BAB XV GENETIKA POPULASI • Populasi Mendelian • Frekuensi Genotipe dan Frekuensi Alel • Polimorfisme Lokus sebagai Indeks Keanekaragaman

Genetik • Hukum Keseimbangan Hardy-Weinberg • Perubahan Frekuensi Alel BAB XV. GENETIKA POPULASI Pola pewarisan suatu sifat tidak selalu dapat dipelajari melalui percobaan persilangan buatan. Pada tanaman keras atau hewan-hewan dengan daur hidup panjang seperti gajah, misalnya, suatu persilangan baru akan memberikan hasil yang dapat dianalisis setelah kurun waktu yang sangat lama. Demikian pula, untuk mempelajari pola pewarisan sifat tertentu pada manusia jelas tidak mungkin dilakukan percobaan persilangan. Pola pewarisan sifat pada organisme-organisme semacam itu harus dianalisis menggunakan data hasil pengamatan langsung pada populasi yang ada. Seluk-beluk pewarisan sifat pada tingkat populasi dipelajari pada cabang genetika yang disebut genetika populasi. Ruang lingkup genetika populasi secara garis besar oleh beberapa penulis dikatakan terdiri atas dua bagian, yaitu (1) deduksi prinsip-prinsip Mendel pada tingkat populasi, dan (2) mekanisme pewarisan sifat kuantitatif. Bagian yang kedua ini berkaitan dengan penjelasan pada Bab XIV bahwa analisis genetik sifat-sifat kuantitatif hanya dapat dilakukan pada tingkat populasi karena individu tidak informatif. Namun, beberapa penulis lainnya, seperti halnya Bab XV ini, menyebutkan bahwa materi yang dibahas dalam genetika populasi hanya meliputi deduksi prinsip-prinsip Mendel pada tingkat populasi. Populasi dalam arti Genetika Untuk mempelajari pola pewarisan sifat pada tingkat populasi terlebih dahulu perlu difahami pengertian populasi dalam arti genetika atau lazim disebut juga populasi Mendelian. Populasi mendelian ialah sekelompok individu suatu spesies yang bereproduksi secara seksual, hidup di tempat tertentu pada saat yang sama, dan di antara mereka terjadi perkawinan (interbreeding) sehingga masing-masing akan memberikan kontribusi genetik ke dalam lungkang gen (gene pool), yaitu sekumpulan informasi genetik yang dibawa oleh semua individu di dalam populasi. Deskripsi susunan genetik suatu populasi mendelian dapat diperoleh apabila kita mengetahui macam genotipe yang ada dan juga banyaknya masing-masing genotipe tersebut. Sebagai contoh, di dalam populasi tertentu terdapat tiga macam genotipe, yaitu AA, Aa, dan aa. Maka, proporsi atau persentase genotipe AA, Aa, dan aa akan menggambarkan susunan genetik populasi tempat mereka berada. Adapun nilai proporsi atau persentase genotipe tersebut dikenal dengan istilah frekuensi genotipe. Jadi, frekuensi genotipe dapat dikatakan sebagai proporsi atau persentase genotipe tertentu di dalam suatu populasi. Dengan perkataan lain, dapat juga didefinisikan bahwa frekuensi genotipe adalah proporsi atau persentase individu di dalam suatu populasi yang tergolong ke dalam genotipe tertentu. Pada contoh di atas jika banyaknya genotipe AA, Aa, dan aa masing-masing 30, 50, dan 20 individu, maka frekuensi genotipe AA = 0,30 (30%), Aa = 0,50 (50%), dan aa = 0,20 (20%). Di samping dengan melihat macam dan jumlah genotipenya, susunan genetik suatu populasi dapat juga dideskripsi atas dasar keberadaan gennya. Hal ini karena populasi dalam arti genetika, seperti telah dikatakan di atas, bukan sekedar kumpulan individu, melainkan kumpulan individu yang dapat melangsungkan perkawinan sehingga terjadi transmisi gen

dari generasi ke generasi. Dalam proses transmisi ini, genotipe tetua (parental) akan dibongkar dan dirakit kembali menjadi genotipe keturunannya melalui segregasi dan rekombinasi gen-gen yang dibawa oleh tiap gamet yang terbentuk, sementara gen-gen itu sendiri akan mengalami kesinambungan (kontinyuitas). Dengan demikian, deskripsi susunan genetik populasi dilihat dari gen-gen yang terdapat di dalamnya sebenarnya justru lebih bermakna bila dibandingkan dengan tinjauan dari genotipenya. Susunan genetik suatu populasi ditinjau dari gen-gen yang ada dinyatakan sebagai frekuensi gen, atau disebut juga frekuensi alel, yaitu proporsi atau persentase alel tertentu pada suatu lokus. Jika kita gunakan contoh perhitungan frekuensi genotipe tersebut di atas, maka frekuensi alelnya dapat dihitung sebagai berikut. AA Aa aa Total Banyaknya individu 30 50 20 100 Banyaknya alel A 60 50 - 110 Banyaknya alel a - 50 40 90 Karena di dalam tiap individu AA terdapat dua buah alel A, maka di dalam populasi yang mempunyai 30 individu AA terdapat 60 alel A. Demikian juga, karena tiap individu Aa membawa sebuah alel A, maka populasi yang mempunyai 50 individu Aa akan membawa 50 alel A. Sementara itu, pada individu aa dengan sendirinya tidak terdapat alel A, sehingga secara keseluruhan banyaknya alel A di dalam populasi tersebut adalah 60 + 50 + 0 = 110. Dengan cara yang sama dapat dihitung banyaknya alel a di dalam populasi, yaitu 0 + 50 + 40 = 90. Oleh karena itu, frekuensi alel A = 110/200 = 0,55 (55%), sedang frekuensi a = 90/200 = 0,45 (45%). Frekuensi alel berkisar dari 0 hingga 1. Suatu populasi yang mempunyai alel dengan frekuensi = 1 dikatakan mengalami fiksasi untuk alel tersebut. Hubungan matematika antara frekuensi genotipe dan frekuensi alel Seandainya di dalam suatu populasi terdapat genotipe AA, Aa, dan aa, masing-masing dengan frekuensi sebesar P, H, dan Q, sementara diketahui bahwa frekuensi alel A dan a masing-masing adalah p dan q, maka antara frekuensi genotipe dan frekuensi alel terdapat hubungan matematika sebagai berikut. p = P + ½ H dan q = Q + ½ H Dalam hal ini P + H + Q = 1 dan p + q = 1. Agar diperoleh gambaran yang lebih jelas mengenai hubungan tersebut, kita perhatikan contoh perhitungan berikut ini. Data frekuensi golongan darah sistem MN pada orang Eskimo di Greenland menurut Mourant (1954) menunjukkan bahwa frekuensi golongan darah M, MN, dan N masingmasing sebesar 83,5 %, 15,6%, dan 0,9% dari 569 sampel individu. Kita telah mengetahui pada Bab II bagian alel ganda bahwa genotipe golongan darah M, MN, dan N masing-masing adalah IMIM, IMIN, dan ININ. Maka, dari data frekuensi genotipe tersebut dapat dihitung besarnya frekuensi alel IM dan IN. Frekuensi alel IM = 83,5% + ½ (15,6%) = 91,3%, sedang frekuensi alel IN = 0,9% + ½ (15,6%) = 8,7%. Hasil perhitungan frekuensi alel dapat digunakan untuk menentukan sifat lokus tempat alel tersebut berada. Suatu lokus dikatakan bersifat polimorfik jika frekuensi alelnya yang terbesar sama atau kurang dari 0,95. Sebaliknya, suatu lokus dikatakan bersifat monomorfik jika frekuensi alelnya yang terbesar melebihi 0,95. Jadi, pada contoh golongan darah sistem MN tersebut lokus yang ditempati oleh alel IM dan IN adalah lokus polimorfik karena frekuensi alel terbesarnya ( IM = 91,3%), masih lebih kecil dari 0,95. Proporsi lokus polimorfik pada suatu populasi sering kali digunakan sebagai salah satu indeks keanekaragaman genetik. Nilai lainnya yang juga sering digunakan sebagai indeks keanekaragaman genetik suatu populasi adalah heterozigositas rata-rata atau frekuensi heterozigot (H) rata-rata. Pada contoh di atas besarnya nilai H untuk lokus MN adalah 15,6%.

Seandainya dapat diperoleh nilai H untuk lokus-lokus yang lain, maka dapat dihitung nilai heterozigositas rata-rata pada populasi tersebut. Perhitungan frekuensi alel menggunakan data elektroforesis Frekuensi alel pada suatu populasi spesies organisme dapat dihitung atas dasar data elektroforesis protein/enzim atau zimogram yang menampilkan pita-pita sebagai gambaran mobililitas masing-masing polipeptida penyusun protein (Gambar 15.1). Elektroforesis merupakan teknik pemisahan molekul yang berbeda-beda ukuran dan muatan listriknya. Oleh karena itu, molekul-molekul yang akan dipisahkan tersebut harus bermuatan listrik seperti halnya protein dan DNA. Jarak migrasi (cm) 4 3 2 1 Individu 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Genotipe CL LL LL CL CL CL LL CL CL CL LL CL LL LL CL Gambar 15.1. Zimogram esterase dari ikan sidat (Anguilla sp) di kawasan Segara Anakan, Cilacap (Sumber : Susanto, 2003) Prinsip kerja elektroforesis secara garis besar dapat dijelaskan sebagai berikut. Sampel ditempatkan pada salah satu ujung media berupa gel, kemudian kedua ujung gel tersebut diberi aliran listrik selama beberapa jam sehingga komponen-komponen penyusun sampel akan bergerak menuju kutub yang muatan listriknya berlawanan dengannya. Kecepatan gerakan (mobilitas) tiap komponen ini akan berbeda-beda sesuai dengan ukuran molekulnya. Makin besar ukuran molekul, makin lambat gerakannya. Akibatnya, dalam satuan waktu yang sama molekul berukuran besar akan menempuh jarak migrasi yang lebih pendek daripada jarak migrasi molekul berukuran kecil. Pola pita seperti pada zimogram esterase di atas sebenarnya merupakan gambaran fenotipe, bukan genotipe. Namun, analisis variasi fenotipe terhadap kebanyakan enzim pada berbagai macam organisme sering kali dapat memberikan dasar genetik secara sederhana. Seperti diketahui, tiap enzim dapat mengandung sebuah polipeptida atau lebih dengan susunan asam amino yang berbeda sehingga menghasilkan fenotipe berupa pita-pita dengan mobilitas yang berbeda. Variasi fenotipe ini disebabkan oleh perbedaan alel yang menyusun genotipe. Jika alel-alel yang menyebabkan perbedaan polipeptida pada enzim tertentu terletak pada suatu lokus, maka bentuk alternatif enzim yang diekspresikannya dikenal sebagai alozim. Alel yang mengatur alozim biasanya bersifat kodominan, yang berarti dalam keadaan heterozigot kedua-duanya akan diekspresikan. Dengan demikian, individu pada Gambar 15.1 yang menampilkan pita lambat dan pita cepat (nomor 1, 4, 5, 6, 8, 9, 10, 12, dan 15) memiliki genotipe heterozigot, yaitu CL (C=cepat; L=lambat). Sementara itu, individu yang hanya menampilkan pita lambat (nomor 2, 3, 7, 11, 13, dan 14) adalah homozigot LL. Begitu pula individu dengan hanya satu pita cepat (kebetulan pada zimogram tersebut tidak ada) dikatakan mempunyai genotipe homozigot CC. Dari data genotipe yang diturunkan dari data variasi fenotipe tersebut, kita dengan mudah dapat menghitung baik frekuensi genotipe maupun frekuensi alelnya. Frekuensi genotipe CC, CL, dan LL masing-masing adalah 0, 9/15, dan 6/15. Frekuensi alel C = 0 + ½ (9/15) = 9/30, sedang frekuensi alel L = 6/15 + ½ (9/15) = 21/30. Hukum Keseimbangan Hardy-Weinberg Populasi mendelian yang berukuran besar sangat memungkinkan terjadinya kawin acak

frekuensi alel akan senantiasa konstan dari generasi ke generasi. baik dengan genotipe yang sama maupun berbeda dengannya. frekuensi gamet a sama dengan frekuensi alel a (q). Dengan adanya sistem kawin acak ini. Hardy. sedang individu tt tidak. dapat dilihat bahwa frekuensi alel pada generasi keturunan sama dengan frekuensi alel pada generasi tetua. Dengan demikian. 2pq. Pada suatu pengujian terhadap 228 orang diperoleh bahwa hanya . yaitu tidak terjadi migrasi.1.1 terlihat bahwa tiga macam genotipe zigot akan terbentuk. zigot-zigot yang terbentuk akan memilki frekuensi genotipe sebagai hasil kali frekuensi gamet yang bergabung. H. dan aa. ahli matematika dari Inggris.(panmiksia) di antara individu-individu anggotanya. Aa. Frekuensi gamet A sama dengan frekuensi alel A (p). Sementara itu. sehingga selanjutnya dikenal sebagai hukum keseimbangan Hardy-Weinberg. tiap individu memiliki peluang yang sama untuk bertemu dengan individu lain. ada persyaratan lain yang harus dipenuhi bagi berlakunya hukum keseimbangan Hardy-Weinberg. Dengan perkatan lain. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel autosomal Kemampuan sesesorang untuk merasakan zat kimia feniltiokarbamid (PTC) disebabkan oleh alel autosomal dominan T. maka terjadi penggabungan gamet A dan a secara acak pula.Weinberg. Individu dengan genotipe TT dan Tt dapat merasakan PTC. Secara lebih rinci ketiga langkah ini dapat dijelaskan sebagai berikut. yakni AA. Kembali kita misalkan bahwa pada generasi tetua terdapat genotipe AA. Tabel 15. mutasi. (2) dari penggabungan gamet-gamet kepada genotipe zigot yang dibentuk. terjadinya peristiwa-peristiwa ini serta sistem kawin yang tidak acak akan mengakibatkan perubahan frekuensi alel. maka frekuensi alel pada populasi zigot atau populasi generasi keturunan dapat dihitung. Deduksi terhadap hukum keseimbangan Hardy-Weinberg meliputi tiga langkah. Dari populasi generasi tetua ini akan dihasilkan dua macam gamet. Fekuensi alel A = p2 + ½ (2pq) = p2 + pq = p (p + q) = p. frekuensi alel A adalah p. Frekuensi alel a = q2 + ½ (2pq) = q2 + pq = q (p + q) = q. dan Q. Pada Tabel 15. dan aa. Oleh karena itu.. dan W. dan (3) dari genotipe zigot kepada frekuensi alel pada generasi keturunan. Di samping kawin acak. Dengan berlangsungnya kawin acak. dan q2. Pembentukan zigot pada kawin acak Gamet-gamet dan frekuensinya A (p) a (q) Gamet-gamet dan frekuensinya A (p) AA (p2) Aa (pq) a (q) Aa (pq) aa (q2) Oleh karena frekuensi genotipe zigot telah didapatkan.H. dokter dari Jerman. yaitu A dan a. dan seleksi. masingmasing dengan frekuensi P. Artinya. yaitu (1) dari tetua kepada gamet-gamet yang dihasilkannya. Begitu juga. masing-masing dengan frekuensi p2. Aa. sedang frekuensi alel a adalah q. Prinsip ini dirumuskan oleh G.

pada jenis kelamin heterogametik formula tersebut tidak berlaku karena frekuensi alel rangkai X benar-benar sama dengan frekuensi genotipe. dan I0. Agar lebih jelas dapat dilihat Tabel 15.20. yang merupakan akar kuadrat frekuensi O. Individu yang tidak dapat merasakan PTC (genotipe tt) jumlahnya 228 – 160 = 68 sehingga frekuensi genotipe tt = 68/228 = 0.30 = 0.30. sementara individu heterogametik memberikan . dari data frekuensi golongan darah (fenotipe) dapat dihitung besarnya frekuensi alel.45. yaitu IA. Jika frekuensi ketiga alel tersebut masing-masing adalah p. sedang individu yang bergenotipe Tt = 0. maka sebaran frekuensi genotipenya = (p + q + r)2 = p2 + 2pq + 2pr + q2 + 2qr + q2. dari 500 mahasiswa Fakultas Biologi Unsoed diketahui 196 orang bergolongan darah A.20 x 228 =46. IB. q. Kontribusi alel sebanyak 2/3 bagian oleh individu homogametik disebabkan oleh keberadaan dua buah kromosom X pada individu tersebut. Dengan cara yang sama dapat dihitung pula frekuensi alel a pada seluruh populasi.25.2 berikut ini. Demikian pula. frekuensi I0 = √ 205/500 = 0. Banyaknya individu yang bergenotipe TT = 0. Pada jenis kelamin homogametik hubungan matematika antara frekuensi alel yang terdapat pada kromosom X (rangkai X) dan frekuensi genotipenya mengikuti formula seperti pada autosom. Jika TT dijumlahkan dengan Tt.50. 205 O. Dengan demikian. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel rangkai X Telah kita ketahui bahwa pada manusia dan beberapa spesies organisme lainnya dikenal adanya jenis kelamin homogametik (XX) dan heterogametik (XY). Dengan mudah dapat diperoleh frekuensi alel t = √ 0. sistem ini diatur oleh tiga buah alel. Dari 160 orang ini dapat dihitung individu yang bergenotipe TT dan Tt sebagai berikut. Alel yang langsung dapat dihitung frekuensinya adalah I0 .160 di antaranya yang dapat merasakan PTC. dan 26 AB. Pada jenis kelamin ini tiap individu hanya membawa sebuah alel untuk masing-masing lokus pada kromosom X-nya.55 dan frekuensi alel T = 1 – 0.2.55) = 0. Hubungan matematika antara fekuensi alel rangkai X dan frekuensi genotipe Homogametik Heterogametik Genotipe AA Aa aa A a Frekuensi genotipe P H Q R S Alel A a A a Frekuensi alel pm = P + ½H qm = Q + ½H pt = R qt = S pm = frekuensi alel A pada individu homogametik qm = frekuensi alel a pada individu homogametik pt = frekuensi alel A pada individu heterogametik qt = frekuensi alel a pada individu heterogametik Untuk seluruh populasi frekuensi alel A dapat dihitung. Tabel 15. dan O pada suatu populasi dapat dicari dari sebaran frekuensi tersebut. jumlah frekuensi A dan O = p2 + 2pr + r2 = (p + r)2 = (1 – q) 2 sehingga akar kuadrat frekuensi A + O = 1 – q. dan r.45)(0. Namun.45)2 = 0. Dengan cara yang sama dapat diperoleh frekuensi alel IA (p) = 1 – √(73 + 205)/500 = 0. Selanjutnya. yaitu p = 2/3 pm + 1/3 pt = 1/3 (2 pm + pt) = 1/3 (2P + H + R). maka diperoleh individu sebanyak 160 orang. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel ganda Salah satu contoh alel ganda yang sering dikemukakan adalah alel pengatur golongan darah sistem ABO pada manusia. Misalnya. sedang frekuensi genotipe Tt = 2(0. yaitu q = 2/3 qm + 1/3 qt = 1/3 (2 qm + qt) = 1/3 (2Q + H + S). Frekuensi golongan darah A adalah penjumlahan frekuensi genotipe IA IA dan IA I0 .55 = 0.50 x 228 = 114. Jadi. yang semuanya dapat merasakan PTC. Seperti telah kita bicarakan pada Bab II. Sebaliknya. frekuensi genotipe TT = (0. AB. Selanjutnya.11. frekuensi IB (q) = 1 – akar kuadrat frekuensi A + O = 1 – √(196 + 205)/500 = 0. 73 golongan B. yakni p2 + 2pr.64. frekuensi golongan darah B.

laju mutasi alel a menjadi A adalah v.82.16 dan frekuensi genotipe bb (Q) = 7 / (277+54+7) = 0. Sementara itu. Misalnya. yaitu q = 1/3 (2. Selain itu. Hubungan matematika antara laju mutasi dan perubahan frekuensi alel dapat dirumuskan seperti pada contoh berikut ini.kontribusi alel 1/3 bagian karena hanya mempunyai sebuah kromosom X. Sekarang kita dapat menghitung frekuensi alel B pada seluruh populasi. hubungan antara perubahan frekuensi alel dan laju migrasi dapat dilihat sebagai persamaan berikut ini.16 + 0. Sebaliknya. dalam suatu populasi terdapat 277 ekor kucing betina berwarna hitam (BB). Jika persamaan ini dielaborasi.11. vqo = upo. di dalam suatu populasi terdapat alel A dan a.02. dan juga tingkat kesuburan (fertilitas). jika pada tiap generasi sebanyak 80 dari 1000 ekor ikan normal digantikan oleh ikan albino.16 + 0.88) = 0.82 + 0.12) = 0. Dari data ini dapat dihitung frekuensi genotipe BB pada populasi kucing betina.88. yaitu P = 277 / (277+54+7) = 0.12. frekuensi genotipe Bb (H) = 54 / (277+54+7) = 0. Oleh karena itu. Mutasi berlangsung dari A ke a dengan laju mutasi sebesar u. 54 betina tortoise shell (Bb). Hal ini berarti bahwa peristiwa migrasi akan menyebabkan terjadinya perubahan frekuensi alel. Di antara populasi kucing jantan frekuensi genotipe B. yang rendah. Dengan demikian. dan 42 jantan kuning (b). Secara matematika. Ketika dicapai keseimbangan di antara kedua arah mutasi tersebut nilai ∆p dan ∆q adalah 0. 311 kucing jantan hitam (B). sedang perubahan frekuensi alel a akibat mutasi adalah ∆q = upo – vqo. maka dikatakan bahwa laju migrasinya 0. Dari kenyataan tersebut di atas dapat dimengerti bahwa mutasi hanya akan memberikan pengaruh nyata terhadap perubahan frekuensi alel jika mutasi berlangsung berulang kali (recurrent mutation) dan mutan yang dihasilkan memiliki kemampuan untuk beradaptasi dengan lingkungan yang ada. Namun. Sebagai contoh perhitungan frekuensi alel rangkai X dapat dikemukakan alel rangkai X yang mengatur warna tortoise shell pada kucing.0. Migrasi Di atas telah disebutkan bahwa migrasi merupakan salah satu syarat yang harus dipenuhi bagi berlakunya hukum keseimbangan Hardy-Weinberg. dan frekuensi alel b pada seluruh populasi. masing-masing dengan frekuensi awal po dan qo.0. individu-individu mutan biasanya mempunyai daya hidup (viabilitas). sering kali digunakan untuk menjelaskan adanya perbedaan frekuensi alel tertentu di antara berbagai populasi. yaitu S = 42 / (311+42) = 0. kuantifikasi migrasi dalam bentuk laju migrasi (lazim dilambangkan sebagai m). Lebih jauh.89. Laju migrasi dapat didefinisikan sebagai proporsi atau persentase alel tertentu di dalam suatu populasi yang digantikan oleh alel migran pada tiap generasi. Hal ini terutama karena laju mutasi yang umumnya terlalu rendah untuk dapat menyebabkan terjadinya perubahan frekuensi alel. sedang frekuensi genotipe b.02 + 0. atau secara umum vq = up. yaitu R = 311 / (311+42) = 0. Sebagai contoh. 7 betina kuning (bb). Misalnya. perubahan frekuensi alel A akibat mutasi adalah ∆p = vqo – upo. misalnya perbedaan frekuensi golongan darah sistem ABO yang terlihat sangat nyata antara ras yang satu dan lainnya. pn – P = (po – P)(1 – m)n pn = frekuensi alel pada populasi yang diamati setelah n generasi migrasi P = frekuensi alel pada populasi migran po = frekuensi alel pada populasi awal (sebelum terjadi migrasi) m = laju migrasi n = jumlah generasi Mutasi Faktor lain yang dapat menyebabkan terjadinya perubahan frekuensi alel adalah mutasi. peristiwa yang sangat mendasari proses evolusi ini sebenarnya tidak begitu nyata pengaruhnya dalam perubahan frekuensi alel. yaitu p = 1/3 (2.08 atau 8%. maka .

Kembali kita misalkan bahwa di dalam suatu populasi terdapat genotipe AA. Genotipe superior di dalam suatu populasi. Namun. genotipe Aa menjadi genotipe baku dan kontribusi genetiknya justru lebih besar daripada kontribusi genotipe AA. Bahkan pada kondisi overdominansi.2 berikut ini.2. Seleksi Sebegitu jauh kita mengasumsikan bahwa semua individu di dalam populasi akan memberikan kontribusi jumlah keturunan yang sama kepada generasi berikutnya. sehingga individu ini akan menderita anemia berat dan biasanya meninggal pada usia muda. individu heterozigot HbSHbA justru memiliki ketahanan yang lebih tinggi terhadap .2 c) genotipe ini memberikan kontribusi genetik sama besar dengan kontribusi genotipe AA. Proporsi pengurangan kontribusi genetik suatu genotipe bila dibandingkan dengan kontribusi genetik genotipe baku disebut koefisien seleksi (s) genotipe tersebut. Individu dengan genotipe homozigot HbSHbS akan mengalami pengkristalan molekul hemoglobin. Namun. dikatakan memiliki nilai fitnes relatif sama dengan 1.akan didapatkan p = v/(u + v) dan q = u/(u + v). Kondisi dominansi ketiga genotipe ini berdasarkan atas nilai fitnes relatifnya dapat dilihat pada Gambar 15. nilai fitnes relatif genotipe ini adalah 1 – s. dan aa. kenyataan yang sebenarnya sering dijumpai tidaklah demikian. Dengan perkataan lain. Aa. Berbagai kondisi dominansi dilihat dari nilai fitnes relatifnya a) Semi dominansi b) Dominansi parsial c) Dominansi penuh d) Overdominansi Pada kondisi semi dominansi dan dominansi parsial (Gambar 15. Nilai fitnes relatif berkisar antara 0 dan 1. dan eritrositnya berbentuk seperti bulan sabit. Proporsi atau persentase kontribusi genetik suatu individu kepada generasi berikutnya dikenal sebagai fitnes relatif atau nilai seleksi individu tersebut.2 a dan b) genotipe Aa memberikan kontribusi genetik yang lebih kecil bila dibandingkan dengan kontribusi genotipe baku (AA). Individu-individu dapat memberikan kontribusi genetik yang berbeda karena mereka mempunyai daya hidup dan tingkat kesuburan yang berbeda. aa Aa AA (1-s) (1-½s) 1 a) aa Aa AA (1-s) (1-½s) 1 b) aa AA/Aa (1-s) 1 c) aa AA Aa (1-s2) (1-s1) 1 d) Fitnes relatif Gambar 15. Dominansi heterozigot (kondisi overdominansi) ini dapat dijumpai misalnya pada kasus resistensi individu karier anemia bulan sabit (sickle cell anemia) terhadap penyakit malaria. atau disebut juga genotipe baku. sementara untuk genotipe-genotipe lainnya nilai fitnes relatif besarnya kurang dari 1. sedang pada kondisi dominansi penuh (Gambar 15.

maka ∆q = q1 – q = q2(1 – s ) + pq / 1-sq2 – q. baik AA maupun aa. dan 1/4 bagian.infeksi parasit penyebab malaria bila dibandingkan dengan individu normal (HbAHbA). Katakanlah generasi pertama suatu populasi tanaman menyerbuk sendiri hanya terdiri atas individu-individu dengan genotipe Aa. mengalami peningkatan. perkawinan asortatif adalah sistem kawin tidak acak yang didasarkan atas fenotipe. genotipe HbSHbA merupakan genotipe baku (fitnes relatif = 1). Sebaliknya. Sebaliknya. perkawinan asortatif negatif dan silang luar akan meningkatkan frekuensi genotipe heterozigot. Oleh karena terjadi penyerbukan sendiri di antara genotipe Aa. 1/4 Aa. Silang dalam Contoh silang dalam yang paling ekstrim dapat dilihat pada tanaman yang melakukan penyerbukan sendiri. perubahan frekuensi alel dapat dihitung sebagai berikut. Di samping perkawinan asortatif ada pula sistem kawin tidak acak yang tidak memandang fenotipe individu tetapi dilihat dari hubungan genetiknya. dan aa masing-masing sebanyak 1/4. yaitu silang dalam (inbreeding) dan silang luar (outbreeding). 3/8 aa. 1/2. Pada generasi ketiga genotipe AA dan aa akan bertambah 1/8 bagian yang berasal dari segregasi genotipe Aa pada generasi kedua. sedang silang luar adalah perkawinan di antara individu-individu yang secara genetik tidak memiliki hubungan kekerabatan. misalnya. Dengan demikian. genotipe Aa akan berkurang menjadi 1/4 bagian sehingga populasi generasi ketiga akan terdiri atas (1/4+1/8) AA. sedang individu normal HbAHbA mempunyai nilai fitnes relatif kurang dari 1. Sistem Kawin Tidak Acak Faktor lain yang meyebabkan gangguan keseimbangan Hardy-Weinberg adalah sistem kawin tidak acak (non random mating). sedang frekuensi heterozigot Aa berkurang. Perkawinan asortatif positif dan silang dalam akan meningkatkan frekuensi genotipe homozigot. Genotipe homozigot untuk suatu lokus tertentu – jika kita berbicara individu normal diploid – . Dengan perkataan lain. Perkawinan asortatif dapat berupa perkawinan asortatif positif atau asortatif negatif (disasortatif). 1/4 Aa. Genotipe AA Aa aa Total Frekuensi awal p2 2pq q2 1 Fitnes relatif 1 1 1 – s Kontribusi genetik p2 2pq q2(1 – s ) 1 – sq2 Terlihat bahwa kontribusi genetik total mejadi lebih kecil dari 1 karena genotipe aa mempunyai nilai fitnes relatif 1 – s. Sistem kawin semacam ini dapat dibedakan menjadi dua macam. Jika perubahan frekuensi alel a dilambangkan dengan ∆q. yaitu q1 = q2(1 – s ) + pq / 1-sq2. ada sistem kawin tidak acak yang dikenal sebagai perkawinan asortatif. Dari rumus hubungan matematika antara frekuensi alel dan frekuensi genotipe dapat dihitung besarnya frekuensi alel a setelah seleksi. sampai dengan generasi ketiga saja sudah terlihat bahwa frekuensi genotipe homozigot. Untuk kondisi dominansi yang lain besarnya perubahan frekuensi alel akibat seleksi dapat dirumuskan dengan cara seperti di atas. Setelah persamaan ini kita elaborasi akan didapatkan ∆q = – sq2( 1 – q) / 1 – sq2. maka pada generasi kedua dari seluruh populasi akan terdapat genotipe AA. Aa. dan (1/4+1/8) aa atau 3/8 AA. Perubahan frekuensi alel akibat seleksi berlangsung sesuai dengan kondisi dominansi yang ada. pada perkawinan asortatif negatif individu-individu yang mempunyai fenotipe berbeda cenderung untuk lebih sering bertemu bila dibandingkan dengan individu-individu dengan fenotipe yang sama. Di tempat-tempat yang menjadi endemi penyakit malaria. Pada perkawinan asortatif positif individu-individu yang mempunyai fenotipe sama cenderung untuk lebih sering bertemu bila dibandingkan dengan individu-individu dengan fenotipe berbeda. Silang dalam adalah perkawinan di antara individu-individu yang secara genetik memiliki hubungan kekerabatan. Pada kondisi dominansi penuh. Jika dilihat dari segi fenotipe. Sebaliknya.

* Hitung nilai F dengan rumus : F = Σ (½)n(1 + FA) n = jumlah individu yang terdapat pada tiap loop (pada soal ini terdapat 3 individu. Nilai ini besarnya berkisar dari 0 hingga 1. Frekuensi tersebut ternyata sama dengan frekuensi genotipe hasil kawin acak. Perubahan frekuensi alel yang disebabkan oleh terjadinya silang dalam dapat dihitung dari perubahan frekuensi genotipe seperti pada Tabel 15. Hal ini berarti di dalam populasi hanya tinggal individu homozigot. Jika nilai F = 1.Contoh diagram silsilah *Hitung jumlah individu yang terdapat pada tiap loop sebagai nilai n. dan q2 . Loop adalah jalan yang menghubungkan kedua orang tua C D X (C dan D) melewati leluhur bersama (A dan B). pada individu X besarnya ¼. makin cepat diperoleh tingkat homozigositas yang tinggi. baik A maupun B. 2 pq. dan q.3. baik pada loop CAD maupun CBD) FA = koefisien silang dalam leluhur bersama (pada soal ini FA dan FB masing-masing sama dengan 0 karena dianggap sebagai individu hasil kawin acak) Dengan demikian. Makin besar nilai F. 0. individu A kawin dengan B menghasilkan dua anak. maka kedua alel tersebut dikatakan seasal atau identik (identical by descent). Hal ini berarti bahwa peluang bertemunya alel-alel identik yang berasal dari leluhur bersama. maka frekuensi genotipe AA. nilai F sama dengan 1 apabila kedua alel sepenuhnya merupakan alel identik atau berasal dari leluhur bersama (common ancestor) yang sangat dekat. Pertama.mempunyai dua buah alel yang sama pada lokus tersebut. pembuahan sendiri dapat mencapai homozigositas 100% pada generasi keenam. yaitu C dan D. dan aa masing-masing menjadi p. Aa. Misalnya. sedang individu heterozigot tidak . nilai F individu X (FX) pada contoh soal tersebut di atas adalah (½)3(1 + 0) + (½)3(1 + 0) = ¼. Tabel 15. Selanjutnya.3. Dua alel semacam ini dikatakan sebagai alel serupa (alike in state). Sebagai gambaran. yaitu CAD dan CBD.3. dan aa masing-masing adalah p2. mereka berasal dari hasil replikasi sebuah alel pada generasi sebelumnya. sementara perkawinan antara saudara kandung baru mencapainya pada generasi keenam belas. Untuk menggambarkan besarnya peluang bahwa dua buah alel yang sama pada individu homozigot merupakan alel identik digunakan suatu nilai yang disebut sebagai koefisien silang dalam (inbreeding coefficient). Sebaliknya. dan biasanya dilambangkan dengan F. A B * Hitung jumlah loop. Aa. maka frekuensi genotipe AA. Persamaan di antara dua alel pada genotipe homozigot dapat terjadi dengan dua kemungkinan. Pada soal ini terdapat dua X loop. Nilai F sama dengan 0 apabila kedua alel pada individu homozigot tidak mempunyai asal. Frekuensi genotipe hasil kawin acak dan silang dalam Genotipe Frekuensi Kawin acak Silang dalam AA p2 p2 (1 – F) + pF Aa 2 pq 2 pq (1 – F) aa q2 q2 (1 – F) + qF Jika nilai F = 0. mereka secara fungsional sama sehingga menghasilkan fenotipe yang sama pula. Jika hal ini yang terjadi. Gambar 15.usul yang sama atau merupakan hasil kawin acak. kakak beradik C dan D kawin. mempunyai anak X.3. Besarnya nilai F dapat dihitung dari diagram silsilah seperti contoh pada Gambar 15. Peningkatan homozigositas akibat silang dalam dapat menimbulkan tekanan silang dalam (inbreeding depression) apabila di antara alel-alel identik yang bertemu terdapat sejumlah alel resesif yang kurang menguntungkan. Koefisien silang dalam individu X dapat dihitung sebagai berikut. Kemungkinan kedua.

Persilangan antara galur murni AAbb (akar kuat. di samping segregasi dan rekombinasi. MUTASI Fungsi ketiga materi genetik adalah fungsi evolusi. Dalam silang ganda ini. Agak berbeda dengan silang tiga arah. Pada silang tiga arah hibrid H digunakan sebagai tetua betina untuk disilangkan lagi dengan galur murni lain sehingga biji hibrid yang dihasilkan akan dibawa oleh tongkol hibrid H yang ukurannya besar. pada silang ganda hibrid H disilangkan dengan hibrid I hasil silang tunggal antara galur murni C dan D. batang lemah) dan aaBB (akar lemah. sedang alel b menyebabkan batang lemah. yang agar dapat melaksanakannya materi genetik harus mempunyai kemampuan untuk melakukan mutasi. Peristiwa mutasi atau perubahan materi genetik. batang kuat) akan menghasilkan hibrid AaBb yang mempunyai akar dan batang kuat. 11/03/2009 Posted by zaifbio | Genetika Dasar | 2 Komentar MUTASI BAB XI MUTASI • Pengertian Mutasi • Mekanisme Molekuler Mutasi • Mutasi Spontan dan Mutasi Induksi • Estimasi Laju Mutasi Spontan dengan Metode Clb • Mutagen Kimia dan Fisika • Mekanisme Perbaikan DNA • Mutasi Balik dan Mutasi Penekan • Uji Ames BAB XI. melainkan hasil silang tiga arah (three-way cross) atau silang ganda (double cross). maka jumlah bijinya menjadi sedikit dan tidak cukup untuk dijual kepada petani. jika silang dalam dapat menyebabkan terjadinya tekanan silang dalam yang berpengaruh buruk terhadap individu yang dihasilkan. antara lain untuk merakit varietas jagung hibrida. Sementara itu.dijumpai lagi. Silang luar Berkebalikan dengan silang dalam. Namun. Fenomena heterosis sudah sering sekali dimanfaatkan pada bidang pemuliaan tanaman. Di samping itu. silang luar justru dapat memunculkan individu hibrid dengan sifat-sifat yang lebih baik daripada kedua tetuanya yang homozigot. mendapatkan hibrid H. silang luar akan meningkatkan frekuensi heterozigot. alel B menyebabkan batang menjadi kokoh. karena biji hibrid H ini dibawa oleh tongkol tetuanya (A atau B) yang kecil. Fenomena keunggulan yang diperlihatkan oleh individu hibrid hasil persilangan dua tetua galur murni (homozigot) disebut sebagai vigor hibrida atau heterosis. Ada beberapa teori mengenai mekanisme genetik yang menjelaskan terjadinya heterosis. ada alel A yang menyebabkan akar tanaman tumbuh kuat sementara alel a menjadikan akar tanaman lemah. Salah satu di antaranya adalah teori dominansi. yang pada prinsipnya menyebutkan bahwa alel-alel reseif merugikan yang dibawa oleh masing-masing galur murni akan tertutupi oleh alel dominan pada individu hibrid yang heterozigot. Galur murni A disilangkan dengan galur murni B. jagung hibrida yang dipasarkan biasanya bukan hasil silang tunggal (single cross) seperti itu. sebagai tetua betina dapat digunakan baik hibrid H maupun hibrid I karena kedua-duanya mempunyai tongkol yang besar. Oleh karena itu. Misalnya. akan menciptakan variasi genetik yang berguna untuk mengantisipasi perubahan kondisi lingkungan yang sewaktu- .

Pengaruh fenotipik yang ditimbulkan oleh mutasi sangat bervariasi. Mutasi germinal terjadi pada sel-sel germinal atau sel-sel penghasil gamet. substitusi asam amino yang tidak menghasilkan perubahan sifat protein atau perubahan fenotipik pun dapat dikatakan sebagai mutasi tenang. Akan tetapi. Seperti dikatakan di atas. Hemoglobin pada individu dewasa normal terdiri atas dua rantai polipeptida α yang identik dan dua rantai polipeptida β yang identik juga. pada organisme diploid pengaruh mutasi juga bergantung kepada dominansi alel. Mekanisme terjadinya mutasi titik ini ada dua macam. yakni asam glutamat. Mutasi yang terjadi pada sebuah atau sepasang basa pada DNA disebut sebagai mutasi titik (point mutation). Substitusi sebuah asam amino oleh asam amino lain yang muatannya sama. Mutasi somatis akan menyebabkan terbentuknya khimera. misalnya substitusi histidin oleh lisin. sedangkan mutasi somatis terjadi pada sel-sel selain sel germinal. Selain itu. Hal ini karena pelipatan rantai polipeptida sebagai penentu struktur tiga dimensi molekul protein sangat bergantung kepada interaksi di antara asam-asam amino dengan muatan yang berlawanan. Pada tanaman tingkat tinggi mutasi somatis justru sering kali menghasilkan varietas-varietas yang diinginkan dan untuk perbanyakannya harus dilakukan secara vegetatif. Pada organisme multiseluler dapat dibedakan antara mutasi germinal dan mutasi somatis. Kita mengenal berbagai macam peristiwa mutasi sesuai dengan kriteria yang digunakan untuk mengelompokkannya. perubahan urutan asam amino tidak selalu menyebabkan perubahan sifat-sifat biologi protein atau menghasilkan fenotipe mutan. perubahan sebuah basa pada DNA tidak selamanya disertai oleh substitusi asam amino karena sebuah asam amino dapat disandi oleh lebih dari sebuah triplet kodon (lihat Bab X). pada penderita anemia bulan sabit (sickle cell anemia) salah satu asam amino pada polipeptida β. Jenis sel dan tahap perkembangan individu menentukan besar kecilnya pengaruh mutasi. yaitu individu dengan jaringan normal dan jaringan yang terdiri atas sel-sel somatis mutan. Hemoglobin penderita anemia bulan sabit akan mengalami kristalisasi ketika tidak bereaksi dengan oksigen sehingga akan mengendap di pembuluh darah dan menyumbatnya. Perubahan atau mutasi basa pada DNA yang tidak menyebabkan substitusi asam amino atau tidak memberikan pengaruh fenotipik dinamakan mutasi tenang (silent mutation). perubahan urutan asam amino pada suatu protein dapat menyebabkan perubahan sifat-sifat biologi protein tersebut. Namun. ada tidaknya pengaruh substitusi suatu asam amino terhadap perubahan sifat protein bergantung kepada peran asam amino tersebut dalam struktur dan fungsi protein. mulai dari perubahan kecil yang hanya dapat dideteksi melalui analisis biokimia hingga perubahan pada prosesproses esensial yang dapat mengakibatkan kematian sel atau bahkan organisme yang mengalaminya.waktu dapat terjadi. eritrositnya menjadi lonjong dan mudah pecah. Jadi. Demikian juga. digantikan atau disubstitusi oleh valin. Dalam hal ini. yang tidak bermuatan atau netral. Mekanisme Molekuler Mutasi Meskipun tidak selalu. Namun. Setiap perubahan asam amino disebabkan oleh perubahan urutan basa nukleotida pada molekul DNA. mengakibatkan perubahan struktur hemoglobin dan juga eritrosit yang membawanya. sering kali tidak berpengaruh terhadap struktur molekul protein atau fenotipe individu. oleh valin. yang bermuatan negatif. Substitusi asam glutamat. Alel-alel hasil mutasi somatis tidak akan diwariskan kepada keturunan individu yang mengalaminya karena mutasi ini tidak mempengaruhi sel-sel germinal. Contoh yang paling sering dikemukakan adalah perubahan sifat biologi yang terjadi pada molekul hemoglobin. yaitu (1) substitusi basa dan (2) perubahan rangka baca akibat adanya penambahan basa (adisi) atau kehilangan . alel mutan resesif tidak akan memunculkan pengaruh fenotipik selama berada di dalam individu heterozigot karena tertutupi oleh alel dominannya yang normal.

