ini terutama karena dari hasil analisis kimia secara kasar terlihat kurangnya variasi kimia pada molekul DNA. protein dengan variasi kimia yang tinggi sangat memenuhi syarat sebagai materi genetik. DNA atau protein. Di samping itu. Sebaliknya. mencit yang diinfeksi dengan strain R dapat bertahan hidup. Masingmasing akan diuraikan berikut ini. selain DNA di dalam kromosom juga terdapat protein sehingga muncul perbedaan pendapat mengenai hakekat materi genetik. Percobaan transformasi F. Pada tahun 1924 studi mikroskopis menunjukkan bahwa DNA terdapat di dalam kromosom. Akan tetapi. Di sisi lain. Pneumokokus yang virulen sering dilambangkan dengan S.

McCarty melakukan percobaan untuk mengetahui hakekat materi yang dipindahkan dari strain S ke strain R. dan M. yaitu dengan menambahkan ekstrak DNA dari strain S yang telah mati kepada strain R yang ditumbuhkan di medium padat. yakni O. Avery. Hal ini jelas membuktikan bahwa materi yang bertanggung jawab atas terjadinya transformasi pada bakteri pneumonia. strain R tidak berubah menjadi strain S. maka transformasi tidak terjadi. Artinya. jika enzim yang diberikan adalah DNase (pemecah DNA). bukan RNA atau protein. Transformasi terjadi karena ada sesuatu yang dipindahkan dari selsel strain S yang telah mati (dipanaskan) ke strain R yang masih hidup sehingga strain R yang semula tidak dapat membentuk kapsul berubah menjadi strain S yang dapat membentuk kapsul dan bersifat virulen. Di dalam ekstrak DNA ini terdapat juga sejumlah protein kontaminan. Diagram percobaan transformasi yang membuktikan DNA sebagai materi genetik Percobaan infeksi bakteriofag . dan ternyata juga pada hampir semua organisme. Namun.Dengan hasil tersebut Griffith menyimpulkan bahwa telah terjadi perubahan (transformasi) sifat strain R menjadi S. pada tahun 1944 tiga orang peneliti. transformasi tetap berjalan atau strain R berubah juga menjadi S. C. adalah DNA. Mereka melakukan percobaan transformasi secara in vitro. MacLeod. dan penambahan tersebut ternyata menyebabkan strain R berubah menjadi S seperti pada percobaan Griffith.1. Akan tetapi. Percobaan Griffith sedikit pun tidak memberikan bukti tentang materi genetik. Jika pada percobaan Avery dan kawan-kawannya itu ditambahkan enzim RNase (pemecah RNA) atau enzim protease (pemecah protein). kultur strain S ekstraksi DNA ekstrak DNA + protein kontaminan ditambahkan ke kultur strain R protease kultur strain R RNase kultur strain R DNase kultur strain R strain R + S strain R + S strain R Gambar 9.

yang umumnya banyak mengandung sulfur tetapi tidak mengandung fosfor dilabeli dengan radioisotop 35S. Daur hidup bakteriofag T2 dan diagram percobaan infeksi T2 pada E. Percobaan dilakukan dengan mengamati reproduksi bakteriofag (virus yang menyerang bakteri) T2 di dalam sel bakteri inangnya. Dengan sentrifugasi. Sebelumnya. RNA sebagai Materi Genetik pada Beberapa Virus . coli adalah materi yang dilabeli dengan 32P atau DNA. Hasil percobaan ini jelas menunjukkan bahwa materi genetik yang dimasukkan oleh bakteriofag T2 ke dalam sel E. Hershey dan M. Akhirnya. coli ini kemudian dipisahkan dari partikel-partikel T2 yang sudah tidak melekat lagi pada dinding selnya. bukannya protein. Bakteriofag T2 diketahui mempunyai kandungan protein dan DNA dalam jumlah yang lebih kurang sama. maka di dalam sel-sel E. materi genetik masuk dilabeli dengan 35S dan 32P ke sel inang banyak didapatkan 35 S sel inang lisis banyak Gambar 9. DNA yang sangat banyak mengandung fosfor tetapi tidak mengandung sulfur dilabeli dengan radioisotop 32P. Untuk memastikan sifat kimia materi genetik yang dimasukkan ke dalam sel inang dilakukan pelabelan terhadap molekul protein dan DNAnya. diikuti oleh masuknya materi genetik T2 ke dalam sel E. yaitu Escherichia coli. partikel-partikel T2 yang keluar akan mencari sel inang yang baru. coli ditemukan banyak sekali radiosiotop 32P. Mula-mula partikel T2 melekatkan ujung ekornya pada dinding sel E. sel E. Apabila dengan cara yang sama digunakan bakteriofag T2 yang dilabeli DNAnya. sel-sel E. coli. coli akan mengalami lisis.Percobaan lain yang membuktikan bahwa DNA adalah materi genetik dilaporkan pada tahun 1952 oleh A. coli yang membuktikan DNA sebagai materi genetik didapatkan 32 P Bakteriofag T2 dengan protein yang telah dilabeli diinfeksikan pada E.2. Chase. Ketika hasil penggandaan partikel T2 telah mencapai jumlah yang sangat besar. coli. coli sehingga memungkinkan terjadinya penggandaan partikel T2 di dalam sel inangnya itu. dan siklus reproduksi tadi akan terulang kembali. coli sangat sedikit ditemukan radioisotop 35S. coli telah diketahui (lihat Bab XII). Sebaliknya. sedangkan pada partikel-partikel T2 hanya ada sedikit sekali radioisotop tersebut. Protein. sedangkan pada partikel-partikel T2 masih banyak didapatkan radioisotop tersebut. Ternyata di dalam sel-sel E. cara berlangsungnya infeksi T2 pada E.

Tiap nukleotida terdiri atas tiga komponen. Pada DNA basa nitrogen berikatan secara kimia dengan gula pentosa membentuk molekul yang disebut nukleosida sehingga setiap nukleotida pada DNA dapat disebut juga sebagai nukleosida monofosfat. Percobaan yang membuktikan RNA sebagai materi genetik pada TMV = TMV strain A = TMV strain B rekonstitusi infeksi ke daun tembakau RNA dari strain A direkonstitusi dengan protein strain B. penomoran atom C pada gula pentosa dilakukan menggunakan tanda aksen (’) untuk membedakannya dengan penomoran atom C pada basa nitrogen. RNA dari strain B direkonstitusi dengan protein dari strain A. Singer pada tahun 1957. Virus ini mengandung molekul RNA yang terbungkus di dalam selubung protein. Untuk memastikan di antara kedua makromolekul tersebut yang berperan sebagai materi genetik. Oleh karena itu. Dengan perlakuan kimia tertentu molekul RNA dapat dipisahkan dari selubung proteinnya untuk kemudian digabungkan (direkonstitusi) dengan selubung protein dari strain TMV yang lain. bukan protein. sedangkan pada RNA adalah ribosa. Menurut kebiasaan. TMV hasil penggandaan ternyata merupakan strain A jika RNAnya berasal dari strain A dan merupakan strain B jika RNAnya berasal dari strain B. Jadi. adalah RNA. gula pentosa (gula dengan lima atom karbon). yaitu virus yang menyebabkan timbulnya penyakit mozaik pada daun tembakau. seperti halnya TMV. Mereka melakukan penelitian pada virus mozaik tembakau atau tobacco mozaic virus (TMV). antara lain telah dilakukan percobaan rekonstitusi yang dilaporkan oleh H. Fraenkel-Conrat dan B. Komposisi Kimia Asam Nukleat Hasil analisis kimia asam nukleat menunjukkan bahwa makromolekul ini tersusun dari subunit-subunit berulang (monomer) yang disebut nukleotida sehingga asam nukleat dapat juga dikatakan sebagai polinukleotida. yaitu gugus fosfat.3. Atom C pada gula pentosa yang berikatan dengan basa nitrogen ditentukan sebagai atom C pertama . protein RNA pemisahan RNA dari protein Gambar 9. dapat disimpulkan bahwa materi genetik pada virus-virus yang tidak mempunyai DNA. tetapi hanya tersusun dari RNA dan protein. dan basa nukleotida atau basa nitrogen (basa siklik yang mengandung nitrogen). Gula pentosa pada DNA adalah 2-deoksiribosa.Beberapa virus tertentu diketahui tidak mempunyai DNA. faktor yang menentukan strain hasil penggandaan adalah RNA. Nukleotida yang satu dengan nukleotida berikutnya dihubungkan oleh ikatan fosfodiester yang sangat kuat. Kedua TMV hasil rekonstitusi ini kemudian diinfeksikan ke inangnya (daun tembakau) agar mengalami penggandaan. Sebaliknya.

sedangkan RNA adalah polinukleotida untai tunggal.(1’). Pada RNA tidak terdapat basa timin. sedangkan basa pirimidin pada DNA dapat berupa sitosin (C) atau timin (T). tetapi mengikat gugus H sehingga gula pentosanya dinamakan deoksiribosa. Biasanya DNA mempunyai struktur sebagai molekul polinukleotida untai ganda. dapat berupa adenin (A) atau guanin (G). baik pada DNA maupun RNA. O O O P=O gugus fosfat 5’CH2OH OH 4’ H 3’ H O 5’CH2OH OH 1’ H H 4’ H 3’ H O 1’ H 2’ H 2’ OH H OH OH gula ribosa gula 2-deoksiribosa NH2 O . Sementara tu. Atom C nomor 2’ pada DNA tidak mengikat gugus OH seperti halnya pada RNA. Ini merupakan perbedaan lain di antara kedua macam asam nukleat tersebut. yakni basa dengan cincin rangkap atau disebut purin dan basa dengan cincin tunggal atau disebut pirimidin. tetapi diganti dengan urasil (U). basa nitrogen ada dua macam. Basa purin.

Crick. Dengan sendirinya. Komponen kimia asam nukleat Model Struktur DNA Watson-Crick Model struktur fisik molekul DNA pertama kali diajukan pada tahun 1953 oleh J. konsentrasi basa purin total menjadi sama dengan konsentrasi basa pirimidin total.4.H.C.N N 1 H 2 3 N adenin 4 N H 9 6 5 7 8 H N H N 1 NH2 2 3 N guanin 4 N H 9 6 5 7 8 H NH2 4 N3 5 H H O 4 N3 5 CH3 H O 4 N3 5 H 2 O 1 6 H 2 O 1 6 NH H 2 O 1 6 H NH NH sitosin timin urasil Gambar 9. Akan tetapi.D. Ada dua dasar yang digunakan dalam melakukan deduksi terhadap model tersebut. Hasil analisis kimia yang dilakukan oleh E. Chargaff terhadap kandungan basa nitrogen molekul DNA dari berbagai organisme selalu menunjukkan bahwa konsentrasi adenin sama dengan timin. Watson dan F. sedangkan guanin sama dengan sitosin. . yaitu 1. nisbah konsentrasi adenin + timin terhadap konsentrasi guanin + sitosin sangat bervariasi dari spesies ke spesies.

4 Å dengan pasangan basa berikutnya. R. maka urutan basa pada untai lainnya dapat ditentukan pula. Satu sama lain arahnya sejajar tetapi berlawanan (antiparalel). Di ujung lainnya atom C nomor 5’ akan mengikat gugus fosfat sehingga ujung ini dinamakan ujung 5’ atau ujung P. dan terjadi ikatan hidrogen antara basa A pada satu untai dan basa T pada untai lainnya. basa G pada satu untai selalu berpasangan dengan basa C pada untai lainnya melalui ikatan hidrogen. dan para koleganya menunjukkan bahwa basabasa nitrogen tersusun vertikal di sepanjang sumbu molekul dengan interval 3. sedangkan antara basa G dan C yang berpasangan terdapat ikatan hidrogen rangkap tiga. Ikatan ini menghubungkan atom C nomor 3’ dengan atom C nomor 5’ pada gula deoksiribosa. Wilkins. Basa-basa nitrogen menghadap ke arah dalam sumbu. Oleh karena itu. atom C nomor 3’ tidak lagi dihubungkan oleh ikatan fosfodiester dengan nukleotida berikutnya. begitu urutan basa pada satu untai polinukleotida diketahui. Setiap pasangan basa berjarak 3. ujung ini dinamakan ujung 3’ atau ujung OH. Pola difraksi yang diperoleh dari hasil pemotretan molekul DNA menggunakan sinar X oleh M. Di salah satu ujung untai polinukleotida.2. Hal ini menyebabkan nisbah A+T terhadap G+C mempengaruhi stabilitas molekul DNA.4 Å.F. maka untai komplementernya mempunyai arah dari ujung 3’ ke 5’. Oleh karena itu. Menurut model ini kedua untai polinukleotida saling memilin di sepanjang sumbu yang sama. OH(3’) P(5’) P P P . Begitu pula. dan begitu pula sebaliknya.H. tetapi akan mengikat gugus OH. nukleotida-nukleotida yang berurutan dihubungkan oleh ikatan fosfodiester. Antara basa A dan T yang berpasangan terdapat ikatan hidrogen rangkap dua. makin rendah stabilitas molekul DNAnya. Kedudukan antiparalel di antara kedua untai polinukleotida sebenarnya dilihat dari ujung-ujung ini. Seperti telah disebutkan di atas. Di dalam satu kali pilinan (360°) terdapat 10 pasangan basa. Gugus fosfat dan gula terletak di sebelah luar sumbu. Makin tinggi nisbah tersebut. Jika untai yang satu mempunyai arah dari ujung 5’ ke 3’. Dari data kimia Chargaff serta difraksi sinar X Wilkins dan Franklin tersebut Watson dan Crick mengusulkan model struktur DNA yang dikenal sebagai model tangga berpilin (double helix). Adanya perpasangan yang khas di antara basa-basa nitrogen itu menyebabkan kedua untai polinukleotida komplementer satu sama lain. Franklin.

3. Fungsi ini merupakan fungsi fenotipik. dari generasi ke generasi. kita akan melihat fungsi yang harus dapat dilaksanakan oleh molekul tersebut sebagai materi genetik. Dalam beberapa dasawarsa pertama semenjak gen dikemukakan sebagai faktor yang diwariskan dari generasi ke generasi.5 Diagram struktur molekul DNA = adenin = timin = guanin = sitosin Fungsi Materi Genetik Setelah terbukti bahwa DNA merupakan materi genetik pada sebagian besar organisme. Bagian setelah ini akan membahas replikasi DNA. 1. harus dapat menjalankan tiga fungsi pokok berikut ini. Artinya. yang dilaksanakan melalui ekspresi gen (Bab X). yang dilaksanakan melalui replikasi. . Fungsi ini merupakan fungsi genotipik. Materi genetik harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya. Fungsi ini merupakan fungsi evolusioner. evolusi tidak akan pernah berlangsung.P P P P P P(5’) OH(3’) = gula Gambar 9. yang sekarang ternyata adalah DNA. yang dilaksanakan melalui peristiwa mutasi (Bab XI). Meskipun demikan. Materi genetik harus mengatur perkembangan fenotipe organisme. materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. Tanpa perubahan semacam ini. sifat-sifat molekulernya baru sedikit sekali terungkap. ketika itu telah disepakati bahwa gen sebagai materi genetik. 2. Materi genetik sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah.

yaitu konservatif. Sementara itu. pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat. Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru. Kemudian. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru. dan dispersif. masing-masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. semikonservatif. Namun. Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah.Replikasi DNA Ada tiga cara teoretis replikasi DNA yang pernah diusulkan. .

basa-basa nitrogen pada molekul DNA sel-sel bakteri tersebut akan memiliki 15N yang berat. kerapatan DNA E.S.700 g/cm3. maka Meselson dan Stahl dapat mengikuti perubahan tingkat kerapatan DNA sel-sel bakteri E. pada generasi 14N yang pertama.6.724 g/cm3. sedangkan kerapatan larutan 6M CsCl adalah 1. atau disebut sebagai generasi 1. Selanjutnya. Mereka menumbuhkan bakteri Escherichia coli selama beberapa generasi di dalam medium yang mengandung isotop nitrogen 15N untuk menggantikan isotop nitrogen normal 14N yang lebih ringan. DNAnya merupakan hibrid . Akibatnya. maka akan terjadi keseimbangan tingkat kerapatan.000 hingga 50. coli yang semula ditumbuhkan pada medium 15N selama beberapa generasi. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation. DNA yang diekstrak dari sel E. dalam waktu 48 hingga 72 jam. DNA yang diekstrak dari sel E.708 g/cm3 dan 1.coli telah ditumbuhkan selama beberapa generasi pada medium 14 N. DNAnya nampak makin banyak berada di bagian atas tabung. Meselson dan Stahl menjelaskan bahwa pada generasi 15 N. DNAnya mempunyai kerapatan tinggi. Molekul DNA dengan basa nitrogen yang mengandung 15N mempunyai tingkat kerapatan (berat per satuan volume) yang lebih tinggi daripada DNA normal (14N). Pada generasi kedua setelah E.coli yang pertama kali dipindahkan kembali ke medium 14N terlihat menempati bagian tengah tabung. Stahl. coli yang ditumbuhkan pada medium 15N terlihat menempati dasar tabung. katakanlah 30. Molekul DNA dengan tingkat kerapatan tertentu akan menempati kedudukan yang sama dengan kedudukan larutan garam yang tingkat kerapatannya sama dengannya. Sebagai perbandingan. kemudian dikembalikan ke medium normal 14N selama beberapa generasi berikutnya.coli dengan basa nitrogen yang mengandung isotop 14N dan 15N masingmasing adalah 1.coli ditumbuhkan pada medium 14N ternyata DNAnya menempati bagian tengah dan atas tabung. Oleh karena molekul-molekul dengan tingkat kerapatan yang berbeda dapat dipisahkan dengan cara sentrifugasi tersebut di atas. atau dianggap sebagai generasi 0.000 rpm. Hal ini karena molekul-molekul garam tersebut akan mengendap ke dasar tabung sentrifuga akibat adanya gaya sentrifugal. Molekul DNA mempunyai kerapatan yang lebih kurang sama dengan kerapatan larutan garam yang sangat pekat seperti larutan 6M CsCl (sesium khlorida). Percobaan ini dilaporkan hasilnya pada tahun 1958 oleh M. Ketika larutan 6M CsCl yang di dalamnya terdapat molekul DNA disentrifugasi dengan kecepatan sangat tinggi. sementara di sisi lain difusi akan menggerakkan molekul-molekul garam kembali ke atas tabung. Kemudian. Tiga cara teoretis replikasi DNA = untai lama = untai baru Di antara ketiga cara replikasi DNA yang diusulkan tersebut.W. sedangkan DNA yang berada di bagian tengah tabung tetap. Ketika E. Meselson dan F.konservatif semikonservatif dispersif Gambar 9.

antara DNA dengan kerapatan tinggi dan rendah. medium 15N (generasi 0) ekstrak DNA ekstrak DNA medium 14N (generasi 1) ekstrak DNA (generasi 2) medium 14N . sedangkan DNA baru dengan kerapatan rendah akan makin banyak dijumpai. Pada generasi 2 DNA hibridnya masih ada. DNA hibrid akan tetap jumlahnya. Demikian seterusnya. Pada Gambar 9.7 terlihat bahwa interpretasi data hasil percobaan sentrifugasi ini jelas sejalan dengan cara pembentukan molekul DNA melalui replikasi semikonservatif. tetapi muncul pula DNA baru dengan kerapatan rendah.

Replikasi lingkaran menggulung = untai lama = untai baru pemanjangan ’ekor’ . Selain replikasi θ.8). Pembentukan (sintesis) untai DNA baru terjadi dengan penambahan deoksinukleotida pada ujung 3’ yang diikuti oleh pelepasan ujung 5’ dari lingkaran molekul DNA. dan mitokhondria melakukan replikasi yang dikenal sebagai replikasi θ (theta) karena autoradiogramnya menghasilkan gambaran seperti huruf Yunani tersebut. penambahan nukleotida ujung 3’ tempat ujung 5’ pelepasan ujung 5’ terpotongnya ikatan fosfodiester Gambar 9. ujung 5’ akan makin terlepas dari lingkaran tersebut sehingga membentuk ’ekor’ yang makin memanjang (Gambar 9. Replikasi DNA kromosom dalam keadaan utuh _ yang pada prokariot ternyata berbentuk melingkar atau sirkular _ baru dapat diamati menggunakan teknik autoradiografi dan mikroskopi elektron. Diagram percobaan Meselson dan Stahl yang memperlihatkan replikasi DNA secara semikonservatif Pada percobaan Meselson dan Stahl ekstrak DNA yang diperoleh dari sel-sel E. khloroplas. Sejalan dengan berlangsungnya replikasi di seputar lingkaran DNA.8.ekstrak DNA medium 14N (generasi 3) interpretasi data hasil sentrifugasi DNA Gambar 9. coli berada dalam keadaan terfragmentasi sehingga replikasi molekul DNA dalam bentuknya yang utuh sebenarnya belum diketahui. Replikasi ini diawali dengan pemotongan ikatan fosfodiester pada daerah tertentu yang menghasilkan ujung 3’ dan ujung 5’.7. Dengan kedua teknik ini terlihat bahwa DNA berbagai virus. pada sejumlah bakteri dan organisme eukariot dikenal pula replikasi yang dinamakan replikasi lingkaran menggulung (rolling circle replication).

Keempat molekul ini berfungsi sebagai sumber basa nukleotida. deoksisitidin trifosfat (dCTP). 2. Agar DNA polimerase dapat bekerja mengatalisis reaksi sintesis DNA. Segmen asam nukleat pendek. . Enzim-enzim yang berperan dalam replikasi DNA Replikasi DNA. baik pada prokariot maupun eukariot. ori dapat ditemukan di beberapa tempat.. DNA cetakan T A G C T A C.. Biasanya. yang mempunyai gugus 3’.. Salah satu diantaranya adalah enzim DNA polimerase. . . terjadi dua arah (bidireksional). Pada eukariot. dan deoksitimidin trifosfat (dTTP).. diperlukan tiga komponen reaksi.9. yaitu 1. Kita lihat bahwa sintesis DNA (penambahan basa demi basa) berlangsung dari ujung 5’ ke ujung 3’. deoksiguanosin trifosfat (dGTP). yang mengatur pembentukan ikatan fosfodiester antara dua nukleotida yang berdekatan sehingga akan terjadi pemanjangan untai DNA (polinukleotida). . . Dua buah atom fosfat (PPi) dilepaskan dari dGTP karena sebuah atom fosfatnya diberikan ke primer dalam bentuk nukleotida dengan basa G atau deoksinukleosida monofosfat (dGMP). Hasil penambahan yang diperoleh adalah molekul DNA yang terdiri atas empat nukleotida (A-C-A-G). selain terjadi replikasi dua arah. atau sintesis DNA. yang terdiri atas deoksiadenosin trifosfat (dATP). Untai DNA yang akan digunakan sebagai cetakan (template). Dalam gambar tersebut sebuah molekul dGTP ditambahkan ke molekul primer yang terdiri atas tiga nukleotida (A-CA). melibatkan sejumlah reaksi kimia yang diatur oleh beberapa enzim. T A dGTP 3’ P 5’ 5’ 3’ P G C T A PPi 3’ P 5’ OH 3’ DNA polimerase P Mg2+ 5’ 5’ 5’ 3’ P 5’ 3’ P 3’ P OH C .. dapat berupa DNA atau RNA. .OH bebas.. . inisiasi replikasi DNA. yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi. . Reaksi sintesis DNA secara skema dapat dilihat pada Gambar 9. Molekul yang dinamakan primer ini diperlukan karena tidak ada enzim DNA polimerase yang diketahui mampu melakukan inisiasi sintesis DNA. G .Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam lingkaran molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori). Deoksinukleosida trifosfat. Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan. Penambahan dGTP terjadi karena untai DNA cetakannya mempunyai urutan basa T-G-TC. Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. 1.

Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. Kedua enzim ini berperan dalam pembukaan pilinan di antara kedua untai DNA sehingga kedua untai tersebut dapat saling memisah. coli ada dua macam. Pol III merupakan enzim replikasi yang utama. Namun.9. Enzim lain yang berperan dalam proses sintesis DNA adalah primase. Untuk menyambung fragmen-fragmen ini diperlukan enzim yang disebut DNA ligase. enzim DNA polimerase untuk sintesis DNA kromosom pada eukariot disebut polimerase α. Setelah primer terbentuk barulah DNA polimerase melakukan elongasi atau pemanjangan untai DNA. Kesalahan penambahan basa pada untai polinukleotida yang sedang tumbuh (dipolimerisasi) menjadikan basa-basa salah berpasangan. Skema reaksi sintesis DNA Enzim DNA polimerase yang diperlukan untuk sintesis DNA pada E. Dalam sintesis DNA. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). Fungsi perbaikan kesalahan yang dijalankan oleh enzim Pol I dan III tersebut dinamakan fungsi penyuntingan (proofreading). Artinya. Enzim Pol I dan Pol III dari E. sedangkan enzim Pol I memegang peran sekunder. sebagian besar enzim DNA polimerase mempunyai aktivitas nuklease. Selain mampu melakukan pemanjangan atau polimerisasi DNA. Sementara itu. pemotongan terjadi dari ujung 3’ ke arah ujung 5’.Gambar 9. Khusus enzim Pol I ternyata juga mempunyai aktivitas eksonuklease 5’→ 3’ di samping aktivitas eksonuklease 3’→5’ (lihat juga Bab XI). yaitu DNA polimerase I (Pol I) dan DNA polimerase III (Pol III). sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. Hanya saja sintesis DNA pada salah satu untai berlangsung tidak kontinyu sehingga menghasilkan fragmen yang terputus-putus. Terjadinya sintesis . yaitu pembuangan molekul nukleotida dari untai polinukleotida. Aktivitas nuklease dapat dibedakan menjadi (1) eksonuklease atau pembuangan nukleotida dari ujung polinukleotida dan (2) endonuklease atau pemotongan ikatan fosfodiester di dalam untai polinukleotida. tetapi pada kedua-duanya. yang bisa saja terjadi meskipun sangat jarang (sekitar satu di antara sejuta basa !). Enzim ini bekerja pada tahap inisiasi dengan cara mengatur pembentukan molekul primer di daerah ori. coli mempunyai aktivitas eksonuklease yang hanya bekerja pada ujung 3’. Pada bagian berikut ini akan dijelaskan bahwa sintesis DNA baru tidak hanya terjadi pada salah satu untai DNA. yang masing-masing mempunyai arah 5’→ 3’. Hal ini bermanfaat untuk memperbaiki kesalahan sintesis DNA atau kesalahan penambahan basa. misalnya A dengan C. Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. Tahap inisiasi sintesis DNA juga melibatkan enzim DNA girase dan protein yang mendestabilkan pilinan (helix destabilizing protein).

10. fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. Fase aseksual juga diawali dengan meiosis mikronuklei menjadi delapan mikronuklei haploid. membran sel di tempat kedua sel berlekatan akan rusak sehingga terjadi pertukaran salah satu mironuklei antarsel. yang kemudian mengalami dua kali mitosis menjadi . yang tujuh di antaranya mengalami degenerasi. Kedua mikronuklei ini bergabung membentuk satu mikronukleus diploid. Selanjutnya. Satu mikronukleus yang tersisa mengalami mitosis menjadi dua mikronuklei yang juga haploid. Seperti telah dikemukakan di atas. ori 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ untai baru kontinyu untai pengarah fragmen-fragmen 5’ 3’ 3’ 5’ Okazaki untai tertinggal 5’ 3’ Gambar 9. Satu mikronukleus yang tersisa mengalami mitosis menjadi dua mikronuklei haploid. yang diikuti dengan fusi kedua mikronuklei menjadi satu mikronukleus diploid. sesuai dengan nama penemunya. fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. Sementara itu. Diagram replikasi pada kedua untai DNA 11/01/2009 Posted by zaifbio | Genetika Dasar | 3 Komentar Sterilitas Jantan pada Jagung hingga dihasilkan delapan mikronuklei haploid. yang tujuh di antaranya akan mengalami degenerasi.DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). Mulai tahap ini kedua sel (ekskonjugan) secara genetik menjadi sama.

genotipe KK dapat menghasilkan fenotipe bukan pembunuh jika di dalam sitoplasma tidak terdapat partikel kappa. yakni sel pembunuh yang bergenotipe Kk. Dua di antara mikronuklei ini berkembang menjadi makronuklei. Kemungkinan ke dua terjadi pertukaran materi sitoplasmik di antara kedua sel (Gambar 8. Jika sel-sel ini melakukan autogami. seperti T. Pada strain tertentu Paramecium aurelia ditemukan adanya fenomena ‘pembunuh’ (killer) yang berkaitan dengan keberadaan sejumlah partikel yang disebut sebagai kappa di dalam sitoplasmanya. aurelia yang mengandung partikel-partikel kappa akan menghasilkan senyawa beracun yang dapat mematikan strainstrain protozoa lainnya yang ada di sekitarnya.M. Sebaliknya sel pembunuh (Kk) melalui autogami dapat menghasilkan sel bukan pembunuh (kk) karena partikel kappa tidak akan mampu bertahan di dalam sitoplasma tanpa adanya gen K. khususnya dalam hal peningkatan homozigositas. Sterilitas jantan sitoplasmik tidak diatur oleh gen-gen kromosomal tetapi diwariskan melalui sitoplasma gamet betina dari . sel-sel yang dihasilkan semuanya akan menjadi homozigot karena sel awal heterozigot tersebut terlebih dahulu mengalami meiosis menjadi sel haploid. maka akan diperoleh sel pembunuh (KK) dan sel bukan pembunuh (kk) yang berasal dari sel pembunuh (Kk) serta sel bukan pembunuh (baik KK maupun kk) yang berasal dari sel bukan pembunuh (Kk). yaitu sterilitas jantan sitoplasmik pada jagung. peristiwa autogami pada hakekatnya sangat menyerupai pembuahan sendiri. sedangkan partikel-partikel kappa ternyata merupakan bakteri simbion yang kemudian dikenal dengan nama Caedobacter taeniospiralis. mengamati bahwa sel P.empat mikronuklei diploid. Beberapa peneliti. Jika masing-masing sel ini melakukan autogami. Dengan demikian.a) sehingga diperoleh dua kelompok sel.5. Jadi. yang artinya bakteri pembunuh berbentuk pita spiral. Tanaman jagung dikatakan steril atau mandul jantan sitoplasmik apabila tidak mampu menghasilkan polen yang aktif dalam jumlah normal sementara proses reproduksi dan fertilitas betinanya normal. Keberadaan kappa bergantung kepada gen kromosomal dominan K. Apabila strain pembunuh melakukan konjugasi dengan strain bukan pembunuh (pada suatu kondisi yang memungkinkan strain bukan pembunuh untuk bertahan hidup). Kedua mikronuklei yang tersisa mengalami mitosis menjadi empat mikronuklei diploid. Setelah terjadi sitokinesis (pemisahan sel) diperoleh dua buah sel masing-masing dengan dua mikronuklei dan satu makronukleus yang semuanya diploid. Dari hasil autogami dapat dipelajari bahwa pewarisan suatu sifat diatur oleh gen-gen kromosomal ataukah sitoplasmik. yakni sel pembunuh dan sel bukan pembunuh yang kedua-duanya bergenotipe Kk. kedua sel tidak bertukar materi sitoplasmik tetapi hanya bertukar mikronuklei (Gambar 8. maka ada dua kemungkinan yang dapat terjadi. Hal yang perlu untuk diketahui pada fase aseksual ini adalah bahwa meskipun sel yang mengalami autogami pada awalnya heterozigot. dari hasil tersebut tampak jelas bahwa sifat pembunuh atau bukan pembunuh ditentukan oleh ada tidaknya partikel kappa di dalam sitoplasma walaupun partikel itu sendiri keberadaannya bergantung kepada gen K di dalam nukleus. maka akan diperoleh sel pembunuh (KK) dan sel bukan pembunuh (kk) dengan nisbah 1 : 1. Dengan demikian.5 b) sehingga hanya diperoleh satu kelompok sel. Senyawa beracun ini selanjutnya disebut sebagai paramesin. Sterilitas Jantan pada Jagung Di bidang pertanian ada satu contoh fenomena pewarisan sitoplasmik yang sangat penting. Pertama. Sonneborn.

Akibatnya. cerevisae dalam hal pertumbuhannya yang lambat dan kerusakan fungsi mitokondrianya. mutan poki juga memperoleh energi untuk pertumbuhannya . persilangan antara betina tipe liar dan jantan poki menghasilkan keturunan yang semuanya normal. Seperti halnya mutan petit. Secara biokimia kelainan ini berupa gangguan pada sistem sintesis protein mitokondria yang diatur oleh materi genetik di dalam mitokondria. Persilangan antara betina poki dan jantan tipe liar menghasilkan keturunan yang semuanya poki. Mutan poki menyerupai mutan petit pada S. Sebaliknya.6. yang secara skema dapat dilihat pada Gambar 8. Individu mandul jantan sebagai tetua betina disilangkan dengan individu normal sebagai 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar Materi Genetik di dalam Kloroplas. Rhoades melalui percobaan persilangan pada jagung. Jenis sterilitas ini telah banyak digunakan dalam produksi biji jagung hibrida. sel kehilangan kemampuan untuk membentuk protein yang diperlukan dalam metabolisme oksidatif.generasi ke generasi. Pola pewarisan sterilitas jantan pertama kali dipelajari oleh M. betina tersebut dinamakan mutan poki (poky mutant).

yaitu hijau. khususnya daun. Suatu tanaman bunga pukul empat dapat memiliki bagian vegetatif yang berbedabeda warnanya. bagian yang belang-belang . pada beberapa tanaman tertentu seperti bunga pukul empat (Mirabilis jalapa). putih. Carl Correns pada tahun 1908 melihat adanya perbedaan hasil persilangan resiprok pada pewarisan warna bagian vegetatif tanaman. Selsel pada bagian yang berwarna hijau mempunyai kloroplas yang mengandung klorofil.melalui jalur fermentasi anaerob yang sangat tidak efisien. dan belang-belang hjau-putih (variegated). Materi Genetik di dalam Kloroplas. Sementara itu. Dia mengamati bahwa pewarisan warna tersebut semata-mata ditentukan oleh tetua betina dan berkaitan dengan ada tidaknya kloroplas di dalam sitoplasma. sedang sel-sel pada bagian yang berwarna putih tidak mempunyai kloroplas tetapi berisi plastida yang tidak berwarna.

Tabel 8. baik dengan maupun tanpa kloroplas. hijau. Model yang menjelaskan pewarisan maternal ini dapat dilihat pada Gambar 8. kontribusi kloroplas kepada zigot dapat dipastikan hanya berasal dari sel kelamin betina. Ketiga macam bagian tanaman tersebut dapat menghasilkan bunga.terdiri atas sel-sel. yakni mt + dan mt .2. Hal ini karena seperti telah dikatakan di atas bahwa warna hijau bergantung kepada ada tidaknya kloroplas. atau putih Penelitian tentang pewarisan sitoplasmik telah dilakukan pula pada alga uniseluler Chlamydomonas reinhardii. yang selanjutnya . sementara polen hanya sedikit sekali atau bahkan sama sekali tidak memiliki kloropas. Kedua macam sel haploid ini dapat bergabung membentuk zigot diploid. atau putih belang-belang.1 Hasil persilangan pada tanaman bunga pukul empat Fenotipe cabang yang membawa bunga sebagai tetua betina putih putih putih hijau hijau hijau belang-belang belang-belang belang-belang Fenotipe cabang yang membawa bunga sebagai tetua jantan Putih Hijau belang-belang Putih Hijau belang-belang Putih Hijau belang-belang Fenotipe keturunan putih putih putih hijau hijau hijau belang-belang. sehingga dimungkinkan adanya sembilan kombinasi persilangan. Jelas dapat disimpulkan dari Tabel 8. yakni mengenai pewarisan sifat ketahanan terhadap antibiotik.1 bahwa fenotipe keturunan akan selalu sama dengan fenotipe tetua betina atau terjadi pewarisan maternal. hijau.1. hijau. atau putih belang-belang. Ada dua macam sel pada Chlamydomonas bila dilihat dari tipe kawinnya. Sel alga ini memiliki sebuah kloroplas yang besar ukurannya dan di dalamya terdapat sejumlah materi genetik. yang hasilnya dapat dilihat pada Tabel 8. Dengan demikian. baik sebagai sumber polen (tetua jantan) maupun sebagai pembawa putik (tetua betina).

Sel-sel haploid di dalam tetrad dapat ditumbuhkan pada medium selektif padat dan membentuk koloni yang menunjukkan genotipenya.2. putih hijau belang-belang sel telur x polen x x x x zigot Gambar 8. = kloroplas . Model pewarisan maternal pada tanaman bunga pukul empat = plastida tanpa klorofil .akan mengalami meiosis untuk menghasilkan tetrad yang terdiri atas empat buah sel haploid. maka kontribusi sitoplasma kepada zigot yang terbentuk akan sama banyaknya. Oleh karena kedua sel tipe kawin tersebut ukurannya sama besar.

Jadi.3.Persilangan resiprok antara tipe liar (rentan antibiotik) dan mutan-mutan yang tahan antibiotik memberikan hasil yang berbeda-beda. kloroplas dari mt – akan hilang oleh suatu sebab yang hingga kini beluim diketahui. pewarisan sifat ketahanan terhadap antibiotik pada Chlamydomonas merupakan pewarisan ekstrakromosomal atau pewarisan sitoplasmik. Jadi. Hal ini didukung oleh penelitian menggunakan penanda fisik untuk membedakan kloroplas dari kedua tipe kawin yang telah menunjukkan bahwa setelah terjadi penggabungan. Keturunan hasil persilangan antara kedua tipe kawin selalu mempunyai genotipe seperti salah satu tetuanya. kloroplas dapat dipastikan berasal dari salah satu tipe kawin saja. Berbagai penelitian mengenai ketahanan terhadap antibiotik selain streptomisin telah dilakukan pula pada Chlamydomonas. pewarisan alel str mengikuti pola pewarisan uniparental. yang berarti sejalan dengan pola pewarisan kloroplas.str+ menghasilkan keturunan yang semuanya rentan streptomisin (str -) .dengan mt . Jika kloroplas ini berasal dari penggabungan kloroplas kedua sel tipe kawin yang digunakan sebagai tetua dengan nisbah yang sama.mt+ str . Sebagai contoh. Meskipun demikian. Persilangan mt+ str+ dengan mt – str . Secara skema persilangan tersebut dapat digambarkan seperti pada Gambar 8.zigot mt – str+ mt+ mt – mt+ mt – mt+ mt – mt+ mt – . Analisis biokimia membuktikan bahwa sifat ketahanan terhadap antibiotik berhubungan dengan kloroplas. Dengan perkataan lain. maka sifat ini jelas dibawa oleh kloroplas. dan semuanya memperlihatkan terjadinya pewarisan uniparental. Dengan perkataan lain. yang menunjukkan bahwa alel tersebut terletak di dalam kromosom nukleus.menghasilkan keturunan yang semuanya tahan streptomisin (str+) sementara persilangan mt+ str . yakni menghasilkan keturunan dengan nisbah 1 : 1. Seperti telah kita ketahui bahwa sel haploid Chlamydomonas hanya mempunyai sebuah kloroplas. pewarisan sifat ketahanan terhadap streptomisin berlangsung uniparental atau bergantung kepada genotipe salah satu tetuanya. Oleh karena pewarisan sifat ketahanan terhadap antibiotik selalu ditentukan oleh tetua mt +. alel yang menentukan tipe kawin itu sendiri (alel mt) tampak bersegregasi mengikuti pola Mendel. persilangan antara tipe liar dan mutan yang tahan terhadap streptomisin menghasilkan keturunan yang sifat ketahanannya terhadap streptomisin bergantung kepada tetua mt+. Dengan demikian. maka tidak mungkin terjadi pewarisan uniparental. kloroplas yang diwariskan hanya berasal dari tetua mt +. dalam hal ini mt+. mt+ str+ zigot mt – str .

str+ mt+str .3. PEWARISAN SITOPLASMIK Sebegitu jauh pembicaraan kita tentang pewarisan sifat pada eukariot selalu dikaitkan dengan gen-gen yang terletak di dalam kromosom/nukleus. Kenyataannya gengen kromosomal ini memang memegang peranan utama di dalam pewarisan sebagian besar sifat genetik.semuanya str+ semuanya str – mt+ str+ mt . Meskipun demikian. str .mt – str – Gambar 8. Diagram pewarisan sifat ketahanan terhadap streptomisin pada Chlamydomonas (mt = tipe kawin . sesekali pernah pula dilaporkan bahwa ada sejumlah sifat genetik pada eukariot yang .=rentan streptomisin) 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar PEWARISAN SITOPLASMIK BAB VIII PEWARISAN SITOPLASMIK      Kriteria Pewarisan Sitoplasmik Organel Sitoplasmik Pembawa Materi Genetik Pengaruh Genetik Simbion Sitoplasmik pada Paramaecium Mekanisme Sterilitas Jantan pada Jagung Pengaruh Maternal dan Pewarisan Maternal BAB VIII. str+ = tahan streptomisin .

atau dikenal pula sebagai pewarisan sitoplasmik. Pewarisan sifat sitoplasmik diatur oleh materi genetik yang terdapat di dalam organel-organel seperti mitokondria. Perbedaan hasil perkawinan resiprok merupakan penyimpangan dari pola Mendel. kloroplas (pada tumbuhan). . Pada Bab VIII ini akan dibahas berbagai contoh kasus yang termasuk dalam pewarisan sitoplasmik. Kriteria Pewarisan Sitoplasmik Sebenarnya tidak ada kriteria yang dapat berlaku universal untuk membedakan pewarisan sitoplasmik dengan pewarisan gen-gen kromosomal. Pewarisan ekstranukleus. Begitu juga virus dan partikel mirip bakteri dapat bertindak sebagai pembawa sifat herediter sitoplasmik. 1. maka perbedaan hasil perkawinan resiprok tersebut menunjukkan bahwa salah satu tetua (biasanya betina) memberikan pengaruh lebih besar daripada pengaruh tetua lainnya dalam pewarisan suatu sifat tertentu. Sebagai contoh. Di bagian akhir dibicarakan pula suatu fenomena lain yang masih ada sangkut pautnya dengan pewarisan sitoplasmik. dan beberapa komponen sitoplasmik lainnya. ini tidak mengikuti pola Mendel. setidaktidaknya lima hal di bawah ini dapat digunakan untuk keperluan tersebut. Jika dalam hal ini pengaruh rangkai kelamin (Bab VI) dikesampingkan.pewarisannya diatur oleh unsur-unsur di luar nukleus. Namun. hasil persilangan antara betina A dan jantan B tidak sama dengan hasil persilangan antara betina B dan jantan A.

Substitusi nukleus dapat memperjelas pengaruh relatif nukleus dan sitoplasma. sangat dimungkinkan bahwa materi genetik tersebut terdapat di dalam sitoplasma 4. Jika materi sitoplasmik terbukti berkaitan dengan pewarisan sifat tertentu. jika ada suatu materi penentu sifat tidak dapat dipetakan ke dalam kelompok-kelompok berangkai yang ada. Gen-gen kromosomal menempati loki tertentu dengan jarak satu sama lain yang tertentu pula sehingga dapat membentuk kelompok berangkai (Bab V). 5. yang memiliki molekul DNA (lihat Bab IX) dan dapat melakukan replikasi subseluler sendiri. Sel kelamin betina biasanya membawa sitoplasma dan organel sitoplasmik dalam jumlah lebih besar daripada sel kelamin jantan. Oleh karena itu.2. Beberapa hasil . 3. maka dapat dipastikan bahwa pewarisan sifat tersebut merupakan pewarisan sitoplasmik. Organel dan simbion di dalam sitoplasma dimungkinkan untuk diisolasi dan dianalisis untuk mendukung pembuktian tentang adanya transmisi maternal dalam pewarisan sifat. maka pewarisan tersebut terjadi karena pengaruh materi sitoplasmik. kedua organel ini sering kali disebut sebagai organel otonom. Tidak adanya nisbah segregasi Mendel menunjukkan bahwa pewarisan sifat tidak diatur oleh gen-gen kromosomal tetapi oleh materi sitoplasmik. Organel Sitoplasmik Pembawa Materi Genetik Di dalam sitoplasma antara lain terdapat organel-organel seperti mitokondria dan kloroplas. Jika pewarisan suatu sifat berlangsung tanpa adanya pewarisan gen-gen kromosomal. Oleh karena itu.

Sementara itu. misalnya mekanisme ketahanan terhadap antibiotik streptomisin pada Chlamydomonas. Enzim-enzim untuk keperluan respirasi sel dan produksi energi terdapat di dalam mitokondria. Begitu juga bahan makanan akan dioksidasi di dalam organel ini untuk menghasilkan senyawa adenosin trifosfat (ATP). Dalam kurun waktu yang sangat panjang mereka kemudian membangun simbiosis turun-temurun dengan sel inang eukariotnya dan akhirnya berkembang menjadi organel yang menetap di dalam sel. Klorofil beserta kelengkapan untuk sintesisnya telah dirakit ketika kloroplas masih dalam bentuk alga yang hidup bebas.penelitian memberikan petunjuk bahwa mitokondria dan kloroplas pada awalnya masing-masing merupakan bakteri dan alga yang hidup bebas. kloroplas sebagai organel fotosintetik pada tumbuhan dan beberapa mikroorganisme membawa sejumlah materi genetik yang diperlukan bagi struktur dan fungsinya dalam melaksanakan proses fotosintesis. Ephrusi menemukan sejumlah . Mitokondria. yang merupakan bahan bakar bagi berbagai reaksi biokomia. diduga membawa hingga lebih kurang 50 gen di dalam molekul DNAnya. yang nanti akan dibicarakan pada bagian lain bab ini. Pada alga hijau plastida diduga membawa mekanisme genetik lainnya. yang dijumpai pada semua jenis organisme eukariot. Mutan Mitokondria Pada suatu penelitian menggunakan khamir Saccharomyces cerevisae B. Gen-gen ini di antaranya bertanggung jawab atas struktur mitokondria itu sendiri dan juga pengaturan berbagai bentuk metabolisme energi.

Analisis genetik terhadap hasil persilangan antara mutan petit dan tipe liarnya memperlihatkan adanya tiga tipe mutan petit seperti dapat dilihat pada Gambar 8. akan diperoleh empat askopora haploid dengan nisbah fenotipe 2 normal : 2 petit. maka dapat . oleh karena zigot diploid mempunyai fenotipe normal. Namun. Hasil pengamatan mikroskopis menunjukkan bahwa selsel pada koloni tersebut berukuran normal. Hal ini menunjukkan bahwa petit segregasional ditimbulkan oleh mutasi di dalam nukleus. hasil studi fisiologi menunjukkan bahwa sel-sel tersebut mengalami petumbuhan yang sangat lambat karena adanya kelainan dalam metabolisme senyawa karbon. Persilangan dengan tipe liarnya menghasilkan zigot diploid yang normal. Koloni-koloni ini dinamakan mutan petit (petite mutant). Jika zigot ini mengalami pembelahan meiosis. melainkan melalui fermentasi glukosa secara anaerob yang jelas jauh kurang efisien bila dibandingkan dengan respirasi aerob. Tipe pertama memperlihatkan segregasi Mendel seperti biasanya sehingga dinamakan petit segregasional. Mutan petit melakukan metabolisme karbon bukan dengan respirasi menggunakan oksigen.1. Selain itu.koloni berukuran sangat kecil yang kadang-kadang terlihat ketika sel ditumbuhkan pada medium padat.

Jadi. fenotipe keturunan hanya ditentukan oleh tetua normalnya. Dengan perkataan lain. Ketika sel petit netral bertemu dengan sel tipe liar. Keempat askospora ini semuanya normal. yang disebut petit netral. pewarisan sifatnya merupakan pewarisan uniparental. .dipastikan bahwa alel yang mengatur mutan petit merupakan alel resesif. sitoplasma sel tipe liar akan menjadi sumber materi genetik mitokhodria bagi spora-spora hasil persilangan petit dengan tipe liar sehingga semuanya akan mempunyai fenotipe normal. Berlangsungnya pewarisan uniparental tersebut disebabkan oleh hilangnya sebagian besar atau seluruh materi genetik di dalam mitokondria yang menyandi sintesis enzim respirasi oksidatif pada kebanyakan petit netral. Hasil yang sama akan diperoleh apabila zigot diploid disilang balik dengan tetua petitnya. Tipe ke dua. berbeda dengan tipe pertama jika dilihat dari keempat askopora hasil pembelahan meiosis zigot diploid.

Segregasional Supresif Netral ha ploid : x x x zigot diploid : normal normal petit askospor a: 2 normal : 2 petit normal 4 4 petit .

Dengan demikian. Pewarisan mutasi petit pada persilangan dengan tipe liarnya (lingkaran kecil menggambarkan sel petit . yang hingga kini belum dapat dijelaskan dengan baik. cerevisae.Gambar 8. Mutan mitokondria pada Neurospora yang diwariskan melalui tetua 10/31/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar . Selanjutnya. hasil meiosis zigot petit ini adalah empat askospora yang semuanya mempunyai fenotipe petit. Petit supresif juga mengalami kerusakan pada materi genetik mitokondrianya tetapi kerusakannya tidak separah pada petit netral. nukleus bergaris untuk pembentukan petit) mendatar membawa alel Tipe ke tiga disebut petit supresif. pewarisan uniparental juga terjadi pada tipe petit supresif. seperti halnya pada tipe petit netral. Pada persilangannya dengan tipe liar dihasilkan zigot diploid dengan fenotipe petit.1. Bedanya. yang pewarisannya berlangsung uniparental melalui tetua betina (pewarisan maternal) meskipun sebenarnya pada jamur ini belum ada perbedaan jenis kelamin yang nyata. Selain pada khamir S. pada petit supresif alel penyebab petit bertindak sebagai penghambat (supresor) dominan terhadap aktivitas mitokondria tipe liar. kasus mutasi mitokondria juga dijumpai pada jamur Neurospora.

Pemberian nama ini karena strukturnya pada individu jantan dan individu betina memperlihatkan perbedaan sehingga dapat digunakan untuk membedakan jenis kelamin individu. menghasilkan peta kromosom untuk spesies tersebut. Kromosom semacam ini dinamakan autosom. terutama hewan dan juga manusia. Gen-gen yang terletak pada kromosom kelamin dinamakan gen rangkai kelamin (sex-linked genes) sementara fenomena yang melibatkan pewarisan gen-gen ini disebut peristiwa rangkai kelamin (linkage). Ternyata banyak sekali spesies organisme lainnya. mempunyai kromosom kelamin. Seperti halnya gen berangkai (autosomal). Adapun gen berangkai yang dibicarakan pada Bab V adalah gengen yang terletak pada kromosom selain kromosom kelamin. melanogaster tersebut. Salah satu dari keempat kelompok gen berangkai atau keempat pasang kromosom pada D. gen-gen rangkai kelamin tidak mengalami segregasi dan penggabungan secara acak di dalam gamet-gamet yang terbentuk. misalnya peta kromosom pada lalat Drosophila melanogaster yang terdiri atas empat kelompok gen berangkai (Gambar 5.4). individu-individu yang dihasilkan melalui kombinasi gamet tersebut memperlihatkan nisbah . dalam hal ini kromosom nomor 1. yang meliputi urutan dan jaraknya satu sama lain. yaitu kromosom yang pada individu jantan dan betina sama strukturnya sehingga tidak dapat digunakan untuk membedakan jenis kelamin. disebut sebagai kromosom kelamin. Keberadaan gen berangkai pada suatu spesies organisme. Akibatnya. RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN Pada Bab V telah kita pelajari pola pewarisan sifat yang diatur oleh gen-gen berangkai atau gen-gen yang terletak pada satu kromosom.RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN BAB VI RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN ·     Kromosom Kelamin dan Autosom Gen Rangkai Kelamin Tipe Penentuan Jenis Kelamin Organisme Kromatin Kelamin dan Hipotesis Lyon Pengaruh Hormon Kelamin dalam Penentuan Jenis Kelamin BAB VI.

misalnya pengatur warna mata merah ini. Pada bab ini akan dijelaskan cara pewarisan macam-macam gen rangkai kelamin tersebut serta beberapa sistem penentuan jenis kelamin pada berbagai spesies organisme. Lalat bermata merah lazim dianggap sebagai lalat normal atau tipe alami (wild type). Dia menyilangkan lalat D. Hasil persilangan Morgan tersebut. tidak demikian halnya untuk sifat-sifat yang diatur oleh gen rangkai kelamin. sedang gen pengatur tipe alami. Pewarisan Rangkai X Percobaan yang pertama kali mengungkapkan adanya peristiwa rangkai kelamin dilakukan oleh T. melanogaster jantan bermata putih dengan betina bermata merah. meskipun tidak selalu. jika pada percobaan Mendel perkawinan resiprok (genotipe tetua jantan dan betina dipertukarkan) menghasilkan keturunan yang sama. gen pengatur warna mata ini dikatakan sebagai gen rangkai X. Dengan perkataan lain.fenotipe dan genotipe yang menyimpang dari hukum Mendel. Biasanya. P: x betina normal jantan mata putih + + w x betina mata putih jantan normal P: w w + F1 : + w + F1: + w w betina normal jantan normal betina normal jantan mata putih . gen tipe alami bersifat dominan terhadap alel mutannya. Oleh karena kromosom kelamin pada umumnya dapat dibedakan menjadi kromosom X dan Y. ada pula beberapa gen yang terletak pada kromosom X tetapi memiliki pasangan pada kromosom Y. khususnya pada generasi F1. Persilangan resiprok dengan hasil yang berbeda ini memberikan petunjuk bahwa pewarisan warna mata pada Drosophila ada hubungannya dengan jenis kelamin. perkawinan resiprok menghasilkan keturunan yang berbeda. Oleh karena itu. Secara skema pewarisan warna mata pada Drosophila dapat dilihat pada Gambar 6. maka gen rangkai kelamin dapat menjadi gen rangkai X (Xlinked genes) dan gen rangkai Y (Y-linked genes). Gen semacam ini dinamakan gen rangkai kelamin tak sempurna (incompletely sex-linked genes).1. dalam hal ini kromosom X. dan ternyata kemudian memang diketahui bahwa gen yang mengatur warna mata pada Drosophila terletak pada kromosom kelamin.H Morgan pada tahun 1910. ternyata berbeda jika tetua jantan yang digunakan adalah tipe alami (bermata merah) dan tetua betinanya bermata putih. dapat dilambangkan dengan tanda +. Di samping itu. Kromosom X dan Y masimg-masing lazim dilambangkan dengan tanda dan . Gen rangkai kelamin dapat dikelompok-kelompokkan berdasarkan atas macam kromosom kelamin tempatnya berada. Selain itu.

Oleh karena itu. Sebenarnya. waktu itu kematian akibat perdarahan ini hanya dianggap sebagai takdir semata. Namun. kasus hemofilia telah dijumpai sejak lama di negara-negara Arab ketika beberapa anak laki-laki meninggal akibat perdarahan hebat setelah dikhitan. individu jantan yang hanya membawa sebuah kromosom X akan menghasilkan dua macam gamet yang berbeda. Rangkai X pada kucing Warna bulu pada kucing ditentukan oleh suatu gen rangkai X. akan nampak bahwa lalat F1 betina mempunyai mata seperti tetua jantannya. Hemofilia baru menjadi terkenal dan dipelajari pola pewarisannya setelah beberapa anggota keluarga Kerajaan Inggris mengalaminya. yang dengan sendirinya homolog.a) b) Gambar 6. Dari kedua putri yang heterozigot ini lahir tiga cucu laki-laki yang menderita hemofilia dan empat cucu wanita yang heterozigot. Oleh karena genotipe heterozigot untuk gen rangkai X hanya dapat dijumpai pada individu betina. Dalam keadaan heterozigot gen ini menyebabkan warna bulu yang dikenal dengan istilah tortoise shell. anggota keluarga Kerajaan Inggris saat ini yang merupakan keturunan putra/putri normal Ratu Victoria bebas dari penyakit hemofilia.1. individu betina ini dikatakan bersifat homogametik. maka kucing berbulu tortoise shell hanya terdapat pada jenis kelamin betina. Rangkai Z pada ayam . lalat F1 jantan warna matanya seperti tetua betinanya. yaitu normal/merah. dan juga beberapa spesies organisme lainnya. salah seorang di antara putra Ratu Victoria menderita hemofilia sementara dua di antara putrinya karier atau heterozigot. Melalui dua dari keempat cucu yang heterozigot inilah penyakit hemofilia tersebar di kalangan keluarga Kerajaan Rusia dan Spanyol. Istilah hemizigot digunakan untuk menyebutkan genotipe individu dengan sebuah kromosom X. yaitu putih. Individu jantan ini dikatakan bersifat heterogametik. Sementara itu. Individu dengan gen dominan yang terdapat pada satu-satunya kromosom X dikatakan hemizigot dominan. jika gen tersebut resesif. individu homozigot dominan (betina) dan hemizigot dominan (jantan) mempunyai bulu berwarna hitam. Sebaliknya. individu betina membawa dua buah kromosom X.b. yaitu gangguan dalam proses pembekuan darah. Awalnya. Diagram persilangan rangkai X pada Drosophila Jika kita perhatikan Gambar 6. Sementara itu. Sebaliknya. individu yang memilikinya disebut hemizigot resesif. yaitu gamet yang membawa kromosom X dan gamet yang membawa kromosom Y. Rangkai X pada manusia Salah satu contoh gen rangkai X pada manusia adalah gen resesif yang menyebabkan penyakit hemofilia. Pewarisan sifat semacam ini disebut sebagai criss cross inheritance. sehingga gamet-gamet yang dihasilkannya akan mempunyai susunan gen yang sama. Individu homozigot resesif (betina) dan hemizigot resesif (jantan) akan berbulu kuning. Sebaliknya.1. Pada Drosophila.

sedang alel dominannya merupakan alel mutan. Oleh karena fenotipe abnormal yang disebabkan oleh gen rangkai Y jumlahnya sangat sedikit. Br. sedang individu heterogametik (ZW) adalah betina. Gen rangkai Y jelas tidak mungkin diekspresikan pada individu betina/wanita sehingga gen ini disebut juga gen holandrik. Contoh gen rangkai Z yang lazim dikemukakan adalah gen resesif br yang menyebabkan pemerataan pigmentasi bulu secara normal pada ayam. dan Wt dengan alelnya wt yang menyebabkan abnormalitas kulit pada jari. P: + + x b b P: b b x + + jantan normal betina normal jantan bulu pendek betina bulu pendek . Pada D. Ht dengan alelnya ht yang menyebabkan pertumbuhan bulu panjang di sekitar telinga.2. Jumlah yang sangat sedikit ini mungkin disebabkan oleh sulitnya menemukan alel mutan bagi gen rangkai Y yang dapat menghasilkan fenotipe abnormal. Contoh gen holandrik pada manusia adalah Hg dengan alelnya hg yang menyebabkan bulu kasar dan panjang. Jadi. pada kasus ini alel resesif justru dianggap sebagai tipe alami atau normal (dilambangkan dengan +). pada rangkai Z justru terjadi sebaliknya. dan berlangsung seperti halnya pewarisan gen autosomal. Pewarisan Rangkai Kelamin Tak Sempurna Meskipun dari uraian di atas secara tersirat dapat ditafsirkan bahwa kromosom X tidak homolog dengan kromosom Y. kalau pada rangkai X individu homogametik berjenis kelamin pria/jantan sementara individu heterogametik berjenis kelamin wanita/betina. gen-gen pada segmen kromosom X dan Y yang homolog ini disebut juga gen rangkai kelamin tak sempurna. Pewarisan Rangkai Y Pada umumnya kromosom Y hanya sedikit sekali mengandung gen yang aktif. Alelnya. Dengan perkataan lain. ternyata ada bagian atau segmen tertentu pada kedua kromosom tersebut yang homolog satu sama lain. maka gen rangkai Y diduga merupakan gen yang sangat stabil. ada beberapa gen pada kromosom X yang mempunyai alel pada kromosom Y. Pewarisan sifat yang diatur oleh gen semacam ini dapat dikatakan tidak dipengaruhi oleh jenis kelamin. Pewarisan gen yang bersifat resesif ini dapat dilihat pada Gambar 6. Biasanya suatu gen/alel dapat dideteksi keberadaannya apabila fenotipe yang dihasilkannya adalah abnormal. melanogaster terdapat gen rangkai kelamin tak sempurna yang menyebabkan pertumbuhan bulu pendek. menyebabkan bulu ayam menjadi burik. Individu homogametik (ZZ) adalah jantan. Hanya saja.Pada dasarnya pola pewarisan sifat rangkai Z sama dengan pewarisan sifat rangkai X. Oleh karena itu.

