BAB XV GENETIKA POPULASI • Populasi Mendelian • Frekuensi Genotipe dan Frekuensi Alel • Polimorfisme Lokus sebagai Indeks Keanekaragaman

Genetik • Hukum Keseimbangan Hardy-Weinberg • Perubahan Frekuensi Alel BAB XV. GENETIKA POPULASI Pola pewarisan suatu sifat tidak selalu dapat dipelajari melalui percobaan persilangan buatan. Pada tanaman keras atau hewan-hewan dengan daur hidup panjang seperti gajah, misalnya, suatu persilangan baru akan memberikan hasil yang dapat dianalisis setelah kurun waktu yang sangat lama. Demikian pula, untuk mempelajari pola pewarisan sifat tertentu pada manusia jelas tidak mungkin dilakukan percobaan persilangan. Pola pewarisan sifat pada organisme-organisme semacam itu harus dianalisis menggunakan data hasil pengamatan langsung pada populasi yang ada. Seluk-beluk pewarisan sifat pada tingkat populasi dipelajari pada cabang genetika yang disebut genetika populasi. Ruang lingkup genetika populasi secara garis besar oleh beberapa penulis dikatakan terdiri atas dua bagian, yaitu (1) deduksi prinsip-prinsip Mendel pada tingkat populasi, dan (2) mekanisme pewarisan sifat kuantitatif. Bagian yang kedua ini berkaitan dengan penjelasan pada Bab XIV bahwa analisis genetik sifat-sifat kuantitatif hanya dapat dilakukan pada tingkat populasi karena individu tidak informatif. Namun, beberapa penulis lainnya, seperti halnya Bab XV ini, menyebutkan bahwa materi yang dibahas dalam genetika populasi hanya meliputi deduksi prinsip-prinsip Mendel pada tingkat populasi. Populasi dalam arti Genetika Untuk mempelajari pola pewarisan sifat pada tingkat populasi terlebih dahulu perlu difahami pengertian populasi dalam arti genetika atau lazim disebut juga populasi Mendelian. Populasi mendelian ialah sekelompok individu suatu spesies yang bereproduksi secara seksual, hidup di tempat tertentu pada saat yang sama, dan di antara mereka terjadi perkawinan (interbreeding) sehingga masing-masing akan memberikan kontribusi genetik ke dalam lungkang gen (gene pool), yaitu sekumpulan informasi genetik yang dibawa oleh semua individu di dalam populasi. Deskripsi susunan genetik suatu populasi mendelian dapat diperoleh apabila kita mengetahui macam genotipe yang ada dan juga banyaknya masing-masing genotipe tersebut. Sebagai contoh, di dalam populasi tertentu terdapat tiga macam genotipe, yaitu AA, Aa, dan aa. Maka, proporsi atau persentase genotipe AA, Aa, dan aa akan menggambarkan susunan genetik populasi tempat mereka berada. Adapun nilai proporsi atau persentase genotipe tersebut dikenal dengan istilah frekuensi genotipe. Jadi, frekuensi genotipe dapat dikatakan sebagai proporsi atau persentase genotipe tertentu di dalam suatu populasi. Dengan perkataan lain, dapat juga didefinisikan bahwa frekuensi genotipe adalah proporsi atau persentase individu di dalam suatu populasi yang tergolong ke dalam genotipe tertentu. Pada contoh di atas jika banyaknya genotipe AA, Aa, dan aa masing-masing 30, 50, dan 20 individu, maka frekuensi genotipe AA = 0,30 (30%), Aa = 0,50 (50%), dan aa = 0,20 (20%). Di samping dengan melihat macam dan jumlah genotipenya, susunan genetik suatu populasi dapat juga dideskripsi atas dasar keberadaan gennya. Hal ini karena populasi dalam arti genetika, seperti telah dikatakan di atas, bukan sekedar kumpulan individu, melainkan kumpulan individu yang dapat melangsungkan perkawinan sehingga terjadi transmisi gen

dari generasi ke generasi. Dalam proses transmisi ini, genotipe tetua (parental) akan dibongkar dan dirakit kembali menjadi genotipe keturunannya melalui segregasi dan rekombinasi gen-gen yang dibawa oleh tiap gamet yang terbentuk, sementara gen-gen itu sendiri akan mengalami kesinambungan (kontinyuitas). Dengan demikian, deskripsi susunan genetik populasi dilihat dari gen-gen yang terdapat di dalamnya sebenarnya justru lebih bermakna bila dibandingkan dengan tinjauan dari genotipenya. Susunan genetik suatu populasi ditinjau dari gen-gen yang ada dinyatakan sebagai frekuensi gen, atau disebut juga frekuensi alel, yaitu proporsi atau persentase alel tertentu pada suatu lokus. Jika kita gunakan contoh perhitungan frekuensi genotipe tersebut di atas, maka frekuensi alelnya dapat dihitung sebagai berikut. AA Aa aa Total Banyaknya individu 30 50 20 100 Banyaknya alel A 60 50 - 110 Banyaknya alel a - 50 40 90 Karena di dalam tiap individu AA terdapat dua buah alel A, maka di dalam populasi yang mempunyai 30 individu AA terdapat 60 alel A. Demikian juga, karena tiap individu Aa membawa sebuah alel A, maka populasi yang mempunyai 50 individu Aa akan membawa 50 alel A. Sementara itu, pada individu aa dengan sendirinya tidak terdapat alel A, sehingga secara keseluruhan banyaknya alel A di dalam populasi tersebut adalah 60 + 50 + 0 = 110. Dengan cara yang sama dapat dihitung banyaknya alel a di dalam populasi, yaitu 0 + 50 + 40 = 90. Oleh karena itu, frekuensi alel A = 110/200 = 0,55 (55%), sedang frekuensi a = 90/200 = 0,45 (45%). Frekuensi alel berkisar dari 0 hingga 1. Suatu populasi yang mempunyai alel dengan frekuensi = 1 dikatakan mengalami fiksasi untuk alel tersebut. Hubungan matematika antara frekuensi genotipe dan frekuensi alel Seandainya di dalam suatu populasi terdapat genotipe AA, Aa, dan aa, masing-masing dengan frekuensi sebesar P, H, dan Q, sementara diketahui bahwa frekuensi alel A dan a masing-masing adalah p dan q, maka antara frekuensi genotipe dan frekuensi alel terdapat hubungan matematika sebagai berikut. p = P + ½ H dan q = Q + ½ H Dalam hal ini P + H + Q = 1 dan p + q = 1. Agar diperoleh gambaran yang lebih jelas mengenai hubungan tersebut, kita perhatikan contoh perhitungan berikut ini. Data frekuensi golongan darah sistem MN pada orang Eskimo di Greenland menurut Mourant (1954) menunjukkan bahwa frekuensi golongan darah M, MN, dan N masingmasing sebesar 83,5 %, 15,6%, dan 0,9% dari 569 sampel individu. Kita telah mengetahui pada Bab II bagian alel ganda bahwa genotipe golongan darah M, MN, dan N masing-masing adalah IMIM, IMIN, dan ININ. Maka, dari data frekuensi genotipe tersebut dapat dihitung besarnya frekuensi alel IM dan IN. Frekuensi alel IM = 83,5% + ½ (15,6%) = 91,3%, sedang frekuensi alel IN = 0,9% + ½ (15,6%) = 8,7%. Hasil perhitungan frekuensi alel dapat digunakan untuk menentukan sifat lokus tempat alel tersebut berada. Suatu lokus dikatakan bersifat polimorfik jika frekuensi alelnya yang terbesar sama atau kurang dari 0,95. Sebaliknya, suatu lokus dikatakan bersifat monomorfik jika frekuensi alelnya yang terbesar melebihi 0,95. Jadi, pada contoh golongan darah sistem MN tersebut lokus yang ditempati oleh alel IM dan IN adalah lokus polimorfik karena frekuensi alel terbesarnya ( IM = 91,3%), masih lebih kecil dari 0,95. Proporsi lokus polimorfik pada suatu populasi sering kali digunakan sebagai salah satu indeks keanekaragaman genetik. Nilai lainnya yang juga sering digunakan sebagai indeks keanekaragaman genetik suatu populasi adalah heterozigositas rata-rata atau frekuensi heterozigot (H) rata-rata. Pada contoh di atas besarnya nilai H untuk lokus MN adalah 15,6%.

Seandainya dapat diperoleh nilai H untuk lokus-lokus yang lain, maka dapat dihitung nilai heterozigositas rata-rata pada populasi tersebut. Perhitungan frekuensi alel menggunakan data elektroforesis Frekuensi alel pada suatu populasi spesies organisme dapat dihitung atas dasar data elektroforesis protein/enzim atau zimogram yang menampilkan pita-pita sebagai gambaran mobililitas masing-masing polipeptida penyusun protein (Gambar 15.1). Elektroforesis merupakan teknik pemisahan molekul yang berbeda-beda ukuran dan muatan listriknya. Oleh karena itu, molekul-molekul yang akan dipisahkan tersebut harus bermuatan listrik seperti halnya protein dan DNA. Jarak migrasi (cm) 4 3 2 1 Individu 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Genotipe CL LL LL CL CL CL LL CL CL CL LL CL LL LL CL Gambar 15.1. Zimogram esterase dari ikan sidat (Anguilla sp) di kawasan Segara Anakan, Cilacap (Sumber : Susanto, 2003) Prinsip kerja elektroforesis secara garis besar dapat dijelaskan sebagai berikut. Sampel ditempatkan pada salah satu ujung media berupa gel, kemudian kedua ujung gel tersebut diberi aliran listrik selama beberapa jam sehingga komponen-komponen penyusun sampel akan bergerak menuju kutub yang muatan listriknya berlawanan dengannya. Kecepatan gerakan (mobilitas) tiap komponen ini akan berbeda-beda sesuai dengan ukuran molekulnya. Makin besar ukuran molekul, makin lambat gerakannya. Akibatnya, dalam satuan waktu yang sama molekul berukuran besar akan menempuh jarak migrasi yang lebih pendek daripada jarak migrasi molekul berukuran kecil. Pola pita seperti pada zimogram esterase di atas sebenarnya merupakan gambaran fenotipe, bukan genotipe. Namun, analisis variasi fenotipe terhadap kebanyakan enzim pada berbagai macam organisme sering kali dapat memberikan dasar genetik secara sederhana. Seperti diketahui, tiap enzim dapat mengandung sebuah polipeptida atau lebih dengan susunan asam amino yang berbeda sehingga menghasilkan fenotipe berupa pita-pita dengan mobilitas yang berbeda. Variasi fenotipe ini disebabkan oleh perbedaan alel yang menyusun genotipe. Jika alel-alel yang menyebabkan perbedaan polipeptida pada enzim tertentu terletak pada suatu lokus, maka bentuk alternatif enzim yang diekspresikannya dikenal sebagai alozim. Alel yang mengatur alozim biasanya bersifat kodominan, yang berarti dalam keadaan heterozigot kedua-duanya akan diekspresikan. Dengan demikian, individu pada Gambar 15.1 yang menampilkan pita lambat dan pita cepat (nomor 1, 4, 5, 6, 8, 9, 10, 12, dan 15) memiliki genotipe heterozigot, yaitu CL (C=cepat; L=lambat). Sementara itu, individu yang hanya menampilkan pita lambat (nomor 2, 3, 7, 11, 13, dan 14) adalah homozigot LL. Begitu pula individu dengan hanya satu pita cepat (kebetulan pada zimogram tersebut tidak ada) dikatakan mempunyai genotipe homozigot CC. Dari data genotipe yang diturunkan dari data variasi fenotipe tersebut, kita dengan mudah dapat menghitung baik frekuensi genotipe maupun frekuensi alelnya. Frekuensi genotipe CC, CL, dan LL masing-masing adalah 0, 9/15, dan 6/15. Frekuensi alel C = 0 + ½ (9/15) = 9/30, sedang frekuensi alel L = 6/15 + ½ (9/15) = 21/30. Hukum Keseimbangan Hardy-Weinberg Populasi mendelian yang berukuran besar sangat memungkinkan terjadinya kawin acak

ada persyaratan lain yang harus dipenuhi bagi berlakunya hukum keseimbangan Hardy-Weinberg. Pada suatu pengujian terhadap 228 orang diperoleh bahwa hanya . H. masing-masing dengan frekuensi p2. dan seleksi. dan Q. dan q2. Secara lebih rinci ketiga langkah ini dapat dijelaskan sebagai berikut. frekuensi alel A adalah p. Pembentukan zigot pada kawin acak Gamet-gamet dan frekuensinya A (p) a (q) Gamet-gamet dan frekuensinya A (p) AA (p2) Aa (pq) a (q) Aa (pq) aa (q2) Oleh karena frekuensi genotipe zigot telah didapatkan. sedang individu tt tidak. dan (3) dari genotipe zigot kepada frekuensi alel pada generasi keturunan. 2pq. Dengan demikian. tiap individu memiliki peluang yang sama untuk bertemu dengan individu lain. yakni AA.1. mutasi. ahli matematika dari Inggris. maka frekuensi alel pada populasi zigot atau populasi generasi keturunan dapat dihitung. Oleh karena itu. Sementara itu. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel autosomal Kemampuan sesesorang untuk merasakan zat kimia feniltiokarbamid (PTC) disebabkan oleh alel autosomal dominan T.Weinberg.. Prinsip ini dirumuskan oleh G. Dari populasi generasi tetua ini akan dihasilkan dua macam gamet. dan aa. yaitu (1) dari tetua kepada gamet-gamet yang dihasilkannya. maka terjadi penggabungan gamet A dan a secara acak pula. frekuensi gamet a sama dengan frekuensi alel a (q). terjadinya peristiwa-peristiwa ini serta sistem kawin yang tidak acak akan mengakibatkan perubahan frekuensi alel. Begitu juga. Dengan berlangsungnya kawin acak. Fekuensi alel A = p2 + ½ (2pq) = p2 + pq = p (p + q) = p. Frekuensi alel a = q2 + ½ (2pq) = q2 + pq = q (p + q) = q. (2) dari penggabungan gamet-gamet kepada genotipe zigot yang dibentuk. Dengan perkatan lain. yaitu A dan a. dan W. Aa. Individu dengan genotipe TT dan Tt dapat merasakan PTC. yaitu tidak terjadi migrasi. baik dengan genotipe yang sama maupun berbeda dengannya. Hardy. masingmasing dengan frekuensi P. dokter dari Jerman. sedang frekuensi alel a adalah q. frekuensi alel akan senantiasa konstan dari generasi ke generasi. Frekuensi gamet A sama dengan frekuensi alel A (p). Pada Tabel 15. dapat dilihat bahwa frekuensi alel pada generasi keturunan sama dengan frekuensi alel pada generasi tetua. Dengan adanya sistem kawin acak ini.(panmiksia) di antara individu-individu anggotanya. Kembali kita misalkan bahwa pada generasi tetua terdapat genotipe AA. Artinya.H. Tabel 15.1 terlihat bahwa tiga macam genotipe zigot akan terbentuk. Aa. sehingga selanjutnya dikenal sebagai hukum keseimbangan Hardy-Weinberg. Deduksi terhadap hukum keseimbangan Hardy-Weinberg meliputi tiga langkah. dan aa. zigot-zigot yang terbentuk akan memilki frekuensi genotipe sebagai hasil kali frekuensi gamet yang bergabung. Di samping kawin acak.

Dengan cara yang sama dapat diperoleh frekuensi alel IA (p) = 1 – √(73 + 205)/500 = 0.25. dan I0. Kontribusi alel sebanyak 2/3 bagian oleh individu homogametik disebabkan oleh keberadaan dua buah kromosom X pada individu tersebut. Individu yang tidak dapat merasakan PTC (genotipe tt) jumlahnya 228 – 160 = 68 sehingga frekuensi genotipe tt = 68/228 = 0. IB. Selanjutnya. Seperti telah kita bicarakan pada Bab II. dan 26 AB. yaitu p = 2/3 pm + 1/3 pt = 1/3 (2 pm + pt) = 1/3 (2P + H + R). dan O pada suatu populasi dapat dicari dari sebaran frekuensi tersebut. Pada jenis kelamin ini tiap individu hanya membawa sebuah alel untuk masing-masing lokus pada kromosom X-nya. Agar lebih jelas dapat dilihat Tabel 15. sistem ini diatur oleh tiga buah alel. frekuensi golongan darah B. frekuensi I0 = √ 205/500 = 0. yakni p2 + 2pr. Banyaknya individu yang bergenotipe TT = 0.64. frekuensi genotipe TT = (0.30. Tabel 15.55) = 0. Dengan cara yang sama dapat dihitung pula frekuensi alel a pada seluruh populasi. pada jenis kelamin heterogametik formula tersebut tidak berlaku karena frekuensi alel rangkai X benar-benar sama dengan frekuensi genotipe. sedang frekuensi genotipe Tt = 2(0. dari 500 mahasiswa Fakultas Biologi Unsoed diketahui 196 orang bergolongan darah A. Jika frekuensi ketiga alel tersebut masing-masing adalah p. Sebaliknya. maka sebaran frekuensi genotipenya = (p + q + r)2 = p2 + 2pq + 2pr + q2 + 2qr + q2. Jika TT dijumlahkan dengan Tt. Dari 160 orang ini dapat dihitung individu yang bergenotipe TT dan Tt sebagai berikut. dan r. 205 O. Selanjutnya.2 berikut ini. q.11. frekuensi IB (q) = 1 – akar kuadrat frekuensi A + O = 1 – √(196 + 205)/500 = 0.30 = 0.45)(0. yang merupakan akar kuadrat frekuensi O. 73 golongan B.160 di antaranya yang dapat merasakan PTC.20 x 228 =46. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel ganda Salah satu contoh alel ganda yang sering dikemukakan adalah alel pengatur golongan darah sistem ABO pada manusia.50. Hubungan matematika antara fekuensi alel rangkai X dan frekuensi genotipe Homogametik Heterogametik Genotipe AA Aa aa A a Frekuensi genotipe P H Q R S Alel A a A a Frekuensi alel pm = P + ½H qm = Q + ½H pt = R qt = S pm = frekuensi alel A pada individu homogametik qm = frekuensi alel a pada individu homogametik pt = frekuensi alel A pada individu heterogametik qt = frekuensi alel a pada individu heterogametik Untuk seluruh populasi frekuensi alel A dapat dihitung. Dengan demikian. Namun. dari data frekuensi golongan darah (fenotipe) dapat dihitung besarnya frekuensi alel. Jadi.50 x 228 = 114. sementara individu heterogametik memberikan .55 = 0. Demikian pula. AB.20. Dengan mudah dapat diperoleh frekuensi alel t = √ 0. Frekuensi golongan darah A adalah penjumlahan frekuensi genotipe IA IA dan IA I0 . maka diperoleh individu sebanyak 160 orang.2. yaitu IA. Pada jenis kelamin homogametik hubungan matematika antara frekuensi alel yang terdapat pada kromosom X (rangkai X) dan frekuensi genotipenya mengikuti formula seperti pada autosom. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel rangkai X Telah kita ketahui bahwa pada manusia dan beberapa spesies organisme lainnya dikenal adanya jenis kelamin homogametik (XX) dan heterogametik (XY).45. yaitu q = 2/3 qm + 1/3 qt = 1/3 (2 qm + qt) = 1/3 (2Q + H + S). Misalnya. jumlah frekuensi A dan O = p2 + 2pr + r2 = (p + r)2 = (1 – q) 2 sehingga akar kuadrat frekuensi A + O = 1 – q.45)2 = 0.55 dan frekuensi alel T = 1 – 0. Alel yang langsung dapat dihitung frekuensinya adalah I0 . sedang individu yang bergenotipe Tt = 0. yang semuanya dapat merasakan PTC.

Sebagai contoh perhitungan frekuensi alel rangkai X dapat dikemukakan alel rangkai X yang mengatur warna tortoise shell pada kucing. dalam suatu populasi terdapat 277 ekor kucing betina berwarna hitam (BB). maka dikatakan bahwa laju migrasinya 0. hubungan antara perubahan frekuensi alel dan laju migrasi dapat dilihat sebagai persamaan berikut ini. Di antara populasi kucing jantan frekuensi genotipe B. Migrasi Di atas telah disebutkan bahwa migrasi merupakan salah satu syarat yang harus dipenuhi bagi berlakunya hukum keseimbangan Hardy-Weinberg. 311 kucing jantan hitam (B). atau secara umum vq = up. yaitu p = 1/3 (2. laju mutasi alel a menjadi A adalah v. individu-individu mutan biasanya mempunyai daya hidup (viabilitas). sedang perubahan frekuensi alel a akibat mutasi adalah ∆q = upo – vqo. Lebih jauh. Hal ini berarti bahwa peristiwa migrasi akan menyebabkan terjadinya perubahan frekuensi alel.16 dan frekuensi genotipe bb (Q) = 7 / (277+54+7) = 0. Dari kenyataan tersebut di atas dapat dimengerti bahwa mutasi hanya akan memberikan pengaruh nyata terhadap perubahan frekuensi alel jika mutasi berlangsung berulang kali (recurrent mutation) dan mutan yang dihasilkan memiliki kemampuan untuk beradaptasi dengan lingkungan yang ada. yaitu q = 1/3 (2.82. dan juga tingkat kesuburan (fertilitas).88) = 0. masing-masing dengan frekuensi awal po dan qo. vqo = upo. kuantifikasi migrasi dalam bentuk laju migrasi (lazim dilambangkan sebagai m). yang rendah. Secara matematika. maka . dan 42 jantan kuning (b).0. frekuensi genotipe Bb (H) = 54 / (277+54+7) = 0. 54 betina tortoise shell (Bb). dan frekuensi alel b pada seluruh populasi. yaitu P = 277 / (277+54+7) = 0.82 + 0. Hal ini terutama karena laju mutasi yang umumnya terlalu rendah untuk dapat menyebabkan terjadinya perubahan frekuensi alel.02. Sementara itu. Selain itu. peristiwa yang sangat mendasari proses evolusi ini sebenarnya tidak begitu nyata pengaruhnya dalam perubahan frekuensi alel. jika pada tiap generasi sebanyak 80 dari 1000 ekor ikan normal digantikan oleh ikan albino. 7 betina kuning (bb).12) = 0.02 + 0.11. Misalnya.kontribusi alel 1/3 bagian karena hanya mempunyai sebuah kromosom X. Namun. misalnya perbedaan frekuensi golongan darah sistem ABO yang terlihat sangat nyata antara ras yang satu dan lainnya. Sebaliknya.16 + 0.0.16 + 0. Sekarang kita dapat menghitung frekuensi alel B pada seluruh populasi. yaitu S = 42 / (311+42) = 0.89. Dengan demikian. yaitu R = 311 / (311+42) = 0. Dari data ini dapat dihitung frekuensi genotipe BB pada populasi kucing betina. Ketika dicapai keseimbangan di antara kedua arah mutasi tersebut nilai ∆p dan ∆q adalah 0. Mutasi berlangsung dari A ke a dengan laju mutasi sebesar u. Sebagai contoh. pn – P = (po – P)(1 – m)n pn = frekuensi alel pada populasi yang diamati setelah n generasi migrasi P = frekuensi alel pada populasi migran po = frekuensi alel pada populasi awal (sebelum terjadi migrasi) m = laju migrasi n = jumlah generasi Mutasi Faktor lain yang dapat menyebabkan terjadinya perubahan frekuensi alel adalah mutasi. sering kali digunakan untuk menjelaskan adanya perbedaan frekuensi alel tertentu di antara berbagai populasi. Jika persamaan ini dielaborasi.08 atau 8%. di dalam suatu populasi terdapat alel A dan a. Oleh karena itu. Laju migrasi dapat didefinisikan sebagai proporsi atau persentase alel tertentu di dalam suatu populasi yang digantikan oleh alel migran pada tiap generasi.88. perubahan frekuensi alel A akibat mutasi adalah ∆p = vqo – upo. Hubungan matematika antara laju mutasi dan perubahan frekuensi alel dapat dirumuskan seperti pada contoh berikut ini. Misalnya.12. sedang frekuensi genotipe b.

2 c) genotipe ini memberikan kontribusi genetik sama besar dengan kontribusi genotipe AA. Aa. sehingga individu ini akan menderita anemia berat dan biasanya meninggal pada usia muda. Namun. Dominansi heterozigot (kondisi overdominansi) ini dapat dijumpai misalnya pada kasus resistensi individu karier anemia bulan sabit (sickle cell anemia) terhadap penyakit malaria. Berbagai kondisi dominansi dilihat dari nilai fitnes relatifnya a) Semi dominansi b) Dominansi parsial c) Dominansi penuh d) Overdominansi Pada kondisi semi dominansi dan dominansi parsial (Gambar 15.2. atau disebut juga genotipe baku. Individu-individu dapat memberikan kontribusi genetik yang berbeda karena mereka mempunyai daya hidup dan tingkat kesuburan yang berbeda. aa Aa AA (1-s) (1-½s) 1 a) aa Aa AA (1-s) (1-½s) 1 b) aa AA/Aa (1-s) 1 c) aa AA Aa (1-s2) (1-s1) 1 d) Fitnes relatif Gambar 15. sementara untuk genotipe-genotipe lainnya nilai fitnes relatif besarnya kurang dari 1. dan aa.2 berikut ini. Kembali kita misalkan bahwa di dalam suatu populasi terdapat genotipe AA. Individu dengan genotipe homozigot HbSHbS akan mengalami pengkristalan molekul hemoglobin. individu heterozigot HbSHbA justru memiliki ketahanan yang lebih tinggi terhadap . nilai fitnes relatif genotipe ini adalah 1 – s. Nilai fitnes relatif berkisar antara 0 dan 1. Proporsi atau persentase kontribusi genetik suatu individu kepada generasi berikutnya dikenal sebagai fitnes relatif atau nilai seleksi individu tersebut. Bahkan pada kondisi overdominansi. Genotipe superior di dalam suatu populasi. Proporsi pengurangan kontribusi genetik suatu genotipe bila dibandingkan dengan kontribusi genetik genotipe baku disebut koefisien seleksi (s) genotipe tersebut. genotipe Aa menjadi genotipe baku dan kontribusi genetiknya justru lebih besar daripada kontribusi genotipe AA. dan eritrositnya berbentuk seperti bulan sabit.akan didapatkan p = v/(u + v) dan q = u/(u + v).2 a dan b) genotipe Aa memberikan kontribusi genetik yang lebih kecil bila dibandingkan dengan kontribusi genotipe baku (AA). Kondisi dominansi ketiga genotipe ini berdasarkan atas nilai fitnes relatifnya dapat dilihat pada Gambar 15. Seleksi Sebegitu jauh kita mengasumsikan bahwa semua individu di dalam populasi akan memberikan kontribusi jumlah keturunan yang sama kepada generasi berikutnya. sedang pada kondisi dominansi penuh (Gambar 15. dikatakan memiliki nilai fitnes relatif sama dengan 1. Namun. Dengan perkataan lain. kenyataan yang sebenarnya sering dijumpai tidaklah demikian.

Dengan perkataan lain. Sistem kawin semacam ini dapat dibedakan menjadi dua macam. Genotipe homozigot untuk suatu lokus tertentu – jika kita berbicara individu normal diploid – . sedang frekuensi heterozigot Aa berkurang. Jika dilihat dari segi fenotipe. genotipe HbSHbA merupakan genotipe baku (fitnes relatif = 1). Genotipe AA Aa aa Total Frekuensi awal p2 2pq q2 1 Fitnes relatif 1 1 1 – s Kontribusi genetik p2 2pq q2(1 – s ) 1 – sq2 Terlihat bahwa kontribusi genetik total mejadi lebih kecil dari 1 karena genotipe aa mempunyai nilai fitnes relatif 1 – s. Oleh karena terjadi penyerbukan sendiri di antara genotipe Aa. Perubahan frekuensi alel akibat seleksi berlangsung sesuai dengan kondisi dominansi yang ada. 1/4 Aa. dan 1/4 bagian. Silang dalam adalah perkawinan di antara individu-individu yang secara genetik memiliki hubungan kekerabatan. Pada generasi ketiga genotipe AA dan aa akan bertambah 1/8 bagian yang berasal dari segregasi genotipe Aa pada generasi kedua. dan (1/4+1/8) aa atau 3/8 AA. Jika perubahan frekuensi alel a dilambangkan dengan ∆q. Perkawinan asortatif positif dan silang dalam akan meningkatkan frekuensi genotipe homozigot. Setelah persamaan ini kita elaborasi akan didapatkan ∆q = – sq2( 1 – q) / 1 – sq2. Aa. Pada perkawinan asortatif positif individu-individu yang mempunyai fenotipe sama cenderung untuk lebih sering bertemu bila dibandingkan dengan individu-individu dengan fenotipe berbeda. Perkawinan asortatif dapat berupa perkawinan asortatif positif atau asortatif negatif (disasortatif). misalnya. Sistem Kawin Tidak Acak Faktor lain yang meyebabkan gangguan keseimbangan Hardy-Weinberg adalah sistem kawin tidak acak (non random mating). maka pada generasi kedua dari seluruh populasi akan terdapat genotipe AA. Sebaliknya. maka ∆q = q1 – q = q2(1 – s ) + pq / 1-sq2 – q. 1/4 Aa. sampai dengan generasi ketiga saja sudah terlihat bahwa frekuensi genotipe homozigot. Pada kondisi dominansi penuh. baik AA maupun aa. genotipe Aa akan berkurang menjadi 1/4 bagian sehingga populasi generasi ketiga akan terdiri atas (1/4+1/8) AA. Silang dalam Contoh silang dalam yang paling ekstrim dapat dilihat pada tanaman yang melakukan penyerbukan sendiri. yaitu silang dalam (inbreeding) dan silang luar (outbreeding). perkawinan asortatif negatif dan silang luar akan meningkatkan frekuensi genotipe heterozigot. dan aa masing-masing sebanyak 1/4. sedang silang luar adalah perkawinan di antara individu-individu yang secara genetik tidak memiliki hubungan kekerabatan.infeksi parasit penyebab malaria bila dibandingkan dengan individu normal (HbAHbA). mengalami peningkatan. perubahan frekuensi alel dapat dihitung sebagai berikut. Sebaliknya. 1/2. 3/8 aa. Di tempat-tempat yang menjadi endemi penyakit malaria. Untuk kondisi dominansi yang lain besarnya perubahan frekuensi alel akibat seleksi dapat dirumuskan dengan cara seperti di atas. Sebaliknya. yaitu q1 = q2(1 – s ) + pq / 1-sq2. pada perkawinan asortatif negatif individu-individu yang mempunyai fenotipe berbeda cenderung untuk lebih sering bertemu bila dibandingkan dengan individu-individu dengan fenotipe yang sama. sedang individu normal HbAHbA mempunyai nilai fitnes relatif kurang dari 1. Dari rumus hubungan matematika antara frekuensi alel dan frekuensi genotipe dapat dihitung besarnya frekuensi alel a setelah seleksi. Dengan demikian. ada sistem kawin tidak acak yang dikenal sebagai perkawinan asortatif. perkawinan asortatif adalah sistem kawin tidak acak yang didasarkan atas fenotipe. Katakanlah generasi pertama suatu populasi tanaman menyerbuk sendiri hanya terdiri atas individu-individu dengan genotipe Aa. Di samping perkawinan asortatif ada pula sistem kawin tidak acak yang tidak memandang fenotipe individu tetapi dilihat dari hubungan genetiknya.

mereka secara fungsional sama sehingga menghasilkan fenotipe yang sama pula. Dua alel semacam ini dikatakan sebagai alel serupa (alike in state). Perubahan frekuensi alel yang disebabkan oleh terjadinya silang dalam dapat dihitung dari perubahan frekuensi genotipe seperti pada Tabel 15.mempunyai dua buah alel yang sama pada lokus tersebut. dan q. Tabel 15. makin cepat diperoleh tingkat homozigositas yang tinggi. Peningkatan homozigositas akibat silang dalam dapat menimbulkan tekanan silang dalam (inbreeding depression) apabila di antara alel-alel identik yang bertemu terdapat sejumlah alel resesif yang kurang menguntungkan. mempunyai anak X. Persamaan di antara dua alel pada genotipe homozigot dapat terjadi dengan dua kemungkinan.Contoh diagram silsilah *Hitung jumlah individu yang terdapat pada tiap loop sebagai nilai n. Jika nilai F = 1. pembuahan sendiri dapat mencapai homozigositas 100% pada generasi keenam. baik pada loop CAD maupun CBD) FA = koefisien silang dalam leluhur bersama (pada soal ini FA dan FB masing-masing sama dengan 0 karena dianggap sebagai individu hasil kawin acak) Dengan demikian. Hal ini berarti di dalam populasi hanya tinggal individu homozigot. nilai F sama dengan 1 apabila kedua alel sepenuhnya merupakan alel identik atau berasal dari leluhur bersama (common ancestor) yang sangat dekat. Besarnya nilai F dapat dihitung dari diagram silsilah seperti contoh pada Gambar 15. Kemungkinan kedua.3. Selanjutnya. baik A maupun B. Sebaliknya. individu A kawin dengan B menghasilkan dua anak. yaitu C dan D. maka kedua alel tersebut dikatakan seasal atau identik (identical by descent). sementara perkawinan antara saudara kandung baru mencapainya pada generasi keenam belas. 0.usul yang sama atau merupakan hasil kawin acak.3. Jika hal ini yang terjadi. kakak beradik C dan D kawin. Hal ini berarti bahwa peluang bertemunya alel-alel identik yang berasal dari leluhur bersama. Frekuensi tersebut ternyata sama dengan frekuensi genotipe hasil kawin acak. Sebagai gambaran. Frekuensi genotipe hasil kawin acak dan silang dalam Genotipe Frekuensi Kawin acak Silang dalam AA p2 p2 (1 – F) + pF Aa 2 pq 2 pq (1 – F) aa q2 q2 (1 – F) + qF Jika nilai F = 0. nilai F individu X (FX) pada contoh soal tersebut di atas adalah (½)3(1 + 0) + (½)3(1 + 0) = ¼. dan aa masing-masing menjadi p. Makin besar nilai F. Koefisien silang dalam individu X dapat dihitung sebagai berikut.3. A B * Hitung jumlah loop. maka frekuensi genotipe AA. dan q2 . Misalnya. sedang individu heterozigot tidak . Untuk menggambarkan besarnya peluang bahwa dua buah alel yang sama pada individu homozigot merupakan alel identik digunakan suatu nilai yang disebut sebagai koefisien silang dalam (inbreeding coefficient). yaitu CAD dan CBD. Nilai ini besarnya berkisar dari 0 hingga 1. mereka berasal dari hasil replikasi sebuah alel pada generasi sebelumnya. Aa. maka frekuensi genotipe AA. Gambar 15. Aa. Loop adalah jalan yang menghubungkan kedua orang tua C D X (C dan D) melewati leluhur bersama (A dan B). * Hitung nilai F dengan rumus : F = Σ (½)n(1 + FA) n = jumlah individu yang terdapat pada tiap loop (pada soal ini terdapat 3 individu. Pada soal ini terdapat dua X loop. Pertama. dan aa masing-masing adalah p2. dan biasanya dilambangkan dengan F. Nilai F sama dengan 0 apabila kedua alel pada individu homozigot tidak mempunyai asal. 2 pq.3. pada individu X besarnya ¼.

sebagai tetua betina dapat digunakan baik hibrid H maupun hibrid I karena kedua-duanya mempunyai tongkol yang besar. batang lemah) dan aaBB (akar lemah. jika silang dalam dapat menyebabkan terjadinya tekanan silang dalam yang berpengaruh buruk terhadap individu yang dihasilkan. Namun. mendapatkan hibrid H. ada alel A yang menyebabkan akar tanaman tumbuh kuat sementara alel a menjadikan akar tanaman lemah. akan menciptakan variasi genetik yang berguna untuk mengantisipasi perubahan kondisi lingkungan yang sewaktu- . 11/03/2009 Posted by zaifbio | Genetika Dasar | 2 Komentar MUTASI BAB XI MUTASI • Pengertian Mutasi • Mekanisme Molekuler Mutasi • Mutasi Spontan dan Mutasi Induksi • Estimasi Laju Mutasi Spontan dengan Metode Clb • Mutagen Kimia dan Fisika • Mekanisme Perbaikan DNA • Mutasi Balik dan Mutasi Penekan • Uji Ames BAB XI. di samping segregasi dan rekombinasi. yang pada prinsipnya menyebutkan bahwa alel-alel reseif merugikan yang dibawa oleh masing-masing galur murni akan tertutupi oleh alel dominan pada individu hibrid yang heterozigot. MUTASI Fungsi ketiga materi genetik adalah fungsi evolusi. batang kuat) akan menghasilkan hibrid AaBb yang mempunyai akar dan batang kuat. sedang alel b menyebabkan batang lemah. silang luar justru dapat memunculkan individu hibrid dengan sifat-sifat yang lebih baik daripada kedua tetuanya yang homozigot. yang agar dapat melaksanakannya materi genetik harus mempunyai kemampuan untuk melakukan mutasi. Fenomena keunggulan yang diperlihatkan oleh individu hibrid hasil persilangan dua tetua galur murni (homozigot) disebut sebagai vigor hibrida atau heterosis. Dalam silang ganda ini.dijumpai lagi. karena biji hibrid H ini dibawa oleh tongkol tetuanya (A atau B) yang kecil. Salah satu di antaranya adalah teori dominansi. Ada beberapa teori mengenai mekanisme genetik yang menjelaskan terjadinya heterosis. Silang luar Berkebalikan dengan silang dalam. Galur murni A disilangkan dengan galur murni B. Di samping itu. silang luar akan meningkatkan frekuensi heterozigot. Misalnya. alel B menyebabkan batang menjadi kokoh. antara lain untuk merakit varietas jagung hibrida. Sementara itu. Persilangan antara galur murni AAbb (akar kuat. Fenomena heterosis sudah sering sekali dimanfaatkan pada bidang pemuliaan tanaman. pada silang ganda hibrid H disilangkan dengan hibrid I hasil silang tunggal antara galur murni C dan D. maka jumlah bijinya menjadi sedikit dan tidak cukup untuk dijual kepada petani. Oleh karena itu. melainkan hasil silang tiga arah (three-way cross) atau silang ganda (double cross). Peristiwa mutasi atau perubahan materi genetik. Agak berbeda dengan silang tiga arah. jagung hibrida yang dipasarkan biasanya bukan hasil silang tunggal (single cross) seperti itu. Pada silang tiga arah hibrid H digunakan sebagai tetua betina untuk disilangkan lagi dengan galur murni lain sehingga biji hibrid yang dihasilkan akan dibawa oleh tongkol hibrid H yang ukurannya besar.

ada tidaknya pengaruh substitusi suatu asam amino terhadap perubahan sifat protein bergantung kepada peran asam amino tersebut dalam struktur dan fungsi protein. Setiap perubahan asam amino disebabkan oleh perubahan urutan basa nukleotida pada molekul DNA. Mekanisme terjadinya mutasi titik ini ada dua macam. alel mutan resesif tidak akan memunculkan pengaruh fenotipik selama berada di dalam individu heterozigot karena tertutupi oleh alel dominannya yang normal. Hal ini karena pelipatan rantai polipeptida sebagai penentu struktur tiga dimensi molekul protein sangat bergantung kepada interaksi di antara asam-asam amino dengan muatan yang berlawanan. Pengaruh fenotipik yang ditimbulkan oleh mutasi sangat bervariasi. yang bermuatan negatif. Substitusi sebuah asam amino oleh asam amino lain yang muatannya sama. yaitu (1) substitusi basa dan (2) perubahan rangka baca akibat adanya penambahan basa (adisi) atau kehilangan . Namun. Perubahan atau mutasi basa pada DNA yang tidak menyebabkan substitusi asam amino atau tidak memberikan pengaruh fenotipik dinamakan mutasi tenang (silent mutation). Pada tanaman tingkat tinggi mutasi somatis justru sering kali menghasilkan varietas-varietas yang diinginkan dan untuk perbanyakannya harus dilakukan secara vegetatif. yaitu individu dengan jaringan normal dan jaringan yang terdiri atas sel-sel somatis mutan. Alel-alel hasil mutasi somatis tidak akan diwariskan kepada keturunan individu yang mengalaminya karena mutasi ini tidak mempengaruhi sel-sel germinal. Seperti dikatakan di atas. Substitusi asam glutamat. Jadi. pada penderita anemia bulan sabit (sickle cell anemia) salah satu asam amino pada polipeptida β. Mekanisme Molekuler Mutasi Meskipun tidak selalu. oleh valin. sering kali tidak berpengaruh terhadap struktur molekul protein atau fenotipe individu. Hemoglobin pada individu dewasa normal terdiri atas dua rantai polipeptida α yang identik dan dua rantai polipeptida β yang identik juga. perubahan sebuah basa pada DNA tidak selamanya disertai oleh substitusi asam amino karena sebuah asam amino dapat disandi oleh lebih dari sebuah triplet kodon (lihat Bab X). yang tidak bermuatan atau netral. misalnya substitusi histidin oleh lisin. sedangkan mutasi somatis terjadi pada sel-sel selain sel germinal. Pada organisme multiseluler dapat dibedakan antara mutasi germinal dan mutasi somatis. Kita mengenal berbagai macam peristiwa mutasi sesuai dengan kriteria yang digunakan untuk mengelompokkannya. pada organisme diploid pengaruh mutasi juga bergantung kepada dominansi alel. Contoh yang paling sering dikemukakan adalah perubahan sifat biologi yang terjadi pada molekul hemoglobin. Mutasi yang terjadi pada sebuah atau sepasang basa pada DNA disebut sebagai mutasi titik (point mutation). Dalam hal ini. substitusi asam amino yang tidak menghasilkan perubahan sifat protein atau perubahan fenotipik pun dapat dikatakan sebagai mutasi tenang. Demikian juga. Namun. yakni asam glutamat. eritrositnya menjadi lonjong dan mudah pecah. Mutasi somatis akan menyebabkan terbentuknya khimera. perubahan urutan asam amino pada suatu protein dapat menyebabkan perubahan sifat-sifat biologi protein tersebut. Mutasi germinal terjadi pada sel-sel germinal atau sel-sel penghasil gamet. Akan tetapi.waktu dapat terjadi. Selain itu. Hemoglobin penderita anemia bulan sabit akan mengalami kristalisasi ketika tidak bereaksi dengan oksigen sehingga akan mengendap di pembuluh darah dan menyumbatnya. perubahan urutan asam amino tidak selalu menyebabkan perubahan sifat-sifat biologi protein atau menghasilkan fenotipe mutan. digantikan atau disubstitusi oleh valin. mengakibatkan perubahan struktur hemoglobin dan juga eritrosit yang membawanya. mulai dari perubahan kecil yang hanya dapat dideteksi melalui analisis biokimia hingga perubahan pada prosesproses esensial yang dapat mengakibatkan kematian sel atau bahkan organisme yang mengalaminya. Jenis sel dan tahap perkembangan individu menentukan besar kecilnya pengaruh mutasi.