basa (delesi). Mutasi titik yang disebabkan oleh substitusi basa dinamakan mutasi substitusi basa, sedangkan mutasi yang terjadi karena perubahan rangka baca dinamakan mutasi rangka baca (frameshift mutation) seperti telah disinggung pada Bab X. Apabila substitusi basa menyebabkan substitusi asam amino seperti pada kasus hemoglobin anemia bulan sabit, maka mutasinya dinamakan mutasi salah makna (missense mutation). Sementara itu, jika substitusi basa menghasilkan kodon stop, misalnya UAU (tirosin) menjadi UAG (stop), maka mutasinya dinamakan mutasi tanpa makna (nonsense mutation) atau mutasi terminasi rantai (chain termination mutation). Substitusi basa pada sebuah triplet kodon dapat menghasilkan sembilan kemungkinan perubahan triplet kodon karena tiap basa mempunyai tiga kemungkinan substitusi. Sebagai contoh, kodon UAU dapat mengalami substitusi basa menjadi AAU (asparagin), GAU (asam aspartat), CAU (histidin), UUU (fenilalanin), UGU (sistein), UCU (serin), UAA (stop), UAG (stop), dan UAC (tirosin). Kita bisa melihat bahwa perubahan yang terakhir, yakni UAC, tidak menghasilkan substitusi asam amino karena baik UAC maupun UAU menyandi asam amino tirosin. Mutasi substitusi basa dapat dibedakan menjadi dua kelompok, yaitu transisi dan transversi. Pada transisi terjadi substitusi basa purin oleh purin atau substitusi pirimidin oleh pirimidin, sedangkan pada transversi terjadi substitusi purin oleh pirimidin atau pirimidin oleh purin. Secara skema kedua macam substitusi basa tersebut dapat dilihat pada Gambar 11.1. A TC G Gambar 11.1. Skema substitusi basa nukleotida transisi transversi Sementara itu, mutasi rangka baca akan mengakibatkan perubahan rangka baca semua triplet kodon di belakang tempat terjadinya mutasi tersebut. Akan tetapi, adisi atau pun delesi sebanyak kelipatan tiga basa pada umumnya tidak akan menimbulkan pengaruh fenotipik mutasi rangka baca. Demikian pula, seperti dikatakan pada Bab X adisi satu basa yang diimbangi oleh delesi satu basa di tempat lain, atau sebaliknya, akan memperbaiki kembali rangka baca di belakang tempat tersebut. Selain itu, apabila adisi atau delesi terjadi pada daerah yang sangat dekat dengan ujung karboksil suatu protein, maka mutasi rangka baca yang ditimbulkannya tidak akan menyebabkan sintesis protein nonfungsional. Dengan perkataan lain, mutasi tidak memberikan pengaruh fenotipik. Mutasi Spontan Perubahan urutan basa nukleotida berlangsung spontan dan acak. Tidak ada satu pun cara yang dapat digunakan untuk memprediksi saat dan tempat akan terjadinya suatu mutasi. Meskipun demikian, setiap gen dapat dipastikan mengalami mutasi dengan laju tertentu sehingga memungkinkan untuk ditetapkan peluang mutasinya. Artinya, kita dapat menentukan besarnya peluang bagi suatu gen untuk bermutasi sehingga besarnya peluang untuk mendapatkan suatu alel mutan dari gen tersebut di dalam populasi juga dapat dihitung. Terjadinya suatu peristiwa mutasi tidak dapat dikatakan sebagai hasil adaptasi sel atau organisme terhadap kondisi lingkungannya. Kebanyakan mutasi memperlihatkan pengaruh yang sangat bervariasi terhadap tingkat kemampuan adaptasi sel atau organisme, mulai dari netral (sangat adaptable) hingga letal (tidak adaptable). Oleh karena itu, tidak ada korelasi yang nyata antara mutasi dan adaptasi. Namun, pemikiran bahwa mutasi tidak ada sangkut pautnya dengan adaptasi tidak diterima oleh sebagian besar ahli biologi hingga akhir tahun 1940-an ketika Joshua dan Esther Lederberg melalui percobaannya pada bakteri

membuktikan bahwa mutasi bukanlah hasil adaptasi. Dengan teknik yang dinamakan replica plating koloni-koloni bakteri pada kultur awal (master plate) dipindahkan ke medium baru (replica plate) menggunakan velvet steril sehingga posisi setiap koloni pada medium baru akan sama dengan posisinya masing-masing pada kultur awal. Medium baru dibuat dua macam, yaitu medium nonselektif seperti pada kultur awal dan medium selektif yang mengandung lebih kurang 109 fag T1. Hanya koloni-koloni mutan yang resisten terhadap infeksi fag T1 (mutan T1-r) yang dapat tumbuh pada medium selektif ini. Dari percobaan tersebut terlihat bahwa koloni-koloni mutan T1-r yang tumbuh pada medium selektif tidak terbentuk sebagai hasil adaptasi terhadap kehadiran fag T1, tetapi sebenarnya sudah ada semenjak pada kultur awal. Dengan demikian, teknik selektif semacam itu hanya akan menyeleksi mutan-mutan yang telah ada sebelumnya di dalam suatu populasi. master plate transfer replica plate replica plate (medium nonselektif) (medium selektif) Gambar 11.2. Percobaan transfer koloni (replica plating) = koloni mutan T1-r Teknik selektif seperti yang diuraikan di atas memberikan dasar bagi pemahaman tentang munculnya resistensi berbagai populasi hama dan penyakit terhadap senyawa kimia yang digunakan untuk mengendalikannya. Sebagai contoh, sejumlah populasi lalat rumah saat ini nampak sangat resisten terhadap insektisida DDT. Hal ini menunjukkan betapa seleksi telah memunculkan populasi lalat rumah dengan kombinasi mekanisme enzimatik, anatomi, dan perilaku untuk dapat resisten terhadap atau menghindari bahan kimia tersebut. Begitu pula, gejala peningkatan resistensi terhadap antibiotik yang diperlihatkan oleh berbagai macam bakteri penyebab penyakit pada manusia tidak lain merupakan akibat proses seleksi untuk memunculkan dominansi strain-strain mutan tahan antibiotik yang sebenarnya memang telah ada sebelumnya. Laju mutasi Laju mutasi adalah peluang terjadinya mutasi pada sebuah gen dalam satu generasi atau dalam pembentukan satu gamet. Pengukuran laju mutasi penting untuk dilakukan di dalam genetika populasi, studi evolusi, dan analisis pengaruh mutagen lingkungan. Mutasi spontan biasanya merupakan peristiwa yang sangat jarang terjadi sehingga untuk memperkirakan peluang kejadiannya diperlukan populasi yang sangat besar dengan teknik tertentu. Salah satu teknik yang telah digunakan untuk mengukur laju mutasi adalah metode ClB yang ditemukan oleh Herman Muller. Metode ClB mengacu kepada suatu kromosom X lalat Drosophila melanogaster yang memiliki sifat-sifat tertentu. Teknik ini dirancang untuk mendeteksi mutasi yang terjadi pada kromosom X normal. Kromosom X pada metode ClB mempunyai tiga ciri penting, yaitu (1) inversi yang sangat besar (C), yang menghalangi terjadinya pindah silang pada individu betina heterozigot; (2) letal resesif (l); dan (3) marker dominan Bar (B) yang menjadikan mata sempit (lihat Bab VII). Dengan adanya letal resesif, individu jantan dengan kromosom tersebut dan individu betina homozigot tidak akan bertahan hidup. Persilangan pertama dilakukan antara betina heterozigot untuk kromosom ClB dan jantan dengan kromosom X normal. Di antara keturunan yang diperoleh, dipilih individu betina yang mempunyai mata Bar untuk selanjutnya pada persilangan kedua dikawinkan dengan jantan normal. Individu betina dengan mata Bar ini jelas mempunyai genotipe heterozigot

karena menerima kromosom ClB dari tetua betina dan kromosom X normal dari tetua jantannya. Hasil persilangan kedua yang diharapkan adalah dua betina berbanding dengan satu jantan. Ada tidaknya individu jantan hasil persilangan kedua ini digunakan untuk mengestimasi laju mutasi letal resesif. Oleh karena pindah silang pada kromosom X dihalangi oleh adanya inversi (C) pada individu betina, maka semua individu jantan hasil persilangan hanya akan mempunyai genotipe + . Kromosom X pada individu jantan ini berasal dari tetua jantan awal (persilangan pertama). Sementara itu, individu jantan dengan kromosom X ClB selalu mengalami kematian. Meskipun demikian, kadang-kadang pada persilangan kedua tidak diperoleh individu jantan sama sekali. Artinya, individu jantan yang mati tidak hanya yang membawa kromosom ClB, tetapi juga individu yang membawa kromosom X dari tetua jantan awal. Jika hal ini terjadi, kita dapat menyimpulkan bahwa kromosom X pada tetua jantan awal yang semula normal berubah atau bermutasi menjadi kromosom X dengan letal resesif. Dengan menghitung frekuensi terjadinya kematian pada individu jantan yang seharusnya hidup ini, dapat dilakukan estimasi kuantitatif terhadap laju mutasi yang menyebabkan terbentuknya alel letal resesif pada kromosom X. Ternyata, lebih kurang 0,15% kromosom X terlihat mengalami mutasi semacam itu selama spermatogenesis, yang berarti bahwa laju mutasi untuk mendapatkan letal resesif per kromosom X per gamet adalah 1,5 x 10-3. betina Bar ClB + jantan normal ClB ? + ? ClB + letal betina Bar (dipilih untuk disilangkan dengan jantan normal) ClB ? + ClB + ? + ClB ? letal letal jika X-nya membawa letal resesif Gambar 11.3. Metode ClB untuk mengestimasi laju mutasi = kromosom X yang berasal dari tetua jantan pada persilangan pertama Pada metode ClB tidak diketahui laju mutasi gen tertentu karena kita tidak dapat memastikan banyaknya gen pada kromosom X yang apabila mengalami mutasi akan berubah menjadi alel resesif yang mematikan. Namun, semenjak ditemukannya metode ClB berkembang pula sejumlah metode lain untuk mengestimasi laju mutasi pada berbagai organisme. Hasilnya menunjukkan bahwa laju mutasi sangat bervariasi antara gen yang satu dan lainnya. Sebagai contoh, laju mutasi untuk terbentuknya tubuh berwarna kuning pada Drosophila adalah 10-4 per gamet per generasi, sementara laju mutasi untuk terbentuknya resitensi terhadap streptomisin pada E. coli adalah 10-9 per sel per generasi. Asal-mula terjadinya mutasi spontan Ada tiga mekanisme yang paling penting pada mutasi spontan, yaitu (1) kesalahan selama replikasi, (2) perubahan basa nukleotida secara spontan, dan (3) peristiwa-peristiwa yang berkaitan dengan penyisipan (insersi) dan pemotongan (eksisi) unsur-unsur yang dapat

Namun. tidaklah sempurna sama sekali. Mutasi dengan laju yang ditingkatkan ini dinamakan mutasi induksi. tetapi mengenali kesalahan basa di dalam untai DNA. timbullah mutasi spontan. Sitosin yang seharusnya berpasangan dengan guanin berubah menjadi timin yang berpasangan dengan adenin sehingga terjadilah mutasi transisi (purin menjadi purin. Selanjutnya. Mekanisme perbaikan salah pasangan Basa-basa tautomerik adakalanya dapat tergabung dengan benar ke dalam molekul DNA. Muller pada tahun 1927 yang memperlihatkan bahwa sinar X dapat menyebabkan mutasi pada Drosophila. Bukti pertama bahwa agen eksternal dapat meningkatkan laju mutasi diperoleh dari penelitian H. basa tersebut akan membentuk ikatan hidrogen yang benar dengan basa pada untai DNA cetakan sehingga fungsi penyuntingan oleh DNA polimerase tidak dapat mengenalinya. Jika hal ini terjadi. Kadang-kadang ada juga kesalahan pasangan basa yang tidak dikenalinya. dan basa timin yang seharusnya sitosin tersebut tidak dilihat sebagai basa yang salah. maka sistem perbaikan salah pasangan tidak dapat membedakan antara untai cetakan dan untai baru. Pada Bab IX telah kita bicarakan bahwa enzim Pol I dan Pol III adakalanya membuat kesalahan dengan menyisipkan basa yang salah ketika replikasi DNA sedang berlangsung. dengan bantuan enzim Pol I celah ini akan diisi oleh segmen baru yang membawa basa yang telah diperbaiki. Kadang-kadang suatu kesalahan replikasi luput dari mekanisme penyuntingan tersebut. Sistem ini dikenal sebagai sistem perbaikan salah pasangan (mismatch repair). Caranya. Sumber mutasi spontan lainnya adalah perubahan basa sitosin yang telah termetilasi menjadi timin karena hilangnya gugus amino. jika segmen yang membawa kesalahan basa tersebut telah mengalami metilasi. Akan tetapi. ada sistem lain yang berfungsi dalam perbaikan kesalahan replikasi DNA. Berbeda dengan sistem penyuntingan oleh DNA polimerase.4. pirimidin menjadi pirimidin). Pada saat penggabungan berlangsung. segmen DNA yang membawa basa yang salah dibuang sehingga terdapat celah (gap) di dalam untai DNA. . seperti halnya mekanisme penyuntingan oleh DNA polimerase. sistem perbaikan salah pasangan tidak bekerja pada ujung 3’ untai DNA yang sedang tumbuh. Aktivitas penyuntingan oleh DNA polimerase boleh dikatakan sangat efisien meskipun tidak berarti sempurna benar. Mutasi Induksi Laju mutasi spontan yang sangat rendah ternyata dapat ditingkatkan dengan aplikasi berbagai agen eksternal. Akan tetapi. enzim-enzim DNA polimerase ini juga diketahui mempunyai kemampuan untuk memperbaiki kesalahan (proof reading) melalui aktivitas eksonukleasenya dengan cara memotong basa yang salah pada ujung 3’ untai DNA yang sedang dipolimerisasi. Sistem perbaikan salah pasangan akan mengoreksi kesalahan semacam itu. Hal ini akan menimbulkan mutasi spontan.berpindah (transposable elements). Dalam hal ini hilangnya gugus amino dari sitosin yang telah termetilasi tidak dapat dikenali oleh sistem perbaikan salah pasangan. Sistem perbaikan salah pasangan. Agen yang dapat menyebabkan terjadinya mutasi seperti sinar X ini dinamakan mutagen. 5’ GAGTCGAATC 3’ untai cetakan 3’ CTCAGTTTAG 5’ untai baru GAGTCGAATC CTC AG AGTTT segmen dengan perbaikan eksisi basa yang salah GAGTCGAATC CTCAGCTTAG untai yang telah diperbaiki Gambar 11.

Basa ini analog dengan basa timin karena hanya berbeda pada posisi gugus metil yang diganti dengan atom bromium. Penggantian ini belum dapat dikatakan sebagai peristiwa mutasi. nisbah dTTP terhadap dCTP menjadi sangat tinggi dan frekuensi salah pasangan GT. maka akan terjadi hambatan dalam sintesis dCTP. akan meningkat. mutagen kimia dapat mengakibatkan mutasi pada DNA baik yang sedang . maka dTTP akan disintesis dalam jumlah normal tetapi sintesis dCTP akan sangat terhambat.5). maka basa analog ini dikatakan bersifat mutagenik. Basa analog Basa analog merupakan senyawa kimia yang struktur molekulnya sangat menyerupai basa nukleotida DNA sehingga dapat menjadi bagian yang menyatu di dalam molekul DNA selama berlangsungnya replikasi normal. Akan tetapi. Jika sel yang akan dimutasi ditumbuhkan pada medium yang mengandung BU dalam bentuk keto. yang seharusnya GC. Pada putaran replikasi berikutnya basa timin pada pasangan GT akan berpasangan dengan adenin sehingga posisi yang seharusnya ditempati oleh GC sekarang diganti dengan AT. Mutasi tautomerik (transisi) akibat basa analog 5-bromourasil Mutagen-mutagen kimia Berbeda dengan basa analog yang hanya bersifat mutagenik ketika DNA sedang melakukan replikasi.5. Artinya. Sebagai contoh. Hal ini karena suatu basa analog dapat berpasangan dengan basa tertentu pada untai DNA cetakan. BU sebagai basa yang analog dengan timin juga dapat menghambat sintesis dCTP. Percobaan-percobaan berikutnya menunjukkan bahwa mekanisme mutagenesis BU dapat terjadi dengan cara lain. bisa juga masuknya sebuah basa analog terkoreksi melalui mekanisme penyuntingan oleh enzim DNA polimerase. Dengan perkataan lain. Sementara itu. jika BU berada dalam bentuk enol. berbagai mutagen fisika dan kimia digunakan untuk meningkatkan laju mutasi. Mekanisme penyuntingan dan perbaikan salah pasangan sebenarnya dapat membuang basa timin yang salah berpasangan dengan guanin tersebut. Konsentrasi deoksinukleosida trifofat (dNTP) di dalam sel pada umumnya diatur oleh konsentrasi deoksitimidin trifosfat (dTTP). Dengan demikian. basa 5-bromourasil (BU) yang diketahui mudah sekali bergabung dengan DNA bakteri dan virus. A=T substitusi T oleh BU (keto) A=BU replikasi 1 A=T G=BU pengikatan G oleh BU (enol) replikasi 2 A=T A=T G=C A=BU transisi Gambar 11. Jika BU ditambahkan ke dalam medium pertumbuhan. maka selama replikasi DNA adakalanya timin digantikan oleh BU sehingga pasangan basa AT berubah menjadi ABU. Apabila suatu basa analog dapat membentuk ikatan hidrogen dengan dua macam cara. BU telah menginduksi mutasi tautomerik berupa transisi GC menjadi AT. Dengan mutagen-mutagen ini dapat diperoleh bermacam-macam mutan pada beberapa spesies organisme. maka BU akan berpasangan dengan guanin (GBU). dan pada putaran replikasi berikutnya. Akibatnya. dapat mempunyai dua macam bentuk. Akan tetapi.Semenjak penemuan Muller tersebut. Apabila suatu saat dTTP terdapat dalam jumlah yang sangat berlebihan. telah terjadi mutasi tautomerik berupa transisi dari AT ke GC (Gambar 11. molekul DNA yang baru akan mempunyai pasangan basa GC pada posisi yang seharusnya ditempati oleh pasangan basa AT. Namun. yaitu keto dan enol sehingga dapat membentuk ikatan hidrogen dengan dua macam cara. konsentrasi dTTP akan menentukan konsentrasi ketiga dNTP lainnya untuk keperluan sintesis DNA. keberadaan BU ternyata menyebabkan laju perbaikan menjadi tertinggal oleh laju salah pasangan.

misalnya agen-agen alkilasi. melainkan mutasi rangka baca. Dengan demikian. Dengan struktur yang sangat menyerupai sebuah pasangan basa. EMS dapat juga bereaksi dengan A dan C. Iradiasi ultraviolet Sinar ultraviolet (UV) dapat menghasilkan pengaruh. Hal ini mengakibatkan terjadinya transisi AT menjadi GC melaui HC. O CH2 – CH2 – Cl CH3 – CH2 – O – S – CH3 HN O CH2 – CH2 – Cl etilmetan sulfonat mustard nitrogen Gambar 11. sitosin. Akan tetapi. menimbulkan perubahan yang sangat khas. Interkalasi Senyawa kimia akridin.6. memiliki struktur molekul berupa tiga cincin sehingga sangat menyerupai pasangan basa purin – pirimidin atau pirimidin – purin. Peristiwa penyisipan semacam ini dinamakan interkalasi. maka replikasi akan terhenti tepat di depan celah dan kemudian dimulai lagi dengan menyisipkan basa adenin pada posisi yang komplementer dengan celah tersebut. Jika HNO2 terbukti sangat bermanfaat pada sistem prokariot. memberikan pengaruh dengan spektrum yang luas. baik letal maupun mutagenik. Besarnya perenggangan sama dengan tebal molekul akridin. HNO2 bekerja sebagai mutagen dengan mengubah gugus amino (NH2) pada basa adenin. Oleh karena itu pada posisi celah tersebut terjadi perubahan dari GC menjadi TA atau purin-pirimidin menjadi pirimidin-purin. mutasi yang ditimbulkan bukanlah mutasi tautomerik. beberapa lainnya. maka agen-agen alkilasi sangat efektif untuk digunakan pada sistem eukariot. Pengaruh ini disebabkan oleh terjadinya perubahan kimia pada . Selain itu. Beberapa di antara mutagen kimia. yang berpasangan dengan sitosin. yang salah satu contohnya adalah proflavin (Bab X). Apabila DNA yang membawa akridin tadi melakukan replikasi.bereplikasi maupun yang tidak sedang bereplikasi. Padahal seharusnya pasangan basa pada posisi celah tersebut adalah GC (bukankah yang hilang adalah G?). Perubahan ini tidak lain merupakan mutasi tautomerik jenis transversi. dan guanin menjadi gugus keto (=O) sehingga spesifisitas pengikatan hidrogen pada basa-basa tersebut juga mengalami perubahan. setelah replikasi basa adenin di posisi celah tersebut akan berpasangan dengan timin atau terjadi pasangan TA. Dengan mekanisme serupa. Jika hal ini terjadi. Depurinasi tidak selalu bersifat mutagenik karena celah yang terbentuk dengan hilangnya basa purin tadi dapat segera diperbaiki. deaminasi sitosin yang menghasilkan urasil akan mengakibatkan transisi GC menjadi AT melalui AU. garpu replikasi sering kali terlebih dahulu telah mencapai celah tersebut sebelum perbaikan sempat dilakukan. Deaminasi adenin akan menghasilkan hipoksantin (H). maka untai DNA hasil replikasi akan ada yang mengalami adisi dan ada yang mengalami delesi pada posisi terjadinya interkalasi. Struktur molekul dua agen alkilasi yang umum digunakan Fenomena lain yang dapat muncul akibat terjadinya alkilasi guanin adalah depurinasi. yaitu hilangnya basa purin yang telah mengalami alkilasi tersebut dari molekul DNA karena patahnya ikatan yang menghubungkannya dengan gula deoksiribosa. pada semua jenis virus dan sel. Agen alkilasi etilmetan sulfonat (EMS) dan mustard nitrogen merupakan mutagen-mutagen kimia yang banyak digunakan dalam penelitian genetika. akridin dapat menyisip di antara dua pasangan basa yang berdekatan pada molekul DNA. misalnya asam nitros (HNO2). Alkilasi pada basa G atau T akan menyebabkan terjadinya salah pasangan yang mengarah kepada transisi AT→ GC dan GC → AT. Akibatnya. Namun. Kedua-duanya akan memberikan gugus etil (C2H5) atau sejenisnya kepada basa DNA. Pengaruh interkalasi terhadap molekul DNA adalah terjadinya perenggangan jarak antara dua pasangan basa yang berurutan.

DNA yang membawa dimer pada kedua untainya melakukan replikasi (Gambar 11. Akhirnya. Pada mekanisme yang kedua pemotongan mula-mula hanya terjadi pada satu tempat. Namun. ikatan antara timin dan timin akan terputus oleh suatu enzim tertentu.8. rekombinasi. khususnya timin dimer. yakni di sekitar dimer. Pengaruh terbesar yang ditimbulkan oleh iradiasi sinar UV adalah terbentuknya pirimidin dimer. kerusakan DNA ini pada umumnya dapat diperbaiki melalui salah satu di antara empat macam mekanisme.8. Pada mekanisme pertama. Dengan adanya timin dimer. diikuti oleh resintesis segmen DNA baru. Akibatnya. replikasi DNA akan terhalang pada posisi terjadinya timin dimer tersebut. skema mekanisme tersebut dapat dilihat pada Gambar 11. proses ini diakhiri dengan ligasi segmen yang baru tadi dengan untai DNA. enzim endonuklease melakukan pemotongan (eksisi) pada dua tempat yang mengapit dimer. Sebenarnya enzim tersebut telah mengikat dimer.8. Untuk jelasnya. dan diakhiri oleh ligasi segmen tersebut dengan untai DNA. sedangkan kedua untai DNA baru tidak mempunyai celah lagi (Gambar 11. Celah akan diisi oleh segmen yang sesuai dari masingmasing untai DNA cetakan yang membawa dimer. Pembuangan segmen ini kemudian diikuti oleh sintesis segmen baru yang akan menggantikannya dengan bantuan enzim DNA polimerase I. Oleh karena itu. segmen yang membawa dimer akan terlepas dari untai DNA. maka polimerisasi akan terhenti sejenak untuk kemudian dimulai lagi dari posisi setelah dimer. Ada dua mekanisme eksisi yang agak berbeda.8. Akibatnya. baik ketika ada cahaya maupun tidak ada cahaya. Mekanisme SOS Mekanisme perbaikan DNA dengan sistem SOS dapat dilihat sebagai jalan pintas yang memungkinkan replikasi tetap berlangsung meskipun harus melintasi dimer.basa DNA akibat absorpsi energi dari sinar tersebut. yaitu saling terikatnya dua molekul timin yang berurutan pada sebuah untai DNA.b). Hasilnya berupa . Eksisi Perbaikan dengan cara eksisi merupakan proses enzimatik bertahap yang diawali dengan pembuangan dimer dari molekul DNA. dan SOS. pada untai DNA cetakan terdapat segmen yang hilang. sekarang kedua untai DNA cetakan selain membawa dimer juga mempunyai celah. untai DNA hasil polimerisasi akan mempunyai celah pada posisi dimer. eksisi. Akan tetapi. Rekombinasi Berbeda dengan dua mekanisme yang telah dijelaskan sebelumnya.d). yaitu fotoreaktivasi.a) sehingga pada waktu garpu replikasi mencapai dimer akan terbentuk celah pada kedua untai DNA yang baru (Gambar 11. perbaikan kerusakan DNA dengan cara rekombinasi terjadi setelah replikasi berlangsung. Ketika DNA polimerase sampai pada suatu dimer.c). Mekanisme rekombinasi pada prinsipnya merupakan cara untuk menutup celah tersebut menggunakan segmen yang sesuai pada untai DNA cetakan yang membawa dimer. Fotoreaktivasi Mekanisme perbaikan ini bergantung kepada cahaya. Seperti pada mekanisme yang pertama. aktivasinya memerlukan spektrum biru cahaya sehingga enzim tersebut hanya bisa bekerja apabila ada cahaya. Pada waktu yang sama terjadi pemotongan lagi pada segmen yang membawa dimer sehingga segmen ini terlepas dari untai DNA. mekanisme ini sering juga dikatakan sebagai rekombinasi pascareplikasi. Jadi. Akibatnya. segmen yang baru tersebut diligasi dengan untai DNA sehingga untai DNA ini sekarang tidak lagi membawa dimer.8. segmen penutup celah akan terligasi dengan sempurna pada masing-masing untai DNA baru (Gambar 11. Akhirnya. Dengan adanya cahaya. Pada celah yang terbentuk akibat pemotongan tersebut segera terjadi sintesis segmen baru dengan urutan basa yang benar.

β. mutasi tetap terjadi. mekanisme SOS dapat dikatakan sebagai sistem perbaikan yang rentan terhadap kesalahan. maka sistem perbaikan salah pasangan tidak dapat memperbaiki semua kesalahan yang ada. Sistem penyuntingan tidak dapat memperbaiki kesalahan ini karena tidak aktif.8. Namun. Pemaparan sebesar 1000 rad meningkatkan . Dengan sendirinya. sedangkan sistem perbaikan salah pasangan sebenarnya dapat memperbaikinya. Oleh karena itu. a) b) d) c) Gambar 11. dimer pemotongan di dua tempat pemotongan di satu tempat di sekitar dimer resintesis segmen baru oleh Pol I pemotongan segmen ligasi yang membawa dimer ligasi Gambar 11. Frekuensi mutasi yang diinduksi oleh sinar X sebanding dengan dosis radiasi yang diberikan. Skema mekanisme rekombinasi pascareplikasi = pirimidin dimer = penutupan celah oleh segmen dari untai DNA cetakan yang membawa dimer Radiasi pengion Radiasi pengion mempunyai energi yang begitu besar sehingga molekul air dan senyawa kimia lainnya yang terkena olehnya akan terurai menjadi fragmen-fragmen bermuatan listrik.untai DNA yang utuh tetapi sering kali sangat defektif. yang didefinisikan sebagai besarnya radiasi yang menyebabkan absorpsi energi sebesar 100 erg pada setiap gram materi. Intensitas radiasi pengion dinyatakan secara kuantitatif dengan beberapa macam cara. frekuensi letal resesif pada kromosom X Drosophila meningkat linier sejalan dengan meningkatnya dosis radiasi sinar X. Mekanisme eksisi untuk memperbaiki DNA Ketika sistem SOS aktif.7. Radiasi pengion meliputi sinar X beserta partikel-partikelnya dan radiasi yang dihasilkan oleh unsur-unsur radioaktif seperti partikel α. kedua adenin ini tidak dapat berpasangan dengan timin karena kedua timin berada dalam bentuk dimer. Untai DNA yang baru akan mempunyai dua basa adenin berurutan pada posisi dimer (dalam kasus timin dimer). Ukuran yang paling lazim digunakan adalah rad. karena jumlah dimer di dalam setiap sel yang mengalami iradiasi UV biasanya begitu banyak. Akibatnya. Sebagai contoh. dan sinar γ. sistem penyuntingan oleh DNA polimerase III justru menjadi tidak aktif. Semua bentuk radiasi pengion akan menyebabkan pengaruh mutagenik dan letal pada virus dan sel. Pengaruh mutagenik iradiasi UV memang hampir selalu merupakan akibat perbaikan yang rentan terhadap kesalahan. Hal ini dimaksudkan agar polimerisasi tetap dapat berjalan melintasi dimer.

Cara yang pertama telah kita jelaskan pada Bab X. Oleh karena tumor mengandung banyak sekali sel yang mengalami mitosis sementara jaringan normal tidak. Pada cara yang kedua tidak terjadi adisi dan delesi pada urutan basa. yaitu kerusakan pada salah satu untai. Pada eukariot radiasi pengion dapat menyebabkan kerusakan kromosom. Pada Drosophila tidak terdapat ambang bawah dosis pemaparan yang yang tidak menyebabkan mutasi. Mutasi semacam ini dinamakan mutasi balik atau reversi. Jika bagian yang tidak dapat dipulihkan bukan merupakan urutan yang esensial. maka pembacaan rangka baca akan menghasilkan fenotipe normal. tidak dapat sepenuhnya memulihkan mutan ke fenotipe normalnya seperti yang akan diuraikan di bawah ini. Kebanyakan mutasi penekan. Diharapkan setelah iradiasi diberikan selama kurun waktu tertentu. tetapi perubahan suatu asam amino yang mengakibatkan hilangnya aktivitas protein akan diimbangi oleh perubahan asam amino lainnya yang memulihkan aktivitas protein tersebut. semua sel tumor akan rusak. Akan tetapi. terjadi penekanan intragenik. yang biasanya bersifat letal. Sebagai contoh dapat dikemukakan penekanan mutasi enzim triptofan sintetase pada E. Akan tetapi. seperti telah disinggung pada Bab X. Mutasi Balik dan Mutasi Penekan Kebanyakan mutasi yang telah kita bicarakan hingga saat ini adalah perubahan dari bentuk alami atau normal ke bentuk mutan. yaitu perbaikan rangka baca dengan kompensasi adisi-delesi sehingga rangka baca yang bergeser sebagian besar dapat dikembalikan seperti semula. pada beberapa organisme terdapat sistem yang dapat memperbaiki kerusakan kromosom tersebut meskipun perbaikan yang dilakukan sering mengakibatkan delesi. dan translokasi. Jika asam amino glisin ini berubah menjadi asam glutamat. Artinya. Perubahan glisin menjadi asam glutamat sebenarnya . mutasi dapat juga berlangsung dari bentuk mutan ke bentuk normal. Ada dua mekanisme yang berbeda pada mutasi balik. dan perubahan basa nukleotida. Namun. coli.maupun intergenik. inversi. maka enzim triptofan sintetase menjadi tidak aktif. Salah satu di antara dua polipeptida yang menyusun enzim tersebut adalah polipeptida A yang terdiri atas 268 asam amino. atau sering dikatakan sebagai mutasi ke depan (forward mutation). mutasi penekan dapat juga terjadi di dalam gen yang lain atau bahkan di dalam kromosom yang lain sehingga peristiwanya dinamakan penekanan intergenik. iradiasi biasanya dilakukan dengan selang waktu beberapa hari agar sel-sel tumor yang semula sedang beristirahat kemudian melakukan mitosis. Pada strain normal asam amino yang ke-210 adalah glisin. Namun. mutasi akan tetap terinduksi. duplikasi. yang disandi oleh gen trpA pada. Mutasi penekan dapat terjadi di suatu tempat di dalam gen yang sama dengan mutasi pertama yang ditekannya. kerusakan pada kedua untai. Radiasi pengion banyak digunakan dalam terapi tumor. yaitu (1) perubahan urutan basa pada DNA mutan sehingga benar-benar pulih seperti urutan basa pada fenotipe normalnya dan (2) terjadinya mutasi kedua di suatu tempat lainnya di dalam genom yang mengimbangi atau menekan pengaruh mutasi pertama sehingga mutasi yang kedua tersebut sering disebut sebagai mutasi penekan (suppressor mutation). Ada tiga macam kerusakan DNA yang disebabkan oleh radiasi pengion.frekuensi mutasi dari laju mutasi spontan sebesar 0. Dengan perkataan lain. Pada prinsipnya perlakuan ini dimaksudkan untuk meningkatkan frekuensi kerusakan kromosom pada sel-sel yang sedang mengalami mitosis. betapapun rendahnya dosis radiasi. Pengaruh mutagenik dan letal yang ditimbulkan oleh radiasi pengion terutama berkaitan dengan kerusakan DNA. Mekanisme mutasi balik berupa mutasi penekan jauh lebih umum dijumpai daripada mekanisme yang pertama.15% menjadi 3%. Oleh karena itu. tidak semua sel tumor mengalami mitosis pada waktu yang sama. Penekanan intragenik Pada garis besarnya ada dua macam cara penekanan intragenik. maka sel tumor yang dirusak akan jauh lebih banyak daripada sel normal yang dirusak. baik intra.

Mutasi penekan intergenik dapat memulihkan baik mutasi tanpa makna (nonsense) maupun mutasi salah makna (missense). Mutasi semacam itu pertama kali ditemukan pada strain-strain E. perubahan glisin menjadi asam glutamat akan ditekan pengaruhnya oleh perubahan tirosin menjadi sistein. (3) mutasi di luar kala (loop) antikodon yang memungkinkan aminoasil sintetase mengenali tRNA sehingga terjadi asilasi yang menyebabkan tRNA ini membawa asam amino yang lain. Apabila tirosin berubah menjadi sistein. Selain itu. yakni UAC dapat berubah menjadi kodon stop UAG. uji mutagenesis terhadap bahan-bahan kimia . salah satu kodon untuk tirosin. Penekanan intergenik Penekanan intergenik yang paling umum dijumpai adalah penekanan oleh suatu produk mutasi gen terhadap pengaruh mutasi yang ditimbulkan oleh sejumlah gen lainnya. Pemulihan terjadi karena asam aspartat digantikan oleh alanin (tidak bermuatan). Penekanan mutasi tanpa makna disebabkan oleh mutasi gen penyandi tRNA sehingga terjadi perubahan antikodon pada tRNA yang memungkinkannya untuk mengenali kodon stop hasil mutasi. terminasi dapat dibatalkan. Beberapa di antaranya dikenal potensial sebagai mutagen. Antikodon pada molekul tRNA normal yang membawa triptofan adalah AAC. asam amino normal yang ke-174 adalah tirosin. maka pengaruhnya akan ditekan oleh perubahan glisin menjadi asam glutamat.tidak menyebabkan inaktivasi enzim secara langsung karena glisin tidak terletak pada tapak aktif. mutasi tRNA telah memulihkan mutasi tanpa makna. dan (4) mutasi aminoasil sintetase yang kadang-kadang salah mengasilasi tRNA. aktivitas enzim pun dapat dipulihkan. Sel yang tidak mempunyai penekan dilambangkan dengan sup0. Mutasi ini dapat ditekan oleh molekul tRNA mutan yang membawa triptofan dengan antikodon AUC. maka struktur pelipatan enzim yang telah berubah karena glisin digantikan oleh asam glutamat justru akan dipulihkan oleh interaksi sistein dengan asam glutamat. coli yang dapat menekan mutan-mutan fag T4 tertentu. Akibatnya. Pada notasi konvensional. Dengan tRNA mutan. Penekanan mutasi salah makna oleh mutasi penekan intergenik antara lain dapat dilihat contohnya pada pemulihan aktivitas protein yang hilang akibat perubahan valin (tidak bermuatan) menjadi asam aspartat (bermuatan negatif). jika perubahan tirosin menjadi sistein terjadi terlebih dahulu. Pengaruh yang ditimbulkannya adalah mengubah kekhususan pengenalan kodon pada mRNA oleh antikodon pada tRNA. atau dengan perkataan lain. Substitusi ini dapat terjadi dengan empat macam cara. Contoh yang paling dikenal dapat dilihat pada gen-gen penyandi tRNA. Strain yang mengalami mutasi penekan ini ternyata juga dapat menekan mutasi pada sejumlah gen yang terdapat pada genom bakteri sendiri. Mutasi balik sebagai cara untuk mendeteksi mutagen dan karsinogen Dewasa ini terjadi peningkatan jumlah dan macam bahan kimia yang mencemari lingkungan. (2) mutasi pada tRNA yang mengubah sebuah basa di dekat antikodon sehingga tRNA dapat mengenali dua kodon yang berbeda. Begitu pula sebaliknya. Namun. kebanyakan karsinogen juga merupakan mutagen. Sebagai contoh. yang interaksinya dengan asam amino ke-210 menentukan aktivitas enzim. Mutan-mutan ini gagal untuk membentuk plak (lihat Bab XII) pada strain bakteri standar tetapi dapat membentuk plak pada strain yang mengalami mutasi penekan. perubahan ini mengakibatkan perubahan struktur pelipatan enzim sehingga secara tidak langsung akan mempengaruhi tapak aktifnya. Jadi. yaitu (1) mutasi antikodon yang memungkinkan tRNA untuk mengenali kodon yang berbeda seperti halnya yang terjadi pada pemulihan mutasi tanpa makna. mutasi penekan diberi lambang sup diikuti dengan angka (atau kadang-kadang huruf) yang membedakan penekan yang satu dengan penekan lainnya. Sementara itu. Oleh karena itu. kodon UAG yang seharusnya merupakan kodon stop berubah menjadi kodon yang menyandi triptofan. Dengan demikian.

diikuti dengan penaburan (plating) suatu mutan bakteri dalam jumlah tertentu. Hal ini karena banyak sekali senyawa kimia yang tidak langsung bersifat mutagenik / karsinogenik. Jadi.digunakan untuk menguji mutagenisitas senyawa kimia atas dasar mutasi baliknya menjadi His+. Reaksireaksi enzimatik tersebut terjadi di dalam organ hati hewan dan tidak ada kesepadanannya di dalam sel bakteri. diikuti dengan penaburan bakteri. Fungsi normal enzim-enzim itu adalah melindungi organisme dari berbagai bahan beracun dengan cara mengubahnya menjadi bahan yang tidak beracun. Senyawa yang dicurigai potensial sebagai mutagen ditambahkan ke dalam medium padat. Frekuensi mutasi balik ternyata bergantung kepada konsentrasi bahan kimia yang diuji. maka medium pertumbuhan yang digunakan harus mengandung histidin dalam jumlah yang cukup untuk mendukung beberapa putaran replikasi tetapi tidak cukup untuk memungkinkan terbentuknya koloni yang dapat dilihat. strain-strain bakteri tersebut dibuat menjadi lebih sensitif terhadap mutagenesis dengan menggabungkan beberapa alel mutan yang dapat menginaktifkan sistem perbaikan eksisi dan menjadikannya lebih permiabel terhadap molekul-molekul asing. Mutan-mutan Hismembawa baik mutasi tautomerik maupun mutasi rangka baca. uji Ames sebenarnya hanya berperan dalam mengurangi jumlah bahan kimia yang harus diuji menggunakan hewan percobaan. Oleh karena beberapa mutagen hanya bekerja pada DNA yang sedang melakukan replikasi. Banyaknya koloni revertan (fenotipe normal hasil mutasi balik) yang muncul dihitung. pewarna rambut. dan kosmetika. banyak industri terpaksa mereformulasi produk-produknya. Analisis kuantitatif terhadap frekuensi mutasi balik dapat dilakukan juga dengan membuat variasi jumlah mutagen potensial tersebut di dalam medium. Pemberian fraksi mikrosomal yang berasal dari hati tikus ke dalam medium pertumbuhan bakteri memungkinkan dilakukannya deteksi mutagenisitas. maka mereka akan mengubah bahan tersebut dari sifatnya yang semula tidak mutagenik menjadi mutagenik. Peningkatan frekuensi revertan yang tajam apabila dibandingkan dengan frekuensi yang diperoleh di dalam medium tanpa senyawa kimia yang dicurigai tersebut mengindikasikan bahwa senyawa yang diuji adalah mutagen. Meskipun demikian. Perlakuan ini mendasari teknik pemeriksaan karsinogen menggunakan metode yang dinamakan uji Ames. Fraksi mikrosomal dari hati tikus disebarkan ke permukaan medium.semacam ini perlu dilakukan. tetapi setidak-tidaknya memperlihatkan adanya peluang seperti itu. Di samping itu. 11/03/2009 Posted by zaifbio | Genetika Dasar | 8 Komentar . Frekuensi mutasi balik yang tinggi tidak serta-merta berarti bahwa senyawa yang diuji adalah karsinogen. Enzim-enzim tersebut terdapat di dalam komponen sel-sel hati yang dinamakan fraksi mikrosomal. Akan tetapi. maka koloni bakteri akan terbentuk. Apabila bahan kimia yang diuji adalah mutagen atau diubah menjadi mutagen. Cara yang paling sederhana untuk melihat mutagenesis suatu bahan kimia adalah uji mutasi balik menggunakan mutan nutrisional pada bakteri. dan pada karsinogen tertentu juga nampak adanya korelasi dengan efektivitasnya pada hewan. cara seperti tersebut di atas tidak dapat digunakan untuk memperlihatkan mutagenesis sejumlah besar karsinogen yang potensial. pestisida. Akibat dilakukannya uji Ames. tetapi harus melalui beberapa reaksi enzimatik terlebih dahulu sebelum menjadi mutagen. ketika enzim-enzim itu bertemu dengan bahan kimia tertentu. Di dalam uji Ames mutan-mutan bakteri Salmonella typhimurium yang memerlukan pemberian histidin eksternal atau disebut dengan mutan His. Bukti terakhir tentang karsinogenisitas suatu bahan kimia ditentukan atas dasar hasil uji pembentukan tumor pada hewan-hewan percobaan. Ke dalam medium tersebut kemudian ditambahkan mutagen potensial yang akan diuji. Uji Ames saat ini telah banyak digunakan pada beribu-ribu senyawa seperti pengawet makanan.

Artinya. mulai dari DNA hingga terbentuknya asam amino. tidak semua urutan basa DNA akan diekspresikan menjadi urutan asam amino. Fenotipe organisme sangat ditentukan oleh hasil interaksi protein-protein di dalam sel. Setiap protein tersusun dari sejumlah asam amino dengan urutan tertentu. khususnya pada Prokariot Kode Genetik Mekanisme Pengaturan Ekspresi Gen pada Prokariot Mekanisme Pengaturan Ekspresi Gen pada Eukariot BAB X. EKSPRESI GEN Pada Bab IX telah disebutkan bahwa salah satu fungsi dasar yang harus dijalankan oleh DNA sebagai materi genetik adalah fungsi fenotipik. secara kimia gen adalah urutan basa nitrogen tertentu pada molekul DNA yang dapat dieskpresikan melalui tahap-tahap transkripsi dan translasi menjadi urutan asam amino tertentu. DNA harus mampu mengatur pertumbuhan dan diferensiasi individu organisme sehingga dihasilkan suatu fenotipe tertentu. Rangkaian proses ini. Urutan basa DNA yang pada akhirnya menyandi urutan asam amino disebut sebagai gen.1. Dengan demikian. DNA replikasi RNA transkripsi translasi asam amino Gambar 10. dan setiap asam amino pembentukannya disandi (dikode) oleh urutan basa nitrogen di dalam molekul DNA. sedangkan penerjemahan urutan basa RNA menjadi urutan asam amino suatu protein dinamakan translasi.EKSPRESI GEN BAB X EKSPRESI GEN         Dogma Sentral Genetika Molekuler Perkembangan Konsep tentang Gen Transkripsi Tiga Macam RNA Translasi. . Namun. proses tanskripsi dan translasi dapat dilihat sebagai tahaptahap ekspresi urutan basa DNA. Jadi. Diagram dogma sentral genetika molekuler Perubahan urutan basa di dalam molekul DNA menjadi urutan basa molekul RNA dinamakan transkripsi. dikenal sebagai dogma sentral genetika molekuler.

sebagai kontrol. dan masing-masing polipeptida merupakan produk gen yang berbeda. misalnya alkaptonuria. Sebagai contoh. sedangkan strain mutan hanya mampu tumbuh pada medium lengkap. Dengan cara seperti ini Beadle dan Tatum memperlihatkan bahwa tiap mutasi menyebabkan kebutuhan akan pemberian satu macam faktor pertumbuhan. setelah diketahui bahwa sebagian besar enzim tersusun dari beberapa polipetida. mempelajari mutasi gen pada jamur Neurospora crassa dengan menumbuhkan berbagai strain mutan hasil iradiasi menggunakan sinar X atau sinar ultraviolet pada medium lengkap dan medium minimal. dan satu macam vitamin. dengan mengorelasikan hasil analisis genetik dengan hasil analisis biokimia terhadap strainstrain mutan Neurospora tersebut dapat diketahui bahwa tiap mutasi menyebabkan hilangnya satu aktivitas enzim. mengajukan konsep satu gen mutan – satu hambatan metabolisme. mutan yang hanya tumbuh pada medium minimal yang ditambah dengan tiamin adalah mutan yang mengalami mutasi pada gen untuk biosintesis tiamin. Mutan yang digunakan adalah mutan dengan hanya satu kelainan. sebuah gula sederhana. Medium minimal adalah medium untuk pertumbuhan mikroorganisme yang hanya mengandung garam-garam anorganik. Polipeptida α merupakan produk gen trpA. Garrod mempelajari sejumlah penyakit metabolik bawaan pada manusia dan menyimpulkan bahwa setiap gangguan metabolisme bawaan yang menimbulkan penyakit tertentu. maka konsep terbaru tentang gen yang dianut hingga kini adalah satu gen – satu polipeptida. Sebagai contoh. Sir Archibald E. disebabkan oleh satu gen mutan resesif. Strain-strain mutan ini kemudian dianalisis lebih lanjut untuk mengetahui macam faktor pertumbuhan yang diperlukannya dengan cara melakukan variasi penambahannya ke dalam medium minimal. Selanjutnya. Maka. Tatum. enzim triptofan sintetase pada Escherichia coli terdiri atas dua buah polipeptida. Sekitar 50 tahun kemudian dua orang peneliti.Di atas telah kita katakan bahwa sejumlah asam amino dengan urutan (sekuens) tertentu akan menyusun sebuah molekul protein. G. mampu tumbuh baik pada medium lengkap maupun pada medium minimal. Oleh karena itu. Dalam perkembangan berikutnya. konsep satu gen mutan – satu hambatan metabolisme bergeser menjadi satu gen – satu enzim. Mutan hasil silang balik dengan nisbah keturunan tipe liar : mutan = 1 : 1 dipastikan sebagai mutan dengan hanya satu kelainan (mutasi). Strain tipe liar.L. Garrod. Namun. Beadle dan E. sinarX atau sinar uv . setiap molekul protein sendiri dapat dilihat sebagai gabungan beberapa subunit yang dinamakan polipeptida. yaitu polipeptida α dan polipeptida β. sedangkan polipeptida β merupakan produk gen trpB. yang untuk mendapatkannya dilakukan silang balik dengan strain tipe liar. muncul pertanyaan tentang hakekat sebuah gen : tiap gen menyandi satu protein ataukah tiap gen menyandi satu polipeptida ? Perkembangan konsep tentang gen dapat diikuti semenjak awal abad ke-20 ketika seorang dokter sekaligus ahli biokimia dari Inggris. W.

Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. disebut sebagai pita sens. Sintesis RNA mempunyai ciri-ciri kimiawi yang serupa dengan sintesis DNA. Meskipun demikian. 2. sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. Jadi. guanosin trifosfat (GTP). Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. Adanya sumber basa nitrogen berupa nukleosida trifosfat. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). yang mempunyai urutan basa sama dengan urutan basa RNA. Bedanya dengan sumber basa untuk DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi tetapi digantikan oleh urasil. dan uridin trifosfat (UTP). 3. yaitu 1. Gugus 3’.spora seksual konidia tipe liar silang balik medium lengkap medium minimal riboflavin piridoksin tiamin asam pantotenat kholin asam folat asam nukleat niasin inositol Gambar 10. Jadi. Hanya saja enzim yang bekerja bukannya DNA polimerase. Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada . melainkan RNA polimerase. Adanya molekul cetakan berupa untai DNA.2. Sementara itu. Reaksi ini jelas sama dengan reaksi polimerisasi DNA. untai DNA pasangannya. sitidin trifosfat (CTP).trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). 4. dan disebut sebagai pita antisens.OH pada suatu nukleotida bereaksi dengan gugus 5’. bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. Diagram percobaan yang memperlihatkan satu gen – satu enzim Transkripsi Tahap pertama ekspresi gen adalah transkripsi atau sintesis molekul RNA dari DNA (gen).

