BAB XV GENETIKA POPULASI • Populasi Mendelian • Frekuensi Genotipe dan Frekuensi Alel • Polimorfisme Lokus sebagai Indeks Keanekaragaman

Genetik • Hukum Keseimbangan Hardy-Weinberg • Perubahan Frekuensi Alel BAB XV. GENETIKA POPULASI Pola pewarisan suatu sifat tidak selalu dapat dipelajari melalui percobaan persilangan buatan. Pada tanaman keras atau hewan-hewan dengan daur hidup panjang seperti gajah, misalnya, suatu persilangan baru akan memberikan hasil yang dapat dianalisis setelah kurun waktu yang sangat lama. Demikian pula, untuk mempelajari pola pewarisan sifat tertentu pada manusia jelas tidak mungkin dilakukan percobaan persilangan. Pola pewarisan sifat pada organisme-organisme semacam itu harus dianalisis menggunakan data hasil pengamatan langsung pada populasi yang ada. Seluk-beluk pewarisan sifat pada tingkat populasi dipelajari pada cabang genetika yang disebut genetika populasi. Ruang lingkup genetika populasi secara garis besar oleh beberapa penulis dikatakan terdiri atas dua bagian, yaitu (1) deduksi prinsip-prinsip Mendel pada tingkat populasi, dan (2) mekanisme pewarisan sifat kuantitatif. Bagian yang kedua ini berkaitan dengan penjelasan pada Bab XIV bahwa analisis genetik sifat-sifat kuantitatif hanya dapat dilakukan pada tingkat populasi karena individu tidak informatif. Namun, beberapa penulis lainnya, seperti halnya Bab XV ini, menyebutkan bahwa materi yang dibahas dalam genetika populasi hanya meliputi deduksi prinsip-prinsip Mendel pada tingkat populasi. Populasi dalam arti Genetika Untuk mempelajari pola pewarisan sifat pada tingkat populasi terlebih dahulu perlu difahami pengertian populasi dalam arti genetika atau lazim disebut juga populasi Mendelian. Populasi mendelian ialah sekelompok individu suatu spesies yang bereproduksi secara seksual, hidup di tempat tertentu pada saat yang sama, dan di antara mereka terjadi perkawinan (interbreeding) sehingga masing-masing akan memberikan kontribusi genetik ke dalam lungkang gen (gene pool), yaitu sekumpulan informasi genetik yang dibawa oleh semua individu di dalam populasi. Deskripsi susunan genetik suatu populasi mendelian dapat diperoleh apabila kita mengetahui macam genotipe yang ada dan juga banyaknya masing-masing genotipe tersebut. Sebagai contoh, di dalam populasi tertentu terdapat tiga macam genotipe, yaitu AA, Aa, dan aa. Maka, proporsi atau persentase genotipe AA, Aa, dan aa akan menggambarkan susunan genetik populasi tempat mereka berada. Adapun nilai proporsi atau persentase genotipe tersebut dikenal dengan istilah frekuensi genotipe. Jadi, frekuensi genotipe dapat dikatakan sebagai proporsi atau persentase genotipe tertentu di dalam suatu populasi. Dengan perkataan lain, dapat juga didefinisikan bahwa frekuensi genotipe adalah proporsi atau persentase individu di dalam suatu populasi yang tergolong ke dalam genotipe tertentu. Pada contoh di atas jika banyaknya genotipe AA, Aa, dan aa masing-masing 30, 50, dan 20 individu, maka frekuensi genotipe AA = 0,30 (30%), Aa = 0,50 (50%), dan aa = 0,20 (20%). Di samping dengan melihat macam dan jumlah genotipenya, susunan genetik suatu populasi dapat juga dideskripsi atas dasar keberadaan gennya. Hal ini karena populasi dalam arti genetika, seperti telah dikatakan di atas, bukan sekedar kumpulan individu, melainkan kumpulan individu yang dapat melangsungkan perkawinan sehingga terjadi transmisi gen