1.B. Wilson menemukan bahwa sel somatis serangga Protenor betina mempunyai 14 kromosom. Penentuan jenis kelamin pada manusia/mamalia dikatakan mengikuti sistem XY. Sistem Penentuan Jenis Kelamin Telah disebutkan di atas bahwa pada manusia dan mamalia. Sistem nisbah X/A C. dalam hal ini kucing. dan unggas lainnya serta ikan tertentu. mengikuti sistem ZW. Bridge melakukan serangkaian penelitian mengenai jenis kelamin pada lalat Drosophila.2 bahwa perkawinan resiprok untuk gen rangkai kelamin tak sempurna akan memberikan hasil yang sama seperti halnya hasil yang diperoleh dari perkawinan resiprok untuk gen-gen autosomal. pada ayam individu jantan justru homogametik (ZZ) sementara individu betinanya heterogametik (ZW).B.5 jenis kelamin jantan . dan tidak ada hubungannya dengan kromosom Y. Dia berhasil menyimpulkan bahwa sistem penentuan jenis kelamin pada organisme tersebut berkaitan dengan nisbah banyaknya kromosom X terhadap banyaknya autosom. Jadi.F1 : + b betina normal a) + b jantan normal F1: + b betina normal b) + b jantan normal Gambar 6. misalnya belalang. pewarisan gen rangkai kelamin tak sempurna mempunyai pola seperti pewarisan gen autosomal. hal ini mirip dengan sistem XY. Dalam hal ini kromosom Y hanya berperan mengatur fertilitas jantan. jumlah kromosom sel somatis individu betina lebih banyak daripada jumlah pada individu jantan. pada sistem XO individu jantan tidak mempunyai kromosom Y. individu betina memiliki dua buah kromosom X sementara individu jantan hanya mempunyai sebuah kromosom X. Jadi. Bedanya. Berikut ini akan dijelaskan beberapa di antaranya. Dengan demikian.1. sedang pada ayam. Diagram pewarisan gen rangkai kelamin tak sempurna Dapat dilihat pada Gambar 6. Penentuan jenis kelamin pada lalat Drosophila Σ kromosom X 1 Σ autosom 2 nibah X/A 0. Sistem XO Sistem XO dijumpai pada beberapa jenis serangga. Secara ringkas penentuan jenis kelamin dengan sistem X/A pada lalat Drosophila dapat dilihat pada Tabel 6. Tabel 6. Di dalam sel somatisnya. masih banyak sistem penentuan jenis kelamin lainnya. individu pria/jantan adalah heterogametik (XY) sementara wanita/betina adalah homogametik (XX). sedang pada individu jantannya hanya ada 13 kromosom. E. Sebagai contoh. Sebaliknya. Selain kedua sistem tersebut.2.

67 0. betina triploid dan tetraploid.33 1 1 0.2 3 4 4 3 3 2 2 1 2 2 3 4 3 4 3 4 3 1 1.3. Penyebabnya adalah ketidakteraturan distribusi kromosom X pada masa-masa awal pembelahan mitosis zigot.33 betina metabetina metabetina betina 4n betina 3n interseks interseks jantan metajantan Jika kita perhatikan kolom pertama pada Tabel 6. serta interseks. Pada Drosophila terjadinya gagal pisah dapat menyebabkan terbentuknya beberapa individu abnormal seperti nampak pada Gambar 6. yakni individu dengan jenis kelamin metabetina. Partenogenesis . Diagram munculnya beberapa individu abnormal pada Drosophila akibat peristiwa gagal pisah Di samping kelainan-kelainan tersebut pernah pula dilaporkan adanya lalat Drosophila yang sebagian tubuhnya memperlihatkan sifat-sifat sebagai jenis kelamin jantan sementara sebagian lainnya betina.5 1. Adanya kromosom X yang didapatkan melebihi jumlah kromosom X pada individu normal (diploid) ini disebabkan oleh terjadinya peristiwa yang dinamakan gagal pisah (non disjunction). Dalam hal ini ada sel yang menerima dua kromosom X tetapi ada pula yang hanya menerima satu kromosom X.1 akan terlihat bahwa ada beberapa individu yang jumlah kromosom X-nya lebih dari dua buah. P: E AAXX x AAXY G gagal pisah gamet : F1 : AXX AO AX AAXXY AY AAXO letal AAOY AAXXX betina betina super jantan steril Gambar 6. yaitu gagal berpisahnya kedua kromosom X pada waktu pembelahan meiosis.5 0.3.75 0. Lalat ini dikatakan mengalami mozaik seksual atau biasa disebut dengan istilah ginandromorfi.

sistem tersebut masih ada kaitannya dengan jumlah perangkat kromosom. Dengan demikian. M. Sistem gen Sk-Ts Di atas disebutkan bahwa sistem penentuan jenis kelamin pada lebah tidak berhubungan dengan kromosom kelamin. dapat dibedakan dengan sel somatis wanita atas dasar ada tidaknya struktur tertentu yang kemudian dikenal dengan nama kromatin kelamin atau badan Barr. berkembang dari telur yang dibuahi sehingga perangkat kromosomnya adalah diploid. Jagung monosius ini mempunyai fenotipe Sk_Ts_. yang mengatur pembentukan bunga betina. alel-alel resesif sk dan ts masing-masing menghalangi pembentukan bunga betina dan mensterilkan bunga jantan. wanita normal mempunyai sebuah . bunga betina tetap terbentuk seakan-akan tidak ada alel sk. F. Selanjutnya diketahui bahwa banyaknya kromatin kelamin ternyata sama dengan banyaknya kromosom X dikurangi satu. dan tawon. sedang jagung skskTs_ adalah jantan diosius. baik kepada kromosom kelamin maupun jumlah genom. jagung dengan fenotipe Sk_tsts adalah betina diosius (berumah dua). Struktur semacam ini ternyata tidak dijumpai pada sel-sel kucing jantan. yaitu melalui telur yang tidak dibuahi. Oleh karena itu. Pada manusia dilaporkan pula bahwa sel-sel somatis pria. dapat dikatakan bahwa partenogenesis merupakan sistem penentuan jenis kelamin yang tidak ada sangkut pautnya sama sekali dengan kromosom kelamin tetapi hanya bergantung kepada jumlah genom (perangkat kromosom). individu jantan ini hanya memiliki sebuah genom atau perangkat kromosomnya haploid.Pada beberapa spesies Hymenoptera seperti semut. Jagung normal monosius (berumah satu) mempunyai gen Sk. individu betina dan golongan pekerja. Pada jagung dikenal sistem penentuan jenis kelamin yang tidak bergantung. atau dengan perkataan lain. Sementara itu. pada tahun 1949 menemukan adanya struktur tertentu yang dapat memperlihatkan reaksi pewarnaan di dalam nukleus sel syaraf kucing betina. Jagung sksktsts berjenis kelamin betina karena ts dapat mengatasi pengaruh sk. dan gen Ts. cacing yang hidup di lingkungan betina dewasa akan mendekati dan memasuki saluran reproduksi cacing betina dewasa tersebut untuk kemudian berkembang menjadi individu jantan yang parasitik. Pada sel somatis wanita terdapat sebuah kromatin kelamin sementara sel somatis pria tidak memilikinya. Baltzer menemukan bahwa cacing Bonellia yang berasal dari sebuah telur yang diisolasi akan berkembang menjadi individu betina. Hal ini misalnya dijumpai pada cacing laut Bonellia. Pengaruh lingkungan Sistem penentuan jenis kelamin bahkan ada pula yang bersifat nongenetik. Kromatin Kelamin Seorang ahli genetika dari Kanada. yang mengatur pembentukan bunga jantan. individu jantan berkembang dengan cara partenogenesis. Barr.L. misalnya sel epitel selaput lendir mulut.. lebah. yang jenis kelaminnya semata-mata ditentukan oleh faktor lingkungan. Meskipun demikian. Oleh karena itu. Sementara itu. tetapi didasarkan atas keberadaan gen tertentu. Jadi. Sebaliknya. khususnya pada lebah.

Sebaliknya. Tabel 6. Sebagai contoh. untuk dapat bertanduk domba betina harus mempunyai dua gen H (homozigot) sementara domba jantan cukup dengan satu gen H (heterozigot). Gen terpengaruh kelamin Gen terpengaruh kelamin (sex influenced genes) ialah gen yang memperlihatkan perbedaan ekspresi antara individu jantan dan betina akibat pengaruh hormon kelamin. misalnya penderita sindrom Klinefelter (XXY). Dengan perkataan lain. Demikian pula. Hipotesis Lyon juga menjelaskan adanya mekanisme kompensasi dosis pada mamalia. Selanjutnya. Hal ini menunjukkan bahwa hanya ada satu kromosom X yang aktif di antara kedua kromosom X pada individu betina. Mekanisme kompensasi dosis diusulkan karena adanya fenomena bahwa suatu gen rangkai X akan mempunyai dosis efektif yang sama pada kedua jenis kelamin. Pria dengan kelainan kromosom kelamin. Hormon dan Diferensiasi Kelamin Dari penjelasan mengenai berbagai sistem penentuan jenis kelamin organisme diketahui bahwa faktor genetis memegang peranan utama dalam ekspresi sifat kelamin primer. Ovarium dan testes masing-masing mempunyai fungsi ganda. Ekspresi gen terpengaruh kelamin pada domba . Hipotesis ini dilandasi hasil pengamatannya atas ekspresi gen rangkai X yang mengatur warna bulu pada mencit. gen rangkai X pada individu homozigot akan diekspesikan sama kuat dengan gen rangkai X pada individu hemizigot. bersifat dominan pada domba betina tetapi resesif pada domba jantan. mempunyai sebuah kromatin kelamin yang seharusnya tidak dimiliki oleh seorang pria normal. kelenjar adrenalin menghasilkan steroid yang secara kimia berhubungan erat dengan gonad. testes. Pada hewan tingkat tinggi dan manusia hormon kelamin disintesis oleh ovarium. wanita penderita sindrom Turner (XO) tidak mempunyai kromatin kelamin yang seharusnya ada pada wanita normal. seorang ahli genetika dari Inggris mengajukan hipotesis bahwa kromatin kelamin merupakan kromosom X yang mengalami kondensasi atau heterokromatinisasi sehingga secara genetik menjadi inaktif. Kromosom X yang aktif pada suatu sel mungkin membawa gen dominan sementara pada sel yang lain mungkin justru membawa gen resesif. Mary F. sistem hormon akan mengatur kondisi fisiologi dalam tubuh individu sehingga mempengaruhi perkembangan sifat kelamin sekunder.2. alelnya h. Sementara itu. Sebaliknya. Lyon. dan kelenjar adrenalin. Individu betina heterozigot memperlihatkan fenotipe mozaik yang jelas berbeda dengan ekspresi gen semidominan (warna antara yang seragam). yaitu sebagai penghasil sel kelamin (gamet) dan sebagai penghasil hormon kelamin. gen autosomal H yang mengatur pembentukan tanduk pada domba akan bersifat dominan pada individu jantan tetapi resesif pada individu betina.kromatin kelamin karena kromosom X-nya ada dua. Oleh karena itu. pria normal tidak mempunyai kromatin kelamin karena kromosom X-nya hanya satu. Dewasa ini keberadaan kromatin kelamin sering kali digunakan untuk menentukan jenis kelamin serta mendiagnosis berbagai kelainan kromosom kelamin pada janin melalui pengambilan cairan amnion embrio (amniosentesis).

maka akan terlihat bahwa gamet-gamet yang terbentuk tidak hanya mengandung kombinasi gen dominan untuk warna biji (K) dengan gen dominan untuk bentuk biji (B). Oleh karena peluang terjadinya kombinasi-kombinasi tersebut sama besar. sedang wanita heterozigot akan normal. Gen terbatasi kelamin Selain mempengaruhi perbedaan ekspresi gen di antara jenis kelamin. yang dengan sendirinya hanya dapat diekspresikan pada individu betina. Sebaliknya. Untuk dapat mengalami kebotakan seorang wanita harus mempunyai gen B dalam keadaan homozigot. Akibatnya. dan juga kombinasi gen K dengan gen b. gen b dominan pada wanita tetapi resesif pada pria. individu jantan dengan genotipe tertentu sebenarnya juga mempunyai potensi untuk menghasilkan keturunan dengan produksi susu yang tinggi sehingga keberadaannya sangat diperlukan dalam upaya pemuliaan ternak tersebut. telah menghasilkan dua hukum Mendel. Namun. serta gen k dengan gen B. tetapi memungkinkan pula kombinasi gen resesif untuk warna biji (k) dengan gen resesif untuk bentuk biji (b). Jika kembali kita perhatikan persilangan dihibrid menyangkut pewarisan warna biji dan bentuk biji. Contoh gen semacam ini adalah gen yang mengatur produksi susu pada sapi perah. Gen B dominan pada pria tetapi resesif pada wanita. . hormon kelamin juga dapat membatasi ekspresi gen pada salah satu jenis kelamin.Genotipe HH Hh hh Domba jantan bertanduk bertanduk tidak bertanduk Domba betina bertanduk tidak bertanduk tidak bertanduk Contoh lain gen terpengaruh kelamin adalah gen autosomal B yang mengatur kebotakan pada manusia. yakni hukum segegasi dan hukum pemilihan bebas. BERANGKAI Percobaan-percobaan persilangan pada kacang ercis yang dilakukan oleh Mendel. pria heterozigot akan mengalami kebotakan. 10/31/2009 Posted by zaifbio | Genetika Dasar | 7 Komentar BERANGKAI BAB V BERANGKAI     Dua Gen Berangkai dan Pindah Silang Tiga Gen Berangkai dan Pindah Silang Ganda Pemetaan Kromosom Pemetaan Kromosom pada Manusia BAB V. Gen yang hanya dapat diekspresikan pada salah satu jenis kelamin dinamakan gen terbatasi kelamin (sex limited genes). baik monohibrid maupun dihibrid.

gamet yang mengandung kombinasi gen dominanresesif akan lebih banyak jumlahnya daripada gamet dengan kandungan gen sesama dominan dan sesama resesif. Sturtevant. dan kb. Adanya perbedaan jumlah di antara macam gamet yang terbentuk tersebut disebabkan oleh kecenderungan gen-gen berangkai untuk selalu berada bersama-sama. barangkali Mendel tidak akan berhasil merumuskan hukum pemilihan bebas. Dalam hal ini n merupakan bilangan positif dengan nilai lebih dari satu. maka gamet yang mengandung gen-gen dominan dan gamet yang mengandung gen-gen resesif akan dijumpai lebih banyak daripada gamet dengan kombinasi gen dominan-resesif.maka keempat macam gamet yang dihasilkan. dan ab dengan nisbah n : 1 : 1 : n. mereka tidak dapat memberikan interpretasi terhadap hasil persilangan yang diperoleh. yang sebagian besar melibatkan karya Morgan dan para mahasiswanya seperti C. di dalam sebuah kromosom tertentu dapat dijumpai lebih dari sebuah gen. akan menjadi pokok bahasan pada Bab V ini. kalau gen-gen yang berangkai adalah sesama dominan dan sesama resesif. sedang gen pengatur bentuk biji terletak pada kromosom 7. Muller. H. Sebagai contoh. jika gen A berangkai dengan gen b. Dua Gen Berangkai Dua buah gen yang berangkai akan mengalami segregasi dan rekombinasi dengan pola yang tidak mengikuti hukum Mendel. Baru sekitar lima tahun kemudian seorang ahli genetika dan embriologi dari Amerika Serikat. Fenomena berangkai pertama kali ditemukan pada percobaan dihibrid oleh W. yaitu KB. Ab. Kb. Gen-gen yang terdapat pada kromosom yang sama dinamakan gen-gen berangkai (linked genes). Bridges. Akan tetapi.B. T. dan juga pada setiap spesies organisme lainnya. Artinya. pola segregasi dan rekombinasinya tidak bebas sehingga tiap macam gamet yang dihasilkannya pun menjadi tidak sama jumlahnya.H. Gen pengatur warna biji terletak pada kromosom 1. Inilah keuntungan lain yang diperoleh Mendel di samping secara kebetulan tanaman yang digunakan adalah diploid. Sebaliknya. Dari konsep mengenai berangkai ini selanjutnya berkembang pengetahuan mengenai pindah silang (crossing over) dan pemetaan kromosom. maka gamet-gamet yang dihasilkan akan terdiri atas AB. termasuk cara memetakannya pada kromosom tempat mereka berada. aB. Seluk-beluk mengenai gen-gen berangkai.J. akan mempunyai nisbah 1 : 1 : 1 : 1. Seandainya gen pengatur warna biji dan gen pengatur bentuk biji terletak pada kromosom yang sama. jauh lebih banyak daripada jumlah kromosomnya. dan A. Demikian pula. . juga berangkai pada kromosom homolognya.C Punnet pada tahun 1906. Morgan. sedang fenomenanya sendiri dinamakan berangkai (linkage).H. dan gen a berangkai dengan gen B. a dan b. Jadi. jika gen A dan gen B berangkai pada suatu kromosom sementara alel-alel resesifnya.Bateson dan R. Artinya. Gen-gen yang mengatur warna biji dan bentuk biji dewasa ini telah diketahui letaknya masing-masing. maka nisbah gamet AB : Ab : aB : ab menjadi 1 : n : n : 1. dapat menjelaskan mekanisme pewarisan gen-gen berangkai pada lalat Drosophila melanogaster. kB. dalam keadaan gen dominan berangkai dengan gen resesif. Saat ini kita telah mengetahui bahwa banyaknya gen pada kacang ercis.

individu dihibrid AaBb akan menghasilkan gamet tipe parental AB dan ab serta gamet tipe rekombinasi Ab dan aB jika kedua gen tersebut berangkai dengan kedudukan sis. pada Gambar 5.1.1.1 di bawah ini secara skema dapat diperbandingkan tiga kemungkinan segregasi dan rekombinasi gen-gen pada individu dihibrid AaBb.a) memperlihatkan pola segregasi dan rekombinasi gen-gen yang terjadi secara bebas karena keduanya tidak berangkai.Untuk lebih jelasnya pada Gambar 5. dan ditulis sebagai Ab/aB jika kedudukan berangkainya adalah trans.b) gen dominan A berangkai dengan gen dominan B dan gen resesif a berangkai dengan gen resesif b.1. A a gamet : A A a a a) B b B b 1 1 1 1 A a A a b) B b b B c) n n 1 1 A a A a b B B b n n 1 1 B b A a B b A a b B Gambar 5. penulisan AaBb hanya digunakan apabila kedua gen tersebut tidak berangkai.1.b) dan 5. Jadi.c). Individu dihibrid AaBb. Baik pada kedudukan sis maupun trans terdapat dua macam gamet.1.c) tampak bahwa segregasi dan rekombinasi kedua gen tidak terjadi secara bebas. maka kedudukannya dinamakan trans atau repulsion phase. Gambar 5. ditulis sebagai AB/ab jika kedua gen tersebut berangkai dengan kedudukan sis. yang masing-masing disebut sebagai gamet tipe parental dan gamet tipe rekombinasi. Pada Gambar 5. . Sementara itu.1. Dua gen yang berangkai cenderung untuk selalu bersama-sama atau tidak bersegregasi di dalam gametgamet yang terbentuk. jika gen dominan berangkai dengan gen resesif seperti pada Gambar 5. misalnya. Sebaliknya.1. sedang gamet tipe rekombinasi susunan gennya merupakan rekombinasi susunan gen pada individu. akan tampak bahwa dua buah gen yang berangkai dapat berada pada dua macam kedudukan atau konfigurasi yang berbeda. Jadi. Kedudukan gen berangkai harus tercerminkan pada notasi individu yang bersangkutan. Gamet yang terbentuk dari individu dihibrid a) Kedua gen tidak berangkai b) Kedua gen berangkai dengan kedudukan sis c) Kedua gen berangkai dengan kedudukan trans Kedudukan Dua Gen Berangkai Kalau kita perhatikan lagi Gambar 5. Gamet tipe parental mempunyai susunan gen yang sama dengan susunan gen pada individu. Kedudukan gen berangkai semacam ini dinamakan sis atau coupling phase.

Pindah Silang Telah disebutkan bahwa dua buah gen yang berangkai akan cenderung untuk tetap bersamasama di dalam gamet yang terbentuk. merupakan mekanisme penting yang mendasari pembentukan keanekaragaman genetik karena kedua-duanya akan menghasilkan kombinasi baru di antara gen-gen yang terdapat pada individu sebelumnya. maka kedua gen dikatakan mempunyai loki (tempat gen pada kromosom) yang sangat berdekatan. Gamet tipe parental jumlahnya selalu lebih besar atau setidak-tidaknya sama dengan jumlah gamet tipe rekombinasi. Selanjutnya. di antara keduanya masih terdapat pula kemungkinan untuk mengalami segregasi dan rekombinasi sehingga akan diperoleh kombinasi gen-gen seperti yang dijumpai pada gamet tipe rekombinasi. gamet tipe parental jumlahnya berkisar dari 50% hingga 100%. Sturtevant digunakan untuk menggambarkan jarak fisik antara dua gen berangkai. Peristiwa pindah silang. sedang gamet tipe rekombinasi adalah gamet yang susunan gennya merupakan rekombinasi susunan gen pada individu.H.Kebalikannya. seleksi alam akan bekerja untuk mempertahankan . Di atas telah dikatakan bahwa gamet tipe parental adalah gamet dengan susunan gen yang sama dengan susunan gen pada individu. sedang gamet tipe rekombinasi berkisar dari 0% hingga 50%. yaitu pertukaran materi genetik (gen) di antara kromosom-kromosom homolog. jika kedua gen tersebut berangkai dengan kedudukan trans. maka gamet tipe parentalnya adalah Ab dan aB sementara gamet tipe rekombinasinya adalah AB dan ab. jika suatu individu dihibrid dengan gen-gen yang berangkai menghasilkan gamet tipe parental sebanyak 80% atau gamet tipe rekombinasi sebanyak 20%. sedang gamet tipe rekombinasi adalah gamet hasil pindah silang. Sekarang dengan lebih mudah dapat kita katakan bahwa gamet tipe parental adalah gamet bukan hasil pindah silang. atau dengan perkataan lain sama sekali tidak terdapat gamet tipe rekombinasi. Jika gamet tipe parental sama banyaknya dengan gamet tipe rekombinasi (masing-masing 50% atau nisbah gamet = 1 : 1 : 1 : 1). maka jarak antara kedua gen berangkai tersebut dikatakan sama dengan 20% atau 20 satuan peta atau 20 Morgan. gamet tipe rekombinasi jumlahnya paling banyak hanya 50%. Makin panjang jarak antara dua gen berangkai. Di sisi lain jarak antara dua gen berangkai dapat mencapai lebih dari 100%. Di atas nilai ini peningkatan jarak tidak terus-menerus diikuti oleh peningkatan persentase gamet tipe rekombinasi. Sebagai contoh. Sebaliknya. Akan tetapi. bersama-sama dengan pemilihan bebas (hukum Mendel II). maka hal ini berarti kedua gen tidak berangkai. makin besar persentase gamet tipe rekombinasi yang dihasilkan. Dari pengertian pindah silang tersebut kita dapat menyederhanakan batasan tentang gamet tipe parental dan gamet tipe rekombinasi. Dengan perkataan lain. Setiap satuan peta ditetapkan sebagai jarak antara dua gen berangkai yang dapat menghasilkan gamet tipe rekombinasi sebanyak 1%. atau persentase. jika semua gamet yang ada merupakan gamet tipe parental. Terjadinya segregasi dan rekombinasi dua buah gen berangkai ini tidak lain karena mereka mengalami peristiwa yang dinamakan pindah silang (crossing over). Besar kecilnya jumlah. gamet tipe rekombinasi oleh A. Sebenarnya hubungan linier antara jarak dua gen berangkai dan persentase gamet tipe rekombinasi hanya berlaku lebih kurang hingga nilai 20%. Seperti telah dijelaskan. misalnya jarak terpanjang antara dua gen berangkai pada kromosom 1 tanaman jagung yang mencapai 161%.