2. Daerah ini dinamakan promoter. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. Tahap-tahap transkripsi Transkripsi berlangsung dalam empat tahap. promoter selalu membawa suatu urutan basa yang tetap atau hampir tetap sehingga urutan ini dikatakan sebagai urutan konsensus. Terminasi dapat terjadi oleh dua macam sebab. Nukleosida trifosfat pertama akan diletakkan di tempat ini dan sintesis RNA pun segera dimulai. Baik pada prokariot maupun eukariot. dan teminasi. 1. elongasi. Di antara keduanya terminasi diri lebih umum dijumpai. Molekul RNA yang baru saja selesai disintesis. 4. inisiasi. dan juga enzim RNA polimerase. 3. sedangkan pada eukariot urutan konsensusnya adalah TATAAAT dan disebut kotak TATA. yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). yang dinamakan tempat awal polimerisasi. Setelah mengalami pengikatan oleh promoter. Selama sintesis RNA berlangsung RNA polimerase bergerak di sepanjang molekul DNA cetakan sambil menambahkan nukleotida demi nukleotida kepada untai RNA yang sedang diperpanjang. Hal ini mengakibatkan perbedaan kekuatan ekspresi gen.kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. segera terlepas dari untai DNA cetakan begitu enzim tersebut mencapai urutan basa pengakhir (terminasi).3. Pada prokariot urutan konsensusnya adalah TATAAT dan disebut kotak Pribnow. Enzim RNA polimerase mengikat untai DNA cetakan pada suatu daerah yang mempunyai urutan basa tertentu sepanjang 20 hingga 200 basa. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). yaitu pengenalan promoter. Masing-masing akan dijelaskan sebagai berikut. Kekuatan pengikatan RNA polimerase oleh promoter yang berbeda sangat bervariasi. RNA polimerase akan terikat pada suatu tempat di dekat daerah promoter. Urutan konsensus akan menunjukkan kepada RNA polimerase tempat dimulainya sintesis. urutan penyela 5’ ATTAAAGGCTCCTTTTGGAGCCTTTTTTTT T A A T T T C C G A G GA AA A C C T C G G A A AAA A AA 3’ 5’ 3’ DNA transkripsi . maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 10.

promoter dapat mengikat RNA polimerase yang lain. Setelah intron dibuang. Pembuangan intron dan . sedangkan ujung 3’ dimodifikasi dengan urutan poliadenosin (poli A) sepanjang lebih kurang 200 basa. panjang intron yang harus dibuang dapat mencapai 50% hingga 90% dari panjang transkrip primer. Secara umum mekanisme transkripsi pada prokariot dan eukariot hampir sama. Hanya saja.3 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya.U U U C C U C G G A A 5’ A U U G G A G C C U U A U 3’ RNA U U U U U U Gambar 10. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida. Ujung 5’ dimodifikasi dengan penambahan guanosin dalam ikatan 5’-5’ yang tidak umum hingga terbentuk suatu gugus terminal yang dinamakan cap. Prosesing RNA ini mencakup dua peristiwa. segmensegmen sisanya (disebut ekson) segera digabungkan menjadi mRNA. pada prokariot produk langsung transkripsi atau transkrip primernya adalah mRNA (akan dijelaskan di bawah). Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. yaitu modifikasi kedua ujung transkrip primer dan pembuangan urutan basa pada transkrip primer yang tidak akan ditranslasi (disebut intron). sedangkan pada eukariot transkrip primernya harus mengalami prosesing RNA terlebih dahulu sebelum menjadi mRNA. Sementara itu. tetapi segmen yang mengandung ujung 5’ (gugus cap) tidak pernah dibuang.

penggabungan ekson menjadi molekul mRNA dinamakan penyatuan RNA atau RNA splicing. Macam-macam RNA Transkripsi DNA menghasilkan molekul RNA yang kemudian akan mengalami diferensiasi struktur sesuai dengan fungsinya masing-masing. Kita mengenal tiga macam RNA, yaitu 1. RNA duta atau messenger RNA (mRNA), yang mempunyai struktur linier kecuali bagian ujung terminasinya yang berbentuk batang dan kala (Gambar 10.3). Molekul mRNA membawa urutan basa yang sebagian di antaranya akan ditranslasi menjadi urutan asam amino. Urutan basa yang dinamakan urutan penyandi (coding sequences) ini dibaca tiga demi tiga. Artinya, tiap tiga basa akan menyandi pembentukan satu asam amino sehingga tiap tiga basa ini dinamakan triplet kodon. Daftar triplet kodon beserta asam amino yang disandinya dapat dilihat pada Tabel 10.1. Pada prokariot bagian mRNA yang tidak ditranslasi terletak di depan urutan penyandi (disebut pengarah atau leader) dan di antara dua urutan penyandi (disebut spacer sequences atau noncoding sequences). Sementara itu, pada eukariot di samping kedua bagian tadi ada juga bagian di dalam urutan penyandi yang tidak ditranslasi. Bagian inilah yang dinamakan intron seperti telah dijelaskan di atas. Molekul mRNA pada prokariot sering kali membawa sejumlah urutan penyandi bagi beberapa polipeptida yang berbeda. Molekul mRNA seperti ini dinamakan mRNA polisistronik. Dengan adanya mRNA polisistronik, sintesis beberapa protein yang masih terkait satu sama lain dapat diatur dengan lebih efisien karena hanya dibutuhkan satu sinyal. Pada eukariot hampir tidak pernah dijumpai mRNA polisistronik. 2. RNA pemindah atau transfer RNA (tRNA), yang strukturnya mengalami modifikasi hingga berbentuk seperti daun semanggi. Seperti halnya struktur ujung terminasi mRNA, struktur seperti daun semanggi ini terjadi karena adanya urutan palindrom yang diselingi oleh beberapa basa (Gambar 10.4). Pada salah satu kalanya, tRNA membawa tiga buah basa yang komplemeter dengan triplet kodon pada mRNA. Ketiga basa ini dinamakan antikodon. Sementara itu, pada ujung 3’-nya terdapat tempat pengikatan asam amino tertentu. Pengikatan yang membentuk molekul aminoasil-tRNA ini terjadi dengan bantuan enzim aminoasil-tRNA sintetase. Dalam hal ini gugus hidroksil (OH) pada ujung 3’ tRNA terikat sangat kuat dengan gugus karboksil (COOH) asam amino. Macam asam amino yang dibawa ditentukan oleh urutan basa pada antikodon. Jadi, ada beberapa macam aminoasil-tRNA sesuai dengan antikodon dan macam asam amino yang dibawanya. antikodon

5’

3’ (tempat pengikatan asam amino) Gambar 10.4. Diagram struktur tRNA

3. RNA ribosomal atau ribosomal RNA (rRNA), yang strukturnya merupakan bagian struktur ribosom. Lebih kurang separuh struktur kimia ribosom berupa rRNA dan separuh lainnya berupa protein. Molekul rRNA, dan juga tRNA, dapat dikatakan sebagai RNA struktural dan tidak ditranslasi menjadi asam amino/protein. Akan tetapi, mereka adalah bagian mesin sel yang menyintesis protein (lihat uraian tentang translasi di bawah ini). Translasi Bila dibandingkan dengan transkripsi, translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel, maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. Empat puluh hingga 60 molekul tRNA yang berbeda 4. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi, elongasi, dan terminasi polipeptida. Translasi, atau pada hakekatnya sintesis protein, berlangsung di dalam ribosom, suatu struktur organel yang banyak terdapat di dalam sitoplasma. Ribosom terdiri atas dua subunit, besar dan kecil, yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). Pada kebanyakan prokariot ribosom mempunyai ukuran 70S, sedangkan pada eukariot biasanya sekitar 80S. Tiap ribosom mempunyai dua tempat pengikatan tRNA, yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A, sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. 1. Molekul mRNA ditranslasi dengan arah 5’→ 3’, tetapi tidak dari ujung 5’ hingga ujung 3’. 2. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil. Sebagai contoh, sintesis protein yang mempunyai urutan NH2-Met-Pro- . . . -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 10.5. Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. Sementara itu, pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA. Selanjutnya, berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya.

Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh, khususnya pada prokariot, akan diberikan di bawah ini. arah gerakan ribosom

ribosom AUC UAG ACC UGG

aa 5’

aa CUG GGG 3’ mRNA

GAC COOH aa tRNA aa NH2 aa NH2 COOH aminoasil-tRNA

ikatan peptida Gambar 10.5. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus, yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet). Hal ini berarti bahwa sintesis semua polipeptida selalu dimulai dengan metionin. Khusus pada prokariot akan terjadi formilasi

baik pada prokariot maupun eukariot. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet). serta sebuah molekul GTP. suatu enzim yang terikat pada subunit ribosom 50S. metionil-tRNAfMet. akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. yang melibatkan (1) perpindahan f-met-ala. Langkah berikutnya adalah translokasi. kedua subunit ribosom pun memisah. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom. Pengikatan aminoasil-tRNAfMet berikutnya. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin. Triplet kodon berikutnya. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. misalnya alanil. Terminasi ditandai oleh terlepasnya mRNA. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA.tRNAala. Selanjutnya. ke tapak A memerlukan proteinprotein elongasi EF-Ts dan EF-Tu. IF-2. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin.gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa f-metionin. dan metionil-tRNAfMet terikat pada tapak P. yaitu RF-1 dan RF-2. dan IF-3). dan IF-3. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. . dan subunit kecil ribosom (30S) dengan bantuan protein IF-1. misalnya penyandi serin. IF-2. Kompleks inisiasi pada prokariot terbentuk antara mRNA. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasil-tRNAfMet berikutnya yang akan masuk ke tapak A. Selain itu. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. kompleks inisiasi bergabung dengan subunit besar ribosom (50S). Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. Sebagai contoh. tRNA di tapak P. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. Dengan berlangsungnya kedua proses tersebut secara bersamaan. dan rantai polipeptida dari ribosom. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A.tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. Selain itu.

juga menjadi sangat efisien. Begitu juga. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. Oleh karena itu. Tabel 10. Kode genetik Penetapan triplet kodon pada mRNA sebagai pembawa informasi genetik atau kode genetik yang akan menyandi pembentukan suatu asam amino tertentu berawal dari pemikiran bahwa macam basa nitrogen jauh lebih sedikit daripada macam asam amino. Dalam hal ini. Salah satu di antaranya seperti telah kita bicarakan di atas. Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. tidak demikian halnya pada eukariot. masih lebih sedikit daripada macam amino yang ada. jelas tidak mungkin tiap asam amino disandi oleh satu basa. sedangkan translasi terjadi di sitoplasma (ribosom). sedangkan asam amino ada 20 macam. kombinasi dua basa hanya akan menghasilkan 42 atau 16 macam duplet.ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn on-turn off) ekspresi gen. Basa nitrogen pada mRNA hanya ada empat macam.1. seperti yang akan dijelaskan nanti. melebihi jumlah macam asam amino. Kode genetik Basa I (5’) Basa II U Phe Phe Leu Leu Leu Leu Leu Leu ILe Ile ILe Met Val Val Val Val C Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala A Tyr Tyr Stop Stop His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu G Cys Cys Stop Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly U C A G U C A G U C A G U C A G Basa III (3’) U C A G . satu macam asam amino dapat disandi oleh lebih dari satu macam triplet kodon. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. Transkripsi terjadi di dalam nukleus. Kombinasi tiga basa akan menghasilkan 43 atau 64 triplet. Namun. yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi.

Hal ini akan menyebabkan perubahan rangka baca (reading frame). menghasilkan DNA yang kelebihan atau kekurangan satu pasangan basa.H. Mutasi tersebut diinduksi oleh proflavin. . Begitu pula sebaliknya. yaitu strain + dan strain -. Namun. Jika dua strain mutan T4 yang satu sama lain mengalami mutasi berbeda di dalam bagian protein rIIB disilangkan melalui infeksi campuran pada suatu inang. sekali kita gunakan tanda + untuk mutan delesi berarti strain + adalah mutan delesi. maka T4 tipe liar akan diperoleh sebagai hasil rekombinasi genetik antara kedua tempat mutasi yang berbeda itu. karena mutasi bersifat acak. ketika kedua strain mutan rIIB yang disilangkan merupakan strain-strain yang diseleksi secara acak (tidak harus mengalami mutasi yang berbeda). Crick dan kawan-kawannya yang mempelajari mutasi pada lokus rIIB bakteriofag T4. Namun. suatu molekul yang dapat menyisip di sela-sela pasangan basa nitrogen sehingga kesalahan replikasi DNA dapat terjadi sewaktu-waktu. Protein rIIB pada T4 mempunyai bagian-bagian yang di dalamnya dapat terjadi perubahan urutan asam amino. akan diperoleh beberapa fag tipe liar sehingga mutasi seolah-olah dapat dipulihkan atau terjadi mutasi balik (reverse mutation). Crick dan kawan-kawannya menjelaskan bahwa mutasi balik disebabkan oleh hilangnya (delesi) satu pasangan basa lain yang letaknya tidak terlalu jauh dari pasangan basa yang menyisip (adisi). Akan tetapi. sekali kita menggunakan tanda + untuk mutan adisi berarti strain + adalah mutan adisi. Pada awalnya mutasi balik diduga karena kelebihan pasangan basa dibuang dari rangka baca yang salah sehingga rangka baca tersebut telah diperbaiki menjadi seperti semula.Keterangan : phe = fenilalanin leu = leusin ile = isoleusin met = metionin val = valin ser = serin pro = prolin thr = treonin ala = alanin tyr = tirosin his = histidin gln = glutamin asn = asparagin lys = lisin asp = asam aspartat glu = asam glutamat cys = sistein trp = triptofan arg = arginin gly = glisin AUG (kodon metionin) dapat menjadi kodon awal (start codon) stop = kodon stop (stop codon) Bukti bahwa kode genetik berupa triplet kodon diperoleh dari hasil penelitian F. Rangka baca yang baru ini akan menghasilkan urutan asam amino yang masih sama fungsinya dengan urutan sebelum terjadi mutasi. strain + tidak harus selalu mutan adisi. Perubahan ini dapat berpengaruh atau tidak berpengaruh terhadap fungsi proteinnya.C. maka mekanisme semacam itu kecil sekali kemungkinannya untuk terjadi dan dugaan tersebut nampaknya tidak benar. Dalam hal ini. Jika mutan (hasil mutasi) rangka baca yang diinduksi oleh proflavin ditumbuhkan pada medium yang mengandung proflavin. Mutasi yang disebabkan oleh perubahan rangka baca akibat kelebihan atau kekurangan pasangan basa disebut sebagai mutasi rangka baca (frameshift mutation) (lihat Bab XI). Hasil ini menunjukkan bahwa strain-strain mutan dapat dibagi menjadi dua kelompok. mutasi balik terjadi karena efek mutasi awal akibat penambahan basa ditekan oleh mutasi kedua akibat pengurangan basa sehingga mutasi yang kedua ini disebut juga sebagai mutasi penekan (suppressor mutation). dan strain – tidak harus selalu mutan delesi. ternyata tidak selalu diperoleh tipe liar. Dengan perkataan lain. yaitu urutan pembacaan basa-basa nitrogen untuk diterjemahkan menjadi urutan asam amino tertentu.

. Hal ini memperlihatkan bahwa kode genetik terdiri atas tiga basa. . AUG UUU CCC AAA GGG UUU . . . . Mutasi penekan yang memulihkan rangka baca Oleh karena persilangan sesama + atau sesama – tidak pernah menghasilkan tipe liar. persilangan antara starin + dan – akan menyebabkan terjadinya mutasi penekan (adisi ditekan oleh delesi atau delesi ditekan oleh adisi) atau hanya menghasilkan mutasi pada urutan asam amino yang tidak berpengaruh terhadap fungsi protein sehingga diperoleh fenotipe tipe liar. Kenyataannya tidak demikian. . . Apabila kode genetik berupa triplet. sedangkan persilangan antara sesama + atau sesama – tidak pernah menghasilkan tipe liar. Hal ini karena persilangan sesama + atau sesama – akan menyebabkan adisi atau delesi ganda sehingga selalu menghasilkan fenotipe mutan. Seandainya. kode genetik berupa duplet. sesuai dengan hasil kenyataannya.Persilangan antara strain + dan strain – hanya menghasilkan rekombinasi berupa fenotipe tipe liar. Sementara itu.6. rekombinasi antara tiga + atau tiga – akan menghasilkan tipe liar. . CCU AG . CCC UAG met ile ser lys gly phe pro stop mRNA ‘tipe liar’ urutan asam urutan asam amino tipe liar amino yang berubah Gambar 10. . . mRNA mutan met ile ser gln arg val leu pengurangan pasangan basa G = G(mutasi rangka baca II) AUG AUU UCC AAA GGG UUU . . Namun. maka persilangan teoretis sesama + atau sesama – akan menghasilkan fenotipe mutan. kode genetik jelas tidak mungkin terdiri atas dua basa. Pemulihan rangka baca akibat mutasi penekan justru terjadi apabila persilangan dilakukan antara strain + dan strain -. . . . CCC UAG met phe pro lys gly phe pro stop mRNA tipe liar penambahan pasangan basa A=T (mutasi rangka baca I) AUG AUU UCC CAA AGG GUU U . . maka akan terjadi pemulihan rangka baca hasil persilangan tersebut. . .

urutan yang bila berubah tidak berpengaruh urutan yang bila berubah berpengaruh tipe liar AB CD EF GH IJ KL protein tipe liar +1 AB C1 DE FG HI JK +2 AB CD E2 FG HI JK -1 AB DE FG HI JK LM -2 AB CD FG HI JK LM +1 x +2 AB C1 DE 2F GH IJ KL liar -1 x -2 AB CD EF GH IJ KL liar +1 x -1 AB C1 DE FG HI JK mutan MN OP QR ST UV WX LM NO PQ RS TU VW X protein mutan LM NO PQ RS TU VW X protein mutan NO PQ RS TU VW X NO PQ RS TU VW X MN OP QR ST UV WX protein mutan protein mutan protein tipe MN OP QR ST UV WX protein tipe LM NO PQ RS TU VW X protein a) urutan yang bila berubah tidak berpengaruh urutan yang bila berubah berpengaruh tipe liar ABC DEF GHI JKL protein tipe liar +1 AB1 CDE FGH IJK +2 ABC DE2 FGH IJK +3 ABC DEF GHI J3K +1 x +2 AB1 CDE 2FG HIJ mutan +1 x +2 x +3 AB1 protein tipe liar CDE 2FG HIJ 3KL MNO PQR STU VWX LMN OPQ RST UVW X LMN OPQ RST UVW X LMN OPQ RST UVW X protein mutan protein mutan protein mutan protein KLM NOP QRS TUV WX MNO PQR STU VWX .

3. atau berarti juga DNA. Artinya. yang artinya bahwa basa ketiga dapat berubah-ubah tanpa selalu disertai perubahan macam asam amino yang disandinya. Pengaturan Ekspresi Gen Produk-produk gen tertentu seperti protein ribosomal. hasil persilangan teoretis tidak sesuai dengan kenyataan yang diperoleh. tRNA. jika sebuah molekul protein rata-rata tersusun dari 400 asam amino. Kode genetik bersifat degenerate atau redundant. Dengan perkataan lain. bakteriofag фX174 mempunyai sebuah untai tunggal DNA yang panjangnya lebih kurang hanya 5000 basa.b) Gambar 10. dan ACG. Sifat-sifat kode genetik Kode genetik mempunyai sifat-sifat yang akan dijelaskan sebagai berikut. Sebagai contoh. Oleh karena tiap kodon terdiri atas tiga buah basa. hasil persilangan teoretis sesuai dengan kenyataan yang diperoleh. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. Sebagai contoh.7. Kemudian. U. Diketahuinya sifat wobble bermula dari penemuan basa inosin (I) sebagai basa pertama pada antikodon tRNAala ragi. Di samping itu. Sifat ini erat kaitannya dengan sifat wobble basa ketiga. Diagram persilangan mutan rIIB pada T4 yang memperlihatkan bahwa kode genetik berupa triplet kodon a) Jika kode genetik berupa duplet. atau pun C. Dengan demikian. suatu segmen DNA dapat terdiri atas lebih dari sebuah gen yang saling tumpang tindih (overlapping). yang ternyata dapat berpasangan dengan basa A. di dalam suatu segmen tertentu pada DNA dapat terjadi transkripsi dan translasi urutan basa dengan panjang yang berbeda. Padahal kenyataannya. maka akan terdapat sekitar 1700 asam amino yang dapat disintesis. RNA polimerase. dan urutan basa yang diekspresikan (gen) dapat tumpang tindih satu sama lain. treonin dapat disandi oleh ACU. ACA. b) Jika kode genetik berupa triplet. Dengan demikian. ACC. kode genetik berlaku sama hampir di setiap spesies organisme. Gen-gen yang menyandi . Seandainya dari urutan basa ini hanya digunakan sebuah rangka baca. rRNA. mempunyai tiga rangka baca yang berbeda (open reading frame). maka dari sekitar 1700 asam amino tersebut hanya akan terbentuk 4 hingga 5 buah molekul protein. Kode genetik bersifat universal. yaitu bahwa satu macam asam amino dapat disandi oleh lebih dari satu triplet kodon. 1. maka tiap urutan basa mRNA. jelaslah bahwa dari urutan basa DNA yang ada tidak hanya digunakan sebuah rangka baca. satu antikodon pada tRNA dapat mengenali lebih dari satu macam kodon pada mRNA. 2. bakteriofag фX174 mempunyai 11 protein yang secara keseluruhan terdiri atas 2300 asam amino.

Namun. Pada pengaktifan enzim suatu molekul kecil akan terikat pada enzim sehingga akan terjadi peningkatan aktivitas enzim tersebut. Proses yang terjadi ketika ekspresi gen merupakan respon terhadap keberadaan suatu zat di lingkungannya dikenal sebagai induksi. paling banyak terjadi pada tahap transkripsi. sedangkan zat atau molekul yang menyebabkan terjadinya induksi disebut sebagai induser. bagi eukariot mekanisme ini nampaknya tidak terlalu penting karena pada organisme ini sel justru cenderung merespon sinyal-sinyal yang datang dari dalam tubuh. bukan peningkatan laju sintesisnya.pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. dalam keadaan normal. bakteri juga dapat menyintesis (anabolisme) berbagai molekul organik yang diperlukan bagi pertumbuhannya. produk gen kedua akan menekan transkripsi gen kedua dan memacu transkripsi gen ketiga. produk suatu gen akan menekan transkripsi gen itu sendiri dan sekaligus memacu transkripsi gen kedua. Sebaliknya. misalnya transkripsi. Induksi dan represi pada prokariot Escherichia coli merupakan bakteri yang sering dijadikan model untuk mempelajari berbagai mekanisme genetika molekuler. prosesing mRNA. dalam contoh ini laktosa merupakan induser. Oleh karena urutan ekspresinya berupa sirkit. Untuk itu. Ekspresi gen yang berurutan ini telah terprogram secara genetik sehingga gen-gen tersebut tidak akan dapat diekspresikan di luar urutan. bukan dengan aktivitas enzim. sesuatu yang tidak biasa dilakukannya. Sementara itu. Induksi secara molekuler terjadi pada tingkat transkripsi. dan di sisi lain. Jadi. maka gen-gen tersebut tidak diekspresikan (turned off). Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. yaitu (1) mekanisme yang melibatkan penyalapadaman (turn on and turn off) ekspresi gen sebagai respon terhadap perubahan kondisi lingkungan dan (2) sirkit ekspresi gen yang telah terprogram (preprogramed circuits). gen-gen penyandi berbagai enzim yang terlibat dalam pemanfaatan laktosa akan diekspresikan (turned on). Sebagai contoh. maka enzim pemecah laktosa akan disintesis. secara garis besar dapat dibedakan menjadi dua kategori utama. Sebaliknya. Dalam medium pertumbuhan yang tidak . Mekanisme pengaturan transkripsi. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. atau translasi. Salmonella typhimurium mempunyai sejumlah gen yang menyandi enzim-enzim untuk biosintesis triptofan. maka mekanisme tersebut dinamakan sirkit ekspresi gen. Pada mekanisme sirkit. coli ditumbuhkan pada medium yang sumber karbonnya bukan glukosa melainkan laktosa. Selain mempunyai kemampuan untuk memecah suatu molekul (katabolisme). Apabila suatu ketika E. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. demikian seterusnya. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. yaitu ketika tersedia glukosa sebagai sumber karbon. khususnya pada prokariot. baik pada prokariot maupun pada eukariot. Bakteri ini secara alami hidup di dalam usus besar manusia dengan memanfaatkan sumber karbon yang umumnya berupa glukosa. sistem sirkulasi akan menjadi penyangga bagi sel terhadap perubahan kondisi lingkungan yang mendadak tersebut. Mekanisme penyalapadaman sangat penting bagi mikroorganisme untuk menyesuaikan diri terhadap perubahan lingkungan yang seringkali terjadi secara tiba-tiba. Peristiwa ini berkenaan dengan laju sintesis enzim.

Jacob dan J. Proses pemadaman (turn off) ekspresi gen sebagai respon terhadap keberadaan suatu zat di lingkungannya dinamakan represi. Pada kondisi tertentu represor akan berikatan dengan operator. dan gen-gen struktural (GS). yaitu penghambatan aktivitas enzim akibat pengikatan produk akhir reaksi yang dikatalisis oleh enzim itu sendiri. Seperti halnya induksi. Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. maka gen-gen tersebut tidak perlu diekspresikan (turned off). sedangkan pada represi adalah korepresor. Represi tidak menghambat aktivitas enzim. menyebabkan terhalangnya transkripsi gen-gen struktural. Molekul efektor pada induksi adalah induser. Jadi. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. sedangkan zat yang menyebabkan terjadinya represi disebut sebagai korepresor. S. operator (O). Akan tetapi. dengan operator. represi juga terjadi pada tahap transkripsi. Model operon Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model yang diajukan oleh F. Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. operon PR R PO O GS1 GS2 GS3 represor a) efektor (induser atau korepresor) RNA polimerase induser RNA polimerase berjalan . jika suatu saat ke dalam medium pertumbuhannya ditambahkan triptofan. Represi sering dikacaukan dengan inhibisi umpan balik (feedback inhibition). tetapi menekan laju sintesisnya.mengandung triptofan. dan molekul efektor. dalam contoh ini triptofan merupakan korepresor. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. typhimurium akan mengekspresikan (turned on) gen-gen tersebut. atau bahkan tumpang tindih. Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). Di luar operon terdapat gen regulator (R) beserta promoternya (PR). Monod pada tahun 1961. molekul protein represor yang dihasilkan oleh gen regulator.

Dengan pengikatan ini. Namun. Sebaliknya. promoter operon menjadi terbuka bagi RNA polimerase sehingga gengen struktural dapat ditranskripsi dan selanjutnya ditranslasi. gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi. Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Pada Gambar 10. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang. Akibatnya. Salah satu contohnya adalah operon lac. dengan adanya korepresor. dengan terikatnya represor oleh induser. Dengan demikian. transkripsi gen-gen struktural tidak dapat berlangsung. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon.8 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator. Jadi. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. .8. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas.transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 10. Akan tetapi. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor.

Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. terindikasi juga bahwa diferensiasi sel sedikit banyak melibatkan ekspresi seperangkat gen yang telah terprogram (preprogramed). dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. kalau pun ada. molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. Dosis gen dan amplifikasi gen Kebutuhan akan produk-produk gen pada eukariot dapat sangat bervariasi. Dengan perkataan lain. . ada gen A dan gen B yang ditranskripsi dan ditranslasi dengan efisiensi yang sama. mRNA di dalam selsel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. dan juga prosesing mRNA. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. nampaknya tidak begitu penting pada eukariot. Produk gen A dapat 20 kali lebih banyak daripada produk gen B apabila terdapat 20 salinan (kopi) gen A untuk setiap salinan gen B. Katakanlah. Operon. Namun. Beberapa produk gen dibutuhkan dalam jumlah yang jauh lebih besar daripada produk gen lainnya sehingga terdapat nisbah kebutuhan di antara produk-produk gen yang berbeda. hormon. Contoh yang nyata dapat dilihat pada gen-gen penyandi histon. memegang peran yang sangat penting dalam proses diferensiasi sel. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. Jadi. Untuk menyintesis histon dalam jumlah besar yang dibutuhkan dalam pembentukan kromatin. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. Demikian pula. yaitu hanya membawa urutan sebuah gen struktural. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. Sebagai contoh. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau mirip operon.Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. Untuk memenuhi nisbah kebutuhan ini antara lain dapat ditempuh melalui dosis gen. Operon trp. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. Selain itu. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi.

kebanyakan sel mempunyai beratus-ratus kali salinan gen histon daripada jumlah salinan gen yang diperlukan untuk replikasi DNA. sel-sel prekursor tidak mempunyai gen penyandi rRNA dalam jumlah yang mencukupi untuk sintesis molekul tersebut dalam waktu yang relatif singkat. Salah satu pengaruh dosis gen adalah amplifikasi gen. Sebagai contoh. molekul mRNA dapat dibagi menjadi tiga kelompok. Oleh karena itu. Pengaturan transkripsi Berdasarkan atas banyaknya salinan di dalam tiap sel. coli. Kita mengetahui bahwa ribosom antara lain terdiri atas molekulmolekul rRNA. yaitu (1) mRNA salinan tunggal (single copy). Sebagai contoh. Namun. Di sisi lain. Namun. sel-sel eritroblas di dalam sumsum tulang belakang mempunyai sejumlah besar mRNA yang dapat ditranslasi menjadi globin matang. Padahal. Dengan demikian. sejalan dengan perkembangan oosit terjadi peningkatan jumlah gen rRNA hingga 4000 kali sehingga dari sebanyak 600 gen yang ada pada prekursor akan diperoleh sekitar dua juta gen setelah amplifikasi. gen rRNA yang telah begitu banyak disalin kemudian didegradasi kembali oleh berbagai enzim intrasel. dan (3) mRNA superprevalen dengan jumlah salinan beberapa ratus hingga beberapa ribu per sel. Secara garis besar pengaturan transkripsi oleh hormon dimulai dengan masuknya hormon ke dalam sel target melewati membran sel. . Cara lain untuk mengatasi kebutuhan protein tersebut adalah dengan meningkatkan masa hidup mRNA (lihat bagian pengaturan translasi). amplifikasi gen terjadi selama perkembangan oosit katak Xenopus laevis. Molekul mRNA salinan tunggal dan semiprevalen masing-masing menyandi enzim dan protein struktural. Jika waktu yang tersedia untuk melakukan sintesis sejumlah besar protein cukup banyak. (2) mRNA semiprevalen dengan jumlah salinan lebih dari satu hingga beberapa ratus per sel. Molekul rRNA tidak diperlukan lagi ketika oosit telah matang hingga saat terjadinya fertilisasi. Jika sebelum amplifikasi ke-600 gen rRNA berada di dalam satu segmen DNA linier. hanya sedikit sekali atau bahkan tidak ada globin yang dihasilkan oleh sel-sel prekursor yang belum berkembang menjadi eritroblas. Sementara itu. molekul protein kecil yang dibawa dari sel tertentu menuju ke sel target. maka selama dan setelah amplifikasi gen tersebut akan berada di dalam gulungan-gulungan kecil yang mengalami replikasi. yang kemudian ditangkap oleh reseptor khusus yang terdapat di dalam sitoplasma sehingga terbentuk kompleks hormon-reseptor. Pembentukan oosit dari prekursornya (oogonium) merupakan proses kompleks yang membutuhkan sejumlah besar sintesis protein. Salah satu regulator yang diketahui berperan dalam transkripsi eukariot adalah hormon. kita dapat memastikan adanya suatu mekanisme pengaturan ekspresi gen penyandi mRNA superprevalen pada tahap transkripsi eukariot meskipun hingga kini belum terlalu banyak rincian prosesnya yang dapat diungkapkan. penetrasi hormon ke dalam sel target dan pengangkutannya ke dalam nukleus merupakan proses yang jauh lebih rumit bila dibandingkan dengan induksi oleh laktosa pada E. amplifikasi gen sebenarnya tidak perlu dilakukan. Setelah kompleks ini terbentuk biasanya reseptor akan mengalami modifikasi struktur kimia. mRNA superprevalen biasanya dihasilkan sejalan dengan terjadinya perubahan di dalam suatu tahap perkembangan organisme eukariot. Untuk itu dibutuhkan sejumlah besar ribosom. yaitu peningkatan jumlah gen sebagai respon terhadap sinyal tertentu. Mekanisme kerja hormon dalam mengatur transkripsi eukariot lebih kurang dapat disetarakan dengan induksi pada prokariot.

Macam-macam pengaturan tersebut adalah (1) kondisi bahwa mRNA tidak akan ditranslasi sama sekali sebelum datangnya suatu sinyal. hal ini bukan akibat kurangnya pasokan mRNA. Pengaturan pada tahap prosesing mRNA Dua jenis sel yang berbeda dapat membuat protein yang sama tetapi dalam jumlah yang berbeda meskipun transkripsi di dalam kedua sel tersebut terjadi pada gen yang sama. Jadi. misalnya. Akan tetapi. dan (3) pengaturan laju seluruh sintesis protein. (4) inaktivasi represor. (3) aktivasi protein yang terikat DNA. tetapi rupanya di dalam nukleus kompleks tersebut. begitu fertilisasi terjadi. Kelenjar ludah menghasilkan α-amilase lebih banyak daripada yang dihasilkan oleh jaringan hati meskipun gen yang ditranskripsi sama. khususnya pada penyatuan (splicing) mRNA. Namun. melainkan karena terbatasnya ketersediaan suatu unsur yang dinamakan faktor rekrutmen. sedangkan molekul mRNA yang belum ditranslasi itu dinamakan mRNA tersembunyi (masked mRNA). Contoh induksi transkripsi oleh hormon antara lain dapat dilihat pada stimulasi sintesis ovalbumin pada saluran telur (oviduktus) ayam oleh hormon kelamin estrogen. akan mengalami salah satu di antara beberapa peristiwa. laju sintesis protein menjadi sangat rendah. atau mungkin hormonnya saja. dan hanya sel-sel oviduktus yang akan menyintesis mRNA tersebut. dalam hal ini transkrip primernya sebenarnya sama. Hingga kini belum diketahui hakekat unsur tersebut. Pada tikus. ditemukan bahwa perbedaan sintesis enzim α-amilase oleh berbagai mRNA yang berasal dari gen yang sama dapat terjadi karena adanya perbedaan pola pembuangan intron. Telur yang tidak dibuahi secara biologi bersifat statis. Sinyal tersebut tidak lain adalah fertilisasi oleh spermatozoon. . tetapi rupanya berperan dalam pembentukan kompleks ribosom-mRNA. Hal ini menunjukkan bahwa di dalam sel telur yang belum dibuahi akan dijumpai sejumlah mRNA yang menantikan datangnya sinyal untuk translasi. (2) pengaturan umur (lifetime) molekul mRNA. sejumlah protein akan disintesis. Pengaturan umur mRNA juga dijumpai pada telur yang belum dibuahi. yang akan ditranslasi dengan efisiensi berbeda pula. pada eukariot ada mekanisme pengaturan translasi. Dengan demikian. Sel telur ini akan mempertahankan diri untuk tidak mengalami pertumbuhan atau perkembangan. Fenomena ini seringkali berkaitan dengan adanya molekul-molekul mRNA yang berbeda.Kompleks hormon-reseptor yang termodifikasi kemudian menembus dinding nukleus untuk memasuki nukleus. dan (5) perubahan struktur kromatin agar DNA terbuka bagi enzim RNA polimerase. Sintesis ini akan terus berlanjut selama estrogen diberikan. Hal ini karena sel-sel atau jaringan lainnya tidak mempunyai reseptor hormon estrogen di dalam sitoplasmanya. yaitu (1) pengikatan langsung pada DNA. Proses selanjutnya belum banyak diketahui. Pengaturan translasi Berbeda dengan translasi mRNA pada prokariot yang terjadi dalam jumlah yang lebih kurang sama. jaringan-jaringan oviduktus akan memberikan respon berupa sintesis mRNA untuk ovalbumin. Jika ayam disuntik dengan estrogen. tetapi kemudian ada perbedaan mekanisme prosesing. (2) pengikatan pada suatu protein efektor.

Dalam sistem semacam itu urutan penyandi pada masing-masing gen tidak saling dipisahkan oleh kodon stop dan kodon awal. Meskipun ternyata asam nukleat selalu dapat diisolasi dari nukleus berbagai macam sel. J. pada eukariot tidak pernah dijumpai mRNA polisistronik. Sebagai contoh. 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar MATERI GENETIK BAB IX MATERI GENETIK       Pembuktian DNA sebagai Materi Genetik Pembuktian RNA sebagai Materi Genetik pada Virus Tertentu Model Struktur Molekul DNA menurut Watson-Crick Tiga Fungsi Materi Genetik Replikasi Semi Konservatif Replikasi Θ dan Replikasi Lingkaran Menggulung BAB IX. yakni sintesis poliprotein. waktu itu fungsinya sama sekali belum diketahui. Tiap protein ini dapat dilihat sebagai produk satu gen tunggal. tetapi bergantian mengikuti suatu urutan. tetapi dipisahkan oleh urutan asam amino tertentu yang dikenal sebagai tempat pemotongan (cleavage sites) oleh enzim protease tertentu.Sintesis beberapa protein tertentu diatur oleh aktivitas protein itu sendiri terhadap mRNA. menemukan suatu zat kimia bersifat asam yang banyak mengandung nitrogen dan fosfor. Jadi. Miescher. Sintesis beberapa protein dari satu segmen DNA Pada prokariot terdapat mRNA polisistronik yang menyandi semua produk gen. Sebaliknya. Zat ini diisolasi dari nukleus sel nanah manusia dan kemudian dikenal dengan nama nuklein atau asam nukleat.F. MATERI GENETIK Pada tahun 1868 seorang mahasiswa kedokteran di Swedia. tetapi ada kondisi yang dapat disetarakan dengannya. . Poliprotein adalah polipeptida berukuran besar yang setelah berakhirnya translasi akan terpotong-potong untuk menghasilkan sejumlah molekul protein yang utuh. molekul antibodi tersebut berikatan secara khusus dengan molekul mRNA yang menyandinya sehingga inisiasi translasi akan terhambat. konsentrasi suatu jenis molekul antibodi dipertahankan konstan oleh mekanisme inhibisi atau penghambatan diri dalam proses translasi. Tempattempat pemotongan ini tidak akan berfungsi serempak.

DNA atau protein. Akan tetapi. dan dari organ paru-parunya dapat diisolasi strain S yang masih hidup. Hasil yang mengundang pertanyaan adalah ketika mencit diinfeksi dengan campuran antara strain S yang telah dipanaskan dan strain R yang masih hidup. dan akibatnya tidak bersifat virulen. bakteri pneumokokus akan membentuk koloni dengan kenampakan halus mengkilap. Di sisi lain. Griffith pada tahun 1928 melakukan percobaan infeksi bakteri pneumokokus (Streptococcus pneumonia) pada mencit. Namun. mencit yang diinfeksi dengan strain S yang sebelumnya telah dipanaskan terlebih dahulu akan dapat bertahan hidup. Masingmasing akan diuraikan berikut ini. ada pula strain mutan pneumokokus yang kehilangan kemampuan untuk menyintesis kapsul polisakarida sehingga menjadi tidak tahan terhadap sistem kekebalan tubuh hewan inangnya. sedangkan kandungan RNA dan proteinnya berbeda-beda antara satu sel dan sel yang lain. Oleh karena itu. dalam kurun waktu yang cukup lama fakta semacam itu tidak cukup kuat untuk meyakinkan bahwa DNA adalah materi genetik. Pneumokokus yang virulen sering dilambangkan dengan S. sementara DNA hanya merupakan kerangka struktur kromosom. Demikian juga. Ternyata dengan perlakuan ini mencit mengalami kematian. mencit yang diinfeksi dengan strain R dapat bertahan hidup.Dari hasil analisis kimia yang dilakukan sekitar empat puluh tahun kemudian ditemukan bahwa asam nukleat ada dua macam. Pada tahun 1924 studi mikroskopis menunjukkan bahwa DNA terdapat di dalam kromosom. nukleus hasil meiosis baik pada tumbuhan maupun hewan mempunyai kandungan DNA separuh kandungan DNA di dalam nukleus sel somatisnya. DNA sebagai Materi Genetik Ada dua bukti percobaan yang menunjukkan bahwa DNA adalah materi genetik. Di samping itu. Strain mutan ini akan membentuk koloni dengan kenampakan kasar apabila ditumbuhkan pada medium padat. pada pertengahan tahun 1940-an terbukti bahwa justru DNA-lah yang merupakan materi genetik pada sebagian besar organisme. Hal ini terutama karena dari hasil analisis kimia secara kasar terlihat kurangnya variasi kimia pada molekul DNA. yang waktu itu telah diketahui sebagai organel pembawa gen (materi genetik). Sementara itu. Percobaan transformasi F. yaitu asam deoksiribonukleat atau deoxyribonucleic acid (DNA) dan asam ribonukleat atau ribonucleic acid (RNA). Mencit yang diinfeksi dengan pneumokokus S akan mengalami kematian. Meskipun demikian. Sebaliknya. selama bertahun-tahun protein lebih diyakini sebagai materi genetik. selain DNA di dalam kromosom juga terdapat protein sehingga muncul perbedaan pendapat mengenai hakekat materi genetik. Bakteri penyebab penyakit pneumonia ini dapat menyintesis kapsul polisakarida yang akan melindunginya dari mekanisme pertahanan tubuh hewan yang terinfeksi sehingga bersifat virulen (menimbulkan penyakit). dan dari organ paru-parunya dapat diisolasi strain S tersebut. sedangkan strain mutannya yang tidak virulen dilambangkan dengan R. Dugaan DNA sebagai materi genetik secara tidak langsung sebenarnya dapat dibuktikan dari kenyataan bahwa hampir semua sel somatis pada spesies tertentu mempunyai kandungan DNA yang selalu tetap. Jika ditumbuhkan pada medium padat. protein dengan variasi kimia yang tinggi sangat memenuhi syarat sebagai materi genetik. .

MacLeod. bukan RNA atau protein. Artinya. Diagram percobaan transformasi yang membuktikan DNA sebagai materi genetik Percobaan infeksi bakteriofag .Dengan hasil tersebut Griffith menyimpulkan bahwa telah terjadi perubahan (transformasi) sifat strain R menjadi S. transformasi tetap berjalan atau strain R berubah juga menjadi S. Namun. Di dalam ekstrak DNA ini terdapat juga sejumlah protein kontaminan. dan penambahan tersebut ternyata menyebabkan strain R berubah menjadi S seperti pada percobaan Griffith. adalah DNA. C. Percobaan Griffith sedikit pun tidak memberikan bukti tentang materi genetik. jika enzim yang diberikan adalah DNase (pemecah DNA). pada tahun 1944 tiga orang peneliti. Mereka melakukan percobaan transformasi secara in vitro. dan ternyata juga pada hampir semua organisme. yaitu dengan menambahkan ekstrak DNA dari strain S yang telah mati kepada strain R yang ditumbuhkan di medium padat. maka transformasi tidak terjadi. Hal ini jelas membuktikan bahwa materi yang bertanggung jawab atas terjadinya transformasi pada bakteri pneumonia. dan M. kultur strain S ekstraksi DNA ekstrak DNA + protein kontaminan ditambahkan ke kultur strain R protease kultur strain R RNase kultur strain R DNase kultur strain R strain R + S strain R + S strain R Gambar 9. Jika pada percobaan Avery dan kawan-kawannya itu ditambahkan enzim RNase (pemecah RNA) atau enzim protease (pemecah protein).1. McCarty melakukan percobaan untuk mengetahui hakekat materi yang dipindahkan dari strain S ke strain R. Avery. strain R tidak berubah menjadi strain S. yakni O. Akan tetapi. Transformasi terjadi karena ada sesuatu yang dipindahkan dari selsel strain S yang telah mati (dipanaskan) ke strain R yang masih hidup sehingga strain R yang semula tidak dapat membentuk kapsul berubah menjadi strain S yang dapat membentuk kapsul dan bersifat virulen.

Chase. Hershey dan M.Percobaan lain yang membuktikan bahwa DNA adalah materi genetik dilaporkan pada tahun 1952 oleh A. RNA sebagai Materi Genetik pada Beberapa Virus . Mula-mula partikel T2 melekatkan ujung ekornya pada dinding sel E. Hasil percobaan ini jelas menunjukkan bahwa materi genetik yang dimasukkan oleh bakteriofag T2 ke dalam sel E. dan siklus reproduksi tadi akan terulang kembali. sedangkan pada partikel-partikel T2 hanya ada sedikit sekali radioisotop tersebut. coli akan mengalami lisis. partikel-partikel T2 yang keluar akan mencari sel inang yang baru. yang umumnya banyak mengandung sulfur tetapi tidak mengandung fosfor dilabeli dengan radioisotop 35S. maka di dalam sel-sel E. coli telah diketahui (lihat Bab XII).2. Apabila dengan cara yang sama digunakan bakteriofag T2 yang dilabeli DNAnya. Daur hidup bakteriofag T2 dan diagram percobaan infeksi T2 pada E. yaitu Escherichia coli. coli adalah materi yang dilabeli dengan 32P atau DNA. coli. materi genetik masuk dilabeli dengan 35S dan 32P ke sel inang banyak didapatkan 35 S sel inang lisis banyak Gambar 9. coli yang membuktikan DNA sebagai materi genetik didapatkan 32 P Bakteriofag T2 dengan protein yang telah dilabeli diinfeksikan pada E. coli. sel-sel E. Percobaan dilakukan dengan mengamati reproduksi bakteriofag (virus yang menyerang bakteri) T2 di dalam sel bakteri inangnya. Ketika hasil penggandaan partikel T2 telah mencapai jumlah yang sangat besar. coli sehingga memungkinkan terjadinya penggandaan partikel T2 di dalam sel inangnya itu. Sebaliknya. Sebelumnya. diikuti oleh masuknya materi genetik T2 ke dalam sel E. Bakteriofag T2 diketahui mempunyai kandungan protein dan DNA dalam jumlah yang lebih kurang sama. Ternyata di dalam sel-sel E. coli ditemukan banyak sekali radiosiotop 32P. DNA yang sangat banyak mengandung fosfor tetapi tidak mengandung sulfur dilabeli dengan radioisotop 32P. bukannya protein. Akhirnya. coli sangat sedikit ditemukan radioisotop 35S. coli ini kemudian dipisahkan dari partikel-partikel T2 yang sudah tidak melekat lagi pada dinding selnya. sedangkan pada partikel-partikel T2 masih banyak didapatkan radioisotop tersebut. Untuk memastikan sifat kimia materi genetik yang dimasukkan ke dalam sel inang dilakukan pelabelan terhadap molekul protein dan DNAnya. sel E. Dengan sentrifugasi. Protein. cara berlangsungnya infeksi T2 pada E.