dari generasi ke generasi. Dalam proses transmisi ini, genotipe tetua (parental) akan dibongkar dan dirakit kembali menjadi genotipe keturunannya melalui segregasi dan rekombinasi gen-gen yang dibawa oleh tiap gamet yang terbentuk, sementara gen-gen itu sendiri akan mengalami kesinambungan (kontinyuitas). Dengan demikian, deskripsi susunan genetik populasi dilihat dari gen-gen yang terdapat di dalamnya sebenarnya justru lebih bermakna bila dibandingkan dengan tinjauan dari genotipenya. Susunan genetik suatu populasi ditinjau dari gen-gen yang ada dinyatakan sebagai frekuensi gen, atau disebut juga frekuensi alel, yaitu proporsi atau persentase alel tertentu pada suatu lokus. Jika kita gunakan contoh perhitungan frekuensi genotipe tersebut di atas, maka frekuensi alelnya dapat dihitung sebagai berikut. AA Aa aa Total Banyaknya individu 30 50 20 100 Banyaknya alel A 60 50 - 110 Banyaknya alel a - 50 40 90 Karena di dalam tiap individu AA terdapat dua buah alel A, maka di dalam populasi yang mempunyai 30 individu AA terdapat 60 alel A. Demikian juga, karena tiap individu Aa membawa sebuah alel A, maka populasi yang mempunyai 50 individu Aa akan membawa 50 alel A. Sementara itu, pada individu aa dengan sendirinya tidak terdapat alel A, sehingga secara keseluruhan banyaknya alel A di dalam populasi tersebut adalah 60 + 50 + 0 = 110. Dengan cara yang sama dapat dihitung banyaknya alel a di dalam populasi, yaitu 0 + 50 + 40 = 90. Oleh karena itu, frekuensi alel A = 110/200 = 0,55 (55%), sedang frekuensi a = 90/200 = 0,45 (45%). Frekuensi alel berkisar dari 0 hingga 1. Suatu populasi yang mempunyai alel dengan frekuensi = 1 dikatakan mengalami fiksasi untuk alel tersebut. Hubungan matematika antara frekuensi genotipe dan frekuensi alel Seandainya di dalam suatu populasi terdapat genotipe AA, Aa, dan aa, masing-masing dengan frekuensi sebesar P, H, dan Q, sementara diketahui bahwa frekuensi alel A dan a masing-masing adalah p dan q, maka antara frekuensi genotipe dan frekuensi alel terdapat hubungan matematika sebagai berikut. p = P + ½ H dan q = Q + ½ H Dalam hal ini P + H + Q = 1 dan p + q = 1. Agar diperoleh gambaran yang lebih jelas mengenai hubungan tersebut, kita perhatikan contoh perhitungan berikut ini. Data frekuensi golongan darah sistem MN pada orang Eskimo di Greenland menurut Mourant (1954) menunjukkan bahwa frekuensi golongan darah M, MN, dan N masingmasing sebesar 83,5 %, 15,6%, dan 0,9% dari 569 sampel individu. Kita telah mengetahui pada Bab II bagian alel ganda bahwa genotipe golongan darah M, MN, dan N masing-masing adalah IMIM, IMIN, dan ININ. Maka, dari data frekuensi genotipe tersebut dapat dihitung besarnya frekuensi alel IM dan IN. Frekuensi alel IM = 83,5% + ½ (15,6%) = 91,3%, sedang frekuensi alel IN = 0,9% + ½ (15,6%) = 8,7%. Hasil perhitungan frekuensi alel dapat digunakan untuk menentukan sifat lokus tempat alel tersebut berada. Suatu lokus dikatakan bersifat polimorfik jika frekuensi alelnya yang terbesar sama atau kurang dari 0,95. Sebaliknya, suatu lokus dikatakan bersifat monomorfik jika frekuensi alelnya yang terbesar melebihi 0,95. Jadi, pada contoh golongan darah sistem MN tersebut lokus yang ditempati oleh alel IM dan IN adalah lokus polimorfik karena frekuensi alel terbesarnya ( IM = 91,3%), masih lebih kecil dari 0,95. Proporsi lokus polimorfik pada suatu populasi sering kali digunakan sebagai salah satu indeks keanekaragaman genetik. Nilai lainnya yang juga sering digunakan sebagai indeks keanekaragaman genetik suatu populasi adalah heterozigositas rata-rata atau frekuensi heterozigot (H) rata-rata. Pada contoh di atas besarnya nilai H untuk lokus MN adalah 15,6%.