Selanjutnya. Pindah silang terjadi pascaduplikasi kromosom Pada profase I meiosis kedua kromosom homolog akan mengalami duplikasi menjadi empat buah kromatid (lihat Bab IV). keempat kromatid ini akan membentuk sinapsis yang dinamakan tetrad. Dengan adanya miselium haploid inilah. Secara skema bukti yang menujukkan bahwa pindah silang terjadi pascaduplikasi kromosom dapat dilihat pada Gambar 5. Bukti bahwa pindah silang terjadi sesudah kromosom homolog mengalami duplikasi diperoleh dari hasil analisis genetik pada percobaan menggunakan kapang Neurospora crassa. banyak ilmuwan yang menganggap bahwa pindah silang dan pemilihan bebas sangat penting bagi berlangsungnya proses evolusi.2 di bawah ini. Kapang ini sangat cocok untuk keperluan analisis genetik terutama karena dalam fase reproduksi aseksualnya terdapat askosopra haploid yang akan mengalami pembelahan mitosis sehingga berkecambah dan tumbuh menjadi miselium multisel yang juga haploid. keberadaan gen-gen resesif dapat dideteksi karena ekspresinya tidak tertutup oleh gen dominan. Pola askus A b A a a a B B b B a B a B binasi A b A b A b 100% rekom- Meiosis I Mitosis a) Meiosis II. Oleh karena itulah.genotipe-genotipe dengan kombinasi gen yang adaptif saja. . Pada saat terbentuknya konfigurasi tetrad inilah pindah silang terjadi.

b) ini masuk akal. Hal ini jelas sesuatu yang tidak mungkin terjadi karena dari penjelasan sebelumnya kita mengetahui bahwa persentase gamet tipe rekombinasi berkisar dari 0 hingga 50%.Pola askus parental A A a a a B B b b b a a B b a a B b A A B B A B A b A b rekombinasi parental Meiosis I Mitosis b) Meiosis II.a) pindah silang terjadi sebelum kromosom mengalami duplikasi. Gambar 5. yaitu askospora yang berasal dari gamet tipe parental dan askosopra yang berasal dari gamet tipe rekombinasi. Di antara askospora tipe parental masih dapat dibedakan lagi askopora dari parental pertama (AB) dengan askospora dari parental kedua (ab). Oleh karena kemungkinan pada Gambar 5. maka dapat disimpulkan bahwa pindah silang terjadi setelah kromosom mengalami duplikasi.b) pindah silang terjadi sesudah kromosom mengalami duplikasi. Persentase pindah silang menggambarkan jarak antara dua gen berangkai . Tampak bahwa kedelapan askospora yang terbentuk terdiri atas dua macam. Ternyata dilihat dari kedelapan askospora hasil pembelahan mitosis gamet dapat dipastikan bahwa keempat gamet yang dihasilkan seluruhnya merupakan gamet tipe rekombinasi atau sama sekali tidak ada gamet tipe parental.2. Hasil pindah silang dilihat dari pola askus pada Neurospora crassa Pada Gambar 5.2. Sebaliknya.2. pada Gambar 5.2.

serta AbC dan aBc (hasil pindah silang ganda). Tiga Gen Berangkai Di antara tiga buah gen berangkai. pindah silang terjadi antara A dan B sekaligus antara B dan C. A a interval I B b interval II C c A A B B C C a a b b c c . besarnya persentase pindah silang juga menggambarkan jarak fisik antara dua gen berangkai. Ke tiga. misalnya gen-gen dengan urutan A-B-C. gamet tipe rekombinasi merupakan gamet hasil pindah silang. pindah silang terjadi antara B dan C atau pindah silang pada interval II. dapat terjadi tiga kemungkinan pindah silang. Sementara itu. gamet tipe rekombinasi yang dihasilkan ada tiga macam. atau seperti disebutkan di atas. persentase gamet tipe rekombinasi sampai dengan batas tertentu (lebih kurang 20%) memperlihatkan korelasi positif dengan jarak fisik antara dua gen berangkai. ada juga gamet tipe parental. Kalau kita misalkan bahwa kedudukan ketiga gen berangkai tersebut seperti pada Gambar 5. Dengan demikian.3. ABc dan abC (hasil pindah silang II). maka gamet tipe rekombinasi yang dihasilkan adalah Abc dan aBC (hasil pindah silang I).Peristiwa pindah silang akan menyebabkan terbentuknya gamet tipe rekombinasi. Kemungkinan yang terakhir ini dinamakan pindah silang ganda (double crossing over). yaitu gamet tipe rekombinasi hasil pindah silang pada interval I. Pertama. Ke dua. Sesuai dengan banyaknya macam pindah silang yang terjadi. dan gamet tipe rekombinasi hasil pindah silang ganda. yaitu ABC dan abc. pindah silang terjadi antara A dan B atau pindah silang pada interval I. gamet tipe rekombinasi hasil pindah silang pada interval II. Selain itu.

dari individu homozigot resesif aabbcc (abc/abc) hanya akan dihasilkan satu macam gamet. maka nisbah fenotipe yang dihasilkan tidak akan sama tetapi bergantung kepada jumlah tiap macam gamet individu trihibrid tersebut. Sebagai contoh. maka hasil persilangannnya ada delapan macam fenotipe. maka gamet hasil pindah silang I lebih banyak daripada gamet hasil pindah silang II. Namun. dan aabbcc. adalah persilangan suatu individu dengan individu homozigot resesif.3. yang masing-masing terdiri atas dua macam fenotipe. yaitu A-B-C-. yakni abc. A-bbC-.A A B b C C a a B b c c Gambar 5. aaB-cc. Sementara itu. Begitu pula sebaliknya. fenotipe sekaligus genotipe hasil silang ujinya akan ada empat kelompok. Jika A-B lebih panjang daripada B-C. Seperti pada penjelasan Gambar 5. seperti telah dijelaskan pada Bab II. Pindah silang di antara tiga gen berangkai Dari delapan macam gamet yang dihasilkan tersebut. dan kelompok ke empat gamet hasil pindah silang ganda (AbC dan aBc). kelompok ke dua gamet hasil pindah silang di daerah I (Abc dan aBC). sedang gamet yang paling kecil persentasenya adalah gamet tipe rekombinasi hasil pindah silang ganda. aaB-C-. gamet hasil pindah silang II akan dijumpai lebih banyak daripada gamet hasil pindah silang I jika jarak B-C lebih panjang daripada jarak A-B. A-B-cc. Silang Uji Tiga Titik Silang uji. Kelompok pertama adalah gamet tipe parental (ABC dan abc). gamet dari individu ABC/abc dapat dibagi menjadi empat kelompok. sesuai dengan nisbah gamet individu ABC/abc. Silang uji terhadap individu trihibrid dinamakan silang uji tiga titik (three-point test cross). individu trihibrid AaBbCc disilang uji dengan aabbcc.3. kelompok ke tiga gamet pindah silang di daerah II (ABc dan abC). Jika di antara ketiga gen tersebut tidak ada yang berangkai. dengan nisbah 1 : 1 : 1 : 1 : 1 : 1 : 1 : 1. karena baik gamet tipe parental maupun rekombinasi akan mempunyai susunan gen yang sama. jika gen A berangkai dengan gen B dan gen C. Abbcc. Bagaimana dengan gamet hasil pindah silang I dan gamet hasil pindah silang II ? Mana di antara kedua kelompok gamet tipe rekombinasi tersebut yang lebih besar persentasenya ? Jawabannya tentu saja bergantung kepada besarnya jarak A-B dan jarak B-C. aabbC-. ABC/abc tipe parental (persentasenya terbesar) abc/abc . Dengan demikian. gamet tipe parental dengan sendirinya paling besar persentasenya.

yaitu dua individu yang persentase atau jumlahnya terbesar (aBC dan Abc). Pemetaan Kromosom Data hasil silang uji tiga titik dapat dimanfaatkan untuk membuat peta kromosom. kita cari .Abc/abc tipe rekombinasi hasil pindah silang antara A dan B (persentasenya bergantung kepada posisi lokus B) aBC/abc ABc/abc tipe rekombinasi hasil pindah silang antara B dan C (persentasenya bergantung kepada posisi lokus B) abC/abc AbC/abc tipe rekombinasi hasil pindah silang ganda (persentasenya terkecil) aBc/abc Salah satu kromosom homolog pada tiap fenotipe/genotipe hasil silang uji tersebut di atas selalu membawa gen-gen dengan susunan yang sama. ABC = 265 ABc = 133 AbC = 6 aBC = 441 Abc = 435 aBc = 4 abC = 139 abc = 227 Untuk menentukan urutan gen yang benar pertama-tama kita cari individu tipe parental di antara kedelapan genotipe tersebut. cukup ditulis dengan ABC.4. yaitu abc. Oleh karena itu. Keduanya dipasangkan menjadi aBC/Abc. Di dalam peta kromosom tiap kromosom disebut sebagai satu kelompok gen berangkai (linkage group). pada lalat Drosophila melanogaster telah ditemukan adanya empat kelompok gen berangkai seperti dapat dilihat pada Gambar 5. individu ABC/abc. yang terdiri atas sederetan gen-gen dengan urutan dan jarak tertentu. misalnya. Kemudian. Langkah-langkah untuk membuat peta kromosom dari data hasil silang uji dapat dijelaskan dengan contoh berikut ini. pada prinsipnya pembuatan peta kromosom meliputi penentuan urutan gen pada satu kromosom dan penghitungan jarak antara gen yang satu dan lainnya. biasanya notasi fenotipe/genotipe individu hasil silang uji untuk gen-gen berangkai sama dengan notasi untuk gametnya masing-masing. Jadi. Dengan demikian. Begitu juga untuk ketujuh genotipe lainnya penulisannya cukup seperti notasi gametnya saja. Sebagai contoh.

dapat disimpulkan bahwa urutan loki gen yang benar adalah A-C-B atau B-C-A. Ini juga kita pasangkan menjadi AbC/aBc. Alternatif ke tiga (terakhir) adalah mengubah urutan gen pada individu parental menjadi aCB/Acb. individu parental harus kita ubah urutan gennya. Setelah hasil simuasi ini dicocokkan dengan individu psg yang ada ternyata susunan gennya tidak sama (abC/ABc tidak sama dengan AbC/aBc).individu hasil pindah silang ganda. yaitu dua individu yang jumlahnya terkecil (AbC dan aBc). yang ternyata cocok dengan AbC/aBc. 0 y (yellow body) 0 ci (cubitus interruptus eyes) w (whirte eyes) (bent wings) N (Notch wings) (shaven bristles) ec (echinus eyes) rb (ruby eyes) bo (bordeaux eyes) cv (crossveinless wings) ov (oval eyes) ct (cut wings) sn (singed bristles) ed (echinoid eyes) dp (dumpy wings) cl (clot eyes) spd (spade wings) lys (lysine accumulation) jv (javelin bristles) Hn (Henna eyes) fs(3) G2 (betina steril) Cy (Curly wings) net (net wings) 0 ru (roughoid eyes) 0 S (Star eyes) R (Roughened eyes) bt 3 sv IV t (tan body) ras (raspberry eyes) m (miniature wings) wy (wavy wings) g (garnet eyes) pl (pleated wings) tu-48 (abdominal tumors) fy (fuzzy hairs) corr (corrugated wings) J (Jammed wings) se (sepia eyes) cur (curvoid wings) rs (rose eyes) Gl (Glued eyes) st (scarlet eyes) b (black body) eg (eagle wings) . aBC/Abc disimulasi untuk mengalami psg menjadi abC/ABc. yang ternyata masih belum cocok juga dengan AbC/aBc. Individu parental disimulasi untuk mengalami pindah silang ganda (psg). misalnya menjadi BaC/bAc. Jika individu ini mengalami psg. Dengan demikian. Artinya. Individu parental dengan urutan gen seperti ini (lokus C di tengah) jika mengalami psg akan menjadi acB/ACb. maka akan diperoleh BAC/bac. Oleh karena itu.

sd (scalloped wings) r (rudimentary wings) B (Bar eyes) car (carnation eyes) rd (reduced bristles) stw (straw bristles) cn (cinnabar eyes) che (cherub wings) cu (curly wings) bx (bithorax body) sr (stripe body) bb (bobbed bristles) 68 I c (curved wings) Amy (Amylase) rf (roof wings) nw (narrow wings) vg (vestigial wings) U (Upturmed wings) Dl (Delta wings) e (ebony body) cd (cardinal eyes) obt (obtuse wings) dsr (disrupted wings) hy (humpy body) ra (rase britles) a (arc wings) Frd (Freckled body) M(2)c (Minute body) 106 108 II Pr (Prickly bristles) r sd (raised wings) ca (claret eyes) M(3)g (Minute body) III Gambar 5. Peta kromosom pada lalat Drosophila melanogaster = sentromir Kromosom I = kromosom kelamin .4.

seperti telah dijelaskan sebelumnya. acB. dan ACb. 17. dan dinamakan interferensi kromosom atau interferensi kiasma.J.4% Interferensi Kromosom Pada contoh soal tersebut di atas terlihat bahwa banyaknya individu hasil pindah silang ganda ada (4 + 6) / 1650 x 100% = 0.1%.4% x 17. AcB. Muller pada tahun 1916. yang masing-masing sama dengan persentase pindah silang di antara kedua gen yang diukur jaraknya (ingat ! besarnya persentase pindah silang menggambarkan jarak fisik antara dua gen berangkai). Jadi. Oleh karena individu parentalnya aCB/Acb.1% = 5. Dengan demikian. pindah silang ganda adalah dua peristiwa pindah silang yang terjadi bersama-sama pada dua daerah yang berurutan. Nilai ini merupakan persentase pindah silang ganda yang benar-benar terjadi (psg O). A 30. acB. individu hasil pindah silang antara C dan B masingmasing aCb. dan ACb. Sementara itu.12. Derajad interferensi secara kuantitatif diukur dengan suatu nilai yang disebut koefisien koinsidensi (KK).2% = 0. Jadi. Nilai KK = 1 menggambarkan adanya independensi yang sempurna di antara dua peristiwa pindah silang yang berurutan sehingga psg O sama besarnya dengan psg E. Nilai KK berkisar dari 0 hingga 1. sedang jarak C-B sama dengan pindah silang antara C dan B. Oleh karena itu. dan pada contoh soal di atas nilai KK = 0.Mutan yang diawali dengan huruf besar = mutan dominan Setelah urutan gen yang benar diketahui. Namun.1% C B . nilai KK = 0 menunjukkan bahwa dua peristiwa pindah silang yang berurutan benar-benar saling menghalangi. Sebaliknya. ACB.6% / 5.2%. jarak A-C = (227 + 265 + 4 + 6) / 1650 x 100% = 30. interferensi ini menunjukkan bahwa pindah silang di suatu tempat akan menghalangi terjadinya pindah silang di dekatnya. maka secara teori besarnya persentase pindah silang ganda seharusnya sama dengan hasil kali masing-masing pindah silang (lihat teori peluang pada Bab II). Seandainya kedua pindah silang ini benar-benar independen satu sama lain. yang merupakan nisbah psg O terhadap psg E. maka individu hasil pindah silang antara A dan C terdiri atas acb.6%. Pada soal tersebut di atas persentase pindah silang ganda yang diharapkan atau seharusnya terjadi (psg E) sama dengan 30. data hasil silang uji tersebut di atas diubah urutan gennya sehingga menjadi ACB = 265 AcB = 133 ACb = 6 aCB = 441 Acb = 435 acB = 4 aCb = 139 acb = 227 Selanjutnya. Biasanya psg O lebih kecil daripada psg E. kita dapat menghitung jarak antara dua gen berurutan (A-C dan C-B). sehingga jarak C-B = (139 + 133 + 4 + 6) / 1650 x 100% = 17. Fenomena ini pertama kali ditemukan oleh H. jarak A-C sama dengan pindah silang antara A dan C. nilai KK berbanding terbalik dengan besarnya interferensi.4%.

nilai KI juga berkisar dari 0 hingga 1 tetapi berbanding lurus dengan besarnya interferensi. Dengan demikian. Cara yang paling lama dikenal adalah analisis silsilah keluarga dengan mengamati pola pewarisan suatu sifat. Untuk menggambarkan derajad interferensi dapat pula digunakan koefisien interferensi (KI). Namun. Pada tahun 1960-an terjadi kemajuan yang pesat dalam pembuatan peta kromosom pada manusia berkat ditemukannya suatu teknik yang dikenal sebagai hibridisasi sel somatis. yaitu sekitar satu di antara sejuta sel. Pemetaan Kromosom pada Manusia Pada manusia dengan sendirinya tidak dapat dilakukan pembuatan peta kromosom menggunakan data hasil silang uji. Terlihat bahwa kromosom 17 merupakan satu-satunya kromosom yang keberadaannya berkorelasi positif dengan aktivitas timidin kinase. kedua pindah silang makin menghalangi satu sama lain atau makin besar interferensinya. Dalam hal ini kromosom 17 selalu dijumpai pada setiap sel hibrid yang memperlihatkan aktivitas timidin kinase dan tidak dijumpai pada sel hibrid yang tidak memperlihatkan aktivitas enzim tersebut. Dengan adanya variasi jumlah kromosom manusia pada sel hibrid. Teknik hibridisasi sel somatis pertama kali digunakan oleh G. Selain dengan virus Sendai. Data hibridisasi sel somatis Nomor Aktivitas Kromosom manusia . Di antara sel-sel hibrid hasil mitosis ini selalu terjadi pengurangan jumlah kromosom manusia sementara jumlah kromosom mencitnya tetap.1. Sel hibrid yang terbentuk kemudian mengalami pembelahan mitosis sehingga dihasilkan sejumlah besar sel hibrid. Dengan demikian. Barski dan koleganya pada tahun 1960 untuk menggabungkan sel somatis mencit dengan sel somatis manusia secara in vitro. kedua pindah silang makin independen sehingga makin kecil interferensinya. Sebagai contoh. dapat disimpulkan bahwa gen yang mengatur sintesis timidin kinase terletak pada kromosom nomor 17. frekuensi fusi dapat juga ditingkatkan dengan pemberian bahan kimia polietilen glikol. makin besar KI.Makin besar KK. Artinya. frekuensi fusi tersebut dapat ditingkatkan dengan penambahan sejenis virus. Cara yang sama digunakan untuk menentukan bahwa pada suatu kromosom terdapat gen-gen tertentu. yang telah diinaktifkan dengan radiasi ultraviolet. yang nilainya sama dengan 1 – KK. yakni virus Sendai. Sejalan dengan penemuan ini berkembang pula teknik sitologi yang memungkinkan dilakukannya identifikasi kromosom dan segmen kromosom manusia. Tabel 5. keberadaan gen yang mengatur sintesis enzim timidin kinase dapat diketahui dari data seperti pada Tabel 5. Oleh karena itu. Bahkan dewasa ini teknik DNA rekombinan dapat digunakan untuk isolasi dan identifikasi keberadaan masingmasing gen di dalam molekul DNA kromosom. Penggabungan (fusi) sel ini berlangsung dengan tingkat keberhasilan yang sangat rendah.1. diperlukan cara lain untuk dapat mengetahui susunan gen pada suatu kromosom tertentu. dapat ditentukan keberadaan gen tertentu pada suatu kromosom atas dasar aktivitas enzim yang dihasilkan.

sel hibrid 1 2 3 4 5 timidin kinase aktif aktif aktif aktif tidak aktif (+ = ada. – = tidak ada) X Y 1 2 4 7 + + + + + + + + + + + + + + - 9 + + + 10 + + - 15 + + + 17 + + + + - 18 + - 21 + + - 10/31/2009 Posted by zaifbio | Genetika Dasar | 5 Komentar GENOM ORGANISME .

Salah satu kelompok peneliti. maka untuk mempelajari mekanisme transmisi gen perlu dilakukan pengamatan terhadap perilaku kromosom. Meskipun demikian. ketika itu belum dapat diungkapkan mekanisme transmisi gen dari satu generasi ke generasi berikutnya. Begitu juga. hukum Mendel II (pemilihan bebas) hanya mengemukakan bahwa segregasi pasangan gen yang satu tidak bergantung kepada segregasi pasangan gen lainnya. sedangkan bentuk bijinya diatur oleh pasangan gen W dan w. Demikian pula. T.BAB III GENOM ORGANISME    Pengertian Genom Struktur Kromosom Jumlah Kromosom BAB III. Dalam hukum Mendel I (segregasi) hanya disebutkan bahwa tiap pasangan gen akan dipisahkan ke dalam gamet-gamet yang terbentuk. sejumlah sifat lainnya diatur oleh pasangan-pasangan gen tersendiri. Sebagai contoh. Selanjutnya. melalui studi pada lalat buah Drosophila melanogaster mengajukan konsep bahwa gen merupakan satuan-satuan diskrit (terpisah satu sama lain) di dalam kromosom. Beberapa tahun kemudian barulah diketahui bahwa gen terdapat di dalam struktur intranukeus yang dinamakan kromosom (chromo=warna . Jadi. Morgan dan koleganya. GENOM ORGANISME Analisis hasil percobaan persilangan yang dilakukan oleh Mendel telah memberikan pemahaman bahwa satuan-satuan herediter yang mengatur pemunculan sifat atau fenotipe individu bersifat diskrit (terpisah satu sama lain).H. rekombinasi gen akan berlangsung pada saat terjadi penggabungan gamet jantan dengan gamet betina melalui perkawinan. soma=badan). Oleh karena gen terdapat di dalam kromosom. khususnya selama . sifat tinggi tanaman kacang ercis diatur oleh pasangan gen D dan d. masing-masing pasangan gen tersebut merupakan satuan-satuan herediter yang terpisah satu sama lain.

Genom Eukariot Di atas telah disinggung bahwa genom eukariot terdiri atas beberapa buah kromosom. Kebanyakan spesies mempunyai 10 hingga 40 . genom suatu organisme adalah kumpulan semua gen yang dimiliki oleh organisme tersebut pada setiap selnya. atau berarti hanya mempunyai sebuah genom. Dengan perkataan lain. Lalu bagaimanakah hubungan antara genom dan kromosom? Organisme prokariot seperti bakteri diketahui hanya mempunyai sebuah kromosom yang tidak dikemas di dalam suatu nukleus sejati. Gambar 3. dan semua gen tersusun di sepanjang lingkaran tersebut. Pada Bab III ini hanya akan dibahas sekilas kedudukan gen di dalam kromosom. Posisi di dalam kromosom. Oleh karena itu. genom organisme prokariot dikatakan hanya terdiri atas sebuah kromosom tunggal (lihat juga Bab XII). genom eukariot tersusun dari beberapa buah kromosom. sel-sel lainnya (sel somatis) hampir selalu mempunyai dua buah genom.1. Tiap kromosom membawa sederetan gen tertentu. Selain itu. yang menampilkan peta kromosom pada lalat D. Jumlah kromosom dasar di dalam genom haploid pada umumnya berbeda-beda antara satu spesies dan spesies lainnya. Kromosom ini berbentuk lingkaran (sirkuler). Contoh deretan lokus sejumlah gen di dalam suatu kromosom eukariot dapat dilihat pada Gambar 5. Pengertian Genom Secara keseluruhan kumpulan gen-gen yang terdapat di dalam setiap sel individu organisme disebut sebagai genom. atau dikatakan mempunyai genom diploid. kromosom eukariot mempunyai bentuk linier. yang ditempati oleh suatu gen disebut sebagai lokus (jamak: loki) bagi gen tersebut. Sementara itu.4 (Bab V).berlangsungnya pembelahan sel (lihat Bab IV). Genom/kromosom prokariot Berbeda dengan genom prokariot. melanogaster. baik pada prokariot maupun pada eukariot. Jumlah kromosom dasar di dalam genom suatu organisme eukariot (biasa dilambangkan dengan n) dikatakan sebagai jumlah kromosom haploid (lihat juga Bab VII). jumlah kromosom ini tidak ada kaitannya dengan ukuran atau kompleksitas biologi suatu organisme. Sel-sel kelamin (gamet) pada manusia merupakan contoh sel yang mempunyai seperangkat kromosom haploid. Namun.

sedangkan beberapa spesies paku-pakuan diketahui mempunyai beratus-ratus kromosom di dalam genom haploidnya. Tabel 3. Kromosom-kromosom yang berpasangan ini dinamakan kromosom homolog.1. sejenis rusa kecil dari Asia.buah kromosom di dalam genom haploidnya (Tabel 3. Demikian seterusnya hingga pasangan kromosom yang ke-n. .1). hanya mempunyai tiga buah kromosom. kromosom nomor 1 dari genom pertama akan berpasangan dengan kromosom nomor 1 pula dari genom kedua. Muntjac. Artinya. Jumlah kromosom pada genom haploid beberapa spesies organisme eukariot Spesies organisme Jumlah kromosom haploid (n) 16 7 17 10 21 12 6 11 5 4 3 18 6 14 25 17 39 20 36 24 23 Eukariot sederhana Saccharomyces cerevisiae Neurospora crassa Chlamydomonas reinhardtii Tumbuhan Zea mays Triticum aestivum Lycopersicon esculentum Vicia faba Sequoia sempivirens Arabidopsis thaliana Hewan avertebrata Drosophila melanogaster Anopheles culicifacies Asterias forbesi Caenorhabditis elegans Mytilus edulis Hewan vertebrate Esox lucius Xenopus laevis Gallus domesticus Mus musculus Felis domesticus Pan tryglodites Homo sapiens Pada organisme diploid kedua genom akan berpasangan pada setiap kromosom yang sesuai.

Lengan yang panjang biasanya dilambangkan dengan huruf q. dan akrosentrik. Sebagai contoh. dan kedua lengan kromosom semakin jelas beda panjangnya. dikenal ada tiga macam struktur kromosom eukariot. jika pada kedua kromosom homolog gen a berpasangan dengan gen a.2. Sebagai contoh. Bentuk submetasentrik menghasilkan dua lengan kromosom yang tidak sama panjangnya. akrosentrik. maka akan didapatkan genotipe homozigot resesif. lalat Drosophila melanogaster mempunyai dua buah . Pada bentuk submetasentrik sentromir terletak di antara tengah dan ujung kromosom sehingga memberikan kenampakan kromosom seperti huruf J. Dilihat dari kedudukan sentromirnya. submetasentrik. evolusi kromosom sering kali cenderung mempertahankan jumlah lengan kromosom tanpa mempertahankan jumlah kromosom. bentuk metasentrik ini menghasilkan dua lengan kromosom yang kira-kira sama panjangnya. tiap gen yang terletak pada lokus tertentu di dalam suatu kromosom dapat berpasangan dengan gen yang sesuai pada kromosom homolognya. Terlebih penting lagi. dan akrosentrik tadi sebenarnya agak dipaksakan. Klasifikasi struktur kromosom menjadi metasentrik. Bentuk yang ketiga. yang telah kita ketahui berbentuk linier. Oleh karena itu. Jika pada kromosom yang satu terdapat gen A dan pada kromosom homolognya terdapat gen a. yaitu metasentrik. maka akan diperoleh genotipe heterozigot. Klasifikasi struktur kromosom eukariot Kromosom eukariot. istilah-sitilah tersebut sangat berguna untuk memberikan gambaran fisik tentang kromosom. Demikian pula. gen A (dominan) pada suatu kromosom dapat berpasangan dengan gen A pada kromosom homolognya sehingga terbentuk genotipe homozigot dominan untuk lokus tersebut. sedang lengan yang pendek p. Sentromir adalah suatu daerah pada kromosom yang merupakan tempat melekatnya benang-benang spindel dari sentriol selama berlangsungnya pembelahan sel (Bab IV). s s a) s b) c) Gambar 3. Struktur kromosom pada anafase a) metasentrik b) submetasentrik c) akrosentrik s = sentromir Pada metasentrik kedudukan sentromir lebih kurang berada di tengah-tengah kromosom sehingga memberikan kenampakan kromosom seperti huruf V. Struktur kromosom ini dapat dilihat dengan jelas ketika pembelahan sel berada pada tahap anafase. Akan tetapi. submetasentrik. ternyata dapat dikelompokkan menurut kedudukan sentromirnya. dijumpai apabila sentromir terletak hampir di ujung kromosom sehingga memberikan kenampakan kromosom seperti huruf I.Dengan adanya kromosom-kromosom homolog.

Sebaliknya. masing-masing lengan metasentrik pada manusia homolog dengan lengan panjang akrosentrik pada simpanse. Kromatid Kromosom yang sedang mengalami pengandaan. yang satu sama lain dihubungkan pada daerah sentromir. Akan tetapi. Tiap kromatid membawa sebuah molekul DNA yang strukturnya berupa untai ganda (Bab IX) sehingga di dalam kedua kromatid terdapat dua molekul DNA. yaitu suatu protein struktural yang berperan dalam pergerakan kromosom selama berlangsungnya pembelahan sel. Jika peta kromosom kedua kelompok Drosophila ini dibandingkan. Demikian juga. simpanse dan manusia sama-sama mempunyai 22 pasang autosom yang secara morfologi sangat mirip. akan nampak bahwa tiap lengan kromosom metasentrik pada D. melanogaster sesuai dengan lengan panjang kromosom akrosentrik pada Drosophila lainnya itu. terdiri atas dua buah kromatid kembar (sister chromatids). manusia mempunyai sepasang autosom metasentrik yang tidak dimiliki oleh simpanse. Bahan penyusun kromosom adalah DNA (asam deoksiribonukleat) dan protein. telomir (ujung kromosom) sentromir (konstriksi primer) kinetokor kromatid kembar (sister chromatids) .autosom metasentrik yang besar sementara banyak spesies Drosophila lainnya mempunyai empat autosom akrosentrik yang kecil. Dalam hal ini. dan perbedaan letak ini dapat digunakan sebagai dasar untuk klasifikasi struktur kromosom seperti telah diuraikan di atas. Pada Bab X akan dijelaskan bahwa bagian-bagian tertentu molekul DNA merupakan gen-gen yang mengekspresikan fenotipenya masing-masing sehingga DNA dapat juga dilihat sebagai materi genetik. Letak sentromir berbeda-beda. yakni pada tahap S di dalam daur sel (lihat Bab IV). pada simpanse terdapat dua pasang autosom akrosentrik yang tidak ada pada manusia. Autosom adalah kromosom yang bentuknya sama pada kedua jenis kelamin (Bab VI). Pada sentromir terdapat kinetokor.

3.a) b) Gambar 3. Gambaran umum struktur kromosom eukariot yang sedang mengalami penggandaan a) kromosom b) molekul DNA 10/31/2009 Posted by zaifbio | Genetika Dasar | 2 Komentar « Entri Sebelumnya SINOPSIS BLOG INI BERISI SEMUA MATERI TENTANG BIOLOGI DAN PENDIDIKAN YANG DIBUAT OLEH ORANG YANG HAUS AKAN ILMU DAN BERCITA-CITA TINGGI UNTUK MENJADI DOSEN DAN MEMAJUKAN ILMU PENGETAHUAN DIMANAPUN DIA BERADA DAN MENGABDI .

.5.948..2:3 503097.8 40:7#9/.9:83...33/:8 5.397.3:2.3203..3/032/.3.3/-..7839088574903 &39:9:/-:9:.3 80:2.7-4842.3-07.7 2#./.39/.28.9-.40-07-.10798.-08./..54070805947:8:8.3.. .3  $.3 ::3./.580 240:2#/.39.3.35748083.203.:-..9:9..9:5033.9.9/97.0/.9202-7.251.3.9/:3.9202.387584047243/2:.80/980..3.9..3/..8  $.9  ./.8897:9:72.3503..03503.3 97..9/.3 57480842508.3.9.224/1.3 907.9:850780 /.80-:9:.. 47243/..50702-./-.3203.9:.4-3.3 4489.8 !02-039:..907-039:4250847243 70805947 $090.-08.7.3202-:9:.5.3/03.507:-.7..9:7.9:8..302:/.2809.3/.370.3//07.3.9.3/.8.3 203.251.80  .9:797.803 .8.3038943/.9:.3.570:7847..:.2 ::3.3802570.28:.5.7503./.2203.9:7.34489907.390780/..5.3820 503.0380-.7.7:/48803.77-4842 9.0-.2../.3/50740809.:./03.3.7570:78473...302:/.47243  240:5749030.5.9:8 7...3.038090.3.3.-0-07..597.3-0.3.3//..3 57490390780-:9.38200:.5./80..:39:20.3.33.7.035./..38758 07/.2705..0345:8./:52# .251.8240: 240:7# !.3:9.-08.3.3/507:.39:3./07974-. 80 80570:78479/.38.507:/./03.3 90.0.-09:-.03/03./..709/.2. 708543907.2025:3.9.20309.397.9/809..45   2#802570.3/9.037#3.30-/.//..3574808.9:7.32.8:3.33.802-./..749 .5.803907./3.73.3/09.38.251..80./507:.:2.8..550702-./ 9.:0-7:29-..:-07507.3 907/./.-0-07.709200.3/03.3:39:203.9: 037#.472430 /.3/03.3 88.3.7490-:7...9.4394 80 8007974-./5033./8.8.7809079039:203::0809./.80  037#-07.583.7.347.  .9/-..2.032397.89.3/...9.9:70:.7./.8.803.9:  2#8.303 .4  $0.8.3:2.380:2.:-..8.383908880:2..3:2.80-0:2.251.4394 .3/.34489/.703.709 0..780-.3./././3.38090.749 $0-.. .2.8//.9183.3 . 830.3//.251.33/:840 .3503.32033.749 2085:33./4-32.3907/7.30.03-../.: -.9:503.387580:.::5:39:839088240:90780-:9/.9079039: $0-.3:39:705.29.32.75.8.3/7#/...3-0:2907.3 9..8  !03.80:2.3.5.::5-.8472430/.8203. :9.5.9..9907../.382007.8.3.2 3:0:8207:5.8 03.-08.9//.2:3 80.3203.7574903.448990.. $02039..//.308570803503..78.297.3.5.3.3-0:2-0702-.2 :2.3-0-07.3802025:3.3  2# 8:507570.9.3.8.8.7-:50780 40: 2#8.8.9: 80203307 2./.9:3.380./.387580:.8.3/2#8:507570.32025:3..3.3574903 897:9:7.3/03..7.3/02.574..8-.83203.82.8.83 2.39:3.8  0.04254 .3.3 .3.9:7.80390780-:9.350702-.././.-07.  .749..9: 2#8:507570./.7.03 /03.5.380 . 4443:2 207:5.70805947.28:28:29:..387580:.032..80380-03.  .8:.9:20. 03./.8 .3.5.7/:.3:2.803. 09.28945. 425083907-039:-.9.947.73.2809..34080 80570:7847.3.78-08.9.3/3.