3. Pada DNA basa nitrogen berikatan secara kimia dengan gula pentosa membentuk molekul yang disebut nukleosida sehingga setiap nukleotida pada DNA dapat disebut juga sebagai nukleosida monofosfat. Singer pada tahun 1957. yaitu gugus fosfat. bukan protein. Atom C pada gula pentosa yang berikatan dengan basa nitrogen ditentukan sebagai atom C pertama . Untuk memastikan di antara kedua makromolekul tersebut yang berperan sebagai materi genetik. Kedua TMV hasil rekonstitusi ini kemudian diinfeksikan ke inangnya (daun tembakau) agar mengalami penggandaan.Beberapa virus tertentu diketahui tidak mempunyai DNA. Komposisi Kimia Asam Nukleat Hasil analisis kimia asam nukleat menunjukkan bahwa makromolekul ini tersusun dari subunit-subunit berulang (monomer) yang disebut nukleotida sehingga asam nukleat dapat juga dikatakan sebagai polinukleotida. Percobaan yang membuktikan RNA sebagai materi genetik pada TMV = TMV strain A = TMV strain B rekonstitusi infeksi ke daun tembakau RNA dari strain A direkonstitusi dengan protein strain B. TMV hasil penggandaan ternyata merupakan strain A jika RNAnya berasal dari strain A dan merupakan strain B jika RNAnya berasal dari strain B. adalah RNA. Tiap nukleotida terdiri atas tiga komponen. penomoran atom C pada gula pentosa dilakukan menggunakan tanda aksen (’) untuk membedakannya dengan penomoran atom C pada basa nitrogen. Oleh karena itu. dapat disimpulkan bahwa materi genetik pada virus-virus yang tidak mempunyai DNA. gula pentosa (gula dengan lima atom karbon). Nukleotida yang satu dengan nukleotida berikutnya dihubungkan oleh ikatan fosfodiester yang sangat kuat. dan basa nukleotida atau basa nitrogen (basa siklik yang mengandung nitrogen). Menurut kebiasaan. protein RNA pemisahan RNA dari protein Gambar 9. Sebaliknya. Dengan perlakuan kimia tertentu molekul RNA dapat dipisahkan dari selubung proteinnya untuk kemudian digabungkan (direkonstitusi) dengan selubung protein dari strain TMV yang lain. sedangkan pada RNA adalah ribosa. Jadi. tetapi hanya tersusun dari RNA dan protein. Fraenkel-Conrat dan B. RNA dari strain B direkonstitusi dengan protein dari strain A. Mereka melakukan penelitian pada virus mozaik tembakau atau tobacco mozaic virus (TMV). Virus ini mengandung molekul RNA yang terbungkus di dalam selubung protein. yaitu virus yang menyebabkan timbulnya penyakit mozaik pada daun tembakau. antara lain telah dilakukan percobaan rekonstitusi yang dilaporkan oleh H. seperti halnya TMV. Gula pentosa pada DNA adalah 2-deoksiribosa. faktor yang menentukan strain hasil penggandaan adalah RNA.

O O O P=O gugus fosfat 5’CH2OH OH 4’ H 3’ H O 5’CH2OH OH 1’ H H 4’ H 3’ H O 1’ H 2’ H 2’ OH H OH OH gula ribosa gula 2-deoksiribosa NH2 O . Pada RNA tidak terdapat basa timin. baik pada DNA maupun RNA. Sementara tu. Biasanya DNA mempunyai struktur sebagai molekul polinukleotida untai ganda. Basa purin. Atom C nomor 2’ pada DNA tidak mengikat gugus OH seperti halnya pada RNA. yakni basa dengan cincin rangkap atau disebut purin dan basa dengan cincin tunggal atau disebut pirimidin.(1’). tetapi mengikat gugus H sehingga gula pentosanya dinamakan deoksiribosa. dapat berupa adenin (A) atau guanin (G). sedangkan RNA adalah polinukleotida untai tunggal. basa nitrogen ada dua macam. Ini merupakan perbedaan lain di antara kedua macam asam nukleat tersebut. tetapi diganti dengan urasil (U). sedangkan basa pirimidin pada DNA dapat berupa sitosin (C) atau timin (T).

D. yaitu 1.4. Komponen kimia asam nukleat Model Struktur DNA Watson-Crick Model struktur fisik molekul DNA pertama kali diajukan pada tahun 1953 oleh J. sedangkan guanin sama dengan sitosin. Crick. Watson dan F.N N 1 H 2 3 N adenin 4 N H 9 6 5 7 8 H N H N 1 NH2 2 3 N guanin 4 N H 9 6 5 7 8 H NH2 4 N3 5 H H O 4 N3 5 CH3 H O 4 N3 5 H 2 O 1 6 H 2 O 1 6 NH H 2 O 1 6 H NH NH sitosin timin urasil Gambar 9. Chargaff terhadap kandungan basa nitrogen molekul DNA dari berbagai organisme selalu menunjukkan bahwa konsentrasi adenin sama dengan timin. . Dengan sendirinya. nisbah konsentrasi adenin + timin terhadap konsentrasi guanin + sitosin sangat bervariasi dari spesies ke spesies. Akan tetapi. Ada dua dasar yang digunakan dalam melakukan deduksi terhadap model tersebut.H. konsentrasi basa purin total menjadi sama dengan konsentrasi basa pirimidin total.C. Hasil analisis kimia yang dilakukan oleh E.

Seperti telah disebutkan di atas.4 Å. tetapi akan mengikat gugus OH. Dari data kimia Chargaff serta difraksi sinar X Wilkins dan Franklin tersebut Watson dan Crick mengusulkan model struktur DNA yang dikenal sebagai model tangga berpilin (double helix). Franklin. dan terjadi ikatan hidrogen antara basa A pada satu untai dan basa T pada untai lainnya. Oleh karena itu. Pola difraksi yang diperoleh dari hasil pemotretan molekul DNA menggunakan sinar X oleh M. maka urutan basa pada untai lainnya dapat ditentukan pula. R. ujung ini dinamakan ujung 3’ atau ujung OH. Adanya perpasangan yang khas di antara basa-basa nitrogen itu menyebabkan kedua untai polinukleotida komplementer satu sama lain. Satu sama lain arahnya sejajar tetapi berlawanan (antiparalel). Jika untai yang satu mempunyai arah dari ujung 5’ ke 3’. dan begitu pula sebaliknya. Ikatan ini menghubungkan atom C nomor 3’ dengan atom C nomor 5’ pada gula deoksiribosa. Setiap pasangan basa berjarak 3. Gugus fosfat dan gula terletak di sebelah luar sumbu.2. makin rendah stabilitas molekul DNAnya.F. Antara basa A dan T yang berpasangan terdapat ikatan hidrogen rangkap dua. Di dalam satu kali pilinan (360°) terdapat 10 pasangan basa. maka untai komplementernya mempunyai arah dari ujung 3’ ke 5’. Di ujung lainnya atom C nomor 5’ akan mengikat gugus fosfat sehingga ujung ini dinamakan ujung 5’ atau ujung P.4 Å dengan pasangan basa berikutnya. dan para koleganya menunjukkan bahwa basabasa nitrogen tersusun vertikal di sepanjang sumbu molekul dengan interval 3. atom C nomor 3’ tidak lagi dihubungkan oleh ikatan fosfodiester dengan nukleotida berikutnya. Oleh karena itu. Wilkins. OH(3’) P(5’) P P P . Kedudukan antiparalel di antara kedua untai polinukleotida sebenarnya dilihat dari ujung-ujung ini. Basa-basa nitrogen menghadap ke arah dalam sumbu. Di salah satu ujung untai polinukleotida.H. begitu urutan basa pada satu untai polinukleotida diketahui. sedangkan antara basa G dan C yang berpasangan terdapat ikatan hidrogen rangkap tiga. Hal ini menyebabkan nisbah A+T terhadap G+C mempengaruhi stabilitas molekul DNA. Menurut model ini kedua untai polinukleotida saling memilin di sepanjang sumbu yang sama. Begitu pula. nukleotida-nukleotida yang berurutan dihubungkan oleh ikatan fosfodiester. Makin tinggi nisbah tersebut. basa G pada satu untai selalu berpasangan dengan basa C pada untai lainnya melalui ikatan hidrogen.

Materi genetik harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya. . Bagian setelah ini akan membahas replikasi DNA. dari generasi ke generasi. 1. 2. Artinya. Materi genetik harus mengatur perkembangan fenotipe organisme. materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. yang dilaksanakan melalui ekspresi gen (Bab X). yang sekarang ternyata adalah DNA. yang dilaksanakan melalui replikasi. 3. kita akan melihat fungsi yang harus dapat dilaksanakan oleh molekul tersebut sebagai materi genetik. evolusi tidak akan pernah berlangsung. Fungsi ini merupakan fungsi genotipik. Meskipun demikan. ketika itu telah disepakati bahwa gen sebagai materi genetik. Fungsi ini merupakan fungsi fenotipik. Fungsi ini merupakan fungsi evolusioner. sifat-sifat molekulernya baru sedikit sekali terungkap. Dalam beberapa dasawarsa pertama semenjak gen dikemukakan sebagai faktor yang diwariskan dari generasi ke generasi.P P P P P P(5’) OH(3’) = gula Gambar 9. harus dapat menjalankan tiga fungsi pokok berikut ini. yang dilaksanakan melalui peristiwa mutasi (Bab XI). Tanpa perubahan semacam ini.5 Diagram struktur molekul DNA = adenin = timin = guanin = sitosin Fungsi Materi Genetik Setelah terbukti bahwa DNA merupakan materi genetik pada sebagian besar organisme. Materi genetik sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah.

Namun. Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. . fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru. masing-masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. Kemudian. dan dispersif. Sementara itu. semikonservatif. pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat. yaitu konservatif. Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru.Replikasi DNA Ada tiga cara teoretis replikasi DNA yang pernah diusulkan.

Hal ini karena molekul-molekul garam tersebut akan mengendap ke dasar tabung sentrifuga akibat adanya gaya sentrifugal. Akibatnya. basa-basa nitrogen pada molekul DNA sel-sel bakteri tersebut akan memiliki 15N yang berat. Meselson dan Stahl menjelaskan bahwa pada generasi 15 N. Sebagai perbandingan. Molekul DNA dengan tingkat kerapatan tertentu akan menempati kedudukan yang sama dengan kedudukan larutan garam yang tingkat kerapatannya sama dengannya. DNA yang diekstrak dari sel E. DNA yang diekstrak dari sel E. maka akan terjadi keseimbangan tingkat kerapatan.724 g/cm3. Meselson dan F.S. sementara di sisi lain difusi akan menggerakkan molekul-molekul garam kembali ke atas tabung. kemudian dikembalikan ke medium normal 14N selama beberapa generasi berikutnya. atau dianggap sebagai generasi 0.000 hingga 50.708 g/cm3 dan 1. sedangkan DNA yang berada di bagian tengah tabung tetap. Tiga cara teoretis replikasi DNA = untai lama = untai baru Di antara ketiga cara replikasi DNA yang diusulkan tersebut. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation. Ketika larutan 6M CsCl yang di dalamnya terdapat molekul DNA disentrifugasi dengan kecepatan sangat tinggi. coli yang semula ditumbuhkan pada medium 15N selama beberapa generasi. Pada generasi kedua setelah E. DNAnya mempunyai kerapatan tinggi. Molekul DNA mempunyai kerapatan yang lebih kurang sama dengan kerapatan larutan garam yang sangat pekat seperti larutan 6M CsCl (sesium khlorida). maka Meselson dan Stahl dapat mengikuti perubahan tingkat kerapatan DNA sel-sel bakteri E. Mereka menumbuhkan bakteri Escherichia coli selama beberapa generasi di dalam medium yang mengandung isotop nitrogen 15N untuk menggantikan isotop nitrogen normal 14N yang lebih ringan. Ketika E. Stahl. kerapatan DNA E. Selanjutnya. dalam waktu 48 hingga 72 jam. Molekul DNA dengan basa nitrogen yang mengandung 15N mempunyai tingkat kerapatan (berat per satuan volume) yang lebih tinggi daripada DNA normal (14N). pada generasi 14N yang pertama.konservatif semikonservatif dispersif Gambar 9.700 g/cm3.coli telah ditumbuhkan selama beberapa generasi pada medium 14 N.coli yang pertama kali dipindahkan kembali ke medium 14N terlihat menempati bagian tengah tabung. atau disebut sebagai generasi 1. coli yang ditumbuhkan pada medium 15N terlihat menempati dasar tabung.6.coli ditumbuhkan pada medium 14N ternyata DNAnya menempati bagian tengah dan atas tabung. DNAnya merupakan hibrid . Kemudian. katakanlah 30.W. DNAnya nampak makin banyak berada di bagian atas tabung. Oleh karena molekul-molekul dengan tingkat kerapatan yang berbeda dapat dipisahkan dengan cara sentrifugasi tersebut di atas. sedangkan kerapatan larutan 6M CsCl adalah 1.000 rpm.coli dengan basa nitrogen yang mengandung isotop 14N dan 15N masingmasing adalah 1. Percobaan ini dilaporkan hasilnya pada tahun 1958 oleh M.

7 terlihat bahwa interpretasi data hasil percobaan sentrifugasi ini jelas sejalan dengan cara pembentukan molekul DNA melalui replikasi semikonservatif. Pada Gambar 9. DNA hibrid akan tetap jumlahnya. medium 15N (generasi 0) ekstrak DNA ekstrak DNA medium 14N (generasi 1) ekstrak DNA (generasi 2) medium 14N . Pada generasi 2 DNA hibridnya masih ada. tetapi muncul pula DNA baru dengan kerapatan rendah.antara DNA dengan kerapatan tinggi dan rendah. sedangkan DNA baru dengan kerapatan rendah akan makin banyak dijumpai. Demikian seterusnya.

ekstrak DNA medium 14N (generasi 3) interpretasi data hasil sentrifugasi DNA Gambar 9. Selain replikasi θ. coli berada dalam keadaan terfragmentasi sehingga replikasi molekul DNA dalam bentuknya yang utuh sebenarnya belum diketahui.8).7. Pembentukan (sintesis) untai DNA baru terjadi dengan penambahan deoksinukleotida pada ujung 3’ yang diikuti oleh pelepasan ujung 5’ dari lingkaran molekul DNA. Replikasi lingkaran menggulung = untai lama = untai baru pemanjangan ’ekor’ . Diagram percobaan Meselson dan Stahl yang memperlihatkan replikasi DNA secara semikonservatif Pada percobaan Meselson dan Stahl ekstrak DNA yang diperoleh dari sel-sel E. Replikasi DNA kromosom dalam keadaan utuh _ yang pada prokariot ternyata berbentuk melingkar atau sirkular _ baru dapat diamati menggunakan teknik autoradiografi dan mikroskopi elektron. khloroplas. Dengan kedua teknik ini terlihat bahwa DNA berbagai virus. dan mitokhondria melakukan replikasi yang dikenal sebagai replikasi θ (theta) karena autoradiogramnya menghasilkan gambaran seperti huruf Yunani tersebut. pada sejumlah bakteri dan organisme eukariot dikenal pula replikasi yang dinamakan replikasi lingkaran menggulung (rolling circle replication).8. Replikasi ini diawali dengan pemotongan ikatan fosfodiester pada daerah tertentu yang menghasilkan ujung 3’ dan ujung 5’. Sejalan dengan berlangsungnya replikasi di seputar lingkaran DNA. ujung 5’ akan makin terlepas dari lingkaran tersebut sehingga membentuk ’ekor’ yang makin memanjang (Gambar 9. penambahan nukleotida ujung 3’ tempat ujung 5’ pelepasan ujung 5’ terpotongnya ikatan fosfodiester Gambar 9.

Dalam gambar tersebut sebuah molekul dGTP ditambahkan ke molekul primer yang terdiri atas tiga nukleotida (A-CA).. Enzim-enzim yang berperan dalam replikasi DNA Replikasi DNA. T A dGTP 3’ P 5’ 5’ 3’ P G C T A PPi 3’ P 5’ OH 3’ DNA polimerase P Mg2+ 5’ 5’ 5’ 3’ P 5’ 3’ P 3’ P OH C .Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam lingkaran molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori).. 2. deoksisitidin trifosfat (dCTP). melibatkan sejumlah reaksi kimia yang diatur oleh beberapa enzim. Biasanya.. Dua buah atom fosfat (PPi) dilepaskan dari dGTP karena sebuah atom fosfatnya diberikan ke primer dalam bentuk nukleotida dengan basa G atau deoksinukleosida monofosfat (dGMP). Kita lihat bahwa sintesis DNA (penambahan basa demi basa) berlangsung dari ujung 5’ ke ujung 3’. .9. Segmen asam nukleat pendek. Pada eukariot. diperlukan tiga komponen reaksi. yaitu 1..OH bebas. .. yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi. . deoksiguanosin trifosfat (dGTP). DNA cetakan T A G C T A C. Agar DNA polimerase dapat bekerja mengatalisis reaksi sintesis DNA. Untai DNA yang akan digunakan sebagai cetakan (template). Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. Deoksinukleosida trifosfat. Salah satu diantaranya adalah enzim DNA polimerase. yang terdiri atas deoksiadenosin trifosfat (dATP). Reaksi sintesis DNA secara skema dapat dilihat pada Gambar 9. 1. Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan. . yang mengatur pembentukan ikatan fosfodiester antara dua nukleotida yang berdekatan sehingga akan terjadi pemanjangan untai DNA (polinukleotida). dan deoksitimidin trifosfat (dTTP). dapat berupa DNA atau RNA. Penambahan dGTP terjadi karena untai DNA cetakannya mempunyai urutan basa T-G-TC. Hasil penambahan yang diperoleh adalah molekul DNA yang terdiri atas empat nukleotida (A-C-A-G). selain terjadi replikasi dua arah. terjadi dua arah (bidireksional). . baik pada prokariot maupun eukariot. yang mempunyai gugus 3’. G . Molekul yang dinamakan primer ini diperlukan karena tidak ada enzim DNA polimerase yang diketahui mampu melakukan inisiasi sintesis DNA.. . . . Keempat molekul ini berfungsi sebagai sumber basa nukleotida. inisiasi replikasi DNA. atau sintesis DNA. ori dapat ditemukan di beberapa tempat.

Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. pemotongan terjadi dari ujung 3’ ke arah ujung 5’. Enzim ini bekerja pada tahap inisiasi dengan cara mengatur pembentukan molekul primer di daerah ori. Kedua enzim ini berperan dalam pembukaan pilinan di antara kedua untai DNA sehingga kedua untai tersebut dapat saling memisah. sebagian besar enzim DNA polimerase mempunyai aktivitas nuklease. Skema reaksi sintesis DNA Enzim DNA polimerase yang diperlukan untuk sintesis DNA pada E. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). Kesalahan penambahan basa pada untai polinukleotida yang sedang tumbuh (dipolimerisasi) menjadikan basa-basa salah berpasangan. Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. Fungsi perbaikan kesalahan yang dijalankan oleh enzim Pol I dan III tersebut dinamakan fungsi penyuntingan (proofreading). Namun. yaitu pembuangan molekul nukleotida dari untai polinukleotida.Gambar 9. tetapi pada kedua-duanya. yang masing-masing mempunyai arah 5’→ 3’. Pada bagian berikut ini akan dijelaskan bahwa sintesis DNA baru tidak hanya terjadi pada salah satu untai DNA. Enzim Pol I dan Pol III dari E. Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. coli mempunyai aktivitas eksonuklease yang hanya bekerja pada ujung 3’. yang bisa saja terjadi meskipun sangat jarang (sekitar satu di antara sejuta basa !). sedangkan enzim Pol I memegang peran sekunder. Aktivitas nuklease dapat dibedakan menjadi (1) eksonuklease atau pembuangan nukleotida dari ujung polinukleotida dan (2) endonuklease atau pemotongan ikatan fosfodiester di dalam untai polinukleotida. Khusus enzim Pol I ternyata juga mempunyai aktivitas eksonuklease 5’→ 3’ di samping aktivitas eksonuklease 3’→5’ (lihat juga Bab XI). yaitu DNA polimerase I (Pol I) dan DNA polimerase III (Pol III). Dalam sintesis DNA. Artinya. Selain mampu melakukan pemanjangan atau polimerisasi DNA. Tahap inisiasi sintesis DNA juga melibatkan enzim DNA girase dan protein yang mendestabilkan pilinan (helix destabilizing protein). coli ada dua macam. enzim DNA polimerase untuk sintesis DNA kromosom pada eukariot disebut polimerase α. Sementara itu. Setelah primer terbentuk barulah DNA polimerase melakukan elongasi atau pemanjangan untai DNA. Enzim lain yang berperan dalam proses sintesis DNA adalah primase. misalnya A dengan C. Untuk menyambung fragmen-fragmen ini diperlukan enzim yang disebut DNA ligase. Pol III merupakan enzim replikasi yang utama.9. Hal ini bermanfaat untuk memperbaiki kesalahan sintesis DNA atau kesalahan penambahan basa. Hanya saja sintesis DNA pada salah satu untai berlangsung tidak kontinyu sehingga menghasilkan fragmen yang terputus-putus. Terjadinya sintesis .

yang kemudian mengalami dua kali mitosis menjadi . fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. Mulai tahap ini kedua sel (ekskonjugan) secara genetik menjadi sama. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). ori 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ untai baru kontinyu untai pengarah fragmen-fragmen 5’ 3’ 3’ 5’ Okazaki untai tertinggal 5’ 3’ Gambar 9. sesuai dengan nama penemunya. fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki.DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. membran sel di tempat kedua sel berlekatan akan rusak sehingga terjadi pertukaran salah satu mironuklei antarsel. Seperti telah dikemukakan di atas. Diagram replikasi pada kedua untai DNA 11/01/2009 Posted by zaifbio | Genetika Dasar | 3 Komentar Sterilitas Jantan pada Jagung hingga dihasilkan delapan mikronuklei haploid. yang tujuh di antaranya mengalami degenerasi. yang diikuti dengan fusi kedua mikronuklei menjadi satu mikronukleus diploid. Fase aseksual juga diawali dengan meiosis mikronuklei menjadi delapan mikronuklei haploid. Kedua mikronuklei ini bergabung membentuk satu mikronukleus diploid. Satu mikronukleus yang tersisa mengalami mitosis menjadi dua mikronuklei yang juga haploid. Satu mikronukleus yang tersisa mengalami mitosis menjadi dua mikronuklei haploid. yang tujuh di antaranya akan mengalami degenerasi. Selanjutnya. Sementara itu.10.

aurelia yang mengandung partikel-partikel kappa akan menghasilkan senyawa beracun yang dapat mematikan strainstrain protozoa lainnya yang ada di sekitarnya. peristiwa autogami pada hakekatnya sangat menyerupai pembuahan sendiri. sel-sel yang dihasilkan semuanya akan menjadi homozigot karena sel awal heterozigot tersebut terlebih dahulu mengalami meiosis menjadi sel haploid. yang artinya bakteri pembunuh berbentuk pita spiral. Senyawa beracun ini selanjutnya disebut sebagai paramesin. kedua sel tidak bertukar materi sitoplasmik tetapi hanya bertukar mikronuklei (Gambar 8.5. Kedua mikronuklei yang tersisa mengalami mitosis menjadi empat mikronuklei diploid. Dua di antara mikronuklei ini berkembang menjadi makronuklei. yakni sel pembunuh dan sel bukan pembunuh yang kedua-duanya bergenotipe Kk. Sterilitas jantan sitoplasmik tidak diatur oleh gen-gen kromosomal tetapi diwariskan melalui sitoplasma gamet betina dari . Hal yang perlu untuk diketahui pada fase aseksual ini adalah bahwa meskipun sel yang mengalami autogami pada awalnya heterozigot.empat mikronuklei diploid. dari hasil tersebut tampak jelas bahwa sifat pembunuh atau bukan pembunuh ditentukan oleh ada tidaknya partikel kappa di dalam sitoplasma walaupun partikel itu sendiri keberadaannya bergantung kepada gen K di dalam nukleus. Apabila strain pembunuh melakukan konjugasi dengan strain bukan pembunuh (pada suatu kondisi yang memungkinkan strain bukan pembunuh untuk bertahan hidup). Dari hasil autogami dapat dipelajari bahwa pewarisan suatu sifat diatur oleh gen-gen kromosomal ataukah sitoplasmik. Beberapa peneliti. yaitu sterilitas jantan sitoplasmik pada jagung. genotipe KK dapat menghasilkan fenotipe bukan pembunuh jika di dalam sitoplasma tidak terdapat partikel kappa. Jadi. Tanaman jagung dikatakan steril atau mandul jantan sitoplasmik apabila tidak mampu menghasilkan polen yang aktif dalam jumlah normal sementara proses reproduksi dan fertilitas betinanya normal. Sebaliknya sel pembunuh (Kk) melalui autogami dapat menghasilkan sel bukan pembunuh (kk) karena partikel kappa tidak akan mampu bertahan di dalam sitoplasma tanpa adanya gen K. Jika masing-masing sel ini melakukan autogami. maka akan diperoleh sel pembunuh (KK) dan sel bukan pembunuh (kk) yang berasal dari sel pembunuh (Kk) serta sel bukan pembunuh (baik KK maupun kk) yang berasal dari sel bukan pembunuh (Kk). maka ada dua kemungkinan yang dapat terjadi.M. Sonneborn. Setelah terjadi sitokinesis (pemisahan sel) diperoleh dua buah sel masing-masing dengan dua mikronuklei dan satu makronukleus yang semuanya diploid. Dengan demikian. Kemungkinan ke dua terjadi pertukaran materi sitoplasmik di antara kedua sel (Gambar 8.5 b) sehingga hanya diperoleh satu kelompok sel. Pertama. khususnya dalam hal peningkatan homozigositas. Dengan demikian. maka akan diperoleh sel pembunuh (KK) dan sel bukan pembunuh (kk) dengan nisbah 1 : 1. Jika sel-sel ini melakukan autogami. yakni sel pembunuh yang bergenotipe Kk. Sterilitas Jantan pada Jagung Di bidang pertanian ada satu contoh fenomena pewarisan sitoplasmik yang sangat penting.a) sehingga diperoleh dua kelompok sel. Pada strain tertentu Paramecium aurelia ditemukan adanya fenomena ‘pembunuh’ (killer) yang berkaitan dengan keberadaan sejumlah partikel yang disebut sebagai kappa di dalam sitoplasmanya. Keberadaan kappa bergantung kepada gen kromosomal dominan K. seperti T. sedangkan partikel-partikel kappa ternyata merupakan bakteri simbion yang kemudian dikenal dengan nama Caedobacter taeniospiralis. mengamati bahwa sel P.

Rhoades melalui percobaan persilangan pada jagung. yang secara skema dapat dilihat pada Gambar 8. Individu mandul jantan sebagai tetua betina disilangkan dengan individu normal sebagai 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar Materi Genetik di dalam Kloroplas. Secara biokimia kelainan ini berupa gangguan pada sistem sintesis protein mitokondria yang diatur oleh materi genetik di dalam mitokondria.generasi ke generasi. sel kehilangan kemampuan untuk membentuk protein yang diperlukan dalam metabolisme oksidatif. mutan poki juga memperoleh energi untuk pertumbuhannya . persilangan antara betina tipe liar dan jantan poki menghasilkan keturunan yang semuanya normal. cerevisae dalam hal pertumbuhannya yang lambat dan kerusakan fungsi mitokondrianya. Akibatnya. Mutan poki menyerupai mutan petit pada S. Sebaliknya. Jenis sterilitas ini telah banyak digunakan dalam produksi biji jagung hibrida. betina tersebut dinamakan mutan poki (poky mutant). Seperti halnya mutan petit. Pola pewarisan sterilitas jantan pertama kali dipelajari oleh M. Persilangan antara betina poki dan jantan tipe liar menghasilkan keturunan yang semuanya poki.6.

melalui jalur fermentasi anaerob yang sangat tidak efisien. Suatu tanaman bunga pukul empat dapat memiliki bagian vegetatif yang berbedabeda warnanya. bagian yang belang-belang . Dia mengamati bahwa pewarisan warna tersebut semata-mata ditentukan oleh tetua betina dan berkaitan dengan ada tidaknya kloroplas di dalam sitoplasma. dan belang-belang hjau-putih (variegated). Sementara itu. putih. Selsel pada bagian yang berwarna hijau mempunyai kloroplas yang mengandung klorofil. yaitu hijau. Materi Genetik di dalam Kloroplas. Carl Correns pada tahun 1908 melihat adanya perbedaan hasil persilangan resiprok pada pewarisan warna bagian vegetatif tanaman. khususnya daun. sedang sel-sel pada bagian yang berwarna putih tidak mempunyai kloroplas tetapi berisi plastida yang tidak berwarna. pada beberapa tanaman tertentu seperti bunga pukul empat (Mirabilis jalapa).

2. sehingga dimungkinkan adanya sembilan kombinasi persilangan. Tabel 8.1 bahwa fenotipe keturunan akan selalu sama dengan fenotipe tetua betina atau terjadi pewarisan maternal. yang hasilnya dapat dilihat pada Tabel 8. kontribusi kloroplas kepada zigot dapat dipastikan hanya berasal dari sel kelamin betina. baik sebagai sumber polen (tetua jantan) maupun sebagai pembawa putik (tetua betina). yakni mengenai pewarisan sifat ketahanan terhadap antibiotik. Kedua macam sel haploid ini dapat bergabung membentuk zigot diploid. Jelas dapat disimpulkan dari Tabel 8. Model yang menjelaskan pewarisan maternal ini dapat dilihat pada Gambar 8. yang selanjutnya . Sel alga ini memiliki sebuah kloroplas yang besar ukurannya dan di dalamya terdapat sejumlah materi genetik. Dengan demikian.1. hijau. hijau. atau putih belang-belang. atau putih belang-belang. atau putih Penelitian tentang pewarisan sitoplasmik telah dilakukan pula pada alga uniseluler Chlamydomonas reinhardii. yakni mt + dan mt .1 Hasil persilangan pada tanaman bunga pukul empat Fenotipe cabang yang membawa bunga sebagai tetua betina putih putih putih hijau hijau hijau belang-belang belang-belang belang-belang Fenotipe cabang yang membawa bunga sebagai tetua jantan Putih Hijau belang-belang Putih Hijau belang-belang Putih Hijau belang-belang Fenotipe keturunan putih putih putih hijau hijau hijau belang-belang. hijau. Hal ini karena seperti telah dikatakan di atas bahwa warna hijau bergantung kepada ada tidaknya kloroplas. baik dengan maupun tanpa kloroplas.terdiri atas sel-sel. Ada dua macam sel pada Chlamydomonas bila dilihat dari tipe kawinnya. sementara polen hanya sedikit sekali atau bahkan sama sekali tidak memiliki kloropas. Ketiga macam bagian tanaman tersebut dapat menghasilkan bunga.

2.akan mengalami meiosis untuk menghasilkan tetrad yang terdiri atas empat buah sel haploid. putih hijau belang-belang sel telur x polen x x x x zigot Gambar 8. = kloroplas . Model pewarisan maternal pada tanaman bunga pukul empat = plastida tanpa klorofil . Sel-sel haploid di dalam tetrad dapat ditumbuhkan pada medium selektif padat dan membentuk koloni yang menunjukkan genotipenya. maka kontribusi sitoplasma kepada zigot yang terbentuk akan sama banyaknya. Oleh karena kedua sel tipe kawin tersebut ukurannya sama besar.

Hal ini didukung oleh penelitian menggunakan penanda fisik untuk membedakan kloroplas dari kedua tipe kawin yang telah menunjukkan bahwa setelah terjadi penggabungan. Secara skema persilangan tersebut dapat digambarkan seperti pada Gambar 8. pewarisan alel str mengikuti pola pewarisan uniparental. Persilangan mt+ str+ dengan mt – str . Analisis biokimia membuktikan bahwa sifat ketahanan terhadap antibiotik berhubungan dengan kloroplas. kloroplas yang diwariskan hanya berasal dari tetua mt +. kloroplas dapat dipastikan berasal dari salah satu tipe kawin saja.3. Jika kloroplas ini berasal dari penggabungan kloroplas kedua sel tipe kawin yang digunakan sebagai tetua dengan nisbah yang sama. dan semuanya memperlihatkan terjadinya pewarisan uniparental. Jadi.menghasilkan keturunan yang semuanya tahan streptomisin (str+) sementara persilangan mt+ str . Sebagai contoh.str+ menghasilkan keturunan yang semuanya rentan streptomisin (str -) . Dengan perkataan lain. Keturunan hasil persilangan antara kedua tipe kawin selalu mempunyai genotipe seperti salah satu tetuanya. Jadi. Meskipun demikian. Berbagai penelitian mengenai ketahanan terhadap antibiotik selain streptomisin telah dilakukan pula pada Chlamydomonas. dalam hal ini mt+. Dengan demikian. Seperti telah kita ketahui bahwa sel haploid Chlamydomonas hanya mempunyai sebuah kloroplas. pewarisan sifat ketahanan terhadap antibiotik pada Chlamydomonas merupakan pewarisan ekstrakromosomal atau pewarisan sitoplasmik. yakni menghasilkan keturunan dengan nisbah 1 : 1. maka sifat ini jelas dibawa oleh kloroplas. pewarisan sifat ketahanan terhadap streptomisin berlangsung uniparental atau bergantung kepada genotipe salah satu tetuanya. yang menunjukkan bahwa alel tersebut terletak di dalam kromosom nukleus. alel yang menentukan tipe kawin itu sendiri (alel mt) tampak bersegregasi mengikuti pola Mendel. Dengan perkataan lain. mt+ str+ zigot mt – str . yang berarti sejalan dengan pola pewarisan kloroplas. Oleh karena pewarisan sifat ketahanan terhadap antibiotik selalu ditentukan oleh tetua mt +. persilangan antara tipe liar dan mutan yang tahan terhadap streptomisin menghasilkan keturunan yang sifat ketahanannya terhadap streptomisin bergantung kepada tetua mt+.Persilangan resiprok antara tipe liar (rentan antibiotik) dan mutan-mutan yang tahan antibiotik memberikan hasil yang berbeda-beda. maka tidak mungkin terjadi pewarisan uniparental.zigot mt – str+ mt+ mt – mt+ mt – mt+ mt – mt+ mt – . kloroplas dari mt – akan hilang oleh suatu sebab yang hingga kini beluim diketahui.dengan mt .mt+ str .

Kenyataannya gengen kromosomal ini memang memegang peranan utama di dalam pewarisan sebagian besar sifat genetik.3.mt – str – Gambar 8. Meskipun demikian. PEWARISAN SITOPLASMIK Sebegitu jauh pembicaraan kita tentang pewarisan sifat pada eukariot selalu dikaitkan dengan gen-gen yang terletak di dalam kromosom/nukleus. str+ = tahan streptomisin .str+ mt+str .semuanya str+ semuanya str – mt+ str+ mt .=rentan streptomisin) 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar PEWARISAN SITOPLASMIK BAB VIII PEWARISAN SITOPLASMIK      Kriteria Pewarisan Sitoplasmik Organel Sitoplasmik Pembawa Materi Genetik Pengaruh Genetik Simbion Sitoplasmik pada Paramaecium Mekanisme Sterilitas Jantan pada Jagung Pengaruh Maternal dan Pewarisan Maternal BAB VIII. str . Diagram pewarisan sifat ketahanan terhadap streptomisin pada Chlamydomonas (mt = tipe kawin . sesekali pernah pula dilaporkan bahwa ada sejumlah sifat genetik pada eukariot yang .

Sebagai contoh. maka perbedaan hasil perkawinan resiprok tersebut menunjukkan bahwa salah satu tetua (biasanya betina) memberikan pengaruh lebih besar daripada pengaruh tetua lainnya dalam pewarisan suatu sifat tertentu. dan beberapa komponen sitoplasmik lainnya. setidaktidaknya lima hal di bawah ini dapat digunakan untuk keperluan tersebut. Begitu juga virus dan partikel mirip bakteri dapat bertindak sebagai pembawa sifat herediter sitoplasmik. Perbedaan hasil perkawinan resiprok merupakan penyimpangan dari pola Mendel. Kriteria Pewarisan Sitoplasmik Sebenarnya tidak ada kriteria yang dapat berlaku universal untuk membedakan pewarisan sitoplasmik dengan pewarisan gen-gen kromosomal. Pewarisan ekstranukleus. Di bagian akhir dibicarakan pula suatu fenomena lain yang masih ada sangkut pautnya dengan pewarisan sitoplasmik. Namun.pewarisannya diatur oleh unsur-unsur di luar nukleus. kloroplas (pada tumbuhan). Pada Bab VIII ini akan dibahas berbagai contoh kasus yang termasuk dalam pewarisan sitoplasmik. Pewarisan sifat sitoplasmik diatur oleh materi genetik yang terdapat di dalam organel-organel seperti mitokondria. ini tidak mengikuti pola Mendel. atau dikenal pula sebagai pewarisan sitoplasmik. 1. Jika dalam hal ini pengaruh rangkai kelamin (Bab VI) dikesampingkan. . hasil persilangan antara betina A dan jantan B tidak sama dengan hasil persilangan antara betina B dan jantan A.

Substitusi nukleus dapat memperjelas pengaruh relatif nukleus dan sitoplasma. Organel Sitoplasmik Pembawa Materi Genetik Di dalam sitoplasma antara lain terdapat organel-organel seperti mitokondria dan kloroplas. kedua organel ini sering kali disebut sebagai organel otonom. 3. maka pewarisan tersebut terjadi karena pengaruh materi sitoplasmik. Jika materi sitoplasmik terbukti berkaitan dengan pewarisan sifat tertentu. yang memiliki molekul DNA (lihat Bab IX) dan dapat melakukan replikasi subseluler sendiri. maka dapat dipastikan bahwa pewarisan sifat tersebut merupakan pewarisan sitoplasmik.2. Gen-gen kromosomal menempati loki tertentu dengan jarak satu sama lain yang tertentu pula sehingga dapat membentuk kelompok berangkai (Bab V). Oleh karena itu. 5. Sel kelamin betina biasanya membawa sitoplasma dan organel sitoplasmik dalam jumlah lebih besar daripada sel kelamin jantan. Oleh karena itu. jika ada suatu materi penentu sifat tidak dapat dipetakan ke dalam kelompok-kelompok berangkai yang ada. Jika pewarisan suatu sifat berlangsung tanpa adanya pewarisan gen-gen kromosomal. sangat dimungkinkan bahwa materi genetik tersebut terdapat di dalam sitoplasma 4. Beberapa hasil . Organel dan simbion di dalam sitoplasma dimungkinkan untuk diisolasi dan dianalisis untuk mendukung pembuktian tentang adanya transmisi maternal dalam pewarisan sifat. Tidak adanya nisbah segregasi Mendel menunjukkan bahwa pewarisan sifat tidak diatur oleh gen-gen kromosomal tetapi oleh materi sitoplasmik.

Enzim-enzim untuk keperluan respirasi sel dan produksi energi terdapat di dalam mitokondria.penelitian memberikan petunjuk bahwa mitokondria dan kloroplas pada awalnya masing-masing merupakan bakteri dan alga yang hidup bebas. Klorofil beserta kelengkapan untuk sintesisnya telah dirakit ketika kloroplas masih dalam bentuk alga yang hidup bebas. Begitu juga bahan makanan akan dioksidasi di dalam organel ini untuk menghasilkan senyawa adenosin trifosfat (ATP). kloroplas sebagai organel fotosintetik pada tumbuhan dan beberapa mikroorganisme membawa sejumlah materi genetik yang diperlukan bagi struktur dan fungsinya dalam melaksanakan proses fotosintesis. Mitokondria. yang nanti akan dibicarakan pada bagian lain bab ini. Sementara itu. Dalam kurun waktu yang sangat panjang mereka kemudian membangun simbiosis turun-temurun dengan sel inang eukariotnya dan akhirnya berkembang menjadi organel yang menetap di dalam sel. diduga membawa hingga lebih kurang 50 gen di dalam molekul DNAnya. misalnya mekanisme ketahanan terhadap antibiotik streptomisin pada Chlamydomonas. Ephrusi menemukan sejumlah . Mutan Mitokondria Pada suatu penelitian menggunakan khamir Saccharomyces cerevisae B. Pada alga hijau plastida diduga membawa mekanisme genetik lainnya. yang dijumpai pada semua jenis organisme eukariot. yang merupakan bahan bakar bagi berbagai reaksi biokomia. Gen-gen ini di antaranya bertanggung jawab atas struktur mitokondria itu sendiri dan juga pengaturan berbagai bentuk metabolisme energi.

Koloni-koloni ini dinamakan mutan petit (petite mutant). Tipe pertama memperlihatkan segregasi Mendel seperti biasanya sehingga dinamakan petit segregasional. Namun. Jika zigot ini mengalami pembelahan meiosis. Analisis genetik terhadap hasil persilangan antara mutan petit dan tipe liarnya memperlihatkan adanya tiga tipe mutan petit seperti dapat dilihat pada Gambar 8. Hasil pengamatan mikroskopis menunjukkan bahwa selsel pada koloni tersebut berukuran normal. maka dapat . oleh karena zigot diploid mempunyai fenotipe normal. Hal ini menunjukkan bahwa petit segregasional ditimbulkan oleh mutasi di dalam nukleus. melainkan melalui fermentasi glukosa secara anaerob yang jelas jauh kurang efisien bila dibandingkan dengan respirasi aerob. akan diperoleh empat askopora haploid dengan nisbah fenotipe 2 normal : 2 petit. Mutan petit melakukan metabolisme karbon bukan dengan respirasi menggunakan oksigen. Selain itu. Persilangan dengan tipe liarnya menghasilkan zigot diploid yang normal.koloni berukuran sangat kecil yang kadang-kadang terlihat ketika sel ditumbuhkan pada medium padat. hasil studi fisiologi menunjukkan bahwa sel-sel tersebut mengalami petumbuhan yang sangat lambat karena adanya kelainan dalam metabolisme senyawa karbon.1.

Hasil yang sama akan diperoleh apabila zigot diploid disilang balik dengan tetua petitnya. fenotipe keturunan hanya ditentukan oleh tetua normalnya. Tipe ke dua. yang disebut petit netral. Dengan perkataan lain. . Berlangsungnya pewarisan uniparental tersebut disebabkan oleh hilangnya sebagian besar atau seluruh materi genetik di dalam mitokondria yang menyandi sintesis enzim respirasi oksidatif pada kebanyakan petit netral. berbeda dengan tipe pertama jika dilihat dari keempat askopora hasil pembelahan meiosis zigot diploid. Jadi. Ketika sel petit netral bertemu dengan sel tipe liar.dipastikan bahwa alel yang mengatur mutan petit merupakan alel resesif. sitoplasma sel tipe liar akan menjadi sumber materi genetik mitokhodria bagi spora-spora hasil persilangan petit dengan tipe liar sehingga semuanya akan mempunyai fenotipe normal. Keempat askospora ini semuanya normal. pewarisan sifatnya merupakan pewarisan uniparental.

Segregasional Supresif Netral ha ploid : x x x zigot diploid : normal normal petit askospor a: 2 normal : 2 petit normal 4 4 petit .