Seandainya dapat diperoleh nilai H untuk lokus-lokus yang lain, maka dapat dihitung nilai heterozigositas rata-rata pada populasi tersebut. Perhitungan frekuensi alel menggunakan data elektroforesis Frekuensi alel pada suatu populasi spesies organisme dapat dihitung atas dasar data elektroforesis protein/enzim atau zimogram yang menampilkan pita-pita sebagai gambaran mobililitas masing-masing polipeptida penyusun protein (Gambar 15.1). Elektroforesis merupakan teknik pemisahan molekul yang berbeda-beda ukuran dan muatan listriknya. Oleh karena itu, molekul-molekul yang akan dipisahkan tersebut harus bermuatan listrik seperti halnya protein dan DNA. Jarak migrasi (cm) 4 3 2 1 Individu 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Genotipe CL LL LL CL CL CL LL CL CL CL LL CL LL LL CL Gambar 15.1. Zimogram esterase dari ikan sidat (Anguilla sp) di kawasan Segara Anakan, Cilacap (Sumber : Susanto, 2003) Prinsip kerja elektroforesis secara garis besar dapat dijelaskan sebagai berikut. Sampel ditempatkan pada salah satu ujung media berupa gel, kemudian kedua ujung gel tersebut diberi aliran listrik selama beberapa jam sehingga komponen-komponen penyusun sampel akan bergerak menuju kutub yang muatan listriknya berlawanan dengannya. Kecepatan gerakan (mobilitas) tiap komponen ini akan berbeda-beda sesuai dengan ukuran molekulnya. Makin besar ukuran molekul, makin lambat gerakannya. Akibatnya, dalam satuan waktu yang sama molekul berukuran besar akan menempuh jarak migrasi yang lebih pendek daripada jarak migrasi molekul berukuran kecil. Pola pita seperti pada zimogram esterase di atas sebenarnya merupakan gambaran fenotipe, bukan genotipe. Namun, analisis variasi fenotipe terhadap kebanyakan enzim pada berbagai macam organisme sering kali dapat memberikan dasar genetik secara sederhana. Seperti diketahui, tiap enzim dapat mengandung sebuah polipeptida atau lebih dengan susunan asam amino yang berbeda sehingga menghasilkan fenotipe berupa pita-pita dengan mobilitas yang berbeda. Variasi fenotipe ini disebabkan oleh perbedaan alel yang menyusun genotipe. Jika alel-alel yang menyebabkan perbedaan polipeptida pada enzim tertentu terletak pada suatu lokus, maka bentuk alternatif enzim yang diekspresikannya dikenal sebagai alozim. Alel yang mengatur alozim biasanya bersifat kodominan, yang berarti dalam keadaan heterozigot kedua-duanya akan diekspresikan. Dengan demikian, individu pada Gambar 15.1 yang menampilkan pita lambat dan pita cepat (nomor 1, 4, 5, 6, 8, 9, 10, 12, dan 15) memiliki genotipe heterozigot, yaitu CL (C=cepat; L=lambat). Sementara itu, individu yang hanya menampilkan pita lambat (nomor 2, 3, 7, 11, 13, dan 14) adalah homozigot LL. Begitu pula individu dengan hanya satu pita cepat (kebetulan pada zimogram tersebut tidak ada) dikatakan mempunyai genotipe homozigot CC. Dari data genotipe yang diturunkan dari data variasi fenotipe tersebut, kita dengan mudah dapat menghitung baik frekuensi genotipe maupun frekuensi alelnya. Frekuensi genotipe CC, CL, dan LL masing-masing adalah 0, 9/15, dan 6/15. Frekuensi alel C = 0 + ½ (9/15) = 9/30, sedang frekuensi alel L = 6/15 + ½ (9/15) = 21/30. Hukum Keseimbangan Hardy-Weinberg Populasi mendelian yang berukuran besar sangat memungkinkan terjadinya kawin acak