28945.33..9:/ ./.82.7907-:.2 /8:39/03.9.507-0/.3.3.38758//.3-07-0/./:9:8 .:7.5:./5.-:23 $390883.3203390882#90780-:9 .38073.  .9. .:2:33472433.9574903./.5/.0897403/-07..73.35.8..9202-:.73.3.8.3.9:574903010947   .38./.03.9/.3897:9:7742.   503.73.  034203.2.3/97./09.3-.8574903.892:.3.: 909.8/03.20/:.30897403 .3-07-0/.3839088032..50789.57:5.3018038-07-0/.9.93.2 3:0:84250890780-:9 .3 -07-0/. /902:.3203.80 804.9:7.80 80 .3  /..3/.7.-0-07.3.3   507:-./.28.9.320302-:8/3/33:0:8:39: 202..9:8 28.8:3:0:8 !7480880.39.5.2085:397.8.3.032#54207.3.802:/.:.-.3.3202-07.8090780-:9907.230897403 .3.3.2..  !.3:980.38:35.557480832# :.7.35.-07.2:2.//..387584047243.5.3. ..  !03.. 8390882#:39:4.240: 240:2#./.909.703.9..9.9.870570847 /.95..5.-:235.240472430.390724/1.80  43943/:897.. 8:./:9:8.9   3.3.4250847243 70805947.34.-0:2-..70805947472430897403//./.390:7 4.3708543-07:5.03880..3 .39./.3907.3907:8-07.2.9/.38...././..2025:3.8839088 4.3/03.3:93.38...9:  503./:9:8......9.

/.8.3-07.507-0/./. .38.3. 2#.8.339743 003.203.2./.3.3.5. 502-:.2.703.8040-07-..354.7:/./...703.9907.

/.9:7.203..3203:3:.9:7.. 5. -07507.3 ./  80:2. .80/2#  !03.8907.-..3  503./03.703.749.90780-:99/.9..574903.9703/.//.3/7:39:9/.3.94443 80/.32# 20.3/97.3.9.80./.30-:7.3-:.57:5.2.83./ /.7.3 2025079..907-.38..84085072.33..  43/8-.38.9:7..3/:25.387588.89:/3.33.9:7./.9:.3-0:2/-:.28090:7.2. 5.3/.8:.3:2:72#:.3909.73.80..749.75.3240:2# .73.:39:97.9.800--.0:.:80:7: 839088574903  %0:7.3820503.2.2.3.38.2 2.10798.3/97.80-0:2/.3 85.9..80-03..3 /.84.9: 83..38.397.947707:9203 3./:25. .340..32#907802-:3 2.92085:303..3 03.3.320.3 8.. ..9:7.3875572073.:839088574903203.507-0/.2.88.38:.8 ..9::38:7.8.90:7./-:.3./..3-0:2/09..397./.9:7./..5.3425087-4842 2#  .80:2./8./. 909..2.3..3.98 .8.   503.2.2502-039:.3.3/3.3-0:2/97.2#9/.39/.3:2:7 10920 240:2# /..20.3203.090780/.5.3.82#5.397.5 -09:10798.3 2#  !03.8 07-0/./.. $090:73.38.3 97.3 1.3/839088 .502:/.574.3.:50702-..//.38205748083  :8:83.3-0:2 /-:.83.25079:2-:.2:2..0.3-.3.39.3907.8  $3.3./.3.9:7.3.38./.2.2#.989.2:3 .3 /02..:.390780-:9 .2503.-44-0781.503.3/.9:38:790780-:9 909.33..

  .9:039:3.3/3.8.4394 4380397.39.574/:03 $0-..288902802.80-.3. .5073.85749039:803/7907.7.3/7/.574. 240:574903.7499/.5-07.9/.-07..2#54889743 909.39-4//5079.97.749907/.3907.8..3203.08908 4003257490.545059/./.3/03.38./ 240:.38203-8.340:7:9.390754943 54943:39:203.5.340 20..7.809079039: %025.29::7:9.2.5/58.52#  $0-.0:.83039/.38090.3203.383908854574903 !4574903.9 /809.8 97./.2-.5.2349079039:.5.  5.3..0..574903/..257480897.5.38.-07::7.3 -08.95024943.380.38..5749039079039:/.78..3 /03./:25.9.95024943..43/8./.8.9  $39088-0-07.3-071:38807025.3:9: %.2-.38.9.73.980-.92#54889743.3.34389..8.380:2.9:740.$39088-0-07..3 404/438945/.3    .9 9025.88:.9:80203 !.2.33./.83 2.3503..:503.3 ./.9025..55749033/.9: :7:9.5..:8:8/03.9./.3/.5.9:038240:.8.. 909.9.34/43...339/.7.3240:2#..803...9.39-4/ 90780-:9-07.3/5.8 . 909.3/58.3203:98:.574/:8.3/802:.

.

7%3. !4890/-.8.9070309 !02-:9.7 %#%   %#% O O O O O O !02-:9.....8$0243807. %.380-..:38./.42039.1-40309..8.9843 7.380-:.'7:8%079039: 4/0$97:9:740:203:7:9.3#80-.90703095.9070309 #05.91 #05..

3/03.3./.2.9  085:39073.3-.83...:.2./.3:8.7 3:0:8803.2.7..3148147 .:/.3/:3397403/.2.280  .8.3.:38047..9.9: .9.3:03.92.38:.33.32.8/.80.3#05./03.23:0.9.9/84.8.0/4907./.303::3  %#% !.:  .93/84.73:0:8-07-.8.07 20302:.3/$0/.5.203.980.9.8/.9:9:1:383.88.-0781.   08.302:/..23:0.-0:2/09.8.2.

:389:/ 2748458203:3:.7:03 $97.39070-/.8.9:./.907530:244:8 $970594.747.7:038073/..3202-039:443/03..3.3  574903/03.9...7:3.:574903  :.-503.23:0:880 842.35.30502-..9.9/3108/03.3507.3/3108/03.720.-0781./..9.8.3.9:39:20.5.3938.3.380.82.9: 80.9070309 ./9:2-:.3 /./9/.32.303././.3.3#.802.3//.3203/:33.9.7.3$90780-:9 $0-.5 $02039.7907../.:.3$.58:548.9-079...:302:/.3/:5 02.3/.3-.:909.9:9:90.3.5.2:3.9: .1.0.3820  80-..9.3.9/84.257802:. /09.90.20/:2 5.:..5 80..8/:5 %073.2 7424842:. 203.3 203:3/.203./..3.7.920203:8.39:-: 0.7:3.9/-:9.507903..9.3 /.39.3#/.33.3 -08.9.9:.3907.2.7.8 ..8/:5  ..3/.80-.3 02..3-.2539: 3:0:8.  085:3/02.32.3.::..:3 9..3/.25.5.2.3#/..9:7..7.58:548.202.33203.7.4-.9/./..2/0487-43:0.../:././5.3/.907030980..3.2.3..7.3 90.8897.2..8508089079039:2025:3.30..303.:/047-43:.3530:244:8.-:9507.2-.8897.90703095.8.3/03.3-07:93  !07.3 897.9: 80/.-0781.-07-0/.5:.3897.703.3202-039:443/03.7:. 203.3$.3$.3 3.3/:3.9:2-:.4.0.80./.::5.3.27-43:0.3.9//.7/...-.3.3.9./  /.:320.20/:25../.5.9.:5:3 0.2-.207:5.-.2:3 5.32025:3..3 .3-.:35749030-/..882.38:380-03.80842.3./..3/3108/03./.7.9...8  71195..7.. .7/.3203:3:.9.32:9.5 80/.3907-:9-.9530:243.983.897.5...9 2..9070309  0.33.35079...9070309 /./ # !.93..3...:7-43:.9..3...2 .3530:244:8$.380.703./.9.3..203.8./...9.39/.:.9/84.3.897.5.380-./.9..9574903803.9 .95::9.9 !30:244:8.907530:244:8.9.9 .4-.3503/.3/:7.985.5.9070309 .9.3909.747.3.9 203.8.307..9 -..83.747././:.3.25:7.3 5.29:9/./.73..3.3805.4-.3 9././.803.../9:2-:.32:9..7.32:9.9.33. /..::5 :../.38205079.9070309 .3#  03.3503..9/.3.0.25.980-.-079.:8530:243.:8203.3 8..:897: .2..35..39.897:9:77424842 .33108-.32.27424842 .8.2:7:3..39:-:0..882.8..3/902:.8.381472..23:0.7025.3.25:.8.7:03 2032-:.5.3203.3207:5.9075030-.3$ 80/.9-079.3 /..7: 5./03.5.2.3. 5..3...39073108803.3 -.8.3.7 03.7.7.3507.7: 5.202.3897..3-.7:03/.907/.9070309  802039..33.203.3 .920303..397.5.2./.3:.3809.820488-.380-.3 80-0:23.3/03.35749033.03 2../.3/. .3.3897.:80-.907/.3/:3.:507-0/.3/.3 5./.3//...2.9070309 .3./5.3/:3.3:39:20339088.47.3/:5 .240: 88.82..5 8890200-.3907:9..9 20339088.09.3.3/3108/03. -0/..3.5.3/.2.9.32.3/:3.7.:3 .5.83 2.

907530:243.2030-.8 0897./3.3#897.9 /5.3#  897..3-:99039.07/.2-.:39.3/53/.23.58:/././$8050795.32.3907/.9.20.8202-:9.# ...9.47.3 .3/.:././.97.808:.3. 507.3:3.3#-07:-.974 .574903 97./.7./.3/./. 574903439.3#  .381472. 897.5-07.574903439.3:39:20309./.8909.:.9:/03.2.3.2-.0.4-.80 5020./.9:...-.-.7897.3$ 0897.3 202-:9./.80:2.2.20897./$ ../ 793..5 .8/:5803.8.3# $897.203. 9.30:9:7897.39073.897.23.381472.4-. -:.3-079.3 97.3-0781.3032 #..880.203.381472.3#.907.9070309 .3/9:2-:.33.381472.9.3#897.3$ ./$ %7.2.3507.9/.:03257490.2..8..381472.32.5.3././897..907.3 .3/.92..3#-07:-.2-.3/53/.203..890780-:9711920325:.:574903    :9:7897.3.780 80897.3#  070.203.5.47.380-.3 /.4-.3 503. 2.90.30..3909.8  81.3$0897..:.9.397..3$.9202-039: .390780-:99073.897.5.3#203.390.8907..04/ /.3.4-..2-..80.3 0897.-.3# $897.7920./.257802:.2-..7:03  !07.33108-.37119 .9:/9.3#9/.3$.032.4-.4-.07  .3 507../.3#.89/.3$.3#.90741..907.3#.5...80 5020.3203.80 :9:7:9:7:9:7 897.9.3711980/95:39/.9.3# 57490.80 5020.3-.-07:-.3 802:. 97. /.9897..80#.3 ..:.381472.58:-07:-.381472../.3 0897..7.7  .8907.9...7897.3..703.350309 ..5.507.905.3 /9.:897.4-.3/20/:2 5.390.03.3 .397.3/-07.9070309 !07./507:-..2:3 5.3820  . .202-07..9 /.85.3-.9202-039:.3897.2507.:.9:.907./ 897.

9-08.3..9. .9./.790%//.3/58.:2025:3..9: 8.5.2.38:8 70574/:89..7:8.-0/03.3/.:7 /:5 -.3!0803.4 $0-0:23.37.3-.203././/.59/..2507...-0/3108.3$/.4-.37.288  73.907 %//.3..30- :7.//.4803.4-.280-.33.3.2-.203. //.790%.80 !07.3!.7.280 ..30:.3  !   .3-.80/980. 5.4/902:.7.9070309.9..33.9.7.2.330.3108%5.37.490./.7.3907:./3.%.-07./:3.280 3..35.7 80 .8503./.9073. 2:..8:.4./.3 5.- :.!07.3 907.9.4.:.203.-.4302:/.0-07.-0/03.3/.35.790 5.3203.3  -.90703092.2...5240:574903/.390../.5. .8:3.3/.'7:8 ..3907.5...381.9070309  ./.3.970574/:8 -.5.8507.:.203. &39:202.3/.:2.3.5.3/:3.3.38.3.340-.90741.3/.%0/.3/:3148147/.8 80 80 . ..3/2.2.3-.203.9-.3.9/./.7   .38:/..: -:.574903  #80-.  . .35.-0/03./484945!  2.30/.3202-:9..280 80 ..4-./48494590780-:9 ../.90741.80.3.9.3/.3.3574903.547.3.4 03.7.3202-:9..3 803971:.2.89..33108%5.90741..33.33..2:2..388  -.3/:3148147909.38:33./03.3.//.3/.3:2:23.3.8 203:3:.  2.7803.3  $    803.5.3.9070309%0/..2.35.790%200.90741./. ./. ./484945$ 80/..-03.9.:3 40 0780/.3-.3.980/9/902:. //.2.280 80 . 5.4  /:9402.3 .790%2.38.3::30473.202:33./.3.3/2.2803./09.503./484945$  $0-.59/./3/3803.3 7.790%90..-0/03.3-.4.90741. 200.07.3.38..280  .790%.3 80-.48.90703095.7: /.9.302-.8-..38.90741..9070309.8:.790 5..: . !74903 .3574903/.75.%/03.3/03.5./484945! 80/.320307.3/...2.2./.5.790 5.9../. -.%/.3-.35..9: 09.3/:38:1:7909./484945 90780-:9 5.8: /.3/.3203.%/09.790 5./3/380 .907.7.5.350.9070309/. %073..3203./. .4-.3/:38:1:7 /.92..790%.-0..

2503.3.3-07507.7897.#  4254882.9.32..3/. 3:049/..3  574903 # 5028.9 %.780:-:35749033.9203:3:.703.3/:3397403 !. .-07.7:8.803./03./..20.3/.80-.89.350309.8.3574903897..9/80-:9:. 80/.9079039:240:#/.:./.0/:././..2.%'.7-48..: .3 /7043899:8/03.3.3..35034247..202-039:240:.3...3-.3 %'...8.3 80-./.9./.5.23:0.7# /.9425./.9.:-.3 /3108.-:3.9:/03./ 1.# -:.392-:3.8.:3902-.53:049/.53:049/.8..3.3202-:9.924.5.3207:5.-07.90703095./.030 437.7-43 /./.9.2.3:.503948.././..38.7 8:-:39 8:-:39-07:.#3.3507..:.8 503..7./.9.902-. 397403-07.9:.397403/9039:.8.%' .3203039:.3:048/.503.7897.3%'897.-.5. .3574903/.5. /:-:3.942./.9070309 .2..3574903 &39:202.280:-:3574903 03./..3897.547. 24341481.35. /0487-48.2-.3 #/..32030-.3.340.:.9:.503948./..33:049/.9 .3-.7897../.3/.3..39.8.:.7  !07..2:0.3.907 03095.3 $0-.37043899:8.3574903  0.../03.803../.9  :.9425.2.:.3.87043899:8302:/.207:5.9.947.:. 909.3 $3075. 4254303 .3#80-.3 .9425079.9 :.3...3 5034247.7897.543:049/.3/03.38.303.3 0/:.3203.9:::81481.809.3/:3240:#.37043899:831080/..74240:39078:8:3/.4-.3 2434207 ..380.8.3-.2.314814/08907.8 503./.397403 -.89.4-.9/.7:824..3 40 7.503948.3897.3/.5.3-07.397403 942 5.#..:.:  '7:83203. /.424.9078:8:3/..23:0. #/.2025:3.%' %'897..-.7902-..5.8.9.9.380-.#3.35.0-07.:39: 02:/.3/7043899:8/03.39/.390.882.803 :39:202-0/.74240:90780-:9.3.:3902-.2025:3.: 574903 .7:89079039:/09..8.39073./.7897.3..3-.3/.:3 #/.9/58.3./.:94-./.907/7..:9/./.39. 805079.33..  03:7:90-.9/825:.3203:3.9: /... :049/.:3  070.3%'.3.9/. :.9.-.3/.7.3/..8.8.2.33.503948.9 :.7897.3/.7.32./03.5.39.3907-:3:8//.-07:93.7:8 .5.7:8.3 507.8.380:-:3574903/.2./.3 897.8.3/80-:93:049/.380-..5.3/.3 /7043899:8 /03..8.7:8 %' .503948.7203.3/80-:9 3:048/....

39/03.8.5.5.8.3:7.2025:3.543:049/.3 #.89483  .3/.9.       ./03..9-07:5.5.897:9:780-.5 203.  $02039.3./3. 2.503948.3.9: -..2.572/35.7-48.:923 % !.8.::.3-. /.3.37.3.3./:.9::8803./. 80/. 3207:5..:/80-:9572/3 .8.9                            :.3./033  .3./03.:39. 2.5.:.39:3..:/80-:9 5:73/.8.203.8.9.240:543:049/..8.990780-:9    ! ::81481.3/0487-48./.0/:.2./.3507-0/.3/.9..3.9-. 94234247 5.9/.9-07:5.:5:3# /.33  80/.7.907/.:39.. /0487-48../.9.8.7..2 .# 909.3./...#9/.:.2..5.923 909.3.5:73 -.5.3-./.9:3./.23:0.3.9::8 805079.5 /.3-.8 &  .39.397403.

/03./. 4380397.5./0338.3.9:   .3/.3/:3./.572/3949.:340  .382080.338.23:0.8.8..78508080850808  .203.9.:.:203:3:.8.9843 /.5:73949.3923 80/.11907.7./03.8./..8./03.5 4380397.3:..8.33 894838./.8-.5 38-.3803/73. 4/0897:9:718240:5079.3.340 .882.3/.8.524/0 90780-:9 .:.7  42543032./8.34380397./.3-.2-. ..3.2.8 -.      .3/0/:8907.3-.9-07.220./.47. 4380397.9843 7.7.35..4380397. 397403240:/..7.2.3909.33              89483923:7.8.8  ./033 923907./:. /.2.2.3/:3./033:..9 4/0$97:9:7.7-07-.3   7.:.8/.389483  03..8:.

90709..33.8.7.:7:9.28:2-: /.3390780-:9.5..5.3::3 ./.5.3-.338-.. 39.94234247 /03.9./.9:  ::33/3.9..: -075.38.3/03.9/.8. /.7.:::3! 0/:/:.-.. 53.7.:39.94234247 5.7:89.3 203.8.90780-:9 2../:-:3.9:8.7.8.8.3.3-.543:049/.30/:.3.3.5.2.3./09.33 203:-:3./.3. .3-.-07:93.7 40   38 # 7.5./.37./0487-48.:39.:39..8..8.8.33 /.543:049/.55.340.3.397403 9:2030-.8  3:049/. 80/./17.3974039078:8:3.9843/.3907/..883./.9 .8/.8.3-.::33/3.3. 3:049/.8.8.7909./17.3.33. 8.39.8.94234247 .:.3.59.3.9.543:049/.-9.38./80-0.9:  -09::7:9.28. -.35:.:39.33907..9:2025:3.3.5./.35.3.3%.39338-.3.5/:..340.3/. -.8.:..3. 8.39.9.3.7::3 0 2.89.8.203:3:.  ::81481.. .5.2.8.3907.203:8:.8./.7.33:049/.80.3/74037./.3/74037.850249709. 909.9:::3:39.9:.3-.40..80-.703.9 5.7/.314814/08907 ./.118079./..-..8./.0/.3.3-075.-07.3240:203:3.395..3-.7.8.3  S 907/.7./.5-07..8.9::39.-.7.32030-.8240: ./. ?  .3 14814/08907/03.80-03.9.3  $09.9..8.3..8.703.78:2-: $0507990.3..3.:39.395. .9/9039:.3703/.079.3 7.-07:93.543:049/.3.7.3 ./.3 8:2-:.8.9803.543:049/.3/03./. -. 8..7.35.-.2.3 .5.-.3.3.. /.3/7403  0.9::39.  !4.9.9.3-.3907/.383.:39.8.3-07:7:9. /.-./.9.8. 397403203.3:.3.80-.7.39.42502039078....9/.2.-0753 /4:-00 03:7:924/030/:.0 ./805.24/09.8.:::3  ::3.7.2.3/:-:3.-.42502039073. 2025:3.94234247 9/.7::3 ::33 .3-09:5:.8.8.3::3 .33.5075.2.324/0897:9:7.8 240:3.9::81481. ?/03.32023/805./80-:9.:39.20.8. :39.38:2-:240:/03.7::3 0    !   !  !  !  .3-.9::39.5  202503.: 2. %907.3/7403.73.5.5.3-075.9::8   0.%5.39. -.3.7.3.50.:.9./.738/.9.9 .-9.9:8.3/50740/.33.80./.3203.7. 09:5:. $.0/:.7.

.7:8203. /.39073.2507:-.38090..907030980.9.2. 2:9..3905.8 .5079.3-078.9240:073.:50789.2897:9:7240: :. :383207:5.3/.8.9203..907:3.3.32..7:8/.8.9070309 $090.7:8203.3 /...5  085:3/02.3389483 :38.3/107038.1../..3803..80 0307.03/02:.-07.25:-07.38:3  :383207:5. .2-.9070309..3/.90703095.3820 .9203.3 20.747.5.3.2.3.331472.9/.907 0309 ..8 :383207:5./033923:.3.7...80203.907-:9-.!  !  !  !  !  !     .31:3803495 ...1:38544-07:93    .9-.3/.38202:./..:08570803 .2-0-07.3.3202-.5.3820 9.70307.0380-.: 705.4:84307 .8.3/.3 09...78.331472.35.7909:.-.7.9:750702-.9/.9070309 .7:8/.343/83:3.. .8 .47.59./805.380-.320.3103495047.32..890780-:9/./. %..9070309.8/03.31:38103495 .05.3/03..70307.3.9: ..3:9..2.3.33.9:90.7:82.320.5.340240:90780-:980-...80-.35073.907 0309.5.3.3802./.8..25:20325.4:89/.8.507:-.947.7 .-  .8705. 2./:/0.3 -07:-.9 81.9:.3.23 0.8 81.35079:2-:.7:80/980.3820 793.91:38.320.7:8/.3/..09:7:3.3-08.3 80.3/..7.78....847.3.39.9 20307:8.31:380.8    ..-    .5.207:5.749 3.800307.80309/.8./../.

3.2039..705.3:39.38./.17.5/5079..3/:25./.5/5079.90 -.39..9 02:/.8 80243807.3...3/850781 !.39070-/.3 .9: 5.203..:39.7..83 2. -0780.7: !.83:39.3.-.3 803//.9047098705.3907-039:.::803.3502-039:...35073./.7..843807.-0753203.3 17.:39.80-.-0753-.9./..2502-:.3 9025.217..3-.09.3..29. .3 .3909.3203.203.8/ 80:2.7:                     .17.203 17.8.7:  $02039.9180:7:9.9:43807.#05..203543:049/.3-0793/.09.705.2..543:049/./ .3..2033:049/.390758. 543:049/..0/:.3...3-.91 /.. 909..8 /.91  80243807.3/.2:3 2...7:803.8/8507810/:..-.7.9025.3..705.3203.502-039:.919.-0753.-0753.3/.7:./:8:.3-.543:049/.

4/03.480.3.32..5.3   $9.890780-:9/.7.3/:384945397403 :39:203.3/3.93.8.080843/.4-.95078.07.3 202.703./039 .9..03971:.907.-0-07.3$9.5.5.9047098705.0307.9.9..393.3203.33.83 2.   0.240: 240:/03.9 203:9507:-.38..2.2-.2.80243807. -.8. 803971:./.4.3802:.30-:7.2.20./.8 02:/.8.7:9...9..7:  .307.8-07:93.9.240:80 80-.90790780-:9.3849453974033472.5.9 /58.9.  070.38.3/:8:.3 .9.2.-0-07.8802-.7.0307.7:9.390780-:9 ..:340 $ 080843/.8 2.91/850781 .220/:2 .5.  .3 5.3203./.2.3.380 80-./03.293.5.3-07.8.20/:280.91 .4-.83.39.3.75.8 :39.3/03.9078./9:2-:. 3472.5.3 0-73.907 .:39.9805079.4:20 ..3/:384945 /.3974035.9180243807.943 !07.38 808:247/./.5.07.3.3  07.9.397403..-0-07../.7.33.3-.3-07-0/.8//.3-.33/..9:.39. $0-..3-.2.3.705.3/:3 2025:3..5.83. 43807.203:2-:.3 ..30-03.0307.5.3/02-.3203.5.3..5./.7.7..2.5.393.9/-:9.09.5..9..9..3/03.:06:-7:2/0389 7..7  %.3/./.30-93/.9 40:/03.. -.907.-.3020/:23472.950.3. 80.907.507-.:507..3/.  40:2025:3.3.803971:.3 -07./03.397403.3.3.93.547.8.7...907.7.3 -.

.3 .2/.

2 80/..3.9./.7:9.   ..3.307.5.38.

8   .-:3 40:/03.9.:/80-:980-.3.907..3.33.79.2 2..3903.9.7:9..2. .4/9:2-:.39079039:.320303/.0307.393../03.3./-.3/1:8.3907.2025:3.07..8/03..3 8.9.3  5../9:2-:.580-.25.-:3 !.20/:2   3.290780-:9.3903.4. 3./53/.3.320307.90/:/:.4.8 9.8.5.3 0.9 /.9-.202-./03.907.803971:.-.2..50/. .7.3.35.703.2..3.3.7:9.5.38.907.9. .35079.8.9.3$9.2.23.9.3203025.8.3903.207:5.-0-07.-:3 $0.3:93.3.5.20/:2 9073.-:3803971:./.2  09.0.85.-:3 09.2.8 3.35079./.3-7/ ./.3.-:3 80/..9203025.  802039.2./88.7.-07.5..0307.3.9240:/803971:.9203025./.3240: 240:.05.3//.240: 240: .2030.  . .2.3-.-:3909./.0307..3.0307./. 8090..3/0897../.35./.20/:2907.3/0897..89..393 02:/.3.3.33.907/.7.9-.9.3..3 02-..393.780 .9. 752 /..8./0802-.9.3.393./.:/.3 . ..5..5.3.490./.780 .9.9.80/:.89.9.3/9:2-:..30/:/:.5.9.8.8 3.0307..380.5 080843/. /.0307.2./-.020/:2 907.79.38.7.9.../.9.9:3.203025.3 -07.993 .3-.

.5.8      0897.. !.307.5.39.7 907.5:2..39075709.8  20/:2    .880. !.5.:5:./. -7/ .2.-.32..3703/.7:/03.3909.83 0.8. /:25..3.3-.3.380907:83.880243807./.7. 20/:2  0307.3-.9../.  909.502-039:. 0307.7:/03. 80/.0307.9-./03.2-.3240:20.8-7/3.3/03.9.3803971:.3. 0307.3703/.91       20/:2 0897.7.9..:705. 02..307..9..8/.3.52:3.4-.307.3703/.393/.8507.8      0897..