Bedanya. yang hingga kini belum dapat dijelaskan dengan baik. nukleus bergaris untuk pembentukan petit) mendatar membawa alel Tipe ke tiga disebut petit supresif.1. seperti halnya pada tipe petit netral. pewarisan uniparental juga terjadi pada tipe petit supresif. hasil meiosis zigot petit ini adalah empat askospora yang semuanya mempunyai fenotipe petit. Petit supresif juga mengalami kerusakan pada materi genetik mitokondrianya tetapi kerusakannya tidak separah pada petit netral. Pewarisan mutasi petit pada persilangan dengan tipe liarnya (lingkaran kecil menggambarkan sel petit . kasus mutasi mitokondria juga dijumpai pada jamur Neurospora. Selanjutnya. yang pewarisannya berlangsung uniparental melalui tetua betina (pewarisan maternal) meskipun sebenarnya pada jamur ini belum ada perbedaan jenis kelamin yang nyata. cerevisae. Mutan mitokondria pada Neurospora yang diwariskan melalui tetua 10/31/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar . Pada persilangannya dengan tipe liar dihasilkan zigot diploid dengan fenotipe petit.Gambar 8. Dengan demikian. pada petit supresif alel penyebab petit bertindak sebagai penghambat (supresor) dominan terhadap aktivitas mitokondria tipe liar. Selain pada khamir S.

disebut sebagai kromosom kelamin. Keberadaan gen berangkai pada suatu spesies organisme. Salah satu dari keempat kelompok gen berangkai atau keempat pasang kromosom pada D. Seperti halnya gen berangkai (autosomal).RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN BAB VI RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN ·     Kromosom Kelamin dan Autosom Gen Rangkai Kelamin Tipe Penentuan Jenis Kelamin Organisme Kromatin Kelamin dan Hipotesis Lyon Pengaruh Hormon Kelamin dalam Penentuan Jenis Kelamin BAB VI. Gen-gen yang terletak pada kromosom kelamin dinamakan gen rangkai kelamin (sex-linked genes) sementara fenomena yang melibatkan pewarisan gen-gen ini disebut peristiwa rangkai kelamin (linkage). yaitu kromosom yang pada individu jantan dan betina sama strukturnya sehingga tidak dapat digunakan untuk membedakan jenis kelamin. individu-individu yang dihasilkan melalui kombinasi gamet tersebut memperlihatkan nisbah .4). Adapun gen berangkai yang dibicarakan pada Bab V adalah gengen yang terletak pada kromosom selain kromosom kelamin. RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN Pada Bab V telah kita pelajari pola pewarisan sifat yang diatur oleh gen-gen berangkai atau gen-gen yang terletak pada satu kromosom. gen-gen rangkai kelamin tidak mengalami segregasi dan penggabungan secara acak di dalam gamet-gamet yang terbentuk. Ternyata banyak sekali spesies organisme lainnya. terutama hewan dan juga manusia. mempunyai kromosom kelamin. Pemberian nama ini karena strukturnya pada individu jantan dan individu betina memperlihatkan perbedaan sehingga dapat digunakan untuk membedakan jenis kelamin individu. melanogaster tersebut. misalnya peta kromosom pada lalat Drosophila melanogaster yang terdiri atas empat kelompok gen berangkai (Gambar 5. dalam hal ini kromosom nomor 1. Akibatnya. yang meliputi urutan dan jaraknya satu sama lain. Kromosom semacam ini dinamakan autosom. menghasilkan peta kromosom untuk spesies tersebut.

perkawinan resiprok menghasilkan keturunan yang berbeda. Selain itu. Pada bab ini akan dijelaskan cara pewarisan macam-macam gen rangkai kelamin tersebut serta beberapa sistem penentuan jenis kelamin pada berbagai spesies organisme. Dia menyilangkan lalat D. Secara skema pewarisan warna mata pada Drosophila dapat dilihat pada Gambar 6. misalnya pengatur warna mata merah ini. jika pada percobaan Mendel perkawinan resiprok (genotipe tetua jantan dan betina dipertukarkan) menghasilkan keturunan yang sama. dapat dilambangkan dengan tanda +. maka gen rangkai kelamin dapat menjadi gen rangkai X (Xlinked genes) dan gen rangkai Y (Y-linked genes). Lalat bermata merah lazim dianggap sebagai lalat normal atau tipe alami (wild type). ternyata berbeda jika tetua jantan yang digunakan adalah tipe alami (bermata merah) dan tetua betinanya bermata putih. Oleh karena kromosom kelamin pada umumnya dapat dibedakan menjadi kromosom X dan Y. dan ternyata kemudian memang diketahui bahwa gen yang mengatur warna mata pada Drosophila terletak pada kromosom kelamin. meskipun tidak selalu. Dengan perkataan lain. Di samping itu. khususnya pada generasi F1. Gen rangkai kelamin dapat dikelompok-kelompokkan berdasarkan atas macam kromosom kelamin tempatnya berada. sedang gen pengatur tipe alami. melanogaster jantan bermata putih dengan betina bermata merah.1. Hasil persilangan Morgan tersebut. Biasanya. gen pengatur warna mata ini dikatakan sebagai gen rangkai X. ada pula beberapa gen yang terletak pada kromosom X tetapi memiliki pasangan pada kromosom Y. P: x betina normal jantan mata putih + + w x betina mata putih jantan normal P: w w + F1 : + w + F1: + w w betina normal jantan normal betina normal jantan mata putih . Persilangan resiprok dengan hasil yang berbeda ini memberikan petunjuk bahwa pewarisan warna mata pada Drosophila ada hubungannya dengan jenis kelamin. dalam hal ini kromosom X. gen tipe alami bersifat dominan terhadap alel mutannya. tidak demikian halnya untuk sifat-sifat yang diatur oleh gen rangkai kelamin. Pewarisan Rangkai X Percobaan yang pertama kali mengungkapkan adanya peristiwa rangkai kelamin dilakukan oleh T.fenotipe dan genotipe yang menyimpang dari hukum Mendel.H Morgan pada tahun 1910. Oleh karena itu. Gen semacam ini dinamakan gen rangkai kelamin tak sempurna (incompletely sex-linked genes). Kromosom X dan Y masimg-masing lazim dilambangkan dengan tanda dan .

a) b) Gambar 6. individu homozigot dominan (betina) dan hemizigot dominan (jantan) mempunyai bulu berwarna hitam. Sebaliknya. salah seorang di antara putra Ratu Victoria menderita hemofilia sementara dua di antara putrinya karier atau heterozigot. Individu homozigot resesif (betina) dan hemizigot resesif (jantan) akan berbulu kuning. dan juga beberapa spesies organisme lainnya. akan nampak bahwa lalat F1 betina mempunyai mata seperti tetua jantannya. Individu jantan ini dikatakan bersifat heterogametik. Hemofilia baru menjadi terkenal dan dipelajari pola pewarisannya setelah beberapa anggota keluarga Kerajaan Inggris mengalaminya. Sebaliknya. Awalnya. jika gen tersebut resesif. individu jantan yang hanya membawa sebuah kromosom X akan menghasilkan dua macam gamet yang berbeda. Sebenarnya.b. Diagram persilangan rangkai X pada Drosophila Jika kita perhatikan Gambar 6. kasus hemofilia telah dijumpai sejak lama di negara-negara Arab ketika beberapa anak laki-laki meninggal akibat perdarahan hebat setelah dikhitan. individu betina ini dikatakan bersifat homogametik. Dalam keadaan heterozigot gen ini menyebabkan warna bulu yang dikenal dengan istilah tortoise shell. Melalui dua dari keempat cucu yang heterozigot inilah penyakit hemofilia tersebar di kalangan keluarga Kerajaan Rusia dan Spanyol. yang dengan sendirinya homolog. yaitu normal/merah. Rangkai Z pada ayam .1. Oleh karena genotipe heterozigot untuk gen rangkai X hanya dapat dijumpai pada individu betina. Sementara itu. Namun. Pewarisan sifat semacam ini disebut sebagai criss cross inheritance. lalat F1 jantan warna matanya seperti tetua betinanya. Sebaliknya. Rangkai X pada manusia Salah satu contoh gen rangkai X pada manusia adalah gen resesif yang menyebabkan penyakit hemofilia. anggota keluarga Kerajaan Inggris saat ini yang merupakan keturunan putra/putri normal Ratu Victoria bebas dari penyakit hemofilia. waktu itu kematian akibat perdarahan ini hanya dianggap sebagai takdir semata. individu betina membawa dua buah kromosom X. Istilah hemizigot digunakan untuk menyebutkan genotipe individu dengan sebuah kromosom X. yaitu gamet yang membawa kromosom X dan gamet yang membawa kromosom Y. maka kucing berbulu tortoise shell hanya terdapat pada jenis kelamin betina. Dari kedua putri yang heterozigot ini lahir tiga cucu laki-laki yang menderita hemofilia dan empat cucu wanita yang heterozigot.1. Individu dengan gen dominan yang terdapat pada satu-satunya kromosom X dikatakan hemizigot dominan. Oleh karena itu. sehingga gamet-gamet yang dihasilkannya akan mempunyai susunan gen yang sama. Rangkai X pada kucing Warna bulu pada kucing ditentukan oleh suatu gen rangkai X. individu yang memilikinya disebut hemizigot resesif. Sementara itu. yaitu putih. yaitu gangguan dalam proses pembekuan darah. Pada Drosophila.

Dengan perkataan lain. maka gen rangkai Y diduga merupakan gen yang sangat stabil. dan berlangsung seperti halnya pewarisan gen autosomal. Jadi. Gen rangkai Y jelas tidak mungkin diekspresikan pada individu betina/wanita sehingga gen ini disebut juga gen holandrik. sedang individu heterogametik (ZW) adalah betina.2. melanogaster terdapat gen rangkai kelamin tak sempurna yang menyebabkan pertumbuhan bulu pendek. gen-gen pada segmen kromosom X dan Y yang homolog ini disebut juga gen rangkai kelamin tak sempurna. Ht dengan alelnya ht yang menyebabkan pertumbuhan bulu panjang di sekitar telinga. P: + + x b b P: b b x + + jantan normal betina normal jantan bulu pendek betina bulu pendek . Pewarisan Rangkai Y Pada umumnya kromosom Y hanya sedikit sekali mengandung gen yang aktif. Oleh karena itu. Br. Biasanya suatu gen/alel dapat dideteksi keberadaannya apabila fenotipe yang dihasilkannya adalah abnormal. pada kasus ini alel resesif justru dianggap sebagai tipe alami atau normal (dilambangkan dengan +). Alelnya. Pada D. pada rangkai Z justru terjadi sebaliknya. Pewarisan gen yang bersifat resesif ini dapat dilihat pada Gambar 6. ada beberapa gen pada kromosom X yang mempunyai alel pada kromosom Y. Oleh karena fenotipe abnormal yang disebabkan oleh gen rangkai Y jumlahnya sangat sedikit. sedang alel dominannya merupakan alel mutan. ternyata ada bagian atau segmen tertentu pada kedua kromosom tersebut yang homolog satu sama lain. Contoh gen holandrik pada manusia adalah Hg dengan alelnya hg yang menyebabkan bulu kasar dan panjang. Hanya saja. Pewarisan sifat yang diatur oleh gen semacam ini dapat dikatakan tidak dipengaruhi oleh jenis kelamin. Jumlah yang sangat sedikit ini mungkin disebabkan oleh sulitnya menemukan alel mutan bagi gen rangkai Y yang dapat menghasilkan fenotipe abnormal. menyebabkan bulu ayam menjadi burik. Individu homogametik (ZZ) adalah jantan. kalau pada rangkai X individu homogametik berjenis kelamin pria/jantan sementara individu heterogametik berjenis kelamin wanita/betina. Pewarisan Rangkai Kelamin Tak Sempurna Meskipun dari uraian di atas secara tersirat dapat ditafsirkan bahwa kromosom X tidak homolog dengan kromosom Y. dan Wt dengan alelnya wt yang menyebabkan abnormalitas kulit pada jari.Pada dasarnya pola pewarisan sifat rangkai Z sama dengan pewarisan sifat rangkai X. Contoh gen rangkai Z yang lazim dikemukakan adalah gen resesif br yang menyebabkan pemerataan pigmentasi bulu secara normal pada ayam.

masih banyak sistem penentuan jenis kelamin lainnya. Secara ringkas penentuan jenis kelamin dengan sistem X/A pada lalat Drosophila dapat dilihat pada Tabel 6. Sebagai contoh. dan unggas lainnya serta ikan tertentu. hal ini mirip dengan sistem XY.B. misalnya belalang. Sebaliknya. Dalam hal ini kromosom Y hanya berperan mengatur fertilitas jantan. pada sistem XO individu jantan tidak mempunyai kromosom Y. Dia berhasil menyimpulkan bahwa sistem penentuan jenis kelamin pada organisme tersebut berkaitan dengan nisbah banyaknya kromosom X terhadap banyaknya autosom. Penentuan jenis kelamin pada manusia/mamalia dikatakan mengikuti sistem XY.5 jenis kelamin jantan . sedang pada ayam. Jadi. dan tidak ada hubungannya dengan kromosom Y. Di dalam sel somatisnya. jumlah kromosom sel somatis individu betina lebih banyak daripada jumlah pada individu jantan. pewarisan gen rangkai kelamin tak sempurna mempunyai pola seperti pewarisan gen autosomal.1. Tabel 6. Sistem nisbah X/A C. E. Jadi. Berikut ini akan dijelaskan beberapa di antaranya.1. pada ayam individu jantan justru homogametik (ZZ) sementara individu betinanya heterogametik (ZW). individu pria/jantan adalah heterogametik (XY) sementara wanita/betina adalah homogametik (XX). Selain kedua sistem tersebut. Penentuan jenis kelamin pada lalat Drosophila Σ kromosom X 1 Σ autosom 2 nibah X/A 0. Bridge melakukan serangkaian penelitian mengenai jenis kelamin pada lalat Drosophila. Bedanya. dalam hal ini kucing.F1 : + b betina normal a) + b jantan normal F1: + b betina normal b) + b jantan normal Gambar 6. sedang pada individu jantannya hanya ada 13 kromosom.2 bahwa perkawinan resiprok untuk gen rangkai kelamin tak sempurna akan memberikan hasil yang sama seperti halnya hasil yang diperoleh dari perkawinan resiprok untuk gen-gen autosomal. Sistem XO Sistem XO dijumpai pada beberapa jenis serangga. Sistem Penentuan Jenis Kelamin Telah disebutkan di atas bahwa pada manusia dan mamalia. Diagram pewarisan gen rangkai kelamin tak sempurna Dapat dilihat pada Gambar 6.2. Dengan demikian. Wilson menemukan bahwa sel somatis serangga Protenor betina mempunyai 14 kromosom. individu betina memiliki dua buah kromosom X sementara individu jantan hanya mempunyai sebuah kromosom X.B. mengikuti sistem ZW.

betina triploid dan tetraploid.33 betina metabetina metabetina betina 4n betina 3n interseks interseks jantan metajantan Jika kita perhatikan kolom pertama pada Tabel 6. Adanya kromosom X yang didapatkan melebihi jumlah kromosom X pada individu normal (diploid) ini disebabkan oleh terjadinya peristiwa yang dinamakan gagal pisah (non disjunction).2 3 4 4 3 3 2 2 1 2 2 3 4 3 4 3 4 3 1 1. Partenogenesis . yakni individu dengan jenis kelamin metabetina. P: E AAXX x AAXY G gagal pisah gamet : F1 : AXX AO AX AAXXY AY AAXO letal AAOY AAXXX betina betina super jantan steril Gambar 6. serta interseks.67 0.75 0.3. yaitu gagal berpisahnya kedua kromosom X pada waktu pembelahan meiosis. Dalam hal ini ada sel yang menerima dua kromosom X tetapi ada pula yang hanya menerima satu kromosom X. Lalat ini dikatakan mengalami mozaik seksual atau biasa disebut dengan istilah ginandromorfi.33 1 1 0.1 akan terlihat bahwa ada beberapa individu yang jumlah kromosom X-nya lebih dari dua buah.5 0. Penyebabnya adalah ketidakteraturan distribusi kromosom X pada masa-masa awal pembelahan mitosis zigot. Diagram munculnya beberapa individu abnormal pada Drosophila akibat peristiwa gagal pisah Di samping kelainan-kelainan tersebut pernah pula dilaporkan adanya lalat Drosophila yang sebagian tubuhnya memperlihatkan sifat-sifat sebagai jenis kelamin jantan sementara sebagian lainnya betina.3. Pada Drosophila terjadinya gagal pisah dapat menyebabkan terbentuknya beberapa individu abnormal seperti nampak pada Gambar 6.5 1.

tetapi didasarkan atas keberadaan gen tertentu. Jagung normal monosius (berumah satu) mempunyai gen Sk. Jagung sksktsts berjenis kelamin betina karena ts dapat mengatasi pengaruh sk. wanita normal mempunyai sebuah . misalnya sel epitel selaput lendir mulut. Jagung monosius ini mempunyai fenotipe Sk_Ts_. Barr. berkembang dari telur yang dibuahi sehingga perangkat kromosomnya adalah diploid. Oleh karena itu. alel-alel resesif sk dan ts masing-masing menghalangi pembentukan bunga betina dan mensterilkan bunga jantan. M. Selanjutnya diketahui bahwa banyaknya kromatin kelamin ternyata sama dengan banyaknya kromosom X dikurangi satu. atau dengan perkataan lain. sistem tersebut masih ada kaitannya dengan jumlah perangkat kromosom. Pada jagung dikenal sistem penentuan jenis kelamin yang tidak bergantung. Struktur semacam ini ternyata tidak dijumpai pada sel-sel kucing jantan. jagung dengan fenotipe Sk_tsts adalah betina diosius (berumah dua). Sementara itu. bunga betina tetap terbentuk seakan-akan tidak ada alel sk. dan tawon. Sebaliknya. Pada manusia dilaporkan pula bahwa sel-sel somatis pria. individu betina dan golongan pekerja. individu jantan berkembang dengan cara partenogenesis. dapat dikatakan bahwa partenogenesis merupakan sistem penentuan jenis kelamin yang tidak ada sangkut pautnya sama sekali dengan kromosom kelamin tetapi hanya bergantung kepada jumlah genom (perangkat kromosom). dan gen Ts. Baltzer menemukan bahwa cacing Bonellia yang berasal dari sebuah telur yang diisolasi akan berkembang menjadi individu betina. Sementara itu. cacing yang hidup di lingkungan betina dewasa akan mendekati dan memasuki saluran reproduksi cacing betina dewasa tersebut untuk kemudian berkembang menjadi individu jantan yang parasitik. dapat dibedakan dengan sel somatis wanita atas dasar ada tidaknya struktur tertentu yang kemudian dikenal dengan nama kromatin kelamin atau badan Barr. F. Hal ini misalnya dijumpai pada cacing laut Bonellia. sedang jagung skskTs_ adalah jantan diosius.. lebah. Kromatin Kelamin Seorang ahli genetika dari Kanada. Sistem gen Sk-Ts Di atas disebutkan bahwa sistem penentuan jenis kelamin pada lebah tidak berhubungan dengan kromosom kelamin. Dengan demikian. pada tahun 1949 menemukan adanya struktur tertentu yang dapat memperlihatkan reaksi pewarnaan di dalam nukleus sel syaraf kucing betina. yang mengatur pembentukan bunga betina. yaitu melalui telur yang tidak dibuahi. Jadi.Pada beberapa spesies Hymenoptera seperti semut. khususnya pada lebah. yang mengatur pembentukan bunga jantan. individu jantan ini hanya memiliki sebuah genom atau perangkat kromosomnya haploid. yang jenis kelaminnya semata-mata ditentukan oleh faktor lingkungan. Oleh karena itu. baik kepada kromosom kelamin maupun jumlah genom.L. Pengaruh lingkungan Sistem penentuan jenis kelamin bahkan ada pula yang bersifat nongenetik. Pada sel somatis wanita terdapat sebuah kromatin kelamin sementara sel somatis pria tidak memilikinya. Meskipun demikian.

Hipotesis ini dilandasi hasil pengamatannya atas ekspresi gen rangkai X yang mengatur warna bulu pada mencit.kromatin kelamin karena kromosom X-nya ada dua. bersifat dominan pada domba betina tetapi resesif pada domba jantan. yaitu sebagai penghasil sel kelamin (gamet) dan sebagai penghasil hormon kelamin. Sementara itu. Lyon. Hal ini menunjukkan bahwa hanya ada satu kromosom X yang aktif di antara kedua kromosom X pada individu betina. seorang ahli genetika dari Inggris mengajukan hipotesis bahwa kromatin kelamin merupakan kromosom X yang mengalami kondensasi atau heterokromatinisasi sehingga secara genetik menjadi inaktif. Sebaliknya. Pria dengan kelainan kromosom kelamin. mempunyai sebuah kromatin kelamin yang seharusnya tidak dimiliki oleh seorang pria normal. sistem hormon akan mengatur kondisi fisiologi dalam tubuh individu sehingga mempengaruhi perkembangan sifat kelamin sekunder. Individu betina heterozigot memperlihatkan fenotipe mozaik yang jelas berbeda dengan ekspresi gen semidominan (warna antara yang seragam). Sebagai contoh.2. dan kelenjar adrenalin. testes. pria normal tidak mempunyai kromatin kelamin karena kromosom X-nya hanya satu. Mekanisme kompensasi dosis diusulkan karena adanya fenomena bahwa suatu gen rangkai X akan mempunyai dosis efektif yang sama pada kedua jenis kelamin. Hipotesis Lyon juga menjelaskan adanya mekanisme kompensasi dosis pada mamalia. gen rangkai X pada individu homozigot akan diekspesikan sama kuat dengan gen rangkai X pada individu hemizigot. Dewasa ini keberadaan kromatin kelamin sering kali digunakan untuk menentukan jenis kelamin serta mendiagnosis berbagai kelainan kromosom kelamin pada janin melalui pengambilan cairan amnion embrio (amniosentesis). Selanjutnya. Sebaliknya. kelenjar adrenalin menghasilkan steroid yang secara kimia berhubungan erat dengan gonad. wanita penderita sindrom Turner (XO) tidak mempunyai kromatin kelamin yang seharusnya ada pada wanita normal. Dengan perkataan lain. untuk dapat bertanduk domba betina harus mempunyai dua gen H (homozigot) sementara domba jantan cukup dengan satu gen H (heterozigot). misalnya penderita sindrom Klinefelter (XXY). Pada hewan tingkat tinggi dan manusia hormon kelamin disintesis oleh ovarium. gen autosomal H yang mengatur pembentukan tanduk pada domba akan bersifat dominan pada individu jantan tetapi resesif pada individu betina. alelnya h. Gen terpengaruh kelamin Gen terpengaruh kelamin (sex influenced genes) ialah gen yang memperlihatkan perbedaan ekspresi antara individu jantan dan betina akibat pengaruh hormon kelamin. Oleh karena itu. Ovarium dan testes masing-masing mempunyai fungsi ganda. Kromosom X yang aktif pada suatu sel mungkin membawa gen dominan sementara pada sel yang lain mungkin justru membawa gen resesif. Demikian pula. Ekspresi gen terpengaruh kelamin pada domba . Tabel 6. Mary F. Hormon dan Diferensiasi Kelamin Dari penjelasan mengenai berbagai sistem penentuan jenis kelamin organisme diketahui bahwa faktor genetis memegang peranan utama dalam ekspresi sifat kelamin primer.

sedang wanita heterozigot akan normal. yang dengan sendirinya hanya dapat diekspresikan pada individu betina. 10/31/2009 Posted by zaifbio | Genetika Dasar | 7 Komentar BERANGKAI BAB V BERANGKAI     Dua Gen Berangkai dan Pindah Silang Tiga Gen Berangkai dan Pindah Silang Ganda Pemetaan Kromosom Pemetaan Kromosom pada Manusia BAB V. dan juga kombinasi gen K dengan gen b. Jika kembali kita perhatikan persilangan dihibrid menyangkut pewarisan warna biji dan bentuk biji. Gen B dominan pada pria tetapi resesif pada wanita. individu jantan dengan genotipe tertentu sebenarnya juga mempunyai potensi untuk menghasilkan keturunan dengan produksi susu yang tinggi sehingga keberadaannya sangat diperlukan dalam upaya pemuliaan ternak tersebut. pria heterozigot akan mengalami kebotakan. Untuk dapat mengalami kebotakan seorang wanita harus mempunyai gen B dalam keadaan homozigot. Gen yang hanya dapat diekspresikan pada salah satu jenis kelamin dinamakan gen terbatasi kelamin (sex limited genes).Genotipe HH Hh hh Domba jantan bertanduk bertanduk tidak bertanduk Domba betina bertanduk tidak bertanduk tidak bertanduk Contoh lain gen terpengaruh kelamin adalah gen autosomal B yang mengatur kebotakan pada manusia. . Oleh karena peluang terjadinya kombinasi-kombinasi tersebut sama besar. Sebaliknya. Gen terbatasi kelamin Selain mempengaruhi perbedaan ekspresi gen di antara jenis kelamin. BERANGKAI Percobaan-percobaan persilangan pada kacang ercis yang dilakukan oleh Mendel. Contoh gen semacam ini adalah gen yang mengatur produksi susu pada sapi perah. baik monohibrid maupun dihibrid. Namun. tetapi memungkinkan pula kombinasi gen resesif untuk warna biji (k) dengan gen resesif untuk bentuk biji (b). hormon kelamin juga dapat membatasi ekspresi gen pada salah satu jenis kelamin. telah menghasilkan dua hukum Mendel. serta gen k dengan gen B. Akibatnya. yakni hukum segegasi dan hukum pemilihan bebas. gen b dominan pada wanita tetapi resesif pada pria. maka akan terlihat bahwa gamet-gamet yang terbentuk tidak hanya mengandung kombinasi gen dominan untuk warna biji (K) dengan gen dominan untuk bentuk biji (B).

Adanya perbedaan jumlah di antara macam gamet yang terbentuk tersebut disebabkan oleh kecenderungan gen-gen berangkai untuk selalu berada bersama-sama. Artinya.H. maka nisbah gamet AB : Ab : aB : ab menjadi 1 : n : n : 1. Muller. dan ab dengan nisbah n : 1 : 1 : n. Artinya. barangkali Mendel tidak akan berhasil merumuskan hukum pemilihan bebas. Jadi. Gen pengatur warna biji terletak pada kromosom 1. kB. Dalam hal ini n merupakan bilangan positif dengan nilai lebih dari satu. dalam keadaan gen dominan berangkai dengan gen resesif. Bridges. yang sebagian besar melibatkan karya Morgan dan para mahasiswanya seperti C.maka keempat macam gamet yang dihasilkan. dan juga pada setiap spesies organisme lainnya. sedang gen pengatur bentuk biji terletak pada kromosom 7. juga berangkai pada kromosom homolognya. gamet yang mengandung kombinasi gen dominanresesif akan lebih banyak jumlahnya daripada gamet dengan kandungan gen sesama dominan dan sesama resesif.B. jika gen A berangkai dengan gen b. pola segregasi dan rekombinasinya tidak bebas sehingga tiap macam gamet yang dihasilkannya pun menjadi tidak sama jumlahnya. Kb. a dan b. dan gen a berangkai dengan gen B. jauh lebih banyak daripada jumlah kromosomnya. Baru sekitar lima tahun kemudian seorang ahli genetika dan embriologi dari Amerika Serikat. akan menjadi pokok bahasan pada Bab V ini. kalau gen-gen yang berangkai adalah sesama dominan dan sesama resesif. maka gamet-gamet yang dihasilkan akan terdiri atas AB. sedang fenomenanya sendiri dinamakan berangkai (linkage). Demikian pula. Ab. Seandainya gen pengatur warna biji dan gen pengatur bentuk biji terletak pada kromosom yang sama.Bateson dan R.C Punnet pada tahun 1906. yaitu KB. Inilah keuntungan lain yang diperoleh Mendel di samping secara kebetulan tanaman yang digunakan adalah diploid. dan A. aB. Fenomena berangkai pertama kali ditemukan pada percobaan dihibrid oleh W. T. dan kb. . Morgan. maka gamet yang mengandung gen-gen dominan dan gamet yang mengandung gen-gen resesif akan dijumpai lebih banyak daripada gamet dengan kombinasi gen dominan-resesif. mereka tidak dapat memberikan interpretasi terhadap hasil persilangan yang diperoleh. Gen-gen yang terdapat pada kromosom yang sama dinamakan gen-gen berangkai (linked genes). jika gen A dan gen B berangkai pada suatu kromosom sementara alel-alel resesifnya. dapat menjelaskan mekanisme pewarisan gen-gen berangkai pada lalat Drosophila melanogaster. Dari konsep mengenai berangkai ini selanjutnya berkembang pengetahuan mengenai pindah silang (crossing over) dan pemetaan kromosom. Sebaliknya.J. H. Seluk-beluk mengenai gen-gen berangkai. Akan tetapi. Dua Gen Berangkai Dua buah gen yang berangkai akan mengalami segregasi dan rekombinasi dengan pola yang tidak mengikuti hukum Mendel. Gen-gen yang mengatur warna biji dan bentuk biji dewasa ini telah diketahui letaknya masing-masing. termasuk cara memetakannya pada kromosom tempat mereka berada. Sebagai contoh. akan mempunyai nisbah 1 : 1 : 1 : 1. Sturtevant. Saat ini kita telah mengetahui bahwa banyaknya gen pada kacang ercis.H. di dalam sebuah kromosom tertentu dapat dijumpai lebih dari sebuah gen.

Baik pada kedudukan sis maupun trans terdapat dua macam gamet. Gamet tipe parental mempunyai susunan gen yang sama dengan susunan gen pada individu. Sebaliknya. Dua gen yang berangkai cenderung untuk selalu bersama-sama atau tidak bersegregasi di dalam gametgamet yang terbentuk.b) dan 5. maka kedudukannya dinamakan trans atau repulsion phase.a) memperlihatkan pola segregasi dan rekombinasi gen-gen yang terjadi secara bebas karena keduanya tidak berangkai. yang masing-masing disebut sebagai gamet tipe parental dan gamet tipe rekombinasi. Gamet yang terbentuk dari individu dihibrid a) Kedua gen tidak berangkai b) Kedua gen berangkai dengan kedudukan sis c) Kedua gen berangkai dengan kedudukan trans Kedudukan Dua Gen Berangkai Kalau kita perhatikan lagi Gambar 5.1.1.c). .1. Jadi. misalnya. Pada Gambar 5. Sementara itu. ditulis sebagai AB/ab jika kedua gen tersebut berangkai dengan kedudukan sis.1 di bawah ini secara skema dapat diperbandingkan tiga kemungkinan segregasi dan rekombinasi gen-gen pada individu dihibrid AaBb. individu dihibrid AaBb akan menghasilkan gamet tipe parental AB dan ab serta gamet tipe rekombinasi Ab dan aB jika kedua gen tersebut berangkai dengan kedudukan sis. penulisan AaBb hanya digunakan apabila kedua gen tersebut tidak berangkai. Kedudukan gen berangkai semacam ini dinamakan sis atau coupling phase.Untuk lebih jelasnya pada Gambar 5. dan ditulis sebagai Ab/aB jika kedudukan berangkainya adalah trans. Individu dihibrid AaBb.b) gen dominan A berangkai dengan gen dominan B dan gen resesif a berangkai dengan gen resesif b. sedang gamet tipe rekombinasi susunan gennya merupakan rekombinasi susunan gen pada individu. A a gamet : A A a a a) B b B b 1 1 1 1 A a A a b) B b b B c) n n 1 1 A a A a b B B b n n 1 1 B b A a B b A a b B Gambar 5.1. Gambar 5.c) tampak bahwa segregasi dan rekombinasi kedua gen tidak terjadi secara bebas.1. jika gen dominan berangkai dengan gen resesif seperti pada Gambar 5. Jadi.1. akan tampak bahwa dua buah gen yang berangkai dapat berada pada dua macam kedudukan atau konfigurasi yang berbeda.1. Kedudukan gen berangkai harus tercerminkan pada notasi individu yang bersangkutan. pada Gambar 5.

Dari pengertian pindah silang tersebut kita dapat menyederhanakan batasan tentang gamet tipe parental dan gamet tipe rekombinasi. Terjadinya segregasi dan rekombinasi dua buah gen berangkai ini tidak lain karena mereka mengalami peristiwa yang dinamakan pindah silang (crossing over). Gamet tipe parental jumlahnya selalu lebih besar atau setidak-tidaknya sama dengan jumlah gamet tipe rekombinasi. maka jarak antara kedua gen berangkai tersebut dikatakan sama dengan 20% atau 20 satuan peta atau 20 Morgan. sedang gamet tipe rekombinasi berkisar dari 0% hingga 50%. Seperti telah dijelaskan. yaitu pertukaran materi genetik (gen) di antara kromosom-kromosom homolog. gamet tipe parental jumlahnya berkisar dari 50% hingga 100%. Sturtevant digunakan untuk menggambarkan jarak fisik antara dua gen berangkai. gamet tipe rekombinasi oleh A. jika kedua gen tersebut berangkai dengan kedudukan trans. Jika gamet tipe parental sama banyaknya dengan gamet tipe rekombinasi (masing-masing 50% atau nisbah gamet = 1 : 1 : 1 : 1). Sebagai contoh. Setiap satuan peta ditetapkan sebagai jarak antara dua gen berangkai yang dapat menghasilkan gamet tipe rekombinasi sebanyak 1%. di antara keduanya masih terdapat pula kemungkinan untuk mengalami segregasi dan rekombinasi sehingga akan diperoleh kombinasi gen-gen seperti yang dijumpai pada gamet tipe rekombinasi. Di sisi lain jarak antara dua gen berangkai dapat mencapai lebih dari 100%. Makin panjang jarak antara dua gen berangkai. atau persentase. maka hal ini berarti kedua gen tidak berangkai. bersama-sama dengan pemilihan bebas (hukum Mendel II). jika semua gamet yang ada merupakan gamet tipe parental. seleksi alam akan bekerja untuk mempertahankan . Di atas nilai ini peningkatan jarak tidak terus-menerus diikuti oleh peningkatan persentase gamet tipe rekombinasi. Besar kecilnya jumlah. sedang gamet tipe rekombinasi adalah gamet hasil pindah silang. gamet tipe rekombinasi jumlahnya paling banyak hanya 50%. Akan tetapi. Dengan perkataan lain. sedang gamet tipe rekombinasi adalah gamet yang susunan gennya merupakan rekombinasi susunan gen pada individu. merupakan mekanisme penting yang mendasari pembentukan keanekaragaman genetik karena kedua-duanya akan menghasilkan kombinasi baru di antara gen-gen yang terdapat pada individu sebelumnya. Di atas telah dikatakan bahwa gamet tipe parental adalah gamet dengan susunan gen yang sama dengan susunan gen pada individu. misalnya jarak terpanjang antara dua gen berangkai pada kromosom 1 tanaman jagung yang mencapai 161%. maka kedua gen dikatakan mempunyai loki (tempat gen pada kromosom) yang sangat berdekatan. Sebenarnya hubungan linier antara jarak dua gen berangkai dan persentase gamet tipe rekombinasi hanya berlaku lebih kurang hingga nilai 20%. Sebaliknya. Selanjutnya. Sekarang dengan lebih mudah dapat kita katakan bahwa gamet tipe parental adalah gamet bukan hasil pindah silang. jika suatu individu dihibrid dengan gen-gen yang berangkai menghasilkan gamet tipe parental sebanyak 80% atau gamet tipe rekombinasi sebanyak 20%. makin besar persentase gamet tipe rekombinasi yang dihasilkan.Kebalikannya. atau dengan perkataan lain sama sekali tidak terdapat gamet tipe rekombinasi. maka gamet tipe parentalnya adalah Ab dan aB sementara gamet tipe rekombinasinya adalah AB dan ab.H. Peristiwa pindah silang. Pindah Silang Telah disebutkan bahwa dua buah gen yang berangkai akan cenderung untuk tetap bersamasama di dalam gamet yang terbentuk.

Dengan adanya miselium haploid inilah. . Pola askus A b A a a a B B b B a B a B binasi A b A b A b 100% rekom- Meiosis I Mitosis a) Meiosis II. Secara skema bukti yang menujukkan bahwa pindah silang terjadi pascaduplikasi kromosom dapat dilihat pada Gambar 5.genotipe-genotipe dengan kombinasi gen yang adaptif saja. Oleh karena itulah. Kapang ini sangat cocok untuk keperluan analisis genetik terutama karena dalam fase reproduksi aseksualnya terdapat askosopra haploid yang akan mengalami pembelahan mitosis sehingga berkecambah dan tumbuh menjadi miselium multisel yang juga haploid. Selanjutnya. Pindah silang terjadi pascaduplikasi kromosom Pada profase I meiosis kedua kromosom homolog akan mengalami duplikasi menjadi empat buah kromatid (lihat Bab IV). banyak ilmuwan yang menganggap bahwa pindah silang dan pemilihan bebas sangat penting bagi berlangsungnya proses evolusi. keempat kromatid ini akan membentuk sinapsis yang dinamakan tetrad. Pada saat terbentuknya konfigurasi tetrad inilah pindah silang terjadi.2 di bawah ini. Bukti bahwa pindah silang terjadi sesudah kromosom homolog mengalami duplikasi diperoleh dari hasil analisis genetik pada percobaan menggunakan kapang Neurospora crassa. keberadaan gen-gen resesif dapat dideteksi karena ekspresinya tidak tertutup oleh gen dominan.

a) pindah silang terjadi sebelum kromosom mengalami duplikasi. Hasil pindah silang dilihat dari pola askus pada Neurospora crassa Pada Gambar 5. Hal ini jelas sesuatu yang tidak mungkin terjadi karena dari penjelasan sebelumnya kita mengetahui bahwa persentase gamet tipe rekombinasi berkisar dari 0 hingga 50%. Oleh karena kemungkinan pada Gambar 5.2. Tampak bahwa kedelapan askospora yang terbentuk terdiri atas dua macam.2.2. yaitu askospora yang berasal dari gamet tipe parental dan askosopra yang berasal dari gamet tipe rekombinasi.Pola askus parental A A a a a B B b b b a a B b a a B b A A B B A B A b A b rekombinasi parental Meiosis I Mitosis b) Meiosis II. maka dapat disimpulkan bahwa pindah silang terjadi setelah kromosom mengalami duplikasi. Persentase pindah silang menggambarkan jarak antara dua gen berangkai . Sebaliknya. Di antara askospora tipe parental masih dapat dibedakan lagi askopora dari parental pertama (AB) dengan askospora dari parental kedua (ab).b) ini masuk akal. Gambar 5.b) pindah silang terjadi sesudah kromosom mengalami duplikasi. Ternyata dilihat dari kedelapan askospora hasil pembelahan mitosis gamet dapat dipastikan bahwa keempat gamet yang dihasilkan seluruhnya merupakan gamet tipe rekombinasi atau sama sekali tidak ada gamet tipe parental.2. pada Gambar 5.

3. dapat terjadi tiga kemungkinan pindah silang. Ke tiga. Pertama. pindah silang terjadi antara A dan B sekaligus antara B dan C. Selain itu. gamet tipe rekombinasi merupakan gamet hasil pindah silang. ABc dan abC (hasil pindah silang II). Kemungkinan yang terakhir ini dinamakan pindah silang ganda (double crossing over). maka gamet tipe rekombinasi yang dihasilkan adalah Abc dan aBC (hasil pindah silang I). A a interval I B b interval II C c A A B B C C a a b b c c . Kalau kita misalkan bahwa kedudukan ketiga gen berangkai tersebut seperti pada Gambar 5. misalnya gen-gen dengan urutan A-B-C. gamet tipe rekombinasi yang dihasilkan ada tiga macam. ada juga gamet tipe parental. gamet tipe rekombinasi hasil pindah silang pada interval II. atau seperti disebutkan di atas. dan gamet tipe rekombinasi hasil pindah silang ganda. Dengan demikian. persentase gamet tipe rekombinasi sampai dengan batas tertentu (lebih kurang 20%) memperlihatkan korelasi positif dengan jarak fisik antara dua gen berangkai. serta AbC dan aBc (hasil pindah silang ganda).Peristiwa pindah silang akan menyebabkan terbentuknya gamet tipe rekombinasi. yaitu ABC dan abc. pindah silang terjadi antara B dan C atau pindah silang pada interval II. Sesuai dengan banyaknya macam pindah silang yang terjadi. Sementara itu. besarnya persentase pindah silang juga menggambarkan jarak fisik antara dua gen berangkai. yaitu gamet tipe rekombinasi hasil pindah silang pada interval I. pindah silang terjadi antara A dan B atau pindah silang pada interval I. Ke dua. Tiga Gen Berangkai Di antara tiga buah gen berangkai.

gamet dari individu ABC/abc dapat dibagi menjadi empat kelompok. Abbcc. yaitu A-B-C-. aaB-C-. Dengan demikian. gamet tipe parental dengan sendirinya paling besar persentasenya. ABC/abc tipe parental (persentasenya terbesar) abc/abc . Jika di antara ketiga gen tersebut tidak ada yang berangkai. aaB-cc. Sebagai contoh. jika gen A berangkai dengan gen B dan gen C. Bagaimana dengan gamet hasil pindah silang I dan gamet hasil pindah silang II ? Mana di antara kedua kelompok gamet tipe rekombinasi tersebut yang lebih besar persentasenya ? Jawabannya tentu saja bergantung kepada besarnya jarak A-B dan jarak B-C. adalah persilangan suatu individu dengan individu homozigot resesif. maka nisbah fenotipe yang dihasilkan tidak akan sama tetapi bergantung kepada jumlah tiap macam gamet individu trihibrid tersebut. Seperti pada penjelasan Gambar 5. seperti telah dijelaskan pada Bab II. dari individu homozigot resesif aabbcc (abc/abc) hanya akan dihasilkan satu macam gamet. maka gamet hasil pindah silang I lebih banyak daripada gamet hasil pindah silang II. fenotipe sekaligus genotipe hasil silang ujinya akan ada empat kelompok.3. Pindah silang di antara tiga gen berangkai Dari delapan macam gamet yang dihasilkan tersebut. dan aabbcc. gamet hasil pindah silang II akan dijumpai lebih banyak daripada gamet hasil pindah silang I jika jarak B-C lebih panjang daripada jarak A-B. yakni abc. A-B-cc. aabbC-. dengan nisbah 1 : 1 : 1 : 1 : 1 : 1 : 1 : 1. dan kelompok ke empat gamet hasil pindah silang ganda (AbC dan aBc). kelompok ke dua gamet hasil pindah silang di daerah I (Abc dan aBC). Jika A-B lebih panjang daripada B-C.3. sedang gamet yang paling kecil persentasenya adalah gamet tipe rekombinasi hasil pindah silang ganda. kelompok ke tiga gamet pindah silang di daerah II (ABc dan abC). A-bbC-. Kelompok pertama adalah gamet tipe parental (ABC dan abc). Sementara itu. individu trihibrid AaBbCc disilang uji dengan aabbcc. Silang uji terhadap individu trihibrid dinamakan silang uji tiga titik (three-point test cross). sesuai dengan nisbah gamet individu ABC/abc.A A B b C C a a B b c c Gambar 5. karena baik gamet tipe parental maupun rekombinasi akan mempunyai susunan gen yang sama. yang masing-masing terdiri atas dua macam fenotipe. Begitu pula sebaliknya. maka hasil persilangannnya ada delapan macam fenotipe. Silang Uji Tiga Titik Silang uji. Namun.

Sebagai contoh. pada prinsipnya pembuatan peta kromosom meliputi penentuan urutan gen pada satu kromosom dan penghitungan jarak antara gen yang satu dan lainnya. Kemudian. yaitu dua individu yang persentase atau jumlahnya terbesar (aBC dan Abc).4. pada lalat Drosophila melanogaster telah ditemukan adanya empat kelompok gen berangkai seperti dapat dilihat pada Gambar 5. kita cari . yang terdiri atas sederetan gen-gen dengan urutan dan jarak tertentu. Dengan demikian. misalnya. Langkah-langkah untuk membuat peta kromosom dari data hasil silang uji dapat dijelaskan dengan contoh berikut ini.Abc/abc tipe rekombinasi hasil pindah silang antara A dan B (persentasenya bergantung kepada posisi lokus B) aBC/abc ABc/abc tipe rekombinasi hasil pindah silang antara B dan C (persentasenya bergantung kepada posisi lokus B) abC/abc AbC/abc tipe rekombinasi hasil pindah silang ganda (persentasenya terkecil) aBc/abc Salah satu kromosom homolog pada tiap fenotipe/genotipe hasil silang uji tersebut di atas selalu membawa gen-gen dengan susunan yang sama. Keduanya dipasangkan menjadi aBC/Abc. Begitu juga untuk ketujuh genotipe lainnya penulisannya cukup seperti notasi gametnya saja. Pemetaan Kromosom Data hasil silang uji tiga titik dapat dimanfaatkan untuk membuat peta kromosom. Di dalam peta kromosom tiap kromosom disebut sebagai satu kelompok gen berangkai (linkage group). ABC = 265 ABc = 133 AbC = 6 aBC = 441 Abc = 435 aBc = 4 abC = 139 abc = 227 Untuk menentukan urutan gen yang benar pertama-tama kita cari individu tipe parental di antara kedelapan genotipe tersebut. Oleh karena itu. Jadi. yaitu abc. cukup ditulis dengan ABC. individu ABC/abc. biasanya notasi fenotipe/genotipe individu hasil silang uji untuk gen-gen berangkai sama dengan notasi untuk gametnya masing-masing.

misalnya menjadi BaC/bAc. individu parental harus kita ubah urutan gennya. Alternatif ke tiga (terakhir) adalah mengubah urutan gen pada individu parental menjadi aCB/Acb. 0 y (yellow body) 0 ci (cubitus interruptus eyes) w (whirte eyes) (bent wings) N (Notch wings) (shaven bristles) ec (echinus eyes) rb (ruby eyes) bo (bordeaux eyes) cv (crossveinless wings) ov (oval eyes) ct (cut wings) sn (singed bristles) ed (echinoid eyes) dp (dumpy wings) cl (clot eyes) spd (spade wings) lys (lysine accumulation) jv (javelin bristles) Hn (Henna eyes) fs(3) G2 (betina steril) Cy (Curly wings) net (net wings) 0 ru (roughoid eyes) 0 S (Star eyes) R (Roughened eyes) bt 3 sv IV t (tan body) ras (raspberry eyes) m (miniature wings) wy (wavy wings) g (garnet eyes) pl (pleated wings) tu-48 (abdominal tumors) fy (fuzzy hairs) corr (corrugated wings) J (Jammed wings) se (sepia eyes) cur (curvoid wings) rs (rose eyes) Gl (Glued eyes) st (scarlet eyes) b (black body) eg (eagle wings) .individu hasil pindah silang ganda. yang ternyata masih belum cocok juga dengan AbC/aBc. dapat disimpulkan bahwa urutan loki gen yang benar adalah A-C-B atau B-C-A. Oleh karena itu. Setelah hasil simuasi ini dicocokkan dengan individu psg yang ada ternyata susunan gennya tidak sama (abC/ABc tidak sama dengan AbC/aBc). Jika individu ini mengalami psg. yang ternyata cocok dengan AbC/aBc. Artinya. aBC/Abc disimulasi untuk mengalami psg menjadi abC/ABc. Ini juga kita pasangkan menjadi AbC/aBc. Individu parental disimulasi untuk mengalami pindah silang ganda (psg). yaitu dua individu yang jumlahnya terkecil (AbC dan aBc). Individu parental dengan urutan gen seperti ini (lokus C di tengah) jika mengalami psg akan menjadi acB/ACb. Dengan demikian. maka akan diperoleh BAC/bac.