basa (delesi). Mutasi titik yang disebabkan oleh substitusi basa dinamakan mutasi substitusi basa, sedangkan mutasi yang terjadi karena perubahan rangka baca dinamakan mutasi rangka baca (frameshift mutation) seperti telah disinggung pada Bab X. Apabila substitusi basa menyebabkan substitusi asam amino seperti pada kasus hemoglobin anemia bulan sabit, maka mutasinya dinamakan mutasi salah makna (missense mutation). Sementara itu, jika substitusi basa menghasilkan kodon stop, misalnya UAU (tirosin) menjadi UAG (stop), maka mutasinya dinamakan mutasi tanpa makna (nonsense mutation) atau mutasi terminasi rantai (chain termination mutation). Substitusi basa pada sebuah triplet kodon dapat menghasilkan sembilan kemungkinan perubahan triplet kodon karena tiap basa mempunyai tiga kemungkinan substitusi. Sebagai contoh, kodon UAU dapat mengalami substitusi basa menjadi AAU (asparagin), GAU (asam aspartat), CAU (histidin), UUU (fenilalanin), UGU (sistein), UCU (serin), UAA (stop), UAG (stop), dan UAC (tirosin). Kita bisa melihat bahwa perubahan yang terakhir, yakni UAC, tidak menghasilkan substitusi asam amino karena baik UAC maupun UAU menyandi asam amino tirosin. Mutasi substitusi basa dapat dibedakan menjadi dua kelompok, yaitu transisi dan transversi. Pada transisi terjadi substitusi basa purin oleh purin atau substitusi pirimidin oleh pirimidin, sedangkan pada transversi terjadi substitusi purin oleh pirimidin atau pirimidin oleh purin. Secara skema kedua macam substitusi basa tersebut dapat dilihat pada Gambar 11.1. A TC G Gambar 11.1. Skema substitusi basa nukleotida transisi transversi Sementara itu, mutasi rangka baca akan mengakibatkan perubahan rangka baca semua triplet kodon di belakang tempat terjadinya mutasi tersebut. Akan tetapi, adisi atau pun delesi sebanyak kelipatan tiga basa pada umumnya tidak akan menimbulkan pengaruh fenotipik mutasi rangka baca. Demikian pula, seperti dikatakan pada Bab X adisi satu basa yang diimbangi oleh delesi satu basa di tempat lain, atau sebaliknya, akan memperbaiki kembali rangka baca di belakang tempat tersebut. Selain itu, apabila adisi atau delesi terjadi pada daerah yang sangat dekat dengan ujung karboksil suatu protein, maka mutasi rangka baca yang ditimbulkannya tidak akan menyebabkan sintesis protein nonfungsional. Dengan perkataan lain, mutasi tidak memberikan pengaruh fenotipik. Mutasi Spontan Perubahan urutan basa nukleotida berlangsung spontan dan acak. Tidak ada satu pun cara yang dapat digunakan untuk memprediksi saat dan tempat akan terjadinya suatu mutasi. Meskipun demikian, setiap gen dapat dipastikan mengalami mutasi dengan laju tertentu sehingga memungkinkan untuk ditetapkan peluang mutasinya. Artinya, kita dapat menentukan besarnya peluang bagi suatu gen untuk bermutasi sehingga besarnya peluang untuk mendapatkan suatu alel mutan dari gen tersebut di dalam populasi juga dapat dihitung. Terjadinya suatu peristiwa mutasi tidak dapat dikatakan sebagai hasil adaptasi sel atau organisme terhadap kondisi lingkungannya. Kebanyakan mutasi memperlihatkan pengaruh yang sangat bervariasi terhadap tingkat kemampuan adaptasi sel atau organisme, mulai dari netral (sangat adaptable) hingga letal (tidak adaptable). Oleh karena itu, tidak ada korelasi yang nyata antara mutasi dan adaptasi. Namun, pemikiran bahwa mutasi tidak ada sangkut pautnya dengan adaptasi tidak diterima oleh sebagian besar ahli biologi hingga akhir tahun 1940-an ketika Joshua dan Esther Lederberg melalui percobaannya pada bakteri

membuktikan bahwa mutasi bukanlah hasil adaptasi. Dengan teknik yang dinamakan replica plating koloni-koloni bakteri pada kultur awal (master plate) dipindahkan ke medium baru (replica plate) menggunakan velvet steril sehingga posisi setiap koloni pada medium baru akan sama dengan posisinya masing-masing pada kultur awal. Medium baru dibuat dua macam, yaitu medium nonselektif seperti pada kultur awal dan medium selektif yang mengandung lebih kurang 109 fag T1. Hanya koloni-koloni mutan yang resisten terhadap infeksi fag T1 (mutan T1-r) yang dapat tumbuh pada medium selektif ini. Dari percobaan tersebut terlihat bahwa koloni-koloni mutan T1-r yang tumbuh pada medium selektif tidak terbentuk sebagai hasil adaptasi terhadap kehadiran fag T1, tetapi sebenarnya sudah ada semenjak pada kultur awal. Dengan demikian, teknik selektif semacam itu hanya akan menyeleksi mutan-mutan yang telah ada sebelumnya di dalam suatu populasi. master plate transfer replica plate replica plate (medium nonselektif) (medium selektif) Gambar 11.2. Percobaan transfer koloni (replica plating) = koloni mutan T1-r Teknik selektif seperti yang diuraikan di atas memberikan dasar bagi pemahaman tentang munculnya resistensi berbagai populasi hama dan penyakit terhadap senyawa kimia yang digunakan untuk mengendalikannya. Sebagai contoh, sejumlah populasi lalat rumah saat ini nampak sangat resisten terhadap insektisida DDT. Hal ini menunjukkan betapa seleksi telah memunculkan populasi lalat rumah dengan kombinasi mekanisme enzimatik, anatomi, dan perilaku untuk dapat resisten terhadap atau menghindari bahan kimia tersebut. Begitu pula, gejala peningkatan resistensi terhadap antibiotik yang diperlihatkan oleh berbagai macam bakteri penyebab penyakit pada manusia tidak lain merupakan akibat proses seleksi untuk memunculkan dominansi strain-strain mutan tahan antibiotik yang sebenarnya memang telah ada sebelumnya. Laju mutasi Laju mutasi adalah peluang terjadinya mutasi pada sebuah gen dalam satu generasi atau dalam pembentukan satu gamet. Pengukuran laju mutasi penting untuk dilakukan di dalam genetika populasi, studi evolusi, dan analisis pengaruh mutagen lingkungan. Mutasi spontan biasanya merupakan peristiwa yang sangat jarang terjadi sehingga untuk memperkirakan peluang kejadiannya diperlukan populasi yang sangat besar dengan teknik tertentu. Salah satu teknik yang telah digunakan untuk mengukur laju mutasi adalah metode ClB yang ditemukan oleh Herman Muller. Metode ClB mengacu kepada suatu kromosom X lalat Drosophila melanogaster yang memiliki sifat-sifat tertentu. Teknik ini dirancang untuk mendeteksi mutasi yang terjadi pada kromosom X normal. Kromosom X pada metode ClB mempunyai tiga ciri penting, yaitu (1) inversi yang sangat besar (C), yang menghalangi terjadinya pindah silang pada individu betina heterozigot; (2) letal resesif (l); dan (3) marker dominan Bar (B) yang menjadikan mata sempit (lihat Bab VII). Dengan adanya letal resesif, individu jantan dengan kromosom tersebut dan individu betina homozigot tidak akan bertahan hidup. Persilangan pertama dilakukan antara betina heterozigot untuk kromosom ClB dan jantan dengan kromosom X normal. Di antara keturunan yang diperoleh, dipilih individu betina yang mempunyai mata Bar untuk selanjutnya pada persilangan kedua dikawinkan dengan jantan normal. Individu betina dengan mata Bar ini jelas mempunyai genotipe heterozigot

karena menerima kromosom ClB dari tetua betina dan kromosom X normal dari tetua jantannya. Hasil persilangan kedua yang diharapkan adalah dua betina berbanding dengan satu jantan. Ada tidaknya individu jantan hasil persilangan kedua ini digunakan untuk mengestimasi laju mutasi letal resesif. Oleh karena pindah silang pada kromosom X dihalangi oleh adanya inversi (C) pada individu betina, maka semua individu jantan hasil persilangan hanya akan mempunyai genotipe + . Kromosom X pada individu jantan ini berasal dari tetua jantan awal (persilangan pertama). Sementara itu, individu jantan dengan kromosom X ClB selalu mengalami kematian. Meskipun demikian, kadang-kadang pada persilangan kedua tidak diperoleh individu jantan sama sekali. Artinya, individu jantan yang mati tidak hanya yang membawa kromosom ClB, tetapi juga individu yang membawa kromosom X dari tetua jantan awal. Jika hal ini terjadi, kita dapat menyimpulkan bahwa kromosom X pada tetua jantan awal yang semula normal berubah atau bermutasi menjadi kromosom X dengan letal resesif. Dengan menghitung frekuensi terjadinya kematian pada individu jantan yang seharusnya hidup ini, dapat dilakukan estimasi kuantitatif terhadap laju mutasi yang menyebabkan terbentuknya alel letal resesif pada kromosom X. Ternyata, lebih kurang 0,15% kromosom X terlihat mengalami mutasi semacam itu selama spermatogenesis, yang berarti bahwa laju mutasi untuk mendapatkan letal resesif per kromosom X per gamet adalah 1,5 x 10-3. betina Bar ClB + jantan normal ClB ? + ? ClB + letal betina Bar (dipilih untuk disilangkan dengan jantan normal) ClB ? + ClB + ? + ClB ? letal letal jika X-nya membawa letal resesif Gambar 11.3. Metode ClB untuk mengestimasi laju mutasi = kromosom X yang berasal dari tetua jantan pada persilangan pertama Pada metode ClB tidak diketahui laju mutasi gen tertentu karena kita tidak dapat memastikan banyaknya gen pada kromosom X yang apabila mengalami mutasi akan berubah menjadi alel resesif yang mematikan. Namun, semenjak ditemukannya metode ClB berkembang pula sejumlah metode lain untuk mengestimasi laju mutasi pada berbagai organisme. Hasilnya menunjukkan bahwa laju mutasi sangat bervariasi antara gen yang satu dan lainnya. Sebagai contoh, laju mutasi untuk terbentuknya tubuh berwarna kuning pada Drosophila adalah 10-4 per gamet per generasi, sementara laju mutasi untuk terbentuknya resitensi terhadap streptomisin pada E. coli adalah 10-9 per sel per generasi. Asal-mula terjadinya mutasi spontan Ada tiga mekanisme yang paling penting pada mutasi spontan, yaitu (1) kesalahan selama replikasi, (2) perubahan basa nukleotida secara spontan, dan (3) peristiwa-peristiwa yang berkaitan dengan penyisipan (insersi) dan pemotongan (eksisi) unsur-unsur yang dapat

tetapi mengenali kesalahan basa di dalam untai DNA. Sistem perbaikan salah pasangan akan mengoreksi kesalahan semacam itu. Mutasi dengan laju yang ditingkatkan ini dinamakan mutasi induksi. Agen yang dapat menyebabkan terjadinya mutasi seperti sinar X ini dinamakan mutagen. dengan bantuan enzim Pol I celah ini akan diisi oleh segmen baru yang membawa basa yang telah diperbaiki. Kadang-kadang ada juga kesalahan pasangan basa yang tidak dikenalinya. Dalam hal ini hilangnya gugus amino dari sitosin yang telah termetilasi tidak dapat dikenali oleh sistem perbaikan salah pasangan. Bukti pertama bahwa agen eksternal dapat meningkatkan laju mutasi diperoleh dari penelitian H. basa tersebut akan membentuk ikatan hidrogen yang benar dengan basa pada untai DNA cetakan sehingga fungsi penyuntingan oleh DNA polimerase tidak dapat mengenalinya. Berbeda dengan sistem penyuntingan oleh DNA polimerase.4. Sistem ini dikenal sebagai sistem perbaikan salah pasangan (mismatch repair). Sumber mutasi spontan lainnya adalah perubahan basa sitosin yang telah termetilasi menjadi timin karena hilangnya gugus amino. Mutasi Induksi Laju mutasi spontan yang sangat rendah ternyata dapat ditingkatkan dengan aplikasi berbagai agen eksternal. ada sistem lain yang berfungsi dalam perbaikan kesalahan replikasi DNA. Pada Bab IX telah kita bicarakan bahwa enzim Pol I dan Pol III adakalanya membuat kesalahan dengan menyisipkan basa yang salah ketika replikasi DNA sedang berlangsung. seperti halnya mekanisme penyuntingan oleh DNA polimerase. tidaklah sempurna sama sekali. Akan tetapi. sistem perbaikan salah pasangan tidak bekerja pada ujung 3’ untai DNA yang sedang tumbuh. jika segmen yang membawa kesalahan basa tersebut telah mengalami metilasi. Sistem perbaikan salah pasangan. Aktivitas penyuntingan oleh DNA polimerase boleh dikatakan sangat efisien meskipun tidak berarti sempurna benar. enzim-enzim DNA polimerase ini juga diketahui mempunyai kemampuan untuk memperbaiki kesalahan (proof reading) melalui aktivitas eksonukleasenya dengan cara memotong basa yang salah pada ujung 3’ untai DNA yang sedang dipolimerisasi. dan basa timin yang seharusnya sitosin tersebut tidak dilihat sebagai basa yang salah. . Namun. Sitosin yang seharusnya berpasangan dengan guanin berubah menjadi timin yang berpasangan dengan adenin sehingga terjadilah mutasi transisi (purin menjadi purin. Selanjutnya. Hal ini akan menimbulkan mutasi spontan. segmen DNA yang membawa basa yang salah dibuang sehingga terdapat celah (gap) di dalam untai DNA. maka sistem perbaikan salah pasangan tidak dapat membedakan antara untai cetakan dan untai baru. Kadang-kadang suatu kesalahan replikasi luput dari mekanisme penyuntingan tersebut. timbullah mutasi spontan. 5’ GAGTCGAATC 3’ untai cetakan 3’ CTCAGTTTAG 5’ untai baru GAGTCGAATC CTC AG AGTTT segmen dengan perbaikan eksisi basa yang salah GAGTCGAATC CTCAGCTTAG untai yang telah diperbaiki Gambar 11. Akan tetapi. Mekanisme perbaikan salah pasangan Basa-basa tautomerik adakalanya dapat tergabung dengan benar ke dalam molekul DNA. Jika hal ini terjadi.berpindah (transposable elements). pirimidin menjadi pirimidin). Pada saat penggabungan berlangsung. Caranya. Muller pada tahun 1927 yang memperlihatkan bahwa sinar X dapat menyebabkan mutasi pada Drosophila.

Akan tetapi. Hal ini karena suatu basa analog dapat berpasangan dengan basa tertentu pada untai DNA cetakan. BU telah menginduksi mutasi tautomerik berupa transisi GC menjadi AT. Akibatnya. konsentrasi dTTP akan menentukan konsentrasi ketiga dNTP lainnya untuk keperluan sintesis DNA. maka basa analog ini dikatakan bersifat mutagenik. keberadaan BU ternyata menyebabkan laju perbaikan menjadi tertinggal oleh laju salah pasangan. Dengan demikian. yaitu keto dan enol sehingga dapat membentuk ikatan hidrogen dengan dua macam cara. BU sebagai basa yang analog dengan timin juga dapat menghambat sintesis dCTP. Dengan mutagen-mutagen ini dapat diperoleh bermacam-macam mutan pada beberapa spesies organisme. Percobaan-percobaan berikutnya menunjukkan bahwa mekanisme mutagenesis BU dapat terjadi dengan cara lain. dan pada putaran replikasi berikutnya. maka dTTP akan disintesis dalam jumlah normal tetapi sintesis dCTP akan sangat terhambat. bisa juga masuknya sebuah basa analog terkoreksi melalui mekanisme penyuntingan oleh enzim DNA polimerase. Jika sel yang akan dimutasi ditumbuhkan pada medium yang mengandung BU dalam bentuk keto.5). Sementara itu. A=T substitusi T oleh BU (keto) A=BU replikasi 1 A=T G=BU pengikatan G oleh BU (enol) replikasi 2 A=T A=T G=C A=BU transisi Gambar 11. Mutasi tautomerik (transisi) akibat basa analog 5-bromourasil Mutagen-mutagen kimia Berbeda dengan basa analog yang hanya bersifat mutagenik ketika DNA sedang melakukan replikasi. Mekanisme penyuntingan dan perbaikan salah pasangan sebenarnya dapat membuang basa timin yang salah berpasangan dengan guanin tersebut. nisbah dTTP terhadap dCTP menjadi sangat tinggi dan frekuensi salah pasangan GT. molekul DNA yang baru akan mempunyai pasangan basa GC pada posisi yang seharusnya ditempati oleh pasangan basa AT. Jika BU ditambahkan ke dalam medium pertumbuhan. Akan tetapi. maka selama replikasi DNA adakalanya timin digantikan oleh BU sehingga pasangan basa AT berubah menjadi ABU.5. Pada putaran replikasi berikutnya basa timin pada pasangan GT akan berpasangan dengan adenin sehingga posisi yang seharusnya ditempati oleh GC sekarang diganti dengan AT. berbagai mutagen fisika dan kimia digunakan untuk meningkatkan laju mutasi. jika BU berada dalam bentuk enol. Sebagai contoh. Apabila suatu basa analog dapat membentuk ikatan hidrogen dengan dua macam cara. Namun. akan meningkat. Konsentrasi deoksinukleosida trifofat (dNTP) di dalam sel pada umumnya diatur oleh konsentrasi deoksitimidin trifosfat (dTTP). Basa ini analog dengan basa timin karena hanya berbeda pada posisi gugus metil yang diganti dengan atom bromium. Penggantian ini belum dapat dikatakan sebagai peristiwa mutasi. maka BU akan berpasangan dengan guanin (GBU). telah terjadi mutasi tautomerik berupa transisi dari AT ke GC (Gambar 11. Basa analog Basa analog merupakan senyawa kimia yang struktur molekulnya sangat menyerupai basa nukleotida DNA sehingga dapat menjadi bagian yang menyatu di dalam molekul DNA selama berlangsungnya replikasi normal. maka akan terjadi hambatan dalam sintesis dCTP. yang seharusnya GC. Apabila suatu saat dTTP terdapat dalam jumlah yang sangat berlebihan.Semenjak penemuan Muller tersebut. mutagen kimia dapat mengakibatkan mutasi pada DNA baik yang sedang . dapat mempunyai dua macam bentuk. Artinya. Dengan perkataan lain. basa 5-bromourasil (BU) yang diketahui mudah sekali bergabung dengan DNA bakteri dan virus.

Perubahan ini tidak lain merupakan mutasi tautomerik jenis transversi.bereplikasi maupun yang tidak sedang bereplikasi. memiliki struktur molekul berupa tiga cincin sehingga sangat menyerupai pasangan basa purin – pirimidin atau pirimidin – purin. Pengaruh ini disebabkan oleh terjadinya perubahan kimia pada . Akibatnya. Besarnya perenggangan sama dengan tebal molekul akridin. yang berpasangan dengan sitosin. maka untai DNA hasil replikasi akan ada yang mengalami adisi dan ada yang mengalami delesi pada posisi terjadinya interkalasi. Interkalasi Senyawa kimia akridin. maka replikasi akan terhenti tepat di depan celah dan kemudian dimulai lagi dengan menyisipkan basa adenin pada posisi yang komplementer dengan celah tersebut. Dengan demikian. dan guanin menjadi gugus keto (=O) sehingga spesifisitas pengikatan hidrogen pada basa-basa tersebut juga mengalami perubahan.6. O CH2 – CH2 – Cl CH3 – CH2 – O – S – CH3 HN O CH2 – CH2 – Cl etilmetan sulfonat mustard nitrogen Gambar 11. Beberapa di antara mutagen kimia. deaminasi sitosin yang menghasilkan urasil akan mengakibatkan transisi GC menjadi AT melalui AU. akridin dapat menyisip di antara dua pasangan basa yang berdekatan pada molekul DNA. misalnya asam nitros (HNO2). baik letal maupun mutagenik. Akan tetapi. Struktur molekul dua agen alkilasi yang umum digunakan Fenomena lain yang dapat muncul akibat terjadinya alkilasi guanin adalah depurinasi. memberikan pengaruh dengan spektrum yang luas. Pengaruh interkalasi terhadap molekul DNA adalah terjadinya perenggangan jarak antara dua pasangan basa yang berurutan. Dengan struktur yang sangat menyerupai sebuah pasangan basa. Deaminasi adenin akan menghasilkan hipoksantin (H). mutasi yang ditimbulkan bukanlah mutasi tautomerik. menimbulkan perubahan yang sangat khas. pada semua jenis virus dan sel. beberapa lainnya. yaitu hilangnya basa purin yang telah mengalami alkilasi tersebut dari molekul DNA karena patahnya ikatan yang menghubungkannya dengan gula deoksiribosa. melainkan mutasi rangka baca. Apabila DNA yang membawa akridin tadi melakukan replikasi. Iradiasi ultraviolet Sinar ultraviolet (UV) dapat menghasilkan pengaruh. setelah replikasi basa adenin di posisi celah tersebut akan berpasangan dengan timin atau terjadi pasangan TA. HNO2 bekerja sebagai mutagen dengan mengubah gugus amino (NH2) pada basa adenin. Jika hal ini terjadi. Selain itu. Oleh karena itu pada posisi celah tersebut terjadi perubahan dari GC menjadi TA atau purin-pirimidin menjadi pirimidin-purin. Alkilasi pada basa G atau T akan menyebabkan terjadinya salah pasangan yang mengarah kepada transisi AT→ GC dan GC → AT. Agen alkilasi etilmetan sulfonat (EMS) dan mustard nitrogen merupakan mutagen-mutagen kimia yang banyak digunakan dalam penelitian genetika. yang salah satu contohnya adalah proflavin (Bab X). Namun. Depurinasi tidak selalu bersifat mutagenik karena celah yang terbentuk dengan hilangnya basa purin tadi dapat segera diperbaiki. maka agen-agen alkilasi sangat efektif untuk digunakan pada sistem eukariot. Padahal seharusnya pasangan basa pada posisi celah tersebut adalah GC (bukankah yang hilang adalah G?). Dengan mekanisme serupa. Kedua-duanya akan memberikan gugus etil (C2H5) atau sejenisnya kepada basa DNA. Peristiwa penyisipan semacam ini dinamakan interkalasi. Jika HNO2 terbukti sangat bermanfaat pada sistem prokariot. garpu replikasi sering kali terlebih dahulu telah mencapai celah tersebut sebelum perbaikan sempat dilakukan. sitosin. Hal ini mengakibatkan terjadinya transisi AT menjadi GC melaui HC. misalnya agen-agen alkilasi. EMS dapat juga bereaksi dengan A dan C.

d). khususnya timin dimer. Pada mekanisme pertama. Akibatnya. untai DNA hasil polimerisasi akan mempunyai celah pada posisi dimer.8. DNA yang membawa dimer pada kedua untainya melakukan replikasi (Gambar 11. yakni di sekitar dimer. sedangkan kedua untai DNA baru tidak mempunyai celah lagi (Gambar 11. Pada mekanisme yang kedua pemotongan mula-mula hanya terjadi pada satu tempat. Hasilnya berupa . Pada celah yang terbentuk akibat pemotongan tersebut segera terjadi sintesis segmen baru dengan urutan basa yang benar.8. baik ketika ada cahaya maupun tidak ada cahaya. Pada waktu yang sama terjadi pemotongan lagi pada segmen yang membawa dimer sehingga segmen ini terlepas dari untai DNA. Untuk jelasnya. replikasi DNA akan terhalang pada posisi terjadinya timin dimer tersebut. perbaikan kerusakan DNA dengan cara rekombinasi terjadi setelah replikasi berlangsung. Akhirnya. eksisi. Akibatnya. aktivasinya memerlukan spektrum biru cahaya sehingga enzim tersebut hanya bisa bekerja apabila ada cahaya. mekanisme ini sering juga dikatakan sebagai rekombinasi pascareplikasi.8. Mekanisme rekombinasi pada prinsipnya merupakan cara untuk menutup celah tersebut menggunakan segmen yang sesuai pada untai DNA cetakan yang membawa dimer. Eksisi Perbaikan dengan cara eksisi merupakan proses enzimatik bertahap yang diawali dengan pembuangan dimer dari molekul DNA. Akibatnya. Seperti pada mekanisme yang pertama. segmen yang membawa dimer akan terlepas dari untai DNA. Akan tetapi. Fotoreaktivasi Mekanisme perbaikan ini bergantung kepada cahaya. Oleh karena itu. segmen yang baru tersebut diligasi dengan untai DNA sehingga untai DNA ini sekarang tidak lagi membawa dimer. Dengan adanya timin dimer. segmen penutup celah akan terligasi dengan sempurna pada masing-masing untai DNA baru (Gambar 11. Celah akan diisi oleh segmen yang sesuai dari masingmasing untai DNA cetakan yang membawa dimer. rekombinasi. skema mekanisme tersebut dapat dilihat pada Gambar 11.b).8. proses ini diakhiri dengan ligasi segmen yang baru tadi dengan untai DNA. enzim endonuklease melakukan pemotongan (eksisi) pada dua tempat yang mengapit dimer. Rekombinasi Berbeda dengan dua mekanisme yang telah dijelaskan sebelumnya. Dengan adanya cahaya. Pengaruh terbesar yang ditimbulkan oleh iradiasi sinar UV adalah terbentuknya pirimidin dimer. diikuti oleh resintesis segmen DNA baru. Mekanisme SOS Mekanisme perbaikan DNA dengan sistem SOS dapat dilihat sebagai jalan pintas yang memungkinkan replikasi tetap berlangsung meskipun harus melintasi dimer. dan diakhiri oleh ligasi segmen tersebut dengan untai DNA. Pembuangan segmen ini kemudian diikuti oleh sintesis segmen baru yang akan menggantikannya dengan bantuan enzim DNA polimerase I. sekarang kedua untai DNA cetakan selain membawa dimer juga mempunyai celah. Ada dua mekanisme eksisi yang agak berbeda. ikatan antara timin dan timin akan terputus oleh suatu enzim tertentu. Akhirnya.basa DNA akibat absorpsi energi dari sinar tersebut. Sebenarnya enzim tersebut telah mengikat dimer. Namun. dan SOS.8. maka polimerisasi akan terhenti sejenak untuk kemudian dimulai lagi dari posisi setelah dimer.c). Jadi. yaitu fotoreaktivasi. pada untai DNA cetakan terdapat segmen yang hilang.a) sehingga pada waktu garpu replikasi mencapai dimer akan terbentuk celah pada kedua untai DNA yang baru (Gambar 11. kerusakan DNA ini pada umumnya dapat diperbaiki melalui salah satu di antara empat macam mekanisme. yaitu saling terikatnya dua molekul timin yang berurutan pada sebuah untai DNA. Ketika DNA polimerase sampai pada suatu dimer.

Akibatnya. sedangkan sistem perbaikan salah pasangan sebenarnya dapat memperbaikinya. Namun. Sistem penyuntingan tidak dapat memperbaiki kesalahan ini karena tidak aktif. sistem penyuntingan oleh DNA polimerase III justru menjadi tidak aktif. Semua bentuk radiasi pengion akan menyebabkan pengaruh mutagenik dan letal pada virus dan sel. mutasi tetap terjadi. Pemaparan sebesar 1000 rad meningkatkan . Hal ini dimaksudkan agar polimerisasi tetap dapat berjalan melintasi dimer. Mekanisme eksisi untuk memperbaiki DNA Ketika sistem SOS aktif. karena jumlah dimer di dalam setiap sel yang mengalami iradiasi UV biasanya begitu banyak. Frekuensi mutasi yang diinduksi oleh sinar X sebanding dengan dosis radiasi yang diberikan. Dengan sendirinya. mekanisme SOS dapat dikatakan sebagai sistem perbaikan yang rentan terhadap kesalahan.8. Oleh karena itu. Radiasi pengion meliputi sinar X beserta partikel-partikelnya dan radiasi yang dihasilkan oleh unsur-unsur radioaktif seperti partikel α.untai DNA yang utuh tetapi sering kali sangat defektif. maka sistem perbaikan salah pasangan tidak dapat memperbaiki semua kesalahan yang ada.7. Intensitas radiasi pengion dinyatakan secara kuantitatif dengan beberapa macam cara. Pengaruh mutagenik iradiasi UV memang hampir selalu merupakan akibat perbaikan yang rentan terhadap kesalahan. dimer pemotongan di dua tempat pemotongan di satu tempat di sekitar dimer resintesis segmen baru oleh Pol I pemotongan segmen ligasi yang membawa dimer ligasi Gambar 11. yang didefinisikan sebagai besarnya radiasi yang menyebabkan absorpsi energi sebesar 100 erg pada setiap gram materi. Untai DNA yang baru akan mempunyai dua basa adenin berurutan pada posisi dimer (dalam kasus timin dimer). Sebagai contoh. Skema mekanisme rekombinasi pascareplikasi = pirimidin dimer = penutupan celah oleh segmen dari untai DNA cetakan yang membawa dimer Radiasi pengion Radiasi pengion mempunyai energi yang begitu besar sehingga molekul air dan senyawa kimia lainnya yang terkena olehnya akan terurai menjadi fragmen-fragmen bermuatan listrik. Ukuran yang paling lazim digunakan adalah rad. a) b) d) c) Gambar 11. kedua adenin ini tidak dapat berpasangan dengan timin karena kedua timin berada dalam bentuk dimer. dan sinar γ. β. frekuensi letal resesif pada kromosom X Drosophila meningkat linier sejalan dengan meningkatnya dosis radiasi sinar X.

maka sel tumor yang dirusak akan jauh lebih banyak daripada sel normal yang dirusak. Oleh karena itu. baik intra. betapapun rendahnya dosis radiasi. iradiasi biasanya dilakukan dengan selang waktu beberapa hari agar sel-sel tumor yang semula sedang beristirahat kemudian melakukan mitosis. pada beberapa organisme terdapat sistem yang dapat memperbaiki kerusakan kromosom tersebut meskipun perbaikan yang dilakukan sering mengakibatkan delesi. kerusakan pada kedua untai. Diharapkan setelah iradiasi diberikan selama kurun waktu tertentu. duplikasi. yaitu perbaikan rangka baca dengan kompensasi adisi-delesi sehingga rangka baca yang bergeser sebagian besar dapat dikembalikan seperti semula.maupun intergenik. Pada strain normal asam amino yang ke-210 adalah glisin. Perubahan glisin menjadi asam glutamat sebenarnya . mutasi akan tetap terinduksi. coli. Salah satu di antara dua polipeptida yang menyusun enzim tersebut adalah polipeptida A yang terdiri atas 268 asam amino. Mutasi semacam ini dinamakan mutasi balik atau reversi. dan perubahan basa nukleotida. atau sering dikatakan sebagai mutasi ke depan (forward mutation). seperti telah disinggung pada Bab X. Dengan perkataan lain. Pada Drosophila tidak terdapat ambang bawah dosis pemaparan yang yang tidak menyebabkan mutasi. Radiasi pengion banyak digunakan dalam terapi tumor. Pada cara yang kedua tidak terjadi adisi dan delesi pada urutan basa. Pada eukariot radiasi pengion dapat menyebabkan kerusakan kromosom.frekuensi mutasi dari laju mutasi spontan sebesar 0. Pada prinsipnya perlakuan ini dimaksudkan untuk meningkatkan frekuensi kerusakan kromosom pada sel-sel yang sedang mengalami mitosis. Artinya.15% menjadi 3%. Ada tiga macam kerusakan DNA yang disebabkan oleh radiasi pengion. Penekanan intragenik Pada garis besarnya ada dua macam cara penekanan intragenik. Kebanyakan mutasi penekan. Ada dua mekanisme yang berbeda pada mutasi balik. Pengaruh mutagenik dan letal yang ditimbulkan oleh radiasi pengion terutama berkaitan dengan kerusakan DNA. Akan tetapi. dan translokasi. Oleh karena tumor mengandung banyak sekali sel yang mengalami mitosis sementara jaringan normal tidak. Sebagai contoh dapat dikemukakan penekanan mutasi enzim triptofan sintetase pada E. terjadi penekanan intragenik. Mekanisme mutasi balik berupa mutasi penekan jauh lebih umum dijumpai daripada mekanisme yang pertama. inversi. yaitu (1) perubahan urutan basa pada DNA mutan sehingga benar-benar pulih seperti urutan basa pada fenotipe normalnya dan (2) terjadinya mutasi kedua di suatu tempat lainnya di dalam genom yang mengimbangi atau menekan pengaruh mutasi pertama sehingga mutasi yang kedua tersebut sering disebut sebagai mutasi penekan (suppressor mutation). semua sel tumor akan rusak. tetapi perubahan suatu asam amino yang mengakibatkan hilangnya aktivitas protein akan diimbangi oleh perubahan asam amino lainnya yang memulihkan aktivitas protein tersebut. yang disandi oleh gen trpA pada. Jika asam amino glisin ini berubah menjadi asam glutamat. Mutasi Balik dan Mutasi Penekan Kebanyakan mutasi yang telah kita bicarakan hingga saat ini adalah perubahan dari bentuk alami atau normal ke bentuk mutan. yang biasanya bersifat letal. mutasi dapat juga berlangsung dari bentuk mutan ke bentuk normal. yaitu kerusakan pada salah satu untai. Mutasi penekan dapat terjadi di suatu tempat di dalam gen yang sama dengan mutasi pertama yang ditekannya. Akan tetapi. mutasi penekan dapat juga terjadi di dalam gen yang lain atau bahkan di dalam kromosom yang lain sehingga peristiwanya dinamakan penekanan intergenik. maka enzim triptofan sintetase menjadi tidak aktif. Namun. tidak semua sel tumor mengalami mitosis pada waktu yang sama. maka pembacaan rangka baca akan menghasilkan fenotipe normal. tidak dapat sepenuhnya memulihkan mutan ke fenotipe normalnya seperti yang akan diuraikan di bawah ini. Jika bagian yang tidak dapat dipulihkan bukan merupakan urutan yang esensial. Cara yang pertama telah kita jelaskan pada Bab X. Namun.

Pengaruh yang ditimbulkannya adalah mengubah kekhususan pengenalan kodon pada mRNA oleh antikodon pada tRNA. atau dengan perkataan lain. maka pengaruhnya akan ditekan oleh perubahan glisin menjadi asam glutamat. Oleh karena itu. Begitu pula sebaliknya. Penekanan intergenik Penekanan intergenik yang paling umum dijumpai adalah penekanan oleh suatu produk mutasi gen terhadap pengaruh mutasi yang ditimbulkan oleh sejumlah gen lainnya. salah satu kodon untuk tirosin. Penekanan mutasi tanpa makna disebabkan oleh mutasi gen penyandi tRNA sehingga terjadi perubahan antikodon pada tRNA yang memungkinkannya untuk mengenali kodon stop hasil mutasi. dan (4) mutasi aminoasil sintetase yang kadang-kadang salah mengasilasi tRNA. Beberapa di antaranya dikenal potensial sebagai mutagen. Selain itu. mutasi penekan diberi lambang sup diikuti dengan angka (atau kadang-kadang huruf) yang membedakan penekan yang satu dengan penekan lainnya. Mutan-mutan ini gagal untuk membentuk plak (lihat Bab XII) pada strain bakteri standar tetapi dapat membentuk plak pada strain yang mengalami mutasi penekan. Namun. Akibatnya. perubahan ini mengakibatkan perubahan struktur pelipatan enzim sehingga secara tidak langsung akan mempengaruhi tapak aktifnya. Sel yang tidak mempunyai penekan dilambangkan dengan sup0.tidak menyebabkan inaktivasi enzim secara langsung karena glisin tidak terletak pada tapak aktif. perubahan glisin menjadi asam glutamat akan ditekan pengaruhnya oleh perubahan tirosin menjadi sistein. kodon UAG yang seharusnya merupakan kodon stop berubah menjadi kodon yang menyandi triptofan. Sebagai contoh. mutasi tRNA telah memulihkan mutasi tanpa makna. Penekanan mutasi salah makna oleh mutasi penekan intergenik antara lain dapat dilihat contohnya pada pemulihan aktivitas protein yang hilang akibat perubahan valin (tidak bermuatan) menjadi asam aspartat (bermuatan negatif). yang interaksinya dengan asam amino ke-210 menentukan aktivitas enzim. maka struktur pelipatan enzim yang telah berubah karena glisin digantikan oleh asam glutamat justru akan dipulihkan oleh interaksi sistein dengan asam glutamat. asam amino normal yang ke-174 adalah tirosin. Jadi. Mutasi ini dapat ditekan oleh molekul tRNA mutan yang membawa triptofan dengan antikodon AUC. Antikodon pada molekul tRNA normal yang membawa triptofan adalah AAC. coli yang dapat menekan mutan-mutan fag T4 tertentu. Pada notasi konvensional. Contoh yang paling dikenal dapat dilihat pada gen-gen penyandi tRNA. Mutasi semacam itu pertama kali ditemukan pada strain-strain E. Mutasi balik sebagai cara untuk mendeteksi mutagen dan karsinogen Dewasa ini terjadi peningkatan jumlah dan macam bahan kimia yang mencemari lingkungan. Mutasi penekan intergenik dapat memulihkan baik mutasi tanpa makna (nonsense) maupun mutasi salah makna (missense). jika perubahan tirosin menjadi sistein terjadi terlebih dahulu. Strain yang mengalami mutasi penekan ini ternyata juga dapat menekan mutasi pada sejumlah gen yang terdapat pada genom bakteri sendiri. uji mutagenesis terhadap bahan-bahan kimia . Dengan demikian. terminasi dapat dibatalkan. Apabila tirosin berubah menjadi sistein. Sementara itu. (2) mutasi pada tRNA yang mengubah sebuah basa di dekat antikodon sehingga tRNA dapat mengenali dua kodon yang berbeda. kebanyakan karsinogen juga merupakan mutagen. Pemulihan terjadi karena asam aspartat digantikan oleh alanin (tidak bermuatan). Substitusi ini dapat terjadi dengan empat macam cara. (3) mutasi di luar kala (loop) antikodon yang memungkinkan aminoasil sintetase mengenali tRNA sehingga terjadi asilasi yang menyebabkan tRNA ini membawa asam amino yang lain. yakni UAC dapat berubah menjadi kodon stop UAG. aktivitas enzim pun dapat dipulihkan. Dengan tRNA mutan. yaitu (1) mutasi antikodon yang memungkinkan tRNA untuk mengenali kodon yang berbeda seperti halnya yang terjadi pada pemulihan mutasi tanpa makna.

Meskipun demikian. Di dalam uji Ames mutan-mutan bakteri Salmonella typhimurium yang memerlukan pemberian histidin eksternal atau disebut dengan mutan His. strain-strain bakteri tersebut dibuat menjadi lebih sensitif terhadap mutagenesis dengan menggabungkan beberapa alel mutan yang dapat menginaktifkan sistem perbaikan eksisi dan menjadikannya lebih permiabel terhadap molekul-molekul asing. maka koloni bakteri akan terbentuk. Akibat dilakukannya uji Ames. tetapi setidak-tidaknya memperlihatkan adanya peluang seperti itu. banyak industri terpaksa mereformulasi produk-produknya. Apabila bahan kimia yang diuji adalah mutagen atau diubah menjadi mutagen. Oleh karena beberapa mutagen hanya bekerja pada DNA yang sedang melakukan replikasi. maka mereka akan mengubah bahan tersebut dari sifatnya yang semula tidak mutagenik menjadi mutagenik. Senyawa yang dicurigai potensial sebagai mutagen ditambahkan ke dalam medium padat. Enzim-enzim tersebut terdapat di dalam komponen sel-sel hati yang dinamakan fraksi mikrosomal. Fungsi normal enzim-enzim itu adalah melindungi organisme dari berbagai bahan beracun dengan cara mengubahnya menjadi bahan yang tidak beracun. Banyaknya koloni revertan (fenotipe normal hasil mutasi balik) yang muncul dihitung. maka medium pertumbuhan yang digunakan harus mengandung histidin dalam jumlah yang cukup untuk mendukung beberapa putaran replikasi tetapi tidak cukup untuk memungkinkan terbentuknya koloni yang dapat dilihat. Reaksireaksi enzimatik tersebut terjadi di dalam organ hati hewan dan tidak ada kesepadanannya di dalam sel bakteri. Mutan-mutan Hismembawa baik mutasi tautomerik maupun mutasi rangka baca. dan pada karsinogen tertentu juga nampak adanya korelasi dengan efektivitasnya pada hewan. ketika enzim-enzim itu bertemu dengan bahan kimia tertentu. diikuti dengan penaburan bakteri. Frekuensi mutasi balik ternyata bergantung kepada konsentrasi bahan kimia yang diuji. cara seperti tersebut di atas tidak dapat digunakan untuk memperlihatkan mutagenesis sejumlah besar karsinogen yang potensial. Fraksi mikrosomal dari hati tikus disebarkan ke permukaan medium.digunakan untuk menguji mutagenisitas senyawa kimia atas dasar mutasi baliknya menjadi His+. Ke dalam medium tersebut kemudian ditambahkan mutagen potensial yang akan diuji. pewarna rambut. Akan tetapi. Di samping itu. Bukti terakhir tentang karsinogenisitas suatu bahan kimia ditentukan atas dasar hasil uji pembentukan tumor pada hewan-hewan percobaan. Pemberian fraksi mikrosomal yang berasal dari hati tikus ke dalam medium pertumbuhan bakteri memungkinkan dilakukannya deteksi mutagenisitas. Cara yang paling sederhana untuk melihat mutagenesis suatu bahan kimia adalah uji mutasi balik menggunakan mutan nutrisional pada bakteri. Hal ini karena banyak sekali senyawa kimia yang tidak langsung bersifat mutagenik / karsinogenik. Uji Ames saat ini telah banyak digunakan pada beribu-ribu senyawa seperti pengawet makanan. Jadi. pestisida. diikuti dengan penaburan (plating) suatu mutan bakteri dalam jumlah tertentu. tetapi harus melalui beberapa reaksi enzimatik terlebih dahulu sebelum menjadi mutagen. Analisis kuantitatif terhadap frekuensi mutasi balik dapat dilakukan juga dengan membuat variasi jumlah mutagen potensial tersebut di dalam medium. dan kosmetika. uji Ames sebenarnya hanya berperan dalam mengurangi jumlah bahan kimia yang harus diuji menggunakan hewan percobaan. Peningkatan frekuensi revertan yang tajam apabila dibandingkan dengan frekuensi yang diperoleh di dalam medium tanpa senyawa kimia yang dicurigai tersebut mengindikasikan bahwa senyawa yang diuji adalah mutagen. Perlakuan ini mendasari teknik pemeriksaan karsinogen menggunakan metode yang dinamakan uji Ames. Frekuensi mutasi balik yang tinggi tidak serta-merta berarti bahwa senyawa yang diuji adalah karsinogen. 11/03/2009 Posted by zaifbio | Genetika Dasar | 8 Komentar .semacam ini perlu dilakukan.

DNA harus mampu mengatur pertumbuhan dan diferensiasi individu organisme sehingga dihasilkan suatu fenotipe tertentu. Setiap protein tersusun dari sejumlah asam amino dengan urutan tertentu. Urutan basa DNA yang pada akhirnya menyandi urutan asam amino disebut sebagai gen. mulai dari DNA hingga terbentuknya asam amino. Namun.1. sedangkan penerjemahan urutan basa RNA menjadi urutan asam amino suatu protein dinamakan translasi. . Dengan demikian. Diagram dogma sentral genetika molekuler Perubahan urutan basa di dalam molekul DNA menjadi urutan basa molekul RNA dinamakan transkripsi. EKSPRESI GEN Pada Bab IX telah disebutkan bahwa salah satu fungsi dasar yang harus dijalankan oleh DNA sebagai materi genetik adalah fungsi fenotipik. Fenotipe organisme sangat ditentukan oleh hasil interaksi protein-protein di dalam sel. proses tanskripsi dan translasi dapat dilihat sebagai tahaptahap ekspresi urutan basa DNA. Jadi. Artinya. Rangkaian proses ini.EKSPRESI GEN BAB X EKSPRESI GEN         Dogma Sentral Genetika Molekuler Perkembangan Konsep tentang Gen Transkripsi Tiga Macam RNA Translasi. tidak semua urutan basa DNA akan diekspresikan menjadi urutan asam amino. khususnya pada Prokariot Kode Genetik Mekanisme Pengaturan Ekspresi Gen pada Prokariot Mekanisme Pengaturan Ekspresi Gen pada Eukariot BAB X. dan setiap asam amino pembentukannya disandi (dikode) oleh urutan basa nitrogen di dalam molekul DNA. secara kimia gen adalah urutan basa nitrogen tertentu pada molekul DNA yang dapat dieskpresikan melalui tahap-tahap transkripsi dan translasi menjadi urutan asam amino tertentu. DNA replikasi RNA transkripsi translasi asam amino Gambar 10. dikenal sebagai dogma sentral genetika molekuler.

Sebagai contoh. Beadle dan E. setelah diketahui bahwa sebagian besar enzim tersusun dari beberapa polipetida. sinarX atau sinar uv . G. Dengan cara seperti ini Beadle dan Tatum memperlihatkan bahwa tiap mutasi menyebabkan kebutuhan akan pemberian satu macam faktor pertumbuhan. dengan mengorelasikan hasil analisis genetik dengan hasil analisis biokimia terhadap strainstrain mutan Neurospora tersebut dapat diketahui bahwa tiap mutasi menyebabkan hilangnya satu aktivitas enzim. Mutan hasil silang balik dengan nisbah keturunan tipe liar : mutan = 1 : 1 dipastikan sebagai mutan dengan hanya satu kelainan (mutasi). Tatum. dan masing-masing polipeptida merupakan produk gen yang berbeda. dan satu macam vitamin. muncul pertanyaan tentang hakekat sebuah gen : tiap gen menyandi satu protein ataukah tiap gen menyandi satu polipeptida ? Perkembangan konsep tentang gen dapat diikuti semenjak awal abad ke-20 ketika seorang dokter sekaligus ahli biokimia dari Inggris. Strain-strain mutan ini kemudian dianalisis lebih lanjut untuk mengetahui macam faktor pertumbuhan yang diperlukannya dengan cara melakukan variasi penambahannya ke dalam medium minimal. mempelajari mutasi gen pada jamur Neurospora crassa dengan menumbuhkan berbagai strain mutan hasil iradiasi menggunakan sinar X atau sinar ultraviolet pada medium lengkap dan medium minimal. yaitu polipeptida α dan polipeptida β. sebagai kontrol. Strain tipe liar. Sekitar 50 tahun kemudian dua orang peneliti. Dalam perkembangan berikutnya. Sebagai contoh. Maka. Selanjutnya. maka konsep terbaru tentang gen yang dianut hingga kini adalah satu gen – satu polipeptida. sebuah gula sederhana. yang untuk mendapatkannya dilakukan silang balik dengan strain tipe liar.Di atas telah kita katakan bahwa sejumlah asam amino dengan urutan (sekuens) tertentu akan menyusun sebuah molekul protein. Garrod mempelajari sejumlah penyakit metabolik bawaan pada manusia dan menyimpulkan bahwa setiap gangguan metabolisme bawaan yang menimbulkan penyakit tertentu. disebabkan oleh satu gen mutan resesif. Medium minimal adalah medium untuk pertumbuhan mikroorganisme yang hanya mengandung garam-garam anorganik. mampu tumbuh baik pada medium lengkap maupun pada medium minimal.L. Namun. W. Polipeptida α merupakan produk gen trpA. konsep satu gen mutan – satu hambatan metabolisme bergeser menjadi satu gen – satu enzim. Garrod. mengajukan konsep satu gen mutan – satu hambatan metabolisme. misalnya alkaptonuria. Mutan yang digunakan adalah mutan dengan hanya satu kelainan. setiap molekul protein sendiri dapat dilihat sebagai gabungan beberapa subunit yang dinamakan polipeptida. Oleh karena itu. mutan yang hanya tumbuh pada medium minimal yang ditambah dengan tiamin adalah mutan yang mengalami mutasi pada gen untuk biosintesis tiamin. sedangkan strain mutan hanya mampu tumbuh pada medium lengkap. Sir Archibald E. sedangkan polipeptida β merupakan produk gen trpB. enzim triptofan sintetase pada Escherichia coli terdiri atas dua buah polipeptida.