Hardy. Individu dengan genotipe TT dan Tt dapat merasakan PTC. Oleh karena itu. Deduksi terhadap hukum keseimbangan Hardy-Weinberg meliputi tiga langkah. terjadinya peristiwa-peristiwa ini serta sistem kawin yang tidak acak akan mengakibatkan perubahan frekuensi alel.(panmiksia) di antara individu-individu anggotanya. Dengan berlangsungnya kawin acak. dan (3) dari genotipe zigot kepada frekuensi alel pada generasi keturunan. sehingga selanjutnya dikenal sebagai hukum keseimbangan Hardy-Weinberg. sedang frekuensi alel a adalah q. 2pq. baik dengan genotipe yang sama maupun berbeda dengannya. dan q2. tiap individu memiliki peluang yang sama untuk bertemu dengan individu lain. frekuensi alel akan senantiasa konstan dari generasi ke generasi. Pada Tabel 15. dokter dari Jerman. Begitu juga.1 terlihat bahwa tiga macam genotipe zigot akan terbentuk. mutasi. Prinsip ini dirumuskan oleh G. dan aa. dan seleksi. Di samping kawin acak. yaitu tidak terjadi migrasi. Dengan adanya sistem kawin acak ini. Dengan demikian.1. yaitu (1) dari tetua kepada gamet-gamet yang dihasilkannya. sedang individu tt tidak.Weinberg. ahli matematika dari Inggris. Artinya.. zigot-zigot yang terbentuk akan memilki frekuensi genotipe sebagai hasil kali frekuensi gamet yang bergabung. frekuensi alel A adalah p. Fekuensi alel A = p2 + ½ (2pq) = p2 + pq = p (p + q) = p. Pada suatu pengujian terhadap 228 orang diperoleh bahwa hanya . Pembentukan zigot pada kawin acak Gamet-gamet dan frekuensinya A (p) a (q) Gamet-gamet dan frekuensinya A (p) AA (p2) Aa (pq) a (q) Aa (pq) aa (q2) Oleh karena frekuensi genotipe zigot telah didapatkan. yaitu A dan a. dapat dilihat bahwa frekuensi alel pada generasi keturunan sama dengan frekuensi alel pada generasi tetua. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel autosomal Kemampuan sesesorang untuk merasakan zat kimia feniltiokarbamid (PTC) disebabkan oleh alel autosomal dominan T. masingmasing dengan frekuensi P. Secara lebih rinci ketiga langkah ini dapat dijelaskan sebagai berikut. yakni AA. ada persyaratan lain yang harus dipenuhi bagi berlakunya hukum keseimbangan Hardy-Weinberg. Frekuensi alel a = q2 + ½ (2pq) = q2 + pq = q (p + q) = q. H. maka terjadi penggabungan gamet A dan a secara acak pula. Frekuensi gamet A sama dengan frekuensi alel A (p). dan aa. Kembali kita misalkan bahwa pada generasi tetua terdapat genotipe AA.H. Tabel 15. maka frekuensi alel pada populasi zigot atau populasi generasi keturunan dapat dihitung. Aa. Aa. frekuensi gamet a sama dengan frekuensi alel a (q). (2) dari penggabungan gamet-gamet kepada genotipe zigot yang dibentuk. Sementara itu. masing-masing dengan frekuensi p2. dan W. Dengan perkatan lain. dan Q. Dari populasi generasi tetua ini akan dihasilkan dua macam gamet.