7.9-.9033907.7..35.8.3080843/.3$9.390780-:9803.//03.2-. 705.73.2507.314814/08907 .3705.3805079:7:1:3./.3$9.83.3 839088 :39.7:8 4745.38200:.8240:/.9.9::3 5005.9..2-.9079039:.7:907.-.2./03..9.3/03.87424842/.3::3 !02-039:.20.705.7: ..8Û 909.:947.390705.9..3::3 /.7.3/50740/. ::3  9025..:39.2-.203.8.83/.780 80 .:87:.8.3::3 502.-.5.-07-039:203./.80-.7 3.3:9: 80-03.  0897.-.8Û 5.3/03.:.-0:2/09.3 903.: #05.3240: $0.20.3705.35024943.3 3:049/.4-.7  #05..7499073.2-..3  ::3 .9/..3.07.2-.32.8/805:9.880..8803971:..././.7.749/03....3 705..907/. -07-..23.73.83.9./..32.0897.9.8/.7.4-07.3080843/.2.8.3 .2-.3. 705..314814/089075.7..3:9:*.2..705.3202507.7     503..507.3 503.3705.943  #05.30/:..2039.3..3274845009743 03.80:2.0705.390717.::3 .3::3 /..20.80243807./47.3 202./.7  ./.:947.38:33.3/3./.8803. 20/:2  0307.3-07.5..329443/7. .3203::3 743.1/.8.3.3203::3 :39.2-039:3..7../47.5:.7.7*-.8 /.347.9203:3. 574.73./.3 047  907549433.7.3.8 .703.3 203.91  !.8/.202-039: 047 .8  39075709.7. /.4-.3 90780-:9 $0.7:/.8.3/:9405005.3/0483:049/.

240:/%!/9.:39..7.3.//8:.3.3.: /0483:048/.9. 47/.:# .3/50740.802.9../03.3907/7.8.8.32.3/.9 /%! /04889/3971481.09.7/%!. 574..3.83 2.3/:3.8 .3-..3:049/.09.  .971481..32028.:.8/:.8 #05.8.. 38.203.80 .9: .7.0/:.7::3 0::3  %%     .7  .032 $.7.9 /%!  /048:.80.3057207/.3:39.3-0707. -/70843. .8.9.9.9.:39.75:705.2705..09...200-.3/-0-07.380:2.9:7 502-039:.3-.8.5.3.2025:3.39.839088 503.80/.5.338.9.9025.3.-:..399.240:.83/9.9/902:.83.2-.3/3..5.3/%!907.3.. ::8  -0-.38:3/..%  %       .8 705.8503.9 /%! /.3:049/.8.9-007./.380-...5.. .:47341705.95.9.7..-.2.2.9421481.:7:9.3/./:.703.9 3:049/..7.3483971481./. 2:..9-.3:049/.749 907.3/04892/3 971481.8025.2.    !03.9:/.3/:..2-.747203::/:..8 40:.3/. /02-.8.89. .75:705.82./.93.8907. 9/.:5:30:.9/.5.     :.7.9  32 032.3/3.3907...3803.8 .3 907.9:   0483:048/.8:2-07-..3907/7.790780-:9 80-:.3203..3 240:.23.//:.24341481.8 .25:20.749 80.3/09.9..9 !! /05..:839088 20-./-07.8 839088  #0.8870.8.3/80-:980-../.70...502-039:.3 !.3.90    $0203.9.3572073/507:.8/048. 425430370.80-:..03254207.9421481.3/507408:.3907/7...7/.9:9025..2-.39.8..943 47 !74808 38.8.7.9 /! 9.7492.2.03254207./03483971481./705.5.23:0..9-07:5.8 ...2-. 543:049/.883908880./ 502...3/.3-07.9:740 -0-07.2-.9.2-.33.2-039:3:049/.754207.3:39.314814/08907. 38..3-07507..8839088 /507:.3-.. -07.0:.7:803..380-..99079039://.3.9...3..3 -07507./.9 .703.9503/0 /./..5.705.09.3.3.3 9025.39.32025:3.:2./..    &39...2-.3-.8 -.408.7.9 /%%! 0025../..3-07/0.3%%        /%!!!         !!! 54207.8705.80!!!!           .30240:57207.9240:3-071:3880-.703.

2  .80:39:83908874248425. .2.. 80/.3.9: 03254207.749/80-:954207.3:9.8.2-..3507.70.2. 0:.80 !4 .2839088 !4 207:5.3 80:3/07 $02039.80.3032!42020.3/507:../..3:39:8390885.80 !4 /./.80.8839088 3254207.7  $02./:./.3032705.4.9:54207.354207.7..

353.8.3503.09.9.80/.3... !74808705.:.::3 ./.  .2574808839088.3.3!4/.80.78.2-../.7.3.3/.7 .0/:.538.9.:5024943..3-8.8..8..3.7.543:049/.   %.9.8 80-.32. 8.9.33.5..9.3240:3:049/.9.7:39.3/.3.3 0/089. .7.83:0.803.9::39.38:380.9.8 203.31.3839088.3/ $39088-.9: :39..503.34393:803.80843:0.3  03/43:0.203../..3.80   .9:7502-039:.3 ./.3 503./.-  32.3 -.3 203/089.:542078.2:3  8390885.3/.9.8..38..:-0707.390780-:9/3..98.:502.314814/08907//.3.3./././3  :8:8032!49073..839088-.7::3543:049/.8.2033/507:.:39. 9.203.-007.3 5744170...  32!4/.80  /8.9.3../.5.3 2028.3.9:/..:08.3.42025:3.2039075:9:8 5:9:8 .8.9.380/.90780-:9/.3907.3 /.:39./..8839088:.3.7:/.353.25:20.3574903.9.8.83 2.7::3  0::3 .::3 793.9:502-:.3 17.538.:.832025:3./.3-../  0843:0.3:39.839088 .3-.3:39.9:.80.572.2-.9.7::3 0.7.8.-.907.//.3/.:.3-07507./. 08.-075.2:39. 8.8.9073..3032.:-0707.8.503.3 809.907.  %07...73.3./..543:049/. 5./805...4393:803.7:. /:.3203.80..8.802025:3.  $0.47 $090./.9.3240:57207//.203 17...-.3.:.20-.39.3.0/:./5.9./839088-.:39.3 :38507-.3./3 897.8.7:.7::3 0::3  .: 502-:.8390885./2085:38..8..3/0.2.5...9./. 5.90780-:98073/3.2-:317.253 ./5...2 502-:.4393:/.3-07:93.8.30327. 0..:39.340032!4/.39. -.3043.3-07.7::3 0::3  !..9.880-03.3 -072.3-..39.3502.7. 909.85.3-08.39:2-: /542078.83:0.9.503.3.38:39/.203.7./.907.33.7:5./.317.9..54207.0/:.-.:39.3:39.3/80-:9.3.33:049/.3 28.308.8./.8.203.9/-0/.3907.0323-07507.-07.9..8.7.80 . 543:049/.9:39/.32.. 5024943. 57207907-039:-.9:39:202507-.08..55.5.. &39.9.8.7.  !...2.9.7::3 0::3 .8020.7.7:9/.:39.9.39075:9:8 5:9:8  &39:203.80 323-007.80  #05./03.80/.80843:0.8..-3574903 0/:..3.0/:.9::39.-07.2025:3.8/03./.-./805.9.7032 54207.:39.7..80843:0.7.3./3.3/.3:39.31:38503:393.80:9.574808.07.3.-.3.

3203.39/..3897.09..2..3/ $02039.203 17..        17.7:4393: :39..  $0507990.:39:20./80-.317.3/.34081.8839088  &39.-.903254207.3/8.203 17.33.4393:80-03.      :39.7.39/.  .203.4393:/3.7.203      .3 .2705.5.9. . 808:.2.9: 17.90793.. 0 8079.3 38..3.203 .73.7 839088.9:.7.33.:39.8 17.920339088/.:.09/./80-:.7.-.8390889/.4393:9:/80-:9:39..203 ./.0/:.3:9:/03.8.85.3203.25:.3-.3032.. .80      47:39.203 17.3-.50302:3..39:.. :39./02:. 90793.7./.80.7  .2./.503.3/.2-.3/./03.

.

7.780 .  .9:2743:0:8.3:93.5..54/ .9:2743:0:8.9.808:.229488203.39./.229488203.8.3  80.:.32743:0.../03. 202-7.29488203.3.90/:.8 $.//:.3204882743:0203.31:80/:.3203.80 0843:. 803./ ..2743:03-07.7.9:2743:0:8/54/ .742039.1-40309./5079:.3203.3. 2743:0203. 203..54/ $0./.:3 3..530/:.80.54/ 0/:.-:3 202-039:8./8. !4890/-.39.32743:0 .54/ ..3/0.3:.7.8.80-070.0309203.8..2./8.2/:..2743:0..3/:9/03.203.39.3.7 $9079.37:8.390788.35.//:.5.380/9025..8./.39..2 /00307.302:/.7.39::/..9:2743:0:8/54/ :...9:2743:0.//0..2743:0 .203.390788.38.907.8 $.9.39::/.2/00307.

5 .39.3203. 50309 805079%  $4330-473 203..3.80 80320.2743:0./42449.38945.25.2085:380.83 80320.82  !./.-07.39.3 502-:3:  .5.2 2.25...9-.907 502-:3:-07-039:59. 02:33.0.38:.2/./ 034950/.9:89079..790.28945.907/.3803.9:81.:3.7.3 50789.703..3424489..03//.20.55.338-.8.5.80.2:2.8. /:.3897.3.3.743:0  0/:.39:305./.0425480 .80 ..3/5074080502-:3:  /.  5./2.32.5. 803.5033.:3380. $03.790.034857.9.2. $0-.3 /.82.:5:3 .3.93.72743:0 .3203.3897.3 502-:3:  .. 502-:3:  07  .-.80! .5.3...9.:94./50740/:.3.7  ./.. 50.790.3802:.743:0:8.82.897.5.790 5.35.790.:3/.:.8..8.3/:3 5.92743:0/54/  $090.:2./025.790 5.35079.9: 43/8.3502-:3:.207:5.343:.3/02.3 897.808:..9.25:203././8943088 5028.2 8945..390788.9502-:3:.209-093./902:.302:/.9..3/: .9:74003 037424842.3.825....3.39:305./.:3 %.-07034950 ..380-:..380-:../...8..8-093.9:2...55..9:74003 037424842..-:.82 9/.9/.1034203.78.780-:..3/.78.8..3502-:3:.907.3 502-:3:  /03.38.950393  .310799.9.3472.229488203././.7.9/.:94.3.502-:.92743:0/54/ :./.2-.-079:.8.2.3-:.3/.3507::39:/09.3./.81.:94.:94.39.3:93.3802:.8 ..:./80.3.3502-:3:/9039:.5.3203.55./.72.8/03.3.:2.3/5074080502-:3:  /.2.-07.3502-:3:20.-07.25:-079.907.2-..80..30-07.3.8.82/.3502-:3: 5.31034950-:.82.3203.28945.82./.2743:03-0702-.1.340.3.//.35.9078945.3472.8.7.9/.55.8..8./03..5/.9 203.82.2083 80/.3803/7  :8:83.:70.9:0425480 .38945.39079039:!.33.857.3574944.:5:3 5.30/:.203.5.39.3202:33.83 2.780502-:3:  8079.:./.3-07.809/././.8 .9.3502-:3: -..-. 090744990780-:99070-/./.90782-43 .7.9/..8945.3.33.3-07.793..82.920307:5.32.95.3.91/..3//.3/:.39./507408..7.380502-:3:.:.7  .220488203.::203.3.//.9907..2 2.2./.: 5.7. 0907449 80 80.8.:.3./5079:.-.380:2..38945./.80502-:3:  20..3.802.2/.9073.55.//.:70.9.-079:.3 0-07.82909.037424842.025.3-.:8945.3203./80-:9 80-.7-..3..803. 2.3/03./ !079..3.83/03.7909:803/70-07. 802039.35..54/ 03..9/50.3502-:3::39:-079..380-:.8..9079.790 .57480870574/:8/..320../...:3 -/...:94.380 /50740/:.39.50.2.28945.9078945..3.5.83 2.   $9079..3-07.8:./54/ ..3-:. .703.3-07034950  .3/80-:980-.23:0:8  02:33.30/:.0/:.2.9/.2..: -:. 0/:.55.7 ./809.9.3502-:3:  .5.-07.80-:.8-.3.3/.0.5.0/4-.790.35403.5./.38.-.3.3.890780-:99..897.38945.78./.38907.55.380-:.2.380 502-:3:/.9.909.7.9203./:.82./.03 03. 0-07.3897. $9079.3.9:.3/03.25.33.73.43941034203.3../.3/:5 2.3.3 /02.9202. 2743:0/./.:94...7.5./423./.

:3 -7/./:2./. ..8390.3 5078.-.3/.39.././0820.2.  !4.3.35079..8...380.35..:3 ./50.0307.:507.8 03889079..389079..3/03.802./:3.-093.909:.3..2574/:8-./8.95.2-.800307.78./:3472.33/.3./.7  3/.39.3/: .80-.740 #4.50..380-.9/.5.7.4-.

.

7 .7%3.8  -093../.39. 202507400307:39:5079:2-:. !4890/-.3.7.3 3-07:5.3.3/. .1-40309.950 .3.3.3.070.3.9070309//.33.7.302.8.  -.9:740 2.8..39 !078.3.88902839088 57490329443/7.3802:.  :9.3/507:.39.3 /.7.. $0.91 $05079 .2.3./.2:9..3802:.39.35099 2:9. 5078.354203.3..3..3.380-:. 54/.3950.3 :39:202-039:574903.307:8.0/.3.-093.3.9/.229443/7.3:.33.-42.8.-482048/. $ .8.354:.7/.54  $0-.5079:2-:. .2.3.93.32:9.90780-:9/3.0.9070309//..3.-093.42039.2-.3.2:9.2209.31:38 29443/7.25:.7203..3 09:7:3..350995..354 542:9. 800.24745.39.3472.35.35420307:5.3 09:7:3..

70.01803  .89/.: 5:9 ..4745.5.3 .8  .5::025..3.5-0785..39/.99/.3-07-0/.8//.9.73.90/ $0 805.9/.9.24745.3/:3 4741 80/.009.3 :8:83..3-:3.9 ./.8 909.9.3 .85078. -0/.:3 20.340909:./9039:.74770385././././.: 5:9 /.8. 5::025.009.3.3.3.50.9070309//.5.3-0.5.-07..  $:.9 7.3 -0.. -0-07.78. 2.-.3-07.2.9/.2.3.78../..2.73.3..7.3203.9 202-.3 -0.8.-./. 203.3.20.3.82.507-0/.-8.73.3.3. 4745.4745.3 -0..3.73..  $02039.9:.2025:3.-.3./.3 7085745. .3.9-.3 -07.3.380 805..074-.919.3 8.9: -.9.73.5:99/. -093.2.:.3-07..9.91.:3 5.3.50.28945.39079039:805079-:3.3/03.: 2025:3. .73.:71072039.3. 90780-:9802.9:9./.3..3.

9-07..3202-.73.:-././.: .8703.8-.8/.329 /.380.: -0.320303.350.8./03.85078.2.-07..3 ...: ./:.9/..5.3.3.-093..49/.3 -0.5403.805.4745.9.802-.:5:9 -0.5:9 909:..9/.3-:3.3 ..-093.: .7950.3 !:9 .-.: -0.-0   0..5..:.329 0/:.3.80.2.3//.3 -0.2805./.4745.2.:-07.5.: .5.35.3 4397-:8 4745.3  !0309..3... 80/980.50.8.3 -0..: -0.39.39-49  $0. 4/0.4745...: -0./.3 -0.3 !:9 .7%.39.9/.95.: .3 -0.80-.9/.3 -0.3 5:9 5:9 5:9 ..103495009:7:3.3 -0. .8.2.7::7.8 09..3.7800.. 803.5./.3 .2/4243.83.39:305.39039..78.38945.3-08.703.:380:07 ././03.3/02. -:3.2.7/ .280.5..3 .33.502-.35.:5:3 9.: .33.880 80 -.: .8.3.9/5.320280-:.%.907/7.35:.8 802039.8-./.3 ..54/3/.3  .85078.3 -:3...5..9203..390780-:9/.9073.-0 -.3 9.2.9/.:5:9 -0.32.9.3 .23-093..3.2.3 !:9 .3 2030.80507990.381./.32.5::025.78.3 03495009:7:3.2/4243.78.:5:9 .9.3:93.:907. -:3.3 -0.3 -0. 909:.3 2.80-.3. -..3202-./.89.9.9 034950.3.2-.9.3 -0.3/.2.342-3.. 5:9 5:9 5:9 .9..3 1034950909:.32. 909:..3.9.3/.-0 .: -0./.38.9.8 03./2:33. 034950.8290.3.380.78.5.2024745.3.3907.3../.350./50.909.7.80-./.3 -0.:5:380-..9.9 80:2.9/825:..:8.2.8:2-075403 909:.9070309  /. ./.9073.-093.3/ . ./.95.2-.907/./.5.7   %.-:3202-039:49/54/ ./.-.

9-:.54/  0.47414745.9 /9:2-:.3    8090:7                                      5403                   49          .3907/7.2-.703.390780-:9::7.78.2.7 2.9.2.3 0349503.3907-039:...3203:3:.8 .5../..3.89/.220488:39:203.80.-.9073.9/. $0 80.9.35.35.82.2.9 5.    5:9.9.32.5.33.7  4/050.8025.20/:2800915.//./.-08.29097.3203.3.3-:3.49..38..39097.3202-039:443.3.4397-:88945./.80950./.54///.3 -0./.5::025.:-0.8. 05.8.0/:.

:.70/:.38970594283 897  .8/.3.3.3.909.3.3:35.8. /.340909:.34745.3../.703./03.3 4745.909.8/-...3203.3.39-4980.2-.34745.3..8 03.0349508.3. 3... !078.8.329 897 /03.:-.39.9:80-.25...2./50.7039.29 ..3 90780-:9/.3802:.3. 9.34745./.78.82     29 897 49 29 897 29 897 4929 897      29  29 29 29  29  29 29 29        .50309..78.930./.34745.3 907.8203:954.58970594283-07.3907.3950.8 2.3.329 897 203.-:3. !078.35:.39:305.3-.8.3 :35. 907.50.3../.9.39.80-:..5.8./.950..381.3203:3.38970594283 897 802039.3 4745./ 50.7 /.3203:3:.9/.3907.30897.39:803/7 .3/.89.85078.39-49 /./.88-42.8 /.39-495.3.4745.39-49 -07:-:3.-:3. /.8..:/9039:.3.39:305.5./.3 507.3.3..329 03./.8090.8 $0507990.78.0/:.9:950..3/03.7039.7.3907. 8.78.950.33.9:909:. 2.2-.78.729 .3.3..390.18 :39:202-0/.3-.8/.80..3-07.3.58970594283203..202-:9.3507.3503.2025:3.3.5078.78.909.-078070.3/02.3//::34050309.329 897 203.9/5.-07..09..5./.3.54/.3907./. 03.5..8 207:5../.32:9. 50.7.3.3.81.03/0 .29 $0.350.3 09:7:3. 2:33907.8.090780-:990709. -0/.3 50.3 .5.9.380-.7   09:7:3.32:9.907.7909:.3408:.381.-.7.802.09.309:7:3.38050795.2/4243.7503.3.3:35.50... .9.5.//.3/03.381.7039.39-4980.309:7:3.338-.39.909.8 .78.3-.39.3.2.5.380.3.8..320303.7 7039.909:../.9 09.3907.3.81.4745./.38945.3-07.3/03.3 38-. 50.3802:.950. $0-.2/4243.38..83-07.3.3802:.3-07-0/.78../..7424842.79 80.354.:2025:3.0 29 9.3.:-07.33.9/.: . /.909:.9.58970594283-07.9..3.78.329 897 /03.3. .274248423:0:8  07-.8 0/:.29  0.7.:50.3.7.3.78.202507.38:3:35..9.39-49202-07./3.39.4394 5078.38.309:7:3.8.../503.0349508050798..3/:3.3708574.7039..8/.8.3 2:9.3 -0:2/09.7039.80950..9: 909:....8.0897203:954. 085:3/02..3 .3.404745.8.203:3:.3203039:.78.5078.3..381.0.3 50.8 .7.3.950.3897059428390.78.3./ 4745.3/.2/4243.3907.

250.897                                                               29 897 29 897 29 897 29 897   .802:.3.8 29950..3897 9.909.897 802:.381.78.3907.3.7  .3 8970594283    . .589705942835.38970594283897 7039.2/4243.2-..7././.3.

.

8.3/03..:3 !03.78.42039../.:502-./....7:.!.1-40309./...303 03.82 7.9073.:2 0. !4890/-.9./.3 90709.39.7.0.74980.7%3.350.380-:.35.30$945.9070309 !03.27424842.3820$9079.3$945..//.7 !#$$% !$ ' !#$$% !$ O O O O O 7907.8.3.7:0309$2-43$945.9039.:/.2.7.39.381.78.3!0.!0.0:.825.  ' !#$$% !$ $0-09:.82!02-.9 5.78.9073.

250.81.547..5073./.. //.5:.903095.781.80:2.78.3.3 .33.3507.3:9.90309  085:3/02.3 8080..3:0:8 03.03 037424842.3202.32020.9./.380-.749.../.3-08.2.0:.3 -.

39/.9//.38945.3$945.2.9:740:38:7 :38:7/:.502-./.5.78.8. 202-07.7:7.-'  /08.03/0 $0-..3 /.203:954.4394 .3.3/.9/.39..7 /..303 037424842.8.3907/..2:3 809/.75.381. -.98945./../.9: 81.32.3.82.38:.8:/./-..754.73.3-.3 50325.5.9070309 .5.8:8.078.73:0:8  !0..78.2.:39:202-0/.39.7.78..7:8/./.3.78.5.7/-....7. 9/.3 5.-093.33..907/./.2.9:2-:.39072.3.3./.3..3.30 47.7:0--08.35:.8507.38945. /03.78.78.3:0:8 .78.99079039:  .3.7..7:909:.8 5.78.3/.8.78.8 5078.9-07.82 39/.3:95..3.9-0793/.03/0  !0.-093.9.82 !..-'3.!0..3-0-07.82  7907.5..38945.82 $0-03..50.9/:3.2 50.33.82 /03.3 70857490780-:9203:3:. 4745.9:909:.33.3...790275-.78.7907. .503.3:39: 0507:.9:1034203.3503. 50.23 . /03./.80-. 42543038945.39.85078.3.38945.507-0/.8...3708574207:5.9070/9078945.9:7402.390780-:9   !07-0/..3/./.39.8..30897..3 /-.3.250.4394.3.0./..:93.: :3.8-07-.3  .3.350.350.3 2. 81.:/03../.-093. 09::.80-.247.253.8507.350.82 -.. 8:.82/.3...3.30805079 29443/7..3503.5:.3.8.

/.800.30 80507929443/7.78.3/03.907503039:81.9073.82/.75.3.5.82.30 47.9:2.38945.30/.3:39:/84..381.34745. /.5.78.8/.9 .7.8.47.50.39.38:39.949079039: /03.88:39:203/::3502-:9.:.8945.2.3-....347./.390780-:9907.920.50.308945.-'  0 . 503.39039.50.350.303 8073.3907/..78.3705.9: .78.913:0:8/.803.82   03 037424842.23.82.- /.. $00.9 90780-:9207:5.8503..28945../.9078945..47. 8.9: 0/:.3.3.9.38:.350.9/5..803/0 203:3:.0--08.78.3-.9:740 03 037424842.82!02-.907 8945.3 ..7 /...23-093.3.82907-:9-07./.30$945.9//..2..3.5.9 /509.9:81.909.82....99/.3.5.-.8 .5. 97..28945.382-43/ /.82.5.203025.9070309 /.50. 2.3 /. /.89.9:8.82  7.3  7./.303 03 7424842.8 .7:2..9 9079039: 2.8070./.9 -07. .907030990780-:9 907/.28945.35.38-.947..78.2.50.8 8:-80:07803/7  0.38945.39.3.3..703.9078945.82   $:-899:83:0:8/.5.39079039:5:.3202240:  .3.3.3-.3.  %/.8./80-:980-.2:2.9.703.30/.381.92025070.38282././.381.5.82.9202-039:04254-07.9/2:33./.703./2:33.7.8:.99/./.78.250..202-./..381../.3/.204254 04254-07. .78.5402.7: 70.30494342 0-07.

3203:3.-0702-.....2-039:...9:7. 28.3:3.4745.802:.380:2.5 //.742.3../.9:803/7 /.2240:3..5.9:50309./.3-.3203.3/-.:5.8.3/507:.29443/7..-48200307  32 032:39:0507:.-../.3/48/..8-442.3803.9//.85.3/.3 03/ /.2.39.3..3803.33.3././03483971481..3574/:8 0307907/.. 9:2-:.35.3820202-.8 .3..301494839095. .3 4745. -.73.229443/7.907/... /.3820 09. 20.909.7.3 /:5-0-.03847...9 %! .2.3:39:8390883.33.749 //:. ..3/:25./.38200309.83 2.3.9070309.39.35748081494839088  4741-08079.20...3/:5-0-.-3  :9..0 57:820302:.3:.3.8897:9:729443/7./47..83207:5..3907.5.9..-039:209..3..003././...39-4989705942835.897:9:7 /.7.3.7. /7...280  9443/7.8.3. 09::.3820 0:.9: 4745...8:.8.39443/7.3-..220.//:.82.2/4243.202-.27447.303:39: 203./.247.38. .3-. !..7-.-.503.8/...3.08.. 03 033/.3-0-07.90.9: .32070.3-.31:383.880-. 80:2.880/.  $02039.02:/..89/.47.50309.5.8 .3./.7493.95./.3.3-07-.320309.5.2:7:3.8//.3.202-.0-:7..3202-.3 2.5.3202-07.070..8 !.3 -.370857.27 $.70. -079.3.30:.3509:3:-.30..3:3 82-4889:7:3 902:7:3/03.3 207:5.-07-.

2509:2-:..3-.7-43  :9. /92-:././...2.3.9.9/.7   %505079.202507.950 2:9../.-4820..39  .3950.9..8.9  443 4433/3.074-. .8.3509920.2./.8//./.7.3.80/9:2-:.20/:25.2:9.: :7.39: 40.370857.8203:3.80 805.9.5..493 203. /3.8 03/0805079-.35099 509902:9.074-  3./.803..3..9 .38070.3.3.:.84547. .3/03.3 /03.3/.39.35099805079/.-4820803.370857.34803 20.3 5099/.35.5.85078.3.:1072039.349 /54/. 2.8 89:/1844203:3:.3.350998070.443-07::7.3../.3/3./.3..320488 .8:48.3402:9.2.32748458203:3:.2:3 .2-..7-43-:.3.73.703.3 38-.3 907.95.843.202507.5099 .33472.9.3-.90./-.843.9...38.203.0.10349503472.7.80 8090780-:9 203.33472.3. !078.9.880309907.44390780-:9-07::7.3950.3 /50740025./.23:0:8  $0..10349503472..5.3.73.3 /03.38.2. .50998070.8...30.8.9.3-.3 .909..3209.2-.3 203:3:.703.3.301803-.49/54/ 2025:3.2209.8503.32:9..80.2502-0.54//03.3./.3 20.

3 2048849/54/ 0025. .8502-0./.50.3-.350.84547./5.90780-:9/80-.:80:7: 2.-.802:.3-.0-... .85078.35099/03.9:7 2:9.0708081  %500/:.350993097.  .80950..3203.3507.91 5. 8547.340 .2.78.3. 8547.3..3/83908803270857./9039:..39505079.49/54/ /8.0.3 203.7039.229443/7.78./03.7.  -07-0/.7039.-..93.3. ..70025.33.35099207:5.3.3.9 /.5.3 :35. 3802:..3909:.380950.3.381..3 950.9.3.848547.7.80 50993097.3/80-:950993097.9070309//.3472.2..38.90703092944/7..207:5. 03.50993.38:33.3203.10349503472.89.848/.80-.3 :35.3  50../  103495009:7:3..82.9.3.3. 09./ 8:2-072.7803.7  8945...340 909:.8..-. .3-08.3 2025:3.3472. 07././03.-07902:/03.9.3/50740..9.78.

 $:57081                                 .843. 3472.848547 .5099 3472.097.$070.                                                                       3472.5099 .5099                                                           . 54/                                                            49 /54/ 3472.

350.3. 2085:380-03.503.38:3:35.78203/.3 2.329443/7. 5078.10349505099 03.9/0.3 805079.73.025.7  !0.3/03././.950.38050993:0:8-07.9/..9././...7.3 3.3/03.2:7 0:748547. .9.78.78./.9..78.203.27$ .507-0/./ 5. 50998:57081.32:9.7./:25.5 07:8.805.7202-.2:73-0:2.907.9.850995.5.820488495099 3..3802:.829443/7.3950.3.0 .:./.320.5. 2025:3.73.2-.070.  ./.3 3.909.35.:.3.31034950 5099 $0. 50.05030-.2-.848547.95050998:57081 0/.33.-07. 5.829443/7.7039.7  !0998:57081:.2./.8:82:9.349/54//03.9073.. !.3:93.7.5.2-.23.33././.3-0:2/.7 /.3.3.3950..3/.3 /02.0 :39:502-039:.30./../80-:950998:57081 .907030929443/7. 3.:909:.3:35.7039.35099  %5009.3. .30380.3 5..78.-5099-0793/.33..5.:909:. 80-. 50.0:748547../. :9.3 -.207:8..5078.5099 3097.8.8..5.-093.5.203././.9 8:570847 /423.78.  $0.9505099 3097.5..9.20.3 907./03.8.

.

.42039..1-40309.380-:.7 . !4890/-.8.7%3.