4. Peta kromosom pada lalat Drosophila melanogaster = sentromir Kromosom I = kromosom kelamin .sd (scalloped wings) r (rudimentary wings) B (Bar eyes) car (carnation eyes) rd (reduced bristles) stw (straw bristles) cn (cinnabar eyes) che (cherub wings) cu (curly wings) bx (bithorax body) sr (stripe body) bb (bobbed bristles) 68 I c (curved wings) Amy (Amylase) rf (roof wings) nw (narrow wings) vg (vestigial wings) U (Upturmed wings) Dl (Delta wings) e (ebony body) cd (cardinal eyes) obt (obtuse wings) dsr (disrupted wings) hy (humpy body) ra (rase britles) a (arc wings) Frd (Freckled body) M(2)c (Minute body) 106 108 II Pr (Prickly bristles) r sd (raised wings) ca (claret eyes) M(3)g (Minute body) III Gambar 5.

Jadi.6% / 5. interferensi ini menunjukkan bahwa pindah silang di suatu tempat akan menghalangi terjadinya pindah silang di dekatnya. Muller pada tahun 1916. Dengan demikian.4% x 17. yang masing-masing sama dengan persentase pindah silang di antara kedua gen yang diukur jaraknya (ingat ! besarnya persentase pindah silang menggambarkan jarak fisik antara dua gen berangkai). Derajad interferensi secara kuantitatif diukur dengan suatu nilai yang disebut koefisien koinsidensi (KK). Sebaliknya. dan dinamakan interferensi kromosom atau interferensi kiasma. acB.4% Interferensi Kromosom Pada contoh soal tersebut di atas terlihat bahwa banyaknya individu hasil pindah silang ganda ada (4 + 6) / 1650 x 100% = 0. 17. nilai KK = 0 menunjukkan bahwa dua peristiwa pindah silang yang berurutan benar-benar saling menghalangi.1%. Nilai KK berkisar dari 0 hingga 1. seperti telah dijelaskan sebelumnya. sedang jarak C-B sama dengan pindah silang antara C dan B. jarak A-C sama dengan pindah silang antara A dan C. maka secara teori besarnya persentase pindah silang ganda seharusnya sama dengan hasil kali masing-masing pindah silang (lihat teori peluang pada Bab II). Oleh karena itu. pindah silang ganda adalah dua peristiwa pindah silang yang terjadi bersama-sama pada dua daerah yang berurutan. data hasil silang uji tersebut di atas diubah urutan gennya sehingga menjadi ACB = 265 AcB = 133 ACb = 6 aCB = 441 Acb = 435 acB = 4 aCb = 139 acb = 227 Selanjutnya.J. kita dapat menghitung jarak antara dua gen berurutan (A-C dan C-B).2% = 0.1% = 5.Mutan yang diawali dengan huruf besar = mutan dominan Setelah urutan gen yang benar diketahui.6%. Jadi.1% C B . Sementara itu.12. dan ACb. A 30. Nilai KK = 1 menggambarkan adanya independensi yang sempurna di antara dua peristiwa pindah silang yang berurutan sehingga psg O sama besarnya dengan psg E. Biasanya psg O lebih kecil daripada psg E.4%. jarak A-C = (227 + 265 + 4 + 6) / 1650 x 100% = 30. Pada soal tersebut di atas persentase pindah silang ganda yang diharapkan atau seharusnya terjadi (psg E) sama dengan 30. AcB. dan pada contoh soal di atas nilai KK = 0. Nilai ini merupakan persentase pindah silang ganda yang benar-benar terjadi (psg O). yang merupakan nisbah psg O terhadap psg E.2%. maka individu hasil pindah silang antara A dan C terdiri atas acb. Fenomena ini pertama kali ditemukan oleh H. ACB. acB. Namun. dan ACb. Oleh karena individu parentalnya aCB/Acb. individu hasil pindah silang antara C dan B masingmasing aCb. Seandainya kedua pindah silang ini benar-benar independen satu sama lain. sehingga jarak C-B = (139 + 133 + 4 + 6) / 1650 x 100% = 17. nilai KK berbanding terbalik dengan besarnya interferensi.

Tabel 5.1. nilai KI juga berkisar dari 0 hingga 1 tetapi berbanding lurus dengan besarnya interferensi. frekuensi fusi tersebut dapat ditingkatkan dengan penambahan sejenis virus. dapat disimpulkan bahwa gen yang mengatur sintesis timidin kinase terletak pada kromosom nomor 17.1. Barski dan koleganya pada tahun 1960 untuk menggabungkan sel somatis mencit dengan sel somatis manusia secara in vitro. frekuensi fusi dapat juga ditingkatkan dengan pemberian bahan kimia polietilen glikol. Teknik hibridisasi sel somatis pertama kali digunakan oleh G. Selain dengan virus Sendai. kedua pindah silang makin independen sehingga makin kecil interferensinya. Sebagai contoh. Dengan adanya variasi jumlah kromosom manusia pada sel hibrid. Pada tahun 1960-an terjadi kemajuan yang pesat dalam pembuatan peta kromosom pada manusia berkat ditemukannya suatu teknik yang dikenal sebagai hibridisasi sel somatis. Terlihat bahwa kromosom 17 merupakan satu-satunya kromosom yang keberadaannya berkorelasi positif dengan aktivitas timidin kinase. Sel hibrid yang terbentuk kemudian mengalami pembelahan mitosis sehingga dihasilkan sejumlah besar sel hibrid. Pemetaan Kromosom pada Manusia Pada manusia dengan sendirinya tidak dapat dilakukan pembuatan peta kromosom menggunakan data hasil silang uji. makin besar KI. Data hibridisasi sel somatis Nomor Aktivitas Kromosom manusia .Makin besar KK. yakni virus Sendai. kedua pindah silang makin menghalangi satu sama lain atau makin besar interferensinya. Cara yang sama digunakan untuk menentukan bahwa pada suatu kromosom terdapat gen-gen tertentu. yang telah diinaktifkan dengan radiasi ultraviolet. Artinya. Sejalan dengan penemuan ini berkembang pula teknik sitologi yang memungkinkan dilakukannya identifikasi kromosom dan segmen kromosom manusia. keberadaan gen yang mengatur sintesis enzim timidin kinase dapat diketahui dari data seperti pada Tabel 5. diperlukan cara lain untuk dapat mengetahui susunan gen pada suatu kromosom tertentu. Dengan demikian. yang nilainya sama dengan 1 – KK. Dalam hal ini kromosom 17 selalu dijumpai pada setiap sel hibrid yang memperlihatkan aktivitas timidin kinase dan tidak dijumpai pada sel hibrid yang tidak memperlihatkan aktivitas enzim tersebut. Cara yang paling lama dikenal adalah analisis silsilah keluarga dengan mengamati pola pewarisan suatu sifat. Namun. yaitu sekitar satu di antara sejuta sel. Oleh karena itu. Penggabungan (fusi) sel ini berlangsung dengan tingkat keberhasilan yang sangat rendah. Dengan demikian. Bahkan dewasa ini teknik DNA rekombinan dapat digunakan untuk isolasi dan identifikasi keberadaan masingmasing gen di dalam molekul DNA kromosom. Di antara sel-sel hibrid hasil mitosis ini selalu terjadi pengurangan jumlah kromosom manusia sementara jumlah kromosom mencitnya tetap. Untuk menggambarkan derajad interferensi dapat pula digunakan koefisien interferensi (KI). dapat ditentukan keberadaan gen tertentu pada suatu kromosom atas dasar aktivitas enzim yang dihasilkan.

– = tidak ada) X Y 1 2 4 7 + + + + + + + + + + + + + + - 9 + + + 10 + + - 15 + + + 17 + + + + - 18 + - 21 + + - 10/31/2009 Posted by zaifbio | Genetika Dasar | 5 Komentar GENOM ORGANISME .sel hibrid 1 2 3 4 5 timidin kinase aktif aktif aktif aktif tidak aktif (+ = ada.

Jadi. Oleh karena gen terdapat di dalam kromosom. masing-masing pasangan gen tersebut merupakan satuan-satuan herediter yang terpisah satu sama lain. Begitu juga. sejumlah sifat lainnya diatur oleh pasangan-pasangan gen tersendiri. hukum Mendel II (pemilihan bebas) hanya mengemukakan bahwa segregasi pasangan gen yang satu tidak bergantung kepada segregasi pasangan gen lainnya. ketika itu belum dapat diungkapkan mekanisme transmisi gen dari satu generasi ke generasi berikutnya. Morgan dan koleganya. Dalam hukum Mendel I (segregasi) hanya disebutkan bahwa tiap pasangan gen akan dipisahkan ke dalam gamet-gamet yang terbentuk. sifat tinggi tanaman kacang ercis diatur oleh pasangan gen D dan d. Meskipun demikian. Beberapa tahun kemudian barulah diketahui bahwa gen terdapat di dalam struktur intranukeus yang dinamakan kromosom (chromo=warna . khususnya selama .H. maka untuk mempelajari mekanisme transmisi gen perlu dilakukan pengamatan terhadap perilaku kromosom. T. Sebagai contoh.BAB III GENOM ORGANISME    Pengertian Genom Struktur Kromosom Jumlah Kromosom BAB III. sedangkan bentuk bijinya diatur oleh pasangan gen W dan w. GENOM ORGANISME Analisis hasil percobaan persilangan yang dilakukan oleh Mendel telah memberikan pemahaman bahwa satuan-satuan herediter yang mengatur pemunculan sifat atau fenotipe individu bersifat diskrit (terpisah satu sama lain). melalui studi pada lalat buah Drosophila melanogaster mengajukan konsep bahwa gen merupakan satuan-satuan diskrit (terpisah satu sama lain) di dalam kromosom. Demikian pula. soma=badan). rekombinasi gen akan berlangsung pada saat terjadi penggabungan gamet jantan dengan gamet betina melalui perkawinan. Salah satu kelompok peneliti. Selanjutnya.

Genom/kromosom prokariot Berbeda dengan genom prokariot. baik pada prokariot maupun pada eukariot. Namun. kromosom eukariot mempunyai bentuk linier.4 (Bab V). Sementara itu. atau dikatakan mempunyai genom diploid.berlangsungnya pembelahan sel (lihat Bab IV). jumlah kromosom ini tidak ada kaitannya dengan ukuran atau kompleksitas biologi suatu organisme. Gambar 3. yang ditempati oleh suatu gen disebut sebagai lokus (jamak: loki) bagi gen tersebut. genom suatu organisme adalah kumpulan semua gen yang dimiliki oleh organisme tersebut pada setiap selnya. Kromosom ini berbentuk lingkaran (sirkuler). Dengan perkataan lain. Contoh deretan lokus sejumlah gen di dalam suatu kromosom eukariot dapat dilihat pada Gambar 5. Lalu bagaimanakah hubungan antara genom dan kromosom? Organisme prokariot seperti bakteri diketahui hanya mempunyai sebuah kromosom yang tidak dikemas di dalam suatu nukleus sejati. Oleh karena itu. yang menampilkan peta kromosom pada lalat D. Posisi di dalam kromosom. Tiap kromosom membawa sederetan gen tertentu. Jumlah kromosom dasar di dalam genom haploid pada umumnya berbeda-beda antara satu spesies dan spesies lainnya. Pengertian Genom Secara keseluruhan kumpulan gen-gen yang terdapat di dalam setiap sel individu organisme disebut sebagai genom. Kebanyakan spesies mempunyai 10 hingga 40 . melanogaster. dan semua gen tersusun di sepanjang lingkaran tersebut. genom eukariot tersusun dari beberapa buah kromosom. Sel-sel kelamin (gamet) pada manusia merupakan contoh sel yang mempunyai seperangkat kromosom haploid. genom organisme prokariot dikatakan hanya terdiri atas sebuah kromosom tunggal (lihat juga Bab XII). Selain itu. Jumlah kromosom dasar di dalam genom suatu organisme eukariot (biasa dilambangkan dengan n) dikatakan sebagai jumlah kromosom haploid (lihat juga Bab VII). sel-sel lainnya (sel somatis) hampir selalu mempunyai dua buah genom. Pada Bab III ini hanya akan dibahas sekilas kedudukan gen di dalam kromosom. atau berarti hanya mempunyai sebuah genom. Genom Eukariot Di atas telah disinggung bahwa genom eukariot terdiri atas beberapa buah kromosom.1.

1). Tabel 3.1. Jumlah kromosom pada genom haploid beberapa spesies organisme eukariot Spesies organisme Jumlah kromosom haploid (n) 16 7 17 10 21 12 6 11 5 4 3 18 6 14 25 17 39 20 36 24 23 Eukariot sederhana Saccharomyces cerevisiae Neurospora crassa Chlamydomonas reinhardtii Tumbuhan Zea mays Triticum aestivum Lycopersicon esculentum Vicia faba Sequoia sempivirens Arabidopsis thaliana Hewan avertebrata Drosophila melanogaster Anopheles culicifacies Asterias forbesi Caenorhabditis elegans Mytilus edulis Hewan vertebrate Esox lucius Xenopus laevis Gallus domesticus Mus musculus Felis domesticus Pan tryglodites Homo sapiens Pada organisme diploid kedua genom akan berpasangan pada setiap kromosom yang sesuai. sedangkan beberapa spesies paku-pakuan diketahui mempunyai beratus-ratus kromosom di dalam genom haploidnya. Muntjac. Artinya. hanya mempunyai tiga buah kromosom.buah kromosom di dalam genom haploidnya (Tabel 3. . Kromosom-kromosom yang berpasangan ini dinamakan kromosom homolog. Demikian seterusnya hingga pasangan kromosom yang ke-n. kromosom nomor 1 dari genom pertama akan berpasangan dengan kromosom nomor 1 pula dari genom kedua. sejenis rusa kecil dari Asia.

sedang lengan yang pendek p. bentuk metasentrik ini menghasilkan dua lengan kromosom yang kira-kira sama panjangnya. tiap gen yang terletak pada lokus tertentu di dalam suatu kromosom dapat berpasangan dengan gen yang sesuai pada kromosom homolognya. istilah-sitilah tersebut sangat berguna untuk memberikan gambaran fisik tentang kromosom.Dengan adanya kromosom-kromosom homolog. dan akrosentrik. Oleh karena itu. Terlebih penting lagi. Demikian pula. Klasifikasi struktur kromosom eukariot Kromosom eukariot. lalat Drosophila melanogaster mempunyai dua buah . Lengan yang panjang biasanya dilambangkan dengan huruf q. dan kedua lengan kromosom semakin jelas beda panjangnya. Bentuk yang ketiga. Sebagai contoh.2. Dilihat dari kedudukan sentromirnya. Bentuk submetasentrik menghasilkan dua lengan kromosom yang tidak sama panjangnya. dijumpai apabila sentromir terletak hampir di ujung kromosom sehingga memberikan kenampakan kromosom seperti huruf I. Klasifikasi struktur kromosom menjadi metasentrik. dikenal ada tiga macam struktur kromosom eukariot. submetasentrik. s s a) s b) c) Gambar 3. Sebagai contoh. Struktur kromosom ini dapat dilihat dengan jelas ketika pembelahan sel berada pada tahap anafase. Akan tetapi. maka akan didapatkan genotipe homozigot resesif. gen A (dominan) pada suatu kromosom dapat berpasangan dengan gen A pada kromosom homolognya sehingga terbentuk genotipe homozigot dominan untuk lokus tersebut. evolusi kromosom sering kali cenderung mempertahankan jumlah lengan kromosom tanpa mempertahankan jumlah kromosom. dan akrosentrik tadi sebenarnya agak dipaksakan. Struktur kromosom pada anafase a) metasentrik b) submetasentrik c) akrosentrik s = sentromir Pada metasentrik kedudukan sentromir lebih kurang berada di tengah-tengah kromosom sehingga memberikan kenampakan kromosom seperti huruf V. jika pada kedua kromosom homolog gen a berpasangan dengan gen a. akrosentrik. Sentromir adalah suatu daerah pada kromosom yang merupakan tempat melekatnya benang-benang spindel dari sentriol selama berlangsungnya pembelahan sel (Bab IV). Pada bentuk submetasentrik sentromir terletak di antara tengah dan ujung kromosom sehingga memberikan kenampakan kromosom seperti huruf J. ternyata dapat dikelompokkan menurut kedudukan sentromirnya. yang telah kita ketahui berbentuk linier. yaitu metasentrik. Jika pada kromosom yang satu terdapat gen A dan pada kromosom homolognya terdapat gen a. submetasentrik. maka akan diperoleh genotipe heterozigot.

Autosom adalah kromosom yang bentuknya sama pada kedua jenis kelamin (Bab VI). akan nampak bahwa tiap lengan kromosom metasentrik pada D. Letak sentromir berbeda-beda. Demikian juga.autosom metasentrik yang besar sementara banyak spesies Drosophila lainnya mempunyai empat autosom akrosentrik yang kecil. Tiap kromatid membawa sebuah molekul DNA yang strukturnya berupa untai ganda (Bab IX) sehingga di dalam kedua kromatid terdapat dua molekul DNA. Akan tetapi. Pada Bab X akan dijelaskan bahwa bagian-bagian tertentu molekul DNA merupakan gen-gen yang mengekspresikan fenotipenya masing-masing sehingga DNA dapat juga dilihat sebagai materi genetik. Jika peta kromosom kedua kelompok Drosophila ini dibandingkan. yang satu sama lain dihubungkan pada daerah sentromir. Bahan penyusun kromosom adalah DNA (asam deoksiribonukleat) dan protein. pada simpanse terdapat dua pasang autosom akrosentrik yang tidak ada pada manusia. Dalam hal ini. melanogaster sesuai dengan lengan panjang kromosom akrosentrik pada Drosophila lainnya itu. Sebaliknya. yakni pada tahap S di dalam daur sel (lihat Bab IV). telomir (ujung kromosom) sentromir (konstriksi primer) kinetokor kromatid kembar (sister chromatids) . manusia mempunyai sepasang autosom metasentrik yang tidak dimiliki oleh simpanse. terdiri atas dua buah kromatid kembar (sister chromatids). yaitu suatu protein struktural yang berperan dalam pergerakan kromosom selama berlangsungnya pembelahan sel. simpanse dan manusia sama-sama mempunyai 22 pasang autosom yang secara morfologi sangat mirip. masing-masing lengan metasentrik pada manusia homolog dengan lengan panjang akrosentrik pada simpanse. dan perbedaan letak ini dapat digunakan sebagai dasar untuk klasifikasi struktur kromosom seperti telah diuraikan di atas. Kromatid Kromosom yang sedang mengalami pengandaan. Pada sentromir terdapat kinetokor.

Gambaran umum struktur kromosom eukariot yang sedang mengalami penggandaan a) kromosom b) molekul DNA 10/31/2009 Posted by zaifbio | Genetika Dasar | 2 Komentar « Entri Sebelumnya SINOPSIS BLOG INI BERISI SEMUA MATERI TENTANG BIOLOGI DAN PENDIDIKAN YANG DIBUAT OLEH ORANG YANG HAUS AKAN ILMU DAN BERCITA-CITA TINGGI UNTUK MENJADI DOSEN DAN MEMAJUKAN ILMU PENGETAHUAN DIMANAPUN DIA BERADA DAN MENGABDI .a) b) Gambar 3.3.

3/03.9/97.5.03/03.550702-.8:3.9:7.7.4  $0.302:/.9202-7./..-08./.03-.39/.8.9.8//.9:8.380.3 88.2.3 9.5.8472430/.9:9.9.387580:.8...33/:840 .7809079039:203::0809.3:2.3  2# 8:507570.3/.9.9: 037#.3 57480842508.7/:.3802570.597.9-.9../.34489/.9907.7.9:70:.3.3...3503.73.39:3.9:  2#8..803 .251.3/7#/.80-:9:.3.947...3/-.8203.703.3.30.73.4-3.0.:39:20.3.7..3820 503.0-.3.3-07.9:20.8.32.7..9: 2#8:507570..9:7.9:8 7.3503.5.2705.037#3.7:/48803.75.:2.8 03.347.370. 47243/.5.3 .2:3 80.80  037#-07.28945.9..9:7./.9.0/.5.9.5.3. 425083907-039:-.251.780-.472430 /./..7490-:7.749 $0-.3/09.80/980.:-./.3 57490390780-:9./03./4-32.251.9:797../5033.3203. $02039.8.28:28:29:...3202-:9:.8 !02-039:.34489907.9.. 03.3/50740809.3:39:203.8.749.803.9202.803907.28:.3/9.3..2.80390780-:9.35748083.383908880:2.: -.2809.380:2.45   2#802570.3-0:2-0702-.3.7.9./.  .3.8897:9:72./.387580:.387584047243/2:..9/-.297.3/.9: 80203307 2.3.251.7.380 .9183.0380-.3/.749 2085:33.5...7503..78-08.803./.3//.33.10798./03.38..3-0:2907.3038943/.8  $.3.38758 07/.3/032/..2:3 503097.749 ./.8.:.9:503.-0-07.2..80380-03.3 203.80  ./80././..9./.3802025:3.8:.38090.9:3.2203./.7-:50780 40: 2#8.8.251.8.038090.-09:-.574..9:83.. 80 80570:78479/.387580:.3:39:705..32..40-07-...507:/.2025:3.203.3/02.8240: 240:7# !. 708543907.80.3:2.9//.. 09.2809.7 2#.4394 80 8007974-.9/:3.5.3 4489.9079039: $0-..8./.04254 ./3.80-0:2.:.-08.9  .390780/./3.38200:.9:. :9.948..89.709200.8 40:7#9/.03 /03.907-039:4250847243 70805947 $090.302:/.3.32033.802-. 830.9/.80:2.3.9.3.3/507:../:52# .709/.-08.2 3:0:8207:5.54070805947:8:8..3..29. 4443:2 207:5.507:-.308570803503.3 ..5../.20309..8.39:3.5.7570:78473.//.70805947.448990./.3 907/.3574808.3/.03503.3/03.8.83203.350702-.:0-7:29-.3/.397.9:850780 /..5.3.-0-07.78.7..33.8  !03...9:././.3.83 2.3 97.28.3 ::3.9/809.7574903..-08.34080 80570:7847.8.3:9.::5:39:839088240:90780-:9/.3 907.3.3//..50702-.3:2.3 90.3574903 897:9:7.3:2.3.032./..224/1.3-0..8-.303 .82.8 .709 0.::5-. .3203.3/03.39.3907/7../ 9.9:7./.3.032397.3  $.583.580 240:2#/.7839088574903 &39:9:/-:9:.3//07.-07..32025:3.3.2 :2.3/03.5...3.8.3 80:2.  ..  .77-4842 9.7-4842.:-07507.2 ::3.3.:-.035.33/:8 5.3../-.0345:8.8./507:.3..397..3.30-/. ....3/3.//.9:5033..4394 ../07974-.3-0-07.7.47243  240:5749030.2..3203./8.251.8  0.38.570:7847.3/2#8:507570.382007./..

/.032#54207.9:/ .2085:397.909. /902:.3-07-0/.7907-:..-0:2-./.0897403/-07.8:3:0:8 !7480880.7.2.3 -07-0/.9:7.:7.-07.8.2:2.3/03.2.230897403 .   503.8574903.3   507:-.3.802:/.73.80 80 .320302-:8/3/33:0:8:39: 202.03.892:.3:980.93.8.33.2025:3./.-.30897403 .95..3...9.38:35.3839088032..9:  503.9.28945./.70805947472430897403//./:9:8.3-07-0/.3..:2:33472433.3  /.35.//.3..9.-:23 $390883.  !03.73.39.38073.9.9/.  034203.3-.  !.38.35./.5.: 909. ..8839088 4.3907:8-07.3018038-07-0/.3.240: 240:2#../:9:8 .390:7 4.3.3/./.2.3708543-07:5. 8390882#:39:4.3...50789.703..9.9:574903010947   .9:8 28.34.870570847 /..3.03880./5.82..2 /8:39/03..38.5..20/:..28.507-0/../..4250847243 70805947.5.8090780-:9907.3.9   3.3..3.3897:9:7742.390724/1.80 804.57:5.9/.5/.3203.3 .240472430..80  43943/:897.9../.9574903.3/97.3203390882#90780-:9 ..3202-07..3.73.3907..9.:..3.  .38758//.3:93.5:.8.7.9202-:. 8:.557480832# :.2 3:0:84250890780-:9 . .8/03./09./:9:8./.38.39.-:235.9.387584047243.-0-07.

.3.2.339743 003.7:/.2..203.507-0/./.38. 2#.8.354.3-07./. 502-:.8.5...8040-07-./.3.703.9907./.703.3.

0:../-:.3.38205748083  :8:83.2.749.390780-:9 .33.3/97.//.3203:3:./03. 909.3..-.2#9/.3:2:7 10920 240:2# /.3.3./.:50702-..2 2.9...7.502:/.9:7.3-0:2 /-:.9./.397./  80:2..907-.82#5.3 1.3:2:72#:.090780/.989.574903..   503.3/7:39:9/.3-./:25.9:7.387588./.3909.2503.9:.9: 83.3/839088 .2.3/3.2:2.38.749.3/..507-0/.3907..:39:97.3 .947707:9203 3.340..2.-44-0781.80-03./.574../. -07507. 5..5./.32#907802-:3 2.83.9.3..3/97.94443 80/.89:/3.9:7. 5.3-0:2/-:. .:839088574903203.2#.90:7././..80.703..8907.39..38.  43/8-..800--.3.39/.33.2.3 97.320.38.25079:2-:..9:7.//.0.57:5.3/:25.3-:.8.3/.3 03./ /.503.:.2502-039:..2.5.2:3 .75.84085072...3 85.3 2#  !03.3425087-4842 2#  .3-0:2/97.5 -09:10798.3 /.3.8:.32# 20.9:7.30-:7.92085:303.8 07-0/.3../.33.3820503.73.3203..3 8.9:38:790780-:9 909..90780-:99/.80:2. $090:73.:80:7: 839088574903  %0:7..38.8..3..397.3-0:2/09.3.9703/.84.80.80-0:2/.9:7.3  503.2./8.28090:7.3.3875572073.3.2.3./.3 2025079.38.3240:2# .8  $3. .8 .9::38:7.3.203.20.80/2#  !03.10798.83.98 .38:.88. .9.38..73.2.397.9:7.3 /02.

7499/.257480897.2349079039:.  .809079039: %025.5.  5...9: :7:9.5./ 240:.288902802.380.9..43/8./.3/58.-07.9 9025.95024943. 909.97.8.8 97./. 909.5/58./.33.7...08908 4003257490.3/.9025.3/3.5073.3203.39.55749033/.3    .38090.5.3 -08.38.340 20.9:80203 !..83039/.8 .52#  $0-.8.3.2#54889743 909. 240:574903.34/43..38.88:.9.7.2-.80-.5-07..3 .9  $39088-0-07.3 /03..749907/.3/03.:8:8/03.$39088-0-07.3.9./:25.3:9: %.3/7/.3503.9:038240:./.3/802:.4394 4380397..0..29::7:9.9:740..9:039:3.3-071:38807025.9 /809.574/:8.85749039:803/7907.3240:2#.339/.78.5749039079039:/.-07::7.3/5.574903/./..9.7.3.380:2.340:7:9.383908854574903 !4574903.2.5..73.980-.803.545059/.2.83 2.390754943 54943:39:203..92#54889743..9.3203. .3 404/438945/.5.8.3203:98:.38.39-4/ 90780-:9-07.3907.574/:03 $0-..0:./..34389.38203-8.8.95024943.574.5.38.:503.39-4//5079..8.9/.2-...

.

.9070309 !02-:9..'7:8%079039: 4/0$97:9:740:203:7:9.8.3#80-.. !4890/-.42039.8./..380-:..7 %#%   %#% O O O O O O !02-:9..:38. %.1-40309.9843 7..9070309 #05.8$0243807.90703095.7%3.91 #05.380-.

3.80..8../.303::3  %#% !.2.280  ..07 20302:.203.3/$0/.:38047.23:0.2.9.9  085:39073.23:0.92.3-.3:03.8.9: .3#05.8/.7./.2.9:9:1:383.38:./03.8.88.:.8/.302:/..-0781.3148147 ..-0:2/09.5.:/.3/:3397403/.3.33.2.   08.3/03.0/4907.83.3:8.7 3:0:8803.9.9.980.93/84.32./.9.2.8.73:0:8-07-.9/84.:  .

./.3$.3 5.3507.2.203.8.32.9.7 03.20/:2 5..3/:3.2.:7-43:..35749033.20/:25.....39070-/.3897.7.3#  03.747.9: 80/.7.8./.3507.32:9./../.240: 88..9.3.3.3$ 80/.5.380.7:03 $97..7025.8.3  574903/03.9 .7./03.3.5 8890200-.5./.:8530:243.3/.3-07:93  !07.39.2:3.4-. .3 /.3897.5.82.207:5.882.:320.9..-503./.3.920203:8.3/03.7.2:7:3.3503/.3 9.3202-039:443/03.:3 .3503.9:.3 3.9/84.303.9/.9070309 /.7./.2:3 5.7:038073/.3:.3809.3-.720...3.3203:3:.381472../5.803.985.32:9.5..29:9/..2.3907.4-.1....9070309 .33./  /. 203.:5:3 0.3.3-.9/.9./:.3.8.0.9070309 ..3805.-:9507.747.3/.83 2.3203/:33.9/3108/03.703.907530:244:8.4.3#/.3.3/:3..9:7.3/./9:2-:.3 /.:574903  :.2.33./.39.9070309 .7:03 2032-:.58:548..3./.9 !30:244:8.9/84.9070309  802039..3./..33108-.2.3.5 80.3.3 -08.:389:/ 2748458203:3:.3//.35.3.897:9:77424842 .3 02.3203.5..25:7..7/.35079.8.3/:3./5..3#.3 90./.3..3./.95::9.3$.. /.32025:3.3.32.8897.9.-07-0/.9530:243...3//.93.8508089079039:2025:3.39073108803.3.9.2 7424842:.7../9/.83.3530:244:8.2539: 3:0:8..33.9..7.-079.58:548.907/.03 2.3/.2.9070309  0.8.32.::.8897....3 ./.38205079.9-079.2-..9.8/:5  ./:.802.35.9: 80.3..897.2.30502-.9...::5..25:.3/:3.9 20339088...8/:5 %073.3.9070309 .9/-:9..3 8.8 ./.3 897.307.202./.5:.9:2-:.5 80/.2.3/.3 80-0:23.9 203.0..983.:909.3-./.9.380-.3938.907030980.  085:3/02.3 /..33203.3 203:3/...3.3.7.3909.9.5 $02039.39/.2 ..32.3-.3/03.:35749030-/.3..7:03/.3$90780-:9 $0-..2-.9.:3 9..9.3530:244:8$.3.82.23:0:880 842.303.3.3/:5 ..9.:302:/.9//.7:3.-0781../.73.380.202... .90.9574903803.9..9:.7..3/3108/03.5.-./.3.4-.7: 5.:.9./9:2-:.9: .27424842 . -0/.39:-: 0.23:0.3.38:380-03.9:39:20.9 2.:897: .7: 5.25.8.5....3$.-0781.32:9.9 -.3..3897.30.5./.9-079.::5 :.703.9075030-.3/3108/03./ # !.3.:80-.907/. /09..8.257802:.8  71195.882.9:9:90.920303.3 5.27-43:0. 5..203.8.0..8..3907-:9-..80.380-.2.3/902:..3907:9.3/3108/03.7.3/:5 02..-.39:-:0.3/.507903.397.:8203.90703095..9.3202-039:443/03.3.5.3..907530:244:8 $970594.09.2/0487-43:0.7907.:507-0/.9 .:././..3/:7.47.5./..5.3 -.7:3.3.3/.7:.:/047-43:.7.9.3#/.80842.3207:5.980-.5.9.33..../.3:39:20339088..7/.80-.3 . 203.25..7.820488-.3820  80-.:..203..897..747.

:.8907.90..-.574903 97..3$ .381472.2.5. 897../ 897.907530:243.80 5020.-.3#897.974 .8/:5803. 97...203.3# $897. -:. 507...2-.507.07/.3.3-:99039.3 507./..:574903    :9:7897.203.890780-:9711920325:.80.58:/.2.3 0897.203.85.20.9202-039: ..3 .381472.3-.89/.3#  897.905./$8050795.80 5020.5. /.80 5020.3 ./897.3#  .3 .8907.3507../..3-./.907.. .2:3 5./$ .:..3/53/.47.9./.9.80 :9:7:9:7:9:7 897./.33108-.9..3 202-:9.3#  070.3 0897.3#9/..3$0897.3909.33.397.8 0897.92.3/53/..97.202-07.7.3/9:2-:.9 /5.2-. 9.3# $897.9070309 !07.897..3#.9070309 .3#.8.3..3#203.80#.4-.7897.897...574903439.03.3$ 0897.3 /9.23./.9.2..8...390780-:99073.2-.2507.4-.381472..2030-.9:/03./3.:897.4-.3$../.3#-07:-..5 .3-0781.703.350309 .3:3..397.780 80897.30:9:7897.907.3 503.907.032..3-079.8202-:9.9:/9./..9897.9:.390.3# 57490.7897.7920.381472.3$.32.39073.808:.8  81.4-.-./.5-07..7:03  !07.257802:.0.80:2.37119 .20897.9.2.3711980/95:39/.04/ /.9:.30.3/-07.3 .8909.3/..5.3032 #.381472.907.:. 2.:.3 97.2-./.3/.32.3.4-././.3897./. 574903439.3.9..07  ..:39.4-.:03257490.5.9202-039:.3#897.9.381472.3203.203.:.3:39:20309..4-.7  .380-.58:-07:-.7.# .3 802:.3/.3 /.3$.2-.3.-07:-.5.47.9 /.3907/.3820  ./507:-.3.381472./$ %7.3#.3#.90741.390.3/20/:2 5.23.880.3#-07:-./ 793.9/.

3/:38:1:7909.3./484945$ 80/.9-08.30:.!07.0-07.-0/03.89.9: 8. -.%0/./.:2025:3..9.9. 5.2. //.90741./484945 90780-:9 5.4-.9/..3!0803.3/..-0/3108.280-.8 80 80 .35.33.3/:38:1:7 /.3 803971:.59/.5.490.547.-0/03.3.4.5.203./484945! 80/.3./484945!  2.2..90741.37.5.90703092.203.3-.:7 /:5 -.4-..3/.3/:3148147909.2803..4.35.35.80.2-. .-0/03./.7.980/9/902:.: -:.5240:574903/...3203.35.3203./.4.8 203:3:. . &39:202./3.280 80 . .8:.3.381.3../:3.9: 09.90741.503.48.-..5..3202-:9.2.3907.//.2.3/.3.790 5.3/.9.3-.37./.3/.75.9...3/.3 5.9070309%0/.9.3  $    803.3/:3..320307.././..280  .33.35.3..38..7..203.2./.33..7.790%.2..202:33./.3.574903  #80-..33108%5.790 5.-03./.3/2.790%90.:.340-.3-.280 80 .//.790%2.288  73.8:.07.907 %//.  ..:.38:33.2.... %073.3-.9-.8:3.790%//.3/58.38:/.9070309.90741.5.3/:3148147/../.:3 40 0780/.9.-07.3.790 5.280 ..3  !   .:2.'7:8 .302-./..3574903/./09../3/380 .3-.3202-:9.3.3/2.38:8 70574/:89.203./.7.3:2:23.: .907..3907:.2.3/03.. .8-.3 907.90741..4-.350.9073.7   .8: /.4/902:. .3/.3$/. !74903 .790%200.5.3.2..3108%5.7..4-./.80/980.4  /:9402./.90703095.3.37.%/.33.92./48494590780-:9 .9.38.3-.9070309/.3203.- :./3/3803.3.970574/:8 -.7803.5.-0/03.390.388  -.3.%..3::30473..8507.3!.%/03.3574903.7 80 .//.5./03.790 5.4302:/./.59/.30- :7. //. 2:.3.3 .9070309  .203.80 !07.9. 5.9.38.30/..4 03.%/09.3/.38.7.-0.3  -.790%. .8503..7: /.4 $0-0:23.3.2507.9070309.330.90741.3 80-..280 3.4803.3/.7:8. .5.3 7./484945$  $0-.790%..2:2. 200.  2.3.

202-039:240:..:3902-.380-.5.3/7043899:8/03. 4254303 .2.3.2.7.0-07.9.314814/08907.7:89079039:/09.33.80-.8.23:0.942. .38.3%'.3/./.780:-:35749033.74240:90780-:9.9: /.:3902-.9.7./.3 5034247..39/.5.#3./.9  :. 805079..:.3.-:3.280:-:3574903 03..390.397403 -.397403 942 5..9.3:048/.2.503948.3897.543:049/.3507.803.2.7:824.3-.4-.3/:3397403 !.-../03.3  574903 # 5028.3-.207:5./.3 897.030 437..902-..7 8:-:39 8:-:39-07:.9/58.8..924.3897.8.8.3.7902-.%'.38.5.3203:3./.#  4254882.8.  03:7:90-.5.:.9:.9/.397403/9039:.7897.3. 3:049/.3/80-:9 3:048/.8.7203.3 2434207 .9203:3:...503.7897.3/.5.# -:.3 $3075. /..9 %.3907-:3:8//.5.32030-./../. /:-:3.8.9425.3 40 7.:3 #/.8.4-.3-.2.9:/03..2025:3.3/80-:93:049/.90703095.380-.2.:.:3  070. 397403-07./.5.547.37043899:831080/.33.9 :.3/03.:.340.8 503..3 #/./.89../.9:::81481.:39: 02:/.-07.3-./.7:8 %' ..33:049/.9.7:8..23:0.8.%' %'897.../..7.#.2.3574903/.3 /7043899:8/03./03././ 1...803 :39:202-0/.20.7897.503948.7897.9 :.3 80-..:  '7:83203./.3.3202-:9../03.: 574903 .809.8..0/:.8...89.7# /.3207:5.-07.3.3/.3203./.3 /7043899:8 /03.7:8..907 03095.9..3.3-07507..803.39073..39.7  !07../.882.35.380..503948.87043899:8302:/.3/.3#80-.53:049/. #/.3574903  0.947.3 507.3.3%'897.9079039:240:#/.7-43 /.392-:3..3.3.3/.303.7-48.9/.8./.. :.-07:93.5.32. 80/.7897.7897.9...:9/. /0487-48.2:0..907/7./.503948.2025:3. 24341481.#3.3. 909.9078:8:3/./.%' .9:.3 0/:.-./.9425079.3 /3108.3...39.3.9425.5.32. :049/.3/.3 $0-.3/.:.53:049/.703.9.: .350309.3 %'..8.7:8 .-.:-..:.8.2503./.3/.37043899:8.380:-:3574903/..:94-.9/825:.3:./.2-.9.8 503.3574903897.3203039:.3/.9.3-07.39.:.424..9/80-:9:..3 .35034247.9 ../.9070309 .503948.. .3/:3240:#.3574903 &39:202.74240:39078:8:3/.35.3.

/03.8.:/80-:9 5:73/.8.9:3.       .3.3-.#9/. 2..:39.9/.2.3./.2.3 #./..7. 2..3..3.5 /.5:73 -. 80/.9::8803.3/.3.5 203.0/:.8.3.9.8 &  .5. /0487-48.203.8.9-.33  80/.39/03.. 3207:5.5./.503948.5.2 .240:543:049/./.572/35./.23:0..:/80-:9572/3 .3./3.897:9:780-.3/0487-48..::.3-.8.39:3.923 909..3:7.3.8.9::8 805079./.:.9.2.  $02039.89483  . 94234247 5.9.3-.2025:3.9-07:5.3507-0/.7.8.:39./.9                            :./:.:923 % !.:.9-07:5.7-48.8..:5:3# /.990780-:9    ! ::81481.907/./033  .3/.5.37.3.5.9: -.3.3.397403.5. /..39.543:049/..# 909./03..9.

/.3.11907.2-.8 -.8  .:.9 4/0$97:9:7.9843 /..382080.5:73949.203.7.5.8.8./.338.35. /.8:.:.9-07.7..3/0/:8907. .8.340 ./:.220..3.9:   .7.8.4380397. 4380397.882./8./.34380397. 4380397.3/:3.9843 7.389483  03./0338.3909.9.3803/73.5 38-.8..3923 80/.2.47.7-07-.2.7  42543032.524/0 90780-:9 .5 4380397.8../03../.78508080850808  ./.33              89483923:7.3.3/:3.3:.8./03.2. 397403240:/.23:0.3/./033 923907.8-..33 894838.:340  .      .:./. 4/0897:9:718240:5079.:203:3:.8./03.2.3-..3   7.3/.8/.572/3949.3-./033:.

543:049/.9::39.3-. /.0/:.3..9803.39.9/.9/9039:.9 5.3.33:049/.3.38:2-:240:/03./.33. 09:5:.383. -.%5.3390780-:9.3/./.7::3 0 2.3.8.3/03.3. .9843/.5075.3/03.3907/.8.59.3 8:2-:.3.:39.7.7.9.8. 397403203.9:8.3.9.9./.20.:..50.3/50740/.3-075..7.7.3.3.8. ?  .8..3/7403  0.5.9.40...9.8.2.8.3 7.39.8.5-07.3.7.94234247 .3974039078:8:3.7.3.3 203.7.: -075..80.30/:.395.8.:39.3.33.9::81481.3 14814/08907/03.-.079.7.42502039078..3-07:7:9.7.397403 9:2030-..80-. 39.3.3.:..7.9.3.3.::33/3.-07:93.3  $09.33 203:-:3.2.8.8.-9.3/74037.37.3-.703.80-..55./:-:3./0487-48.: 2.3.5  202503.38.90709.3.543:049/.8. :39./.3-09:5:.3-./.3-.3/:-:3.7::3 ::33 .3-. %907.3::3 .35:.7 40   38 # 7.28:2-: /.8.8.33907.8..:7:9.:::3! 0/:/:.:39.8.9::8   0.8/.3907./.-9.-0753 /4:-00 03:7:924/030/:.203:8:.7.33 /.3-.8.9/./.:::3  ::3..5.8240: .9:  ::33/3.. ?/03. -.3 .94234247 /03.3907/.39. 3:049/.33.8.94234247 9/.543:049/.-.8.5./80-0./.9::39.3.2.340.3.0/.39338-././17.3-.80.-07.5/:.9.9 . -.543:049/. -.3203...7.42502039073.94234247 5.3.7:89.203:3:.8.3%.8.9:8.3. 80/.9.38.314814/08907 .-.9:::3:39.2.3.9:  -09::7:9.2.-.5.5..703.80-03.8.8  3:049/..8./805. 8.28.7.0 ./.8..3240:203:3.78:2-: $0507990.7.-./. . 2025:3.9.-.3:.9::39.8.395..3-075.118079.8.3-.24/09.543:049/.5.3/74037.:39.9.7..338-.90780-:9 2..-07:93.3703/./. /. 53.. .-.8.3.33.5.8..9.7::3 0    !   !  !  !  ./. 8..3.3 .7/.324/0897:9:7.5.9:.8 240:3./09. $.883.5.:. 909.89.32023/805./.5.7909.850249709..35.3/7403./. /./80-:9.2.3::3 .73.:39.:39.9:2025:3.738/.39.  !4./.9 ./17.340.  ::81481./.32030-. 8.3  S 907/.35.:39./.

3-08..890780-:9/.5079.78.33..7:8/.32.70307.3.3-078.-07. 2:9..7:8203.3.90703095.31:380.3803.3103495047.70307.3.5  085:3/02.9 20307:8.2-0-07.3905.9070309.947.38202:.91:38.3 80.8.320./.3:9.3.7:82.32.39073..38090.3/.9: ../..3820 9.3/.3802.9..3..: 705.8.343/83:3.03/02:.3 09.5.7. /.35073.78.09:7:3.39..05..80309/...:50789.5.3 20.9070309.3820 793...3389483 :38.3.3 -07:-.9240:073. 2.38:3  :383207:5.:08570803 .3/..3.907 0309 .7:80/980..320.0380-.8/03.-  .2507:-.9203..7:8/.1.749 3.8 ../. ..320.80203.800307./.2897:9:7240: :.331472.9:.9070309 .7:8203. %.3 /. :383207:5..8705..3/.3/03.9 81.25:20325.8    .8.907030980..3.2.747.9:750702-..23 0.9/.8.2.7..907 0309./033923:.7909:.8.7 .80 0307...-.3/107038.3/.-    .31:38103495 ... .907:3.9-.1:38544-07:93    .3.!  !  !  !  !  !     .8.47..8 :383207:5.9/.8 81..5./.907-:9-.3/.2..7:8/.80-.507:-.3202-.3820 .59..7.35079:2-:.340240:90780-:980-.4:89/.380-.31:3803495 ./805.3.9:90...5.207:5.5.847.9070309 $090.35.4:84307 ./..8 ./:/0.2-.331472.9203.25:-07.

3-.217.7:803.::803.3907-039:.2:3 2.09.2039.2502-:.38.705.17.7: !./.-0753-.3 .2033:049/.-.7:./.../:8:.-0753203.8/ 80:2.8.0/:./.91  80243807.8 /.3.91 /..83 2.3 .8 80243807..5/5079.705.3.502-039:.3 17.9 02:/.3203.5/5079..35073..7.9:43807.3-.3/850781 !.9047098705..3 9025..843807..705.8/8507810/:. .9.90 -. 909.:39.3 803//. -0780.203543:049/..-0753.-0753.3.3.9: 5./.39..3.:39.....3909.2..80-.7.3:39.3/:25.3.83:39.3/.3-0793/.203...390758....39070-/..7:                     .3/.29.543:049/.7:  $02039.3.543:049/.-..919.3502-039:.#05.203 17.3-.09.3203. 543:049/./ .203..7.17..9180:7:9.9025.