3.spora seksual konidia tipe liar silang balik medium lengkap medium minimal riboflavin piridoksin tiamin asam pantotenat kholin asam folat asam nukleat niasin inositol Gambar 10. 2. 4. guanosin trifosfat (GTP). Jadi. Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. Diagram percobaan yang memperlihatkan satu gen – satu enzim Transkripsi Tahap pertama ekspresi gen adalah transkripsi atau sintesis molekul RNA dari DNA (gen).OH pada suatu nukleotida bereaksi dengan gugus 5’. disebut sebagai pita sens. bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. Gugus 3’. untai DNA pasangannya. Sintesis RNA mempunyai ciri-ciri kimiawi yang serupa dengan sintesis DNA. Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. Bedanya dengan sumber basa untuk DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi tetapi digantikan oleh urasil. yang mempunyai urutan basa sama dengan urutan basa RNA. sitidin trifosfat (CTP). Hanya saja enzim yang bekerja bukannya DNA polimerase. dan uridin trifosfat (UTP). melainkan RNA polimerase. Reaksi ini jelas sama dengan reaksi polimerisasi DNA. Meskipun demikian. sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. Sementara itu. dan disebut sebagai pita antisens.2. Jadi. yaitu 1. Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. Adanya molekul cetakan berupa untai DNA. Adanya sumber basa nitrogen berupa nukleosida trifosfat.trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada .

maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 10. dan teminasi. Baik pada prokariot maupun eukariot. 3. elongasi. Urutan konsensus akan menunjukkan kepada RNA polimerase tempat dimulainya sintesis. yaitu pengenalan promoter. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). RNA polimerase akan terikat pada suatu tempat di dekat daerah promoter. Pada prokariot urutan konsensusnya adalah TATAAT dan disebut kotak Pribnow. promoter selalu membawa suatu urutan basa yang tetap atau hampir tetap sehingga urutan ini dikatakan sebagai urutan konsensus. 1. Molekul RNA yang baru saja selesai disintesis. yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). Terminasi dapat terjadi oleh dua macam sebab.3. Nukleosida trifosfat pertama akan diletakkan di tempat ini dan sintesis RNA pun segera dimulai. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. Di antara keduanya terminasi diri lebih umum dijumpai.kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. Enzim RNA polimerase mengikat untai DNA cetakan pada suatu daerah yang mempunyai urutan basa tertentu sepanjang 20 hingga 200 basa. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. 2. dan juga enzim RNA polimerase. urutan penyela 5’ ATTAAAGGCTCCTTTTGGAGCCTTTTTTTT T A A T T T C C G A G GA AA A C C T C G G A A AAA A AA 3’ 5’ 3’ DNA transkripsi . Selama sintesis RNA berlangsung RNA polimerase bergerak di sepanjang molekul DNA cetakan sambil menambahkan nukleotida demi nukleotida kepada untai RNA yang sedang diperpanjang. yang dinamakan tempat awal polimerisasi. inisiasi. Masing-masing akan dijelaskan sebagai berikut. Tahap-tahap transkripsi Transkripsi berlangsung dalam empat tahap. sedangkan pada eukariot urutan konsensusnya adalah TATAAAT dan disebut kotak TATA. Daerah ini dinamakan promoter. 4. Hal ini mengakibatkan perbedaan kekuatan ekspresi gen. segera terlepas dari untai DNA cetakan begitu enzim tersebut mencapai urutan basa pengakhir (terminasi). Kekuatan pengikatan RNA polimerase oleh promoter yang berbeda sangat bervariasi. Setelah mengalami pengikatan oleh promoter.

Ujung 5’ dimodifikasi dengan penambahan guanosin dalam ikatan 5’-5’ yang tidak umum hingga terbentuk suatu gugus terminal yang dinamakan cap. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida. panjang intron yang harus dibuang dapat mencapai 50% hingga 90% dari panjang transkrip primer.U U U C C U C G G A A 5’ A U U G G A G C C U U A U 3’ RNA U U U U U U Gambar 10. sedangkan pada eukariot transkrip primernya harus mengalami prosesing RNA terlebih dahulu sebelum menjadi mRNA. promoter dapat mengikat RNA polimerase yang lain.3 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. pada prokariot produk langsung transkripsi atau transkrip primernya adalah mRNA (akan dijelaskan di bawah). Secara umum mekanisme transkripsi pada prokariot dan eukariot hampir sama. Setelah intron dibuang. Pembuangan intron dan . Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. tetapi segmen yang mengandung ujung 5’ (gugus cap) tidak pernah dibuang. Prosesing RNA ini mencakup dua peristiwa. segmensegmen sisanya (disebut ekson) segera digabungkan menjadi mRNA. yaitu modifikasi kedua ujung transkrip primer dan pembuangan urutan basa pada transkrip primer yang tidak akan ditranslasi (disebut intron). Sementara itu. sedangkan ujung 3’ dimodifikasi dengan urutan poliadenosin (poli A) sepanjang lebih kurang 200 basa. Hanya saja.

penggabungan ekson menjadi molekul mRNA dinamakan penyatuan RNA atau RNA splicing. Macam-macam RNA Transkripsi DNA menghasilkan molekul RNA yang kemudian akan mengalami diferensiasi struktur sesuai dengan fungsinya masing-masing. Kita mengenal tiga macam RNA, yaitu 1. RNA duta atau messenger RNA (mRNA), yang mempunyai struktur linier kecuali bagian ujung terminasinya yang berbentuk batang dan kala (Gambar 10.3). Molekul mRNA membawa urutan basa yang sebagian di antaranya akan ditranslasi menjadi urutan asam amino. Urutan basa yang dinamakan urutan penyandi (coding sequences) ini dibaca tiga demi tiga. Artinya, tiap tiga basa akan menyandi pembentukan satu asam amino sehingga tiap tiga basa ini dinamakan triplet kodon. Daftar triplet kodon beserta asam amino yang disandinya dapat dilihat pada Tabel 10.1. Pada prokariot bagian mRNA yang tidak ditranslasi terletak di depan urutan penyandi (disebut pengarah atau leader) dan di antara dua urutan penyandi (disebut spacer sequences atau noncoding sequences). Sementara itu, pada eukariot di samping kedua bagian tadi ada juga bagian di dalam urutan penyandi yang tidak ditranslasi. Bagian inilah yang dinamakan intron seperti telah dijelaskan di atas. Molekul mRNA pada prokariot sering kali membawa sejumlah urutan penyandi bagi beberapa polipeptida yang berbeda. Molekul mRNA seperti ini dinamakan mRNA polisistronik. Dengan adanya mRNA polisistronik, sintesis beberapa protein yang masih terkait satu sama lain dapat diatur dengan lebih efisien karena hanya dibutuhkan satu sinyal. Pada eukariot hampir tidak pernah dijumpai mRNA polisistronik. 2. RNA pemindah atau transfer RNA (tRNA), yang strukturnya mengalami modifikasi hingga berbentuk seperti daun semanggi. Seperti halnya struktur ujung terminasi mRNA, struktur seperti daun semanggi ini terjadi karena adanya urutan palindrom yang diselingi oleh beberapa basa (Gambar 10.4). Pada salah satu kalanya, tRNA membawa tiga buah basa yang komplemeter dengan triplet kodon pada mRNA. Ketiga basa ini dinamakan antikodon. Sementara itu, pada ujung 3’-nya terdapat tempat pengikatan asam amino tertentu. Pengikatan yang membentuk molekul aminoasil-tRNA ini terjadi dengan bantuan enzim aminoasil-tRNA sintetase. Dalam hal ini gugus hidroksil (OH) pada ujung 3’ tRNA terikat sangat kuat dengan gugus karboksil (COOH) asam amino. Macam asam amino yang dibawa ditentukan oleh urutan basa pada antikodon. Jadi, ada beberapa macam aminoasil-tRNA sesuai dengan antikodon dan macam asam amino yang dibawanya. antikodon

5’

3’ (tempat pengikatan asam amino) Gambar 10.4. Diagram struktur tRNA

3. RNA ribosomal atau ribosomal RNA (rRNA), yang strukturnya merupakan bagian struktur ribosom. Lebih kurang separuh struktur kimia ribosom berupa rRNA dan separuh lainnya berupa protein. Molekul rRNA, dan juga tRNA, dapat dikatakan sebagai RNA struktural dan tidak ditranslasi menjadi asam amino/protein. Akan tetapi, mereka adalah bagian mesin sel yang menyintesis protein (lihat uraian tentang translasi di bawah ini). Translasi Bila dibandingkan dengan transkripsi, translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel, maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. Empat puluh hingga 60 molekul tRNA yang berbeda 4. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi, elongasi, dan terminasi polipeptida. Translasi, atau pada hakekatnya sintesis protein, berlangsung di dalam ribosom, suatu struktur organel yang banyak terdapat di dalam sitoplasma. Ribosom terdiri atas dua subunit, besar dan kecil, yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). Pada kebanyakan prokariot ribosom mempunyai ukuran 70S, sedangkan pada eukariot biasanya sekitar 80S. Tiap ribosom mempunyai dua tempat pengikatan tRNA, yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A, sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. 1. Molekul mRNA ditranslasi dengan arah 5’→ 3’, tetapi tidak dari ujung 5’ hingga ujung 3’. 2. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil. Sebagai contoh, sintesis protein yang mempunyai urutan NH2-Met-Pro- . . . -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 10.5. Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. Sementara itu, pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA. Selanjutnya, berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya.

Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh, khususnya pada prokariot, akan diberikan di bawah ini. arah gerakan ribosom

ribosom AUC UAG ACC UGG

aa 5’

aa CUG GGG 3’ mRNA

GAC COOH aa tRNA aa NH2 aa NH2 COOH aminoasil-tRNA

ikatan peptida Gambar 10.5. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus, yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet). Hal ini berarti bahwa sintesis semua polipeptida selalu dimulai dengan metionin. Khusus pada prokariot akan terjadi formilasi

metionil-tRNAfMet. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. dan subunit kecil ribosom (30S) dengan bantuan protein IF-1. Triplet kodon berikutnya. baik pada prokariot maupun eukariot. Sebagai contoh. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. kompleks inisiasi bergabung dengan subunit besar ribosom (50S). rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). yaitu RF-1 dan RF-2. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom. Dengan berlangsungnya kedua proses tersebut secara bersamaan. dan rantai polipeptida dari ribosom. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A. Pengikatan aminoasil-tRNAfMet berikutnya. dan metionil-tRNAfMet terikat pada tapak P. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet). tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. misalnya alanil. Kompleks inisiasi pada prokariot terbentuk antara mRNA. ke tapak A memerlukan proteinprotein elongasi EF-Ts dan EF-Tu. Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. yang melibatkan (1) perpindahan f-met-ala. serta sebuah molekul GTP. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. dan IF-3). Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin.tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. tRNA di tapak P. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin. . Selain itu. misalnya penyandi serin. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasil-tRNAfMet berikutnya yang akan masuk ke tapak A. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. suatu enzim yang terikat pada subunit ribosom 50S.tRNAala. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase.gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa f-metionin. IF-2. IF-2. Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. Terminasi ditandai oleh terlepasnya mRNA. Langkah berikutnya adalah translokasi. Selain itu. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. dan IF-3. kedua subunit ribosom pun memisah. akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. Selanjutnya.

sedangkan translasi terjadi di sitoplasma (ribosom). kombinasi dua basa hanya akan menghasilkan 42 atau 16 macam duplet. tidak demikian halnya pada eukariot. masih lebih sedikit daripada macam amino yang ada. Oleh karena itu. Kombinasi tiga basa akan menghasilkan 43 atau 64 triplet. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. satu macam asam amino dapat disandi oleh lebih dari satu macam triplet kodon. Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma. Transkripsi terjadi di dalam nukleus. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. Namun.1. juga menjadi sangat efisien. Dalam hal ini. yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. Basa nitrogen pada mRNA hanya ada empat macam. Kode genetik Basa I (5’) Basa II U Phe Phe Leu Leu Leu Leu Leu Leu ILe Ile ILe Met Val Val Val Val C Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala A Tyr Tyr Stop Stop His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu G Cys Cys Stop Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly U C A G U C A G U C A G U C A G Basa III (3’) U C A G . Salah satu di antaranya seperti telah kita bicarakan di atas. seperti yang akan dijelaskan nanti.ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn on-turn off) ekspresi gen. Begitu juga. sedangkan asam amino ada 20 macam. jelas tidak mungkin tiap asam amino disandi oleh satu basa. Kode genetik Penetapan triplet kodon pada mRNA sebagai pembawa informasi genetik atau kode genetik yang akan menyandi pembentukan suatu asam amino tertentu berawal dari pemikiran bahwa macam basa nitrogen jauh lebih sedikit daripada macam asam amino. melebihi jumlah macam asam amino. Tabel 10.

mutasi balik terjadi karena efek mutasi awal akibat penambahan basa ditekan oleh mutasi kedua akibat pengurangan basa sehingga mutasi yang kedua ini disebut juga sebagai mutasi penekan (suppressor mutation).H. suatu molekul yang dapat menyisip di sela-sela pasangan basa nitrogen sehingga kesalahan replikasi DNA dapat terjadi sewaktu-waktu.Keterangan : phe = fenilalanin leu = leusin ile = isoleusin met = metionin val = valin ser = serin pro = prolin thr = treonin ala = alanin tyr = tirosin his = histidin gln = glutamin asn = asparagin lys = lisin asp = asam aspartat glu = asam glutamat cys = sistein trp = triptofan arg = arginin gly = glisin AUG (kodon metionin) dapat menjadi kodon awal (start codon) stop = kodon stop (stop codon) Bukti bahwa kode genetik berupa triplet kodon diperoleh dari hasil penelitian F. Perubahan ini dapat berpengaruh atau tidak berpengaruh terhadap fungsi proteinnya. yaitu strain + dan strain -. Dengan perkataan lain. Akan tetapi. maka mekanisme semacam itu kecil sekali kemungkinannya untuk terjadi dan dugaan tersebut nampaknya tidak benar. Mutasi yang disebabkan oleh perubahan rangka baca akibat kelebihan atau kekurangan pasangan basa disebut sebagai mutasi rangka baca (frameshift mutation) (lihat Bab XI). Hal ini akan menyebabkan perubahan rangka baca (reading frame). Dalam hal ini. ternyata tidak selalu diperoleh tipe liar. Pada awalnya mutasi balik diduga karena kelebihan pasangan basa dibuang dari rangka baca yang salah sehingga rangka baca tersebut telah diperbaiki menjadi seperti semula.C. akan diperoleh beberapa fag tipe liar sehingga mutasi seolah-olah dapat dipulihkan atau terjadi mutasi balik (reverse mutation). menghasilkan DNA yang kelebihan atau kekurangan satu pasangan basa. sekali kita gunakan tanda + untuk mutan delesi berarti strain + adalah mutan delesi. Protein rIIB pada T4 mempunyai bagian-bagian yang di dalamnya dapat terjadi perubahan urutan asam amino. strain + tidak harus selalu mutan adisi. maka T4 tipe liar akan diperoleh sebagai hasil rekombinasi genetik antara kedua tempat mutasi yang berbeda itu. sekali kita menggunakan tanda + untuk mutan adisi berarti strain + adalah mutan adisi. Crick dan kawan-kawannya menjelaskan bahwa mutasi balik disebabkan oleh hilangnya (delesi) satu pasangan basa lain yang letaknya tidak terlalu jauh dari pasangan basa yang menyisip (adisi). karena mutasi bersifat acak. Namun. Hasil ini menunjukkan bahwa strain-strain mutan dapat dibagi menjadi dua kelompok. Begitu pula sebaliknya. Mutasi tersebut diinduksi oleh proflavin. yaitu urutan pembacaan basa-basa nitrogen untuk diterjemahkan menjadi urutan asam amino tertentu. ketika kedua strain mutan rIIB yang disilangkan merupakan strain-strain yang diseleksi secara acak (tidak harus mengalami mutasi yang berbeda). Crick dan kawan-kawannya yang mempelajari mutasi pada lokus rIIB bakteriofag T4. . Jika dua strain mutan T4 yang satu sama lain mengalami mutasi berbeda di dalam bagian protein rIIB disilangkan melalui infeksi campuran pada suatu inang. Namun. dan strain – tidak harus selalu mutan delesi. Jika mutan (hasil mutasi) rangka baca yang diinduksi oleh proflavin ditumbuhkan pada medium yang mengandung proflavin. Rangka baca yang baru ini akan menghasilkan urutan asam amino yang masih sama fungsinya dengan urutan sebelum terjadi mutasi.

Sementara itu. . mRNA mutan met ile ser gln arg val leu pengurangan pasangan basa G = G(mutasi rangka baca II) AUG AUU UCC AAA GGG UUU . sedangkan persilangan antara sesama + atau sesama – tidak pernah menghasilkan tipe liar. kode genetik berupa duplet. . AUG UUU CCC AAA GGG UUU . . CCC UAG met phe pro lys gly phe pro stop mRNA tipe liar penambahan pasangan basa A=T (mutasi rangka baca I) AUG AUU UCC CAA AGG GUU U . . . rekombinasi antara tiga + atau tiga – akan menghasilkan tipe liar. Hal ini memperlihatkan bahwa kode genetik terdiri atas tiga basa. . CCU AG . . . . . Kenyataannya tidak demikian. sesuai dengan hasil kenyataannya. . Pemulihan rangka baca akibat mutasi penekan justru terjadi apabila persilangan dilakukan antara strain + dan strain -. . . Apabila kode genetik berupa triplet.6. Hal ini karena persilangan sesama + atau sesama – akan menyebabkan adisi atau delesi ganda sehingga selalu menghasilkan fenotipe mutan.Persilangan antara strain + dan strain – hanya menghasilkan rekombinasi berupa fenotipe tipe liar. . Seandainya. kode genetik jelas tidak mungkin terdiri atas dua basa. . Mutasi penekan yang memulihkan rangka baca Oleh karena persilangan sesama + atau sesama – tidak pernah menghasilkan tipe liar. . maka akan terjadi pemulihan rangka baca hasil persilangan tersebut. CCC UAG met ile ser lys gly phe pro stop mRNA ‘tipe liar’ urutan asam urutan asam amino tipe liar amino yang berubah Gambar 10. . Namun. maka persilangan teoretis sesama + atau sesama – akan menghasilkan fenotipe mutan. persilangan antara starin + dan – akan menyebabkan terjadinya mutasi penekan (adisi ditekan oleh delesi atau delesi ditekan oleh adisi) atau hanya menghasilkan mutasi pada urutan asam amino yang tidak berpengaruh terhadap fungsi protein sehingga diperoleh fenotipe tipe liar.

urutan yang bila berubah tidak berpengaruh urutan yang bila berubah berpengaruh tipe liar AB CD EF GH IJ KL protein tipe liar +1 AB C1 DE FG HI JK +2 AB CD E2 FG HI JK -1 AB DE FG HI JK LM -2 AB CD FG HI JK LM +1 x +2 AB C1 DE 2F GH IJ KL liar -1 x -2 AB CD EF GH IJ KL liar +1 x -1 AB C1 DE FG HI JK mutan MN OP QR ST UV WX LM NO PQ RS TU VW X protein mutan LM NO PQ RS TU VW X protein mutan NO PQ RS TU VW X NO PQ RS TU VW X MN OP QR ST UV WX protein mutan protein mutan protein tipe MN OP QR ST UV WX protein tipe LM NO PQ RS TU VW X protein a) urutan yang bila berubah tidak berpengaruh urutan yang bila berubah berpengaruh tipe liar ABC DEF GHI JKL protein tipe liar +1 AB1 CDE FGH IJK +2 ABC DE2 FGH IJK +3 ABC DEF GHI J3K +1 x +2 AB1 CDE 2FG HIJ mutan +1 x +2 x +3 AB1 protein tipe liar CDE 2FG HIJ 3KL MNO PQR STU VWX LMN OPQ RST UVW X LMN OPQ RST UVW X LMN OPQ RST UVW X protein mutan protein mutan protein mutan protein KLM NOP QRS TUV WX MNO PQR STU VWX .

treonin dapat disandi oleh ACU. Diketahuinya sifat wobble bermula dari penemuan basa inosin (I) sebagai basa pertama pada antikodon tRNAala ragi. mempunyai tiga rangka baca yang berbeda (open reading frame). ACC. yaitu bahwa satu macam asam amino dapat disandi oleh lebih dari satu triplet kodon. hasil persilangan teoretis tidak sesuai dengan kenyataan yang diperoleh.7. dan urutan basa yang diekspresikan (gen) dapat tumpang tindih satu sama lain. Oleh karena tiap kodon terdiri atas tiga buah basa. maka dari sekitar 1700 asam amino tersebut hanya akan terbentuk 4 hingga 5 buah molekul protein. 2. RNA polimerase. atau pun C. di dalam suatu segmen tertentu pada DNA dapat terjadi transkripsi dan translasi urutan basa dengan panjang yang berbeda. bakteriofag фX174 mempunyai 11 protein yang secara keseluruhan terdiri atas 2300 asam amino. Sifat-sifat kode genetik Kode genetik mempunyai sifat-sifat yang akan dijelaskan sebagai berikut. Sebagai contoh. b) Jika kode genetik berupa triplet. Diagram persilangan mutan rIIB pada T4 yang memperlihatkan bahwa kode genetik berupa triplet kodon a) Jika kode genetik berupa duplet. satu antikodon pada tRNA dapat mengenali lebih dari satu macam kodon pada mRNA. Gen-gen yang menyandi . bakteriofag фX174 mempunyai sebuah untai tunggal DNA yang panjangnya lebih kurang hanya 5000 basa. U. hasil persilangan teoretis sesuai dengan kenyataan yang diperoleh. Artinya. Padahal kenyataannya.b) Gambar 10. atau berarti juga DNA. Dengan perkataan lain. yang artinya bahwa basa ketiga dapat berubah-ubah tanpa selalu disertai perubahan macam asam amino yang disandinya. ACA. Di samping itu. yang ternyata dapat berpasangan dengan basa A. Kode genetik bersifat degenerate atau redundant. Seandainya dari urutan basa ini hanya digunakan sebuah rangka baca. jika sebuah molekul protein rata-rata tersusun dari 400 asam amino. Dengan demikian. Pengaturan Ekspresi Gen Produk-produk gen tertentu seperti protein ribosomal. 1. Dengan demikian. suatu segmen DNA dapat terdiri atas lebih dari sebuah gen yang saling tumpang tindih (overlapping). 3. Kode genetik bersifat universal. dan ACG. maka tiap urutan basa mRNA. rRNA. Sebagai contoh. jelaslah bahwa dari urutan basa DNA yang ada tidak hanya digunakan sebuah rangka baca. Kemudian. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. Sifat ini erat kaitannya dengan sifat wobble basa ketiga. tRNA. kode genetik berlaku sama hampir di setiap spesies organisme. maka akan terdapat sekitar 1700 asam amino yang dapat disintesis.

sesuatu yang tidak biasa dilakukannya. Namun. Oleh karena urutan ekspresinya berupa sirkit. khususnya pada prokariot. coli ditumbuhkan pada medium yang sumber karbonnya bukan glukosa melainkan laktosa. produk suatu gen akan menekan transkripsi gen itu sendiri dan sekaligus memacu transkripsi gen kedua. bukan dengan aktivitas enzim. yaitu ketika tersedia glukosa sebagai sumber karbon. sedangkan zat atau molekul yang menyebabkan terjadinya induksi disebut sebagai induser. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. Untuk itu. Induksi secara molekuler terjadi pada tingkat transkripsi. secara garis besar dapat dibedakan menjadi dua kategori utama. bagi eukariot mekanisme ini nampaknya tidak terlalu penting karena pada organisme ini sel justru cenderung merespon sinyal-sinyal yang datang dari dalam tubuh. Selain mempunyai kemampuan untuk memecah suatu molekul (katabolisme). Jadi. Sebaliknya. Pada mekanisme sirkit. Proses yang terjadi ketika ekspresi gen merupakan respon terhadap keberadaan suatu zat di lingkungannya dikenal sebagai induksi. Sebagai contoh. Sebaliknya. produk gen kedua akan menekan transkripsi gen kedua dan memacu transkripsi gen ketiga. baik pada prokariot maupun pada eukariot. sistem sirkulasi akan menjadi penyangga bagi sel terhadap perubahan kondisi lingkungan yang mendadak tersebut. misalnya transkripsi. Pada pengaktifan enzim suatu molekul kecil akan terikat pada enzim sehingga akan terjadi peningkatan aktivitas enzim tersebut. Apabila suatu ketika E. Induksi dan represi pada prokariot Escherichia coli merupakan bakteri yang sering dijadikan model untuk mempelajari berbagai mekanisme genetika molekuler. dalam keadaan normal. Ekspresi gen yang berurutan ini telah terprogram secara genetik sehingga gen-gen tersebut tidak akan dapat diekspresikan di luar urutan. Peristiwa ini berkenaan dengan laju sintesis enzim. Mekanisme pengaturan transkripsi. demikian seterusnya. paling banyak terjadi pada tahap transkripsi. atau translasi. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. bukan peningkatan laju sintesisnya. bakteri juga dapat menyintesis (anabolisme) berbagai molekul organik yang diperlukan bagi pertumbuhannya. Dalam medium pertumbuhan yang tidak . Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. maka enzim pemecah laktosa akan disintesis. prosesing mRNA.pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. Salmonella typhimurium mempunyai sejumlah gen yang menyandi enzim-enzim untuk biosintesis triptofan. dalam contoh ini laktosa merupakan induser. maka mekanisme tersebut dinamakan sirkit ekspresi gen. maka gen-gen tersebut tidak diekspresikan (turned off). Mekanisme penyalapadaman sangat penting bagi mikroorganisme untuk menyesuaikan diri terhadap perubahan lingkungan yang seringkali terjadi secara tiba-tiba. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. yaitu (1) mekanisme yang melibatkan penyalapadaman (turn on and turn off) ekspresi gen sebagai respon terhadap perubahan kondisi lingkungan dan (2) sirkit ekspresi gen yang telah terprogram (preprogramed circuits). Bakteri ini secara alami hidup di dalam usus besar manusia dengan memanfaatkan sumber karbon yang umumnya berupa glukosa. Sementara itu. dan di sisi lain. gen-gen penyandi berbagai enzim yang terlibat dalam pemanfaatan laktosa akan diekspresikan (turned on).

Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. operator (O). menyebabkan terhalangnya transkripsi gen-gen struktural. represi juga terjadi pada tahap transkripsi. Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). Jacob dan J. dan molekul efektor. Monod pada tahun 1961. typhimurium akan mengekspresikan (turned on) gen-gen tersebut. molekul protein represor yang dihasilkan oleh gen regulator. dalam contoh ini triptofan merupakan korepresor. dengan operator. Proses pemadaman (turn off) ekspresi gen sebagai respon terhadap keberadaan suatu zat di lingkungannya dinamakan represi. Represi sering dikacaukan dengan inhibisi umpan balik (feedback inhibition). Pada kondisi tertentu represor akan berikatan dengan operator. Akan tetapi. Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. tetapi menekan laju sintesisnya. Jadi. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. yaitu penghambatan aktivitas enzim akibat pengikatan produk akhir reaksi yang dikatalisis oleh enzim itu sendiri. operon PR R PO O GS1 GS2 GS3 represor a) efektor (induser atau korepresor) RNA polimerase induser RNA polimerase berjalan . maka gen-gen tersebut tidak perlu diekspresikan (turned off). Molekul efektor pada induksi adalah induser. Model operon Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model yang diajukan oleh F. sedangkan zat yang menyebabkan terjadinya represi disebut sebagai korepresor. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. S. Seperti halnya induksi. dan gen-gen struktural (GS). atau bahkan tumpang tindih. Di luar operon terdapat gen regulator (R) beserta promoternya (PR). jika suatu saat ke dalam medium pertumbuhannya ditambahkan triptofan. sedangkan pada represi adalah korepresor. Represi tidak menghambat aktivitas enzim.mengandung triptofan.

. Sebaliknya.8. Akibatnya. Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Pada Gambar 10. transkripsi gen-gen struktural tidak dapat berlangsung.8 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. dengan adanya korepresor. Akan tetapi.transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 10. Namun. dengan terikatnya represor oleh induser. Salah satu contohnya adalah operon lac. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon. gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. promoter operon menjadi terbuka bagi RNA polimerase sehingga gengen struktural dapat ditranskripsi dan selanjutnya ditranslasi. Dengan pengikatan ini. Jadi. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi. Dengan demikian. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor.

Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau mirip operon. Untuk menyintesis histon dalam jumlah besar yang dibutuhkan dalam pembentukan kromatin. mRNA di dalam selsel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. Namun. terindikasi juga bahwa diferensiasi sel sedikit banyak melibatkan ekspresi seperangkat gen yang telah terprogram (preprogramed). hormon. Dengan perkataan lain. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. Selain itu. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. Produk gen A dapat 20 kali lebih banyak daripada produk gen B apabila terdapat 20 salinan (kopi) gen A untuk setiap salinan gen B. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik. Sebagai contoh. memegang peran yang sangat penting dalam proses diferensiasi sel. Operon trp. . ada gen A dan gen B yang ditranskripsi dan ditranslasi dengan efisiensi yang sama. molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. Demikian pula.Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. Katakanlah. dan juga prosesing mRNA. Untuk memenuhi nisbah kebutuhan ini antara lain dapat ditempuh melalui dosis gen. kalau pun ada. nampaknya tidak begitu penting pada eukariot. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. Beberapa produk gen dibutuhkan dalam jumlah yang jauh lebih besar daripada produk gen lainnya sehingga terdapat nisbah kebutuhan di antara produk-produk gen yang berbeda. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. yaitu hanya membawa urutan sebuah gen struktural. Jadi. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. Contoh yang nyata dapat dilihat pada gen-gen penyandi histon. Operon. Dosis gen dan amplifikasi gen Kebutuhan akan produk-produk gen pada eukariot dapat sangat bervariasi.

Sementara itu. Dengan demikian. molekul protein kecil yang dibawa dari sel tertentu menuju ke sel target. molekul mRNA dapat dibagi menjadi tiga kelompok. kita dapat memastikan adanya suatu mekanisme pengaturan ekspresi gen penyandi mRNA superprevalen pada tahap transkripsi eukariot meskipun hingga kini belum terlalu banyak rincian prosesnya yang dapat diungkapkan. Oleh karena itu. Di sisi lain. Setelah kompleks ini terbentuk biasanya reseptor akan mengalami modifikasi struktur kimia. Padahal. Kita mengetahui bahwa ribosom antara lain terdiri atas molekulmolekul rRNA. Pembentukan oosit dari prekursornya (oogonium) merupakan proses kompleks yang membutuhkan sejumlah besar sintesis protein. yaitu peningkatan jumlah gen sebagai respon terhadap sinyal tertentu. Mekanisme kerja hormon dalam mengatur transkripsi eukariot lebih kurang dapat disetarakan dengan induksi pada prokariot. Jika waktu yang tersedia untuk melakukan sintesis sejumlah besar protein cukup banyak. Jika sebelum amplifikasi ke-600 gen rRNA berada di dalam satu segmen DNA linier. yaitu (1) mRNA salinan tunggal (single copy). Secara garis besar pengaturan transkripsi oleh hormon dimulai dengan masuknya hormon ke dalam sel target melewati membran sel. Molekul rRNA tidak diperlukan lagi ketika oosit telah matang hingga saat terjadinya fertilisasi. Cara lain untuk mengatasi kebutuhan protein tersebut adalah dengan meningkatkan masa hidup mRNA (lihat bagian pengaturan translasi). coli. Sebagai contoh. Namun. Pengaturan transkripsi Berdasarkan atas banyaknya salinan di dalam tiap sel. Namun. amplifikasi gen sebenarnya tidak perlu dilakukan. maka selama dan setelah amplifikasi gen tersebut akan berada di dalam gulungan-gulungan kecil yang mengalami replikasi. Untuk itu dibutuhkan sejumlah besar ribosom. gen rRNA yang telah begitu banyak disalin kemudian didegradasi kembali oleh berbagai enzim intrasel. mRNA superprevalen biasanya dihasilkan sejalan dengan terjadinya perubahan di dalam suatu tahap perkembangan organisme eukariot. yang kemudian ditangkap oleh reseptor khusus yang terdapat di dalam sitoplasma sehingga terbentuk kompleks hormon-reseptor. . Salah satu pengaruh dosis gen adalah amplifikasi gen. sel-sel eritroblas di dalam sumsum tulang belakang mempunyai sejumlah besar mRNA yang dapat ditranslasi menjadi globin matang. penetrasi hormon ke dalam sel target dan pengangkutannya ke dalam nukleus merupakan proses yang jauh lebih rumit bila dibandingkan dengan induksi oleh laktosa pada E. sel-sel prekursor tidak mempunyai gen penyandi rRNA dalam jumlah yang mencukupi untuk sintesis molekul tersebut dalam waktu yang relatif singkat. dan (3) mRNA superprevalen dengan jumlah salinan beberapa ratus hingga beberapa ribu per sel. Molekul mRNA salinan tunggal dan semiprevalen masing-masing menyandi enzim dan protein struktural. (2) mRNA semiprevalen dengan jumlah salinan lebih dari satu hingga beberapa ratus per sel. Sebagai contoh. hanya sedikit sekali atau bahkan tidak ada globin yang dihasilkan oleh sel-sel prekursor yang belum berkembang menjadi eritroblas.kebanyakan sel mempunyai beratus-ratus kali salinan gen histon daripada jumlah salinan gen yang diperlukan untuk replikasi DNA. Salah satu regulator yang diketahui berperan dalam transkripsi eukariot adalah hormon. sejalan dengan perkembangan oosit terjadi peningkatan jumlah gen rRNA hingga 4000 kali sehingga dari sebanyak 600 gen yang ada pada prekursor akan diperoleh sekitar dua juta gen setelah amplifikasi. amplifikasi gen terjadi selama perkembangan oosit katak Xenopus laevis.

Sintesis ini akan terus berlanjut selama estrogen diberikan. dalam hal ini transkrip primernya sebenarnya sama. tetapi rupanya berperan dalam pembentukan kompleks ribosom-mRNA. Pengaturan umur mRNA juga dijumpai pada telur yang belum dibuahi.Kompleks hormon-reseptor yang termodifikasi kemudian menembus dinding nukleus untuk memasuki nukleus. tetapi kemudian ada perbedaan mekanisme prosesing. (4) inaktivasi represor. Hingga kini belum diketahui hakekat unsur tersebut. misalnya. Namun. Contoh induksi transkripsi oleh hormon antara lain dapat dilihat pada stimulasi sintesis ovalbumin pada saluran telur (oviduktus) ayam oleh hormon kelamin estrogen. . Dengan demikian. Akan tetapi. jaringan-jaringan oviduktus akan memberikan respon berupa sintesis mRNA untuk ovalbumin. pada eukariot ada mekanisme pengaturan translasi. (3) aktivasi protein yang terikat DNA. Fenomena ini seringkali berkaitan dengan adanya molekul-molekul mRNA yang berbeda. dan (5) perubahan struktur kromatin agar DNA terbuka bagi enzim RNA polimerase. melainkan karena terbatasnya ketersediaan suatu unsur yang dinamakan faktor rekrutmen. Jika ayam disuntik dengan estrogen. atau mungkin hormonnya saja. dan (3) pengaturan laju seluruh sintesis protein. Pada tikus. yang akan ditranslasi dengan efisiensi berbeda pula. akan mengalami salah satu di antara beberapa peristiwa. Macam-macam pengaturan tersebut adalah (1) kondisi bahwa mRNA tidak akan ditranslasi sama sekali sebelum datangnya suatu sinyal. Hal ini karena sel-sel atau jaringan lainnya tidak mempunyai reseptor hormon estrogen di dalam sitoplasmanya. hal ini bukan akibat kurangnya pasokan mRNA. sejumlah protein akan disintesis. Pengaturan pada tahap prosesing mRNA Dua jenis sel yang berbeda dapat membuat protein yang sama tetapi dalam jumlah yang berbeda meskipun transkripsi di dalam kedua sel tersebut terjadi pada gen yang sama. Jadi. Telur yang tidak dibuahi secara biologi bersifat statis. khususnya pada penyatuan (splicing) mRNA. Sel telur ini akan mempertahankan diri untuk tidak mengalami pertumbuhan atau perkembangan. Kelenjar ludah menghasilkan α-amilase lebih banyak daripada yang dihasilkan oleh jaringan hati meskipun gen yang ditranskripsi sama. (2) pengaturan umur (lifetime) molekul mRNA. ditemukan bahwa perbedaan sintesis enzim α-amilase oleh berbagai mRNA yang berasal dari gen yang sama dapat terjadi karena adanya perbedaan pola pembuangan intron. Proses selanjutnya belum banyak diketahui. tetapi rupanya di dalam nukleus kompleks tersebut. Pengaturan translasi Berbeda dengan translasi mRNA pada prokariot yang terjadi dalam jumlah yang lebih kurang sama. Hal ini menunjukkan bahwa di dalam sel telur yang belum dibuahi akan dijumpai sejumlah mRNA yang menantikan datangnya sinyal untuk translasi. begitu fertilisasi terjadi. yaitu (1) pengikatan langsung pada DNA. (2) pengikatan pada suatu protein efektor. dan hanya sel-sel oviduktus yang akan menyintesis mRNA tersebut. sedangkan molekul mRNA yang belum ditranslasi itu dinamakan mRNA tersembunyi (masked mRNA). laju sintesis protein menjadi sangat rendah. Sinyal tersebut tidak lain adalah fertilisasi oleh spermatozoon.

Sebaliknya. menemukan suatu zat kimia bersifat asam yang banyak mengandung nitrogen dan fosfor. konsentrasi suatu jenis molekul antibodi dipertahankan konstan oleh mekanisme inhibisi atau penghambatan diri dalam proses translasi. waktu itu fungsinya sama sekali belum diketahui. pada eukariot tidak pernah dijumpai mRNA polisistronik. Poliprotein adalah polipeptida berukuran besar yang setelah berakhirnya translasi akan terpotong-potong untuk menghasilkan sejumlah molekul protein yang utuh. J. Jadi. Tempattempat pemotongan ini tidak akan berfungsi serempak. molekul antibodi tersebut berikatan secara khusus dengan molekul mRNA yang menyandinya sehingga inisiasi translasi akan terhambat. Dalam sistem semacam itu urutan penyandi pada masing-masing gen tidak saling dipisahkan oleh kodon stop dan kodon awal.F. tetapi ada kondisi yang dapat disetarakan dengannya. MATERI GENETIK Pada tahun 1868 seorang mahasiswa kedokteran di Swedia. tetapi bergantian mengikuti suatu urutan. . 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar MATERI GENETIK BAB IX MATERI GENETIK       Pembuktian DNA sebagai Materi Genetik Pembuktian RNA sebagai Materi Genetik pada Virus Tertentu Model Struktur Molekul DNA menurut Watson-Crick Tiga Fungsi Materi Genetik Replikasi Semi Konservatif Replikasi Θ dan Replikasi Lingkaran Menggulung BAB IX. Tiap protein ini dapat dilihat sebagai produk satu gen tunggal. Sebagai contoh.Sintesis beberapa protein tertentu diatur oleh aktivitas protein itu sendiri terhadap mRNA. yakni sintesis poliprotein. Sintesis beberapa protein dari satu segmen DNA Pada prokariot terdapat mRNA polisistronik yang menyandi semua produk gen. Miescher. Meskipun ternyata asam nukleat selalu dapat diisolasi dari nukleus berbagai macam sel. Zat ini diisolasi dari nukleus sel nanah manusia dan kemudian dikenal dengan nama nuklein atau asam nukleat. tetapi dipisahkan oleh urutan asam amino tertentu yang dikenal sebagai tempat pemotongan (cleavage sites) oleh enzim protease tertentu.

Ternyata dengan perlakuan ini mencit mengalami kematian. Meskipun demikian.Dari hasil analisis kimia yang dilakukan sekitar empat puluh tahun kemudian ditemukan bahwa asam nukleat ada dua macam. . Hasil yang mengundang pertanyaan adalah ketika mencit diinfeksi dengan campuran antara strain S yang telah dipanaskan dan strain R yang masih hidup. Percobaan transformasi F. pada pertengahan tahun 1940-an terbukti bahwa justru DNA-lah yang merupakan materi genetik pada sebagian besar organisme. Hal ini terutama karena dari hasil analisis kimia secara kasar terlihat kurangnya variasi kimia pada molekul DNA. Griffith pada tahun 1928 melakukan percobaan infeksi bakteri pneumokokus (Streptococcus pneumonia) pada mencit. DNA atau protein. Strain mutan ini akan membentuk koloni dengan kenampakan kasar apabila ditumbuhkan pada medium padat. Jika ditumbuhkan pada medium padat. Bakteri penyebab penyakit pneumonia ini dapat menyintesis kapsul polisakarida yang akan melindunginya dari mekanisme pertahanan tubuh hewan yang terinfeksi sehingga bersifat virulen (menimbulkan penyakit). selama bertahun-tahun protein lebih diyakini sebagai materi genetik. Pada tahun 1924 studi mikroskopis menunjukkan bahwa DNA terdapat di dalam kromosom. Masingmasing akan diuraikan berikut ini. dan dari organ paru-parunya dapat diisolasi strain S yang masih hidup. protein dengan variasi kimia yang tinggi sangat memenuhi syarat sebagai materi genetik. dan dari organ paru-parunya dapat diisolasi strain S tersebut. Pneumokokus yang virulen sering dilambangkan dengan S. Sebaliknya. Di samping itu. dan akibatnya tidak bersifat virulen. DNA sebagai Materi Genetik Ada dua bukti percobaan yang menunjukkan bahwa DNA adalah materi genetik. selain DNA di dalam kromosom juga terdapat protein sehingga muncul perbedaan pendapat mengenai hakekat materi genetik. nukleus hasil meiosis baik pada tumbuhan maupun hewan mempunyai kandungan DNA separuh kandungan DNA di dalam nukleus sel somatisnya. Mencit yang diinfeksi dengan pneumokokus S akan mengalami kematian. Dugaan DNA sebagai materi genetik secara tidak langsung sebenarnya dapat dibuktikan dari kenyataan bahwa hampir semua sel somatis pada spesies tertentu mempunyai kandungan DNA yang selalu tetap. Demikian juga. sedangkan strain mutannya yang tidak virulen dilambangkan dengan R. dalam kurun waktu yang cukup lama fakta semacam itu tidak cukup kuat untuk meyakinkan bahwa DNA adalah materi genetik. sedangkan kandungan RNA dan proteinnya berbeda-beda antara satu sel dan sel yang lain. yaitu asam deoksiribonukleat atau deoxyribonucleic acid (DNA) dan asam ribonukleat atau ribonucleic acid (RNA). Namun. mencit yang diinfeksi dengan strain S yang sebelumnya telah dipanaskan terlebih dahulu akan dapat bertahan hidup. Di sisi lain. bakteri pneumokokus akan membentuk koloni dengan kenampakan halus mengkilap. mencit yang diinfeksi dengan strain R dapat bertahan hidup. ada pula strain mutan pneumokokus yang kehilangan kemampuan untuk menyintesis kapsul polisakarida sehingga menjadi tidak tahan terhadap sistem kekebalan tubuh hewan inangnya. sementara DNA hanya merupakan kerangka struktur kromosom. Sementara itu. Akan tetapi. Oleh karena itu. yang waktu itu telah diketahui sebagai organel pembawa gen (materi genetik).

McCarty melakukan percobaan untuk mengetahui hakekat materi yang dipindahkan dari strain S ke strain R. dan penambahan tersebut ternyata menyebabkan strain R berubah menjadi S seperti pada percobaan Griffith.1. transformasi tetap berjalan atau strain R berubah juga menjadi S. Diagram percobaan transformasi yang membuktikan DNA sebagai materi genetik Percobaan infeksi bakteriofag .Dengan hasil tersebut Griffith menyimpulkan bahwa telah terjadi perubahan (transformasi) sifat strain R menjadi S. Di dalam ekstrak DNA ini terdapat juga sejumlah protein kontaminan. yakni O. Transformasi terjadi karena ada sesuatu yang dipindahkan dari selsel strain S yang telah mati (dipanaskan) ke strain R yang masih hidup sehingga strain R yang semula tidak dapat membentuk kapsul berubah menjadi strain S yang dapat membentuk kapsul dan bersifat virulen. Percobaan Griffith sedikit pun tidak memberikan bukti tentang materi genetik. Akan tetapi. dan ternyata juga pada hampir semua organisme. kultur strain S ekstraksi DNA ekstrak DNA + protein kontaminan ditambahkan ke kultur strain R protease kultur strain R RNase kultur strain R DNase kultur strain R strain R + S strain R + S strain R Gambar 9. pada tahun 1944 tiga orang peneliti. maka transformasi tidak terjadi. yaitu dengan menambahkan ekstrak DNA dari strain S yang telah mati kepada strain R yang ditumbuhkan di medium padat. dan M. Artinya. Jika pada percobaan Avery dan kawan-kawannya itu ditambahkan enzim RNase (pemecah RNA) atau enzim protease (pemecah protein). MacLeod. Mereka melakukan percobaan transformasi secara in vitro. bukan RNA atau protein. C. jika enzim yang diberikan adalah DNase (pemecah DNA). strain R tidak berubah menjadi strain S. Hal ini jelas membuktikan bahwa materi yang bertanggung jawab atas terjadinya transformasi pada bakteri pneumonia. Avery. adalah DNA. Namun.

maka di dalam sel-sel E. Protein. sel-sel E. yang umumnya banyak mengandung sulfur tetapi tidak mengandung fosfor dilabeli dengan radioisotop 35S. Mula-mula partikel T2 melekatkan ujung ekornya pada dinding sel E. Ketika hasil penggandaan partikel T2 telah mencapai jumlah yang sangat besar. coli adalah materi yang dilabeli dengan 32P atau DNA. Bakteriofag T2 diketahui mempunyai kandungan protein dan DNA dalam jumlah yang lebih kurang sama. Hasil percobaan ini jelas menunjukkan bahwa materi genetik yang dimasukkan oleh bakteriofag T2 ke dalam sel E.Percobaan lain yang membuktikan bahwa DNA adalah materi genetik dilaporkan pada tahun 1952 oleh A. Sebelumnya. RNA sebagai Materi Genetik pada Beberapa Virus . coli. dan siklus reproduksi tadi akan terulang kembali. DNA yang sangat banyak mengandung fosfor tetapi tidak mengandung sulfur dilabeli dengan radioisotop 32P. yaitu Escherichia coli. coli akan mengalami lisis. Sebaliknya. Chase. Apabila dengan cara yang sama digunakan bakteriofag T2 yang dilabeli DNAnya. coli sehingga memungkinkan terjadinya penggandaan partikel T2 di dalam sel inangnya itu. sedangkan pada partikel-partikel T2 hanya ada sedikit sekali radioisotop tersebut. sel E. sedangkan pada partikel-partikel T2 masih banyak didapatkan radioisotop tersebut. coli yang membuktikan DNA sebagai materi genetik didapatkan 32 P Bakteriofag T2 dengan protein yang telah dilabeli diinfeksikan pada E. Dengan sentrifugasi. materi genetik masuk dilabeli dengan 35S dan 32P ke sel inang banyak didapatkan 35 S sel inang lisis banyak Gambar 9. partikel-partikel T2 yang keluar akan mencari sel inang yang baru.2. Daur hidup bakteriofag T2 dan diagram percobaan infeksi T2 pada E. bukannya protein. cara berlangsungnya infeksi T2 pada E. coli sangat sedikit ditemukan radioisotop 35S. coli. coli telah diketahui (lihat Bab XII). coli ini kemudian dipisahkan dari partikel-partikel T2 yang sudah tidak melekat lagi pada dinding selnya. coli ditemukan banyak sekali radiosiotop 32P. diikuti oleh masuknya materi genetik T2 ke dalam sel E. Akhirnya. Ternyata di dalam sel-sel E. Hershey dan M. Percobaan dilakukan dengan mengamati reproduksi bakteriofag (virus yang menyerang bakteri) T2 di dalam sel bakteri inangnya. Untuk memastikan sifat kimia materi genetik yang dimasukkan ke dalam sel inang dilakukan pelabelan terhadap molekul protein dan DNAnya.