Frekuensi golongan darah A adalah penjumlahan frekuensi genotipe IA IA dan IA I0 . Agar lebih jelas dapat dilihat Tabel 15. frekuensi IB (q) = 1 – akar kuadrat frekuensi A + O = 1 – √(196 + 205)/500 = 0. frekuensi genotipe TT = (0.55 = 0.45.45)(0. yang merupakan akar kuadrat frekuensi O. dan O pada suatu populasi dapat dicari dari sebaran frekuensi tersebut.20. frekuensi golongan darah B. maka diperoleh individu sebanyak 160 orang. Jadi.11. Dengan demikian. yakni p2 + 2pr. yang semuanya dapat merasakan PTC. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel rangkai X Telah kita ketahui bahwa pada manusia dan beberapa spesies organisme lainnya dikenal adanya jenis kelamin homogametik (XX) dan heterogametik (XY). frekuensi I0 = √ 205/500 = 0.64.55 dan frekuensi alel T = 1 – 0.2 berikut ini. Pada jenis kelamin ini tiap individu hanya membawa sebuah alel untuk masing-masing lokus pada kromosom X-nya. sedang frekuensi genotipe Tt = 2(0. sedang individu yang bergenotipe Tt = 0. Dengan cara yang sama dapat diperoleh frekuensi alel IA (p) = 1 – √(73 + 205)/500 = 0. jumlah frekuensi A dan O = p2 + 2pr + r2 = (p + r)2 = (1 – q) 2 sehingga akar kuadrat frekuensi A + O = 1 – q. 205 O. Namun. Jika frekuensi ketiga alel tersebut masing-masing adalah p.25. sementara individu heterogametik memberikan . maka sebaran frekuensi genotipenya = (p + q + r)2 = p2 + 2pq + 2pr + q2 + 2qr + q2. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel ganda Salah satu contoh alel ganda yang sering dikemukakan adalah alel pengatur golongan darah sistem ABO pada manusia. dari 500 mahasiswa Fakultas Biologi Unsoed diketahui 196 orang bergolongan darah A.160 di antaranya yang dapat merasakan PTC. Hubungan matematika antara fekuensi alel rangkai X dan frekuensi genotipe Homogametik Heterogametik Genotipe AA Aa aa A a Frekuensi genotipe P H Q R S Alel A a A a Frekuensi alel pm = P + ½H qm = Q + ½H pt = R qt = S pm = frekuensi alel A pada individu homogametik qm = frekuensi alel a pada individu homogametik pt = frekuensi alel A pada individu heterogametik qt = frekuensi alel a pada individu heterogametik Untuk seluruh populasi frekuensi alel A dapat dihitung. dan 26 AB. Selanjutnya. Dengan cara yang sama dapat dihitung pula frekuensi alel a pada seluruh populasi. Kontribusi alel sebanyak 2/3 bagian oleh individu homogametik disebabkan oleh keberadaan dua buah kromosom X pada individu tersebut. dari data frekuensi golongan darah (fenotipe) dapat dihitung besarnya frekuensi alel. Dengan mudah dapat diperoleh frekuensi alel t = √ 0. pada jenis kelamin heterogametik formula tersebut tidak berlaku karena frekuensi alel rangkai X benar-benar sama dengan frekuensi genotipe.55) = 0. Misalnya. q. Seperti telah kita bicarakan pada Bab II. Tabel 15.30 = 0. 73 golongan B.2. Banyaknya individu yang bergenotipe TT = 0. Individu yang tidak dapat merasakan PTC (genotipe tt) jumlahnya 228 – 160 = 68 sehingga frekuensi genotipe tt = 68/228 = 0. Alel yang langsung dapat dihitung frekuensinya adalah I0 .45)2 = 0. Pada jenis kelamin homogametik hubungan matematika antara frekuensi alel yang terdapat pada kromosom X (rangkai X) dan frekuensi genotipenya mengikuti formula seperti pada autosom.50 x 228 = 114. yaitu q = 2/3 qm + 1/3 qt = 1/3 (2 qm + qt) = 1/3 (2Q + H + S). yaitu IA. AB. Demikian pula.20 x 228 =46. yaitu p = 2/3 pm + 1/3 pt = 1/3 (2 pm + pt) = 1/3 (2P + H + R).30. Jika TT dijumlahkan dengan Tt. dan I0. sistem ini diatur oleh tiga buah alel. IB. dan r. Dari 160 orang ini dapat dihitung individu yang bergenotipe TT dan Tt sebagai berikut. Sebaliknya.50. Selanjutnya.