/.9.: 03 03..23 3/.:94842  $05079.9.20.23/3.0.509.78.7.30380. 03 037.3742484234247 /80-:980-..0.8907.3:8./../.2.50.3:.:0025.-:3.3/.95.897:9:73.8.5..20990780-:9202507..3:39:202-0/.23 .3.33.320-. ..3.9:850808 47.8..74248425./.3:39: 202-0/.7.350.//././.5.3.#!%& $ ' #  !%&$ 74248420. ./.381.8/.50.390709.85080847.390709.8:.3./..8025.3.3.8.3:94842 O O O O 03#..30380.3.. .03-07.897:9:73./:.3/.3037.5.23 7.23 %50!03039:.-.803.:42-3.3509.3..380.3/.5.1034203.3820 742.23  ' # !%&$ !..209.354908843 !03.338-. 7..374248425.9.5.209 ./.8.0./:-093.3820 .2-.2.5.9:74003 03-07..3 907/7.3 203.3.3/..-'.33.974845.3.2./.3507-0/.0 /.23 !02-07.9.30380.23/.5.7.703.303 033/80-:950789.9:7424842 0-07.2!03039:.8.23 80 30/ 0308 802039.3/.-'90.39.23/..9./../. 2.34./.33/..7424842 :39:85080890780-:9 28.2.:94842.78. 202507. 3/.  20.8.8./: 3/.239/.890790780-:9 /.320. 2025:3..390709.2..23 7424842802.23  03 03..9/:3.3907-039: -.70025.3205:9:7:9..90425403-07.3.3-093.3. 907:9..3803.9.9/:3.23/3.7424842 0..3.754.930.23 3.9:/.2.23/./: %073.0.35.7   $..35.30380.3.3/-.2 8070.90425403-07.2.74248420..3503.9.3.2.5:303-07..3.74248420..7:472430.9..9:8.3/.374248420.93.80.742484280.8...3.9:7424842.303-07..  3/.34.9/.0.7.203..3820.39././:.9./:.3/.03 03.

9 20.:-.3.3./.52025.5.3.23/.:3 .03 ./.9..3472.39: .33472..78./5079:.3 40% 47.4-./.909:.3708574203.3 /.-072.88902503039:..8.380-.82 2.74248420.9.3-07/.703.73.3 203.:39:81.3907.3472. .2 /950 80/..9..-07-.  !078./.2037.3202-07.9/04254 04254.9.9:7.33472.39.3.9:7950./. .37424842  0.3909:.39..3 .5.3.8907.3./.5. ./.3./.303503..0.9: 03503.2.3.7424842 03802.-093.:.23/.7..3/03..5:9.73.390709.93.2 -072.3.23 /.2-./.9.03.9.93472.39.9.32..3./02./037..3/:3. /.  ..9.3/03.-072.3 203.8.50.3-07-0/.39.3. -0-07.3.9/423.5.950.73.0.5././..23  037..90709.80.3 03/0507.74845.3-072.50789..3-093.-07.32.35079.85078.02:9.5./.037.8.2/.30380.2.3.3203.239025.3.235.3037.9.8.5.50./7424842/.39./..33.3. 2085:39/..3.2.5:9  03.74845.7.3  !  !   -093.35.3.3 2.38.-07-0/..3472..  30/0308 8.3.5.3820  !0.3-07-0/.74845.3.3.39.2...9.2.9:7.7./.8.7.9:7.503.3 09:7:3.239.:2:23.  30/0308 /.207./.23/.3././.9.  $0.9-072. .3509:3:-.3.5.5.3.8.9.2.3 507.: 03950 .5:9-093.83.1034950/../03../.:-:3.5./. -.3708574/03.3.78.3#.2.2-.5:9 ..802.3708574 034950909:...30380.2/.-093..-3.2 2..3.3./.9 81.3 /.. !07.8.9:740037.9.203:3.33.235.3..3. 5:9/03.703.2539: ..9.0.3./.3/09. 3.39.7   7424842/.3.2 3/3.3037.7.9. 9/...3.5.73.9..2-0781.507..5.32.5.82.3.9203.0.9.7::203/0 $0.203.207.9./.39.390780-:9 :8:83.:950.95.78.73.3/..3/.23 /.3-093.309:7:3.4-.39.5.9.0307.2.02:/..9/-0/.3.3/.3.                     -093.3/.320325.39073.8 9073..580-.9.35.037.3. 74248420.9/. 0. 207.0.3507..  0.9..207.3 202..2.5:.7424842909..3/.8025:73.34.347..2390780-:98079.2.3.3/0.9/.3034950.5.2 28.32.78.27424842 0.85080847.-0-07.2-.50.3.42509080 30/0308 !.

9. .39.3.2..7  ..25. . 805079909:..2025:3.37.5. .-.9.25078.33..7  .7.74845.9-093..3.33..9.2-.9:3472./.507.. .3..2-.

-.2.0241.805079 909:.23.7424842/./. /:.. /. 30.32025:3./.2.-0-07.-0-07.3203.3./.3:39:2030-:9.30249708081 ..-0-07./:/03.80-:.0380.7424842/.73.9424.90241.:.3.3 -07-:::33  89.3 /.39.309074493.7...3.0249/:3.-:: -07.9 507/.349.3./.909074.80.. ./:-093..303.3803/73.0  !./:/03. 0349500907449:39:037.209.8:8 0241..3#:8.:.90780-.703.5./.7.4244 803.7./80-:9 0249708081  #..3$5. $0-03./..30-./.5:973./.30:.3./.580-.5./:42449708081 -093.9.#./.3203/079.7.-..203/079..4394037.207.9/:25.3 /.3.309:7:3..309074493.39. .5:97.:...3./.30907449 0332030-.30249/423.-:.8.7.. .50.0:.3378203.0390780-:9708081 3/...3 ./7802.7.20.:././:-093.3 .3 202-.9: '. /..39.:0907449 .33.3/.9802...7 0/:.7424842 .33.3/03./.3 $0-.3.7424842 3/.3.9./:..3.90241.947948080  0..5. $./90703.3/:.9: 8. 3/.33.3-07-::947948080.  0241.23/80-:980-.3.3/. 7424842.9.23-093..9: 3/..-::.-09..3-07-0/.381.:. $02039.209 .74845. .947.90.9. .32030-.3-0781.3.95.39.-.07./:.:.85080847./..5.35:97. .:/:. 503.3./03.../9..7.2././30.3820./:.209  #.9:5:9 !0.8:8:3.3.3408:.3/03.3202-./:25.30349503/.30907449 0.70025.34 $02039./:-093.2 3/.33 /..9.209./:42449/423. /.3.202-.3.2.3:.7.349.:.9.7.9.0241.9:9:02.5.8047.95.. 0:.9.39.. 8.. :.7.7.03708081.79.39.8. 2033.. .78.5.802039.9507/.  0.2574808502-0:./.209.9:.707.9:.3 2025:3.5..93.907/.3.8.3025..38.3.33..9:037./.73.7488 3079.3 .9.3.3.202-./:.2.7424842  3/.-093.3:8. .3907/.9:  .389.7:203..3.9:  3/..9.73. ...3/...-.7.3.9:.3.39.703.3:8.9 ..9:3.3/50.2:3 .98090.33788.-. 2..209. 3/.3 503.3/..7/.3.380-:.:.2.9.7.303/423..32023.788.754.3 0249/423.3/9039:..3:.209 $0-.5.3 -093.8.5.78. .3.3 .3-0781.8090.73.07.39. $0-.5.3..5:97..7.07..3207:5.-::5..73.2.

7503..947. #.2 .9:'..5./.90241.5:973472.3.  #.-0-.8/.

54.:5.3./:424. ..350. 8.73.97./.8.7.209-070380.50.2.3.78.78././03.8.381. ..2357.97./.381.3.3.3/.!.

/:09074.39.. 3/.3802039.23.39.7.209-070380.

0/423.8.3/. 3/.02:9.80/980.3 80/.3.3..3.  4394037./.209  .207:5./:424.3..352039.33/.5./-:7 .3#.3..-.9.3.3/:303.:2:23.3472./ 5..8:. 7 2030-..5.580-.-093.950.3.3-::.203..3.2-.:897:907.9203.3.-3472./.3.3  !0././:09074.3 50207.33.2/02:.2 03.91 :2..3.7.3.32030-..39..9:03.31034950./.8-::80.037..209   . !.:3472.2./.0708081:897:/.20302:..../..-.3.2 203.-.980/932:33/80-.3./.3-. . .7424842. 5.02:9.3 80/.8./ 80-.3 8.3.7.03708081-7.3408:93.-093..3.9. /.78..3/03.8:83.

. //:.3.3/.303..33.3.1034950 ..89/.5.0/.037.38.980/9 2.-3472....1034950.3/80-.3..3.3.703.-3472./.2:33/085708.33.  0.-  037..3/./:-093.:2./.207:5.-.35.3.340037..8.989./.5.9//0908 0-07.8.0.-.

38:3 805079.32025:3.2..23/.03 5.3-0781.35.03.3/.3....50./..239.35079:2-:./503.-.3#.3.97080813/.9..32030-.3 9/03.3 2030-./. 20.39.37424842 9073.3..3.3/.9.05.8907907/.3-::5.880.7903.3-::503/0 !0.3./03.2.303.2-.5.95.3.  !.803.9037.0. 085:3/.23 /./.3/7 4394034.3507./.9.5.9./.7    !!  ----   -093.. /.7  !0.3/809./.78.78.-0-07.9.23%./.802037424842 /.9:8. 742484290780-:9.3-::.9/.-..8:95.  0.                .9.9:740 03802.5.74248429/.3472.034.-.78.3.3/75.32030-.03. 4244/03.342448.3 .9.3 .9/.:94842..3.7:7.7/.3.703.3 2030-.-.33472.$025:73.0.3.78..3-.037.5.239..303.3./.34.9/9.39/.7424842.03 3/80-:9:..187.39.-::503/0..9/.3-::503/0-093.39/03.5.3-07.381.39.:802039079039:5./.3 03...7..9..8025:73.8.3.3:8.-.0.-3472.342443/80-:9:.7424842 !0.7:400380.3 5079:2-:.90787./../.03.9: 03 035.8025:73.9.0/:.

8025:73..33472.239.3:8. /.39.507.805079.3/.5. . .3037.2. - - - - -093. .7  .80507950.3..3.38.3202-07.9.23 %0.:94842./: 57.0./.250.78.78.2-.3..7 -.3 3/.3472. 8025:73..7.54.95.7 507.3. .3037.8-.2.3472.8.39.3/50740/..3.5.2-. 8025:73.  $8902!03039:..239.3..303.8.2.3.33472.32.2.. .0.0..3:.239././.3708574:39:03 03..78.2025:3.3708574:39:037.30380./ 50./80-:9.:94842.-093.9/.

39.7./.39.209  802039...3.09074..

209   $0-./..-093../: -093.3/./.235.209  !03039:.09074.23/.3.7.2.3:897:424./..3:8.3..39.209  802039./:.424.30380. 5.

80842.3. 5.983/.3:3.3./:-093.3/.30380.3/02.2./.3/.3.388902 0/././.39079039: 203:9 88902  $0.7.3.3  $0-.2025:3.39./.7424842 80/.9.3275/03.3-./:./.75.8.3.23.3./:.88902503039:. 2025:3.80-:./.39.35.8...3/0.5.30/:.39.038807././.39. 07:9 3.39/.3.33..33.280 842.2.3 :2.7.202/:. 28.3-0-07.  $8902  $8902 /:25.35.-0-07.8890290780-:9 2.-0.4394   84320302:.:2..5.3 /./ ..2 /./:-093..7424842 ..8079..7424842  $890238-.3 203:988902 80/.3./.7424842802039.-:..33. 742484280842./..3.98807.983. 3/..0--.7424842 03..3/. 88902 3/.39.3.5.8-.. 2025:3..!7490347-093./:./:.5.

9:710799.. -07507./.:-:3./.3 $0.3.37424842 .3807.88902503039:.:.9 74845.350309./03.3203.388902 .382090780-:9-07.2.30380.235.8503039:..23/03..820325:..320303.9.:94842 /.8..-.5-.   7/020.338-.0380.3.7.-07./.37424842.33. .3.3-.73..235.3.39/. 47.3./.3. .30380.39.7424842907.3/03..

9/.95.235.-0  !03039:.:94842  3-../... Ð7424842  Ð.974845..30380./..5./.5.%.974845./.-0   %.

  0380.3 .23 .39.

340 907.5.3907.3203.209     -093.2.224..7903403088 .8..3.9.23 209./: .3 209..202507.74248425./: ..3907808 /.9:502-0.34425079.3/3.3 3907808 3907808 ..58.-0758. 2.-0 .3/.39.:3.-:./:/03. -093.58..-.3.%.58.33./.3.-3472..9. 7424842909.-093..9:.5..2-.93/..8.390780-:95073.7424842 3./../3.3/897-:87424842 5.2..3.3:2..7.-0-07..3.3.3890709.22:3.39097.3 0..203072. 209.5.9.                             -093./:3472.2-.39.39.3200-:2.:-.381./.54/ 8079..8050793.-093.3 -093.8./.80./.9-.....39:-:3.502-0././.9.320488  !.2.25.907.5.3802039. 80-.23.9.3 80-.7424842. 209.7  ./.943 .547.7.808:..-3.507.3/742471 !030-.-.907. 0/:.32948849 .8:507-093./. 74845.33/../.5.0-/..-093.3 .3 //.09/.980-. 343/8:3.5.950789./80-:9 /03.974845.5:..5..9..5.3.7/:.3. .3/.9:7.39..2530.92030-./.3/. .. /54/ 3/80-./:. -093../.-093.-0-07...30380..74845. 8.3203072.-.5:.3907-039:3././3.3.7   !  .9754//.3.0380...9 81.-3472./:.50789. .2.58.74248425.3/./..3.3.5.389.8.9:7424842  !.-0-07.  .

/3/. 8.0-.-07:-:3./. $97:9:7802.39/. -093.8:8.3/..1034950$*%8*  $02039.3-0781.23-093.3-:3..380842.742.39.980-:.5:.5:903/72::9  /.9203.3.507.39../.. /:25.3  0.388902503039:.3:8./.35007. -093..3/03.3.8503.974248423.-093..850./.:93..9: 3/.2./.3.23.73.35:.3.3203./:.7424842/:7.974248423./.39.39.8..8.20280-:....:324348:83 2025:3.909.0342 909.3502-039:.23.23 $047.233.7903403088207:5.8.370..3.3 /03.7.3-093.5../03./.33.80-07.2025:3.3 -:3.90780-:9:39:02:/..93430309 .1:.3 /./ ./.9.7..3-0702-.:3/03.9857.3.23909.340 1.32038907./03.3-.30380.930.80842.23 085:3/02. 9: 3/.3./.05.9: .-07.3-0702-.-093.9473:3.77 5.3-.0 .3.3 -093.80 80:.9.3/-:.3203.374248420.9857.:507.39/.9.3.. 2023..3507.3 .9: 2025:3.8/./.39.7:3:3.80 80842./03.39/.3202.:33472. /0.239073.39../..3:95..239073. $0.3.3.9: .38./:.3 :2.3.3-:3.30380.232.98/.3.5.5.:-. ./54/ 03./9039:.7 90:7.897:9:79079039:.5./:.9/.80.5.3/84.9.  0. 2.43 3/..9.3.803.77  !./.802.08  !03.703.97424842  $890203$ %8 . /03.3. ./.7.5.:320302:.3 02:/.8.-07.8. 80/.9./..805079802:9 0-..8.897:9:7 9079039:.8.3 -0702-.39:305.3 $8902503039:./.2.39.3/.3.8/80-:9./..0342.39.39:3 -.85080820345907.328..9/-0/.930.31034950$*9898.3203/0.9202507.23802039./.80059080.90720302:..8..3982.3.35.30380.-./.930.907/.80-:.742.3  . :2.3/03./../.703.9/..83 2./0.   .9/.9:7502-039:...3//.3/48:8 ./:-093.9./:-093.507. $0-.-0-07.../.3 .89  742.3/02.3.547. 74248420../48:8 -07:2..!.33.303%8 .98.9: .5..:90:7.-.88902503039:.83203./.03$ .7903403088 .235./.98.780-:.3-:3...39.39. 28.07080818/.5.3.3-07.9./.7.9.:/03.3 !.3430./:25.9.9.742..9:7502-039:.3/03.8.3.930.3.39..88902503039:.2.:7.30380.3472.7.5//.3  -:3.9..3.3.9:20.5...5.7.3 8890290780-:92..33././-:.5. :8:83.././.3039079039:  .:9430..9/.80842.7.3.3203./:. /.:3/03.:3889898 -070380.9.9 /.97424842  !.3:93.370574/:8..23:0:8808./3/.7.3443.7.5.:-.23-.3/:5 /3:3.3-093.30380.:5:3:2.:388%8*../09. 90:7.374248420./.3. /.3203.9.3.0342 507.0309.9. 2.3-.3..3-.3. -0702-.9.39/.23.54/  $02039.703.5907-039:80. .8.0-.9/.7:8 .24348:8 -07:2.

.0/0308 .0380.39.947030982020..3507./42-.8 085708037. .3549088-./03.9: 80-.80.3.3203:3:.7:0.3..38..2..8/488/:8:.83/742%:7307  9/.93 0.3203.39.9.320303.7.234302-74 ./.703.8472430..-07:-:3.23 .0/:.3472.: 503.3.3507-0/.30-07.83/7423010907  2025:3.7.3203.3:9.2.9: :39:/.3.-07-.32025:3.73. $0-.8.80-:.0907449 202507.74248425.8. 5.91/.39.23 03907503.3:93.9:037.3.503/079.380.0309.7...33.3.3.930..3820425038.39..30380.3/.3320.80./42-.3/:5..-0  8570803907503.3472./:-093.7424842 3.83 2. 7424842.2380:3/07  !./.7:2/.357.393.9:7.374248420.9./.7:50702-.2025:3.930.0/:.: -.3 085708.9 /423..832025:3.23/839088404.9:7502-039:.23 .35.3.4394  03.2348039088 !7.5..9:  003../.8.39./. $0-./3.../42-..9503../.39./.23.742.3/./:803./:3.80. 8890247243.0309203..503.03 42449 802039...:09074742.9: 802:33202-.::5/03.30.23 8031:03. . 57.3909.8.1:38././:. -0781.3/08508.2030. 503/079.7.3820425038.:. 202503.9:  0.8.3:8.7:2 908908 /./.3/.3202507.23.39.3/.9:03 0907449  %.380-.9/03.381.3203.37424842 0..1.742.23 $02039..7:0.88902503039:./.742.3-.343.20.8-07-0/.3  .3.8:.9..-.8.2-.3-093.23 $0-.03/423.7.3802039.3038 0.7:82025:3././.3  037.35:.3 003.993/.23207:5. 5.2.3-0781.3:39:203039:.9/.3.91 5490883/./:.75030..73.3./:-093.38.7.3 .37424842.2 ..9 -079..7./42-.7378203.38./03..7:83.9 3/.-093.3037../.3/.8:.23 28.9:743/81844/.307.2.9/423./.203/.23 03.57080815.3742.308570803802/423.1034203.3203.9.32:33:897:202-. .3 .909./:./.3  0.930.9...703..3/.03.7 43 8047./:-093.3/:/42-.90..3 5. ..3././:42449.9/03.3.3107038.9..9/.742.39.57080815.0.703../703.93 0.8 803.5..32../.23.3203.3./:.-::5..8800./  03907503..3../2408047.39.3103495024.-093..3.8/4885.3807.30.703.380.2.7.3/..3820/09./.209 /.238073.3./..  .39089082.8.7.3./.2357207  $0.39..7424842 3./48801091.5.3.03.7:472430.7.2.3.3/.7.3.23..:.380..208570881.930./.3 .243/038.3./.7:83.235.503.238079.:94842.8./:0249  47243/. 02.3488-07-.472430..235..0.5.389074/. .203.938.3472.7:0.90.3.8503./703.9:7424842.29:-:3/.3/.  0..742././42-. 2025:3.2347..915./.3507./. 03708081  54908843:.2.-.

8.7:0.3 /../: .39....9203.9:70-49.23 80290/ 0308 439403802. -079.39.9:0380.393803.342449  03907-.03.8.9202-.5./.8. -.502:.80.35./.:94842.8.-079.03/..2:5./..5..3/.23. &39:/.20-49.80.3/: 9/.5507.././.3203.308570803/.57..0907449./.9/085708.7:82025:3.57080815.3..034950    42-./:-093..5.9:0380.20.9.:.3/: 42-.909.3.39.03.3.39.303907503.3  80/..2.5..549038:39:203.303907-.90780-:9   .....9:7574/:88:8:5./.23 $0.3/: -079./.39073.9 /085708.. 57..  .30349509079039:80-03. 03/423.8././. .-079.3:8.9/507:.35.3.3803/73.73.33472.35.35.7:507-0/.. 03-/423. .3./.2025:3.3202503.3 -079./.23 472430.3 5..0380./....23/3.3.3/: 4394.9.39.-079.3.23.38047.3/: 9/.3574/:88:8:.39..0907449.8.39.93.3 09:7:3.33.3203.0-07.3/: 9/.9.3/03. 2.23:.3/03.57././.2:3 3/.7.909.8085708035.8.3/03.-093. /. $0-.20-49.23 03..3203.57080815.

.

209 .3.1-40309.::203/0 .9..3/:.:..-   /03.42-3.8.303.2../3.8 .0307. ' # !07.3.03 /03.3.3-0-.35.42-3.703.8.3907-039: 9/....35:.02-.42-3.3/.3 :39:-039:-  909.3::2800.3/.-08.3:8.803/423.35078.-/.303708081:39:-039:- .73.3./. 2434-7/2..5202:33.3907.3.203.34003/0 -.3/:342-3./..3!3/..7 # ' # O O O O :.8.303/423.3.37424842 !0209.73.73.35078.803/03..3:.307...0307.7  .3.$.3 507.. !0209.37424842 5.803708081:39:.$.507.4-.8 42-3.3!3/.4-.3-039:- 2.3/-7/203./.-  /03..742039..3 %.890780-:98.78.9./.8079.50:.209.203. !4890/-.303  0.3907.9-.:5:3/-7/ 90.3:39:.8 /.3::2502./.3:9 50.

/.209/03.73.9:7 .3.8 .209.52.-'3  :.74248429025.320303.2.209.  /.90843/.9.5 85080847.303503.2.3:93.3. 793.3/:3.74380520303.33207:5.5:3203. 9072.209..:-07.:./09. 2. /.5.8/.  03 03. 3...3/5074003/0/ 8.3/-7/40 .3.-/.3.3./.5.3.-.88.3  $9:790.07  /.3.47.:.5 2070.708081  $0-..307.3 /..3907/7.:0--./.:03 03 .380-.3:2..03503.33.3.3. .9/:25.5.3.3 /.280-:.25380.320./423..805079  7/08   :07 /. 54.3.507-0/.0  034203.78.0 7080813..3. 8.5. :.83 2..3.9/.28070.974845..75.32025:3..33./33 ./544-.3.380. /.74248429079039:/.83./423.9:7-039:-90709.8:.2.0025.3.03/07:3.8.303 2. 0309.03.3-07.-.8:.3.3.9:  ./. 0-/.3-08.3.3-07.5./03. 38-.302-744/.939.3.2./.34.20309.3.3 1034203.3..808..7:809..3..3-.203:9::203/0 793.33 $0-..303.3 .8 907.7207./..74248423.37042-3. .3/.. 03/09/.3/:342-3.3-07.3./..-203.3.2.85078./..8./.2.33.342-3.5.303 03-07.:-.72.-07.2.3-07.3 # !:33095.9202-07. /.3/:25.3:...9:7 -039:-90709.3203..8/03.35.8 803.39./03.-90709../ .:3  .5./.7./.7.35./.507..9:7.2.5.0307../.8/. -07.-/03.35:.3 708081 02..303808.3.3.8../.350209./.9..5./.8207:2:8.5079.39 $0: -0:20303.742484242443.3/50740 .73..8.0--. -.340 0.7.3-0-./.9:7.3.2.354.8907 .:302:/.339075709.8070.3909.3203..5.2.73..209 .:2..37424842 .2.5.2.2.53/.7424842...0:39:3.:09./9/.. 2. ..3./.3.803/7/3...3/./3. 03-07.:2.9.-:.-07.7.3-039:-/0.-07.3 9/.3.209.38.303.3/:303 03708081.209./.3-07.3.3808.303708081 .3203.3907-039:90780-:9/80-.354891/03.95.  ..3::2502.35.:2.3.-/. 03 03-07...209 -.3..3203.39.38.803/423.3..9 %  47.38-.7. /.748834../03.20.. / /.2. 2..3.3203.92.. .3 708081.2./.303 /423.2.9/.303-07.8.....8./.90.3/:3 03 03/423.3/.75.3/.3.33.7.20.4-./.3 /.3/.-078.2...3820.035.7424842.9.720-.338-../.3...350309./.3.$07.3.03 03 03.37042-3./.3/:3.3.3.8  $.209.209/03.2.92070.803/423.3./54/ $0.4394 .03/.-0-.-07.-0702-..390.92030.3 .809.20209.780-:.3808.75.9..:39:80.7.3.3/.5./.7424842 80/.3.3203.30--./.2.3820 50.303503.5.9:7424842802039.303 03-07.9: .3.78.303 03-07..708081 2.209. 30/0308 80/../.8 /.0-/.38047.0 .0-09:.3 907/.8./../902:.7424842 3.8..83 03503.

. 0/:/:.- 3 3   ..73/.25.3.-.2.803 035.23/3. .7..38070. 02:33./:/-7/. .7 /-.388.9.03-07..7  .3.25.37042-3.3.303-07.3  .9.2..3.- - ..3  3/.35.2./03..3.3..5.7  .2-.3:.3/3.:9/./.:431:7./:/-7/.7  .3037080818050795.  ./:/-7/ ...8 ./03.303708081./.03/07:3:39:80..802.37042-3.397.80/:.-.28./3.-. 0/:..-07.703.8//./80.9/507-.20/:/:.:9.3 -07.0/:..802. 8.38.3.2. 2.8/.388 .3. /9:880-.2-.209   .-07.507..3-07-0/.0723./03.303-07. .2..397.9.0/:.-078070.3:9. $02039.2-.3/.8../.3.0307.2-.- .8 :.:-078.209 .5.9.209.30/:/:./.4:535.3-07.  -  -      . .3.039/.3907-039:  - .:.303/423.3.. 9.3/.354.-0-.9..80  0/:/:.3./.83.9: 5.803 03. ./../03.5.3907-039:/.-07.8070.2-.8/.39.5./..3../. 03/423. 0/:.9-07.3-07.3.:705:8435.8070. -.2.7.303 708081- 0/:/:..3-078.7   .7.37042-3./..3-07.7:8907.039/.3.380.907./03.-:.7.9/..03.33.03.30/:/:.&39:0-0.-0-. 3 3   - .83/.2-. 202507./:.7  . !. /...8/.39..2-.349.80  $0-..  .03-07.03/423./:../80.9.3.38 0/:/:.209.3./.7  ./:.3907.

-.0390780-:9-07.388 /.30/:/:.. /03.3.-..0/:.3/9:880-.

0390780-:99/.3.3./.3.30/:/:.5.8-/./.88:8:3./:/-7/.:5:397.-./ 503:8./: .38.38907/.7039..303.  .209950 7042-3..32.3-07.38:8:3.0/:/:./:3./: 80/./03.88:8:3.5.3./03.83 /80-:980-.2099505.38  .3035.3203..209950 7042-3.8 .3.9/:..37042-3.3/.-8079..7039.2099507042-3.-.2.0/:..3.3.207:5.5.3.3.388  .2099505.3882./.83 2.7039.3033.2099505.. 2025:3./.-07.2...0390780-:9-07..209 ..0/:/:./.8.0/:.2.3/./..3./  3/..3035.3.8:8:3.-.97.3.

/.8 /.3.748834.890.3.30309 .39.3.3./.9:3/.:-:3.. .2.7.38 2.7.3-././80-:9.30.3-.2.2.3-.80./3.3.39..3/.703.3507. 02:33.  ./:.2099505.7.0/:.3.. .80 .-/.8.3. 802:./..2099507042-3.38..5.5.3.2099507042-3.:5078039.9.3.9.2099505.9.3.-.7039.3:2.8.7..2099507042-3.880-.3 .3.390780-:99.8/.9.209950 7042-3.2099505.840  $9:790..3 . . /909..73.2099505.3/03.: 38-.8..7..3.30/:/:.:0-:7.8 2.8.3./: 80/.7.907:8 20307:8/:9405033./.7.:2.2099507042-3.5./.2099507042-3.18.:809/.03.3509.92030/07.7.9.7.2099505..9.353/.7503079.9.3.3./:.9.3.3 .3 035.80..8.0390780-:9-07.9070309 03 / ./...3.8./: /-7//03.9203.2099507042-3.209..5.88:8:3..397.2099507042-3.209.853/./03.39.5..209.3507./.80.35./:.3-007.209950 5./.7.9..2099507042-3.3 ./03..250789.880-.38:8:3./.5...3 . .2.. $0.3.209950 7042-3.8.5.2-.-07....9.8 . 9/.2.03-07.  .03-07.7424842 74248424244  .  2..0/:.8.32. /:.  88.3:39:203.3 -078.9 5.3502.3203.0-.9...03-07.58..7039./.3.3.3.39.03-07.39./...32025:3.3.95:./:.8.03-07.9..9./: $0..83.3307.3.33.2099507042-3.0/:.3-.3-07.2099507042-3..7.3.3.3-08.3.03/07:3:39:909.209 2.3.3.2099507042-3.3 %0.0/:.39.209 9505.7 3.3../03.8 %07.-078.3.3-.7039./:. 2.7..3  $0-03..5.35078039.:2.3.3.8907/. .207:5.2..9203.3.8:2.7./.8.303 03.7:/.320.3.38.2.853/.7.3.80-..3. 8008.9.4 9025.7/.7039.9.3. $09.03-07.3. 8.37042-3./.  !3/.$.37042-3. 80./03..3.3  !0789.8 ::203/0  207:5.3/:25..39.8/:. /:.203.7..3.209...5.53/...3. . 9/.83 .7502-039:.38.39/.3 80/.7.3/.207:5. $0-..2070..3.9:5079:.5 /.7.7.39039.  .3..03-07.3/.03 03.8.8 $0507990.:.303.0-/.7  28.5.8:..3./.3.3  08.3-07.8..33.2099507042-3..99.209950 5.7039.3.8.74248429.07 .-:..90780-:9 /.7039.9.8.9035.802039.3203.203.803 03805079.039/.209-:.3203/.8.8070.8.5.-:..8 2.9.3.//.30-2:/.3907-039: .7..3:39:203.:/03. ./.3..3/.353/.38:8:3.5-078.3.2..209/03.: 47..0/:. /0.7..2099507042-3.3033.3..83 2. .3/50740 42-3.39.8-.7 5078039.3.3.39 /:3.7  3.2.9.7039.  80/.38.209 9505.9:.2099507042-3.3509..:39:2025079.3907/..3-07.9075.35078039.5. .3.2.8 03./03.9. 8.9/.2.37042-3.4394 .7039.7./.8803.8-078.3.7424842 .3:93.8...-  ./..3 $0-..7/.28070.3.30.7039.3035.5.7.2.9.8./..2.3/.-07./.80.39.38:8:3.70. .03-07.35033./03.9:.3/3.3.:3.907/..7.3-0-.83.:2.3./:80-0:23./:.39.3.03/.342-3.2.9-07/0..790/:..703.3909.3.3 ..: 8.382050393.2.:0--08.7.380-..