RNA dari strain B direkonstitusi dengan protein dari strain A. Tiap nukleotida terdiri atas tiga komponen. adalah RNA. sedangkan pada RNA adalah ribosa. Dengan perlakuan kimia tertentu molekul RNA dapat dipisahkan dari selubung proteinnya untuk kemudian digabungkan (direkonstitusi) dengan selubung protein dari strain TMV yang lain. antara lain telah dilakukan percobaan rekonstitusi yang dilaporkan oleh H. tetapi hanya tersusun dari RNA dan protein. Oleh karena itu. Atom C pada gula pentosa yang berikatan dengan basa nitrogen ditentukan sebagai atom C pertama . Percobaan yang membuktikan RNA sebagai materi genetik pada TMV = TMV strain A = TMV strain B rekonstitusi infeksi ke daun tembakau RNA dari strain A direkonstitusi dengan protein strain B. Singer pada tahun 1957. Kedua TMV hasil rekonstitusi ini kemudian diinfeksikan ke inangnya (daun tembakau) agar mengalami penggandaan. Fraenkel-Conrat dan B.Beberapa virus tertentu diketahui tidak mempunyai DNA. Pada DNA basa nitrogen berikatan secara kimia dengan gula pentosa membentuk molekul yang disebut nukleosida sehingga setiap nukleotida pada DNA dapat disebut juga sebagai nukleosida monofosfat. Sebaliknya.3. Virus ini mengandung molekul RNA yang terbungkus di dalam selubung protein. Mereka melakukan penelitian pada virus mozaik tembakau atau tobacco mozaic virus (TMV). penomoran atom C pada gula pentosa dilakukan menggunakan tanda aksen (’) untuk membedakannya dengan penomoran atom C pada basa nitrogen. Komposisi Kimia Asam Nukleat Hasil analisis kimia asam nukleat menunjukkan bahwa makromolekul ini tersusun dari subunit-subunit berulang (monomer) yang disebut nukleotida sehingga asam nukleat dapat juga dikatakan sebagai polinukleotida. yaitu virus yang menyebabkan timbulnya penyakit mozaik pada daun tembakau. Menurut kebiasaan. faktor yang menentukan strain hasil penggandaan adalah RNA. Untuk memastikan di antara kedua makromolekul tersebut yang berperan sebagai materi genetik. Gula pentosa pada DNA adalah 2-deoksiribosa. Jadi. dapat disimpulkan bahwa materi genetik pada virus-virus yang tidak mempunyai DNA. TMV hasil penggandaan ternyata merupakan strain A jika RNAnya berasal dari strain A dan merupakan strain B jika RNAnya berasal dari strain B. Nukleotida yang satu dengan nukleotida berikutnya dihubungkan oleh ikatan fosfodiester yang sangat kuat. gula pentosa (gula dengan lima atom karbon). yaitu gugus fosfat. dan basa nukleotida atau basa nitrogen (basa siklik yang mengandung nitrogen). bukan protein. seperti halnya TMV. protein RNA pemisahan RNA dari protein Gambar 9.

sedangkan RNA adalah polinukleotida untai tunggal. dapat berupa adenin (A) atau guanin (G). tetapi diganti dengan urasil (U). tetapi mengikat gugus H sehingga gula pentosanya dinamakan deoksiribosa. sedangkan basa pirimidin pada DNA dapat berupa sitosin (C) atau timin (T). Basa purin. Atom C nomor 2’ pada DNA tidak mengikat gugus OH seperti halnya pada RNA. Pada RNA tidak terdapat basa timin. Sementara tu.(1’). basa nitrogen ada dua macam. Biasanya DNA mempunyai struktur sebagai molekul polinukleotida untai ganda. baik pada DNA maupun RNA. Ini merupakan perbedaan lain di antara kedua macam asam nukleat tersebut. yakni basa dengan cincin rangkap atau disebut purin dan basa dengan cincin tunggal atau disebut pirimidin. O O O P=O gugus fosfat 5’CH2OH OH 4’ H 3’ H O 5’CH2OH OH 1’ H H 4’ H 3’ H O 1’ H 2’ H 2’ OH H OH OH gula ribosa gula 2-deoksiribosa NH2 O .

4. nisbah konsentrasi adenin + timin terhadap konsentrasi guanin + sitosin sangat bervariasi dari spesies ke spesies. konsentrasi basa purin total menjadi sama dengan konsentrasi basa pirimidin total.N N 1 H 2 3 N adenin 4 N H 9 6 5 7 8 H N H N 1 NH2 2 3 N guanin 4 N H 9 6 5 7 8 H NH2 4 N3 5 H H O 4 N3 5 CH3 H O 4 N3 5 H 2 O 1 6 H 2 O 1 6 NH H 2 O 1 6 H NH NH sitosin timin urasil Gambar 9. Dengan sendirinya. sedangkan guanin sama dengan sitosin.H. Komponen kimia asam nukleat Model Struktur DNA Watson-Crick Model struktur fisik molekul DNA pertama kali diajukan pada tahun 1953 oleh J.C. Akan tetapi.D. Ada dua dasar yang digunakan dalam melakukan deduksi terhadap model tersebut. yaitu 1. Watson dan F. Hasil analisis kimia yang dilakukan oleh E. Chargaff terhadap kandungan basa nitrogen molekul DNA dari berbagai organisme selalu menunjukkan bahwa konsentrasi adenin sama dengan timin. Crick. .

Wilkins. dan para koleganya menunjukkan bahwa basabasa nitrogen tersusun vertikal di sepanjang sumbu molekul dengan interval 3. Dari data kimia Chargaff serta difraksi sinar X Wilkins dan Franklin tersebut Watson dan Crick mengusulkan model struktur DNA yang dikenal sebagai model tangga berpilin (double helix). sedangkan antara basa G dan C yang berpasangan terdapat ikatan hidrogen rangkap tiga. maka untai komplementernya mempunyai arah dari ujung 3’ ke 5’. Pola difraksi yang diperoleh dari hasil pemotretan molekul DNA menggunakan sinar X oleh M. begitu urutan basa pada satu untai polinukleotida diketahui. atom C nomor 3’ tidak lagi dihubungkan oleh ikatan fosfodiester dengan nukleotida berikutnya. Ikatan ini menghubungkan atom C nomor 3’ dengan atom C nomor 5’ pada gula deoksiribosa. Di dalam satu kali pilinan (360°) terdapat 10 pasangan basa. Jika untai yang satu mempunyai arah dari ujung 5’ ke 3’. OH(3’) P(5’) P P P . makin rendah stabilitas molekul DNAnya. Menurut model ini kedua untai polinukleotida saling memilin di sepanjang sumbu yang sama.2. ujung ini dinamakan ujung 3’ atau ujung OH. dan begitu pula sebaliknya. tetapi akan mengikat gugus OH. R. Gugus fosfat dan gula terletak di sebelah luar sumbu.4 Å.F. Setiap pasangan basa berjarak 3. Satu sama lain arahnya sejajar tetapi berlawanan (antiparalel). Oleh karena itu. Di ujung lainnya atom C nomor 5’ akan mengikat gugus fosfat sehingga ujung ini dinamakan ujung 5’ atau ujung P.H. Makin tinggi nisbah tersebut. Basa-basa nitrogen menghadap ke arah dalam sumbu. basa G pada satu untai selalu berpasangan dengan basa C pada untai lainnya melalui ikatan hidrogen. Begitu pula.4 Å dengan pasangan basa berikutnya. Hal ini menyebabkan nisbah A+T terhadap G+C mempengaruhi stabilitas molekul DNA. Oleh karena itu. maka urutan basa pada untai lainnya dapat ditentukan pula. Di salah satu ujung untai polinukleotida. Antara basa A dan T yang berpasangan terdapat ikatan hidrogen rangkap dua. Adanya perpasangan yang khas di antara basa-basa nitrogen itu menyebabkan kedua untai polinukleotida komplementer satu sama lain. nukleotida-nukleotida yang berurutan dihubungkan oleh ikatan fosfodiester. Kedudukan antiparalel di antara kedua untai polinukleotida sebenarnya dilihat dari ujung-ujung ini. dan terjadi ikatan hidrogen antara basa A pada satu untai dan basa T pada untai lainnya. Franklin. Seperti telah disebutkan di atas.

kita akan melihat fungsi yang harus dapat dilaksanakan oleh molekul tersebut sebagai materi genetik. Artinya. Meskipun demikan. yang dilaksanakan melalui replikasi. Fungsi ini merupakan fungsi evolusioner. evolusi tidak akan pernah berlangsung. 2. yang sekarang ternyata adalah DNA. 1. 3. Dalam beberapa dasawarsa pertama semenjak gen dikemukakan sebagai faktor yang diwariskan dari generasi ke generasi.5 Diagram struktur molekul DNA = adenin = timin = guanin = sitosin Fungsi Materi Genetik Setelah terbukti bahwa DNA merupakan materi genetik pada sebagian besar organisme. Bagian setelah ini akan membahas replikasi DNA.P P P P P P(5’) OH(3’) = gula Gambar 9. . Materi genetik harus mengatur perkembangan fenotipe organisme. materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. yang dilaksanakan melalui ekspresi gen (Bab X). harus dapat menjalankan tiga fungsi pokok berikut ini. dari generasi ke generasi. ketika itu telah disepakati bahwa gen sebagai materi genetik. yang dilaksanakan melalui peristiwa mutasi (Bab XI). Fungsi ini merupakan fungsi genotipik. sifat-sifat molekulernya baru sedikit sekali terungkap. Tanpa perubahan semacam ini. Fungsi ini merupakan fungsi fenotipik. Materi genetik harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya. Materi genetik sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah.

masing-masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. Kemudian. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru. Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru. Sementara itu.Replikasi DNA Ada tiga cara teoretis replikasi DNA yang pernah diusulkan. yaitu konservatif. dan dispersif. semikonservatif. . Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat. Namun.

DNA yang diekstrak dari sel E. coli yang semula ditumbuhkan pada medium 15N selama beberapa generasi. maka akan terjadi keseimbangan tingkat kerapatan.6. Hal ini karena molekul-molekul garam tersebut akan mengendap ke dasar tabung sentrifuga akibat adanya gaya sentrifugal. Oleh karena molekul-molekul dengan tingkat kerapatan yang berbeda dapat dipisahkan dengan cara sentrifugasi tersebut di atas. Molekul DNA dengan basa nitrogen yang mengandung 15N mempunyai tingkat kerapatan (berat per satuan volume) yang lebih tinggi daripada DNA normal (14N). Meselson dan F. Tiga cara teoretis replikasi DNA = untai lama = untai baru Di antara ketiga cara replikasi DNA yang diusulkan tersebut. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation.coli dengan basa nitrogen yang mengandung isotop 14N dan 15N masingmasing adalah 1. Stahl. DNAnya nampak makin banyak berada di bagian atas tabung. sedangkan DNA yang berada di bagian tengah tabung tetap. Sebagai perbandingan. Ketika larutan 6M CsCl yang di dalamnya terdapat molekul DNA disentrifugasi dengan kecepatan sangat tinggi.000 hingga 50. Ketika E. coli yang ditumbuhkan pada medium 15N terlihat menempati dasar tabung.coli yang pertama kali dipindahkan kembali ke medium 14N terlihat menempati bagian tengah tabung. kemudian dikembalikan ke medium normal 14N selama beberapa generasi berikutnya.coli ditumbuhkan pada medium 14N ternyata DNAnya menempati bagian tengah dan atas tabung. DNAnya mempunyai kerapatan tinggi. basa-basa nitrogen pada molekul DNA sel-sel bakteri tersebut akan memiliki 15N yang berat. dalam waktu 48 hingga 72 jam. kerapatan DNA E. DNA yang diekstrak dari sel E. pada generasi 14N yang pertama. katakanlah 30. DNAnya merupakan hibrid .W. sementara di sisi lain difusi akan menggerakkan molekul-molekul garam kembali ke atas tabung. Selanjutnya. atau dianggap sebagai generasi 0.coli telah ditumbuhkan selama beberapa generasi pada medium 14 N. Molekul DNA mempunyai kerapatan yang lebih kurang sama dengan kerapatan larutan garam yang sangat pekat seperti larutan 6M CsCl (sesium khlorida). atau disebut sebagai generasi 1. maka Meselson dan Stahl dapat mengikuti perubahan tingkat kerapatan DNA sel-sel bakteri E.724 g/cm3. Percobaan ini dilaporkan hasilnya pada tahun 1958 oleh M.700 g/cm3. Meselson dan Stahl menjelaskan bahwa pada generasi 15 N. Akibatnya. Mereka menumbuhkan bakteri Escherichia coli selama beberapa generasi di dalam medium yang mengandung isotop nitrogen 15N untuk menggantikan isotop nitrogen normal 14N yang lebih ringan. Molekul DNA dengan tingkat kerapatan tertentu akan menempati kedudukan yang sama dengan kedudukan larutan garam yang tingkat kerapatannya sama dengannya.konservatif semikonservatif dispersif Gambar 9.000 rpm. Kemudian.708 g/cm3 dan 1.S. Pada generasi kedua setelah E. sedangkan kerapatan larutan 6M CsCl adalah 1.

Pada generasi 2 DNA hibridnya masih ada.7 terlihat bahwa interpretasi data hasil percobaan sentrifugasi ini jelas sejalan dengan cara pembentukan molekul DNA melalui replikasi semikonservatif. DNA hibrid akan tetap jumlahnya. Demikian seterusnya. medium 15N (generasi 0) ekstrak DNA ekstrak DNA medium 14N (generasi 1) ekstrak DNA (generasi 2) medium 14N . tetapi muncul pula DNA baru dengan kerapatan rendah. sedangkan DNA baru dengan kerapatan rendah akan makin banyak dijumpai. Pada Gambar 9.antara DNA dengan kerapatan tinggi dan rendah.

7. Dengan kedua teknik ini terlihat bahwa DNA berbagai virus. pada sejumlah bakteri dan organisme eukariot dikenal pula replikasi yang dinamakan replikasi lingkaran menggulung (rolling circle replication). Replikasi lingkaran menggulung = untai lama = untai baru pemanjangan ’ekor’ . Pembentukan (sintesis) untai DNA baru terjadi dengan penambahan deoksinukleotida pada ujung 3’ yang diikuti oleh pelepasan ujung 5’ dari lingkaran molekul DNA. penambahan nukleotida ujung 3’ tempat ujung 5’ pelepasan ujung 5’ terpotongnya ikatan fosfodiester Gambar 9. Sejalan dengan berlangsungnya replikasi di seputar lingkaran DNA. Selain replikasi θ. coli berada dalam keadaan terfragmentasi sehingga replikasi molekul DNA dalam bentuknya yang utuh sebenarnya belum diketahui. Replikasi ini diawali dengan pemotongan ikatan fosfodiester pada daerah tertentu yang menghasilkan ujung 3’ dan ujung 5’. Diagram percobaan Meselson dan Stahl yang memperlihatkan replikasi DNA secara semikonservatif Pada percobaan Meselson dan Stahl ekstrak DNA yang diperoleh dari sel-sel E.8. khloroplas.ekstrak DNA medium 14N (generasi 3) interpretasi data hasil sentrifugasi DNA Gambar 9. ujung 5’ akan makin terlepas dari lingkaran tersebut sehingga membentuk ’ekor’ yang makin memanjang (Gambar 9. dan mitokhondria melakukan replikasi yang dikenal sebagai replikasi θ (theta) karena autoradiogramnya menghasilkan gambaran seperti huruf Yunani tersebut. Replikasi DNA kromosom dalam keadaan utuh _ yang pada prokariot ternyata berbentuk melingkar atau sirkular _ baru dapat diamati menggunakan teknik autoradiografi dan mikroskopi elektron.8).

Reaksi sintesis DNA secara skema dapat dilihat pada Gambar 9. . . dapat berupa DNA atau RNA. Salah satu diantaranya adalah enzim DNA polimerase.. Keempat molekul ini berfungsi sebagai sumber basa nukleotida. Enzim-enzim yang berperan dalam replikasi DNA Replikasi DNA. inisiasi replikasi DNA. Untai DNA yang akan digunakan sebagai cetakan (template). yang mempunyai gugus 3’. . . yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi. 2. Biasanya. deoksiguanosin trifosfat (dGTP). atau sintesis DNA. Segmen asam nukleat pendek. Kita lihat bahwa sintesis DNA (penambahan basa demi basa) berlangsung dari ujung 5’ ke ujung 3’. .. yang terdiri atas deoksiadenosin trifosfat (dATP). Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan. 1.Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam lingkaran molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori). yaitu 1. ori dapat ditemukan di beberapa tempat. baik pada prokariot maupun eukariot. Molekul yang dinamakan primer ini diperlukan karena tidak ada enzim DNA polimerase yang diketahui mampu melakukan inisiasi sintesis DNA.. melibatkan sejumlah reaksi kimia yang diatur oleh beberapa enzim. Penambahan dGTP terjadi karena untai DNA cetakannya mempunyai urutan basa T-G-TC.9. selain terjadi replikasi dua arah. DNA cetakan T A G C T A C. yang mengatur pembentukan ikatan fosfodiester antara dua nukleotida yang berdekatan sehingga akan terjadi pemanjangan untai DNA (polinukleotida). diperlukan tiga komponen reaksi. Hasil penambahan yang diperoleh adalah molekul DNA yang terdiri atas empat nukleotida (A-C-A-G). T A dGTP 3’ P 5’ 5’ 3’ P G C T A PPi 3’ P 5’ OH 3’ DNA polimerase P Mg2+ 5’ 5’ 5’ 3’ P 5’ 3’ P 3’ P OH C . .OH bebas. Agar DNA polimerase dapat bekerja mengatalisis reaksi sintesis DNA. Pada eukariot. Dua buah atom fosfat (PPi) dilepaskan dari dGTP karena sebuah atom fosfatnya diberikan ke primer dalam bentuk nukleotida dengan basa G atau deoksinukleosida monofosfat (dGMP).. deoksisitidin trifosfat (dCTP).. . Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. . G .. terjadi dua arah (bidireksional). Deoksinukleosida trifosfat. dan deoksitimidin trifosfat (dTTP). Dalam gambar tersebut sebuah molekul dGTP ditambahkan ke molekul primer yang terdiri atas tiga nukleotida (A-CA).

Kedua enzim ini berperan dalam pembukaan pilinan di antara kedua untai DNA sehingga kedua untai tersebut dapat saling memisah. sedangkan enzim Pol I memegang peran sekunder. Hanya saja sintesis DNA pada salah satu untai berlangsung tidak kontinyu sehingga menghasilkan fragmen yang terputus-putus. Enzim lain yang berperan dalam proses sintesis DNA adalah primase. Selain mampu melakukan pemanjangan atau polimerisasi DNA. Pol III merupakan enzim replikasi yang utama. Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. pemotongan terjadi dari ujung 3’ ke arah ujung 5’. Pada bagian berikut ini akan dijelaskan bahwa sintesis DNA baru tidak hanya terjadi pada salah satu untai DNA. Hal ini bermanfaat untuk memperbaiki kesalahan sintesis DNA atau kesalahan penambahan basa. yaitu DNA polimerase I (Pol I) dan DNA polimerase III (Pol III). Namun. sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. Terjadinya sintesis . Enzim Pol I dan Pol III dari E. Dalam sintesis DNA. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). Setelah primer terbentuk barulah DNA polimerase melakukan elongasi atau pemanjangan untai DNA. Fungsi perbaikan kesalahan yang dijalankan oleh enzim Pol I dan III tersebut dinamakan fungsi penyuntingan (proofreading). Aktivitas nuklease dapat dibedakan menjadi (1) eksonuklease atau pembuangan nukleotida dari ujung polinukleotida dan (2) endonuklease atau pemotongan ikatan fosfodiester di dalam untai polinukleotida. Tahap inisiasi sintesis DNA juga melibatkan enzim DNA girase dan protein yang mendestabilkan pilinan (helix destabilizing protein). misalnya A dengan C. Kesalahan penambahan basa pada untai polinukleotida yang sedang tumbuh (dipolimerisasi) menjadikan basa-basa salah berpasangan. Artinya. Sementara itu. Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. coli mempunyai aktivitas eksonuklease yang hanya bekerja pada ujung 3’. sebagian besar enzim DNA polimerase mempunyai aktivitas nuklease. yang masing-masing mempunyai arah 5’→ 3’. yaitu pembuangan molekul nukleotida dari untai polinukleotida.9. coli ada dua macam. Untuk menyambung fragmen-fragmen ini diperlukan enzim yang disebut DNA ligase. tetapi pada kedua-duanya. yang bisa saja terjadi meskipun sangat jarang (sekitar satu di antara sejuta basa !). Khusus enzim Pol I ternyata juga mempunyai aktivitas eksonuklease 5’→ 3’ di samping aktivitas eksonuklease 3’→5’ (lihat juga Bab XI). Skema reaksi sintesis DNA Enzim DNA polimerase yang diperlukan untuk sintesis DNA pada E. Enzim ini bekerja pada tahap inisiasi dengan cara mengatur pembentukan molekul primer di daerah ori.Gambar 9. enzim DNA polimerase untuk sintesis DNA kromosom pada eukariot disebut polimerase α. Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA.

fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. yang diikuti dengan fusi kedua mikronuklei menjadi satu mikronukleus diploid. membran sel di tempat kedua sel berlekatan akan rusak sehingga terjadi pertukaran salah satu mironuklei antarsel. Fase aseksual juga diawali dengan meiosis mikronuklei menjadi delapan mikronuklei haploid. Satu mikronukleus yang tersisa mengalami mitosis menjadi dua mikronuklei yang juga haploid. yang kemudian mengalami dua kali mitosis menjadi . Satu mikronukleus yang tersisa mengalami mitosis menjadi dua mikronuklei haploid. yang tujuh di antaranya akan mengalami degenerasi.DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. ori 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ untai baru kontinyu untai pengarah fragmen-fragmen 5’ 3’ 3’ 5’ Okazaki untai tertinggal 5’ 3’ Gambar 9. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). Diagram replikasi pada kedua untai DNA 11/01/2009 Posted by zaifbio | Genetika Dasar | 3 Komentar Sterilitas Jantan pada Jagung hingga dihasilkan delapan mikronuklei haploid.10. sesuai dengan nama penemunya. Sementara itu. fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. Seperti telah dikemukakan di atas. Selanjutnya. yang tujuh di antaranya mengalami degenerasi. Mulai tahap ini kedua sel (ekskonjugan) secara genetik menjadi sama. Kedua mikronuklei ini bergabung membentuk satu mikronukleus diploid.

Dari hasil autogami dapat dipelajari bahwa pewarisan suatu sifat diatur oleh gen-gen kromosomal ataukah sitoplasmik. Tanaman jagung dikatakan steril atau mandul jantan sitoplasmik apabila tidak mampu menghasilkan polen yang aktif dalam jumlah normal sementara proses reproduksi dan fertilitas betinanya normal. dari hasil tersebut tampak jelas bahwa sifat pembunuh atau bukan pembunuh ditentukan oleh ada tidaknya partikel kappa di dalam sitoplasma walaupun partikel itu sendiri keberadaannya bergantung kepada gen K di dalam nukleus. Sterilitas Jantan pada Jagung Di bidang pertanian ada satu contoh fenomena pewarisan sitoplasmik yang sangat penting.5. peristiwa autogami pada hakekatnya sangat menyerupai pembuahan sendiri. maka ada dua kemungkinan yang dapat terjadi. Apabila strain pembunuh melakukan konjugasi dengan strain bukan pembunuh (pada suatu kondisi yang memungkinkan strain bukan pembunuh untuk bertahan hidup). aurelia yang mengandung partikel-partikel kappa akan menghasilkan senyawa beracun yang dapat mematikan strainstrain protozoa lainnya yang ada di sekitarnya. Pada strain tertentu Paramecium aurelia ditemukan adanya fenomena ‘pembunuh’ (killer) yang berkaitan dengan keberadaan sejumlah partikel yang disebut sebagai kappa di dalam sitoplasmanya.M.a) sehingga diperoleh dua kelompok sel. yang artinya bakteri pembunuh berbentuk pita spiral. Hal yang perlu untuk diketahui pada fase aseksual ini adalah bahwa meskipun sel yang mengalami autogami pada awalnya heterozigot. Keberadaan kappa bergantung kepada gen kromosomal dominan K.empat mikronuklei diploid. yaitu sterilitas jantan sitoplasmik pada jagung. Sterilitas jantan sitoplasmik tidak diatur oleh gen-gen kromosomal tetapi diwariskan melalui sitoplasma gamet betina dari . mengamati bahwa sel P. sel-sel yang dihasilkan semuanya akan menjadi homozigot karena sel awal heterozigot tersebut terlebih dahulu mengalami meiosis menjadi sel haploid. Jika sel-sel ini melakukan autogami. Dengan demikian. Kedua mikronuklei yang tersisa mengalami mitosis menjadi empat mikronuklei diploid. yakni sel pembunuh dan sel bukan pembunuh yang kedua-duanya bergenotipe Kk. sedangkan partikel-partikel kappa ternyata merupakan bakteri simbion yang kemudian dikenal dengan nama Caedobacter taeniospiralis. Dengan demikian.5 b) sehingga hanya diperoleh satu kelompok sel. Sonneborn. kedua sel tidak bertukar materi sitoplasmik tetapi hanya bertukar mikronuklei (Gambar 8. yakni sel pembunuh yang bergenotipe Kk. Dua di antara mikronuklei ini berkembang menjadi makronuklei. Senyawa beracun ini selanjutnya disebut sebagai paramesin. Kemungkinan ke dua terjadi pertukaran materi sitoplasmik di antara kedua sel (Gambar 8. khususnya dalam hal peningkatan homozigositas. maka akan diperoleh sel pembunuh (KK) dan sel bukan pembunuh (kk) yang berasal dari sel pembunuh (Kk) serta sel bukan pembunuh (baik KK maupun kk) yang berasal dari sel bukan pembunuh (Kk). maka akan diperoleh sel pembunuh (KK) dan sel bukan pembunuh (kk) dengan nisbah 1 : 1. Jika masing-masing sel ini melakukan autogami. Setelah terjadi sitokinesis (pemisahan sel) diperoleh dua buah sel masing-masing dengan dua mikronuklei dan satu makronukleus yang semuanya diploid. genotipe KK dapat menghasilkan fenotipe bukan pembunuh jika di dalam sitoplasma tidak terdapat partikel kappa. seperti T. Sebaliknya sel pembunuh (Kk) melalui autogami dapat menghasilkan sel bukan pembunuh (kk) karena partikel kappa tidak akan mampu bertahan di dalam sitoplasma tanpa adanya gen K. Beberapa peneliti. Jadi. Pertama.

Jenis sterilitas ini telah banyak digunakan dalam produksi biji jagung hibrida. Secara biokimia kelainan ini berupa gangguan pada sistem sintesis protein mitokondria yang diatur oleh materi genetik di dalam mitokondria.generasi ke generasi. Persilangan antara betina poki dan jantan tipe liar menghasilkan keturunan yang semuanya poki. sel kehilangan kemampuan untuk membentuk protein yang diperlukan dalam metabolisme oksidatif. Pola pewarisan sterilitas jantan pertama kali dipelajari oleh M. Akibatnya. cerevisae dalam hal pertumbuhannya yang lambat dan kerusakan fungsi mitokondrianya. Sebaliknya. Mutan poki menyerupai mutan petit pada S. Seperti halnya mutan petit. yang secara skema dapat dilihat pada Gambar 8. persilangan antara betina tipe liar dan jantan poki menghasilkan keturunan yang semuanya normal. Individu mandul jantan sebagai tetua betina disilangkan dengan individu normal sebagai 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar Materi Genetik di dalam Kloroplas. mutan poki juga memperoleh energi untuk pertumbuhannya .6. Rhoades melalui percobaan persilangan pada jagung. betina tersebut dinamakan mutan poki (poky mutant).

bagian yang belang-belang . sedang sel-sel pada bagian yang berwarna putih tidak mempunyai kloroplas tetapi berisi plastida yang tidak berwarna. Sementara itu. pada beberapa tanaman tertentu seperti bunga pukul empat (Mirabilis jalapa). Materi Genetik di dalam Kloroplas. yaitu hijau. Carl Correns pada tahun 1908 melihat adanya perbedaan hasil persilangan resiprok pada pewarisan warna bagian vegetatif tanaman. Dia mengamati bahwa pewarisan warna tersebut semata-mata ditentukan oleh tetua betina dan berkaitan dengan ada tidaknya kloroplas di dalam sitoplasma.melalui jalur fermentasi anaerob yang sangat tidak efisien. khususnya daun. Selsel pada bagian yang berwarna hijau mempunyai kloroplas yang mengandung klorofil. dan belang-belang hjau-putih (variegated). putih. Suatu tanaman bunga pukul empat dapat memiliki bagian vegetatif yang berbedabeda warnanya.

yakni mt + dan mt . Dengan demikian. Sel alga ini memiliki sebuah kloroplas yang besar ukurannya dan di dalamya terdapat sejumlah materi genetik. Hal ini karena seperti telah dikatakan di atas bahwa warna hijau bergantung kepada ada tidaknya kloroplas. hijau.1. baik dengan maupun tanpa kloroplas.1 Hasil persilangan pada tanaman bunga pukul empat Fenotipe cabang yang membawa bunga sebagai tetua betina putih putih putih hijau hijau hijau belang-belang belang-belang belang-belang Fenotipe cabang yang membawa bunga sebagai tetua jantan Putih Hijau belang-belang Putih Hijau belang-belang Putih Hijau belang-belang Fenotipe keturunan putih putih putih hijau hijau hijau belang-belang. hijau. sehingga dimungkinkan adanya sembilan kombinasi persilangan. sementara polen hanya sedikit sekali atau bahkan sama sekali tidak memiliki kloropas.2.1 bahwa fenotipe keturunan akan selalu sama dengan fenotipe tetua betina atau terjadi pewarisan maternal. Ketiga macam bagian tanaman tersebut dapat menghasilkan bunga. baik sebagai sumber polen (tetua jantan) maupun sebagai pembawa putik (tetua betina). atau putih belang-belang. Kedua macam sel haploid ini dapat bergabung membentuk zigot diploid. yakni mengenai pewarisan sifat ketahanan terhadap antibiotik. Tabel 8. Jelas dapat disimpulkan dari Tabel 8. yang selanjutnya . kontribusi kloroplas kepada zigot dapat dipastikan hanya berasal dari sel kelamin betina. atau putih belang-belang. Ada dua macam sel pada Chlamydomonas bila dilihat dari tipe kawinnya. hijau. yang hasilnya dapat dilihat pada Tabel 8. Model yang menjelaskan pewarisan maternal ini dapat dilihat pada Gambar 8.terdiri atas sel-sel. atau putih Penelitian tentang pewarisan sitoplasmik telah dilakukan pula pada alga uniseluler Chlamydomonas reinhardii.

maka kontribusi sitoplasma kepada zigot yang terbentuk akan sama banyaknya. Oleh karena kedua sel tipe kawin tersebut ukurannya sama besar.2. putih hijau belang-belang sel telur x polen x x x x zigot Gambar 8. = kloroplas . Model pewarisan maternal pada tanaman bunga pukul empat = plastida tanpa klorofil . Sel-sel haploid di dalam tetrad dapat ditumbuhkan pada medium selektif padat dan membentuk koloni yang menunjukkan genotipenya.akan mengalami meiosis untuk menghasilkan tetrad yang terdiri atas empat buah sel haploid.

Jadi. kloroplas dari mt – akan hilang oleh suatu sebab yang hingga kini beluim diketahui. kloroplas dapat dipastikan berasal dari salah satu tipe kawin saja. Keturunan hasil persilangan antara kedua tipe kawin selalu mempunyai genotipe seperti salah satu tetuanya.3. Berbagai penelitian mengenai ketahanan terhadap antibiotik selain streptomisin telah dilakukan pula pada Chlamydomonas. Persilangan mt+ str+ dengan mt – str .zigot mt – str+ mt+ mt – mt+ mt – mt+ mt – mt+ mt – . Sebagai contoh. pewarisan alel str mengikuti pola pewarisan uniparental. Secara skema persilangan tersebut dapat digambarkan seperti pada Gambar 8. Jika kloroplas ini berasal dari penggabungan kloroplas kedua sel tipe kawin yang digunakan sebagai tetua dengan nisbah yang sama. Dengan perkataan lain. kloroplas yang diwariskan hanya berasal dari tetua mt +. persilangan antara tipe liar dan mutan yang tahan terhadap streptomisin menghasilkan keturunan yang sifat ketahanannya terhadap streptomisin bergantung kepada tetua mt+. maka tidak mungkin terjadi pewarisan uniparental. Oleh karena pewarisan sifat ketahanan terhadap antibiotik selalu ditentukan oleh tetua mt +.str+ menghasilkan keturunan yang semuanya rentan streptomisin (str -) . dan semuanya memperlihatkan terjadinya pewarisan uniparental.menghasilkan keturunan yang semuanya tahan streptomisin (str+) sementara persilangan mt+ str . Meskipun demikian. dalam hal ini mt+. Jadi. yakni menghasilkan keturunan dengan nisbah 1 : 1. Seperti telah kita ketahui bahwa sel haploid Chlamydomonas hanya mempunyai sebuah kloroplas. alel yang menentukan tipe kawin itu sendiri (alel mt) tampak bersegregasi mengikuti pola Mendel. pewarisan sifat ketahanan terhadap streptomisin berlangsung uniparental atau bergantung kepada genotipe salah satu tetuanya.dengan mt . Dengan demikian. Hal ini didukung oleh penelitian menggunakan penanda fisik untuk membedakan kloroplas dari kedua tipe kawin yang telah menunjukkan bahwa setelah terjadi penggabungan. Dengan perkataan lain.Persilangan resiprok antara tipe liar (rentan antibiotik) dan mutan-mutan yang tahan antibiotik memberikan hasil yang berbeda-beda. yang menunjukkan bahwa alel tersebut terletak di dalam kromosom nukleus. yang berarti sejalan dengan pola pewarisan kloroplas.mt+ str . Analisis biokimia membuktikan bahwa sifat ketahanan terhadap antibiotik berhubungan dengan kloroplas. pewarisan sifat ketahanan terhadap antibiotik pada Chlamydomonas merupakan pewarisan ekstrakromosomal atau pewarisan sitoplasmik. maka sifat ini jelas dibawa oleh kloroplas. mt+ str+ zigot mt – str .

str+ = tahan streptomisin . PEWARISAN SITOPLASMIK Sebegitu jauh pembicaraan kita tentang pewarisan sifat pada eukariot selalu dikaitkan dengan gen-gen yang terletak di dalam kromosom/nukleus. Meskipun demikian. sesekali pernah pula dilaporkan bahwa ada sejumlah sifat genetik pada eukariot yang .semuanya str+ semuanya str – mt+ str+ mt . str .mt – str – Gambar 8.str+ mt+str .=rentan streptomisin) 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar PEWARISAN SITOPLASMIK BAB VIII PEWARISAN SITOPLASMIK      Kriteria Pewarisan Sitoplasmik Organel Sitoplasmik Pembawa Materi Genetik Pengaruh Genetik Simbion Sitoplasmik pada Paramaecium Mekanisme Sterilitas Jantan pada Jagung Pengaruh Maternal dan Pewarisan Maternal BAB VIII.3. Diagram pewarisan sifat ketahanan terhadap streptomisin pada Chlamydomonas (mt = tipe kawin . Kenyataannya gengen kromosomal ini memang memegang peranan utama di dalam pewarisan sebagian besar sifat genetik.

kloroplas (pada tumbuhan). Begitu juga virus dan partikel mirip bakteri dapat bertindak sebagai pembawa sifat herediter sitoplasmik. dan beberapa komponen sitoplasmik lainnya.pewarisannya diatur oleh unsur-unsur di luar nukleus. Pada Bab VIII ini akan dibahas berbagai contoh kasus yang termasuk dalam pewarisan sitoplasmik. Jika dalam hal ini pengaruh rangkai kelamin (Bab VI) dikesampingkan. Pewarisan sifat sitoplasmik diatur oleh materi genetik yang terdapat di dalam organel-organel seperti mitokondria. Perbedaan hasil perkawinan resiprok merupakan penyimpangan dari pola Mendel. Sebagai contoh. Namun. hasil persilangan antara betina A dan jantan B tidak sama dengan hasil persilangan antara betina B dan jantan A. . setidaktidaknya lima hal di bawah ini dapat digunakan untuk keperluan tersebut. Di bagian akhir dibicarakan pula suatu fenomena lain yang masih ada sangkut pautnya dengan pewarisan sitoplasmik. Kriteria Pewarisan Sitoplasmik Sebenarnya tidak ada kriteria yang dapat berlaku universal untuk membedakan pewarisan sitoplasmik dengan pewarisan gen-gen kromosomal. ini tidak mengikuti pola Mendel. atau dikenal pula sebagai pewarisan sitoplasmik. maka perbedaan hasil perkawinan resiprok tersebut menunjukkan bahwa salah satu tetua (biasanya betina) memberikan pengaruh lebih besar daripada pengaruh tetua lainnya dalam pewarisan suatu sifat tertentu. Pewarisan ekstranukleus. 1.

Oleh karena itu. 3. Oleh karena itu. Substitusi nukleus dapat memperjelas pengaruh relatif nukleus dan sitoplasma. Sel kelamin betina biasanya membawa sitoplasma dan organel sitoplasmik dalam jumlah lebih besar daripada sel kelamin jantan. Tidak adanya nisbah segregasi Mendel menunjukkan bahwa pewarisan sifat tidak diatur oleh gen-gen kromosomal tetapi oleh materi sitoplasmik. 5. maka pewarisan tersebut terjadi karena pengaruh materi sitoplasmik. Organel Sitoplasmik Pembawa Materi Genetik Di dalam sitoplasma antara lain terdapat organel-organel seperti mitokondria dan kloroplas. Jika pewarisan suatu sifat berlangsung tanpa adanya pewarisan gen-gen kromosomal. jika ada suatu materi penentu sifat tidak dapat dipetakan ke dalam kelompok-kelompok berangkai yang ada. Jika materi sitoplasmik terbukti berkaitan dengan pewarisan sifat tertentu. Beberapa hasil . Organel dan simbion di dalam sitoplasma dimungkinkan untuk diisolasi dan dianalisis untuk mendukung pembuktian tentang adanya transmisi maternal dalam pewarisan sifat. Gen-gen kromosomal menempati loki tertentu dengan jarak satu sama lain yang tertentu pula sehingga dapat membentuk kelompok berangkai (Bab V). yang memiliki molekul DNA (lihat Bab IX) dan dapat melakukan replikasi subseluler sendiri. kedua organel ini sering kali disebut sebagai organel otonom.2. maka dapat dipastikan bahwa pewarisan sifat tersebut merupakan pewarisan sitoplasmik. sangat dimungkinkan bahwa materi genetik tersebut terdapat di dalam sitoplasma 4.

Ephrusi menemukan sejumlah . Begitu juga bahan makanan akan dioksidasi di dalam organel ini untuk menghasilkan senyawa adenosin trifosfat (ATP). Enzim-enzim untuk keperluan respirasi sel dan produksi energi terdapat di dalam mitokondria.penelitian memberikan petunjuk bahwa mitokondria dan kloroplas pada awalnya masing-masing merupakan bakteri dan alga yang hidup bebas. diduga membawa hingga lebih kurang 50 gen di dalam molekul DNAnya. yang dijumpai pada semua jenis organisme eukariot. yang nanti akan dibicarakan pada bagian lain bab ini. Dalam kurun waktu yang sangat panjang mereka kemudian membangun simbiosis turun-temurun dengan sel inang eukariotnya dan akhirnya berkembang menjadi organel yang menetap di dalam sel. Mutan Mitokondria Pada suatu penelitian menggunakan khamir Saccharomyces cerevisae B. yang merupakan bahan bakar bagi berbagai reaksi biokomia. kloroplas sebagai organel fotosintetik pada tumbuhan dan beberapa mikroorganisme membawa sejumlah materi genetik yang diperlukan bagi struktur dan fungsinya dalam melaksanakan proses fotosintesis. Klorofil beserta kelengkapan untuk sintesisnya telah dirakit ketika kloroplas masih dalam bentuk alga yang hidup bebas. Mitokondria. misalnya mekanisme ketahanan terhadap antibiotik streptomisin pada Chlamydomonas. Gen-gen ini di antaranya bertanggung jawab atas struktur mitokondria itu sendiri dan juga pengaturan berbagai bentuk metabolisme energi. Sementara itu. Pada alga hijau plastida diduga membawa mekanisme genetik lainnya.

Mutan petit melakukan metabolisme karbon bukan dengan respirasi menggunakan oksigen. Analisis genetik terhadap hasil persilangan antara mutan petit dan tipe liarnya memperlihatkan adanya tiga tipe mutan petit seperti dapat dilihat pada Gambar 8. Namun. hasil studi fisiologi menunjukkan bahwa sel-sel tersebut mengalami petumbuhan yang sangat lambat karena adanya kelainan dalam metabolisme senyawa karbon. akan diperoleh empat askopora haploid dengan nisbah fenotipe 2 normal : 2 petit. Koloni-koloni ini dinamakan mutan petit (petite mutant). Selain itu. oleh karena zigot diploid mempunyai fenotipe normal.1.koloni berukuran sangat kecil yang kadang-kadang terlihat ketika sel ditumbuhkan pada medium padat. Tipe pertama memperlihatkan segregasi Mendel seperti biasanya sehingga dinamakan petit segregasional. Hasil pengamatan mikroskopis menunjukkan bahwa selsel pada koloni tersebut berukuran normal. Hal ini menunjukkan bahwa petit segregasional ditimbulkan oleh mutasi di dalam nukleus. Persilangan dengan tipe liarnya menghasilkan zigot diploid yang normal. maka dapat . melainkan melalui fermentasi glukosa secara anaerob yang jelas jauh kurang efisien bila dibandingkan dengan respirasi aerob. Jika zigot ini mengalami pembelahan meiosis.

fenotipe keturunan hanya ditentukan oleh tetua normalnya. Jadi.dipastikan bahwa alel yang mengatur mutan petit merupakan alel resesif. Keempat askospora ini semuanya normal. berbeda dengan tipe pertama jika dilihat dari keempat askopora hasil pembelahan meiosis zigot diploid. Ketika sel petit netral bertemu dengan sel tipe liar. Dengan perkataan lain. sitoplasma sel tipe liar akan menjadi sumber materi genetik mitokhodria bagi spora-spora hasil persilangan petit dengan tipe liar sehingga semuanya akan mempunyai fenotipe normal. . pewarisan sifatnya merupakan pewarisan uniparental. Berlangsungnya pewarisan uniparental tersebut disebabkan oleh hilangnya sebagian besar atau seluruh materi genetik di dalam mitokondria yang menyandi sintesis enzim respirasi oksidatif pada kebanyakan petit netral. Hasil yang sama akan diperoleh apabila zigot diploid disilang balik dengan tetua petitnya. Tipe ke dua. yang disebut petit netral.

Segregasional Supresif Netral ha ploid : x x x zigot diploid : normal normal petit askospor a: 2 normal : 2 petit normal 4 4 petit .