dalam suatu populasi terdapat 277 ekor kucing betina berwarna hitam (BB). laju mutasi alel a menjadi A adalah v. peristiwa yang sangat mendasari proses evolusi ini sebenarnya tidak begitu nyata pengaruhnya dalam perubahan frekuensi alel.11.02.16 dan frekuensi genotipe bb (Q) = 7 / (277+54+7) = 0. vqo = upo.12. Sebagai contoh.0. individu-individu mutan biasanya mempunyai daya hidup (viabilitas). maka dikatakan bahwa laju migrasinya 0. yaitu p = 1/3 (2. Hal ini terutama karena laju mutasi yang umumnya terlalu rendah untuk dapat menyebabkan terjadinya perubahan frekuensi alel.89. hubungan antara perubahan frekuensi alel dan laju migrasi dapat dilihat sebagai persamaan berikut ini.12) = 0. 7 betina kuning (bb). yaitu P = 277 / (277+54+7) = 0.16 + 0.kontribusi alel 1/3 bagian karena hanya mempunyai sebuah kromosom X. yaitu R = 311 / (311+42) = 0. Selain itu. yang rendah. yaitu S = 42 / (311+42) = 0. Misalnya. di dalam suatu populasi terdapat alel A dan a. Misalnya.16 + 0. masing-masing dengan frekuensi awal po dan qo. Hal ini berarti bahwa peristiwa migrasi akan menyebabkan terjadinya perubahan frekuensi alel. maka .88) = 0. frekuensi genotipe Bb (H) = 54 / (277+54+7) = 0. sering kali digunakan untuk menjelaskan adanya perbedaan frekuensi alel tertentu di antara berbagai populasi. 311 kucing jantan hitam (B). Lebih jauh. pn – P = (po – P)(1 – m)n pn = frekuensi alel pada populasi yang diamati setelah n generasi migrasi P = frekuensi alel pada populasi migran po = frekuensi alel pada populasi awal (sebelum terjadi migrasi) m = laju migrasi n = jumlah generasi Mutasi Faktor lain yang dapat menyebabkan terjadinya perubahan frekuensi alel adalah mutasi. kuantifikasi migrasi dalam bentuk laju migrasi (lazim dilambangkan sebagai m). perubahan frekuensi alel A akibat mutasi adalah ∆p = vqo – upo. Sebagai contoh perhitungan frekuensi alel rangkai X dapat dikemukakan alel rangkai X yang mengatur warna tortoise shell pada kucing. Sementara itu. sedang perubahan frekuensi alel a akibat mutasi adalah ∆q = upo – vqo. Dari data ini dapat dihitung frekuensi genotipe BB pada populasi kucing betina. atau secara umum vq = up. Dengan demikian.82. Jika persamaan ini dielaborasi. Migrasi Di atas telah disebutkan bahwa migrasi merupakan salah satu syarat yang harus dipenuhi bagi berlakunya hukum keseimbangan Hardy-Weinberg. Dari kenyataan tersebut di atas dapat dimengerti bahwa mutasi hanya akan memberikan pengaruh nyata terhadap perubahan frekuensi alel jika mutasi berlangsung berulang kali (recurrent mutation) dan mutan yang dihasilkan memiliki kemampuan untuk beradaptasi dengan lingkungan yang ada. Sekarang kita dapat menghitung frekuensi alel B pada seluruh populasi.82 + 0. yaitu q = 1/3 (2. Secara matematika. Mutasi berlangsung dari A ke a dengan laju mutasi sebesar u. Sebaliknya. jika pada tiap generasi sebanyak 80 dari 1000 ekor ikan normal digantikan oleh ikan albino. sedang frekuensi genotipe b. Ketika dicapai keseimbangan di antara kedua arah mutasi tersebut nilai ∆p dan ∆q adalah 0.0. Di antara populasi kucing jantan frekuensi genotipe B. dan frekuensi alel b pada seluruh populasi. Oleh karena itu. 54 betina tortoise shell (Bb). misalnya perbedaan frekuensi golongan darah sistem ABO yang terlihat sangat nyata antara ras yang satu dan lainnya.02 + 0. dan juga tingkat kesuburan (fertilitas).08 atau 8%. dan 42 jantan kuning (b). Namun. Laju migrasi dapat didefinisikan sebagai proporsi atau persentase alel tertentu di dalam suatu populasi yang digantikan oleh alel migran pada tiap generasi.88. Hubungan matematika antara laju mutasi dan perubahan frekuensi alel dapat dirumuskan seperti pada contoh berikut ini.