8203.    .808:./  :9-..950393-./..3.3907.8.3.907/.5-.3203.39:2-:203.3 .8.2-..3.2-.3.3203./280:22:980.3.74248424244203.5.703.5.21.-:9.8.54/3.280:2.7 /-.8.2..3./3...3907. ./5.. 2:./ !./025. .3.-7042  ..3:93.4:8  !3/.431:7.9742.3.4:39:0507:.9079:9:54003/423.53/.53/.30:748547.87424842 /.5918.3203::..9//0908.7.9/.53/.3/3.4.9:.8...3907.-070..8.74248424244.5.. 0025.802../5.034950 034950/03. 0857083../808:/.80 70574/:8.329488 803.3202-039:83..5748080.803.507.95.8:8   - ---  .9/3.  0.9907-039:3.3.742.848457./..3.3502.9...338./.3203:3.8803095.8.3/.2.-3.80204880/:.5.                 04880488  9488 .303 03708081/.880309907:9.4-..9 -:./.8.3./.3-.3  !4.703.54/.88.3.7.5741.3  $0..9./:5.2/:5..7..3-0-.3...8 /50740/.9/ . -07.342-3.9.8 ./.2502-0.-' $0.5. 0-07.54/ 03.588 ..89097. -./:5.3203./..8..3:.703.53/.2/:5./.9/./.38:33..39097.87424842 !.88.3907.

.848547.7  .5.380-0:23.2.2 /:5.39.7  . 0:748547.- 5.5.8..25.2099505. 2.8808:.:8. 0025.7.2/:5./..8:.2/:5.3907-039:907/7. .80.2:33907..209/.8/.  0..8.   $0-.0/:.8.  --7042-3.7/.5079.3-. .7.8.. /.75.209.3../. .2-.853/./..380:7:3.3/.848547./.7424842203.../.  /03.9/5..2.84547./808:/.53/.8.2099507042-3. 53/.7039.8 %.             04880488  9488 - .209950 7042-3.329488.3907.9.30.-.3.7.7424842203. 5.3.32.9/./.9: .3.3203.8.8/:.8./.848547.:-.8 %073.8 .2-.7.9.8 -078.7./....8  !078039..2.9.2.8. 80.-.7039.3.-.02:33.3.3/./80-0:27424842203.848547.88.89.2099507042-3.3.9..9/.2-.9.39../:.8 .703.9/.9505.9/825:.8.3.2099505.7 5.7  .207:5.848547../.7039./.7  ..39/.2-..3-.7./.03-07.-.8:8  5.9/-0/.0/0.8053/. ..75030.3907.20309.8.7.3..5.8:85..- ./ 8090.7039.!4.3907.754..2-..848457.70/0.2 ..8502-0.3-07.. !.5..5. /.7 3../..53/.7039.703.3-07.3 5.7039..7039.9:.5078039.

-.7.3./03.7.3..3470. 53/.9.:8.8..80./.2-.!0789.3.8.2099507042-3.7. .5078039.2099507042-3.3 /.7.2.353/. /.-/.853/..2099507042-3.8...3907-039:3. /4:-0.8.3907./03.2099507042-3./.8053/. 03.. ./.3.0307.03-07./.2099507042-3.73.8..353/./. ./.-.3907.8./.-.8.3.8.:.9:. 53/.90780-:9 8050795.3.853/.9.3..3./.7. 9: 5078039./.   .3.03-07.7. /:.39.       .8 .3 !079./.309.3.8.39.2-..209. .3 5..2...9.7.:805079 /80-:9.5.3907. . .03 03/03..3907..39.853/.  09.8.3 $02039.3..03-07.8.2.2.9:/.3.3.3/.8././.18.25.3   /.8 53/.35.-. $0.8.3907.07  $08:.3   202507. 8.9907.    .53/.39.9.35.3:.89079039: 0-:7. 53/.853/.39.3.853/.3./.28..39: .8..8 .8.853/.3.8.03-07.3/.8. 02:33.8207:5.39.2099507042-3./.3-.380.8..3907.3 02:33.9.3.7. 28.73/3.3 /02..35.3 ./ .203.3.8.:53/..3:7:9.2099507042-3.:53/.  .3-./.8.9. 0/:.854891/03..3.3/.0/:/:.3.9.3.7  2./..3.3.3907.7.9.39.88.3-.8.3907.3.3907. 3907.- .2099505.:9.  %.-:.8.8.3 -08.3 8079.748834.253/.7.-.3.2099507042-3./9.-..7.3/.7039.3 907.32030-.18.3.2 ./:./.3/.

3. .3-08.../. 99 9700 54399089.3.3./8.209 .7...333./.209.7. ...8.209.5-07..3&%.303 2.8.8.39:305..3./..5.7.3/./.3. 80/./.  2.-.-.853/.0/:.32..7.3 09:5:. 0-5.. /03.  .  -- .7.8.52.3 .33./:97-7//3.3.0--./.3/.30--08.3803/73.8.303/.853/.9039:8./. /.38-...3..././0.853/..-08./03.8 90780-:9....2.35.853/. .:2..21034950 .3/.209.3.3.9:     .3./.3.5.2. -   . .32.2099507042-3.8.2093/.30--.338-..75.5030.3/.03-07.3:907.75..8 5078.3:9.  ....8.803.3.2:3 ./.1034950./.209/.38:.7  .209./:/03..   $..%9 $.   --.3.04254./. .--.35./.75.3.-- /.209.30. .75078039.390780-:9 .853/..75.4394 3/../.3/./:..3.2.2099505.3 9/./:97-7/..39. .9.7.3.7.  .39.5078039../.09.39:305.3:/03.9:3/. 8.3: 80507990.2.03-07.909.3.2-..3.-07.0390780-:99/.853/...--.- .8.7039..7/0.209950 7042-3... .5078..8.853/.3 3/./0.80-./:97-7/ 90780-:9 $050795./.3.3.209...8./.39.8.38. .2.803. 5.2-.3.9.3/:25.3/. 2.3-07.3/.7  !3/.3 .38.53/./03./03. 0-5..209. .75078039..73./:42449708081 $.-.73/.803.7488 $0-.8.

3042540025. 8. 0425409. $02039./..7039.209./:42449708081. .20953/.3//../025.8.2099505.-.-..3.3.209.3./..904254 042545079. -. 203.07.9: /.8.853/..9/-.2.3.9.- /.-..73/. .3/./.3.5./.853/. -/..  042540/:.07. /.--.7.3//. ..

8/:.209 .-.8..83 2..-.8:8:3.38.2.2093/...9.3./03.8.303.703..2.88..38.338-.83907/7.  .32...3.:5:3 7042-3.:8 034950.3.3/.32025:3. 2.3:3..-.2099505.3 103495080.2.21034950 808:./:.025. ..904254 ./. 03.9:2...7039.3/02.

 .-..

803.7039.-.907-08..7  . 5078039. 9505.-.

.-. .

-.

.39./.8. 9507042-3.3 5078039..-07.39:305.803.3./.54884:8  .8.853/.7.-.

-.. .

7.803.-.-07.8. 9507042-3.39.39:305./.853/./.-.54884:8  .3 5078039..3.8.

. -.-.

3/. 5078039.853/.-.8.8..3.  .9070.. 9507042-3.803.

/. $.-..51034950..8.9:742484242445.9.

81034950.38.38:8:3. ..9.  0.3:90780-:9/.2.3.8 80.3.9: -.03 03/03.9:.88.703.-.:202-.034950.8. 349.

8 :39:.3349.2./ 3/.2.2093.0349503/.83 2./:./:.3::39:03 03-07.3./03.8.83 .88.

7   .9.7/.3.303 03/03.74248429.7 .9:/:.34.88.-.5./.502-:./.2.- . $0-. 907-08.73/.3:7:9.7424842/. 9./:9505..7424842 /.7039.75079./:..8 .974845.3.8.9:7424842/.37424842 .3:7:9.3035.3509.3.-.3907/7..::5/9:8/03./.03. 8.88.3 /02.20.....7.3 5.33.::5805079349.3203.39./902:.90425403-07.303495090780-:9 .3.503:8.. .3:/./.025.:39:202-:.3.. 28...880/0709.9.9.31. 0/:.4394  5.3...2.0 74:5 .7.9..7.9/.9:0425403-07.9.  !0209.2-.8.3 /03.9/2.3/.3. 3.5..95..3-....3-03.2093.9:/.5.35039:3.9. 805079/.80.3:9.3/.3:39:202-:. &39:203039:./5.0/0.9509.57424842/80-:980-.573853.3  09::.3.39.33..3.8.. .35078039./ ..3:7:9.99/./.4394-07:93  --.:39:09::034950.38.8.5.9/0.7.::2.2 509..3.9509././.890790.303.3.3.3.33.9079039: 03.3.7424842205:9503039:.9.

7 .3 9. 02:/.-...

3/.3.8.9./:.3. -/. .3.853/./-.8. 3:./:.3:2.9070.5.3 .3/.3/..3203.9:/:.

/:5. 58 793..7039.8:39:203.253/.3/..8. .  3/../82:.3..

 /82:.258203.-.8:39:203./.-..

-.3033.3.2./:58. . $090.8:8:3.9/./.33/.9.4.8.4.9073..3 /03..83/.882:.

.2.8. /03.3-.9/.

.  0.703./:5.3033..:-. 203.:7:9./. 28.7:89.7039.9: 3/.3...

.. ./:3203..-.258 2..3/.3/50740.

3 9073. ..3-.4./03.4:.-.9.2.8-0:2.

7 . 9073.7039..:7:9.203.3/..9109./.. 203:-./:5. 907.3035.././.

3038050793 4:8/903..3 :7:9.203./03./:5.../.3203.- 3/.258.. .7039..

.4.9..4/03.3 9073..3-.

-/423. 4.7488.008   9 9. 8.5.3 /.7.9:2478 80 805.709008  5 50.3-4/ 9:  .3-03.4/38  2 23.:008 0/ 0...9:7038 .9.:2:. 03.90/38 - -..3/02.03-78908  83 830/-78908 8 830..038  .3-.7008 # #4:030/008 -9 -03938   49..:938 85/ 85.3403 ...8907  .943 3 033..7309008 89 8.477 .:-9:839077:59:8008   790008 $ $9./.9/825:.85-077008 1 1:.:7:9.477:./038 .8 7.008  7.. ... ..  .220/38  :0/008   . .49008  .008 .:7.90/38 78 7480008   . 0.:7 .34/008 18   -093.38 8.78 .-4/ 0 0. .03-78908  0.9 .:     04-4/  309 30938  7: 74:4/008   .3:8008  :738 ' 7- 7:-008  -4 -47/0..38  .0308838 /5 /:2538  4.

33.709008  7/ 70.7008 - -947.:7.3 .-78908   ..80/38  7.8907 80397427 742484274248420..089..-.74248425.7  !09.. 3:90-4/     3:90-4/      . .8/ 8.-4/  .0/-4/    .943008 ..77438   /87 /87:590/38 !7 !7.80-7908  .73. 7..: .974845.07:-38 87 89750-4/   -- -4--0/-78908 . ...38  09.7.7/3./ .0/-78908 .38  & &59:720/38 0 0-43-4/   .23 .34.738 89 897.2-.7008 .:738  7 7:/2039.0/38 .-78908   :25-4/ 78/ 7. .7 .38 .80 4-9 4-9:8038  71 744138  3 3.20. ./.008  2 2.450/38 7/ 70/:.0 .

3.7.3.3.3:7:1-08./03./ -.9.3 $090.353/.3.7. 03-07./03.83 2./. 3.3  .3 80/.:7:9.7.3  0.2-.88../:5..7.18.- $0.-.3-03.92039:3.03-07:7:9.8053/.3203./ . .03./.9.8..9-08..7.39.  8.303.73.35078039.: /.0/:.3.3:93.39./:.7.3 2.8.3:90780-:9/.7.8/:-.:7:9.7..39.3/::7 .3.3.7.5078039.3./03./.5./03.:9...2.../:.8.3/.8.3/423.353/.7039.7/09.72:9. 9.3 033.3/.3/.838.8053/.39.2.- .7.39.803.2.703.3  /.7.. 8.203.

 /..3 907/7..      .3/02../:.8..3../.9.8.3 .39.. .3/.853/.2.3- 03.7.7.

39. /.     $02039.83 2.7.8../:.83.803./.      ..7.. .3.7.9: 3/..853/.32.3.

3.8907.3.90780-:9/.-./.3. ..   .8.853/.9.9-.          39071070387424842 !././:.439484.3/..3/.

53/.8.:3 /.2:3 80507990./.7 -03./...3      .3. 2./ 58 .8./:...3 2.90780-:9/.8353/.9.8.338-.3-.73.3.3/.339071070387424842.84..50789.7/.35.3 $0.9904750:.07.9.3/.  . 53/../:.7./03.8.58 907...9:9025.93.3/./03.:80.8./.5.2.3 907. .80.9./.58 034203.83 2.3/3.9047-08..3 -03.53/.7. 8.91/::7/03.35...3207:5.:3907107038./.38:.3/80-:9401803 438/038  ./..5.3203./902:.58 0-0.9./ 39071070383203:3:.8.9:3.    ./.3.5078039./390710703880.  07.7 -03.9.2.8053/.../.3.3.3 -07:7:9.3/. 80.8053/.8.8053/.83..9:8./.././0.75.73/0503/038.2../3.53/.2.399.7  3.7. .:.8..380-0:23.2.3/.3.3/.8.907.558 .3207:5.3907.82.-078./-078.3//0.3.3/8:.53/.0/:./ 58 8.2.- !.8.8.35078039.3 .3.2.7907. /./.439484.33-03.8.8.340   :075.7:83.3..7:83.35079.8 5078039.9.

9: 3.3 .3  0.7.8.73./03.58 8.-08.358 $0-.3.73.703.53/.3-07:7:9.3.3803./03.7 -03.2-.78.3/0503/038.8.   ./:.3-.53/./:.  203:3:.50789.3-03.7.3 203.38025:73.2. 3..50789.3-08.3.-07-.3907107038  ./. 203.3-07:7:9.3/3907-./.3..39.

.93./.3/03.8050795.53/.742484234247 .38.7:8$03/.%.7./.33.3-.8090709.2.985079. 9.954.80/./.3 .9:3./.35.3.9.:..9:81.8:.35:.3 3.3:8.9/09.38:3/03..3/02.:2.2..3803/73.5.880842.2-./0391.9:783908803292/33.9:74248429079039: .340 ..909.5.38020374248422./.7/.80-07.3/3:7:8/03.. .80 .74248422.2.8.-08.9.2-.-0  %07.3:  0.5409034  $0-7/.3-08.7.202507.3:39:/.-078.0:.5 03.9/9039:./03.3/07.9.880842.3 /.7.:..3.3:8..9./. 2.340./503:7.9.33.38.5./03.780-7/ .9:/..3:8.3:8.3:8.98 4247 9.3.9:8.8032 90780-:9 03.53/.2:3 170:0381:890780-:9/.8:.3509..9 /93..9.3035.74248422.-07470.83 2.5./.5.739071070383.5.2.3 1:8 803-07..3/03.9.:2.98203.3509.3 /03..7424842203.329488803.3:8..2502-0.854891/03.9038944./.38:.9:7424842907/.3907-039:02:/..:3 .80:9..39/.. !..78.7..7  0/:..-07.74248425.3502-07.32.-:3..580-7/.: /.3:8./.7.80-.80. .5.9.9.3203./3.380842.-:3.9/.80/.2.3502-:.9/825:.5-07-.3.7./..350302:.380842.9. 3742484280././3907107038/.9-.8:97.2.2../03.38.3./.7.3:39:203039:.3.9.39/./03..802039./.5.3.3/02.8.3.3.9  !.380038.8.80-7/./.32.3907107038 793.3.3203.9. 39071070383.80 ./.3.3-.9/:3.37.3/0.3907.5.-7/8.3/03.8.909..3202:33..9: /507:.8/.9../:3.3 /03.:907.2. .30-07.34018033907107038  .32...9.:/:25.7.3  03.9/03.8.3203.903 039079039:  %.  !0209.95:. 7424842..88.5.982.3./..892/33.7.3503..7  3.5..9/.9:809..3/.:.7424842 203:3.9/902:./.3 :2.32.38.90-07.5.5.409 $0.33.3508.393. .9.3203.7./..80-7/ /.809.3:8.8.39.9..30-07.3.7424842207:5.5.3.:8:8:3.5.3 -.3-08.3 9037042-3.8 74248422.303./:3.9:783908892/3 3..7 0/:.9:7424842.3/03.9/..7:8 .30./.9:.8.7.3202507. .880842.3-08.9.  &39:203.9 20309.03.80 80-7/..4394 0-07././:3.2240:7424842  %03-7/8.8 92/33.3  $0-.8303//.3.3.8:.73.87424842/./93.390.703.8888.8/.3/0391.8:2.:.-0  ../.33.3 80:2.2.3/.9.9.39.3./:25.33/0503/03803.91.9:903. 170:0381:8/.78.8.78/./02.9 703/.5.9.374248425.-7/8.:3 :39:203.829488380./.2502-:.33-0702-.9.7:8$03/.3039079039: 5.3:39:84.3/.7/.8:.974 !03..9: 8.3-08.3 /.3203.50.8032. 2.98  $0. ..

/. 9/.80 -7/                92/3 3.91 .91 9/.91 ../.91 .80 .                                                                            .91 ..

.

8.1-40309. !4890/-..7   #$         .742039.

3 ./ 2.9: 8.9:7405. .85.303 /.800307.3-.3.9-:.2.3  085:3/02.55./.2897:9:7 397.303.835.38.8/.9:.303907803/7  .3 8.3...:1034950 3/.9.2.209.3.3/58.209-093..34.:.5.73..5507..3.3/03.3828 03507:/.:.303/.9./.3. 80:2.9:./.2.9:..9:7502:3.3-.3503..803.8.9:7405.33.. 20.27424842 2.3 5. 8.303.3:0:8.9939.38:35.9:7405..39:305.:.9:..9.3.9/879 90758.2..:-.35078.2.8...3.9:.3 $.2.8..3 8..2.-07.8907203.39.3/.-.8070.3.320.9:9/.3 $0-. .390758.3907-039: $0.3.209 . 20302:.9.3/ 80/.03907/.3-07.8 .343805-.  0-07.9: 0307../:-0781..27424842  0.382803/.8.80.9//..30342 $97:9:77424842 :2.340.3.      #$ O O O !03079./.3-.209..3.9:8.33.8.4394 81..3070/907..5.3 09.3.382097.5.202-07.:. 20.382097.8.303.5.8.4-.9//..3 07.7424842         #$ 3.9:-0:2/.8.30390780-:9207:5.88.:302:/.3907..9907..3 02.8 .3.../09.34003/090./.9:.2.9/:3.3/879 90758.30/.37424842 ..3 09::.8.8070.3.78.3-0-.8.35:.3/.7:.9:8.3:93./503.5.8. ::203/0 502.703.3.3.83 2.9: 0425450309 %  47. 9.  7042-3.38..3/3...3-039:-3.9.8 5.3.81.2::203/0 8070..:507.8-07:93..74845.3 502.-:3.381.8507./.03207:5.8./.3 //.842.03907/.7424.3-.:89:/5.3203.20.:7424842 :8:83.:39:20250.3 8.2.720.8.3.38./80-:9.3070/907.

:-.749805079-.9.. :-:3.2-..749/. ..703..3507.3/-.2025:3..9:47..303//.3820.8//.3 802:.9:.9.2.880-:.9//..390780-:9  0.080:7:.0342/.3.880.3820 /80-:980-...3 03428:.380 .907/09..9.9 74248423-07-039:3.502-0.7  0342.39.74248429:3./:47.37424842 7.3 87:07  /.7.3.3.0342 03.9: 034247.039078:8:3/805.3.-         .7424842.8 0/:/:.38:33.5803/.2809.3.5.382090780-:95.3/24047.80-:.:.3.30342 $0./.3802:. .3820574.-3.27424842  !03079.9./.5803.3 9/.7.303 03.9:3:0:880..3.03.3907/.28:.../02.3..:25:.7..3:25:.7.907/7./.33.-07.809.3820 574..-' !.

30342574.203428:.-:./.3.33.39. 7424842/.33.3.257 80..9:47.749 07-0/.8907  0342:..2-. .3 /9025.7424842  %.57424842202-./.8.54/5..:425089.:2:23.3./83:3-./. 80842.9..3.39: 74248420:.3.38200:.8./03.:2025:3.54/ .7499078:8:3/..0:.98 .97424842. 3.80507.3:8.5.3039079039: $0.3::7.9.95.9.25.33  /.3/03.3820 0-.38508082025:3.79....0390780-:9 4394 /0709.380-.2025:3.890.749 ./.9..9:47.20342..:5:35.-07-0/.9.7424842/.3850808.4:8 .34:880:2.8-448:..9.5.7  .574.33..3 .32025:3.28:.8.209  5.8.749907/7.207:5.9.9:../:.-:.9: 80 80.9:74248420:./03.:/. -039:307 !488//.80/0709.7//.9 20.749/.2.-' $0 800.0342 $02039.7//.  .7.439480.4 -.2.9:03/80-:980-./.9.7424842 :2./.7..7492.7-0-07.03//.0342 .5.:2.2:3 :2.54/ .749 -.3509.-' ..749 .742484239/./.. -0/.-:.8-0-07.0342/54/  :2..5.: -07.7492025:3./.7424842.34..27424842 -.32025:3.749 03420:.03420:.9408:.74248425.80-:.9: 850808/.3203.9/.23 .7424842574..2-.

-0  :2.54/3..47.:8 :82:8.3742484234247 5:.809./.:.9:87424842//.74248425.:8 !./.0. 0.8.5.8025. . $06:4..3.3974/908 4248.0790-7..374248424244  . 7424842 . 742484234247/..54/-0-07.0342.3 /09..-:.37424842.20342.8.8.9./.2.3-075.2025:3...:2025:3.3808:..8.90 84:.38 9:80/:8 0. .7424842//.30 3  7424842 7424842.089.3-075.8147-08 .-.7424842 80/.3-0-07.0.0342.8 ..08 8907.749 $5080847.3.54/ 3                             :.3.74980/07./.5.1.-/45889.7..3.08.::8 08/42089.-/9800.4308.5.-0  :39.54/3.-07.20342. 74845.8508085.0 0:748547.:039:2 '.:2.38200:.33/3.:8/42089.:2 . %. $.    %.3. 02.3-075.34.3.8703.850808 47.5038  !..-:.1.9:8 7.742.8 %79.3.35.7 8.3820/54/0/:.2.3. 800387:8.2/4243.070.:..9.2..8..45078.0790-7.8907 345008.3.7/9 %:2-:.3.20.:8 0345:8.88.  793./.7038 7.: 5.380907:83.3.703420/:.3/03.703425079.3820 :2.57424842.0347..3 0.

80397.202-07.3//.7424842 803.9:209. 2.90780-:98.80397203.37424842 %070-50393.38./.7424842..37424842802.-.9/.2025079.8.3:2.3. 903.33.03/07:32025079..8.81..5.3 203:7:90/:/:.:39: 202-07..  .8./..5..502-0.749 74248420:.7424842 42443.39/.9.39025. 5.4394 03 /423..35:.3.303.5.03.7.5./903.3-07.3.0/:.2-.38:33.3.907/.25.3503/05 039:.34. /03./.3.03.5 89.4394 .8.5..3189039./.374248429.303.3 /:.37424842805079:7:1 /.7  $97:9:774248425./5./.9/04254..5.03.7...3853/0/. 202-07. 0.3/03. 7.25.257/::37424842803.35.3/03.9200.380 .80397 /..3909..9..3.80397 8:-209.74803979.3/:.37424842.5..7424842424403.9/.89072025:3.9:/././:.5.803.9:7424842/./.-07....780397480.3/507400349500907449 02./.503. .03..3.3.-:.4:89079039:/ /.-' .2.37424842./..7424842 $0-.3:7:16 80/.2 897:9:774248420:.3.3::37424842803.9: -039: 209.  .80  8   88 . 03. .-075.4:87424842 8073..3 207:5.380-07.3803974273.3 /03..80397 /..303.7424842 42443.5.8-0/.5.8897:9:77424842203.5.3.8.390.9/03.803973203.8:.9:907/.3.8:-209.9-075.3803974270-:7.3.93.5. 202-07.5.8039742790709././. !.35././...3.9.3.903.3. 2. 502-0.20.5.907-039:03495042449/423. $0-.3 -03.309.3.3 .7480397 /:25.28:.3 :2.303.1. -039:8:-209.3 5.30/:..742484242443./.209.9-075./.3 :39:4:890780-:9 .749 .2../.3.7480397 $97:9:7 74248423/..803978039742790709.903/.9.9-07:3.33.3035.8.3.8897:9:774248420:.37424842805079:7:1'  0. 89.390709.80397 8:-209.3 03495042449708081  .7424842 74248424244 9..903.:-07-039:307 9073.37424842805079:7:1 039:8:-209.9.3 0.37.35.81.3808:.39..303. /..3.25.3..33.7424842./.809.5.80397.03.9:7424842/.80 .749 .8.3.2.5.5. $0397427.303.09.8.  ././.974845.8:..3-.07. . .3803974273. 209.73.2-.30.2.803970/:/:.703.1.-03./209.70/:/:.2-.7480397 880397427 !.3/03././ 80-03.8.

3:8.3 /.3:8.07./:7..3742484280.3/./240825.309.2503.37424842.2. 2./.3507-0/.9.2.-.825.9/907/.3 .9/:.9./03.3 /-.-07.9/202-.-.7 88907.3 209./.3..2...3:8.35../.9070309  90427 ::37424842   80397427 43897857207   309447  742.8.:94842.../.5./.80397427-07-0/.5 742.8303.3503:8:37424842.3/ .742.3 :.303.80397.83 2.0425474845.9275 .33.8.980-.803975.35.38:33.9:.9/ 7424842.80397..303 03.:94842 209./. :94842.7424842.9/8 .3.5.7 88907./.74803975.5.74803975.380  ./.3 /:-:3.9:8:. 025.83803.9/02-.805.3.37424842209.0380.. .//.2.80-:.3/0.. 20.74845.8.23 .380  742.3/3..9:574903897:9:7.9:8.240: !.34.33.20/:.3:8.8897:9:7742484280507990..3.3909..5.3-039:3.380/.3.5..2/0487-43:0.8.3 -.2025:3..3.5.742.7802039.9 .80397427907/.-...503.3/.3/. $0-.9: 02..2.2025:3..3 2../.83 2.39/.9.3-07507.74248420/:./.39/.39079039:240:207:5.-' 907/7.2...380.2 50707.38.9309447 .3897:9:73.9/8    .7480397 .30.380-.9/02-. /.2025:3.5.3203085708.81.7.9 /.35..9/:3.25.3.8..3.-' .8 !./. -0/. 2471448.3 ./. . 5..742./.2.380907/.4244/03.-07:5.85080874845.5$//.9. 8.380 .8.825..8/:.7.7480397.8.5 5.3 10349503.2.:780 .3203. 825.9..8907 808:..742.5./..-:.35..32.:94842.303./.:39.2.:94842.2/.803975.9/:.-  803.80397427 09./.:94842209.3-08..2.0/:.509.8.3..7:39:..240:..3574903 %./.502-0.3 -.-.380/./.33.

2-.3:2:2897:9:774248420:.3 . .2503.2-.7  .3203. 7424842 ..7.. .3/.380/..749 .240:    .

.

1-40309.7 397$0-0:23.742039. $ !$$  #$$&%#%%  ! &%  #&$&#% %% &%& $&&!%& !&# .8. !4890/-..