Pewarisan mutasi petit pada persilangan dengan tipe liarnya (lingkaran kecil menggambarkan sel petit . Selain pada khamir S. seperti halnya pada tipe petit netral. Petit supresif juga mengalami kerusakan pada materi genetik mitokondrianya tetapi kerusakannya tidak separah pada petit netral. Mutan mitokondria pada Neurospora yang diwariskan melalui tetua 10/31/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar . kasus mutasi mitokondria juga dijumpai pada jamur Neurospora.1.Gambar 8. cerevisae. pewarisan uniparental juga terjadi pada tipe petit supresif. Bedanya. Pada persilangannya dengan tipe liar dihasilkan zigot diploid dengan fenotipe petit. pada petit supresif alel penyebab petit bertindak sebagai penghambat (supresor) dominan terhadap aktivitas mitokondria tipe liar. yang hingga kini belum dapat dijelaskan dengan baik. Selanjutnya. Dengan demikian. nukleus bergaris untuk pembentukan petit) mendatar membawa alel Tipe ke tiga disebut petit supresif. hasil meiosis zigot petit ini adalah empat askospora yang semuanya mempunyai fenotipe petit. yang pewarisannya berlangsung uniparental melalui tetua betina (pewarisan maternal) meskipun sebenarnya pada jamur ini belum ada perbedaan jenis kelamin yang nyata.

yang meliputi urutan dan jaraknya satu sama lain.4). melanogaster tersebut. Salah satu dari keempat kelompok gen berangkai atau keempat pasang kromosom pada D. Akibatnya. terutama hewan dan juga manusia. mempunyai kromosom kelamin. gen-gen rangkai kelamin tidak mengalami segregasi dan penggabungan secara acak di dalam gamet-gamet yang terbentuk. Seperti halnya gen berangkai (autosomal). disebut sebagai kromosom kelamin. misalnya peta kromosom pada lalat Drosophila melanogaster yang terdiri atas empat kelompok gen berangkai (Gambar 5. RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN Pada Bab V telah kita pelajari pola pewarisan sifat yang diatur oleh gen-gen berangkai atau gen-gen yang terletak pada satu kromosom. dalam hal ini kromosom nomor 1. Pemberian nama ini karena strukturnya pada individu jantan dan individu betina memperlihatkan perbedaan sehingga dapat digunakan untuk membedakan jenis kelamin individu. Gen-gen yang terletak pada kromosom kelamin dinamakan gen rangkai kelamin (sex-linked genes) sementara fenomena yang melibatkan pewarisan gen-gen ini disebut peristiwa rangkai kelamin (linkage).RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN BAB VI RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN ·     Kromosom Kelamin dan Autosom Gen Rangkai Kelamin Tipe Penentuan Jenis Kelamin Organisme Kromatin Kelamin dan Hipotesis Lyon Pengaruh Hormon Kelamin dalam Penentuan Jenis Kelamin BAB VI. yaitu kromosom yang pada individu jantan dan betina sama strukturnya sehingga tidak dapat digunakan untuk membedakan jenis kelamin. Kromosom semacam ini dinamakan autosom. individu-individu yang dihasilkan melalui kombinasi gamet tersebut memperlihatkan nisbah . Adapun gen berangkai yang dibicarakan pada Bab V adalah gengen yang terletak pada kromosom selain kromosom kelamin. Keberadaan gen berangkai pada suatu spesies organisme. Ternyata banyak sekali spesies organisme lainnya. menghasilkan peta kromosom untuk spesies tersebut.

jika pada percobaan Mendel perkawinan resiprok (genotipe tetua jantan dan betina dipertukarkan) menghasilkan keturunan yang sama. Selain itu. Oleh karena kromosom kelamin pada umumnya dapat dibedakan menjadi kromosom X dan Y. Hasil persilangan Morgan tersebut. Persilangan resiprok dengan hasil yang berbeda ini memberikan petunjuk bahwa pewarisan warna mata pada Drosophila ada hubungannya dengan jenis kelamin. Dia menyilangkan lalat D. dapat dilambangkan dengan tanda +. gen tipe alami bersifat dominan terhadap alel mutannya.H Morgan pada tahun 1910.1. tidak demikian halnya untuk sifat-sifat yang diatur oleh gen rangkai kelamin. Gen semacam ini dinamakan gen rangkai kelamin tak sempurna (incompletely sex-linked genes). Pada bab ini akan dijelaskan cara pewarisan macam-macam gen rangkai kelamin tersebut serta beberapa sistem penentuan jenis kelamin pada berbagai spesies organisme. Dengan perkataan lain. Secara skema pewarisan warna mata pada Drosophila dapat dilihat pada Gambar 6. khususnya pada generasi F1. Kromosom X dan Y masimg-masing lazim dilambangkan dengan tanda dan . misalnya pengatur warna mata merah ini. Di samping itu. dan ternyata kemudian memang diketahui bahwa gen yang mengatur warna mata pada Drosophila terletak pada kromosom kelamin. melanogaster jantan bermata putih dengan betina bermata merah. gen pengatur warna mata ini dikatakan sebagai gen rangkai X. Biasanya. ada pula beberapa gen yang terletak pada kromosom X tetapi memiliki pasangan pada kromosom Y. meskipun tidak selalu. Oleh karena itu. sedang gen pengatur tipe alami.fenotipe dan genotipe yang menyimpang dari hukum Mendel. P: x betina normal jantan mata putih + + w x betina mata putih jantan normal P: w w + F1 : + w + F1: + w w betina normal jantan normal betina normal jantan mata putih . Lalat bermata merah lazim dianggap sebagai lalat normal atau tipe alami (wild type). maka gen rangkai kelamin dapat menjadi gen rangkai X (Xlinked genes) dan gen rangkai Y (Y-linked genes). ternyata berbeda jika tetua jantan yang digunakan adalah tipe alami (bermata merah) dan tetua betinanya bermata putih. Pewarisan Rangkai X Percobaan yang pertama kali mengungkapkan adanya peristiwa rangkai kelamin dilakukan oleh T. Gen rangkai kelamin dapat dikelompok-kelompokkan berdasarkan atas macam kromosom kelamin tempatnya berada. perkawinan resiprok menghasilkan keturunan yang berbeda. dalam hal ini kromosom X.

Individu dengan gen dominan yang terdapat pada satu-satunya kromosom X dikatakan hemizigot dominan. Hemofilia baru menjadi terkenal dan dipelajari pola pewarisannya setelah beberapa anggota keluarga Kerajaan Inggris mengalaminya.1. maka kucing berbulu tortoise shell hanya terdapat pada jenis kelamin betina. Sebaliknya. Pewarisan sifat semacam ini disebut sebagai criss cross inheritance. Sementara itu. yaitu gamet yang membawa kromosom X dan gamet yang membawa kromosom Y. anggota keluarga Kerajaan Inggris saat ini yang merupakan keturunan putra/putri normal Ratu Victoria bebas dari penyakit hemofilia. Oleh karena genotipe heterozigot untuk gen rangkai X hanya dapat dijumpai pada individu betina. individu yang memilikinya disebut hemizigot resesif. Awalnya. individu betina membawa dua buah kromosom X. yaitu putih. Melalui dua dari keempat cucu yang heterozigot inilah penyakit hemofilia tersebar di kalangan keluarga Kerajaan Rusia dan Spanyol. yang dengan sendirinya homolog. Istilah hemizigot digunakan untuk menyebutkan genotipe individu dengan sebuah kromosom X. Oleh karena itu. sehingga gamet-gamet yang dihasilkannya akan mempunyai susunan gen yang sama. dan juga beberapa spesies organisme lainnya.b. Sebenarnya. Diagram persilangan rangkai X pada Drosophila Jika kita perhatikan Gambar 6. yaitu normal/merah. individu jantan yang hanya membawa sebuah kromosom X akan menghasilkan dua macam gamet yang berbeda. Dari kedua putri yang heterozigot ini lahir tiga cucu laki-laki yang menderita hemofilia dan empat cucu wanita yang heterozigot. lalat F1 jantan warna matanya seperti tetua betinanya. Namun. kasus hemofilia telah dijumpai sejak lama di negara-negara Arab ketika beberapa anak laki-laki meninggal akibat perdarahan hebat setelah dikhitan. Sementara itu. jika gen tersebut resesif. Individu homozigot resesif (betina) dan hemizigot resesif (jantan) akan berbulu kuning. individu homozigot dominan (betina) dan hemizigot dominan (jantan) mempunyai bulu berwarna hitam. yaitu gangguan dalam proses pembekuan darah. Sebaliknya. salah seorang di antara putra Ratu Victoria menderita hemofilia sementara dua di antara putrinya karier atau heterozigot. akan nampak bahwa lalat F1 betina mempunyai mata seperti tetua jantannya. waktu itu kematian akibat perdarahan ini hanya dianggap sebagai takdir semata. Sebaliknya. Dalam keadaan heterozigot gen ini menyebabkan warna bulu yang dikenal dengan istilah tortoise shell. Rangkai Z pada ayam . Rangkai X pada manusia Salah satu contoh gen rangkai X pada manusia adalah gen resesif yang menyebabkan penyakit hemofilia. Rangkai X pada kucing Warna bulu pada kucing ditentukan oleh suatu gen rangkai X.a) b) Gambar 6.1. Individu jantan ini dikatakan bersifat heterogametik. individu betina ini dikatakan bersifat homogametik. Pada Drosophila.

melanogaster terdapat gen rangkai kelamin tak sempurna yang menyebabkan pertumbuhan bulu pendek.Pada dasarnya pola pewarisan sifat rangkai Z sama dengan pewarisan sifat rangkai X. sedang alel dominannya merupakan alel mutan. Pewarisan Rangkai Y Pada umumnya kromosom Y hanya sedikit sekali mengandung gen yang aktif. Oleh karena fenotipe abnormal yang disebabkan oleh gen rangkai Y jumlahnya sangat sedikit. ada beberapa gen pada kromosom X yang mempunyai alel pada kromosom Y. Jumlah yang sangat sedikit ini mungkin disebabkan oleh sulitnya menemukan alel mutan bagi gen rangkai Y yang dapat menghasilkan fenotipe abnormal. menyebabkan bulu ayam menjadi burik. Contoh gen holandrik pada manusia adalah Hg dengan alelnya hg yang menyebabkan bulu kasar dan panjang. dan berlangsung seperti halnya pewarisan gen autosomal. Contoh gen rangkai Z yang lazim dikemukakan adalah gen resesif br yang menyebabkan pemerataan pigmentasi bulu secara normal pada ayam. Dengan perkataan lain. Pewarisan Rangkai Kelamin Tak Sempurna Meskipun dari uraian di atas secara tersirat dapat ditafsirkan bahwa kromosom X tidak homolog dengan kromosom Y. Biasanya suatu gen/alel dapat dideteksi keberadaannya apabila fenotipe yang dihasilkannya adalah abnormal. Hanya saja.2. Pewarisan sifat yang diatur oleh gen semacam ini dapat dikatakan tidak dipengaruhi oleh jenis kelamin. ternyata ada bagian atau segmen tertentu pada kedua kromosom tersebut yang homolog satu sama lain. Individu homogametik (ZZ) adalah jantan. Pewarisan gen yang bersifat resesif ini dapat dilihat pada Gambar 6. pada kasus ini alel resesif justru dianggap sebagai tipe alami atau normal (dilambangkan dengan +). Pada D. dan Wt dengan alelnya wt yang menyebabkan abnormalitas kulit pada jari. Ht dengan alelnya ht yang menyebabkan pertumbuhan bulu panjang di sekitar telinga. Alelnya. sedang individu heterogametik (ZW) adalah betina. maka gen rangkai Y diduga merupakan gen yang sangat stabil. Oleh karena itu. Gen rangkai Y jelas tidak mungkin diekspresikan pada individu betina/wanita sehingga gen ini disebut juga gen holandrik. Jadi. gen-gen pada segmen kromosom X dan Y yang homolog ini disebut juga gen rangkai kelamin tak sempurna. kalau pada rangkai X individu homogametik berjenis kelamin pria/jantan sementara individu heterogametik berjenis kelamin wanita/betina. Br. P: + + x b b P: b b x + + jantan normal betina normal jantan bulu pendek betina bulu pendek . pada rangkai Z justru terjadi sebaliknya.

Selain kedua sistem tersebut.B. sedang pada ayam. Bridge melakukan serangkaian penelitian mengenai jenis kelamin pada lalat Drosophila.2. sedang pada individu jantannya hanya ada 13 kromosom. Bedanya. Sebagai contoh. misalnya belalang. dan tidak ada hubungannya dengan kromosom Y. Sistem Penentuan Jenis Kelamin Telah disebutkan di atas bahwa pada manusia dan mamalia. Jadi.1. hal ini mirip dengan sistem XY. Wilson menemukan bahwa sel somatis serangga Protenor betina mempunyai 14 kromosom. Penentuan jenis kelamin pada manusia/mamalia dikatakan mengikuti sistem XY. Penentuan jenis kelamin pada lalat Drosophila Σ kromosom X 1 Σ autosom 2 nibah X/A 0. Sistem XO Sistem XO dijumpai pada beberapa jenis serangga. Dalam hal ini kromosom Y hanya berperan mengatur fertilitas jantan. pewarisan gen rangkai kelamin tak sempurna mempunyai pola seperti pewarisan gen autosomal. Sebaliknya. Diagram pewarisan gen rangkai kelamin tak sempurna Dapat dilihat pada Gambar 6. jumlah kromosom sel somatis individu betina lebih banyak daripada jumlah pada individu jantan. dan unggas lainnya serta ikan tertentu.1.B.2 bahwa perkawinan resiprok untuk gen rangkai kelamin tak sempurna akan memberikan hasil yang sama seperti halnya hasil yang diperoleh dari perkawinan resiprok untuk gen-gen autosomal. Berikut ini akan dijelaskan beberapa di antaranya. Sistem nisbah X/A C. individu pria/jantan adalah heterogametik (XY) sementara wanita/betina adalah homogametik (XX). Dengan demikian. Di dalam sel somatisnya. pada sistem XO individu jantan tidak mempunyai kromosom Y. masih banyak sistem penentuan jenis kelamin lainnya. Tabel 6.5 jenis kelamin jantan . dalam hal ini kucing. mengikuti sistem ZW. Dia berhasil menyimpulkan bahwa sistem penentuan jenis kelamin pada organisme tersebut berkaitan dengan nisbah banyaknya kromosom X terhadap banyaknya autosom. Secara ringkas penentuan jenis kelamin dengan sistem X/A pada lalat Drosophila dapat dilihat pada Tabel 6.F1 : + b betina normal a) + b jantan normal F1: + b betina normal b) + b jantan normal Gambar 6. pada ayam individu jantan justru homogametik (ZZ) sementara individu betinanya heterogametik (ZW). E. individu betina memiliki dua buah kromosom X sementara individu jantan hanya mempunyai sebuah kromosom X. Jadi.

33 1 1 0.5 1. betina triploid dan tetraploid.33 betina metabetina metabetina betina 4n betina 3n interseks interseks jantan metajantan Jika kita perhatikan kolom pertama pada Tabel 6. P: E AAXX x AAXY G gagal pisah gamet : F1 : AXX AO AX AAXXY AY AAXO letal AAOY AAXXX betina betina super jantan steril Gambar 6. serta interseks.75 0.2 3 4 4 3 3 2 2 1 2 2 3 4 3 4 3 4 3 1 1. yaitu gagal berpisahnya kedua kromosom X pada waktu pembelahan meiosis.3. Pada Drosophila terjadinya gagal pisah dapat menyebabkan terbentuknya beberapa individu abnormal seperti nampak pada Gambar 6. Adanya kromosom X yang didapatkan melebihi jumlah kromosom X pada individu normal (diploid) ini disebabkan oleh terjadinya peristiwa yang dinamakan gagal pisah (non disjunction). Lalat ini dikatakan mengalami mozaik seksual atau biasa disebut dengan istilah ginandromorfi. Diagram munculnya beberapa individu abnormal pada Drosophila akibat peristiwa gagal pisah Di samping kelainan-kelainan tersebut pernah pula dilaporkan adanya lalat Drosophila yang sebagian tubuhnya memperlihatkan sifat-sifat sebagai jenis kelamin jantan sementara sebagian lainnya betina. yakni individu dengan jenis kelamin metabetina.67 0.5 0.1 akan terlihat bahwa ada beberapa individu yang jumlah kromosom X-nya lebih dari dua buah.3. Penyebabnya adalah ketidakteraturan distribusi kromosom X pada masa-masa awal pembelahan mitosis zigot. Dalam hal ini ada sel yang menerima dua kromosom X tetapi ada pula yang hanya menerima satu kromosom X. Partenogenesis .

yaitu melalui telur yang tidak dibuahi. Struktur semacam ini ternyata tidak dijumpai pada sel-sel kucing jantan. Oleh karena itu. Baltzer menemukan bahwa cacing Bonellia yang berasal dari sebuah telur yang diisolasi akan berkembang menjadi individu betina.. individu jantan ini hanya memiliki sebuah genom atau perangkat kromosomnya haploid. wanita normal mempunyai sebuah . Pada sel somatis wanita terdapat sebuah kromatin kelamin sementara sel somatis pria tidak memilikinya. Sistem gen Sk-Ts Di atas disebutkan bahwa sistem penentuan jenis kelamin pada lebah tidak berhubungan dengan kromosom kelamin. Barr. Kromatin Kelamin Seorang ahli genetika dari Kanada. Sebaliknya. Sementara itu. jagung dengan fenotipe Sk_tsts adalah betina diosius (berumah dua). tetapi didasarkan atas keberadaan gen tertentu. sistem tersebut masih ada kaitannya dengan jumlah perangkat kromosom. Dengan demikian. khususnya pada lebah.L. Jadi. Pada manusia dilaporkan pula bahwa sel-sel somatis pria. lebah. dan gen Ts. baik kepada kromosom kelamin maupun jumlah genom. dan tawon. bunga betina tetap terbentuk seakan-akan tidak ada alel sk. Jagung monosius ini mempunyai fenotipe Sk_Ts_. dapat dikatakan bahwa partenogenesis merupakan sistem penentuan jenis kelamin yang tidak ada sangkut pautnya sama sekali dengan kromosom kelamin tetapi hanya bergantung kepada jumlah genom (perangkat kromosom). Sementara itu. yang mengatur pembentukan bunga betina. M. individu jantan berkembang dengan cara partenogenesis. Meskipun demikian. F. individu betina dan golongan pekerja. Jagung sksktsts berjenis kelamin betina karena ts dapat mengatasi pengaruh sk. yang mengatur pembentukan bunga jantan. Pengaruh lingkungan Sistem penentuan jenis kelamin bahkan ada pula yang bersifat nongenetik. pada tahun 1949 menemukan adanya struktur tertentu yang dapat memperlihatkan reaksi pewarnaan di dalam nukleus sel syaraf kucing betina. Hal ini misalnya dijumpai pada cacing laut Bonellia. misalnya sel epitel selaput lendir mulut. Jagung normal monosius (berumah satu) mempunyai gen Sk. Selanjutnya diketahui bahwa banyaknya kromatin kelamin ternyata sama dengan banyaknya kromosom X dikurangi satu.Pada beberapa spesies Hymenoptera seperti semut. berkembang dari telur yang dibuahi sehingga perangkat kromosomnya adalah diploid. sedang jagung skskTs_ adalah jantan diosius. alel-alel resesif sk dan ts masing-masing menghalangi pembentukan bunga betina dan mensterilkan bunga jantan. cacing yang hidup di lingkungan betina dewasa akan mendekati dan memasuki saluran reproduksi cacing betina dewasa tersebut untuk kemudian berkembang menjadi individu jantan yang parasitik. Oleh karena itu. Pada jagung dikenal sistem penentuan jenis kelamin yang tidak bergantung. yang jenis kelaminnya semata-mata ditentukan oleh faktor lingkungan. atau dengan perkataan lain. dapat dibedakan dengan sel somatis wanita atas dasar ada tidaknya struktur tertentu yang kemudian dikenal dengan nama kromatin kelamin atau badan Barr.

misalnya penderita sindrom Klinefelter (XXY). wanita penderita sindrom Turner (XO) tidak mempunyai kromatin kelamin yang seharusnya ada pada wanita normal. Hipotesis ini dilandasi hasil pengamatannya atas ekspresi gen rangkai X yang mengatur warna bulu pada mencit. Ekspresi gen terpengaruh kelamin pada domba . Pada hewan tingkat tinggi dan manusia hormon kelamin disintesis oleh ovarium. Sementara itu. Mekanisme kompensasi dosis diusulkan karena adanya fenomena bahwa suatu gen rangkai X akan mempunyai dosis efektif yang sama pada kedua jenis kelamin. seorang ahli genetika dari Inggris mengajukan hipotesis bahwa kromatin kelamin merupakan kromosom X yang mengalami kondensasi atau heterokromatinisasi sehingga secara genetik menjadi inaktif. Oleh karena itu. Lyon. kelenjar adrenalin menghasilkan steroid yang secara kimia berhubungan erat dengan gonad. sistem hormon akan mengatur kondisi fisiologi dalam tubuh individu sehingga mempengaruhi perkembangan sifat kelamin sekunder. gen rangkai X pada individu homozigot akan diekspesikan sama kuat dengan gen rangkai X pada individu hemizigot. alelnya h. Tabel 6. untuk dapat bertanduk domba betina harus mempunyai dua gen H (homozigot) sementara domba jantan cukup dengan satu gen H (heterozigot). Dewasa ini keberadaan kromatin kelamin sering kali digunakan untuk menentukan jenis kelamin serta mendiagnosis berbagai kelainan kromosom kelamin pada janin melalui pengambilan cairan amnion embrio (amniosentesis). Individu betina heterozigot memperlihatkan fenotipe mozaik yang jelas berbeda dengan ekspresi gen semidominan (warna antara yang seragam). Hipotesis Lyon juga menjelaskan adanya mekanisme kompensasi dosis pada mamalia. Hormon dan Diferensiasi Kelamin Dari penjelasan mengenai berbagai sistem penentuan jenis kelamin organisme diketahui bahwa faktor genetis memegang peranan utama dalam ekspresi sifat kelamin primer. Sebagai contoh. Selanjutnya. Mary F. Sebaliknya. Dengan perkataan lain. Ovarium dan testes masing-masing mempunyai fungsi ganda. bersifat dominan pada domba betina tetapi resesif pada domba jantan. mempunyai sebuah kromatin kelamin yang seharusnya tidak dimiliki oleh seorang pria normal. gen autosomal H yang mengatur pembentukan tanduk pada domba akan bersifat dominan pada individu jantan tetapi resesif pada individu betina. Hal ini menunjukkan bahwa hanya ada satu kromosom X yang aktif di antara kedua kromosom X pada individu betina. Pria dengan kelainan kromosom kelamin.kromatin kelamin karena kromosom X-nya ada dua. pria normal tidak mempunyai kromatin kelamin karena kromosom X-nya hanya satu.2. Sebaliknya. dan kelenjar adrenalin. Kromosom X yang aktif pada suatu sel mungkin membawa gen dominan sementara pada sel yang lain mungkin justru membawa gen resesif. testes. yaitu sebagai penghasil sel kelamin (gamet) dan sebagai penghasil hormon kelamin. Demikian pula. Gen terpengaruh kelamin Gen terpengaruh kelamin (sex influenced genes) ialah gen yang memperlihatkan perbedaan ekspresi antara individu jantan dan betina akibat pengaruh hormon kelamin.

Untuk dapat mengalami kebotakan seorang wanita harus mempunyai gen B dalam keadaan homozigot. sedang wanita heterozigot akan normal. Akibatnya. pria heterozigot akan mengalami kebotakan. Gen yang hanya dapat diekspresikan pada salah satu jenis kelamin dinamakan gen terbatasi kelamin (sex limited genes). Sebaliknya. serta gen k dengan gen B. Contoh gen semacam ini adalah gen yang mengatur produksi susu pada sapi perah. Gen B dominan pada pria tetapi resesif pada wanita. baik monohibrid maupun dihibrid. Jika kembali kita perhatikan persilangan dihibrid menyangkut pewarisan warna biji dan bentuk biji. gen b dominan pada wanita tetapi resesif pada pria.Genotipe HH Hh hh Domba jantan bertanduk bertanduk tidak bertanduk Domba betina bertanduk tidak bertanduk tidak bertanduk Contoh lain gen terpengaruh kelamin adalah gen autosomal B yang mengatur kebotakan pada manusia. 10/31/2009 Posted by zaifbio | Genetika Dasar | 7 Komentar BERANGKAI BAB V BERANGKAI     Dua Gen Berangkai dan Pindah Silang Tiga Gen Berangkai dan Pindah Silang Ganda Pemetaan Kromosom Pemetaan Kromosom pada Manusia BAB V. Oleh karena peluang terjadinya kombinasi-kombinasi tersebut sama besar. Gen terbatasi kelamin Selain mempengaruhi perbedaan ekspresi gen di antara jenis kelamin. BERANGKAI Percobaan-percobaan persilangan pada kacang ercis yang dilakukan oleh Mendel. hormon kelamin juga dapat membatasi ekspresi gen pada salah satu jenis kelamin. . dan juga kombinasi gen K dengan gen b. tetapi memungkinkan pula kombinasi gen resesif untuk warna biji (k) dengan gen resesif untuk bentuk biji (b). yang dengan sendirinya hanya dapat diekspresikan pada individu betina. telah menghasilkan dua hukum Mendel. yakni hukum segegasi dan hukum pemilihan bebas. Namun. individu jantan dengan genotipe tertentu sebenarnya juga mempunyai potensi untuk menghasilkan keturunan dengan produksi susu yang tinggi sehingga keberadaannya sangat diperlukan dalam upaya pemuliaan ternak tersebut. maka akan terlihat bahwa gamet-gamet yang terbentuk tidak hanya mengandung kombinasi gen dominan untuk warna biji (K) dengan gen dominan untuk bentuk biji (B).

akan menjadi pokok bahasan pada Bab V ini.C Punnet pada tahun 1906. dan gen a berangkai dengan gen B. yaitu KB. kB. akan mempunyai nisbah 1 : 1 : 1 : 1.H. Baru sekitar lima tahun kemudian seorang ahli genetika dan embriologi dari Amerika Serikat. maka gamet-gamet yang dihasilkan akan terdiri atas AB. Jadi. dapat menjelaskan mekanisme pewarisan gen-gen berangkai pada lalat Drosophila melanogaster. Artinya. kalau gen-gen yang berangkai adalah sesama dominan dan sesama resesif. Sebagai contoh. Gen-gen yang mengatur warna biji dan bentuk biji dewasa ini telah diketahui letaknya masing-masing. dan ab dengan nisbah n : 1 : 1 : n. Morgan. dan A. Kb.maka keempat macam gamet yang dihasilkan. Saat ini kita telah mengetahui bahwa banyaknya gen pada kacang ercis. Muller. Gen pengatur warna biji terletak pada kromosom 1. dalam keadaan gen dominan berangkai dengan gen resesif. Adanya perbedaan jumlah di antara macam gamet yang terbentuk tersebut disebabkan oleh kecenderungan gen-gen berangkai untuk selalu berada bersama-sama. jika gen A dan gen B berangkai pada suatu kromosom sementara alel-alel resesifnya. aB. jauh lebih banyak daripada jumlah kromosomnya. barangkali Mendel tidak akan berhasil merumuskan hukum pemilihan bebas. . Gen-gen yang terdapat pada kromosom yang sama dinamakan gen-gen berangkai (linked genes).J. Ab. dan juga pada setiap spesies organisme lainnya. H. gamet yang mengandung kombinasi gen dominanresesif akan lebih banyak jumlahnya daripada gamet dengan kandungan gen sesama dominan dan sesama resesif. Dalam hal ini n merupakan bilangan positif dengan nilai lebih dari satu. Seluk-beluk mengenai gen-gen berangkai.H. maka nisbah gamet AB : Ab : aB : ab menjadi 1 : n : n : 1. Akan tetapi. Dua Gen Berangkai Dua buah gen yang berangkai akan mengalami segregasi dan rekombinasi dengan pola yang tidak mengikuti hukum Mendel. dan kb. pola segregasi dan rekombinasinya tidak bebas sehingga tiap macam gamet yang dihasilkannya pun menjadi tidak sama jumlahnya. Inilah keuntungan lain yang diperoleh Mendel di samping secara kebetulan tanaman yang digunakan adalah diploid. Sturtevant. maka gamet yang mengandung gen-gen dominan dan gamet yang mengandung gen-gen resesif akan dijumpai lebih banyak daripada gamet dengan kombinasi gen dominan-resesif. jika gen A berangkai dengan gen b. juga berangkai pada kromosom homolognya. Sebaliknya. Demikian pula. Artinya. sedang gen pengatur bentuk biji terletak pada kromosom 7.Bateson dan R. Fenomena berangkai pertama kali ditemukan pada percobaan dihibrid oleh W. mereka tidak dapat memberikan interpretasi terhadap hasil persilangan yang diperoleh. sedang fenomenanya sendiri dinamakan berangkai (linkage). termasuk cara memetakannya pada kromosom tempat mereka berada. Dari konsep mengenai berangkai ini selanjutnya berkembang pengetahuan mengenai pindah silang (crossing over) dan pemetaan kromosom. Bridges. a dan b. yang sebagian besar melibatkan karya Morgan dan para mahasiswanya seperti C.B. T. Seandainya gen pengatur warna biji dan gen pengatur bentuk biji terletak pada kromosom yang sama. di dalam sebuah kromosom tertentu dapat dijumpai lebih dari sebuah gen.

Kedudukan gen berangkai semacam ini dinamakan sis atau coupling phase. Sebaliknya. dan ditulis sebagai Ab/aB jika kedudukan berangkainya adalah trans.1.1. Jadi. pada Gambar 5. Gamet tipe parental mempunyai susunan gen yang sama dengan susunan gen pada individu.1. akan tampak bahwa dua buah gen yang berangkai dapat berada pada dua macam kedudukan atau konfigurasi yang berbeda. maka kedudukannya dinamakan trans atau repulsion phase. Pada Gambar 5. Gamet yang terbentuk dari individu dihibrid a) Kedua gen tidak berangkai b) Kedua gen berangkai dengan kedudukan sis c) Kedua gen berangkai dengan kedudukan trans Kedudukan Dua Gen Berangkai Kalau kita perhatikan lagi Gambar 5.1.b) gen dominan A berangkai dengan gen dominan B dan gen resesif a berangkai dengan gen resesif b.a) memperlihatkan pola segregasi dan rekombinasi gen-gen yang terjadi secara bebas karena keduanya tidak berangkai. A a gamet : A A a a a) B b B b 1 1 1 1 A a A a b) B b b B c) n n 1 1 A a A a b B B b n n 1 1 B b A a B b A a b B Gambar 5.c) tampak bahwa segregasi dan rekombinasi kedua gen tidak terjadi secara bebas. Gambar 5.1.c). .Untuk lebih jelasnya pada Gambar 5.1. Individu dihibrid AaBb. Baik pada kedudukan sis maupun trans terdapat dua macam gamet.1 di bawah ini secara skema dapat diperbandingkan tiga kemungkinan segregasi dan rekombinasi gen-gen pada individu dihibrid AaBb. Dua gen yang berangkai cenderung untuk selalu bersama-sama atau tidak bersegregasi di dalam gametgamet yang terbentuk.1. Jadi. penulisan AaBb hanya digunakan apabila kedua gen tersebut tidak berangkai. jika gen dominan berangkai dengan gen resesif seperti pada Gambar 5. Kedudukan gen berangkai harus tercerminkan pada notasi individu yang bersangkutan. Sementara itu. yang masing-masing disebut sebagai gamet tipe parental dan gamet tipe rekombinasi. individu dihibrid AaBb akan menghasilkan gamet tipe parental AB dan ab serta gamet tipe rekombinasi Ab dan aB jika kedua gen tersebut berangkai dengan kedudukan sis. ditulis sebagai AB/ab jika kedua gen tersebut berangkai dengan kedudukan sis. sedang gamet tipe rekombinasi susunan gennya merupakan rekombinasi susunan gen pada individu.b) dan 5. misalnya.

Sekarang dengan lebih mudah dapat kita katakan bahwa gamet tipe parental adalah gamet bukan hasil pindah silang. bersama-sama dengan pemilihan bebas (hukum Mendel II). maka jarak antara kedua gen berangkai tersebut dikatakan sama dengan 20% atau 20 satuan peta atau 20 Morgan. Di atas nilai ini peningkatan jarak tidak terus-menerus diikuti oleh peningkatan persentase gamet tipe rekombinasi. Di sisi lain jarak antara dua gen berangkai dapat mencapai lebih dari 100%. Sebaliknya. Peristiwa pindah silang. Di atas telah dikatakan bahwa gamet tipe parental adalah gamet dengan susunan gen yang sama dengan susunan gen pada individu. di antara keduanya masih terdapat pula kemungkinan untuk mengalami segregasi dan rekombinasi sehingga akan diperoleh kombinasi gen-gen seperti yang dijumpai pada gamet tipe rekombinasi. atau dengan perkataan lain sama sekali tidak terdapat gamet tipe rekombinasi. misalnya jarak terpanjang antara dua gen berangkai pada kromosom 1 tanaman jagung yang mencapai 161%. jika suatu individu dihibrid dengan gen-gen yang berangkai menghasilkan gamet tipe parental sebanyak 80% atau gamet tipe rekombinasi sebanyak 20%. sedang gamet tipe rekombinasi adalah gamet yang susunan gennya merupakan rekombinasi susunan gen pada individu. Dari pengertian pindah silang tersebut kita dapat menyederhanakan batasan tentang gamet tipe parental dan gamet tipe rekombinasi. Akan tetapi. sedang gamet tipe rekombinasi berkisar dari 0% hingga 50%. seleksi alam akan bekerja untuk mempertahankan . merupakan mekanisme penting yang mendasari pembentukan keanekaragaman genetik karena kedua-duanya akan menghasilkan kombinasi baru di antara gen-gen yang terdapat pada individu sebelumnya. Terjadinya segregasi dan rekombinasi dua buah gen berangkai ini tidak lain karena mereka mengalami peristiwa yang dinamakan pindah silang (crossing over). Setiap satuan peta ditetapkan sebagai jarak antara dua gen berangkai yang dapat menghasilkan gamet tipe rekombinasi sebanyak 1%. yaitu pertukaran materi genetik (gen) di antara kromosom-kromosom homolog. Seperti telah dijelaskan. jika semua gamet yang ada merupakan gamet tipe parental. Jika gamet tipe parental sama banyaknya dengan gamet tipe rekombinasi (masing-masing 50% atau nisbah gamet = 1 : 1 : 1 : 1). maka gamet tipe parentalnya adalah Ab dan aB sementara gamet tipe rekombinasinya adalah AB dan ab. maka hal ini berarti kedua gen tidak berangkai.H. Sebagai contoh. Sebenarnya hubungan linier antara jarak dua gen berangkai dan persentase gamet tipe rekombinasi hanya berlaku lebih kurang hingga nilai 20%. Dengan perkataan lain.Kebalikannya. gamet tipe parental jumlahnya berkisar dari 50% hingga 100%. Gamet tipe parental jumlahnya selalu lebih besar atau setidak-tidaknya sama dengan jumlah gamet tipe rekombinasi. gamet tipe rekombinasi oleh A. Besar kecilnya jumlah. Sturtevant digunakan untuk menggambarkan jarak fisik antara dua gen berangkai. gamet tipe rekombinasi jumlahnya paling banyak hanya 50%. maka kedua gen dikatakan mempunyai loki (tempat gen pada kromosom) yang sangat berdekatan. Makin panjang jarak antara dua gen berangkai. Selanjutnya. jika kedua gen tersebut berangkai dengan kedudukan trans. makin besar persentase gamet tipe rekombinasi yang dihasilkan. Pindah Silang Telah disebutkan bahwa dua buah gen yang berangkai akan cenderung untuk tetap bersamasama di dalam gamet yang terbentuk. atau persentase. sedang gamet tipe rekombinasi adalah gamet hasil pindah silang.

Selanjutnya. keempat kromatid ini akan membentuk sinapsis yang dinamakan tetrad. Pindah silang terjadi pascaduplikasi kromosom Pada profase I meiosis kedua kromosom homolog akan mengalami duplikasi menjadi empat buah kromatid (lihat Bab IV). Pola askus A b A a a a B B b B a B a B binasi A b A b A b 100% rekom- Meiosis I Mitosis a) Meiosis II. keberadaan gen-gen resesif dapat dideteksi karena ekspresinya tidak tertutup oleh gen dominan. Dengan adanya miselium haploid inilah. . Secara skema bukti yang menujukkan bahwa pindah silang terjadi pascaduplikasi kromosom dapat dilihat pada Gambar 5. Oleh karena itulah. Pada saat terbentuknya konfigurasi tetrad inilah pindah silang terjadi. Bukti bahwa pindah silang terjadi sesudah kromosom homolog mengalami duplikasi diperoleh dari hasil analisis genetik pada percobaan menggunakan kapang Neurospora crassa.2 di bawah ini.genotipe-genotipe dengan kombinasi gen yang adaptif saja. Kapang ini sangat cocok untuk keperluan analisis genetik terutama karena dalam fase reproduksi aseksualnya terdapat askosopra haploid yang akan mengalami pembelahan mitosis sehingga berkecambah dan tumbuh menjadi miselium multisel yang juga haploid. banyak ilmuwan yang menganggap bahwa pindah silang dan pemilihan bebas sangat penting bagi berlangsungnya proses evolusi.

2. Sebaliknya. Hal ini jelas sesuatu yang tidak mungkin terjadi karena dari penjelasan sebelumnya kita mengetahui bahwa persentase gamet tipe rekombinasi berkisar dari 0 hingga 50%. Persentase pindah silang menggambarkan jarak antara dua gen berangkai .2. Tampak bahwa kedelapan askospora yang terbentuk terdiri atas dua macam. Gambar 5. pada Gambar 5.a) pindah silang terjadi sebelum kromosom mengalami duplikasi.2. Ternyata dilihat dari kedelapan askospora hasil pembelahan mitosis gamet dapat dipastikan bahwa keempat gamet yang dihasilkan seluruhnya merupakan gamet tipe rekombinasi atau sama sekali tidak ada gamet tipe parental.b) pindah silang terjadi sesudah kromosom mengalami duplikasi.2. yaitu askospora yang berasal dari gamet tipe parental dan askosopra yang berasal dari gamet tipe rekombinasi. Hasil pindah silang dilihat dari pola askus pada Neurospora crassa Pada Gambar 5. Di antara askospora tipe parental masih dapat dibedakan lagi askopora dari parental pertama (AB) dengan askospora dari parental kedua (ab). maka dapat disimpulkan bahwa pindah silang terjadi setelah kromosom mengalami duplikasi.Pola askus parental A A a a a B B b b b a a B b a a B b A A B B A B A b A b rekombinasi parental Meiosis I Mitosis b) Meiosis II. Oleh karena kemungkinan pada Gambar 5.b) ini masuk akal.

3. gamet tipe rekombinasi yang dihasilkan ada tiga macam. besarnya persentase pindah silang juga menggambarkan jarak fisik antara dua gen berangkai. Dengan demikian. ada juga gamet tipe parental. misalnya gen-gen dengan urutan A-B-C. A a interval I B b interval II C c A A B B C C a a b b c c .Peristiwa pindah silang akan menyebabkan terbentuknya gamet tipe rekombinasi. gamet tipe rekombinasi hasil pindah silang pada interval II. Sesuai dengan banyaknya macam pindah silang yang terjadi. Tiga Gen Berangkai Di antara tiga buah gen berangkai. atau seperti disebutkan di atas. Kalau kita misalkan bahwa kedudukan ketiga gen berangkai tersebut seperti pada Gambar 5. gamet tipe rekombinasi merupakan gamet hasil pindah silang. Ke dua. Sementara itu. persentase gamet tipe rekombinasi sampai dengan batas tertentu (lebih kurang 20%) memperlihatkan korelasi positif dengan jarak fisik antara dua gen berangkai. Pertama. dan gamet tipe rekombinasi hasil pindah silang ganda. ABc dan abC (hasil pindah silang II). pindah silang terjadi antara B dan C atau pindah silang pada interval II. Kemungkinan yang terakhir ini dinamakan pindah silang ganda (double crossing over). dapat terjadi tiga kemungkinan pindah silang. serta AbC dan aBc (hasil pindah silang ganda). maka gamet tipe rekombinasi yang dihasilkan adalah Abc dan aBC (hasil pindah silang I). Selain itu. yaitu ABC dan abc. pindah silang terjadi antara A dan B sekaligus antara B dan C. Ke tiga. pindah silang terjadi antara A dan B atau pindah silang pada interval I. yaitu gamet tipe rekombinasi hasil pindah silang pada interval I.

A A B b C C a a B b c c Gambar 5. Abbcc. dari individu homozigot resesif aabbcc (abc/abc) hanya akan dihasilkan satu macam gamet.3. Kelompok pertama adalah gamet tipe parental (ABC dan abc). maka nisbah fenotipe yang dihasilkan tidak akan sama tetapi bergantung kepada jumlah tiap macam gamet individu trihibrid tersebut. dengan nisbah 1 : 1 : 1 : 1 : 1 : 1 : 1 : 1. aaB-cc. Bagaimana dengan gamet hasil pindah silang I dan gamet hasil pindah silang II ? Mana di antara kedua kelompok gamet tipe rekombinasi tersebut yang lebih besar persentasenya ? Jawabannya tentu saja bergantung kepada besarnya jarak A-B dan jarak B-C. Sebagai contoh. sesuai dengan nisbah gamet individu ABC/abc. yakni abc. kelompok ke dua gamet hasil pindah silang di daerah I (Abc dan aBC).3. kelompok ke tiga gamet pindah silang di daerah II (ABc dan abC). Pindah silang di antara tiga gen berangkai Dari delapan macam gamet yang dihasilkan tersebut. gamet tipe parental dengan sendirinya paling besar persentasenya. aabbC-. gamet hasil pindah silang II akan dijumpai lebih banyak daripada gamet hasil pindah silang I jika jarak B-C lebih panjang daripada jarak A-B. Sementara itu. adalah persilangan suatu individu dengan individu homozigot resesif. maka gamet hasil pindah silang I lebih banyak daripada gamet hasil pindah silang II. Silang uji terhadap individu trihibrid dinamakan silang uji tiga titik (three-point test cross). ABC/abc tipe parental (persentasenya terbesar) abc/abc . Dengan demikian. jika gen A berangkai dengan gen B dan gen C. fenotipe sekaligus genotipe hasil silang ujinya akan ada empat kelompok. yang masing-masing terdiri atas dua macam fenotipe. Jika di antara ketiga gen tersebut tidak ada yang berangkai. karena baik gamet tipe parental maupun rekombinasi akan mempunyai susunan gen yang sama. Silang Uji Tiga Titik Silang uji. aaB-C-. individu trihibrid AaBbCc disilang uji dengan aabbcc. A-B-cc. Jika A-B lebih panjang daripada B-C. dan aabbcc. yaitu A-B-C-. maka hasil persilangannnya ada delapan macam fenotipe. dan kelompok ke empat gamet hasil pindah silang ganda (AbC dan aBc). Seperti pada penjelasan Gambar 5. Begitu pula sebaliknya. A-bbC-. Namun. seperti telah dijelaskan pada Bab II. gamet dari individu ABC/abc dapat dibagi menjadi empat kelompok. sedang gamet yang paling kecil persentasenya adalah gamet tipe rekombinasi hasil pindah silang ganda.

yaitu dua individu yang persentase atau jumlahnya terbesar (aBC dan Abc). cukup ditulis dengan ABC. pada prinsipnya pembuatan peta kromosom meliputi penentuan urutan gen pada satu kromosom dan penghitungan jarak antara gen yang satu dan lainnya. Dengan demikian. Begitu juga untuk ketujuh genotipe lainnya penulisannya cukup seperti notasi gametnya saja. individu ABC/abc. Langkah-langkah untuk membuat peta kromosom dari data hasil silang uji dapat dijelaskan dengan contoh berikut ini. Keduanya dipasangkan menjadi aBC/Abc. Di dalam peta kromosom tiap kromosom disebut sebagai satu kelompok gen berangkai (linkage group). Sebagai contoh.4. Oleh karena itu. pada lalat Drosophila melanogaster telah ditemukan adanya empat kelompok gen berangkai seperti dapat dilihat pada Gambar 5. Jadi. misalnya. Pemetaan Kromosom Data hasil silang uji tiga titik dapat dimanfaatkan untuk membuat peta kromosom. ABC = 265 ABc = 133 AbC = 6 aBC = 441 Abc = 435 aBc = 4 abC = 139 abc = 227 Untuk menentukan urutan gen yang benar pertama-tama kita cari individu tipe parental di antara kedelapan genotipe tersebut. kita cari . Kemudian. yang terdiri atas sederetan gen-gen dengan urutan dan jarak tertentu. biasanya notasi fenotipe/genotipe individu hasil silang uji untuk gen-gen berangkai sama dengan notasi untuk gametnya masing-masing.Abc/abc tipe rekombinasi hasil pindah silang antara A dan B (persentasenya bergantung kepada posisi lokus B) aBC/abc ABc/abc tipe rekombinasi hasil pindah silang antara B dan C (persentasenya bergantung kepada posisi lokus B) abC/abc AbC/abc tipe rekombinasi hasil pindah silang ganda (persentasenya terkecil) aBc/abc Salah satu kromosom homolog pada tiap fenotipe/genotipe hasil silang uji tersebut di atas selalu membawa gen-gen dengan susunan yang sama. yaitu abc.

Ini juga kita pasangkan menjadi AbC/aBc. yang ternyata masih belum cocok juga dengan AbC/aBc. dapat disimpulkan bahwa urutan loki gen yang benar adalah A-C-B atau B-C-A. misalnya menjadi BaC/bAc. Alternatif ke tiga (terakhir) adalah mengubah urutan gen pada individu parental menjadi aCB/Acb. Oleh karena itu. aBC/Abc disimulasi untuk mengalami psg menjadi abC/ABc. Individu parental disimulasi untuk mengalami pindah silang ganda (psg). Setelah hasil simuasi ini dicocokkan dengan individu psg yang ada ternyata susunan gennya tidak sama (abC/ABc tidak sama dengan AbC/aBc). Jika individu ini mengalami psg. Individu parental dengan urutan gen seperti ini (lokus C di tengah) jika mengalami psg akan menjadi acB/ACb. yang ternyata cocok dengan AbC/aBc. individu parental harus kita ubah urutan gennya. maka akan diperoleh BAC/bac. Artinya. yaitu dua individu yang jumlahnya terkecil (AbC dan aBc). 0 y (yellow body) 0 ci (cubitus interruptus eyes) w (whirte eyes) (bent wings) N (Notch wings) (shaven bristles) ec (echinus eyes) rb (ruby eyes) bo (bordeaux eyes) cv (crossveinless wings) ov (oval eyes) ct (cut wings) sn (singed bristles) ed (echinoid eyes) dp (dumpy wings) cl (clot eyes) spd (spade wings) lys (lysine accumulation) jv (javelin bristles) Hn (Henna eyes) fs(3) G2 (betina steril) Cy (Curly wings) net (net wings) 0 ru (roughoid eyes) 0 S (Star eyes) R (Roughened eyes) bt 3 sv IV t (tan body) ras (raspberry eyes) m (miniature wings) wy (wavy wings) g (garnet eyes) pl (pleated wings) tu-48 (abdominal tumors) fy (fuzzy hairs) corr (corrugated wings) J (Jammed wings) se (sepia eyes) cur (curvoid wings) rs (rose eyes) Gl (Glued eyes) st (scarlet eyes) b (black body) eg (eagle wings) . Dengan demikian.individu hasil pindah silang ganda.