Berbagai kondisi dominansi dilihat dari nilai fitnes relatifnya a) Semi dominansi b) Dominansi parsial c) Dominansi penuh d) Overdominansi Pada kondisi semi dominansi dan dominansi parsial (Gambar 15. nilai fitnes relatif genotipe ini adalah 1 – s. individu heterozigot HbSHbA justru memiliki ketahanan yang lebih tinggi terhadap .2 berikut ini. Kembali kita misalkan bahwa di dalam suatu populasi terdapat genotipe AA. Individu dengan genotipe homozigot HbSHbS akan mengalami pengkristalan molekul hemoglobin. Bahkan pada kondisi overdominansi. Proporsi pengurangan kontribusi genetik suatu genotipe bila dibandingkan dengan kontribusi genetik genotipe baku disebut koefisien seleksi (s) genotipe tersebut. Dengan perkataan lain. Kondisi dominansi ketiga genotipe ini berdasarkan atas nilai fitnes relatifnya dapat dilihat pada Gambar 15. Genotipe superior di dalam suatu populasi.2 c) genotipe ini memberikan kontribusi genetik sama besar dengan kontribusi genotipe AA. Aa. Dominansi heterozigot (kondisi overdominansi) ini dapat dijumpai misalnya pada kasus resistensi individu karier anemia bulan sabit (sickle cell anemia) terhadap penyakit malaria. Nilai fitnes relatif berkisar antara 0 dan 1. atau disebut juga genotipe baku. Proporsi atau persentase kontribusi genetik suatu individu kepada generasi berikutnya dikenal sebagai fitnes relatif atau nilai seleksi individu tersebut. Namun. sehingga individu ini akan menderita anemia berat dan biasanya meninggal pada usia muda. dikatakan memiliki nilai fitnes relatif sama dengan 1. Seleksi Sebegitu jauh kita mengasumsikan bahwa semua individu di dalam populasi akan memberikan kontribusi jumlah keturunan yang sama kepada generasi berikutnya. Individu-individu dapat memberikan kontribusi genetik yang berbeda karena mereka mempunyai daya hidup dan tingkat kesuburan yang berbeda. dan eritrositnya berbentuk seperti bulan sabit. sedang pada kondisi dominansi penuh (Gambar 15. dan aa. Namun. genotipe Aa menjadi genotipe baku dan kontribusi genetiknya justru lebih besar daripada kontribusi genotipe AA.2 a dan b) genotipe Aa memberikan kontribusi genetik yang lebih kecil bila dibandingkan dengan kontribusi genotipe baku (AA). kenyataan yang sebenarnya sering dijumpai tidaklah demikian. aa Aa AA (1-s) (1-½s) 1 a) aa Aa AA (1-s) (1-½s) 1 b) aa AA/Aa (1-s) 1 c) aa AA Aa (1-s2) (1-s1) 1 d) Fitnes relatif Gambar 15.2. sementara untuk genotipe-genotipe lainnya nilai fitnes relatif besarnya kurang dari 1.akan didapatkan p = v/(u + v) dan q = u/(u + v).