220/:2 .7.3-.91/850781 .  .80243807.240: 240:/03..3203.943 !07.2.-0-07.293.9.907 .2-.20/:280.7  %.3/./.2.3/:384945397403 :39:203. 3472.9/-:9.39.07./.93.9.890780-:9/.3802:./..3/02-.3/3.5.  070.9.3020/:23472./039 .397403.3 -.3849453974033472.3/03.:06:-7:2/0389 7.3/:384945 /.83 2.393.8.9180243807.240:80 80-.7.3 202.3203.09.20.8 2.3/03..547.7:9.5.8 :39.8//.   0..3   $9.3.5.5.3/:3 2025:3.2.95078.:507.8-07:93.3.33/.2.3.7.3.2.-..705.33.3$9.93.3.5.9 203:9507:-..3-07..:39.30-93/.9078. -.3 .8.30-:7.83.0307.2.33.5.2.9 /58.950.38 808:247/.0307.5.907.-0-07.5.3/:8:.9.3/.7.0307./.39.3.30-03.3-07-0/..9.3 .703./.3  07.75.203:2-:.7.83.080843/.4/03.3203..5..38.480. 43807..507-.9805079.3.9:.03971:.9 40:/03..4-.3-. 80.3.9. $0-. -. 803971:.3 5...3..3....393./..:340 $ 080843/.9047098705.8 02:/.  40:2025:3.8.32.5./9:2-:.3-.9.390780-:9 .3 0-73./03.8.5.9..907.5.380 80-.7:9.907.8..38.7./03.7:  ..5.-0-07./.803971:.3974035.90790780-:9.9.8802-.4:20 .5.07.9..91 ..4-.7.4.307..3 -07.397403.907.

.2/.3 .

2 80/.5../.307.   .3.38..9.7:9.3.

5.9./.-:3909.-:3 09.:/80-:980-.4./03..3.2  09.9. ..0307.3/0897..3.9.5.  .9.3903./0802-./88.3.9.3/9:2-:.3  5...9 /.4/9:2-:.23.580-..8.35.3 0.3.3../.907./.8 3..9-.3$9.0.703.320307.3 -07.490. 752 /..7.9203025.3/0897.3903.2.3..5...3. .3:93.8 3.3-7/ .8.-:3 40:/03.. .780 .9.0307.320303/.5 080843/.89.7./.7:9.2.-0-07.3.7.38.020/:2 907.9203025.2 2.3907.3-.3. ./.20/:2 9073.2.9.9:3.0307.07.3.  802039.202-.3.3 .05.7:9.8/03.2025:3.8.20/:2907.. 8090.8.9.3.89.393.-07.3 8.8 9.0307.7./9:2-:.2.3903.993 .2.907.9-.3.79.3 02-.-.240: 240: .203025.380.5.393..9240:/803971:./.3./.9.9.3203025.20/:2   3.8   ../..3//././03.2030.38.3.8.0307.-:3 80/.907/.90/:/:./-.0307.. .30/:/:.2.25.9..5.39079039:. /.9.:/.9.3../..-:3 $0.393.79./.393 02:/.35. 3.35079.3240: 240:.-:3803971:.9.-:3 !..5.2.33.80/:.2.9..907./-.33...780 .207:5./53/.85.4.290780-:9.803971:.35079.3/1:8.5.50/.3-.

880..9-.307./.5:2.5. 02.7 907.8      0897..9.8      0897.. /:25.7:/03.-.8. 20/:2  0307.3803971:.3703/.91       20/:2 0897.8507..32.:5:.83 0.2-.7:/03.3/03./03.393/.4-.3.9.:705.9./.  909...8-7/3. 0307.380907:83..9.7.3.2.3703/. 0307.7./. !.3703/.5.3-.8  20/:2    .3.5. -7/ .880243807.8/.502-039:.307..52:3.0307.39.307. !..3-.3. 80/.39075709.3909.3240:20...

.7.3-07...8Û 909..3705.2.2-..907/.9::3 5005.4-.202-039: 047 .3 .9.8/805:9.7.20..3 903.8/.314814/089075./.2507.0705.7     503.3/3.2-.9033907.3 503. -07-.:87:..5:.-.3 202./47.3 90780-:9 $0.3 203.8.7:8 4745.//03./.749/03.7  ..9203:3.2...3::3 502.3203::3 :39.7.1/.23.880.35.7*-..38:33.73.2-.7.3705.9.3274845009743 03.35024943..8...943  #05../.2-039:3.3:9:*.38200:.390717./.:39.7..80-..7.2-.3.3080843/.2-.9.-.7.::3 . 20/:2  0307.3 3:049/.9079039:.0897..3.8.91  !./47.3  ::3 .20.3::3 /.8Û 5.5.8803971:.347..8 /.3705. 705.7:907.780 80 .705.3$9./.2039.390780-:9803..87424842/..390705./.3203::3 743.8 .8.:.  0897./.3::3 /.4-.9.7: . 705.3.7.32.8.32.73.9.3/:9405005.80243807.3::3 !02-039:.9-.7  #05.83/.5. .8803.73. ::3  9025.30/:../.2.3/03. /...8240:/.:947.80:2.83.8  39075709.3.705.7:/.703.3/03.: #05.3./03.-.3 839088 :39. 574.7.3240: $0.9/.7.-0:2/09.7499073.9.7 3.3 047  907549433.07.2-.8...4-07.:947..203.3:9: 80-03.3080843/./.314814/08907 .329443/7.3/0483:049/.3 705.-07-039:203.83.507.3/50740/..3$9.20.3805079:7:1:3.3202507.8/.

032 $..3-0707...9.39.8 .3:049/..3/04892/3 971481.99079039://.3907/7. -07.8/:.30240:57207./03.2.747203::/:.7.:.9:/.8025.3...2-..8.3.3907.75:705.80!!!!           ..//8:. -/70843.7.    !03..9.5.-.5.93.:39.7..    &39.705.240:.90    $0203.9:7 502-039:..:# .3057207/.9.83/9.95.3 -07507.3:39.82.9.:39.32.//:.3.8907.3203./-07...8.8 40:..:2.3:049/.3/09..  ..: /0483:048/.:839088 20-.8 705.2-.. /02-.80 .70..3 !.3/3.3.754207..23:0.2.3-.3. 425430370.8.9.9: .9:740 -0-07..338.3:049/.380:2.2./ 502.9 /%%! 0025.3.9/.9.3-07/0.408...9421481.9-07:5.83.9 3:049/.2025:3.790780-:9 80-:.943 47 !74808 38../.9421481.3.3/507408:..9503/0 /.32028..9.7.749 907.240:/%!/9.2-.2-.9  32 032./. .3-. 2:..7.9 /%! /04889/3971481..9:9025..38:3/.5../:..89.8:2-07-.3/:.9 !! /05.3572073/507:.7/.8705.7  ..9240:3-071:3880-.03254207.8 839088  #0./..380-.25:20.9 /%!  /048:.09.75:705. .80/.380-.9. 38.703.3-07.3907/7.2-.3.3907/7.80.8.3. 38.3%%        /%!!!         !!! 54207..3/.3-07507.7:803. 9/..7.2705.3/:3..802.8.     :.2-.5.2-..8 .32025:3.8 .3/-0-07.3/..2-039:3:049/.03254207.502-039:./..3-..3-.8503.9:   0483:048/..7::3 0::3  %%     ..39.3:39.8.3/80-:980-..%  %       .749 80..3/./03483971481./705.703.3.703.5. ::8  -0-.8. 574.7492.0/:.8 ./.200-.839088 503.09.8.9./.7.8..2. .3 907..9.3 9025.83 2.399.23.8839088 /507:.883908880.9-.:47341705.0:..7.3.80-:..3483971481.33.3.3/50740.8870.3/%!907.24341481.9-007...:5:30:.9/902:.-:.:7:9.203. 543:049/.971481.09.39..09. 47/.3803.5.9 /! 9..8/048.9025./.3/3./.7/%!..3/.9 /%! /.8.314814/08907.3 240:.9.5...8 #05.8 -.9 .

354207.80.80.9:54207.2  .3507..2.3 80:3/07 $02039.7.2-..80 !4 .80:39:83908874248425. 80/.2839088 !4 207:5.3/507:./.3032705.70.7  $02.3:39:8390885. . 0:.80 !4 /..8839088 3254207./.749/80-:954207.3032!42020./.2.3:9..9: 03254207.4./:.3.8..

9. 9.80.7::3  0::3 .7 .9.3 :38507-./.8...503.:.802025:3.353.80  /8.-07.3.-007.9.:39.80   .8.7.2-:317.54207.3:39. 8.  !.7::3543:049/.  32!4/..3/.0/:..55.8.33:049/..3.7:.31:38503:393..8.32..7. -./3.572.9:39:202507-./.. 08.3.9:/.80.8.538.3 28.:39. .38:380.3-07.907.9.8.5..3:39.7.907.3 0/089.9.574808.3-8. 5.3 /.9.8.8.3-07:93.503.80843:0./..:39./.: 502-:.9./.203.8.3./.3043.3.543:049/...2:39.0/:.9.3 -072.   %.3203..3.:39..8 203. 543:049/.538.3.9./839088-.7::3 0::3 ..3:39.39:2-: /542078...3 ./.3/. 5024943./.:.3907.//.8./.3.:502.3.3  03/43:0.3.::3 793..3.39..308.30327.9.203.0323-07507.803./.9.3-.3.7::3 0::3  .7032 54207.9::39./.83 2.3240:3:049/. 57207907-039:-.3839088.7.80/.83:0.253 .9.203..8020.8/03.3907. 5./.39.  %07.3502.3 -.07..-  32.7.7.3.9. /:.9/-0/.:5024943.3-07507.0/:.7.5...80/.90780-:98073/3.  $0.3. !74808705.4393:803..-.9.9.3.33.80 .839088-.2-.9.8.8390885./5.2..2-.2574808839088.3.3/.47 $090.3-..3.33.85.907.353.9: :39.3/..80  #05.9.9:7502-039:.39075:9:8 5:9:8  &39:203.9.2 502-:./5.-07.839088 .2033/507:.3!4/.8.317./.3032.2.9.80843:0.3 5744170.:39.8.8.3.3 17.:.-3574903 0/:.8.7:39.380/.9.8.32.9.09./  0843:0.503.832025:3.. 0..3.880-03.20-.3503.3-08.38.80 323-007.. 909.98..8./805.5.3 503./03.7:.08..9:39/.2:3  8390885.::3 .-075.8839088:.8.3.:39.390780-:9/3.3/.3-.3/0.8 80-.203 17.9:502-:.7.78.:542078.3 809.38:39/.:-0707.34393:803.9.3574903.73.25:20./3  :8:8032!49073.3/80-:9./.-..80:9./3 897.8.203..-..:39.9::39./805./.7.9:.2039075:9:8 5:9:8 .3240:57207//..3..9.7:9/.543:049/.3/ $39088-.  .42025:3.4393:/./. 8.7:5. &39.-.3 203/089..-.3:39.:.7:/.7::3 0...80./2085:38..90780-:9/.5.0/:..7::3 0::3  !../...:08.39.3 2028.7..9073.314814/08907//.7.3./.31.2025:3.:-0707..340032!4/..80843:0.83:0.

317.:39:20. 808:.8 17.80.0/:..  .7:4393: :39..:..3/8.7 839088.9:.3.  $0507990. :39..2705.50302:3.3203.3032.2.39:.7.73. 0 8079.39/.7.39/.90793./..7.-./.503. .-.4393:80-03./.3/.203.203 17.4393:/3..7.203 17.9: 17..3/.8839088  &39.3-.09/./80-:.3/ $02039.3:9:/03.25:.203 .34081. 90793.203 17./03.33.      :39.3203./80-..3 .3897.80      47:39.7  .. .3 38.85.3/.7.3-.203 .2..8390889/.9.2.920339088/.903254207.5./02:.:39.4393:9:/80-:9:39.2-.203      .8..        17.33.09.

.

3.38.229488203.8 $.2/00307.9:2743:0..5..3/:9/03.39.. !4890/-.39::/./8..8 $.3.9.31:80/:.32743:0.39.390788.3/0.8.907.8.9:2743:0:8.2.8..203.:.54/ .39.9:2743:0:8..2/:.. 202-7.80.39::/..2 /00307..3:.380/9025.3.2743:03-07./.390788.9.3:93.3203.37:8..3  80..80 0843:.32743:0 .//0.54/ $0.229488203.780 . 203.:3 3.8.5. 2743:0203.1-40309. 803./5079:.-:3 202-039:8.7.//:./8..29488203.7.80-070..742039.7.2743:0./03.2743:0 .//:./.203.  .9:2743:0:8/54/ :.39.3203..54/ 0/:.54/ .530/:.7 $9079..90/:././ .302:/.808:..35.9:2743:0:8/54/ .3204882743:0203.7.0309203.

-07.78. 0/:..7 .3-07./.780-:.38945.3.9.3502-:3:.9/. 090744990780-:99070-/.3/:5 2..3.28945.5.7  .7.3.780502-:3:  8079.9/50.3 897.83 2.8.:70.3.35.338-. 2.: 5./.5.32..20...3502-:3:  .8.703.//.2/.03//.30/:.72. ./8943088 5028./.25./.78.:3 -/.7.7.93.3502-:3:.: -:.340. 02:33.9.2-.2.2..:8945.8.3 502-:3:  .:70.38:.39././/.55.1034203.73.3502-:3:20.3.9907.5.:5:3 .3897.8-.502-:...3 502-:3:  /03..907.808:. 0-07.35.3-:..-079:.809/.793..32..-.3802:.9:89079./.3802:./.80-:./.3.5.3897./..380 502-:3:/.-07034950 .82.9.8 .8. 50.2.2083 80/.-07.28945.72743:0 .38945.9:74003 037424842..:.3.3 /02.8.3 502-:3:  ./..9/.82..:94.343:./.3203./.3472.-./2.3.3502-:3:/9039:.54/ 03..9 203. 2743:0/.3/03...9:0425480 .3502-:3: 5..2 2.950393  .0425480 ..9.:3.380 /50740/:.92743:0/54/ :.55.9/./80./507408.82/.2.82.380-:.43941034203.-..790.82.80.:94.5/.3/.2085:380.9.39:305.3-.9:81...5.5./.83 80320. $0-.3./.7.55.55.33. /:./ 034950/.9073./.909.50./80-:9 80-.302:/./03.82  !.:5:3 5.5033.8.82.207:5.:2./.790.3.897.95./.25:203.55.3-07034950  .2 2.3/5074080502-:3:  /.203..3803/7  :8:83.83 2.. 50309 805079%  $4330-473 203..39.2/./025.790./.025.3.390788.:3 %.5./.3/:.80 80320.9079.034857.8.2743:03-0702-.9078945.9:74003 037424842.8.3203.3472.3574944.82909./.-:. $9079.:.//.9: 43/8.:94./50740/:.82.3./ !079..:.03 03.82.037424842.3//.220488203.3.5 ..7.2.3203.0/4-.790 .::203.3 0-07..3507::39:/09.2:2.9.3/.3803.743:0  0/:.3/.3.3.703.3/80-:980-..:3380.38945.803.7.30/:.5..790 5.229488203.802..25. 0907449 80 80.3/5074080502-:3:  /.3/:3 5.8/03.  5.80 .39.3.3/02.   $9079.907/.80! .2743:0.55.380:2.907.8 .920307:5.380-:.209-093../809.31034950-:.-07.9/.81.3.890780-:99.:3/.35.3..3..9:2.7  ..9203./5079:.8./902:../.310799.5.9..-079:.825...3-:.3202:33.7..92743:0/54/  $090.9202.8:.28945..380502-:3:.-07.3./54/ ..3.9/.380-:.33../.1....0/:.39.35079. 803./.:./423..3-07.8..80502-:3:  20.3.9.2.8945.7909:803/70-07..:.38945.2 8945.7.. $03.9502-:3:.39.3.3 50789.35403.3/03..8.3:93.-.9:.5..33.5.5.9078945. 802039.2.8-093.91/.38907.82 9/..3.320.3203.7-./42449.78.:94.3.25..38.897.790 5.39:305.38.3.857.3502-:3::39:-079.3/: .3.8.0..790..743:0:8.3-07..55..9-..2-.3203.. 502-:3:  07  .790.83/03.:2.23:0:8  02:33.80.9.380-:./.30-07.0.907 502-:3:-07-039:59.3.39079039:!./.2.57480870574/:8/.3897.:94../:.3 /..3502-:3: -.8.39.90782-43 .:94.3424489.25:-079.

/..33/.35079.4-.800307.50.:507.35.3/03.3 5078.:3 .-093.5./:3472.80-./8.:3 -7/....2-.3/.740 #4../.39.0307..7  3/.909:.2574/:8-.. .802.3/: .8390.3.95.7.380-.8..8 03889079.  !4./:2.3.9/.380.3../.2./:3.39./50.78.389079.-./0820..

.

7.90780-:9/3. 5078.3. .93.  -.2.3.8.1-40309.7203./..7 .39.3.2209.354:.3.3.2. $ .3.35099 2:9.3.33.54  $0-.-093.3472.7.25:.  :9.39..9/.32:9.3.350995.24745..31:38 29443/7.91 $05079 .0.2:9. 202507400307:39:5079:2-:.3802:.7%3.35420307:5.3 09:7:3.354203.3.8...39.229443/7.3/.9:740 2.3802:./.-093.307:8. 54/.070.3:.3. 800..88902839088 57490329443/7.3 /.8. !4890/-.2:9..9070309//.3.33.3/507:.7.8  -093...-482048/. $0.3 3-07:5.3.3 09:7:3.3 :39:202-039:574903.380-:.3.3.7/.354 542:9.39..3950.5079:2-:.42039.39 !078.35.3..9070309//.3.8.2-.302.0/.-42.950 . .

.2.3.3 -0.: 5:9 /.3 -0.3.24745.9-.7.009.-.91.3-:3.9.3 7085745.3.3-07-0/..9.-..: 5:9 ./.50.-07. 4745. 203.340909:.:71072039.50../9039:. 90780-:9802.919..5./.9 202-.9.78.28945.78.:3 20.8  .-..3.3-07.99/.4745.  $02039.-8.39/.3.3. -0/.3/03.3.5.3.9 .074-.3/:3 4741 80/.3.:3 5.4745.: 2025:3.90/ $0 805. -0-07.73./.8 909.3.380 805.9 7.3.3-07.01803  .507-0/.20.3.73./.73./..89/.2.82..73.3.3-0.9/.3 8.9: -.5-0785..3 . 5::025.9070309//.9/.3. -093. .  $:.:.74770385.8.009.3..70..3.9:9.3 ./.3203.2.5::025. 2.3 :8:83.3.9.3 -0..73././.39079039:805079-:3.5:99/.5./..2.85078.3 -07.9:.8//. .2025:3..3.73.8.9.

.380.8 03.-093.2-.39-49  $0.39.3 .8 09.3 4397-:8 4745.%./.85078./.-093.5::025.9070309  /..80.907/.. 909:.80-.9 034950.7/ .3 !:9 .49/.:-07.9-07.9./2:33.3 2030.7.2024745.-. 4/0.9/.3/.390780-:9/.38./.:380:07 .7950..3 -0.-0 -.80-.35..3 -0.5403./. 803.:5:9 .-093.7   %./.80507990.:5:380-.502-../..8:2-075403 909:... .9.:907.: -0.9.5.909. 5:9 5:9 5:9 .-0   0.9073..9/5.9073.3 9./.9203./03.802-..32.2-.8.380./.2..54/3/.3 03495009:7:3./.3 -0.3 ./:.. -:3.: .8.9.4745.3.3 !:9 ./.5..8./03.8-.:-.2.329 /.3 .9.9/.3 1034950909:.5./. -.2.8703.3.2.: . .280.3 ..3-:3.2.78.3202-.80-.381.39..9/.32./...9.:5:9 -0.3 -0.3 .3 -:3.5.3:93..350.103495009:7:3.73.703./.: .: -0..9/.329 0/:.7800.3907.33.2.35.3.5:9 909:.-07.342-3.-0 .3 -0..50./.350.39:305.3 -0.3.5.:5:9 -0.33.: -0.320303..7%.320280-:.:.3.8.3 . 909:.5.-:3202-039:49/54/ .3/02..2..3 -0..3 -0. ./.805.3. -:3.3-08..880 80 -.9 80:2.:5:3 9..3.39039.85078.3.5. 80/980..8/.83.8290.8 802039.3/.3202-.9.3.2/4243.3 -0..: .: .-.2.95.907/7..3  .38945.3.89.9.23-093.7::7.: -0.3//.78.4745.9.78.3.3 -0..8-.32.2.3.3 2.3  !0309.5. 034950.35:..3.3 -0.3/ .95.3 5:9 5:9 5:9 .3 !:9 .: .78./.5.:8./50.: -0.2805.4745..9/.9/825:.: ..2/4243.

2.35. 05./.78.9/.3.9.29097.0/:.3203:3:.2-.3./.2.9.3907-039:.9-:.4397-:88945.39097.390780-:9::7.3    8090:7                                      5403                   49          .3 -0.3202-039:443.9 /9:2-:.//.33. $0 80.35.703..-08.49.80950.9..3-:3./.3907/7.5...7 2./.3 0349503.38.7  4/050.3203.220488:39:203.8.8..32.    5:9.82..-.54///.47414745.89/.5::025./.20/:2800915.9 5.8 .9073.8025.:-0.54/  0.80.2.5.3.

. 085:3/02..7424842. 9.78.38.-:3.7039.58970594283203.3 90780-:9/.39-495.38:3:35. .3203:3:. !078..350.3.8.3.39:305.3-.38970594283 897 802039.../.82     29 897 49 29 897 29 897 4929 897      29  29 29 29  29  29 29 29        .7039.-.78.3 09:7:3.3 2:9.9.2/4243.34745.3408:..390..8 2.329 897 /03.:.5.. -0/.9:80-.39-49 /.29  0.3950.38050795..39-4980.54/.3203:3.8 207:5.35:./.9.380.8..3907.3802:.7 /. 50.4394 5078.309:7:3.3.8/.09.29 .3 ..78.930.50.3.3.7.3 -0:2/09.78.3..3.39.8.3 38-.70/:.909:.81..2-.8/./.202507.3802:.950..3.3.320303.2/4243.83-07.38945.81.8/-.729 .3. 3.5.39:803/7 ./.5078.3/03....703./.9 09.85078.309:7:3..381. .329 897 /03.39-49202-07.8.3 50.3/. $0-.78.381.8..32:9.5078.7.39.3.8 /.8 $0507990.950.2025:3.3.9: 909:.3.38970594283 897  .3.3907.89.329 03.34745. 8.3:35.5./503.:-07.39-49 -07:-:3..950.3907.3.9/5.39.3../3.5. !078.8090.9.3507.:/9039:.34745.7.7039..3-.3/02.909.5.3503.5.4745..338-.090780-:990709.354.8 0/:.5.-:3../. /.-07.78..30897.3.8.3-.0/:..0 29 9....3907.3.3.2.80950.3//::34050309..3/.3.29 $0.909:.3-07.39.802.3.3.203:3:.7039.907.:2025:3.3.3.274248423:0:8  07-.3.3 507.8.202-:9. 2.7039.78.8.7909:./03.3 907.79 80.38.8/.39:305.3 50./ 50./50.309:7:3.3.381.58970594283-07..18 :39:202-0/.2.3 4745.78.80.2-.3.7..329 897 203./ 4745.3-07-0/.34745. 50.8.32:9. /./.50..3/03. 2:33907..88-42.: .50309.0.404745.9:950.. 907./.0897203:954.3-07.78.3.3.3.78.7   09:7:3.3.7 7039.8203:954.950. 03.3.9.3./.329 897 203./.3.3.-078070.9.78.9.380-.8 .9/.3/03./..7.33.78.33.0349508.381.3802:../.3.8 .39-4980.909..909.8 03.3708574.3907.3897059428390.9/.09..0349508050798.:-.7503.25.9:909:.3/:3.80-:.58970594283-07.8.//. /.4745.3203.7.3 4745.:50.3 :35.3907.03/0 ..3:35.8.909.340909:./..3 .39.3203039:.2/4243./..

.3897 9.8 29950.250.3.3 8970594283    . .38970594283897 7039.909.7./.7  .3.2-.897                                                               29 897 29 897 29 897 29 897   .3907.381.3.589705942835.2/4243..897 802:.78.802:./.

.

.3$945.42039.78.78.7:0309$2-43$945..  ' !#$$% !$ $0-09:..7.39..8.3/03.27424842.74980.78.7 !#$$% !$ ' !#$$% !$ O O O O O 7907.3!0.303 03.825.9 5.30$945.!.35.9073.39.82 7.:502-.8.7%3.0.9070309 !03.82!02-.!0..7.9..//.3820$9079.1-40309.0:./.2.9039.3.../.7:.3 90709.:2 0./.:3 !03. !4890/-.380-:.:/.350.381.9073./.

78.3202.3.32020.9.3 -.3:9.33../.3:0:8 03.90309  085:3/02.03 037424842.749.5:.81.3 8080.5073.3507..3-08.903095..80:2..380-./.2./.0:.781. //.3 ..250.547.

9-07.9-0793/.7:0--08.9:909:.3503./.78.35:.82 $0-03.85078.3 2./.8.82 !.0..5.303 037424842..99079039:  .78.-093.. /03...7.78./.9:2-:. .82.9070/9078945.82/.82 -.73.4394 .3 5.350.39..03/0  !0./.3.2.2.502-.907/.80-.3 /-.3.3. /03.2:3 809/.3.3$945.39.203:954.82 39/.: :3..78.:39:202-0/./..7 /.3907/. 4745..38945.3:0:8 .80-..32...3.4394.3-..30897.3/.9:1034203.78.8..8..78.23 .3.8507.3 /.7.75.3.03/0 $0-.8:/.3.390780-:9   !07-0/.78. -.8507.-093.5.-'  /08.8:8.8 5..5.78./-.-'3.9: 81.7/-.350.3.-093.7:8/.3-0-07.82 /03. 09::.73:0:8  !0.9/:3..3  ..8-07-.78..350.38945.7:909:..3.3.5:.:/03.38:.3.30805079 29443/7. 81./.8 5078.38945.39072.8.78.3:39: 0507:.39.3/. 50.2.!0..9/..39.30 47./.250.078.:93.7. 202-07.82  7907.507-0/.9070309 .3 70857490780-:9203:3:.98945.33. 42543038945..503.3:95.3/.253.3708574207:5.9//..3.3503.3 50325..754.9:740:38:7 :38:7/:.5.790275-.33.3./.5.3. 9/..7:7.381./..247.3..8..39/..2 50.9.8.50./..38945.7907. 8:.9:7402.33..3.

/.38-.39079039:5:.3/03.202-.8./.3.3:39:/84.5.381...82  7.3/.2:2././.9: .82   $:-899:83:0:8/.3.907030990780-:9 907/.50.382-43/ /..308945..3. 97.350.3 .7.28945.50./.5.-'  0 .89.907503039:81..78.:.  %/.39.9: 0/:.347.9/2:33.3.3-./.800.82   03 037424842.50.30 80507929443/7.9070309 /. 8.9:2.9//.8. /.5.2.9:8.7: 70. $00.8503.9:740 03 037424842.9 /509.5402.9202-039:04254-07.3-. .99/./.8 .99/.39./.3907/. 2.8070.8:.47..803/0 203:3:..0--08.8 ..78.82.75.5.947.3./2:33.8945. .3202240:  .381.78.9073..381.3.23-093.82.204254 04254-07.3 /./.3  7.949079039: /03.913:0:8/.23.381.34745.3.9078945./.703.9 -07..38945...3-.2.82.82.5.7 /.9 90780-:9207:5...3.50.390780-:9907.8/.303 03 7424842.28945.703.30/.9 9079039: 2.3.920..9078945.- /.88:39:203/::3502-:9.38:..7:2.78.30/.203025.92025070.30$945.9..803.38282.78.3.82/.38945.47.82907-:9-07../80-:980-.703.-.82.5.250.2.30494342 0-07..28945./. /..30 47.907 8945.9.7..9 .50.3./.9/5.5.3705...909.8 8:-80:07803/7  0.39039.350.82!02-.38:39.303 8073.5..78.9:81.35. 503..78.78.

 -079.897:9:7 /.247.5.. 03 033/.32070.3-.070.-07-.907/..4745.30.-48200307  32 032:39:0507:.73..3/-.320309.8.9.31:383.35748081494839088  4741-08079.5.70.3. 09::.08.3./.3:3 82-4889:7:3 902:7:3/03.3803.3.3. !.8 .909.7.5.3-0-07.3820202-.2/4243./47..3-./.. 28.3 207:5.7493..8 .9070309.. 9:2-:./.03847.7.8..8/.3.8-442..50309.880-.3 4745.220.38.3-.3820 09.3 /:5-0-..9:7.749 //:.90...5./. /..3202-07.3/48/.85.30:..38200309. .3820 0:.0-:7.380:2. /7.3.83 2..7.5 //./.39-4989705942835.47..9: 4745.7-...802:.35.-./.8 !.301494839095./03483971481..:5.202-.2.95.3-07-.280  9443/7.3574/:8 0307907/..8897:9:729443/7..3.39.3 03/ /.503.3/:5-0-.3803.3...-0702-.....5.  $02039. 20./.2:7:3..202-.003.3203.27 $.3203:3.880/.3907.3.8:. 80:2...-3  :9.27447.0 57:820302:.3:..742.3/507:.3/:25.3..-039:209././/:. -.83207:5..82.29443/7.-.9:803/7 /. ...2./.89/.2240:3.3:3..9 %! .39443/7.9//.303:39: 203.3/.3202-.3 2.370857.02:/.33.229443/7.8.39.3.8//.33..3509:3:-.3-... .9: .3.3..3:39:8390883.3..20./..9:50309.3 -.2-039:..

370857.3.10349503472.703.3 203:3:.7.3.-4820803.909.2:9. .2:3 .3. /3.35099805079/.3 38-..5099 .39: 40.: :7.8503..80..8.2-.7-43-:.20/:25.44390780-:9-07::7.3402:9..2.32:9.. /92-:.3.3./.30./.9 .3 .3.202507.73.3209.7-43  :9.5.2.3 /03.350998070.54//03.443-07::7.3.320488 .3.8 89:/1844203:3:.3-...703..3950..34803 20.880309907.493 203.370857.9.:1072039.9.80 8090780-:9 203.3 907.-4820.8203:3..2502-0..843.8 03/0805079-.3.2509:2-:.9.73.80 805.38.49/54/ 2025:3./. !078.3.8.7.8:48.3-./.8.3 5099/./.80/9:2-:.2..5.349 /54/.38070.202507./.95.39.9./.9./.2209.5.3/03.39  .. 2.0.8.2-./.10349503472.3.3 /03..:.3-.33472.84547.3.33472.3.843.90.9.38..3 20.3509920.074-.7   %505079.9  443 4433/3.8//./-..3/3.203. .803.32748458203:3:.950 2:9./. .3950.074-  3.3.9..50998070.3 /50740025.35099 509902:9..2.35.9/..85078..23:0:8  $0.3/.301803-.

38.350.35099/03.84547./9039:.3.848547.3 950.5./. 03.85078.9.3909:.-. 3802:.3  50..7803.38:33.-.3..2.:80:7: 2..50993.80 50993097.8502-0.3.90780-:9/80-.3......0-..3-.80-.3507.7039. 09.848/.8.3203.90703092944/7.350993097./03.70025. .9./ 8:2-072.-./.-07902:/03.340 ...3/50740. 8547.7.9070309//.93.2. 8547.7.39505079.7  8945./5.33.340 909:.9 /.3 2025:3.78. .0.3.3 2048849/54/ 0025.3.3472.91 5.3.9.3. 07. .3203.381.3-08.802:..9:7 2:9.7039. .9.82.3-.78.207:5./  103495009:7:3.89...3.  ..3 :35.3 203..3/83908803270857./03.78.380950.  -07-0/.10349503472.229443/7.3472.3 :35.0708081  %500/:.3/80-:950993097.49/54/ /8.80950.35099207:5.50..

 $:57081                                 .843.5099                                                           . 54/                                                            49 /54/ 3472.$070. 3472.5099 .                                                                       3472.097.5099 3472.848547 .

 2085:380-03.7 /.23. !.5099 3097.3/.3.73.9 8:570847 /423.35.025.2:73-0:2.33.3950./.3950.  .9.3...38050993:0:8-07.3802:.848547.9.3/03.2-.7202-.3:35..27$ .2:7 0:748547.10349505099 03. :9.30380.3.3:93.2-./.73./.9.95050998:57081 0/./.5.7039. 2025:3.850995.829443/7.78.203.503.3 907.9.805.3 3.78./.31034950 5099 $0.8.7.:909:.5.9/.207:8.3/03./.5.950.5../.7  !0998:57081:.2.38:3:35. 3.2-. 50.:../.7..329443/7.507-0/. 50998:57081.-5099-0793/.3 /02./. 80-.5.0 . 5078.:909:../80-:950998:57081 .  $0..829443/7.32:9.5.320.3-0:2/./ 5. .0:748547...05030-.7039././.9073.33./.3 2.7  !0..5078.820488495099 3..0 :39:502-039:.33.78..3 3.-093./03./.-07.909.5 07:8.907.3 5./:25.8.8:82:9.30.203.3 805079.907030929443/7.3.20. 5.9505099 3097.35099  %5009.78.:.5. .7.8.3.9.3.350.78203/..070.349/54//03. 50./.3 -.78.9/0.

.

380-:.1-40309..42039. !4890/-.8.7%3..7 .

/: 3/.9:7424842.9.3.2.509.8025.3.5.23 !02-07.3.3820 .74248420.2.03-07.. 2025:3.209.74248420.0.3:.897:9:73.:42-3./: %073.0 /.3.9/:3.3.0.3.7. .3.338-.8.897:9:73..-'90.:94842.8.34.3..703..3.974845.2..: 03 03.9:/.3.34.9.390709.#!%& $ ' #  !%&$ 74248420.5..9.3/..3507-0/.0..9:74003 03-07./.2.930..5.33.70025.2.35.30380.3:94842 O O O O 03#.303 033/80-:950789.3. 907:9.. 2.0..380.209 .350.33.23/.  3/.9.95./:-093.23 80 30/ 0308 802039..754.3820.9..93./.3.8:..78.5.23  ' # !%&$ !..3.8./:.3:39:202-0/.23  03 03.23/3.23 ./.23/.2!03039:.8.5.7424842 :39:85080890780-:9 28.30380.33/./.-'.5.203./.3:8..3803.3 203.23/3.9:850808 47.50.:0025.3503.23/.3/./..30380.23 3/..7.-:3.390709./.3509.2.3 907/7.742484280.20...9/.3907-039: -.  20.5:303-07.23 3.23 7.23 %50!03039:.803.5.3/. 03 037.8/.8.39. 7.3.3820 742./.374248420.35.0.90425403-07. 202507.30380.3-093.3..39.374248425..303-07./.3.320-././.7:472430.2. 3/.8.320..85080847.3037.7   $.74248425.3/-.239/././...9.3/.3:39: 202-0/..2./:.9./:..9.03 03.1034203.2 8070.8.20990780-:9202507.3742484234247 /80-:980-.7.9:7424842 0-07.3..-.2-.78.3205:9:7:9.3/.50.9:8..390709.890790780-:9 /. ./.381.8..9.7424842 0.354908843 !03.8907.9/:3...//.:94842  $05079.3/. .7.90425403-07..23 7424842802.80.3/.

80.8025:73.39..2/.  !078..3 2.3.2.37424842  0.3820  !0....-072..74845././7424842/..9...0.9../..3./.3/.5:9 ..5.  0.78.35079.30380.203.9.02:/.35..2-.309:7:3.3203..:-.3.23/.3.3 09:7:3.5.3-07-0/.2 28.3/09. .33472.03 .802.7   7424842/.9.9/.3.3.9-072.5.3.23 /.50.5. 5:9/03.9. -.9. 9/.-0-07.8.39./.74248420.-07-0/.3907.:..2-.503..9/-0/.0307.3/:3./..9:7.78./.3..3-07/.5.3.239. 3.39.30380.0.8.9:7.3472.347.7424842909.4-./.909:.:3 ./..037.78../02.83./.-093..9/423.73./...8...0.3.7.3/.3 40% 47.203:3.3/03.90709.703.-3. .9. -0-07.3/03.2.39.3.93.3-093..32.27424842 0.580-.3-072.5..9 81.9203.7.39073.3.9: 03503.3 /.5.3.39.74845.. !07..85080847.85078.8907.0..2 3/3..9.2037.3 203.3472.39: .2 /950 80/.5.8..9/././.73.3  !  !   -093..02:9.3.9.3..2539: .:950.3507.5.3/./03.2.3472.3 203..50.3.2.82..3.235.3.303503.2-0781.73./.: 03950 .3.74845..3909:.3. ./5079:.32.2.                     -093.78.9. . 207.  30/0308 /.5.239025./037.3034950.5.235.3.5:9  03.3.5:9-093.3 202.50789.39.4-./.52025.9.3.35.23 /.42509080 30/0308 !.3.88902503039:.037.3509:3:-.9:7950.5.2-.3 /.73.3.3.3202-07.3.8 9073.9.9.93472..3.95.:-:3. /.1034950/..3 .33472.03.3.5.23/.-07-.8.2 2.3 507.39.39.9..73.5:.3/.5:9.9.9.3./.380-./.9.3708574203.9.2.207.  .390780-:9 :8:83./.3 03/0507.32.82 2.-072.2390780-:98079.7424842 03802.3037.34.3.0.32. 2085:39/./.8..  $0.23  037.2.3.3.8.207..5.3/0.38. 0.7.23/./.3-093.7.3708574/03.3#./.9:7.9.33.2.3-07-0/.  30/0308 8.33.3./.3.507.3708574 034950909:.9.207.5.9 20.3.320325.2 -072.50.9/04254 04254.390709.39.3/.2/.:2:23.-07.2. 74248420.3037.7.9.703.5./.2..:39:81.3.-093.9:740037.7::203/0 $0.950.

.507.25.-.9.2-. 805079909:.9-093.9:3472... .7  .37.33. .7  .33.74845.../.2-.9.2. . .3..3.25078.39.2025:3..5.7.9.3..

.3.90241./:.907/.-0-07.  0.3 2025:3..0  !.7.9802.9:037.2.3.85080847.50..90././:42449708081 -093..30907449 0.3-0781.32025:3. 0:. .9: 3/.9:9:02.3378203..3203.7..580-. 503.:.33 /.3803/73.5.3./:25.0380..9:  3/.95.:.3 .30907449 0332030-.-.5.3.-::.209./.98090.0241.3-0781.2./03.:.35:97.:.34 $02039.349. 3/. ./:/03. .3.-.3025...3203/079.#./:.3./7802./90703./. /.../..3. . $0-.309:7:3.3 -093.3.303.380-:.4394037.:0907449 .:./..3.73. 0349500907449:39:037.07..788.5.5.5:97.3/:.7.202-.209.8..3.78.7.207. /.33..39./:.5.8../.5:97..9.703. 7424842.3907/.30-.7424842 3/./:.30349503/.39.3..-:. .3/9039:..7424842/.802039.. 8.9.2.39.9424.7.3..0249/:3.5:973.3/.309074493..381.3-07-0/.947948080  0.3207:5.3 .5.5.209 $0-.209. .3/.9.2. 2033.9.3..303/423./:/03.3.07.9.9.80-:./.-.909074..4244 803./. 30.5.805079 909:. .2.. 3/.3 0249/423.3 202-.93.:.947..3:8.7.7488 3079.3/.3.3.8..3.23-093.7:203.8:8:3...3..0390780-:9708081 3/.389.3$5.-093.7.9:./.3.3.32030-.8090.9507/.2 3/.209.  0241.3:39:2030-:9.03708081../.39.90780-.3 503.3202-.3 /.-.38..80./9.3408:.703../. :.39.3:8.-.20.0241.8047.9:5:9 !0..7.-::5..3.:./.7.7 0/:.-0-07..202-.73./:42449/423.9/:25.7../. .9:  . /:.7. $0-03. $02039..07.3.90241.203/079.3:. .5.349.39.9 507/.78.30249/423. $..74845.7/..3 .3#:8./.9:.3:.3/50.:/:.33.30249708081 .3.33788.2.:.-09.79.73./80-:9 0249708081  #.3. /.8. .9..70025.7.3.3 ..33./:-093.3/.73./.209 ...7424842 .2.95.9: '...39.9..3820.33.209  #.3/03./:-093../..23/80-:980-.9: 8.3/03.3.7..73././:-093.7424842  3/.-0-07.9.754.0:.30:.9 ./30.5.9.707.7.3 -07-:::33  89.309074493..39.3 $0-.9:.7424842/.3 /.9:3.8:8 0241.23.9. 2.32023.2574808502-0:.-:: -07.2:3 .3-07-::947948080.

7503. #.3..5:973472..2 .-0-.  #.9:'.90241.8/./.947.5.

:5.2.97..3.97.209-070380.3. 8././03.73./.3.78.54.2357.381.8..3.381.78.50. .!./.350.8./:424. .3/.7.

209-070380./:09074.23.3802039.39.39..7. 3/.

./. .91 :2.3. /.-.9..20302:./.980/932:33/80-.3.:2:23.3.-3472.3-.3.32030-..352039.2./ 5.3.9:03.3/:303.3..3/03.03708081-7..3/.31034950....8:83.037.7.-.:3472.9.80/980.3.207:5..3#.8-::80.8:.5.-.3.203./.2-.-093.39..3.3..209  .0/423.02:9.3 50207.  4394037./.5.2/02:.3472./.:897:907.7424842.3 80/.3.3 8. .3  !0.7.3-::.02:9.2 03.3. 7 2030-.9203. 3/.-093.3.8.8.209   ./ 80-./.78././-:7 .33/..3.580-.3 80/./:09074. !.3408:93..0708081:897:/.950..3. 5.2 203..3..33./:424.

9//0908 0-07.1034950./.8.1034950 ..8.3..2:33/085708..3.33..989.703..037.3..5..3/.33.980/9 2.0/.3./.207:5.3.-3472.5..35.-.0.89/.3.340037./.303..3/.38.-.-  037.3/80-. //:.:2.-3472.  0./:-093.

239.03.-.0/:.78.74248429/./.9: 03 035.7:400380.2-.-0-07.0./.23%.8:95.39.0.8025:73.2.78.3./. 4244/03.3.5.95.703..3:8.33472.3.03.3.7424842.037.3.9./.187.3..3/7 4394034.3.97080813/.3-::503/0-093./503.8907907/.3/809..3.303..9/9.9037.-.3-::.342448.37424842 9073.3 2030-.9.342443/80-:9:.  0../..7:7.7/.3/.3507.3-07.9.3-.03 3/80-:9:..-.239.9:8.03 5.78. 20.50.8025:73.35079:2-:.39...78.2.-.3-::5.5.9./.34.9.$025:73.9/.39/03.3 03. 085:3/.38:3 805079.05.-3472./.9/.7    !!  ----   -093.034.9/.39/.3..9.3/.3 .3/75.23 /./.7424842 !0.3-::503/0 !0.3 .8..39./..880.  !..9.:94842.7.-::503/0..32030-.303.0.3-0781.381..35.03./.5.32025:3.7  !0.3 5079:2-:.3 9/03. 742484290780-:9.7903.9.802037424842 /.-./03.32030-.803.                ..3472.9.9:740 03802.90787.5./...3.5.3 2030-.3.23/.3.3#.:802039079039:5.. /.

39.3.805079.3. ./80-:9.250. - - - - -093.0.9.5.2025:3..7  .3.3./..239.95.54.3:.7..80507950.0... /. ..23 %0.2.3472.30380.. 8025:73.3708574:39:03 03.33472.2.5.:94842.3 3/.78.78.2.8-.3./.33472.3202-07.0. ./.2-. . 8025:73.3/50740/.3037.:94842.38.3:8.7 507.3./: 57..39.9/.32.239. .3.7 -.78.303.3708574:39:037.8..239.8.507.2.2-..3/.-093.8025:73.3037./ 50.  $8902!03039:.3472.

/.39.209  802039..7..09074..3.39.

3:897:424.23/./. 5.3:8../:.209   $0-..3.-093.424.235.209  802039..30380.09074./: -093.3/.209  !03039:./../.3.7.39.2.

3.98807..39079039: 203:9 88902  $0./ .202/:.-:.3:3.23.5..2025:3.-0-07.7424842802039.3.3 :2..  $8902  $8902 /:25./.8.8890290780-:9 2./.2.33.33. 28.983/.39..8-./:.88902503039:.39.3  $0-.3./:.7./:-093.3.8.39..388902 0/.-0./.280 842..0--. 742484280842.3.5.35.3-0-07.3.3.3./:.75.39/./. 88902 3/.3/0..3 203:988902 80/.80842.39.3-.7.7424842 ...3/.3. 07:9 3.39../.7424842 03././.3/..3./.3/.3/02.4394   84320302:.33.3275/03.5./:.80-:.!7490347-093.2.038807...2 /.7424842 80/. 3/.30380./.9.7424842  $890238-.35.3 /. 2025:3.. 2025:3. 5./:-093.5.983.:2.30/:.8079./.

30380.382090780-:9-07.73.3-.39/.7424842907..-07./03.33.3203.8.3 $0.9.:.. ./.8503039:.37424842 .7.9:710799.3.3.338-.88902503039:./.820325:.:-:3.-.23/03.3.3..9 74845... 47.3..30380.3./.37424842.320303.   7/020. .0380.5-.:94842 /.388902 .39./.3/03. -07507.235.2.350309.235..3807.

/. Ð7424842  Ð.30380.235.974845..9/.-0  !03039:./.95.:94842  3-.5.974845..5./...%./..-0   %.

39.23 .  0380.3 .