Peta kromosom pada lalat Drosophila melanogaster = sentromir Kromosom I = kromosom kelamin .4.sd (scalloped wings) r (rudimentary wings) B (Bar eyes) car (carnation eyes) rd (reduced bristles) stw (straw bristles) cn (cinnabar eyes) che (cherub wings) cu (curly wings) bx (bithorax body) sr (stripe body) bb (bobbed bristles) 68 I c (curved wings) Amy (Amylase) rf (roof wings) nw (narrow wings) vg (vestigial wings) U (Upturmed wings) Dl (Delta wings) e (ebony body) cd (cardinal eyes) obt (obtuse wings) dsr (disrupted wings) hy (humpy body) ra (rase britles) a (arc wings) Frd (Freckled body) M(2)c (Minute body) 106 108 II Pr (Prickly bristles) r sd (raised wings) ca (claret eyes) M(3)g (Minute body) III Gambar 5.

4%. Sementara itu. Oleh karena itu. dan ACb. kita dapat menghitung jarak antara dua gen berurutan (A-C dan C-B). sedang jarak C-B sama dengan pindah silang antara C dan B.2% = 0. Seandainya kedua pindah silang ini benar-benar independen satu sama lain. jarak A-C = (227 + 265 + 4 + 6) / 1650 x 100% = 30. dan pada contoh soal di atas nilai KK = 0. acB. nilai KK = 0 menunjukkan bahwa dua peristiwa pindah silang yang berurutan benar-benar saling menghalangi. Pada soal tersebut di atas persentase pindah silang ganda yang diharapkan atau seharusnya terjadi (psg E) sama dengan 30. dan dinamakan interferensi kromosom atau interferensi kiasma. Oleh karena individu parentalnya aCB/Acb. seperti telah dijelaskan sebelumnya. Nilai KK = 1 menggambarkan adanya independensi yang sempurna di antara dua peristiwa pindah silang yang berurutan sehingga psg O sama besarnya dengan psg E. data hasil silang uji tersebut di atas diubah urutan gennya sehingga menjadi ACB = 265 AcB = 133 ACb = 6 aCB = 441 Acb = 435 acB = 4 aCb = 139 acb = 227 Selanjutnya.4% Interferensi Kromosom Pada contoh soal tersebut di atas terlihat bahwa banyaknya individu hasil pindah silang ganda ada (4 + 6) / 1650 x 100% = 0. Fenomena ini pertama kali ditemukan oleh H.6% / 5.1% = 5. ACB. Dengan demikian. Jadi. dan ACb. Nilai KK berkisar dari 0 hingga 1.Mutan yang diawali dengan huruf besar = mutan dominan Setelah urutan gen yang benar diketahui. nilai KK berbanding terbalik dengan besarnya interferensi. maka individu hasil pindah silang antara A dan C terdiri atas acb. Derajad interferensi secara kuantitatif diukur dengan suatu nilai yang disebut koefisien koinsidensi (KK).12. Jadi.1%.2%.1% C B . individu hasil pindah silang antara C dan B masingmasing aCb. jarak A-C sama dengan pindah silang antara A dan C. Sebaliknya. Namun. interferensi ini menunjukkan bahwa pindah silang di suatu tempat akan menghalangi terjadinya pindah silang di dekatnya.6%. AcB. pindah silang ganda adalah dua peristiwa pindah silang yang terjadi bersama-sama pada dua daerah yang berurutan. Nilai ini merupakan persentase pindah silang ganda yang benar-benar terjadi (psg O). acB. yang masing-masing sama dengan persentase pindah silang di antara kedua gen yang diukur jaraknya (ingat ! besarnya persentase pindah silang menggambarkan jarak fisik antara dua gen berangkai). yang merupakan nisbah psg O terhadap psg E. Muller pada tahun 1916. A 30. 17. Biasanya psg O lebih kecil daripada psg E. sehingga jarak C-B = (139 + 133 + 4 + 6) / 1650 x 100% = 17. maka secara teori besarnya persentase pindah silang ganda seharusnya sama dengan hasil kali masing-masing pindah silang (lihat teori peluang pada Bab II).4% x 17.J.

kedua pindah silang makin menghalangi satu sama lain atau makin besar interferensinya. Namun. Oleh karena itu. Dengan adanya variasi jumlah kromosom manusia pada sel hibrid. Barski dan koleganya pada tahun 1960 untuk menggabungkan sel somatis mencit dengan sel somatis manusia secara in vitro. keberadaan gen yang mengatur sintesis enzim timidin kinase dapat diketahui dari data seperti pada Tabel 5. dapat disimpulkan bahwa gen yang mengatur sintesis timidin kinase terletak pada kromosom nomor 17. diperlukan cara lain untuk dapat mengetahui susunan gen pada suatu kromosom tertentu.1. Teknik hibridisasi sel somatis pertama kali digunakan oleh G. Data hibridisasi sel somatis Nomor Aktivitas Kromosom manusia . Bahkan dewasa ini teknik DNA rekombinan dapat digunakan untuk isolasi dan identifikasi keberadaan masingmasing gen di dalam molekul DNA kromosom. Untuk menggambarkan derajad interferensi dapat pula digunakan koefisien interferensi (KI). Penggabungan (fusi) sel ini berlangsung dengan tingkat keberhasilan yang sangat rendah. Cara yang sama digunakan untuk menentukan bahwa pada suatu kromosom terdapat gen-gen tertentu. yakni virus Sendai. yang nilainya sama dengan 1 – KK. Pemetaan Kromosom pada Manusia Pada manusia dengan sendirinya tidak dapat dilakukan pembuatan peta kromosom menggunakan data hasil silang uji. Pada tahun 1960-an terjadi kemajuan yang pesat dalam pembuatan peta kromosom pada manusia berkat ditemukannya suatu teknik yang dikenal sebagai hibridisasi sel somatis. Sel hibrid yang terbentuk kemudian mengalami pembelahan mitosis sehingga dihasilkan sejumlah besar sel hibrid. kedua pindah silang makin independen sehingga makin kecil interferensinya. dapat ditentukan keberadaan gen tertentu pada suatu kromosom atas dasar aktivitas enzim yang dihasilkan. Dengan demikian. Dalam hal ini kromosom 17 selalu dijumpai pada setiap sel hibrid yang memperlihatkan aktivitas timidin kinase dan tidak dijumpai pada sel hibrid yang tidak memperlihatkan aktivitas enzim tersebut. makin besar KI. yaitu sekitar satu di antara sejuta sel. Tabel 5. Dengan demikian. Terlihat bahwa kromosom 17 merupakan satu-satunya kromosom yang keberadaannya berkorelasi positif dengan aktivitas timidin kinase. Artinya. frekuensi fusi tersebut dapat ditingkatkan dengan penambahan sejenis virus. Sejalan dengan penemuan ini berkembang pula teknik sitologi yang memungkinkan dilakukannya identifikasi kromosom dan segmen kromosom manusia. yang telah diinaktifkan dengan radiasi ultraviolet. nilai KI juga berkisar dari 0 hingga 1 tetapi berbanding lurus dengan besarnya interferensi. Sebagai contoh.1. Cara yang paling lama dikenal adalah analisis silsilah keluarga dengan mengamati pola pewarisan suatu sifat. Di antara sel-sel hibrid hasil mitosis ini selalu terjadi pengurangan jumlah kromosom manusia sementara jumlah kromosom mencitnya tetap. frekuensi fusi dapat juga ditingkatkan dengan pemberian bahan kimia polietilen glikol. Selain dengan virus Sendai.Makin besar KK.

sel hibrid 1 2 3 4 5 timidin kinase aktif aktif aktif aktif tidak aktif (+ = ada. – = tidak ada) X Y 1 2 4 7 + + + + + + + + + + + + + + - 9 + + + 10 + + - 15 + + + 17 + + + + - 18 + - 21 + + - 10/31/2009 Posted by zaifbio | Genetika Dasar | 5 Komentar GENOM ORGANISME .

Selanjutnya. sedangkan bentuk bijinya diatur oleh pasangan gen W dan w. sejumlah sifat lainnya diatur oleh pasangan-pasangan gen tersendiri. Dalam hukum Mendel I (segregasi) hanya disebutkan bahwa tiap pasangan gen akan dipisahkan ke dalam gamet-gamet yang terbentuk. ketika itu belum dapat diungkapkan mekanisme transmisi gen dari satu generasi ke generasi berikutnya. sifat tinggi tanaman kacang ercis diatur oleh pasangan gen D dan d. masing-masing pasangan gen tersebut merupakan satuan-satuan herediter yang terpisah satu sama lain. Beberapa tahun kemudian barulah diketahui bahwa gen terdapat di dalam struktur intranukeus yang dinamakan kromosom (chromo=warna . Meskipun demikian. Oleh karena gen terdapat di dalam kromosom. soma=badan). rekombinasi gen akan berlangsung pada saat terjadi penggabungan gamet jantan dengan gamet betina melalui perkawinan. GENOM ORGANISME Analisis hasil percobaan persilangan yang dilakukan oleh Mendel telah memberikan pemahaman bahwa satuan-satuan herediter yang mengatur pemunculan sifat atau fenotipe individu bersifat diskrit (terpisah satu sama lain). Salah satu kelompok peneliti. Sebagai contoh.H.BAB III GENOM ORGANISME    Pengertian Genom Struktur Kromosom Jumlah Kromosom BAB III. maka untuk mempelajari mekanisme transmisi gen perlu dilakukan pengamatan terhadap perilaku kromosom. Begitu juga. Morgan dan koleganya. T. khususnya selama . melalui studi pada lalat buah Drosophila melanogaster mengajukan konsep bahwa gen merupakan satuan-satuan diskrit (terpisah satu sama lain) di dalam kromosom. hukum Mendel II (pemilihan bebas) hanya mengemukakan bahwa segregasi pasangan gen yang satu tidak bergantung kepada segregasi pasangan gen lainnya. Demikian pula. Jadi.

baik pada prokariot maupun pada eukariot. Posisi di dalam kromosom. melanogaster. Sementara itu. kromosom eukariot mempunyai bentuk linier. yang ditempati oleh suatu gen disebut sebagai lokus (jamak: loki) bagi gen tersebut.1. Jumlah kromosom dasar di dalam genom haploid pada umumnya berbeda-beda antara satu spesies dan spesies lainnya. Gambar 3. Kebanyakan spesies mempunyai 10 hingga 40 . Pengertian Genom Secara keseluruhan kumpulan gen-gen yang terdapat di dalam setiap sel individu organisme disebut sebagai genom. yang menampilkan peta kromosom pada lalat D. Contoh deretan lokus sejumlah gen di dalam suatu kromosom eukariot dapat dilihat pada Gambar 5. Sel-sel kelamin (gamet) pada manusia merupakan contoh sel yang mempunyai seperangkat kromosom haploid. sel-sel lainnya (sel somatis) hampir selalu mempunyai dua buah genom. dan semua gen tersusun di sepanjang lingkaran tersebut.berlangsungnya pembelahan sel (lihat Bab IV). genom organisme prokariot dikatakan hanya terdiri atas sebuah kromosom tunggal (lihat juga Bab XII). Kromosom ini berbentuk lingkaran (sirkuler). Tiap kromosom membawa sederetan gen tertentu. Pada Bab III ini hanya akan dibahas sekilas kedudukan gen di dalam kromosom. Jumlah kromosom dasar di dalam genom suatu organisme eukariot (biasa dilambangkan dengan n) dikatakan sebagai jumlah kromosom haploid (lihat juga Bab VII). Oleh karena itu. Genom Eukariot Di atas telah disinggung bahwa genom eukariot terdiri atas beberapa buah kromosom. Dengan perkataan lain. atau berarti hanya mempunyai sebuah genom. Selain itu. Lalu bagaimanakah hubungan antara genom dan kromosom? Organisme prokariot seperti bakteri diketahui hanya mempunyai sebuah kromosom yang tidak dikemas di dalam suatu nukleus sejati. atau dikatakan mempunyai genom diploid.4 (Bab V). jumlah kromosom ini tidak ada kaitannya dengan ukuran atau kompleksitas biologi suatu organisme. Namun. genom eukariot tersusun dari beberapa buah kromosom. Genom/kromosom prokariot Berbeda dengan genom prokariot. genom suatu organisme adalah kumpulan semua gen yang dimiliki oleh organisme tersebut pada setiap selnya.

kromosom nomor 1 dari genom pertama akan berpasangan dengan kromosom nomor 1 pula dari genom kedua. Muntjac. Tabel 3. Jumlah kromosom pada genom haploid beberapa spesies organisme eukariot Spesies organisme Jumlah kromosom haploid (n) 16 7 17 10 21 12 6 11 5 4 3 18 6 14 25 17 39 20 36 24 23 Eukariot sederhana Saccharomyces cerevisiae Neurospora crassa Chlamydomonas reinhardtii Tumbuhan Zea mays Triticum aestivum Lycopersicon esculentum Vicia faba Sequoia sempivirens Arabidopsis thaliana Hewan avertebrata Drosophila melanogaster Anopheles culicifacies Asterias forbesi Caenorhabditis elegans Mytilus edulis Hewan vertebrate Esox lucius Xenopus laevis Gallus domesticus Mus musculus Felis domesticus Pan tryglodites Homo sapiens Pada organisme diploid kedua genom akan berpasangan pada setiap kromosom yang sesuai.1).buah kromosom di dalam genom haploidnya (Tabel 3.1. hanya mempunyai tiga buah kromosom. sejenis rusa kecil dari Asia. . sedangkan beberapa spesies paku-pakuan diketahui mempunyai beratus-ratus kromosom di dalam genom haploidnya. Demikian seterusnya hingga pasangan kromosom yang ke-n. Kromosom-kromosom yang berpasangan ini dinamakan kromosom homolog. Artinya.

maka akan diperoleh genotipe heterozigot. submetasentrik. submetasentrik. maka akan didapatkan genotipe homozigot resesif. istilah-sitilah tersebut sangat berguna untuk memberikan gambaran fisik tentang kromosom. Klasifikasi struktur kromosom menjadi metasentrik. dan akrosentrik. dikenal ada tiga macam struktur kromosom eukariot. Sebagai contoh. sedang lengan yang pendek p. dan kedua lengan kromosom semakin jelas beda panjangnya. dan akrosentrik tadi sebenarnya agak dipaksakan. lalat Drosophila melanogaster mempunyai dua buah . Demikian pula. ternyata dapat dikelompokkan menurut kedudukan sentromirnya. Sebagai contoh. jika pada kedua kromosom homolog gen a berpasangan dengan gen a.2.Dengan adanya kromosom-kromosom homolog. evolusi kromosom sering kali cenderung mempertahankan jumlah lengan kromosom tanpa mempertahankan jumlah kromosom. tiap gen yang terletak pada lokus tertentu di dalam suatu kromosom dapat berpasangan dengan gen yang sesuai pada kromosom homolognya. Jika pada kromosom yang satu terdapat gen A dan pada kromosom homolognya terdapat gen a. akrosentrik. Bentuk yang ketiga. Dilihat dari kedudukan sentromirnya. Struktur kromosom pada anafase a) metasentrik b) submetasentrik c) akrosentrik s = sentromir Pada metasentrik kedudukan sentromir lebih kurang berada di tengah-tengah kromosom sehingga memberikan kenampakan kromosom seperti huruf V. Struktur kromosom ini dapat dilihat dengan jelas ketika pembelahan sel berada pada tahap anafase. bentuk metasentrik ini menghasilkan dua lengan kromosom yang kira-kira sama panjangnya. Lengan yang panjang biasanya dilambangkan dengan huruf q. Terlebih penting lagi. Oleh karena itu. Pada bentuk submetasentrik sentromir terletak di antara tengah dan ujung kromosom sehingga memberikan kenampakan kromosom seperti huruf J. Bentuk submetasentrik menghasilkan dua lengan kromosom yang tidak sama panjangnya. gen A (dominan) pada suatu kromosom dapat berpasangan dengan gen A pada kromosom homolognya sehingga terbentuk genotipe homozigot dominan untuk lokus tersebut. yang telah kita ketahui berbentuk linier. Klasifikasi struktur kromosom eukariot Kromosom eukariot. yaitu metasentrik. dijumpai apabila sentromir terletak hampir di ujung kromosom sehingga memberikan kenampakan kromosom seperti huruf I. Sentromir adalah suatu daerah pada kromosom yang merupakan tempat melekatnya benang-benang spindel dari sentriol selama berlangsungnya pembelahan sel (Bab IV). Akan tetapi. s s a) s b) c) Gambar 3.

dan perbedaan letak ini dapat digunakan sebagai dasar untuk klasifikasi struktur kromosom seperti telah diuraikan di atas. masing-masing lengan metasentrik pada manusia homolog dengan lengan panjang akrosentrik pada simpanse. simpanse dan manusia sama-sama mempunyai 22 pasang autosom yang secara morfologi sangat mirip. manusia mempunyai sepasang autosom metasentrik yang tidak dimiliki oleh simpanse. akan nampak bahwa tiap lengan kromosom metasentrik pada D. telomir (ujung kromosom) sentromir (konstriksi primer) kinetokor kromatid kembar (sister chromatids) . Bahan penyusun kromosom adalah DNA (asam deoksiribonukleat) dan protein. Pada sentromir terdapat kinetokor.autosom metasentrik yang besar sementara banyak spesies Drosophila lainnya mempunyai empat autosom akrosentrik yang kecil. Letak sentromir berbeda-beda. terdiri atas dua buah kromatid kembar (sister chromatids). pada simpanse terdapat dua pasang autosom akrosentrik yang tidak ada pada manusia. Dalam hal ini. Jika peta kromosom kedua kelompok Drosophila ini dibandingkan. yang satu sama lain dihubungkan pada daerah sentromir. Sebaliknya. yaitu suatu protein struktural yang berperan dalam pergerakan kromosom selama berlangsungnya pembelahan sel. melanogaster sesuai dengan lengan panjang kromosom akrosentrik pada Drosophila lainnya itu. Demikian juga. yakni pada tahap S di dalam daur sel (lihat Bab IV). Tiap kromatid membawa sebuah molekul DNA yang strukturnya berupa untai ganda (Bab IX) sehingga di dalam kedua kromatid terdapat dua molekul DNA. Kromatid Kromosom yang sedang mengalami pengandaan. Autosom adalah kromosom yang bentuknya sama pada kedua jenis kelamin (Bab VI). Akan tetapi. Pada Bab X akan dijelaskan bahwa bagian-bagian tertentu molekul DNA merupakan gen-gen yang mengekspresikan fenotipenya masing-masing sehingga DNA dapat juga dilihat sebagai materi genetik.

a) b) Gambar 3.3. Gambaran umum struktur kromosom eukariot yang sedang mengalami penggandaan a) kromosom b) molekul DNA 10/31/2009 Posted by zaifbio | Genetika Dasar | 2 Komentar « Entri Sebelumnya SINOPSIS BLOG INI BERISI SEMUA MATERI TENTANG BIOLOGI DAN PENDIDIKAN YANG DIBUAT OLEH ORANG YANG HAUS AKAN ILMU DAN BERCITA-CITA TINGGI UNTUK MENJADI DOSEN DAN MEMAJUKAN ILMU PENGETAHUAN DIMANAPUN DIA BERADA DAN MENGABDI .

7 2#.5.2705.7/:.3:2.9:83.3503.9/-. 4443:2 207:5.-09:-.8472430/.03 /03.251.8.9:.80.9:8.8.38090./.2 :2.34080 80570:7847.803.32.297..89.8./.9:8 7.3/03.448990. 80 80570:78479/.8240: 240:7# !. 708543907.-0-07./.038090..803.9:7./.8:3.251..34489907.350702-.80380-03.3  2# 8:507570.3/3.9/..7-:50780 40: 2#8. :9.3 80:2.3/-.3/03.28.3/.3.3038943/.370..397.3.35748083.709/..30.2:3 80..3203.3.80-:9:.8//..4  $0.8.3/09.3:39:705.9:.2.34489/.82./3.:39:20.387580:.2 ::3.7.947.4-3..9:20.3-0.5...3 90.:2.3.:.03503.3.:-.803907..3 97.2..9:797.83 2.7./07974-.8:.5.28:..50702-.5./.3.7809079039:203::0809.3:9.2203./.9:7.3802025:3.70805947.580 240:2#/..550702-.3 ::3../-.80:2. 830..9.73..45   2#802570.3.3 907/.0.3.7-4842.303 ..-0-07.2809....472430 /.251.749 2085:33. 09.709200./.78.380:2.8897:9:72./.3820 503.3..3.3202-:9:.3/...3.9: 037#.7..7.2 3:0:8207:5.597.9/:3.3/.5./...380.7503..9079039: $0-.3:2.3./80./.7.3907/7.9183.3.203.-08.3/03./.9.3/7#/.3503.9.583.780-.3:2.9.-07..7.9.387584047243/2:.8-.3802570.3/032/.9:70:.4394 80 8007974-.5.3.3//07...8.9.507:/.  .7570:78473.3574808.40-07-..10798.9  .3.9:850780 /./.32.507:-.390780/./.::5:39:839088240:90780-:9/.3 203.80  037#-07.9: 2#8:507570..32025:3.9//.3 9.:-..9202.8 40:7#9/.3-0-07.251.9:7.380 . .7574903.8.2.3./5033.38.7./.3.9: 80203307 2.3.8 03.8.9/97.574.83203..3:39:203.8  0.80  .9907.3:2.9.39:3.  . 425083907-039:-.3. 03.037#3.33.749 .7:/48803..8.302:/.//.3.3..749 $0-.5.3.907-039:4250847243 70805947 $090.032.8./.8 !02-039:.2.::5-..387580:.3 .33.570:7847. 47243/.28945.9202-7.28:28:29:.709 0.382007.0380-.251..9.8..-08.73.0/.3-07.8 ../.2025:3./4-32.803 .:0-7:29-.8  !03..3/507:..29.3/.2809..5.8..032397.347.80/980.32033.302:/./.3.3203.3 .0345:8.7839088574903 &39:9:/-:9:.38758 07/.39:3.3574903 897:9:7.3/50740809.749.4394 .39.3//.3 57480842508.224/1.03/03.3.383908880:2.3 4489.3/2#8:507570./.9:503.9.75.3-0:2907.3.39/..703.397.:-07507.9:3.387580:.0-.5..9:  2#8./.5.9/809..9...:./3.2:3 503097.9:7...9:9.948.04254 ./.9-.3 88./8.8  $. .3/03../03./.8.//.: -.3 907.54070805947:8:8..3/02../507:.035.  .-08.308570803503.8.77-4842 9.3-0:2-0702-..78-08.3203..3/..3./:52# .9.80-0:2.3 57490390780-:9.30-/.3.251..7490-:7./.5.33/:8 5...802-.9:5033.80390780-:9./ 9. $02039..5.03-.38200:.47243  240:5749030.8203./03.-08.3//.7.3/9.33/:840 .8..38.20309..3  $.

3.230897403 ..3708543-07:5.3018038-07-0/.3.  .3839088032./.3203390882#90780-:9 .3   507:-.9:7.5..387584047243.:.35.703...7907-:.8090780-:9907.2 3:0:84250890780-:9 .38073.3.  034203.8/03.9.  !03.73..  !..-:235..03880.3-07-0/.-:23 $390883..2025:3.7.2 /8:39/03.240: 240:2#.38758//.:2:33472433.20/:.2:2.802:/././..9.9/./:9:8 .4250847243 70805947.3.82.9.50789.39.2.390:7 4.3-.3.9574903.33./.73./..3907..892:..9/.9:8 28. .5..3-07-0/.9:574903010947   ..9202-:.2.240472430.28945.8:3:0:8 !7480880.3 -07-0/..35./:9:8.3/03.3:93.03.032#54207./...2.:7.3 .3.9.557480832# :.30897403 .5/.2085:397.5:.73./5.95.//...3.909.3203./.3.9.0897403/-07.3  /.9.38.93.3.8574903.80  43943/:897.9.38..3897:9:7742..3/97.8. 8:.8839088 4.3907:8-07.7.3/.-0:2-.9:/ ..-0-07.   503.8.870570847 /..3.70805947472430897403//.3.3202-07./:9:8.57:5.3:980.9:  503.28. 8390882#:39:4.38:35.34.3.8.3..5.80 80 . .507-0/.320302-:8/3/33:0:8:39: 202./.38.9   3.390724/1./09./.: 909.9.-.80 804.. /902:.-07..39.

7:/.2..703..703././.507-0/.2.8.354.8.. 502-:.339743 003.3.3.8040-07-. 2#.38./.5./. .9907.3.203.3-07.

320. 5.38.574903.8 .80.2.3 2025079.84.33.3 85.3/.84085072. .2#9/./.3.3:2:72#:. 5. .574.38./.28090:7.502:/.3.3.9..9:7.8.2.38.:39:97.3 .989.3.80-03.9:7.5.9:7.9:7.57:5..340.5.390780-:9 .30-:7.3:2:7 10920 240:2# /.3240:2# .9703/...2.-44-0781..3/7:39:9/.83.3..3/.10798.../ /.9:38:790780-:9 909.8.75.2 2. -07507. .749.3-:./:25.32# 20.090780/.73.9./-:.//.8:.387588.3.39/./.90:7.703..9:.38205748083  :8:83.3 8./8.88./  80:2.9.//.2.38.38:.2502-039:./.../03.3-.8 07-0/.3/97.33..80-0:2/.3 1.2.9:7.8907..9.33.98 ..3820503.3203:3:.749.0.3875572073..2#.3 03.3203..80/2#  !03..0:..3-0:2 /-:.2.20.2.3.90780-:99/.32#907802-:3 2.:.3.80:2.38.38.2:3 .2503./.3.3 /02./.507-0/.3/:25.3./.9:7.:839088574903203.  43/8-./.3/839088 .39.92085:303.3909.5 -09:10798..203.82#5.3907.3 2#  !03..3425087-4842 2#  ./.3  503.397.3.-.80.:50702-..73.397..397.3.9: 83.503.   503..3.3.89:/3.3 /..8  $3.83..25079:2-:.3/3.3-0:2/-:.907-. 909.800--. $090:73../.9::38:7.3-0:2/09.3/97.7.2:2.3-0:2/97..947707:9203 3..3 97.2.94443 80/.9:7.:80:7: 839088574903  %0:7.

9  $39088-0-07.73.3203:98:.749907/.3 404/438945/.9025.95024943.380.3:9: %.9:740.:503.5.  .34/43.340:7:9..2349079039:.2.83039/.38.809079039: %025.08908 4003257490.574.5..3-071:38807025.9: :7:9.92#54889743.3/.39-4//5079.574/:8.0.9/.7.3203..9.9 9025.8.3240:2#.38203-8..3/58. .980-..340 20.43/8./.3    .4394 4380397..9.38.5.-07.3. 240:574903.2-../.33.545059/.3/5.8.3 -08.9./.9:039:3..8../ 240:.3907.3 ..5073..8 97.29::7:9.39-4/ 90780-:9-07.3/03.3.-07::7..2#54889743 909.5/58.288902802.3/802:.5.339/.95024943.  5.574/:03 $0-..3 /03.3503.39.7./.9:80203 !.:8:8/03.3203.2-.380:2.574903/..9.55749033/.5.803..383908854574903 !4574903...$39088-0-07.3/7/.83 2.38090.5.257480897.3.3/3./:25./.7.85749039:803/7907.38.88:..390754943 54943:39:203.5-07.34389.7499/..78./.80-. 909.9 /809.8 .. 909.2.97.9.8..9:038240:.5749039079039:/.8.0:.52#  $0-.38.

.

 %.. !4890/-..380-:.8.9843 7.:38...9070309 #05...90703095.91 #05.'7:8%079039: 4/0$97:9:740:203:7:9./.7 %#%   %#% O O O O O O !02-:9.8$0243807.3#80-.42039.380-.9070309 !02-:9..1-40309.7%3.8.

-0781.32.:  .9  085:39073..83.9.-0:2/09.303::3  %#% !.3148147 .7.9..5..3.23:0.80.88..3:03.3/:3397403/.23:0.3/03.8.9: .2.2./03.2.:/.7 3:0:8803.38:.8.3-.9.8.0/4907.2.3#05.302:/.9:9:1:383.33.92.07 20302:.8/.:.2.3/$0/.280  .8..:38047.9.3.980.93/84.3:8.203././.   08./.8/.73:0:8-07-.9/84.

907/.720.:..7:.882.203. /09.3507.9/84.2.9070309 .897.9..0.3..39070-/.4.83 2.3  574903/03.20/:2 5.3/:5 .3:./..8/:5  .3//.20/:25.3/:3.3530:244:8$.3:39:20339088.882.8897.3..:8203.3202-039:443/03./.9 ..::5 :.9...202..23:0.2.9 20339088.747.7.3/03.:8530:243./:.3503..380-.3/3108/03..9..3 .39073108803.3..9070309 /.32:9./.33..4-.5./.::.3/.3/.3/03.8 .33108-...:320.8.80-.5.4-.25:..9-079.27424842 ..:35749030-/.3.3..3..0.:909.::5.35./.907030980. 203..33../.9./03.3-07:93  !07.9:7.3-.703./....307.9.3.9/3108/03.-.9: 80../.380.257802:.:5:3 0...32025:3.7:3..202.32./:.09.5 80/.3 90..3/:5 02./9:2-:./.95::9..3 5.3 /.9:2-:..1.8.3/.8897.3/.33.7025../.2...9/84.38205079.7./5.8..39/.3$ 80/..9070309  0..5..3-.33203.380.9/-:9.5..2.:507-0/..7./.32.7.2539: 3:0:8./..-0781.-:9507.3203/:33..3809.8.8.3 02.7:03 2032-:.3#/.25.3 8.-.:80-.3.9.3/:3.983.7./9/.380-.-079.38:380-03.8..3 /.3507.3207:5.3938.0.2:3 5.2-..3203:3:.3530:244:8.3.9-079.3 897.3. 203.3.9.381472.3#  03..920303.7: 5.3 /.8.35749033.9.7.3..:/047-43:.25.9/.9070309 .82.9: .32:9.  085:3/02..47...802../5.3.3$90780-:9 $0-.9.3909.985.8  71195.-07-0/.32..7. 5.23:0:880 842.2:7:3.7:03/..33.907530:244:8.3.5 $02039./ # !./..3.30502-.5.9.9530:243.5:.3/:3.3#/.5 80.3/3108/03./.7:3.747.240: 88.3.3 203:3/.747.897...7.397.93.5.3.../.3.7.920203:8.907/.3.9: 80/.2:3.3820  80-.3.39:-:0..3503/.3.3#.7...5.32..3$.3/:3.39.3897..:897: ..5.5.:302:/.3./.8./.58:548.90.3.3..25:7.3-.9070309 .3907..7: 5.3$...203.03 2.58:548.2.3/902:.3 80-0:23..3-./.3.3/./.303..9.8508089079039:2025:3.507903.9//. .3//.2.203. .9.:3 .3897.9.3.:389:/ 2748458203:3:./.8/:5 %073.8.7.803.9:39:20.7:03 $97.9:9:90.3/3108/03.83.3.2.-0781./.3 .3..9574903803.207:5.9 203.32:9.4-.3 9.:3 9.9/.7:038073/.9.:.29:9/.27-43:0.9:.5 8890200-.90703095.3.9070309 .2-.980-.. -0/.3897.80842.7.35079..3907:9.30.7/.5.73.3 -.907530:244:8 $970594.-503.3/.2 .39.3 3.3202-039:443/03./.703..9075030-.:574903  :.3907-:9-. /.5.9...9 .3203.5.2/0487-43:0.3 5.2.7907.35.9.3 -08.9.820488-../.9 2.:.82.3$.2.3....2 7424842:.9.3/..9:.8.:7-43:..9070309  802039.303.80./9:2-:.7 03.897:9:77424842 .9 -.9 !30:244:8.3.3/:7.9.7/.39:-: 0.3805./  /.

9.85.3./.# .3032 #.3-079.2.3 /..9.80 :9:7:9:7:9:7 897.3.897.3$.07/.37119 .3203..9070309 !07.381472.20897.808:.9:/03.8907. -:.80 5020.3#.:.-.4-.3-..97.2-.3#  897.381472..3#.92..032.9:.350309 .30:9:7897.381472.3-:99039.3907/. 9.3897.3$0897.03.5 .3/-07.507.9:/9.203.5.:574903    :9:7897.907.3.3/.3 ..381472.2-.7  ././897.3$.04/ /./.203.47.3#  .8/:5803.8202-:9.4-.381472.80 5020.3507.397.3-.907530:243.30.974 . 2.3/.907..4-.703.:.3 .9202-039: .:.9 /5.4-.397.9../$ %7..2..897.381472.58:-07:-./...20.:./.3/53/.80.3 97.3 0897.257802:.7897.58:/.4-.7.89/.3# 57490.574903 97.2-.880.. .9 /.0./ 793.3# $897.3/53/..7920.780 80897. /.-07:-.5.2.9.3 802:.3$ 0897..5./.:39.3711980/95:39/.380-.3#  070..3# $897./..3#.-.23.3/9:2-:.7897.3#897.3 507.390../.203.47.9:. 507.80#.2-.07  .3 202-:9.33..4-.8 0897.33108-.-.9897.3 0897..3:39:20309.3$.90741.3#9/.8.202-07....7.9070309 .8  81.2:3 5.574903439.9..9/./ 897../.:897./507:-.3 .:03257490.5./$8050795.3 503.3#897.905.2030-.3$ .5.890780-:9711920325:..3 /9../..9./$ .7:03  !07.:.2.4-.3#-07:-. 897../.3:3.3#.3909.3 .3#203.3.8907.5-07. 97..3/.90.3/20/:2 5.390780-:99073./.9.8909.39073.203.390.8.3820  .80 5020.32.3-0781.80:2...907.2-.381472.9202-039:.3#-07:-..3.2507../3. 574903439.3./.907.32.23.

.280 80 ./.07.-0/03.2..288  73.3/:38:1:7909..2. .35.3.3-.907.2..3.280 3.%/03.-0/3108.9: 8./484945! 80/.38. &39:202.9: 09. .38:/.3 5.2:2....3907.33.9.302-.37./.3907:.75.3 .30- :7.5./3/3803.2-.3./.90703092...390.3 803971:.-03.3/58.%/09.-0/03.2.7   .790%//.8 80 80 .9070309%0/. .48./..3$/.330.5.907 %//.%0/..5.35.203..3/:38:1:7 /.2.33108%5.9070309.3:2:23. 5.790%90..2.9.90741..5.3203.-.3 907.-0/03.3./09.3/03.9070309  . -.503.59/.790 5.7.4 $0-0:23. .-07.90703095. %073.-0.9070309.38:33.9/.980/9/902:.4-.:. .80.790%2.4803.- :./.80/980.90741.92.3/.2.3 7.3203.8:3.280  .8503.35.0-07.8-.7803.203.3-.3  $    803.5.3.35.: -:.5.5.9-..3..3./484945!  2...9.5.33.280-.8507.3/2.5.3/:3148147/.7:8./3.: .8:.4  /:9402./.340-..9070309/.202:33.790%.37.790 5.4/902:.4 03.3108%5.3-.203.7 80 .33..7.. .3/2.3202-:9.4-.9.3/.7./..37..:2025:3.3-.790%.3  !   .2.203.80 !07.790%200. 2:.3/.3.3.2803.4-.3/.3/./484945$  $0-.9.38:8 70574/:89.790 5.203.4-. !74903 .8 203:3:.4. //.490..-0/03.2507.3!0803.3  -.38.280 80 .9.38.!07./.:3 40 0780/..38.3/..3 80-.../.9-08.8: /..//.3.5240:574903/..30:.3203..790%.7././/.388  -.7: /.9.  ././.790 5.3-.%.:..9.35.3.3/.:7 /:5 -./.3/:3.3..970574/:8 -.3/./484945$ 80/.3.381.320307.90741.574903  #80-.33.90741.3574903.59/.'7:8 .4.7.2. .3574903/.3::30473.7.3-.3./.%/...3.9073..4302:/./48494590780-:9 ..89.3/./484945 90780-:9 5.90741.. 200..  2.3.3.8:.3/:3148147909.:2.30/.4. 5.350.//.280 .547.9./03./3/380 ..90741.3202-:9. //.././:3.3!.

3-.3  574903 # 5028.3 $0-.7.202-039:240:.8.2..5..280:-:3574903 03.424..3/.3-.9425..8.7:89079039:/09.80-. .9:::81481.89.9.7 8:-:39 8:-:39-07:.: .3:048/.314814/08907.2.-.5.3/./.503948.9.3 2434207 .53:049/.8.9 .5..882.8 503.3.3.947.8. .3897.0-07.3/.3 %'..3 80-. /.3./.303.87043899:8302:/.3/.350309.3 /7043899:8 /03.38..207:5. /0487-48.3%'.-07.3...030 437.9..2025:3.9/58.7:8 %' ./.7902-./.35.35034247./.2-.380.3207:5../..9  :.5.3/.3 40 7.9425..23:0. :049/.#3.7:8.3/.9078:8:3/.803 :39:202-0/.:  '7:83203..547.3%'897.3.32030-..3/.3/80-:93:049/.7897./..8.7.4-.9 :..%' .780:-:35749033.9079039:240:#/..392-:3./03.37043899:831080/.9:.9:/03.3-.20.3-.8./.503948.5.-:3.:-.7# /.: 574903 .38.902-.3/:3240:#./..3/03.8. 4254303 .39.5.7-43 /.380-.397403/9039:./03..89..3./03.#3.0/:.3897.. 3:049/.:.-.-07:93./.3907-:3:8//..3:.340.9././.8.. 397403-07././.803.7203.9./. /:-:3.3.9.2.503948.380-.# -:...:3 #/.390.8.#  4254882.803.:3902-.7897.9/.3 $3075.3 /7043899:8/03.907/7.9070309 .3.2503.5. :..#.8.7897.32.53:049/.3202-:9.8.503948.3/:3397403 !.:39: 02:/.942.:..:3  070.7897.3 #/.3574903 &39:202..2.9/80-:9:.:..3.:.2.39..9.9.8 503./.3574903  0.3/7043899:8/03.2025:3.3 897.503.:94-.74240:90780-:9..4-..35.3 0/:.7.9..3/.9203:3:.39073.32.33:049/.7897.3 5034247.3507. #/.8.  03:7:90-.3203:3./.3.90703095./ 1.9/825:.33.3-07507./.7:824.7:8 .3574903/..3/..7:8.3 /3108.7-48.3 507..924.3.397403 -.3203039:.907 03095.39/./.23:0./. 805079.809.3#80-.9: /..8. 80/.33.9/.3574903897.-07.9 :.%'.380:-:3574903/./.3.:.8..3.397403 942 5.:.:9/.543:049/.74240:39078:8:3/.2..5.9 %./. 909.9:.37043899:8.39.3.503948.3-07..7  !07..3 .:.3/80-:9 3:048/.5. 24341481.2.%' %'897..:3902-...7897.703....3203.9425079./.-.2:0.

 94234247 5./.7-48.33  80/.:.5:73 -.9                            :./3.2 .3.2.3.9-. 2..3/.3507-0/.37.572/35.9.3 #.397403...       .3-.3. 80/.8../.3.8./03./.897:9:780-.9::8803.3.9::8 805079.8.9:3.3/. 2.8.8.3.3.23:0. /.3.8.907/.5.9/..3:7.5 /.2025:3..923 909.39/03. 3207:5.2.0/:.3.8 &  .2.7..8.8./03../:.3.:923 % !./033  .  $02039.39.240:543:049/.:39.9: -..39:3.:/80-:9 5:73/..3-.:.543:049/.5 203.3.::.503948.3-.5..990780-:9    ! ::81481./.9.#9/.5.# 909.9-07:5.:39..3/0487-48.7.5.5.89483  .:/80-:9572/3 .9. /0487-48.203.9-07:5././.5.9.:5:3# /./.

8 -./.7.9843 7.7..3/:3.389483  03.3-./.572/3949..33 894838.8..2.3/.5 38-.340 .3:.7-07-.3/0/:8907. 4/0897:9:718240:5079.7.2.7  42543032.8./03./.3-.:340  ./8..3.524/0 90780-:9 ../03.3/..2.2-./0338.8.9.8/.9-07./033:.3803/73.78508080850808  .23:0.8.3909.220.203./:.9:   .9843 /.11907.3.:203:3:. .34380397.4380397.8.8:.882.338.9 4/0$97:9:7.5:73949..3923 80/.2.3/:3. 4380397./.3.8-./03.:. 4380397.:./033 923907.:.. /./.5 4380397.33              89483923:7.35.8.8  .3   7.382080. 397403240:/./.8.      .5.47.8.

3:049/.37.3.7909.3-. -.5.3974039078:8:3.35:.3-075.9::81481.38:2-:240:/03.:39./17.8.118079.5.3.0/.340.3907/.314814/08907 .383./.8.20.9.3..5.3-.5  202503.8.39.39338-.543:049/.5.30/:..94234247 /03.9 5.: 2.9:  ::33/3.9.3-09:5:.9 .9.-..28.3-. .3::3 .50.3:. ?  ..0/:./.-9.3/7403.8..3. .3.8./..3390780-:9.40.0 ..%5./.7.397403 9:2030-.55.80-03. 09:5:.78:2-: $0507990.3.7::3 0    !   !  !  !  .7. 80/.8.38..8.3703/.7.3.7. 53. -.. /.9::8   0.:::3! 0/:/:.703.8.3/03.3-075...5.5/:.5.80.8.9::39.7.:39.3.3/:-:3.203:3:.: -075.3  S 907/.8.35.35.3..703.3907. /./.3.3.7./.-..33:049/.. ?/03.7::3 0 2.:39. 397403203.39.-07:93.3.-..5075.9::39.90780-:9 2.3-..3 .8.:39.8  3:049/.33./..-.3 .8.8.-9.3/.3.  ::81481.9.3.33.3./.7.543:049/.2.3.7.5-07.9/9039:./:-:3.9:.-07.3-.24/09.:39.7. -.2.9.8.94234247 9/. -./17.:39.3/7403  0.7.89.:39. :39.8.324/0897:9:7.38.8.94234247 5.2.33.3.3/50740/.3 203.-.9843/.395.3.3  $09.5.8240: .9:8.5.-07:93.9:::3:39.7.9/.3 14814/08907/03. .8.28:2-: /.3::3 ./80-:9.8.850249709.90709.3203.338-.3.3-.3. 909.9:2025:3.340.:7:9.  !4./.9.3/03.7./80-0.7::3 ::33 .883.5.9.-0753 /4:-00 03:7:924/030/:.9.2.3.:.33 /.7./..3/74037.8/.9.3.8.7:89.543:049/.59. %907.:./.42502039073.-.543:049/.73.7.2.:::3  ::3..3%.3.9::39.3 8:2-:..::33/3. 8.80-.9:  -09::7:9.94234247 .738/.80-.39.079.8.8.8 240:3.3-07:7:9./09.3240:203:3./0487-48.-.3-.42502039078.32023/805.../.2.3/74037.9. 39.. 8.39.80.8.3-.7 40   38 # 7.3 7.5.8.395.9 .8.9:8.33 203:-:3.3. /.203:8:. $.9803.:.8. 8./..7/./.543:049/.3907/.32030-.33.3. 2025:3.8././././805.8.33907..9.7.8./.9/..

3-08.7:8203.8705.5.3803.207:5.35079:2-:..:50789.1:38544-07:93    ..907 0309.2.3/.25:-07.3..8.80-.3/107038..907030980..8 ..3802.90703095. .3 80. .7909:.: 705.9070309.331472.38202:.9 81.3 20..05.35.907:3.380-. /./:/0.3.78.7.2897:9:7240: :..8    .9070309 $090..907-:9-.47.8.9203.3 09.3..2507:-.3/03.5.9/.3.320.3.39073..1.5.8. 2.331472.3820 793.343/83:3.-    ..8 81.907 0309 ././../.-. %.7:8/..38090.3820 9.4:89/.7 .3.7.320..3103495047.70307.2.91:38.9070309 ..5./.32.847..78./.8 .3:9.39.2./033923:.7:82.8.5079.35073.80203.09:7:3.3.9:750702-.3/.9203.9:90.2-0-07.2-..80309/..59.800307.9070309.9 20307:8.9: .3202-.9240:073.5..23 0.320.749 3.8/03..80 0307.9-.8.:08570803 ..7:8203.3820 .31:38103495 .7.03/02:.3/. :383207:5.!  !  !  !  !  !     ..3.-07..4:84307 ...340240:90780-:980-.-  .8.9/.8 :383207:5..33.3.747..9.3.3-078..7:8/.3389483 :38.3/.9:..3/..7:8/.0380-.3 /.3 -07:-.890780-:9/./805....70307.5  085:3/02.38:3  :383207:5.31:380.32.3/.25:20325.31:3803495 .947./.7:80/980.507:-.3905. 2:9..

17.39.502-039:.705.3/850781 !..919.-..203.0/:.2033:049/.8/ 80:2. 909./..3203.9 02:/.3.3 803//./.3-0793/.3.2.8 /.3907-039:.91 /.3 17../.91  80243807.543:049/.3 ..-0753.5/5079.83:39./.::803.09..7:  $02039.3502-039:..3 9025.38./ ..2039./:8:.217.3-.203543:049/.3/...8.9:43807.2502-:.203 17.#05.705.9047098705.09.5/5079.8/8507810/:..-0753203.-.7..3.843807.17.3-.7:                     .83 2.3-.3.-0753-.90 -.3909..705.3.7: !.9025..3 ..3. .-0753.3:39.7.543:049/.3/:25...7.7:.7:803.39070-/..9: 5..203.2:3 2.3203.:39.3/.9.:39.....8 80243807.390758.9180:7:9..80-..29. -0780.3.35073. 543:049/.

 803971:.2.293.3/02-.33.03971:.:507..0307.3849453974033472.30-03.5.30-:7.3 5.3 -07. -.397403.7../.9078.3 -.3/..240: 240:/03.3 .75..907...8.705.9:./.507-.9 203:9507:-.950.38 808:247/.83.91 ...3.30-93/.9805079.3.3.3/3.9.307.480.907.3/03./.3-.2.9047098705.8 :39.380 80-.3/03.3-07-0/...4/03.5.2..5.7.3802:.5.-0-07.7:9.2.39..907 .3974035.93..3-.7./.38. 43807.3.:340 $ 080843/.080843/.5.90790780-:9...240:80 80-.-0-07.390780-:9 .7  %.8802-.5.83.07.943 !07.93.5.3203.8.3 0-73.220/:2 .4:20 .0307.4-..907.3203.8.2.07.803971:.393./039 .  070.397403.547.5.3-07.4-.39.20/:280.33.  40:2025:3..2-.9.9/-:9./.8-07:93.8.9.7:9.20..9.-0-07.5.5. -.5.9.3./.3.95078.3$9./03./9:2-:.8.7.3020/:23472.9 40:/03.38.907.9 /58.3  07..3-.3.3/:384945 /..../03.3/:8:.3/.5. 3472.83 2.393..8 2.9.7.80243807.3/:384945397403 :39:203.2. 80.33/.9.32.4.-.0307.3 .7:  ..9.7./.3/:3 2025:3.3.  .3 202.8 02:/.2.890780-:9/..5.:06:-7:2/0389 7.9.203:2-:.3.9180243807.91/850781 .8//. $0-.3.:39.3203.703.9.09.5.7.3   $9.   0.

.2/.3 .

307...9.3.3.5.2 80/.38./.7:9.   .

85.3-7/ .3$9.79..3 .38.9..9203025.9./-.07.3.3.89.9./03../.3.3//..80/:.79.320307.3/9:2-:.9-.3903.9./.8 3..9.202-.5.5.3.20/:2   3.-:3803971:.38.3903.393.20/:2 9073..5.3903.-07.9203025.3  5.9.9240:/803971:.2.9./. /.7:9.05.780 .8   .3.780 .7.3.9 /.0307.380...7.3.393. 3.8.3.2.8 3.5..50/.020/:2 907.203025.2025:3.35079.35079./.:/80-:980-.240: 240: .3240: 240:.7.3-.30/:/:.0307.393 02:/.393./9:2-:../.89.5.33.  .3 8.-..0.3.4.3 0.-0-07.8..3..5././.907.23.8.9.35. .580-.3.3/0897. 752 /.2  09.9-.-:3 09..3.39079039:.9:3..9.8.9.25..-:3 80/.0307.207:5.2030.20/:2907.3 -07.2./88.3 02-.. .35..907.5 080843/.-:3909. 8090.9.-:3 !.4/9:2-:. ..5.0307.907./..7:9.2 2.3/0897.  802039.9.2.8/03.803971:.993 .3:93. .3.3.:/.2.3-.-:3 40:/03.7.4..8 9.9.0307.9..490.90/:/:./-.2.-:3 $0.3907../0802-.290780-:9./.320303/..3.3./03.2..8./53/.33.9.2. ./.3203025.703./.907/.0307.3/1:8.

2.32.9.9.:5:./.3703/.8.3.3-.502-039:.8      0897.880.5:2.3703/.5.7:/03.-. 20/:2  0307..8507.2-.8  20/:2    ..3.39.393/.8/.307.9.3.3.7:/03.3240:20./03. -7/ .7. 02. !. /:25.8      0897..380907:83.5.  909..7 907.5.4-.:705.307..3/03.307.880243807.9-.0307...52:3. 0307./. 80/..3-./.3909.91       20/:2 0897.83 0.3703/.39075709.3803971:.9. !..7.8-7/3. 0307...

.7..35024943.5.202-039: 047 .30/:.20.7.3.8/.-.8.3080843/.7:907.8.3::3 !02-039:.3202507.2-.3/03./.73.3.705.8/805:9.38:33.3:9: 80-03.9-.1/.32.3 503.. -07-.7:/. 705. 574.2-.32.8240:/.2-.4-.3 90780-:9 $0.9.7 3.20.749/03.9.3705.390705.7.:87:.:947.83/.3/03.3..3-07.3...7.7  .8803971:.2039..3::3 502.3$9.3705.7.-07-039:203.-..3$9.80243807.703..:39.9../47./.35.3 705.73.7*-.0897.5.3/:9405005.705.3805079:7:1:3.3 903.8. 705.329443/7.8. ::3  9025.9203:3.3/50740/.2-.:947.23..390717.83.8.0705.9079039:.9::3 5005.907/.3::3 /.3.7.7  #05..:.9.20.780 80 ./.7./.73.3  ::3 ./../03.3705.38200:.2507. /. 20/:2  0307..8Û 5.8  39075709.3 .8803.3::3 /..  0897...//03.7..2-039:3.2.7     503.4-./.2.3080843/.91  !.07.3 203.8 .-0:2/09.7.4-07.9/.507..3 3:049/.3203::3 743..-.87424842/./...7./47.2-. ..9033907.2.314814/089075.83..8/.3 047  907549433.3 202.80-.390780-:9803.::3 .3/0483:049/.8Û 909.3/3.7: .3:9:*./..314814/08907 .3203::3 :39.3 839088 :39.80:2.943  #05.7:8 4745..203.8 /..3274845009743 03.880.8..3240: $0.347.9./.: #05.5:.9.7499073.2-.

.3/.9 .:839088 20-.9421481.7.2-.3.    !03..8907.7492.....80/.749 80.83.5.95.7..3/%!907.8870.9421481.9.9:9025.3/04892/3 971481.3-07..8503.09.8 705.8.2.5.9 /%! /04889/3971481.9 /%!  /048:.8 839088  #0./ 502./. ::8  -0-..3483971481..8:2-07-.0/:.32028.7.8.3:39.3/09.3/507408:. -07.24341481.5.//8:.943 47 !74808 38.2.3907/7.703. 425430370.9 /%! /.7.9 !! /05.:5:30:.3-07/0.:39..39.3:049/.8 40:.3907/7.3.7:803.839088 503./.9 3:049/.9  32 032.3:049/.25:20.8 ..    &39.9-07:5.2-.7/.03254207.33.9: .8./.2-.8/:. 574.7.8.7  ..8705.2705.9.8.3572073/507:..9:740 -0-07.314814/08907.3907..203.80 ..5...3.80-:.749 907.09.3..3:049/..8.9 /%%! 0025.8 #05.     :.32.3-.3/3..8 -.747203::/:.82..38:3/.9/902:....23.9.:7:9.:# .754207.9240:3-071:3880-.200-.3/.3/:3..03254207.3/.7/%!.032 $.09.971481.399.70.3/.. 47/.5.9:   0483:048/.//:.705.3/80-:980-.3 !./.9.3./03483971481.240:/%!/9.3/:..:.39.9.790780-:9 80-:.3.5.3 9025..7::3 0::3  %%     .7..380-.3057207/.7.3907/7.8.2-039:3:049/.3.338.. .9025.90    $0203.3-.23:0.. 38.8../.39.-:./:.3-0707.802.0:.9. 38.80.240:. -/70843.:39.8 ./-07.3./.. 9/.5../.2025:3..8839088 /507:...99079039://.3803.83 2. /02-.502-039:.9..3203.8025.2-.8 .30240:57207.380-.3%%        /%!!!         !!! 54207./705...3 907.9.9..3/3.. ..-.9/./03.2-..3.09.3:39.9-007.75:705.80!!!!           .93.9:/.2-.7.9 /! 9..9.703..2.3.380:2..75:705.3 -07507.: /0483:048/.3-./..3.3-07507. 2:.408.8/048..8.3.:47341705...89.9-.8 . 543:049/..883908880.9.2.:2.9503/0 /.9:7 502-039:.2-..32025:3.83/9.3/-0-07.3-.3/50740. .%  %       .703.8.3 240:.  .

3032!42020.4.. 80/./.3:9././:..3:39:8390885.7  $02.9:54207.2839088 !4 207:5.80 !4 /.8839088 3254207.2.3 80:3/07 $02039.7.2.70.80 !4 .3507.3032705..80. 0:.80:39:83908874248425../.354207.3/507:..3. .80.2-.2  .8.9: 03254207.749/80-:954207.

./.203.572.3.-.8.:39.8. 543:049/.3/.574808. 5..39.9.839088 ./..832025:3..802025:3./.3 -072..80843:0.:502.-.80..::3 793..7::3543:049/.3/..2 502-:./3 897./3  :8:8032!49073.2-:317.503.78.7.20-.253 .3./.8.314814/08907//.8/03.3...9.2:3  8390885.7::3  0::3 .9:39:202507-.0/:.3 809.8390885.9.  .-.47 $090.9:/.80 323-007. &39.3502.8.503.80/.83:0.3.907.7::3 0::3  !.8.07. 5024943..3 .907.:08./.-007.9.:.3240:57207//.9073./.3 503.9.7::3 0::3 . 57207907-039:-.8.54207.8.2-.25:20.//.2039075:9:8 5:9:8 .3/./.3/80-:9.9.9::39.8././.3.9:39/.-07.80/..3-.80   .3./805.-.9.7::3 0::3  ..380/./.3 17..08.7./5.80843:0..3.0/:.3..8. 0.8./.7032 54207./2085:38.3.3-...3/ $39088-.7:/.7:5.:..9.80:9..90780-:98073/3.80.3 /.80843:0.31:38503:393.503.7.80  /8.9:.8.3043.4393:803..3:39.3 -./..203 17.3 28.3-8.-07.3-07.7.::3 .3.7.. 08.2.33.2. /:.3839088. 5. !74808705. .32.34393:803.:39.83 2.5.8.5../.-  32. 8.9./.:39.9.3..80  #05..353.9.3503.98.3 5744170..:39.9.3/.3032.  %07.3:39.340032!4/.39075:9:8 5:9:8  &39:203.:.83:0.85.30327.31.7 .38.839088-.:39.3-08.9.0/:.2025:3.3.8.9.5.9.7:.9.8.9.907.3203.8839088:.9:502-:.  !.3:39.3907..203.5.0/:.3  03/43:0.39:2-: /542078...3.8.8020.2-..39.3240:3:049/.3907...:-0707.8.0323-07507.7:.3.3.8 80-.7.390780-:9/3..:39.9: :39.3 0/089.55.3/0.7..80 ..8..9.42025:3.7.3 203/089. 8. 9.2574808839088.9.:542078..2033/507:.9:7502-039:.  $0.3-07507./03.90780-:9/./3.3:39.538./  0843:0.32.-075.  32!4/.:-0707.9/-0/.38:39/.33:049/.543:049/.3.9::39.:.09.2:39./.-3574903 0/:.203.3.317.:39.543:049/.9.308.33.7::3 0.73../.8.3-.353.3574903..7.203.8 203.3.: 502-:...7:39.3.39.... -.9.880-03.38:380.3-07:93.538.-./.803..80.3 2028./5.3.7:9/..7.3.9./.3./839088-.3/.7.3 :38507-.   %.:5024943..3!4/.9./805.8.4393:/. 909.

.2-.33.503.09/.25:.2.8390889/.  $0507990.39:.7.5.7 839088./.7.7. 90793.90793.317.:39:20./80-.  .4393:/3.903254207.3 38..3203.73.9:.3 . .:.39/.3897.3-.3:9:/03.9..80      47:39.09..3.203 17. 0 8079.50302:3.203.8839088  &39.7.3/.:39..7.        17.2.203      .0/:.7:4393: :39.3/8./80-:.7  .4393:80-03.3203./.3032.3-.203 .203 .      :39...-.34081.33..920339088/. .-.85.. 808:./.39/.3/..2705./02:. :39.8.9: 17.203 17.8 17..3/.203 17.80./03.2.3/ $02039.4393:9:/80-:9:39.

.

/.39..9.742039.530/:.54/ $0..390788.8.80 0843:.7.3  80.32743:0.8.39::/.229488203.:3 3.31:80/:.39.9:2743:0:8.32743:0 .9:2743:0.//0.7 $9079.2.90/:.:.35.80./.5.9:2743:0:8/54/ .//:..9.3203.390788.3.9:2743:0:8/54/ :.39::/.3204882743:0203.203.2743:0.2743:03-07..2/:.8 $. 202-7.1-40309..907.-:3 202-039:8.2/00307.3.54/ ..380/9025.//:..5.80-070.780 .8 $.7.2743:0 .0309203.3.9:2743:0:8../ .8.3203.7./8.7./.  .3:93.54/ .302:/..38..37:8.39.2 /00307. 2743:0203.3/0../03.../5079:.54/ 0/:...203. 203.808:.29488203./8.229488203. 803.. !4890/-.3/:9/03.8.3:.39.

3/02.8.. 0/:.  5.92743:0/54/  $090.5.3897.920307:5.9./.3.790.8.9.3/.9.3/.897.9./ !079.5..380 502-:3:/.9.33.3.380-:./. $0-.3.55.9 203.229488203..3...:.909.3502-:3:./.. .3/: .33.39:305.9./.9/.35403..-07034950 .7.25:203.::203.2085:380.35.8.:94..35079.39079039:!.38945.82.9:2.-.:94..9078945.3 502-:3:  /03.3/5074080502-:3:  /.55.2./.8-093.380502-:3:.5033.-.5 ..38.950393  .2083 80/.890780-:99.2 2.50.209-093.80502-:3:  20.3 0-07.8.907/. 0-07.790...380 /50740/:.5.31034950-:.78..3.3:93.25:-079.3502-:3:/9039:.-07.302:/.3 /02.3...743:0:8.3203. 2.25.55.91/.9.2. 50.3802:.5..3897.:94./.3.2.3.:70..9/50.7. 803.82 9/.340...2/..82.3/03.3.9/./.3-:.3502-:3::39:-079.-07.55.3803.82.80 ./8943088 5028.78.2/.38:.3-:.:.20./50740/:.2.3/.82909.3-07.9: 43/8..9502-:3:. 090744990780-:99070-/.//.:8945.8945.9:89079./902:.2.7  . /:.310799.3203.2.38945.9:74003 037424842.55.8.3.: -:. 0907449 80 80.3 897./.3203.39.7..3 /..9:74003 037424842.3.3203././.2./5079:.3203.5.:.380:2.3/03.95.:3 %.:2.2743:0.3-07.3.38.3424489.43941034203.780-:.3.3 502-:3:  ..3574944.25.8..7.9.3-.7.3 502-:3:  .8:.83 2.83/03.//./.3/:3 5.:3 -/.82  !.-079:.3./ 034950/.8.703.90782-43 ..0425480 ..390788./03.3.:3/.3897.30-07.703.80-:.9-.8/03./80./.. 2743:0/.1.3.7.8.39.:.790.790../025.207:5. $03..3502-:3: 5.80.3.380-:. $9079.-079:.8.92743:0/54/ :.907../.380-:.907.30/:.3.8 .3.025.3.320.3502-:3:20.0/:.3 50789..73...-07.-.82.809/.: 5.790 5.8.7 .9078945..:5:3 5....3//./.9073.3-07././.3-07034950  .034857.3472.3502-:3:.8-..907 502-:3:-07-039:59.8.037424842.2.80.897..39.82.203./42449.9.03//..2743:03-0702-.81.2 8945.-07.9202.3..82.:94.:5:3 .32.:. 802039.:2.3502-:3:  .5.7./.2-.30/:../54/ .38907.1034203.802..5.3802:.80! .3.39./2./:.5./.7.55.57480870574/:8/.3472. 02:33../423..9203.7  .54/ 03....:70.7-..28945.7909:803/70-07.743:0  0/:.780502-:3:  8079.3803/7  :8:83.38945.790.9907.-.35.220488203.3.55.825..803.790 5.:94.//.5/./.80 80320./.3502-:3: -../80-:9 80-./.343:.808:...3.3507::39:/09.:3.-:./809.9079.2:2.28945.3.33.5.25.3/:5 2.78.83 2.72.9/..03 03.9/.5.3.3/5074080502-:3:  /.502-:.2 2..9:81.9/.380-:.0/4-.793.0..   $9079.:3380.3202:33.3.39.35.3/:..72743:0 ./.8 .83 80320.2-.8..39..32./.8..23:0:8  02:33.28945. 502-:3:  07  . 50309 805079%  $4330-473 203.9:0425480 .338-.82.9:.0.3.39:305.3/80-:980-...857.93.38945./../507408.790 .82/.:94.5./.5.

3/03.78.3/: .-093.7  3/./:3472.3..389079.3/..9/././:2.-.  !4./.35.5.740 #4.50.8./:3.80-.39..380.:507.. .8 03889079..:3 -7/./50.0307.2-.2./0820.7.39.35079./8..3 5078.802..33/.:3 ..2574/:8-..909:.8390.4-..380-.3./.3.95.800307.

.

7..354203.3..9070309//.35420307:5...-482048/.7/.070.3 09:7:3.3.354 542:9.0/.8.2-.2.25:.39 !078.90780-:9/3.3472.3.3 09:7:3./.3.8.3.3.950 .91 $05079 .3.3.7 .  :9.380-:.3802:. $0.2209.3.5079:2-:. .88902839088 57490329443/7...8.3.8  -093.3.3950.39.3 3-07:5.3 /.-093../.229443/7.3. 800. 5078.9:740 2.3:. $ ..9/.39.54  $0-.3/507:.9070309//.2:9.  -.32:9.-093.3..0.3.7.24745.8.7%3.3.42039.350995.93. 54/.3 :39:202-039:574903.31:38 29443/7.33.7.3/.39. .354:. 202507400307:39:5079:2-:..39. !4890/-.302.33.1-40309.-42.35.2.7203.2:9.3802:.307:8..3.35099 2:9.

9-.9.78.3.9/.50.5:99/.3.3...3 .3 8.90/ $0 805..3 -0. .74770385..9.3.3-07.5.3.3.3 -0.5.3.73. 203.9.:./.3-07.3./.99/.:3 5.5::025.89/.8 909./9039:.20.9 7.919.:3 20.  $02039.70. 5::025.39079039:805079-:3.-./..3. -0-07.3.-.2./.:71072039.507-0/.9 202-.73.3. 90780-:9802./.3.28945.3/03. 2.73.3 -0..9: -.3./.  $:.340909:.9 .3.: 5:9 /.: 5:9 .2.9:9. -0/.3 ./.3-:3.9070309//.2025:3.85078.3 -07.5.2..009../..73.9/.9...8  .380 805.50.8.3-0.4745. 4745.3/:3 4741 80/.3.73.3.9:..82.4745.3203.-8.009.5-0785.7.01803  .3.8./.8//.73.3-07-0/.2.: 2025:3. .-07.39/..78.3 7085745. -093.074-.-.3.9.91..3 :8:83.24745.

./.95.: .350. 034950.5403.-.3 -0./.78.2.380. 803.5.3 !:9 .3-:3.3/./.3 -0.35.: .9.85078.: . -:3.8.-093.2/4243.9.2-./. 909:.: ./.5.3 .32.39-49  $0.9 034950. .3.-:3202-039:49/54/ ..802-.4745.9/..3 .8290.3 5:9 5:9 5:9 . 80/980.:8.: -0..3 -0.: .2.280.:5:9 -0. .35:.9073.502-.2..: -0.342-3.3. -.:5:380-.4745./03./..9/..3 4397-:8 4745.5.5.-.-093.9/825:.9/5..5:9 909:..329 /.3 -:3...:5:9 . .3.3//.:5:3 9.3  .3.3 9.78.8-..-0   0..8 802039.2.8 09.3-08.380....9.80507990.3907.33.7   %.381.907/7..3 .9-07.3 2.3.5..: .39:305.: .3/.9/.89./50.9.3.2.95..9.5.3 1034950909:.3.9 80:2.: -0.3 !:9 .:-07.32.2805.2/4243.: -0.9070309  /.390780-:9/..880 80 -.9...2.8703.2..5.39..3 -0./.54/3/.3.-093.9.:5:9 -0./:.3 -0.7/ . 4/0.9.:907..3202-.3 -0. 909:.3 -0.2024745.3202-.5::025.805.2.3 -0.8-.320280-:.:-.:380:07 ..3 ../.7.909.350./.39.33.3/ .49/.8.3:93.907/.3 ./.3/02.3 .23-093.39039.8.-0 -.7::7.329 0/:.-07./.38945.320303..3 -0.80-.2-./.73.5.32.8:2-075403 909:.:./.9.103495009:7:3.3 2030.3  !0309.703..%..3 03495009:7:3.8 03.7800.3 -0./.3. 5:9 5:9 5:9 .50..3.3 !:9 .83.7%.8/./.4745.35.9/.3.5.78../.9/.-0 .3 -0./2:33.85078.80-.2.78.: -0.7950.80-.3. -:3./03.3..9203.9073.8.80..38.

/.7 2.0/:.5.2.9/.3.703.8.9-:.49.47414745.35.9..78.8025..39097.2..20/:2800915.. 05.32.54/  0.220488:39:203./.38..89/.-08.80950.3-:3.9.33.3.3202-039:443.3203:3:.    5:9.-.3    8090:7                                      5403                   49          ./.54///.//.5.2.:-0.3907-039:.35.9 5.8 .82.29097./. $0 80.9073./.390780-:9::7.7  4/050.5::025.3 -0.9.2-.9 /9:2-:.8.3907/7.3 0349503.3.80.4397-:88945.3203..

:2025:3./.3.39-495./.338-.5078.3907.78.2025:3.7.7039.3907.:/9039:.3.39-4980./.0.58970594283203.78.3-07..329 03.3802:.39:305.3.8.-:3..8203:954. 50.3.3./.3907.: .54/.3..9.29 .3 4745.39.3..3.8 2.78.3 -0:2/09..3708574.320303. 9..0/:.3-.9: 909:.03/0 .79 80.9 09.729 .34745..8 /.7 7039.3.50.350./03.3. /.7.34745. .909.2-.390.3.7039.9..9/.3. 8.09.38970594283 897 802039.78.3 09:7:3..7039....3.8/.9.85078..5.3203039:.909:.907..3.29 $0.3507.8 207:5..3.39-4980.50309.3/03.329 897 203.3.2/4243.7.3.3.381.3907./.7424842.3802:.0 29 9.7909:.38:3:35.0897203:954.3-. /.8/.090780-:990709.3802:..3.3-07.3897059428390.909.3 2:9.58970594283-07.82     29 897 49 29 897 29 897 4929 897      29  29 29 29  29  29 29 29        .3203:3:.4745.80-:.329 897 /03.3/:3..3 .35:.38.78./.203:3:.3203.202507.309:7:3.8.3.39-49 /.5.25.3 .8.58970594283-07.3.8/-. ./50. $0-. 2.3:35...3 38-. !078. 085:3/02...380.39:803/7 .8.381.4394 5078.39.8/.30897../503.950.78.89.78.-07.39:305.3-.3907.3408:. /.7 /..7.3.3.3 :35.202-:9..33..38050795.7039.3./.3:35.309:7:3.33.8.381.81.3.5.404745.329 897 /03...50.3907.930.78.7   09:7:3.8 $0507990.950.83-07.7503.0349508.5.9/5./.3. -0/. 907.909.274248423:0:8  07-.38945.3.//.38..8 .3/03.3 507.381./. 3..18 :39:202-0/./3.-:3.-078070.309:7:3..950.909:.80950.:-07. 2:33907.39-49 -07:-:3.7039././ 4745.5.. !078.3/03.3-07-0/./.3.34745.3.38970594283 897  .-.88-42./ 50.81..39./.3.329 897 203.7..9/.3503.3/02.29  0.3.8090..9.32:9.3.340909:.8..4745.78.78.3.3203:3.3.3 907.3 90780-:9/.78.8.34745..2-.:-.8 0/:.8 .09. 03.9.3 4745.80.2/4243.3 50.8 03.7.380-.3 50..8.8../.3950.70/:.703.3/.909.0349508050798.3/.8.2...950.3.5.2/4243. 50.9:909:.:..5..9.9:80-.2.8.:50.78.3//::34050309.802.354.39.5078.39.9:950.32:9.3./.39-49202-07.

 .3 8970594283    ...250./.78.3897 9.3907.897 802:.3.8 29950.897                                                               29 897 29 897 29 897 29 897   .7.3.38970594283897 7039.2-.7  ./.589705942835.2/4243.802:.3.381.909.

.

.2..!.42039./.350.30$945.74980. !4890/-.7.7 !#$$% !$ ' !#$$% !$ O O O O O 7907.1-40309.9.9 5.9070309 !03.8.381.:2 0.//.  ' !#$$% !$ $0-09:.7:0309$2-43$945.7%3.78.9073.0.3820$9079.303 03.27424842.9039.825...:502-.3!0.39.380-:./.:/.39.35.78.0:.9073..82 7.:3 !03.7.7:..78././..3.3/03..!0.82!02-.3$945.3 90709.8.

90309  085:3/02.3-08../.78./.. //.903095.3.33.80:2.3:0:8 03.03 037424842.5:.749.3202.3:9.3 8080.547.250.3 .3 -..3507.2.32020..0:.81..5073.9./.781.380-.

82 /03.78.32.30805079 29443/7.5:. 42543038945.3-.2:3 809/.8507./.: :3.350.2.3  ..3708574207:5.-'  /08.33.78. 50.754.8.7:8/. 81.-093.82 $0-03.38945.39072.8:/.5.39. 202-07./.-093.82 39/.3.8-07-.3.5.3.03/0 $0-.78.3..-'3.3.5.247..9//.3503.3 /-.9:1034203.78.250.4394 .4394.38945.7:0--08.3.. 4745. .7:909:./.35:..790275-..8507.9/:3.3 /.33.9-0793/./.78./.078..8.9:909:.3 50325.:93.3.3$945.9070/9078945. /03.. /03..39.78.9:7402.82 !.0.3:0:8 .78.23 .75.3-0-07./.78.390780-:9   !07-0/./-.98945.!0.9:740:38:7 :38:7/:.7 /.80-.3.7..9-07...3.85078..8.303 037424842.39/.7907.8 5078.82 -.3.9070309 .:/03. -.30 47.38945..7/-.99079039:  .8.3 70857490780-:9203:3:...9/.3:39: 0507:..80-.3 5.78.38945.8:8.73.3503.3..907/..3.3 2../. 8:.8.3907/..8 5.../. 09::.73:0:8  !0...2..381. 9/.3:95.3..8..2 50.5.39...39.3/.3.82  7907./.507-0/.50.7..82.33.30897.9: 81.350.78.502-.7:7.7.203:954.3.:39:202-0/.82/.253.9:2-:.503.03/0  !0..5.3.3/./.-093.3.2.3/.9.38:.350.

 503...82.800..9 -07.28945.9070309 /.3.39.803/0 203:3:.9078945.204254 04254-07.30$945.78.947.9.350..5.3-.9:740 03 037424842.38-..2.9 ..803..3/. .3.82   03 037424842.5.34745.78..78.8 8:-80:07803/7  0. /./.99/.:.82.7.30/.39079039:5:.99/../.78.382-43/ /.82  7.3.-'  0 .-.3907/.82.23-093.82   $:-899:83:0:8/.38:./.5.50./.38945.30 80507929443/7.9/2:33.  %/.8945.75.50.23.303 03 7424842.35..5./2:33.82./.9:2.920.9: .7: 70.9//.3.38945..2:2.381.28945. /.381.50.88:39:203/::3502-:9.28945.3/03.39039.703.3 .8:.5.30 47.78.203025.3.9 /509.303 8073.- /.3-.3.3.2././..39.913:0:8/./80-:980-.3705.3-.308945. .8070.9078945.202-.9/5.703.909.5..92025070.3.347.5402.9.78.8.9:81.907030990780-:9 907/.. $00.82/./.3:39:/84.3  7.82907-:9-07.703.47..3.47.3.50.907503039:81.250..8/..9202-039:04254-07.9 9079039: 2...3202240:  .9 90780-:9207:5..9: 0/:.8503.3. 97.390780-:9907.82.949079039: /03.7:2../.2.9073.9:8.50.38282.30494342 0-07. 2.0--08.8..907 8945.5././.7.350.89.381.78.7 /.5. 8.78.8 .30/..3 /.381.38:39.8 ../..82!02-.

3:3..2. 9:2-:..8//.3803.82.9070309.-..3 /:5-0-.070.9:50309.-48200307  32 032:39:0507:..8 .3...3/48/.3.3820 09.3/507:.3. /7.897:9:7 /.  $02039..9: .9 %! .2240:3.3 2..47.3 03/ /..3:./...8 .003.3.73.880/.5.39-4989705942835.3..220.30:..50309./.9:7.-.03847.39./....83207:5..33.85.8 !.38.0 57:820302:..3.5.3-.8.3202-07...909./.-3  :9.3 207:5.7.-039:209.802:.08.3-.3203.742.3-07-.39.301494839095..8./.2:7:3.-0702-.303:39: 203./47.35748081494839088  4741-08079.3/:5-0-./..2.. -./03483971481.3/..229443/7.7.3.:5.3.7. .-07-.0-:7.30..3820202-.8897:9:729443/7.02:/. 03 033/.. 20.3:39:8390883..3:3 82-4889:7:3 902:7:3/03.8-442..5.90.5...3.5. 09::.3 4745.3907.247.//:. 80:2. !.3 -.3-.3.3.8/.29443/7.320309././...3/-..370857.380:2.. 28. /.907/..95.32070./.33.9:803/7 /.3820 0:.39443/7.9.35.3.5 //.8:.3.3.9//.. .89/.3509:3:-..749 //:./.3202-.20.4745. -079.202-.7-.2/4243.3574/:8 0307907/...880-.3/:25..38200309.70.202-...27 $.27447.3-.3803.280  9443/7..7493. .83 2.9: 4745.8.3203:3.2-039:.3-0-07.503.31:383.

3.3/03.9. .5099 ..35099 509902:9./.8//.35./.8 03/0805079-.33472. ...320488 .3.2509:2-:../-.2.3950.8:48.7.2:9.7-43  :9.3 .3.33472./.7   %505079.2.703.5.80 805.10349503472.90.3/.950 2:9..:.3.202507..3209.3-..9.32748458203:3:./..9.3-.370857.20/:25.38070.38.074-.3.3 203:3:.: :7.074-  3.3 /50740025.3.8.8 89:/1844203:3:.80/9:2-:.8203:3.23:0:8  $0. 2.443-07::7. .2209./.301803-.73.202507.3.:1072039.3./.3509920.7.3 /03.2.3/3..3 20.909.880309907.0..203. /3.84547.44390780-:9-07::7.3.50998070.9/.9.2502-0.843.8..3.9.349 /54/.703.-4820.35099805079/.9 .2.8.3 907.8. /92-:.5.80 8090780-:9 203.3..370857.9  443 4433/3.3 5099/.39: 40.73.2-.843.8503.49/54/ 2025:3.85078.803.3402:9..5.2-.34803 20.32:9.3.-4820803.9./.39  .493 203.9..38.../.30.350998070..3950..95.3 38-..3. !078.3 /03.54//03.80./.39.3.2:3 .3-..7-43-:./.10349503472.

  . 07.  -07-0/.9 /.229443/7.78.802:.80-.3-08. 8547.3.80950... .3..82...70025.8502-0. . 09.3.85078.38.350993097.49/54/ /8.7  8945.3 2048849/54/ 0025. 03.33.3 2025:3./5.3.3....381.3909:.80 50993097.7. 3802:. .9:7 2:9.9.3.78..91 5.35099207:5.-.0708081  %500/:.0-.3 950.7803.9.3507..3.-07902:/03./03..7.7039.90780-:9/80-.3/83908803270857..3  50.3203.35099/03.3-..-.50./ 8:2-072.8.350./..50993.3 :35..78.84547.3.. .3/50740.90703092944/7.5.2.:80:7: 2.10349503472.3472./  103495009:7:3.380950.207:5..3 :35./9039:.9.3472.2.9070309//.848/.0.3/80-:950993097.848547.3.7039.9./03.3203.340 .38:33./.340 909:. 8547.-.39505079.89.93.3 203.3-.

5099 .                                                                       3472.5099                                                           .5099 3472.$070.097. 3472. $:57081                                 . 54/                                                            49 /54/ 3472.848547 .843.

23..-5099-0793/..7 /.2.848547.9505099 3097.3 805079.7./.507-0/./.5078.9.829443/7.33.850995.3./..78.8:82:9.3 907.5../ 5.  $0././.30.-07./03.349/54//03.2:7 0:748547.33.0:748547.78.0 :39:502-039:.320..78.909./.:909:.203..0 .73.3 3. 2085:380-03.329443/7. 3.33.3/03.3-0:2/.27$ .35.2:73-0:2./. 50.-093.9/.907030929443/7. 50998:57081.3:35.9.95050998:57081 0/.20.7. 50.350.503.30380.5.3950./.3802:./.38050993:0:8-07.3/.207:8.9/0.10349505099 03./.3.907.3 /02.3 -.9073...3./80-:950998:57081 .5. . 80-.7  !0.:. :9. !./.32:9.5.3 5./:25.9.3/03.3..7039.3 3.950.025.5.8.2-.3950.3. 5.78.38:3:35.829443/7./.9..3.2-.31034950 5099 $0.5.3 2.:909:.9 8:570847 /423..73.7  !0998:57081:.8../.5.05030-.805.2-.9.78203/...820488495099 3. 5078.78.7202-.203.070.3:93.  . 2025:3.7039.35099  %5009.5 07:8. .7./.:.8.5099 3097.

.

.8.7%3.380-:.42039.. !4890/-.7 .1-40309.

/.320.381.509.9.3907-039: -..3803.3/.03-07.3.74248420./.33/.23 7.8.9/:3.2./.23 3/. 7./...23 7424842802.9:7424842 0-07.974845.35.390709. 2025:3.78.320-.5.3..0. .754.23 %50!03039:..3. .23/.9.2 8070./:.3/..74248425.890790780-:9 /./.3/.3820 742.203.2.3509.23 .3820.33.3507-0/./.50.-'.3.3.8.7.3:94842 O O O O 03#.2./. 3/.0..30380.90425403-07.23/3.3..23/.85080847.2.703.380.20990780-:9202507..5...23 80 30/ 0308 802039.5.23/.239/.5.3 203.5.93.95./.3205:9:7:9.:94842.338-.390709.7.9:7424842.3.7.390709.74248420.3/.20.23 !02-07.9.  20.3 907/7.33.3/.7424842 :39:85080890780-:9 28.3:39: 202-0/.350.209..3.3./.9/:3./.3..3. . 907:9.3820 . 202507.3/./:.8.3/-.354908843 !03.9:850808 47.1034203.3.2..23  03 03.-:3./: 3/.9/.  3/.90425403-07..8..9:/.34.8:..-.374248425.5.8.3.303 033/80-:950789./.30380.0 /.3.303-07.7./:./.9:8.23 3.803. 2.9.39.#!%& $ ' #  !%&$ 74248420.9.2!03039:..3742484234247 /80-:980-.70025.:0025.: 03 03.742484280..7   $.39..80./.3/.897:9:73./: %073.3037..9.2..30380.:94842  $05079./.3.9...78.5:303-07.23/3.//.8..0.:42-3.34..9..897:9:73.-'90.374248420.8025.3-093..209 .2.3503./:-093.50..03 03.30380.930.5.8907.7424842 0.3:.2.0..8.3:39:202-0/.. 03 037.8/.9:74003 03-07.35..3:8.9.7:472430.23  ' # !%&$ !.3.8.0.3.2-..

3/03.2-.2..3 2.35.3.37424842  0.7424842909.-07-0/.3034950.9.39.8.2-.-3.9. ./.3.4-.39: .5:.8.:-./7424842/. 5:9/03.. !07./.:3 ./.23  037.7..9:7.3907./.235.5.9-072.78.78..3.3-07/.7.:950.30380.2 2.703.3.32.2 -072.5./.82 2..3.3 03/0507.2-.9.5.3.9.:-:3.3/09.5.9./.207..2 28..3 507.3 .3 09:7:3.  .9/. -.8.9/-0/.3.5.3-093.7::203/0 $0.3.7   7424842/./.82.5.5:9-093..3 202.39..3509:3:-.2.8 9073.38.303503.5.2.3. .3.7424842 03802.5.239025.3.3#..3/.23/.5.52025..9203.3909:.32././.347./.3 /.74845.309:7:3..:2:23.9/04254 04254. -0-07.5.3037.85080847..7.33472.3.9: 03503.9.39.3.23 /.3/0.3.9.3820  !0...9:7.9:740037.3 /.390709.73..5.8. 3.3.4-.9 81.9.  $0.2.3.3./037./.39.9/423..8.9.93472.50789.2.3/.73..9:7.2 /950 80/.73.                     -093.42509080 30/0308 !. .35079.8025:73.-0-07.5../.9/.9.7.0.78.27424842 0.3.3.35. 2085:39/.-07.207./02.39.3.33472. /.3/03.23/./5079:. 207.32.74845.23/.2..5..: 03950 .33.80././.2539: .3 203./.3472.203:3.../.7.  30/0308 8./03.34.3472..2.88902503039:.3708574 034950909:.32.9.703.3 203.3-07-0/.9.390780-:9 :8:83.93.3037.2.037.0.39.507.3.2/.50.203.3.0.3/.2390780-:98079.380-.3202-07./.33.5.3.9.3  !  !   -093..  30/0308 /.3.50.950.3472.73.3.03.8.02:9.0307./.90709.  !078.1034950/.3..0.5.2/...3.3.207.503.23 /.74845..9.3 40% 47.3507.9.83.39073..-07-.73.39.320325.3.3...0.39./.3-093.:.3-072.5.9.85078.02:/...9:7950.95.2037.3/.3.909:.3/.2.. .  0.9 20.239.74248420.235.03 .9..5:9 ./....78.802.3708574/03.3.2-0781.3-07-0/. 0./.3.2./.30380.-093.3.9.3708574203..580-.39.5:9..037.8.-093.9.:39:81..50.3/:3.9.2 3/3. 74248420.8907..-072.3203.3.3.3.9. 9/.-072.5:9  03.

9-093..25078.9. .37..2.2-.3. ./.33.2025:3..507.9. .9:3472. ..39.7..3..7  ..25.3.9.74845.33.2-. 805079909:.7  .-..5.

3.3.:/:.3378203.30:.3.0249/:3.23-093.73..5.788.9.-0-07.3..23.0241.. .4394037.-./:-093.-. ./:/03.33788.5:97.5./30.39.7.3./.8.8./.78.98090.3/./90703..5.5.0241.805079 909:. :.20.9:5:9 !0. 503..7.3907/.73.3025.9./:-093. $0-..32023.5.:.:0907449 . .3207:5.3.9802.:.2574808502-0:.5:97.:.907/.3.9507/.9:037.7.7.39./7802.39.203/079.39. /:.7:203.07.7.7. 30.73../..:.3 /..381.30349503/.:.3:39:2030-:9.30-..73.07.389.3#:8.3203.947.3 .33.30907449 0. .309074493.3 -093.:.39..3.30907449 0332030-. ./.3202-. 0:./:.3.9.#.7/..3 202-..-0-07.2.5.3-0781./.3/..-::.3..754.80-:.9:.39..0  !.-:.32030-.90241.07.7488 3079. $0-03.9: 3/.9.4244 803./. /.3.209.9:  .3.3 503.8..9:.03708081..:./.3:8.0390780-:9708081 3/.303/423..202-.2:3 .93. 2033.:.5.-0-07.3$5.9 507/..3../:25. .309:7:3. /.3..95.80..90241.2../..-09.303./9./80-:9 0249708081  #.3-07-0/.73.3:8. .3803/73..209.74845.33.85080847.2.7.8:8 0241..3.7.9:.0:.50. .33 /. 3/.3/9039:.7424842/.3 /.309074493./.35:97./:.3.39..3:./:.9.3/.. $02039.703. .209 .  0.802039.2./././:/03..9:9:02..7 0/:.78.3.3.380-:./03.70025.95..2.3 .9./.3.349.5:973.23/80-:980-.3408:.3 -07-:::33  89.7424842/.9.209..30249708081 .209.9:3..79.9.....3 .7.38.3/50..207./.3 0249/423.90780-.209 $0-.3.7.3 2025:3.3/03.3./:-093./:42449708081 -093.209  #.2 3/./..947948080  0..3203/079.202-.7424842  3/...3 ..39.3. 8.3.703.-.7424842 3/.3:. 0349500907449:39:037.-093.2.9424.34 $02039. 7424842.7424842 .9 . /..3-0781..-::5.3/03./:.3/:./..9/:25.5.8:8:3.3.  0241.7.9: 8. $.33.7.8.32025:3.909074./.8090.3-07-::947948080.9:  3/.33.-:: -07.349.5.8047.3820.9..3..90. 2.2.3/.0380.707.580-. ... 3/.3 $0-.7.5./:42449/423.9.7..-.9: './.-.9.30249/423.3.

5:973472.5.8/.-0-./.90241.  #..2 .9:'.7503.947. #.3..

!.54. .97. .3.8.97.3.8.2.7.3/.3.381.2357..350.209-070380./.73./.3./03.50.78.:5./..78. 8.381./:424.

/:09074.209-070380..39.23.39. 3/.7.3802039.

/:424.91 :2.3.3. 3/.7. !.3 50207.3.2.980/932:33/80-.3-::.8.0/423./.9203.3.8..203.3.3/:303./.209  .-3472.3. . /.2-.3.3408:93.3.3.3/.9:03.8:83.3/03.-.33/.02:9..-093./.950.3./ 80-.5...3#.78..2/02:.  4394037./.9./-:7 ..-093.7..02:9..33.3 80/.3-... ./ 5.3.037.3..3.-./.3./.8-::80.0708081:897:/.7424842. 7 2030-.5.207:5.209   ../:09074.31034950..3 80/.3.20302:.3  !0.3.:3472.32030-.9.39./.3 8..03708081-7.80/980.:2:23.:897:907. 5..2 203.8:.-.2 03.3472.352039..580-.

2:33/085708.33.703.3.1034950 ....3.5..980/9 2./.3/.33.-3472..8./.3.  0.-.989./:-093.-3472.3.3.38.-  037..:2. //:.-.1034950.207:5.3.8.0..303.037.340037../.9//0908 0-07.0/.89/.5.3/.35..3/80-.

0.342443/80-:9:.-3472.78. 20.9/.5.03 3/80-:9:.8025:73.5.239.187.802037424842 /.9:740 03802.3.32030-.303.$025:73.3472.3.3 03./.880..5.342448./.0.03..303.7:7.3.9./..03.39.9..3-::5..3-::503/0-093.97080813/.7    !!  ----   -093.8025:73.:94842.3-0781.9/.7424842 !0.3/809.78.3. /.                ./503.7424842.3-07.3/7 4394034.2-.8. 742484290780-:9.803.3/.9.9/9.-0-07.39.037.34..-.7/.0.3-::503/0 !0.9.  !.35079:2-:.78./.239.7.3...2.03.3/..2././.3.7  !0.3507.9/.3.9.37424842 9073..  0.0/:.3...3..03 5.9037.3 ..5.8:95./.32030-..8907907/.39/.23%.3 9/03.-.9.9:8.9.381.39.7:400380.3.-::503/0./03.74248429/.3.-. 085:3/.33472.95./.35.23 /.38:3 805079./.9.-.3 .05.703...39/03.78./.3 5079:2-:.9./. 4244/03..3 2030-.-.034.7903.3-.32025:3.3/75.9: 03 035.3#.:802039079039:5.3 2030-.3.3:8.50.90787.5..3-::.23/.

 .9/.250.8-..7  ./.239. 8025:73..78. 8025:73.0.239..  $8902!03039:.:94842.-093.3:8. .3/50740/.3.:94842.38. .23 %0.239.2025:3.3 3/./80-:9. /.30380.7.7 -.3708574:39:03 03.5./: 57.80507950.8025:73.2-.3.33472.3037.2.3.39.3037.5.3472./.33472.507....2. - - - - -093.3/.8.. .0.3708574:39:037.78.2-.9..3.0.8.3.54./.7 507.303.2.95.39.3.3:. .3472./ 50.78..3.3202-07.805079..32.2.

..3.209  802039.7.39./..09074.39.

209  802039.3/.../.09074.3:8.3.30380./.3:897:424.-093. 5.235.39.3.7.424.209   $0-.././: -093./:..2.23/.209  !03039:.

983./:../.5.4394   84320302:.3275/03./.5.2 /././ .3.3-.33.35..88902503039:.39.80-:../:.3..39.39/./.98807...9.3.3..5.3/0..75./. 2025:3.280 842.3.3 :2./:.7424842 . 07:9 3.3.-0.39079039: 203:9 88902  $0.8-..35.388902 0/.8.3/02../.3 203:988902 80/.3.202/:.23./.80842.3:3..39.8079.3 /.  $8902  $8902 /:25.33.:2.983/.7.7424842  $890238-./:.39.3  $0-.30380.7424842 80/../:-093.-:.3/.33. 88902 3/.7424842 03.-0-07.038807.2025:3. 28.7.3.0--.2..3.39./.3-0-07.8890290780-:9 2.3. 2025:3. 742484280842./.5.3/.. 3/.8.7424842802039.30/:.3/.2. 5./.!7490347-093./:-093.

8503039:. .7.338-.23/03.7424842907.5-.3. ..820325:.3 $0./.3.37424842.8.:.388902 .2.3203.:-:3./.3.235.88902503039:.3..3/03.30380.235.3-..3..3./03./. 47.3807.9 74845.320303.350309.9.-07.39/.39.9:710799.:94842 /.30380.33.37424842 .382090780-:9-07.73. -07507..-..   7/020../.0380.

974845./.:94842  3-.9/.-0   %..5.974845.30380.95././.-0  !03039:.%.5. Ð7424842  Ð..235./....

39.3 .  0380.23 .

93/.5.9 81.2-.2-./80-:9 /03.:-.7424842 3.3 -093.-.7  .3.3 //.-./.74248425./.3:2./. 0/:.                             -093.....3907808 /.202507.9.3/.907. 80-.-093.3.3./.39.950789..3 209.32948849 ./../: ...33/.23.74845./:./.9.-0-07.3./:3472. -093. /54/ 3/80-.5:.33./: ../.5.3/.54/ 8079.389./. -093.-3472.3 80-.39097.381. 209.3203.3203072..9:7424842  !..34425079.3.3 .92030-.980-.3..5./.3 3907808 3907808 .8:507-093.-0 .3.5.-0-07.3.3.58.. 7424842909.9.39..3.2.209     -093.-:....9754//.8050793.30380. 2.%./.9:./3. .2.25..3890709.7.-093.5.3907.390780-:95073.23 209.8.3 0..5.9:502-0.-.39.9.-0758..8./:.. .502-0.-093.547.58.7.5. ..9:7./.224.74248425.9-.80./:/03..203072.58.39:-:3..58.22:3.9.907. 8.3.-3472.5..-093.3802039.3/897-:87424842 5./.7424842.0380..974845. 343/8:3.3200-:2.7903403088 .8..2..943 .3. 74845./3./..8.808:..0-/..5..507.3/3.5:.2.. 209.3/.-0-07.09/.7   !  .7/:.3/742471 !030-.340 907.3/.-3..:3./..50789.  .320488  !.2530.39.9.3907-039:3.