./..8. -093..2. .:3.-3472..9.2-..9754//.3/3.-093.5:.54/ 8079.9:.39097.3.5.  .93/.7   !  ./..3./.2-.-.39.58..9:7./.9. 209.3802039.3.7/:. .74845./..2.3 //.3.9./:.0380.92030-.3907808 /.209     -093. 80-..22:3. /54/ 3/80-.7903403088 .8050793.507.50789..:-.-093.3907. 7424842909./:3472.-0758.9-.5:..7424842. 343/8:3./../..974845....3.3/742471 !030-.8:507-093.3/.3:2.980-.5.74248425.203072. 74845./.381..9.5.-0 .-3472.9:7424842  !.58.3907-039:3..-0-07...-0-07.9.202507./: .23 209./.2..320488  !.907..30380./.74248425.3 -093.389.943 .23./.3/..39.5.9..3.950789.224.3 80-. 2.25.808:..%.3.3200-:2..5.32948849 .39.5.7  .-093.3203072..7424842 3..0-/.3/.547./: ./3.7.9:502-0.7.39:-:3.58.5. .3./:/03.-.3...390780-:95073.2530.34425079.                             -093.-..80.502-0. 0/:.9 81.3/.8./..3.-0-07.-:.5. -093./.3203. 8.3890709.340 907..3 3907808 3907808 .58.907.33/.3.09/..-3.33.8./80-:9 /03./3.3.8./:.39.2.3 ./.5..-093. 209.3 209.3/897-:87424842 5.3 0.

.88902503039:.3/03.23802039.9.3 02:/.5..303%8 .3039079039:  .802.742.3-.8. $97:9:7802.780-:.3-093.9.9.3472./09.32038907..3..3430.0342..9: .9/.7.3/03.83 2.7.9 /./0./...5./3/.3/48:8 ./..0-./:.7.9.388902503039:.3 /.23 085:3/02. .:9430.23.23909.3..1:.39. -0702-.97424842  $890203$ %8 .31034950$*9898.:320302:.974248423.3:95.:3/03.5.0-.35007.39...3.7424842/:7. 2.897:9:79079039:.703.742.3 -0702-.3-0702-. 8.39.3.23:0:8808.8:8./.:388%8*..:507..80-:.8503...:7..33.3/.3.3203.80059080..80 80842.-07.370.239073.98.90720302:.-07.9.9202507.3. -093.3./.803.3.9.98/.39:305.39./:-093.-07:-:3.3  .3 !.80 80:.33./.742.43 3/.232.:33472./03.3/03./.239073./:-093./03.80842.2.897:9:7 9079039:.9./.930..930. 90:7..7903403088 .3.9.54/  $02039.9857.9/.23-.3507./ .30380. $0.../.8.9: 3/.8.-0-07.  0. .90780-:9:39:02:/.3  -:3.5:.97424842  !.235.3.7. $0-.5.7:8 .39.233.3 .7.30380.3203.-.9:7502-039:..39:3 -.0342 507.5//.9/..3443.20280-:.80842../.3.9.8. /:25.39.:5:3:2.9.5.85080820345907.8/....7903403088207:5./:./.0309.907/.3..5:903/72::9  /./:.89  742./.3502-039:. /./48:8 -07:2.8.5.5. /03.9:7502-039:.380842.:3/03.340 1. :2.03$ . 28.23 $047../././54/ 03.9: .3. -093./.8/80-:9.:-./3/..507.:90:7.77  !.-093.5.9.3-07.80-07.30380.3-093.3.-.3.3/84.7.980-:..2.3982.3 -093.39.703.7./.9: 2025:3.08  !03.7.3:8. 80/.2025:3..3203.5.3  0.9.3.7. 2023.0342 909.3-:3./...3.. :8:83./:25.3.9.9. 2.30380.23..5.930././.5.3/:5 /3:3.3203/0.9/.9203.:-..23.703...8.39/../.3.3-:3.8. /0.8.0 .39/..3-.3:93.370574/:8.3./.39/.9./..77 5.!.9: .5907-039:80./.80.:324348:83 2025:3..547.5. 74248420.3-0781.33./9039:..3.3.39/./:.   .7 90:7./.507.-093.38.930.3/-:.3 /03.850.3.:93.3 .805079802:9 0-.374248420.9/-0/.3 :2.83203.3203.05..374248420.:/03.24348:8 -07:2.3.909./03.3 -:3.3 8890290780-:92.8.39.3//.3/02.9473:3./.3./.3-.07080818/. .3/.1034950$*%8*  $02039.23-093.3202./.3.39./.2.98.3. /.93430309 ..:3889898 -070380.328.30380.9.3-.8.9/.73.3-0702-.39...3-:3./.9:20.88902503039:.974248423./-:.35:.39.9857.3 $8902503039:..3.7:3:3.35. 9: 3/.

3:93.0/:..2.38.: -.3./.39.3./.8472430..235.208570881.3.3..9/03.3/.91/.3 003.../703.703.. .8 085708037.238079./:..3..2380:3/07  !.8.30380. $0-... 503/079./03.39.2.3.. 02.39.03.307.33.8:.39089082.380..7:0.3.3/. .742.9.91 5490883/. 7424842.39.703.832025:3.2347.:09074742.2 .3:9.393./.32./.503.:.3549088-.3820425038.57080815.: 503./.83/7423010907  2025:3...../42-.993/./.35.380.8. 202503.23 03./.20.7:472430../:-093. 2025:3.80-:.3/.380...03 42449 802039.3:39:203039:.0309203.357.23207:5.3.2.8.2..1.7424842 3..2-...343.3.3 .5.2348039088 !7.9/423.7.3107038.9.3320.3472.-093.909.938.80...-.8503./:42449.2.:94842.3 5.9.3-0781. 03708081  54908843:.3-.742.7.209 /..3.90.7:0./.3807.3820425038.9 3/.-07-.39.3. 5.30./.3.3203.203/./.9/03.23/839088404.9:7424842.3/./703.3909.3802039.9.3472./:3.7:82025:3... 8890247243..742.2025:3. .7.3742.930...23.7./.203.0907449 202507.37424842./.39.8/488/:8:.38.23 03907503.3203.503.9:  003.9.3/. -0781.7..3/....39.9: 802:33202-.7:2/.8 803.3.742. .930.35:.3/:5.73.3.3/08508.88902503039:.80.3  037./.3507.3.23./:-093.  0.5.-07:-:3./42-.7./.1:38.30..243/038.9:  0. 57./3./.0.3.3 .703.3203./.1034203.74248425.9: 80-.7 43 8047.7..380-.8.7:50702-.7:0.3038 0.4394  03..472430.83 2.3  ..  .37424842 0.3:8.5..320303./48801091.915.3/.23 .5.8-07-0/.7.:..9:7502-039:.23.3..3203.8800.9:7.03.8:.503/079.23 ./2408047.3/.3507.3.238073.0/0308 ./42-.-././../:.0/:./. .9:03 0907449  %.389074/.7.57080815.947030982020.9/.3/.7424842 3.-093.30-07..3472.38./.9 /423.3103495024.7378203.930.23 8031:03.235./:803.3203:3:.73./:.3037.9503..8.0380.0309./:0249  47243/.7.381.8/4885.3203.32025:3.39.29:-:3/.39.9:037.3507-0/. $0-.3.23 $0-.3.93 0.3.3.9../42-.0./03.9/.3820/09.9: :39:/.75030.7:2 908908 /.-::5.930.3488-07-.39.23 $02039.23 28././.9:743/81844/.8.7:83..93 0.83/742%:7307  9/.2030./  03907503.308570803802/423.9 -079..3  0./:.2.8./.3/:/42-.2. 5.3.3 085708.80.742.3 .374248420.32:33:897:202-../.234302-74 .7./.03/423../42-.3-093.-0  8570803907503.90..3202507.7:83.::5/03.2357207  $0.23.703.8./:-093.

502:.8./..3.23.9/507:.20-49.03.5.39.3.3 5.... &39:/.5.3/03.3  80/.3/: 9/.3 -079.35././:-093.39.2:3 3/.342449  03907-.23 80290/ 0308 439403802.3..9.9:70-49.23 472430.33472.:94842.303907503.8085708035.8..3 09:7:3. 2..3/03..57...0-07./..3.3:8. . /.23 $0.23:.8.0380. $0-. 03/423. -.3/: 9/.57.8./.35.:.7:82025:3.8.3/: 42-.909..03/.39.909././..5../...9:0380.57080815.20-49.2:5.7:507-0/.034950    42-.20.9/085708.90780-:9   .5507.3574/:88:8:.393803.3203.23../...303907-.2. 03-/423.-093.33.23 03.3/03.73.3.5..8.3202503.3.80.39073./.57080815.3 /.3/: -079.39.9 /085708./.2025:3.9202-.3/.39. -079.38047./.35.93.3/: 9/. 57.3/: 4394./.7. ...././: ..9203.80.30349509079039:80-03.39.0907449.35.549038:39:203.3803/73.-079.39./.9:7574/:88:8:5..0907449.  .3.7:0.9.9.-079.9:0380.8../.3203.308570803/.3203.-079.23/3.03.

.

8 .303.-/.37424842 !0209.803/03..42-3.3.3-0-./.3 :39:-039:-  909./.9-.-08.8./.3:..7  ....8.8.3!3/. !0209.3907.803708081:39:.3/.890780-:98.9..3.507.3:8.307.9..8 42-3.7 # ' # O O O O :.34003/0 -.3-039:- 2.3/-7/203.3::2800.203.803/423.37424842 5.203.35078.3:39:.73.303/423..50:.3/:.209.3. 2434-7/2.1-40309.::203/0 .$.4-./3.73.3.-  /03.4-.3/:342-3.209 .3::2502.42-3.03 /03.:..2..02-.5202:33.35078.0307.3907-039: 9/.-   /03.303708081:39:-039:- .3!3/..3.35:.742039.3:9 50.8079.78..3/.$.:5:3/-7/ 90./. ' # !07.. !4890/-.303  0.703.3907.0307.3 %.35../.3..3.3 507.42-3.73.8 /.

.3.3.2.3.974845.33.3. 0309....53/.03.3. /.3.303708081 .9:7 -039:-90709..73..3.20309.37424842 .-/.:03 03 ./.8:...3..354.:302:/.7424842 3.3820 50.3808.7.338-./.209.8 803.9.3.350209./.3/. 2.3203.-07.:.9./3.742484242443.3.9:  .83.88.9:7.-07.2.808..5079...3.3-07.3./423. 03-07.3.  03 03..720-.03/..303808./.2.8 .3.74380520303. 9072...37042-3.2.2.350309.3.2.0--.0-/.2.209.307.3/:342-3.7:809.39.2.3  $9:790.3203.7.8/.$07..35.3907-039:90780-:9/80-.3:2..3.2.90.3.3. 38-.3.280-:..33./902:.8.320303.708081  $0-.507...3.:09.. .2. .33.-078.9.7.35:.7.805079  7/08   :07 /..03503./544-.3820..3/:3 03 03/423.3.8.3-08.3././././03.339075709.8..85078.3.30--. -.3.38-.3808.07  /. / /.9.:-07..39.3/5074003/0/ 8.3:.8.38047.3:93.8/03.:.33.3./. ./.73.302-744/.:39:80..5.3. 8.:2./03.9 %  47./.92. 03 03-07.7.:2.9:7.209.4-./33 .3 /. 30/0308 80/.3.209./..-0-. /.3..3 907/.340 0..303 03-07.3-07.2.2.20.5.3-0-.303 2.52.342-3. 793.0-09:.8207:2:8.3.3907/7.5.37042-3./..-.78.8907 .5.3.9/:25.5.3/.507-0/.303 03-07.3..303-07.209/03.3.3.2.5.748834.8:.2.3-07.9/..3 # !:33095.3203.8.3909.33 $0-.2.-07././.3/:3.92070././.803/7/3.-'3  :..3 /./..5.-:.3 9/./03.3/-7/40 .803/423.3203.32025:3.7.-90709.35.3/.74248423.3 708081 02./9/.28070.5 2070.2.47.3./09.8/.780-:. :.38.8070.7424842. /.3.3./.303503.3/:303 03708081.72.8..34./ ..3.3-.303 03-07.035.9:7424842802039..74248429025...8  $.0025..320.39 $0: -0:20303..3..209 -.9:7 .3 1034203.380.73.5.2.3.. 0-/.83 2.8 /.3/.7.75. 54.25380./.5.-/03.03 03 03.3 .5.33207:5.3.:3  .4394 .3/:25. -07. 2.7207../../.3.3 /.-203.  /./.303.3. .9202-07..3.3 .5.2./.92030.3-039:-/0.74248429079039:/./..3-07. /.3/:3.3::2502.:2.0 ./.9:7-039:-90709.354891/03.9.35....8 907.-..3203.380-.20209.3.0  034203.:0--./54/ $0.-07.8..38..2...303.95.3/...:-./423.5.3203.3/.3-07./.3..83 03503.3/50740 .5:3203.20.03/07:3.209/03.8..7424842 80/.303 /423.0307.5.0:39:3.203:9::203/0 793.9: ./../.78.75.90843/..209.809.3 708081.  .-/.9/.5 85080847.939. 3./.7424842.209 .390.209.209.-0702-. 03/09/.0 7080813.803/423.75.303503. 2.708081 2..

303/423..9/..30/:/:.303708081...&39:0-0.8.7  .3-07-0/.20/:/:.:705:8435.3-07.8070.2-.3./:. 9..7.-:.2-.5. $02039.:-078.3.9.9.209 .-07.4:535.- 3 3   .9./.3..3-07.209.0723.7. !.. 3 3   - ./..703..- .0/:.3.../. 8.388 . -.33.907./:.303-07./.-0-.3.80/:.3/.3  3/.35.209.03-07.2-.209   .3-078.7.30/:/:./03./.7   ..3-07./3. .7.2-.039/./.3.802..5.8 .:431:7. 202507.28.3  ./03. .25.3. 2.39././80.9..9: 5.-.. 0/:.8/.803 035.38.-078070.  .3.7  .. .3 -07.8 :.3907.9..8//.8070.802.  -  -      .7  .3/.2.3. ..- - .3. 0/:/:. /9:880-.2-.039/.73/.2.2./:.388.3.7:8907.3.2.80  0/:/:.7  .7 /-.3.380.  .0307.397.83.23/3.37042-3.:9/.3.5./03.349.2..8/.-.83/..7  .-07..303 708081- 0/:/:.803 03.354.3.80  $0-.0/:.303-07./:/-7/.38070.3/3. 02:33../80.39.:.5.-0-.9.2.:9./:/-7/.3037080818050795.-.3. 03/423../.03. /...03-07./03.2-./.3:9./03.03/423.03/07:3:39:80.8/../.9/507-.3.. 0/:.2-./:/-7/ .03. .397..37042-3.507.9-07.38 0/:/:.3:.3907-039:  - .25. .37042-3.3907-039:/.-07.

.30/:/:. /03.-.388 /.0/:.0390780-:9-07.3/9:880-..3.-.

/: .97.3.3.2.0390780-:99/..3203.. 2025:3.5./03..38:8:3.3.83 2.8..9/:./03.0/:.30/:/:./: 80/.209 .2099505.3../ 503:8..88:8:3.-8079.  .-07.207:5./  3/.3/.-..7039.3.2099507042-3./:/-7/./:3.37042-3.././.38  .3.3035..2099505.209950 7042-3.0/:.88:8:3.3.:5:397.38..3./.2099505.8-/.8:8:3.3.209950 7042-3.3033.3.83 /80-:980-././..303..3-07..3035.3/.5.7039.-.0/:/:./.32.3.0/:/:.5.388  .8 .38907/.2.-.3.7039.2.3882.0390780-:9-07.

209.38:8:3.90780-:9 /.748834.03.7039.:809/.3.3.39./.3:39:203. 2.35078039.. .7424842 ..3  !0789.2099507042-3.03-07.203.3./:80-0:23.2099507042-3.3.9./03.9.  !3/.5.3-.3 .9:.80.209.3-08..7/.8.803 03805079.:-:3.3307.2099505.4 9025.3907-039: .3.-078.9..03-07.3  08. ..9.8 2.2.8.3203/.83.5-078.3.2099507042-3.2-.92030/07././..03 03.7...2.. 02:33.7.5.88:8:3.3..-07.7503079..342-3.39.03-07.3/.2099505.: 38-.7039.7.:0-:7.9.70.8-078.907:8 20307:8/:9405033.03-07./03. /909.03-07.7..3.35078039.7.3 .3.3.7.8/:. 80.//.3/3.3 . 9/.3..3/.5.2./03.382050393. ..30309 .03/07:3:39:909.3./80-:9.2099507042-3.-.3.32025:3.7039.8.0-/.99.3.802039.209950 7042-3.207:5. /0.0/:.3  $0-03.3/:25./.2099507042-3.209/03.7../.18.209950 5...2./: 80/.3 .-/..7:/. 802:. .2099507042-3.3.3.7.:5078039.209 9505.7.3509.$./:./03./:..:39:2025079..2099505.5..7. ..0-./:.3-0-.8.:2.39.7 3.3.5 /.3.5..3.840  $9:790.2..7.30.3.907/.3.8.3 %0.3-07.8 $0507990.4394 .3.9..3..38 2.9..3 035.:2.2..3.95:./.03/..3.3 . /:.5.2.5..3/./.0/:.2099505..58.03-07.  2..30-2:/.  .9:5079:./03.: 8.3./:.7/.37042-3.5.3.9:3/./03.74248429.35.8.5.3.39.  88.7..3.9./. $0-.39.-:./:.8 ::203/0  207:5.  .33./.2..203.7.3 $0-.39.2099507042-3.790/:.703.80 .3:2.3.7. $09.2099507042-3.7  3.38.9/.30.207:5.3-07.38:8:3..39.37042-3.3 -078.2099507042-3..7039.38.8.3..8..303 03.3.3.8 /.3502.3/03.3507.5.7502-039:.07 ./././.9.:.-07.3035.3.9.5.3.3.9..0/:. 8...390780-:99.3/.80.209 2.8..3.7.:/03.-  .39/.3-.8 03.3/50740 42-3.7.30/:/:.9../3..2070.3.7039.  ./.8. 8008.3909.5.8.3.9070309 03 / .8:.3.8.80.7039.38.2099507042-3./.9..3:93.5.03-07. /:. .3 80/..250789.8..8.209.3..880-.8 ..7.8.3-.2.3507.3203.38:8:3././. ...8 2.33.2. .3.380-./: /-7//03./.7.:2.3..3.9.3509.3-.37042-3....8907/...9035.2.03-07.209-:. .7424842 74248424244  .3.7.9203. $0.53/.9.8:2.8 %07.38..3.2.-:.2099507042-3.:3.209 9505.3-07..3.2.0390780-:9-07.9...9. 9/.397.7039.3./.73.:0--08.7 5078039.9075.7039..890.2099507042-3.3907/.3033.3.320.80.8.8803.39.853/.3/.353/.2.9.39.3-007.28070.3:39:203.39 /:3.9:.209.7.9.9203.7.2099507042-3.3.3. 8.3-.9 5.3.8.3..880-.39.2099505.3..80-.3.2..7.7..303.703.3..8070..9-07/0./: $0.3 .8/.9./.0/:.3203.8.39039. .7.32.853/.2099507042-3.3..0/:.7039..35033.83 2.8-..83 .  80/.: 47..3./.209950 5.209950 7042-3.7  28./:.353/.83.3.039/.

3.54/.                 04880488  9488 ./.3 .3203..53/.907/../.9.802..88.3-.431:7.3.5..53/.-3.5.3.4:8  !3/.2-.2/:5.8.5741.3  !4.8:8   - ---  ...3  $0.-070.80204880/:.2502-0.4-.7. 0025./:5.2.54/ 03.7..703.3:93./808:/.342-3...8 /50740/.3907.3203.3-0-..74248424244.8..8.329488 803.21..9/.9.3203:3. 0857083.8.8203.9.3/.30:748547.3907.8 .  0.9/.848457..39:2-:203..280:2.3..74248424244203.5918.2/:5./280:22:980.39097./..4.80 70574/:8..3../  :9-.3203::.3.3.5..-7042  ./025.3.9907-039:3./5..303 03708081/.3.4:39:0507:.88.    .8.87424842 /.3203.703.034950 034950/03.53/.3. -.3907.9 -:..-' $0.5.808:.9079:9:54003/423./. .-:9.54/3. 0-07.338..9742././.8803095..../3.803. 2:./:5.703.8../.2-./ !.9:.././5.8.5.588 .9/3.7 /-.38:33.880309907:9.2.3.5748080.3907.53/.7..87424842 !.507.3/3. .9//0908.5-. -07.3.95.3202-039:83.8.3502./.89097..3.8.950393-.742.9/ .3:.

.7 3./80-0:27424842203. ./.8.8 %073.9/-0/.3907..32.8.2...848547.-.  0.53/.9. 5.2-.8.2 /:5.2-./ 8090.7  .9.9/.2099507042-3.8 %.8 . 80.7.8.207:5.3-.8..3..2.3 5.- 5..2099507042-3.88.3907-039:907/7.2:33907.8/:.7  .53/.3.2.2099505.7039.209950 7042-3..380-0:23.  --7042-3.8502-0../.848547./.70/0.  /03.-.848547.8808:./.5..9/.7/.0/0.75.8.2/:5.3.7  .5.5.754.75030.5078039.703.-.329488.39.3..380:7:3.8:8  5.7039.848547./..853/.8:85. .8..20309....7424842203.9..7039. /.7  .8. !.3-07. 0:748547.9.- .5.3.02:33.84547.9: ./...5./.209.39/.8  !078039. 2..7.7.7.   $0-.39.2099505.2-.3907.7039.7.8053/.!4.2/:5.8 ./.3.3.8 -078.30..2.             04880488  9488 - .03-07./.3203. .8.0/:.7039..-..848547..9/./.9.:-.8:...9/5.7424842203.3-.2 .89.209/.3/.3-07.3/..9:.7.8/.703.3.3907.2-./808:/.25..7039.7039.8. 0025.3. 53/..848457.9505.2-. ././:.9/825:.5079. /./.:8..80.7 5..7.

3.3.2099507042-3.  .-.8..7.9. /.!0789.3.  09. 28. 02:33./.3.3907.8.3 -08.3.3 $02039./ .3/.3./03.8./.-././:.8.8.2099507042-3. .35.3:7:9.73./.8.853/.7.80.3907.2.853/.2099507042-3./.3/.39.03-07..    .3 5.07  $08:.       .:8.35.8..03-07.3907. .3 02:33.3.853/.-.3   202507.3/. 03.3907.:805079 /80-:9.3907. 3907. .9907.03-07.88..353/. .. /:.- .3. 53/.9:.25.3./. 53/.9.7..   .353/..3 8079.3 /02./..2099507042-3.3907-039:3.3/.3.39.853/.7.89079039: 0-:7.3 !079.253/./.2-./.:53/.5078039.3-./..39: ./.39.8.-:.32030-.18.-.8.3/..8 53/./.39.8..3907.8.3470.3.8.:.7.8.0/:/:...2099507042-3./.8.853/.3.7.18..39.3..7.0307.3..3../.3.8. /4:-0.9.7.8053/.8 .2099507042-3.28./.39.854891/03./9.39.3.03-07..3907..3.2 .5.8.3.7. 8.9.:9.3.90780-:9 8050795.8.2.3.3. 53/.3   /.2099507042-3. .3 .9.7039.309. 0/:.53/.-.3:.7  2..9.  %.8 .2.9.2099505.2.8.8.8.. 9: 5078039.9:/.03 03/03.73/3.-.3-.9.3907.2099507042-3..3.:53/.203.3907..7.3-.853/.3.3.8.8.3.3 /.35./.-/.209. $0.2-.8207:5.8.380.3 907.748834./03./.7. .

853/.3..7  !3/...  -- ..03-07.338-.7.3/:25./.39.3/../.38:.  2.-.853/. /./.2.2.3: 80507990./.03-07.75./:97-7/ 90780-:9 $050795.  ..3 9/.3/..3-08.8. .  .3./0.209950 7042-3..3.0390780-:99/.2. .- .303/. ..04254. ..-- /.80-... 2.7488 $0-.3.7.3..%9 $....909.7.39.5078039.75078039.39.3...303 2./0.7.3:/03./:.2093/..7.3.3&%.73.209../:97-7/.. ..803./.9039:8.3.21034950 ..2. .39:305.3. .8.853/. 0-5. 8.3/..7039.-.209.209.3..3.3.3/.75.3... 0-5.3./03.3 ./. 5..853/.30--.   --.-07.3.9:3/....32.5-07.3 3/.   $.2:3 .8./.209.3/.209.0--./.209.09.2-.--.32./:97-7//3.35.39:305.3:907./:/03.853/.-.3/.2.2099505.3.30.3. .3:9.853/. .390780-:9 .853/.75078039.75.0/:.8.3..8 90780-:9.8.3.30--08./03.5.3. .7  .53/.8.209..8./.803.5078.8././..9./8../. 99 9700 54399089.52....209/.38. /03.3 .8./:42449708081 $./.7.7.4394 3/.  ./03.9:     ./.3-07./.-08..7/0.73/.8 5078.803.--.8.333.1034950../.38-. 80/.33.5030.9. -   .75.:2.38.2-.2099507042-3..209 .8../.3 09:5:.35.3/.5..3803/73.8.3.

209... -/.-.8. -.07.3.8..- /.. . 0425409. 8.07.20953/.3//..3042540025..9/-.73/./:42449708081.  042540/:.7.904254 042545079. $02039.7039.3//.9: /.9.3.--.3.853/.3/..././.209.-.853/.2099505././. .-.2.3. 203./025. /.3.5. .

2093/..32025:3.2099505.3 103495080./.  .3/.8.904254 ..88.303.32.2..7039..83 2..9.209 .338-.3./:.:5:3 7042-3.-.3.8/:.9:2.38. 2.:8 034950.../03.38.3:3.3/02.8:8:3.-.703. 03..83907/7.2..3.025..8..2. .-..21034950 808:.

 ..-.

-.-.7039..907-08. 5078039. 9505.803.7  .

-. ..

-.

853/.3.3 5078039.39.8.803. 9507042-3.8.7.39:305...-./.-07.54884:8  ./.

. .-.

853/.7.8.3 5078039./.39.54884:8  .3.-07..803.39:305./.8.-. 9507042-3.-.

-. -..

3.853/..  ..9070.8.3/.8.803. 9507042-3. 5078039.-.

51034950.9.-.9:742484242445../.. $.8.

9:.:202-.38.3. 349.703. .  0.034950.8.3.38:8:3.9.8 80.88.-..3:90780-:9/.2.9: -.81034950.03 03/03.

83 2.3::39:03 03-07.88.3349./03.2.3./ 3/.2093.8 :39:./:.8.0349503/./:.2.83 .

2 509.9:/.39.7.7.37424842 .0/0.9/0.3:7:9.33.5..3:/.9..-.3 /03.3907/7.303.3./:.  !0209.8 .34.7 .2.33.3.3. $0-.9.9509.7.3..- .73/./.88.74248429.95.39.3.8.7424842/.3./.9:0425403-07./ .3.3:7:9.35039:3..3/.3203.9509.3. . 805079/.880/0709.35078039.7424842 /.3.3  09::.88.99/.4394-07:93  --..974845...7424842205:9503039:.3 /02.3 5. 3..9.573853. 8.3/.:39:09::034950.:39:202-:.9.3-03./..9079039: 03./. 28.5.5./:9505.9/2...9.3:39:202-:.::5805079349.2./902:..31..38.7   .503:8.502-:.03. 907-08.3.890790.75079..8.3509.3035.5./.9.7039.57424842/80-:980-.3:9.. 0/:../5./..303495090780-:9 .3.::2.8.2-.9.303 03/03.20.33./..3.0 74:5 .7..4394  5.025.3:7:9.9/.3-.9:7424842/.7/...8.2093. 9...::5/9:8/03. &39:203039:.80.9:/:.3.-.3. .90425403-07.

7 .3 9. 02:/..-..

3:.8./:.9.3203.853/.3.3/.3:2.8.3.3/.5.3 .3.. -/.3/.9:/:.9070./:. ./-.

/82:.. ...3. 58 793../:5.3/.8.253/.  3/.7039.8:39:203.

.8:39:203.258203./. /82:.-.-.

4.4.8.882:. $090.9073./:58..3 /03. .9.2.33/.9/.3033.3./.-.83/..8:8:3.

3-.9/.. /03.2.8.

28..703./:5.7:89.9: 3/..3.. 203.:7:9./.:-.  0.3033.7039..

.258 2.3/....3/50740. .-./:3203.

4:.8-0:2. .2.4.-./03..3-.9.3 9073.

9073.203. 907./..9109.3035..7 ..:7:9./. 203:-.././:5.3/.7039.

- 3/../03..258. ....3038050793 4:8/903./.7039./:5.3 :7:9.3203.203.

..4..3 9073.3-.4/03.9.

90/38 - -.7008 # #4:030/008 -9 -03938   49.8907  .03-78908  0.. .38  .-4/ 0 0..78 .3 /.008  7.3-03..038  .9:2478 80 805. 4..5.4/38  2 23. .:938 85/ 85./038 .008   9 9.38 8...3-. .:008 0/ 0.220/38  :0/008   .03-78908  83 830/-78908 8 830.. 03./.:7 ...3:8008  :738 ' 7- 7:-008  -4 -47/0.:2:..  .0308838 /5 /:2538  4.9:7038 .3/02.:7:9..9 .34/008 18   -093.:     04-4/  309 30938  7: 74:4/008   . .477:.709008  5 50.-/423.7..3-4/ 9:  .49008  .85-077008 1 1:.7309008 89 8.9.3403 . 8.8 7.7488.:7.477 .:-9:839077:59:8008   790008 $ $9.9/825:.90/38 78 7480008   .008 . 0.943 3 033..

38  09.74248425.38 .8907 80397427 742484274248420. 3:90-4/     3:90-4/      .:7.80-7908  ..38  & &59:720/38 0 0-43-4/   .7 .8/ 8. ..-78908   .07:-38 87 89750-4/   -- -4--0/-78908 ..738 89 897.34.73.: .77438   /87 /87:590/38 !7 !7.089. 7..80 4-9 4-9:8038  71 744138  3 3./ ...7008 - -947.0/-78908 .974845.450/38 7/ 70/:.0 .943008 .7.7/3. ..0/-4/    .008  2 2.3 .80/38  7. .-.-4/  .0/38 .23 ./.:738  7 7:/2039.-78908   :25-4/ 78/ 7. .709008  7/ 70.7008 .20.7  !09.2-.33..

3/423.3.3 033..7.83 2.8/:-.92039:3./.7.88.3.7./ -.:7:9.7.39.7.35078039..203.3  /.3-03./03.:9.3:90780-:9/.: /.5..39.3.3/::7 .7./03.3.7039.18.39.7.703.7.353/.2-.03./ .2.7.5078039.72:9./03. 03-07.838.03-07:7:9..8053/./.2.  8.303.3  ../:.:7:9.353/. 3.3/.8.7.. 9.8.3203.39.8./.3 $090.8053/.9./:..3.-. .3/.39.- $0..7/09.0/:.- .8.3./03.3.3 80/.803.9.73.3.3 2.9-08.3  0..3:7:1-08.3:93.7.3/.2. 8../:5.

.../.3 907/7./:.      .3- 03.8.2.853/.39.3.7..8...3/02.7. .3 . /.9.3/.

 ././:.      .7.9: 3/.3.32..     $02039..7..7.83 2.8. /.83.3..803.853/.39.

9-.3.3. .8.   ./:..-.3.3/.439484.853/./.90780-:9/.9.8907.3/.          39071070387424842 !./..

8.907.7/.3.35078039.8.83.2.8353/.7 -03.2.3/8:.58 034203./.2./-078.3..3.558 .7:83.73/0503/038. 8.50789.38:.5078039.3 -07:7:9.3907.82.9:3./.83 2./0.399.3/./:.80.75. .3/.:80..9904750:././390710703880.84.0/:..3.3..- !..338-..8. 80.73.35.53/.3/3.3/.9.9./.:3907107038..8.3. ..07. /.8053/.8.7  3.53/.3/.8./ 58 .8.8 5078039.9:8.5.3//0.2..9.9..3 .339071070387424842./ 39071070383203:3:.2.8../.8053/. 53/.439484.3 $0.9.5..33-03./.2.3/.:.380-0:23.3      .:3 /.  .7907.3-.3.9047-08.340   :075.    .35../03../.3..3 907.7 -03.58 907./.3203.3207:5..3207:5.3 -03.9:9025..2:3 80507990.2./ 58 8.3/. 2..91/::7/03.8./:.8./902:.3 2.58 0-0.8.8.3/80-:9401803 438/038  .7:83.53/.  07.7.7.8.9././03.53/.8053/./..-078.7./.90780-:9/.3.35079./3.93.

58 8.  203:3:.8. 203.73.9: 3.7.3.   .39.50789./.358 $0-./:./.7 -03.7.3  0.3.3803. 3..78.3./03./03.3-07:7:9.8.3907107038  .-08.3 ./:.50789.38025:73.3/0503/038.73.3-.2.3-03.3 203..53/.3/3907-.703.3.53/.2-.-07-.3-07:7:9.3-08.

5.3/03.7.80-07.3:8.7:8$03/.982..80-7/.380038.-07470.73.9 703/.03.3:8.3 80:2.:3 .3./:3.9/03.32..5..3 9037042-3.3/07.39/.2.7/.38.5.7424842203.9: /507:.%.8303//. .8.3202:33.9:903./.5.7  0/:.9/902:.8 92/33./..9:7424842907/./0391.80-7/ /.8.50.9.3 :2.9.87424842/.2-.5.5.3202507.8.3203.9.3.3:8.80:9.3:8.3.909.3/02.9038944.3/03.3.5.3/03.83 2.739071070383.9:.30.3803/73..8:97.9.-0  .9.3-08.9-.954.2.580-7/..8032.:.3509.98  $0.3.3/0./..8:.9:783908803292/33.3:39:/../.2240:7424842  %03-7/8.9:74248429079039: .350302:.78.9 20309./..2.9.2:3 170:0381:890780-:9/.38020374248422.7.3  03. 9.:907.-:3.892/33.2.5../.9.380842.7/.9/.8.9.7./:3..7.35..9.3:8.3.74248425.9 /93.74248422./.3.3-.  !0209.5 03.2-.340 .88.32.3.3509.3035.38.98203.3502-:.:2.:2.: /.2502-0./.3503..9:81../.8032 90780-:9 03.38.3.393.303.3 1:8 803-07./93./.80/.78/.33-0702-../.809.:.3502-07../.9:7424842.7:8 .3 /.3.9/:3.880842.:./:25.903 039079039:  %.-7/8./..0:.93.3.2.././3907107038/.80-.5.. 170:0381:8/.5409034  $0-7/.8:.2502-:...7.3-08.. 2.34018033907107038  .:8:8:3.33.7./02.9.3.8:./:3..9:8.9/825:.98 4247 9.5..:/:25..7424842207:5.2.7.80 .38:3/03.7.3/03.8888.880842.-7/8.8090709.5. 39071070383.80 .3/./.  &39:203.. .9.3:8.9./../.39/. 2.-07.7  3.8.3:39:84.409 $0.2.7.3-08..9.3:8.5.7.53/.8:2.95:.7424842 203:3.9/..380842.340.3203.7.90-07.9:/.3:8. .8/./.909..3 /03.3 /.78. 3742484280..3/.9.74248422./.5.37.3 -.9:783908892/3 3.9: 8.3203.30-07.3.8 74248422.3.3.-:3.35:.3907-039:02:/.38:.829488380. !.3/02./.4394 0-07.742484234247 .802039.53/.8/.3/.3/3:7:8/03.91.5-07-.9:3.3508..-0  %07.5.-08.3/0391.703.2..33.9.7:8$03/.3.329488803.80 80-7/./...3:39:203039:.9.3-.3039079039: 5.985079./03.3-08.8050795.80/.7 0/:.39.5..2.-078.9.9.39.:.880842.9.8.9/09....80.33.5.390.9/9039:.3203./503:7. .3:  0.8:..9:809.32.3 .3 /03. .374248425.9.9/.854891/03./.33.32..33/0503/03803.3 3./03.780-7/ ../03. .3907.3907107038 793.974 !03.38. 7424842.8.202507.3203.3  $0-.9  !.9.8./3./03.30-07.3.:3 :39:203.

91 9/./.91 ..91 .80 ../.80 -7/                92/3 3.91 .91 . 9/.                                                                            .

.

7   #$         .1-40309. !4890/-.742039..8.

343805-./.2.9.303..3 09::.703.3.8507.9/879 90758..7424.2::203/0 8070.382097.3-07.3/3.209-093.2.. ::203/0 502.9:.8.9//.3907.3.20..:39:20250.2..5507..03907/..  7042-3.8-07:93.9:7405.3 5.3/.320.8907203.9:..8..:.2.4394 81.3.3.55./.85.8.3./.381.3.78..33.3-0-.9:.3 .202-07.80./ 2.303.3-./80-:9.5.3.38.3:93.303 /.8.303/.3 $./.3203..3-.5.:507.8./.:. 80:2.3/879 90758.3..38:35.8.3. 9.2.3:0:8.9.390758.8/.9:8.382803/.5.88.30342 $97:9:77424842 :2./:-0781.. 20.:302:/.9.8.03207:5.39.3 02.-:3.303907803/7  .9:7502:3...83 2.9/:3.:-..3.8.3 $0-.35:.  0-07.:7424842 :8:83.720.81./.8.73.9:7405.209.9939..3070/907.9: 8.3...2.9: 0425450309 %  47.9907..27424842 2.303.2.340.382097.37424842 .      #$ O O O !03079.3.3 502./09.8070.803.:89:/5.:. .:1034950 3/.:..74845.3.5.835.33.3/.3./503.3503.9..3/ 80/...3/58.8.8 5.2897:9:7 397.39:305.3 07.-..7424842         #$ 3.3.8 .7:.27424842  0.4-..2.9:.3070/907.30/.35078. 8.800307.9:8.9:..9:9/.9: 0307.3 8.3 8.8 .-07.8.3828 03507:/.842.3907-039: $0.38. ./. 20...3..38.3 09.9:7405.34003/090.9:.8.34..209 .3-.9//. 20302:.3  085:3/02.3.8.3/03.3 //.8070.2.9.5.30390780-:9207:5.3-039:-3.9-:.3 8.209.9:-0:2/..3-.3.03907/.

:25:.907/7.3820 574.2-.3.907/09..:-.8//.7.27424842  !03079. .80-:.-         .9:.809.380 .303//.7  0342.3./.3802:.7424842./02..880-:.382090780-:95..33.749/..3:25:.0342/.2809.5803/..3820574.0342 03.:.9:47.3/24047..7.39.-' !.5803.3.303 03..74248429:3..38:33.7.3.390780-:9  0.9//.9./:47..9 74248423-07-039:3..9: 034247.3820. ./.3507.9.3 87:07  /.080:7:.502-0.2.3.039078:8:3/805.30342 $0.8 0/:/:.3..37424842 7.. :-:3.03.9:3:0:880.3 802:.3820 /80-:980-..28:.9.3.703.2025:3.5.3.7...3 03428:.9.-3.749805079-..3/-.3907/.3 9/./.-07.880.

-:.39.9:74248420:.749 03420:..33  /.-:.0342/54/  :2.7424842574.0342 $02039. -0/..5.32025:3.74248425.7424842/.2.8907  0342:.3:8.97424842.9/./..0342 .54/ .98 .3850808.33.9. ../03.9: 80 80.9:03/80-:980-.:5:35.3 .  .3203.3.9..3 /9025.32025:3.23 ..57424842202-.7492.0:.4 -.54/ .3.7424842  %../.7424842 :2.7.-07-0/./.890.80-:.9:47.4:8 .8.7  .7//.8./.-' .5.8-0-07.749907/7..3.749/.:2:23. 3.5.3.25.574.3509.742484239/.7499078:8:3/../.7424842./83:3-..9408:.7492025:3./. 7424842/.9.8.3039079039: $0..33.:2025:3.:/.8-448:.54/5.2.207:5.749 -.9:.380-..30342574. 80842.8.9 20.03420:.:425089./..95.7.5.2025:3.749 .-:.7-0-07.38508082025:3.../03.9.9.749 07-0/.34:880:2.79.28:.:2.7//.39: 74248420:.9.257 80.3820 0-. -039:307 !488//.3/03.3..3::7..-' $0 800./:.34.0390780-:9 4394 /0709.2:3 :2.27424842 -.9:47.20342./.9: 850808/.439480.203428:.209  5.2-..03//.80/0709.749 .: -07.38200:.33.9.9.80507.2-..

8703.2025:3..8 .380907:83.5.1./.3-075. .2..:2 .:2.0790-7.:..::8 08/42089.0790-7.45078.8.:8 !.3.7 8.47.54/3.-07..8508085.8.3-075. 74845.7424842//.7/9 %:2-:.-:. %.2.9.5.8907 345008..4308.-0  :39.08 8907.74248425..3-0-07.070.3 /09.0.3974/908 4248.8147-08 .33/3.:8 :82:8.3/03.8 %79.-/45889. 742484234247/.54/3. 7424842 ./.7038 7./.35.5038  !.703420/:. .3820 :2.:.7.9:8 7.2.850808 47.  793. $.809.0.3742484234247 5:.:8 0345:8.20342.5.54/ 3                             :.:8/42089.8.374248424244  .30 3  7424842 7424842.0 0:748547..3.703425079.2/4243...749 $5080847.34.9.-0  :2.742.1.:039:2 '.37424842.3.8. 0.9:87424842//.3808:.8025.88.-/9800. 800387:8.3..    %.: 5..3.3 0. $06:4.90 84:.3.57424842.089.8.3.54/-0-07.0342.-.20342.7424842 80/.3.3-075.0347./.3820/54/0/:.-:.3. 02..3../..74980/07.38 9:80/:8 0.20.:2025:3.0342.38200:.08..3.

9.9/03.3853/0/.3/03..35. 209.5.9..7424842424403.  .9:/.5... 202-07.5.03.-:.0/:./.2 897:9:774248420:.5./.80397 /.39/.9200.30/:.803973203.3.8..37424842.73.74803979.03.3.8:.9: -039: 209.81.303..8897:9:77424842203.33..803970/:/:.5.2.9-07:3.3.3808:.503.80 .1.7480397 /:25.390709.3803974270-:7.38:33.3.7424842.3/:.3.80397203.3803974273.3 207:5.03..2-..37.3..780397480..9:7424842/. 502-0.3/03.37424842805079:7:1 /.3.37424842./.2.5.3:7:16 80/.03.07.33.8.7424842 $0-.4394 ./5.8:. .3.80397.-' .8.9/. 5.390.3189039.3.7424842.2025079.907/..7424842 74248424244 9./..5.3 0./ 80-03.4:87424842 8073.9. $0-.3-.3 :39:4:890780-:9 .3 03495042449708081  . 202-07.303.3../.3 /:. .3035.380-07.03/07:32025079.9:7424842/.2-..90780-:98./.80397..35.  .25.7.3/03.374248429.9./. /..-./.5.742484242443.3 /03.3 :2.3.9.5.3 .3803974273.4394 03 /423.5.9/.8-0/.  .3::37424842803.. $0397427.39025. 7.-07.3. 03.. 2.303.2.907-039:03495042449/423.3.7424842 42443.303. .7..7480397 880397427 !.:-07-039:307 9073..903/.3..5.309.9:209. 89.03.209.8039742790709./.38.7  $97:9:774248425.8:-209.9-075.8897:9:774248420:.9-075.703.3909./.974845. /03.1..9:907/.3.30.3/507400349500907449 02.80  8   88 ..80397 /.5.25./.502-0././..257/::37424842803.303.7424842 803.3-07.3 -03.803978039742790709.7424842 42443.2-.3.749 .3 5.3../.3.80397 8:-209.749 .-075. 2.25.4:89079039:/ /.202-07.809.37424842805079:7:1'  0.. -039:8:-209.20.5 89.5./.8.80397 8:-209.39.35:.33./903././.28:.8..-03.34.8.8.749 74248420:.380 .35.3.2.37424842 %070-50393./.5.9/04254.8. !.3503/05 039:...5. 903.803./209.3.81...3//.3:2../.:39: 202-07.3 203:7:90/:/:.5.5.7480397 $97:9:7 74248423/.93.903././:. .303.09.3.8.37424842802.903.70/:/:.37424842805079:7:1 039:8:-209. 0.89072025:3.

2..9/ 7424842.7802039.9/:./03.2503.2.-.8.37424842209.35.7.7:39:.80397.303. 025.. :94842../. 5.30.20/:.8 !.240:.2025:3.5. ..80397.83 2.509.3/3.9070309  90427 ::37424842   80397427 43897857207   309447  742..3 .3 /.80397427-07-0/.380/.3203.33..9/:.380.8/:.0425474845.9/02-.2.:39.-' .3.0/:.3 2. 2.742.:94842.3-039:3./. /.5./240825. 20.9.805.2/0487-43:0...7.35..9/02-.5$//. .3/.80-:.5 5.8.3.3.8..9 .:780 .80397427907/.2.:94842 209.23 ..85080874845.8.7 88907.9.380 ...309.38.502-0.980-.:94842..3-08.9/8 ../.2025:3..3.-. 825.5./..-' 907/7./.3 :.3897:9:73.2.742.380  742.35..39/.3.3/ .9/907/.7424842.3 /:-:3./.-.2/.742..742.83 2.380  .825.9/8    ..3742484280.81.7 88907.3 10349503.3:8.5.3../.380/..9/202-.8907 808:.9./. 8.3 209..-07:5.5.2 50707.9: 02./.9309447 .825..74845.33.8303.:94842209.503.3503:8:37424842.83803.2.37424842.. $0-..8.9/:3..//.32.3:8./:7.3:8.35.:94842./.3/.5 742.3 /-.-07.9 /.9:8:.3:8.5.-..74248420/:.2025:3.33.8. -0/.07..-:..5.9.74803975.9:574903897:9:7./.4244/03./.3.39079039:240:207:5.303.7480397.7480397 .2./.3.80397427 09.3 .3507-0/.9:8../.2.380-.9:.3203085708.240: !..39/.34.38:33.8...0380.380907/./.2.3574903 %.3-07507.3/.8897:9:7742484280507990.803975.3909.8.74803975.3 -.2.303 03.9275 .25.5././.3/0./.803975.-  803.9. 2471448.3 -.3.

2-.380/. 7424842 .3203..3:2:2897:9:774248420:.7.3/.2-.7  ..749 .3 . .240:    . ..2503.

.

8. !4890/-.1-40309.7 397$0-0:23.742039.. $ !$$  #$$&%#%%  ! &%  #&$&#% %% &%& $&&!%& !&# .

Sign up to vote on this title
UsefulNot useful