3/03.3 .88902503039:.370.97424842  $890203$ %8 .3.850.974248423.9: 2025:3.:507.-093.8./-:.8/.3.5.8.   ...90780-:9:39:02:/.5.98.23.0309.3  0./.7.98.83 2.:320302:.8.3. 28.9./.5./..8.03$ .30380.742.-093./.3 -:3./. /..5..0342 909.3203.7424842/:7.3/.3/.:324348:83 2025:3.7.3.3.328.3.380842.23802039.9 /.30380.3.23 085:3/02.9: ./:.9202507.35:.2025:3.80842..7.5:903/72::9  /.3/48:8 .3.32038907.3  ./.23.3-:3. /. 8.703..:/03.239073.8503.77  !.3202. 74248420../.9..:-.0-.39./.3. -093. $0-.3.0342.7903403088 .:3/03.8.9.7.3-..5. 90:7.:9430.23:0:8808.5.:7.:388%8*.39..39/.547./:-093. :2.. ../.5.3-:3.9/.3-0702-.3 -093.05.83203../.7:3:3.5907-039:80.-07:-:3.507..3-.23 $047.3-07.3.30380.9473:3.3/-:. -093.54/  $02039.5:.. /03./.3203.3-0781.8.39.:3/03.39:305.7903403088207:5.20280-:.39/./:25./..1034950$*%8*  $02039.80-:./.3 02:/.3472.374248420.9/-0/../:../0...374248420. -0702-.8..9./:...5.8/80-:9.-0-07...8.88902503039:./03.39/.0 .8.-07.3..  0.89  742.39.85080820345907./.9: 3/./9039:.33.3 /./. .31034950$*9898.39.9: ..7:8 .3:95../.9..3 :2.:3889898 -070380.24348:8 -07:2.35007.3. /:25.-./03./ .7 90:7.3-093. 80/.3. $97:9:7802./54/ 03.340 1. 2023.3982..3430./09...80842.9: ..:33472.80.9. .35.5.3-:3./03.703.9/./.5.39./3/.780-:.3 .930....3..7.930....9.07080818/.3.3:8.3.9:20.8.3.930.3 8890290780-:92.3203.805079802:9 0-.-07.897:9:7 9079039:..80059080.235.232.3443.9.909.3039079039:  .0-.980-:.388902503039:.9/.3-.43 3/..3.3/84.23-.7.39.802.-./.233.742.9/.39/.3-0702-.98/. $0.9857.3.39.:90:7.8:8.507.33.33...!.9.3.3203/0.2. 2.:-.3/02.974248423.0342 507.9.7.3-093.803.9.3 !./.5//.80-07.3 $8902503039:. 2./.9./.3/03.38.5./48:8 -07:2.3-.1:.9.39.303%8 .742.897:9:79079039:.5.3//./.3.3502-039:.3:93.9:7502-039:./.3./.907/.9. 9: 3/.7.80 80842.3..39:3 -. /0.3 /03.23909.703.08  !03.3507.77 5.97424842  !.:93././:.30380./3/.9./.93430309 ./:-093.7.80 80:.90720302:...23-093.3/03.2.3.239073.9857.3203.9/.30380.370574/:8.9203.9:7502-039:.3.930.39.:5:3:2.73./.39./..3/:5 /3:3.3. :8:83.9.3 -0702-.23.3  -:3.3.2.

2357207  $0.3.703../.23.23 $02039.2.7./. ./:0249  47243/.9:743/81844/.2348039088 !7.91 5490883/...243/038.3203. 2025:3..2380:3/07  !.32025:3.5.37424842 0.3/.7.75030.7.39.9/423.80. 5.9 /423.8.2025:3.503.8..30./.8/488/:8:..3203..90. 8890247243.9 3/.37424842.8.9:  003./.3037./.3 ..38.7:83.7:82025:3..8.3/../:803.3.29:-:3/.742./:-093.3.3  ./:.2.930.3:9.. 57./.3/.3.93 0..57080815. .23 28.38..374248420.7.832025:3.39. $0-.3472.503/079..947030982020.9/.0907449 202507.3203./:.393.742.3 003.33./:.88902503039:./:-093.3/08508.83/742%:7307  9/.9/03./.503.9.23 03907503.472430.30-07..83 2.307.343.-::5.3742.0309203.9:03 0907449  %.30380.:.23 $0-..9:037./../3./:42449.7:0.91/.: -.9...3-0781./03.235./.3-.7:83.3203./.73.930.3038 0..-07:-:3.3202507.8.9/03.3:93.0.:09074742..39.7424842 3. $0-.8/4885.3802039..39.3.3.2.203/./  03907503.  0.90.8.208570881.2.7:0..83/7423010907  2025:3..7378203.3/.3.-093.57080815.3203:3:.8./42-.39.9: 802:33202-.35:..209 /.80.3.703.3.8800.39089082.-093.3488-07-.23 .915.3/:5..742.0/:.23 .938.0309.380.8:.3107038./:3.32..234302-74 . 7424842.38.9/.3/..2030.930.742..9503.357.: 503.5.3.1034203.703.3 .9.381.9.0.20.3/./2408047.9:7424842../.703./48801091.308570803802/423.380-./:-093.39.3:39:203039:..32:33:897:202-.380.4394  03./.8503./.03.23.3320./.3.2 ..2.3103495024.3/:/42-.3549088-.3.39.7.:94842.9:  0.0/0308 .0/:.3/.-07-.03 42449 802039.3-093.9: 80-.9.23/839088404.3820425038.3203..39..3 085708.7.9:7.2.39.93 0.7:2/.03/423.3909./.39.3507.9: :39:/.30.8472430.:./03.8 803.3/.320303.3472.3  0.35. 02..238079./703.8 085708037.23 8031:03.5.7.7:50702-.3 .1.3.3820/09.5.7.7.3.7:2 908908 /.3  037.73.3..0380.930.9.. 202503.909..1:38.2.23 03.23../42-.3. ././.  ././.8:. 03708081  54908843:.3.-.7:0./././703.3.-0  8570803907503..2-..2347.7424842 3..238073.3:8. .7 43 8047.74248425.3472.. .7:472430.235.3.80-:.993/.. 503/079.742.-.9:7502-039:./:.3. 5.8-07-0/.23..3 5.389074/.8./. -0781.3807./.80../.3..::5/03.3/.3507..7./.7.380.9 -079.203.03..3.3820425038./42-./42-.3../42-.23207:5..3507-0/.

3 /.303907-..3 -079.3.9.393803.9:0380.7:0./. &39:/..39.0907449.  . 2.3/03..8. -..7:82025:3..909.8.3/..39.-079..23 472430.9.80.034950    42-.303907503.3203..2025:3.:94842. -079.80./.5.23/3..03. 03/423.35.03/./.30349509079039:80-03.8../.549038:39:203.:. 57.5.3/: 4394.57080815.90780-:9   .-093..342449  03907-.39...33.23.39.3.3.3/: 42-..23:.39.33472.8.3. .9/085708.23 03.3/: 9/.3/: 9/./. /.35.35.3203.9:7574/:88:8:5.9 /085708.23.57080815...35..73.3202503././.3/03.2:5.3.3  80/./.03.0-07.0907449.93.9..8.23 $0. $0-..38047..8085708035...3:8./.9203.-079.3 5.39.3.9:0380.5..20.5507.20-49./.7:507-0/.3 09:7:3.502:.2:3 3/.3. ./: .3574/:88:8:.9202-./.20-49.7.8.0380.3/: -079.57. 03-/423.39073.57./.2..3/: 9/.9:70-49.39./.23 80290/ 0308 439403802./.-079.5.909.3/03./.308570803/.3203..9/507:.3803/73..8./:-093.

.

3/-7/203.209.203.. 2434-7/2..3/..303708081:39:-039:- .-/.$.7 # ' # O O O O :.35078.307.42-3.703.9.742039.-  /03.203.3907.$..50:. !0209./.3.4-..3::2800.3 :39:-039:-  909.34003/0 -.8.3 %. !4890/-.37424842 !0209.1-40309.890780-:98.3:9 50.03 /03.42-3.-   /03./.803708081:39:.3-039:- 2.3.9. ' # !07.-08.3:./.78.3907.3.3!3/.7  .3:8.42-3.3907-039: 9/.4-.35078.:5:3/-7/ 90..3.35:.73..3.507.3/:.3.73.0307.73./.3/:342-3..9-.8 .3.3::2502.8 /.303  0.8./.803/423.02-.209 .::203/0 .803/03..3-0-.3:39:.37424842 5.8...8 42-3.35..3!3/..3/.2.0307./3.5202:33.8079..303/423.3 507.:.303..

:2.2./.0:39:3.2.74248423. /. -07...9/.3203.-./.5.3/.5././3./.  03 03.350209.3-.75.3 907/.3...340 0.303 /423.974845.3:93./.3/:25.2.3203./.0-/..3 1034203.3.33.5.5 2070. 2.3.2./.3..3-0-.30--..209/03.7424842.7.-/.-90709. /./.03/07:3.9:7.8.2. 03-07.303 03-07.303.3 .83.8.:2./.35.39. :.0  034203.354891/03.209.5.3 708081 02.3.9.7:809..:2.. 2.0307.8.7.  /. .07  /.8/.92.9:7424842802039.303503.803/423../.3/50740 ..303 03-07.52.35.3 9/...3.507-0/.. 38-./.7424842 3.83 2.5.35:.3:./.3-07.0 ./03. 2.342-3..380-.8.3/:342-3.5:3203.8 803. .3.  ./.339075709.:09.5.5.3./.8 907.209.3.3..2..3.03.88..33...3-07.-/./.37424842 .92070.8 ..20309..209/03.74248429079039:/..2.209.-:.28070./.780-:./.3-07.3.03 03 03.3203.72.3/:3 03 03/423.34.25380..3203.-07./.8:...3::2502.5.209.303 2..85078.74248429025.3/-7/40 ./.3 # !:33095.3.3/:303 03708081.3..3.9:  .7.320./.5.720-.9 %  47.9:7 .8..3.20.2.708081  $0-. 793.209 -.5.303 03-07. 3.:-.8.78.38. /.2./03./.3..3..203:9::203/0 793..209 .47.90./33 .:03 03 .3.03503.9.3.8  $.2.3/:3.5. 0-/.3./.4394 .20.3820 50..507.3820.3/:3.03/.37042-3./.803/7/3..9...:.3808.8..302-744/.3...380.3.:-07.2.3-039:-/0. 03 03-07./544-.:302:/.3./423.3808.9:7./03.280-:.8/03./.808.3..75.805079  7/08   :07 /.3-08.8.2.3/./..3.73.-07.9:7 -039:-90709. 30/0308 80/.-078..3./09..939.7.-0-.7.3-07.3 . 54.350309.307.209.3907/7..5 85080847.3203..5.2.39 $0: -0:20303.9:7-039:-90709...9202-07.35. -./.53/.33207:5.-07./.3.9: .95.3.78.0025...320303. / /.3.3/.303808.303-07.3907-039:90780-:9/80-.303..33 $0-.7424842.3/.3 708081. ..742484242443.3.3.:39:80.38-.2./423. 0309.3.303503.-203.3.209./ ./.3:2.3..3.3.748834.3/5074003/0/ 8..8070.7424842 80/...83 03503.38.9/.3  $9:790./.:.3909. /.8/.0-09:.8207:2:8./902:.:0--. 03/09/..3. 8.3-07.3.. .3.92030..:3  .38047.-'3  :.2.8 /./9/.39../54/ $0.-/03.8907 .9/:25..-.3/.32025:3.7.708081 2.3.3.338-.303708081 .3/.2.3 /.3.. 9072.354.209.3 /.3 /.7.2.8:.809.74380520303.9.5.803/423.0 7080813.73.20209.4-.33.0--.$07.035.9.5079.7207.2.-0702-.33.73.90843/.2.-07..3..75.37042-3.3.3203.390.

.80  $0-.5. .5.907.3:.0723.3-07../:/-7/.35.0307. /9:880-./. .3.3.3... 02:33.507.3:9.&39:0-0.2-.- - .3.- 3 3   .30/:/:. ./..  -  -      .28.802.-07..8070.8070.3907..3907-039:/.209. 2./..3/.03-07.397./80.2.3..7  .0/:.39.209 .9.03.3-07.83.-./:/-7/ .2-.7:8907..7  .-07.83/.2-.7   .7.80  0/:/:..  ./03.-078070./03...:431:7.5.8/./..7  .3.:-078. ..7.30/:/:.9-07..-0-.37042-3..2./.2-.303/423. 0/:/:.3./. .23/3.349.-:.03/07:3:39:80.9.8 :. 8.9. !. 202507./.303 708081- 0/:/:.2.73/.37042-3.4:535.38070.8//.3.:705:8435./:.37042-3./. -.:9.209   .:9/. $02039.7  ..354.7 /-.9.:.3/3.3-07..9./.2-.7.. 3 3   - .3 -07.8.039/.2.8/.2-.38 0/:/:..7  .3. /.803 035..0/:.9/.388.38.7.3.- .303-07..9: 5.80/:. 0/:. 0/:. 03/423.3.20/:/:.3.803 03.-.03/423.5.2..3.25.3/./:.3.2-.-./:/-7/.703.209.-0-.2.9/507-.039/.380.388 .3  .3907-039:  - .3-078.3./.03-07./03../03.39.  .03.3.9..3037080818050795./3.8/.303708081../80.8 .. 9.3.25.33.802.3-07-0/./03.397.3  3/. ./:.303-07.-07.

3/9:880-.0/:.-.0390780-:9-07.30/:/:.3.-..388 /.. /03.

2099507042-3.0/:/:.. 2025:3.3.2099505.3.2099505..2./  3/.3.7039.207:5.9/:.3203..8:8:3.3.83 2..3.3-07./..8 .:5:397..7039.3..3033.8..3035./.2.88:8:3./: .30/:/:.38  .-07.3035.3./:3./..-.38907/.3/.5.209950 7042-3.3/.8-/.3.83 /80-:980-.0/:./03./: 80/./.0/:..0390780-:99/.38:8:3../:/-7/.-8079./03.0390780-:9-07.97.3.209 .-.5.303.209950 7042-3.3.5.3882.-.3.  .38..37042-3.388  .2099505.32./ 503:8.0/:/:./.88:8:3.3.7039..2./.

 80..3 %0.8.8.38 2..5-078.-:.9.53/.3./.07 .. $0. .8070.3.90780-:9 /..9.3203/./03.3:2.3907/.9....3.209/03.3.  .3203.209950 5./.3.9.  80/.38.3./:.$./.880-.3  !0789.3.8 .3.3..3.7.3./:80-0:23.7 3.30/:/:..8.03-07.38.7.3.8:.80.9./.83.2.2099505..03-07.3-.3.39.748834..7.703.3..03-07.3.-07..8 03.8.03/07:3:39:909. $0-.2.880-.3509.5./03.7.8.30309 .3:93.88:8:3.-078.7039.907/.:39:2025079.9.209 9505.3:39:203..  88..3  08.2.3.3.3-07.7424842 .8:2.39..:/03..3-007.5.3 ..3.890.39..33.8.73.9./: 80/.7039.3.:.8.5.3-07.:2..3 ...3 $0-.38:8:3.03-07./:.3. .-:.207:5.790/:.18.7.3 .3.3 -078.03-07..3-.7.9:3/.3.32.58.3.../.9.3.9.5.80 .74248429.5.320..30.9203.3. .3. /0.353/.39.0/:.8.7.3/.0-/.30.39/.83 ...2099507042-3.3.3 .853/.  2.7039.3507.7.80-.:2.382050393.2.7.5./.35078039.3507../:./: $0.2099507042-3...2./.9203.2099507042-3..38:8:3..803 03805079.3.-/. .83 2.8.5.7.0/:. .83. .8.9-07/0.9.3.9..70...  .3:39:203.80.: 38-.0/:.3  $0-03./.3/.3.7.37042-3.5 /.3509.3907-039: ..3..2099507042-3.3.30-2:/.03-07.-07..2.03.209950 7042-3.3..0/:.3.:0--08..3-.28070.7.2099505.. 8.38.209.7502-039:. 8.0/:.. $09.7 5078039..7/.9.2-.2.37042-3.303./:./.: 47.8.9/.342-3..  !3/.3.3.353/..3.3.92030/07..3035.3. 802:.9.2..3. /909.3..7..3 .3-0-.7.7.7..38.39.3.39.3..3/.8.2099505.2099507042-3. 8008.03/.  .:5078039.7039.: 8.3.9:.3/./.-  .80.4394 .9.39039.703.209 2.039/./././:..4 9025.9.39.//../80-:9.7.2.853/.2. /:.7503079.3-..3.8..0390780-:9-07..397.03-07../03.8 2.9070309 03 / ..3..3.380-.8-./.2099505./03.33.7.3909.8.3307.3.3/03./03.3.8803.9.3-./.3.2.2099507042-3.35033.39 /:3.250789.5.3.2099507042-3. .907:8 20307:8/:9405033.7.8.:809/..7039.2099507042-3.39.3 80/.7  28.209.209950 7042-3.209 9505.7.203.:0-:7.3.:2.9./: /-7//03.3-07.99.7/.2. 9/.8.03-07.5..-.37042-3..7.9.7.2.390780-:99.7039.:-:3.8-078.39.5.8.3.8/..3-08.95:.3/50740 42-3.35./3.207:5. .8 $0507990.9.9:.209-:. . . 02:33.9.3.209...5.7.2.7.8907/.303 03.2099507042-3./03.8...9035. 9/.2070.3..2099507042-3.5.9075.2099507042-3.3/3.203.0-.7039.38:8:3.35078039./.2099507042-3.3.7:/.3/:25.8 2./.3/.3 035.3.7424842 74248424244  .9:5079:./.3.39.3502. 2.802039.80.8/:.2099507042-3.8 ::203/0  207:5.209. /:.840  $9:790.3 ./:.3.5.9 5.:3.2099505././..32025:3.8 %07../.3033.3203.209950 5.8 /.03 03.2099507042-3.7039..7039.7  3.2.

034950 034950/03.5748080..53/..2-.8.303 03708081/./.9/ ..53/.39:2-:203.3.3:.3. -.8...431:7..-' $0.9:.703.848457./808:/.53/.2502-0./:5.8:8   - ---  .808:..-:9.8803095.4:8  !3/.5-.5.3203.803.3-.5.8.. 0-07.3./.8..    .2/:5. 0025../5.74248424244.-7042  .802.9907-039:3.3502.30:748547.507.4-.3.907/.3907.-070./.880309907:9.3.. .703.3:93..3.3.7..9/3.21.-3.95.703../..2./:5.54/3.4./.8.9079:9:54003/423.3203.  0.3203.54/ 03..8 .5.80204880/:.7..8203.54/.742.2.80 70574/:8.3  $0.9 -:./.7 /-.3203::../  :9-..9//0908.3.8 /50740/.87424842 /.5.3./3.3907.8.4:39:0507:.7. 2:.                 04880488  9488 ..3202-039:83. 0857083..3.2-.74248424244203.53/.3/3./ !.3/.5918.9.5741.. -07.2/:5.8.950393-.88../025.39097.89097.280:2.3.329488 803.338..8..588 ./.9.3907.9.../280:22:980../5.87424842 !.3 .3.9742.38:33.8.5./.342-3.9/.3203:3..3  !4.88.3.3907./.3-0-.9/. .

848547.7.20309.-.2:33907. 0:748547.5.3.89.2.9..7039./80-0:27424842203.3-07.7  . . /.53/.7039.9/.3/.  /03..3.2.!4.2-.8.-.7..9.8502-0./.3./808:/.2099507042-3.209.39. .5./..7424842203.9.8:85.8.380-0:23.0/:.3907. !.3/./.9: .7039. /.209950 7042-3.3.5.9/.70/0./:.75.0/0.3907.:-..-.8/.7039.848547..9505.7 5.209/.5.-.2099505.9/825:.2 /:5./.848457.             04880488  9488 - .3.88. .02:33.2.7  .32.3-.207:5.7.3907-039:907/7./.- ./.75030.8.  --7042-3.3...2/:5..8 .7 3.8.2-.03-07.7.3 5.848547.2099507042-3./.8 %073.703...7424842203.8053/./..2-.848547.2 .3-07.3203.7  .:8..8 %.3...8:8  5.8.8/:.9:.380:7:3.9. 2.8  !078039./.53/.7/..2.7.7039..7039...853/. 53/..39/.8.3..8 .9/-0/..8 -078.8.2099505.2-..5.80.- 5.7039.9./.9/./.3907.754.25.84547. 0025..5079.  0.329488. ../..8./ 8090.8:.   $0-..30.8808:.9/5.8..7.. 80. 5.7  .5078039.8.3-.7.2-.39.2/:5.3..848547.703..

0/:/:.39.3.3-.39.3.:..8.18.3-.3907./.8..9.2-.7.3907.353/.. 53/.3907./..2099507042-3.3.2099507042-3.3907..7.:53/..:9.-.8.35. /4:-0.3907-039:3.3.80.3.9:./.8.3 !079.39: .3/.3907.3:7:9..209..2-.9:/. 53/.3-. .3.:805079 /80-:9. 9: 5078039.9907.8. 3907.7  2. .3/.3.2099507042-3.7.3.3 /.03-07.73. 8.8.8.25..3 907./.35.353/.-:.2099505. 02:33.309.853/..7. 53/.203.2099507042-3.3.853/.9.-.8.2 ./.-./.3.8..3.-/.3.5.3907.   .8.    .8.2099507042-3../.3. .8 .3907..39.3   /.3.3.253/./.5078039. .3:./03.9.2099507042-3.39./03.03 03/03.3./. 0/:.2.8.18.853/./9..3.2.90780-:9 8050795.8.-.2.8.39.7. /.3/.3.3././.8 .8.8.28. 28.3470.3   202507.7.8207:5.853/.3 $02039.7.8.  %.39.  09. ..748834.3 5.9.88.3.3..7.7.:53/.8.3.0307.- ..73/3.2099507042-3.3 .854891/03.3907..3.07  $08:. $0.32030-.8053/..3./.:8.3 /02./.7.8.8.39. /:.8./.8./. 03.3.8./.7.8 53/.9.9.3 8079.3.380.3 -08..3/.89079039: 0-:7..853/.3 02:33.3/.853/..  .03-07.       .-.2.9.35./.3907.!0789. .-.53/.9./:.03-07.7039.03-07./ ..2099507042-3.

/.39:305.9././. 80/.3/. .3 ./8..75.2.8.209./.35..3-07.-- /.3./.-.8.909../..3/:25.%9 $.3.5-07.03-07. /03.03-07.3:9.3 09:5:.853/.7039.3...8..35./03.3.3.2:3 .38. 99 9700 54399089./. .--..73/./:. ./:42449708081 $..3.. /./.3.3..  .- .-07.3..3.  . 0-5.75.8.3-08.209.   $./.7.853/..333....39.7.209.209.209950 7042-3.52.3./:97-7/.2..390780-:9 .--. .3.8.3/.8.3:/03..9:3/./.853/..../0. .7  !3/.38. 2.8 5078.75078039.2-.3/.3/..32.0/:.-.30--.. .853/.38:.75..5078.2.3&%.3.:2.853/.0390780-:99/.803.2.  2.9.3:907.5.2099505.7/0... .209/.209 .73./0.3. 0-5.7./..2093/.338-.75.3..-.7488 $0-..303/.. .  .3.209.   --.8..30--08.. .853/..3/.7.803. 8.04254.3 .09./03./.39.1034950..8. .7.209./03.303 2.-08.30...80-.5..5030./.2099507042-3.3 3/. 5../.4394 3/.209. -   .7  ..33.853/.0--.39.3./.2-.3..3 9/.9:     .803..39:305.2.3803/73./:97-7/ 90780-:9 $050795.  -- .8.75078039.3.53/.38-..5078039.8./:97-7//3.32./:/03.8 90780-:9.3: 80507990.7.9039:8..8.3/.8./.3.7.3/./.3.21034950 .

3..3.73/.-..853/.8.904254 042545079. .209. -/.9./.5.. /../025. 203. 8.3.853/.- /./.20953/.3/..9/-./:42449708081.07. 0425409. -. .  042540/:.3..209./.-.3//.3//.3042540025.-.7039..3.2. . $02039../.9: /.--.8.7.2099505.07.

8/:..:5:3 7042-3.3.8..2.9.303.-.9:2.2099505..2093/..-.88.32025:3.3/.7039. 2..209 ..8.83 2. 03.38.83907/7.3/02.703.38.904254 ./..8:8:3./03.21034950 808:./:..3:3.:8 034950.2.338-.025...  .-.2.3 103495080.3.32... .3.

.-.  .

 9505. 5078039.7039..-.907-08.-.803.7  .

. .-.

-.

803.54884:8  .39.39:305. 9507042-3./.8.../.8.3.7.3 5078039.-07.-.853/.

 .-..

/.853/.39:305.-07..39.8.3 5078039.803.3./.-. 9507042-3.-.8.7.54884:8  .

 -..-.

-.8.  . 9507042-3..9070.8.853/..803.3/. 5078039.3.

.51034950.8.-..9./.9:742484242445. $.

2.3. .9: -.88.034950.703.8. 349.3.-.38.03 03/03.8 80.9:.3:90780-:9/.81034950.9.  0..:202-.38:8:3.

/:.3349.83 2./:.3::39:03 03-07.2093.2.88.3.83 ./03./ 3/.2.0349503/.8.8 :39:.

35039:3.025./.4394-07:93  --.3-.0 74:5 .03.3 5.9079039: 03.3:/.5.9:0425403-07.39..3.9509. 28. 8./902:.9509..::5805079349.9.9.3 /03.2093.95.9:/:. 9../.75079.7.3  09::.. &39:203039:.:39:202-:.303.7   .3/. $0-././.3.-.35078039.74248429.9/.88.3203.7/./ .2-.3./.9/0.33.90425403-07.3.3.-.::5/9:8/03.3907/7.3:9.890790.3035.8. 805079/...3:7:9..34.3509.7..  !0209.3.31..0/0.9.3 /02.7.9. .39.3.3:7:9.::2.8 . 3.3../5.9.3.7.9..502-:.2...38...37424842 .573853.33.88.3-03.5.9/2. 907-08.- ./.3..3:39:202-:.2.57424842/80-:980-.503:8. .7039.3/.. 0/:.7424842/.303 03/03.33..3.3.8.7424842 /..3.5.5.9:/..:39:09::034950./.99/./:9505..3.8.974845.9.7424842205:9503039:.2 509.20..880/0709.3:7:9./:.7 .9:7424842/.4394  5..80.8.303495090780-:9 .73/.

7 .-.3 9.. 02:/..

3/./:.8.8.3/.3.9:/:./-.853/.3.3:2.5. .3/. 3:.3 ./:. -/.9.9070..3.3203.

3/..8.7039.. .  3/. 58 793.8:39:203../:5.253/./82:.3..

./.-. /82:.8:39:203.-.258203.

8:8:3..882:.83/.4.8.33/.9/.9073.3..9.3 /03. ./:58.4.3033.-./. $090.2.

. /03.9/.2.3-.8.

703.9: 3/./. 28... 203.3.  0.3033...:-./:5.7039.7:89.:7:9.

3/.258 2. ..../:3203..-.3/50740.

4:..9. .4./03.2.8-0:2.-.3-.3 9073.

/:5.3035.. 9073.7039././..9109../.:7:9.7 . 907. 203:-.3/..203.

/:5... .203.3203./.258..- 3/.3 :7:9.7039.3038050793 4:8/903./03...

3 9073...9.3-..4/03.4.

03-78908  0.:7.3 /.220/38  :0/008   .9/825:.3-4/ 9:  .7.85-077008 1 1:.038  .38 8..477 .38  .3-03.9 ./..8 7..:-9:839077:59:8008   790008 $ $9.-/423..90/38 78 7480008   . .:2:.9. 03.5..  .3/02.49008  ... 8...:938 85/ 85.03-78908  83 830/-78908 8 830..78 .. .008 .943 3 033../038 .:     04-4/  309 30938  7: 74:4/008   .90/38 - -.:7:9. .:7 .7008 # #4:030/008 -9 -03938   49.008   9 9.3-.709008  5 50.0308838 /5 /:2538  4.9:2478 80 805.477:.:008 0/ 0.34/008 18   -093.7488.7309008 89 8. 0.9:7038 .8907  . .-4/ 0 0.. 4.4/38  2 23.008  7.3403 .3:8008  :738 ' 7- 7:-008  -4 -47/0.

:7.-.80-7908  .7008 ..738 89 897..-78908   .709008  7/ 70.974845.943008 . ..38  09.:738  7 7:/2039...33. 3:90-4/     3:90-4/      ..7  !09. .7/3.450/38 7/ 70/:.7008 - -947.8907 80397427 742484274248420.-78908   :25-4/ 78/ 7.34.73..38  & &59:720/38 0 0-43-4/   .0/38 .38 .20.7 .0/-4/    .07:-38 87 89750-4/   -- -4--0/-78908 ./ . .: .74248425.008  2 2.7.0/-78908 .089.80 4-9 4-9:8038  71 744138  3 3.2-.3 . 7.77438   /87 /87:590/38 !7 !7. .23 .-4/  .0 .8/ 8./.80/38  7..

7.35078039./:.3. .3.5078039./.: /.3.8/:-.39.39..8053/.3 80/.03-07:7:9./:5..7..353/.8./ -.:9.3.303.3 033.-.  8./:.3  /.3.9.8.8053/.39.:7:9.8.7..2-./03.203.3/.88.3:93.92039:3..3. 3.7.0/:./03.8.3-03.3:90780-:9/.7.7039.39./.5.7.3 2.3  ./.838.3/423.7.73.83 2..3/.3203. 8./03./03.72:9.2.- $0.- .2.3 $090.7/09.3/. 03-07../ .9-08.18.2.03...7.3/::7 .9.7.3:7:1-08.7.703.39.3.803.7. 9.:7:9.3  0.3.353/..

39.3/.8../:.9.853/..7.3.8.      ./.7...3 ..2.3- 03.3/02.. . /.3 907/7.

./.39.     $02039.9: 3/..853/.32..83./:.3.83 2.7.8. .803.      .7.7.3.. /.

/:.3.439484.9..853/.8.          39071070387424842 !./.3/.9-.90780-:9/.-.8907./.   .. .3.3/.3.

/0.2.35078039.0/:.3..-078.3 907.73/0503/038..3203.35079..8..3/.2.3..33-03.8.:3 /. .8353/./ 58 8.8 5078039./902:.  .9.399.3-.2. /.907..7.53/.82.9.340   :075.93.9904750:.5.3/.    ..3.9:3.3/..2./03.7:83./.8053/.3/80-:9401803 438/038  .5....3/3.75./.7:83..:80.7 -03.91/::7/03.8.8053/.7/.35.380-0:23../03.8.80.3.53/./.07.90780-:9/.3 -07:7:9.3.3/.3. 8.3 $0.3207:5./.3/8:.50789./:.3/./..9047-08.  07.8053/.8.8.5078039.38:.3 ./ 58 .3/.58 0-0.3.9./...84./.8./.3.8.3      .9:8.83 2. 2.7907.7. 80./.339071070387424842./-078.3907.7  3.3 2.9:9025. 53/.9.53/.73..2:3 80507990./3.2.58 907.3 -03.338-.7.3.:3907107038..8.:./.8.- !./.8./:.558 ./ 39071070383203:3:.9.3//0..2.83.7 -03.3207:5./390710703880.58 034203. .35.8.8.9.2.53/.439484.

3/3907-.3.3/0503/038./03.73.39./.7..3 .703.3-08.3.3907107038  ./03.50789.3 203.38025:73.53/.7 -03.8.3-07:7:9.3803.53/.2-.58 8./:..78.3  0.3-03./.2.-07-.7.73.3.50789. 203.-08.9: 3./:.3.3-07:7:9.   .358 $0-.8.  203:3:. 3.3-.

7:8$03/.39/./.9.3907-039:02:/.5.80-7/. .3/02..3.2.9 703/.780-7/ .35.3/03.9./.8303//. 9.9:8.580-7/.9/.2502-0..3:8.9/825:.9.3 .78./..:2.809.3/02.3/0.32./.340..-7/8.3907107038 793.5.-078.3508.33.7:8 .3803/73..93.5.3...7424842207:5.8050795./.38:..802039.909.3/03.3202507.374248425.33./:3.3203.80 80-7/.9./503:7.329488803.2.30-07./02.3-08.80/.9:7424842907/.3:8.-7/8.8032 90780-:9 03.38.9:74248429079039: .5.9/.: /.954.303.3/03.3202:33.703.982.8 92/33.5. 7424842.3/3:7:8/03.3:8.3.3/0391.7.2. 2.3.:.3:8.9:7424842.80-7/ /.5.3503.3502-07.98  $0.7  0/:.739071070383.2.8.3 3.2.974 !03.50.9:783908803292/33.903 039079039:  %.854891/03.5-07-.7.2:3 170:0381:890780-:9/.:8:8:3.73.9.9.8032.892/33.8888.9/9039:...38020374248422....3:  0./.  &39:203.9/:3.98203. 2.3 9037042-3.3:8.80/..9:903.9: /507:.3.37.7424842203. .5409034  $0-7/.3203.3:8.30-07.0:.8:.3502-:.:3 :39:203.393.7.9.3/03.78/...9.9:/.80 .8.38:3/03.2502-:.380038.35:.39. .9.33-0702-.9 /93.7..03.9.350302:./03.8.9.409 $0./03. .80-07./.-:3.380842.3  03.2-.80-.3.5 03.9038944.3.32././.7./3907107038/.9/09./0391.5..32..9.3907.2240:7424842  %03-7/8.3203.74248422.87424842/.9.34018033907107038  ..5. .3 /.3203..9:809..390.8.7/..3.2.-07./.3203.7.8/.8:.3-08.95:. 3742484280.9.39/../:3.7:8$03/.5.38.-07470.3509.9.9:3..742484234247 .9 20309./.3.3039079039: 5..7./.3:8.9.5.3/.:..:.9.3.3 -.88..8:. 39071070383.3 /03.30.3:8.7  3.33.9:.80.7.2./:25.7 0/:.3.74248425.39.3-08.3 1:8 803-07.9/.8.5.3 /.33/0503/03803.7424842 203:3.2.9:81.202507.38.9.-0  .7../.38.3././93.8 74248422.:907..32./../3.3509.3 /03.91.3-./.78.:2.8.880842.3./.8:97.3/.3-.3 :2.3.80 .380842.9.-0  %07.340 .5. 170:0381:8/.9:783908892/3 3.8./.80:9.7/.5. .  !0209.3:39:/..3-08.3  $0-./03.90-07. !.9-.3/07.-08./.5.909./:3.3./03..3035.8/.:..53/.985079.7.3./.3/.3:39:84.74248422.8090709.5.4394 0-07.9.53/.3 80:2..880842./.-:3.:3 .33.880842.829488380.8.9/902:..5.9: 8.3.9/03.2-.8:..:/:25..9  !.3:39:203039:../.8:2..2.98 4247 9.9..7..%.83 2.

80 -7/                92/3 3..91 .91 ./.91 .91 .                                                                            ../.80 .91 9/. 9/.

.

7   #$         .8.742039.. !4890/-.1-40309.

3-.9-:.9:8.8.303.3 09.3.5..842.2.3 09::.3.9:-0:2/.3070/907.8 ..-:3.3.3/.9:.8 .30342 $97:9:77424842 :2.8.3 8.303.5./80-:9.9.:.:../ 2.34003/090.27424842  0..2897:9:7 397..2.2.3 502.7424842         #$ 3.8..8. 9.7:../.9:.30/.38.8.8/.3-07.34.3907.3/.9//.9:8.343805-.03907/.27424842 2.9:7502:3./..3.3-0-.8-07:93.-07./.382803/.3:0:8.9. .3503.3-..8070./.  7042-3.209-093.209 ./:-0781.2.390758.38.-. 8.3/03..:39:20250.7424..3 5.3203.5.3.2.4-.3 8.73.9:.9:7405.9907.8070../.03207:5.8.74845..9:.3.3/3.2..83 2.3070/907.3/879 90758./.85.303907803/7  .3.3.2.3907-039: $0..835.2.38:35.:1034950 3/.9/:3.3-.35:./.78./09.3..9/879 90758.:302:/.2::203/0 8070.3/ 80/.38.340.720.20..:..8..320.. 80:2. 20.:89:/5.3..3 //.:-.3 07.703.9:7405.803.9: 8.9:.39:305.3.9:7405.. .8.5. ::203/0 502.2.3..4394 81.9:9/.3828 03507:/.  0-07..5.30390780-:9207:5..8....      #$ O O O !03079. 20.209.3.8.3 8.:507.81.55.8507.3 02.303/.80.9:.3 $0-.8 5.209./503.202-07.33.9//.9.8..:7424842 :8:83.303 /.8.3  085:3/02.9: 0307.3-039:-3.33.800307.3-.3.03907/.39.88.9: 0425450309 %  47.382097. 20302:.9939.3.9..3/58.3 $.9.5507.8.:.37424842 .3.382097.303.3.35078.8907203.3:93.381..3.3 ..

7  0342..809.3 802:..5803.9 74248423-07-039:3.3 03428:. .3 9/.33.30342 $0.39..3.8//.-         .0342 03.080:7:.390780-:9  0.:25:.5..:-. .907/09.3.039078:8:3/805.880. :-:3..9.9.380 .9.3..3.80-:./.703.502-0.2025:3.0342/.3820574.3:25:.9:.7424842.2809.303 03..37424842 7.880-:./.3.3/24047.74248429:3.28:.3.3820.27424842  !03079...3..5803/.2.3507.3820 /80-:980-./02..382090780-:95.8 0/:/:.9.3802:.-3.9: 034247.-07.38:33.303//.9:3:0:880.3820 574.-' !.03.907/7.3907/./:47.3./.:...3 87:07  /..9//.7.749805079-..7.749/.2-.9:47..3/-.7.7.

27424842 -.7424842 :2.33.03//.9: 80 80.95.:5:35.74248425.:2.39..25.8.7//.80-:.3.0:.749907/7. 7424842/.3.0342 $02039..2025:3.8.9408:.7424842574.33  /.: -07./:.209  5.. 80842.9.5..8.28:.7.03420:.7492025:3.38200:.257 80./.3.0390780-:9 4394 /0709..30342574.5.2-.-:.207:5.9:47.:425089./03.54/ .742484239/.34..97424842.... -0/./.33.3850808.0342 ./83:3-.34:880:2.39: 74248420:.54/5.7//.:2:23.80507.-07-0/.3 /9025./.9:.3 ..9: 850808/.7.:2025:3.890.4:8 .3::7.203428:.-:.2.79.8-448:....32025:3.749 03420:.9..80/0709./..9.7424842  %.3.20342.  ./.749 -.380-.4 -.2-.54/ .9:47..32025:3.57424842202-./03.9/.-' .3509.574.7492.-' $0 800.8-0-07.9.7424842/.98 ..:/.7424842.2:3 :2.8907  0342:.3:8.5.9 20.749/./.3.749 07-0/.0342/54/  :2.3820 0-.5.3/03.-:. .3039079039: $0.7  .7499078:8:3/..9.7-0-07.23 .9:74248420:.2.9.38508082025:3.8.9..439480.9:03/80-:980-.749 .33. -039:307 !488//.3203.9.749 ./. 3./.

8508085.20342..3.3.-:...37424842.8907 345008.3.:8 :82:8.34.:2 .3742484234247 5:.47.8 ..5.1..:8 !.7424842//.8.3.0342.7/9 %:2-:. %.3/03.0790-7.74248425.3820/54/0/:.3808:.:2.-0  :2.3.8. 0.2. 742484234247/.3-0-07.  793.9.0.703425079.:8 0345:8.88.    %.. $06:4.3974/908 4248. .::8 08/42089.-:.57424842.7424842 80/.4308.38 9:80/:8 0..54/3./. $.-..742.8 %79.54/-0-07.0 0:748547...08./.8025..35.3..:.:8/42089.8.7.070.0.-/45889.7 8.380907:83.9:87424842//.3 /09./.8.3./.1.-/9800.3 0.8703.:.-0  :39.3.3-075.:2025:3. . 800387:8..2.. 74845.5.3-075.2/4243.:039:2 '.45078.3.33/3..90 84:.54/ 3                             :.0790-7.9.8147-08 .809.3.850808 47.7038 7.0347.5038  !.0342.74980/07.3-075.9:8 7.3820 :2.374248424244  .20.2.38200:.54/3.749 $5080847./.08 8907.20342.2025:3.703420/:.: 5.3. 7424842 .30 3  7424842 7424842.8.5.089.-07. 02.

.5.3.4:89079039:/ /./209.. -039:8:-209.3:7:16 80/.9/03.5 89.3.3/507400349500907449 02.4394 .8.9.. $0-.3 0..4394 03 /423.8897:9:774248420:.3-07.37424842.7480397 /:25.5.7424842 74248424244 9...5..303.1.8.303.749 .303.903.3803974270-:7.5.20..3.703.3 /:.3.37424842. 7.33.7424842.309.39025.5.9/.35.37424842805079:7:1 /./.33.3.3 :2./:.2-.3.-./.3.3.7424842 803../.90780-:98.9:7424842/.33.37424842805079:7:1 039:8:-209.7424842 42443. !./.93.80  8   88 .70/:/:.03.907/.9: -039: 209.3.5.37424842805079:7:1'  0./.3.81.9..80397.-:.7424842..3.3 -03.8.7424842424403./.749 74248420:.-075.35:. 903.502-0. 89..9:7424842/. 2. ..3/03. .34.5.39.3..-' .3 . /.903.38./.803970/:/:./. 202-07.303.3/:.9:907/.25.780397480.2.3808:.9/04254..3.380-07.907-039:03495042449/423./ 80-03.3/03./.5.3853/0/.3 207:5.3189039.8.03../.37424842802.5.3/03.0/:.303.8.9-075.8:.3 /03./.7480397 $97:9:7 74248423/.5.380 . 202-07.3 :39:4:890780-:9 .3::37424842803.80397 8:-209.73.80397 /.9-075.390709.89072025:3.974845.903/. $0397427..5..5.3503/05 039:.2 897:9:774248420:. 2.7  $97:9:774248425.2025079.80397 /.8.303..37.8-0/.74803979.3803974273. 502-0.803978039742790709. 5.809..03..9.209.30./5.5.5.35. 209.803973203.257/::37424842803.80 .25.30/:.8.35.8:-209.2.2.3909.07./.-03.8./.25.3../.03/07:32025079.37424842 %070-50393..803./903..4:87424842 8073. .5..3 5.9./.3//. 03.:39: 202-07.:-07-039:307 9073..38:33.9/. ...80397 8:-209.2-.  .3-.3.81.  ./.39/.3. /03.3 203:7:90/:/:.03././.5.3803974273.7.7424842 $0-.374248429.03.7480397 880397427 !.9:209.9-07:3.7.8.8039742790709.202-07.3.7424842 42443.390.503.8897:9:77424842203.2-././..  .80397203.3035..28:.1..9200.3 03495042449708081  .9:/..8:.5.3. 0.2.742484242443.3..3:2.80397.-07.3.09.9.749 .3.

5 742.-  803..5.5 5.:94842209.9/8 ./.7424842.9/8    .. 025..2.3/ .3. $0-. .7 88907.240:.3507-0/..9:.3 /-.9/02-.3897:9:73.9/202-.5.3/0.33.39079039:240:207:5.3 :.:94842.7480397.25.502-0.9:8:.3-07507.3. 20..2.509.3:8.303.2./.35.3 /:-:3. /.:94842 209.83 2.74248420/:.3:8.380/.9/907/.37424842209.. 5..80397.2025:3.38:33./.3:8. 2471448.9.9.-' ..3/.3909.9/:. ..2.30.5.303.80397427907/.3.8..80397..9.8../.8.9/ 7424842..7.380.9:8.9309447 .74803975.34.80-:.23 .37424842.8/:.8.2503.8 !.5.2.805.3574903 %.9070309  90427 ::37424842   80397427 43897857207   309447  742.3.20/:.742.80397427 09.7 88907.35.//..39/.309.38. -0/.7:39:.803975.3.2./.3/3.7480397 .503... 2.3 -..742....3.825./...3 .5$//.5.35.825.0425474845..2 50707./.8907 808:.2.9275 . 825..:94842.9: 02.742.3 10349503.240: !./.3-08.3/.0/:.32.4244/03./. :94842.9.9:574903897:9:7..2.3742484280.380 ./.5.380907/.33.3203085708../240825.07.:39.3203. 8.7802039..3 2.39/./.3 -.:94842././.9/:3.303 03./.742.8897:9:7742484280507990.33.3.9/02-./.380-.-07:5.2025:3...-.-07.3503:8:37424842.8.980-...380  742./.35.2.9 /.3 209.8.74845.3./..3 .-' 907/7.74803975.9/:../03./:7.85080874845.8.8303.-.-:.9.3-039:3.7.83 2.9 .3.0380.83803.5.8.2.380  ./..3/.380/.3 /.80397427-07-0/.2/0487-43:0.81.5.3:8.-.2/.-.803975.:780 .2025:3.

749 .3:2:2897:9:774248420:. ..3203.2-.3/.7.3 ..2503.7  ..2-.240:    . . 7424842 .380/.

.

. $ !$$  #$$&%#%%  ! &%  #&$&#% %% &%& $&&!%& !&# .7 397$0-0:23. !4890/-.742039.8.1-40309.