genotipe Aa akan berkurang menjadi 1/4 bagian sehingga populasi generasi ketiga akan terdiri atas (1/4+1/8) AA. Pada generasi ketiga genotipe AA dan aa akan bertambah 1/8 bagian yang berasal dari segregasi genotipe Aa pada generasi kedua. 1/4 Aa. Katakanlah generasi pertama suatu populasi tanaman menyerbuk sendiri hanya terdiri atas individu-individu dengan genotipe Aa. maka ∆q = q1 – q = q2(1 – s ) + pq / 1-sq2 – q. sampai dengan generasi ketiga saja sudah terlihat bahwa frekuensi genotipe homozigot. 1/2. sedang silang luar adalah perkawinan di antara individu-individu yang secara genetik tidak memiliki hubungan kekerabatan. Perkawinan asortatif dapat berupa perkawinan asortatif positif atau asortatif negatif (disasortatif). perubahan frekuensi alel dapat dihitung sebagai berikut. Di samping perkawinan asortatif ada pula sistem kawin tidak acak yang tidak memandang fenotipe individu tetapi dilihat dari hubungan genetiknya. Dari rumus hubungan matematika antara frekuensi alel dan frekuensi genotipe dapat dihitung besarnya frekuensi alel a setelah seleksi. pada perkawinan asortatif negatif individu-individu yang mempunyai fenotipe berbeda cenderung untuk lebih sering bertemu bila dibandingkan dengan individu-individu dengan fenotipe yang sama. Dengan demikian. Di tempat-tempat yang menjadi endemi penyakit malaria. ada sistem kawin tidak acak yang dikenal sebagai perkawinan asortatif. Oleh karena terjadi penyerbukan sendiri di antara genotipe Aa. perkawinan asortatif adalah sistem kawin tidak acak yang didasarkan atas fenotipe. Sebaliknya. Sistem Kawin Tidak Acak Faktor lain yang meyebabkan gangguan keseimbangan Hardy-Weinberg adalah sistem kawin tidak acak (non random mating). dan (1/4+1/8) aa atau 3/8 AA. Sebaliknya. Setelah persamaan ini kita elaborasi akan didapatkan ∆q = – sq2( 1 – q) / 1 – sq2. Dengan perkataan lain. genotipe HbSHbA merupakan genotipe baku (fitnes relatif = 1).infeksi parasit penyebab malaria bila dibandingkan dengan individu normal (HbAHbA). Genotipe AA Aa aa Total Frekuensi awal p2 2pq q2 1 Fitnes relatif 1 1 1 – s Kontribusi genetik p2 2pq q2(1 – s ) 1 – sq2 Terlihat bahwa kontribusi genetik total mejadi lebih kecil dari 1 karena genotipe aa mempunyai nilai fitnes relatif 1 – s. Pada kondisi dominansi penuh. perkawinan asortatif negatif dan silang luar akan meningkatkan frekuensi genotipe heterozigot. 1/4 Aa. maka pada generasi kedua dari seluruh populasi akan terdapat genotipe AA. Perubahan frekuensi alel akibat seleksi berlangsung sesuai dengan kondisi dominansi yang ada. sedang individu normal HbAHbA mempunyai nilai fitnes relatif kurang dari 1. 3/8 aa. Untuk kondisi dominansi yang lain besarnya perubahan frekuensi alel akibat seleksi dapat dirumuskan dengan cara seperti di atas. mengalami peningkatan. Jika dilihat dari segi fenotipe. Aa. yaitu silang dalam (inbreeding) dan silang luar (outbreeding). Jika perubahan frekuensi alel a dilambangkan dengan ∆q. Pada perkawinan asortatif positif individu-individu yang mempunyai fenotipe sama cenderung untuk lebih sering bertemu bila dibandingkan dengan individu-individu dengan fenotipe berbeda. Sebaliknya. yaitu q1 = q2(1 – s ) + pq / 1-sq2. dan 1/4 bagian. Silang dalam Contoh silang dalam yang paling ekstrim dapat dilihat pada tanaman yang melakukan penyerbukan sendiri. Sistem kawin semacam ini dapat dibedakan menjadi dua macam. misalnya. Silang dalam adalah perkawinan di antara individu-individu yang secara genetik memiliki hubungan kekerabatan. Genotipe homozigot untuk suatu lokus tertentu – jika kita berbicara individu normal diploid – . sedang frekuensi heterozigot Aa berkurang. dan aa masing-masing sebanyak 1/4. Perkawinan asortatif positif dan silang dalam akan meningkatkan frekuensi genotipe homozigot. baik AA maupun aa.

dan aa masing-masing menjadi p.usul yang sama atau merupakan hasil kawin acak.3. sedang individu heterozigot tidak . A B * Hitung jumlah loop. Gambar 15. Aa. Peningkatan homozigositas akibat silang dalam dapat menimbulkan tekanan silang dalam (inbreeding depression) apabila di antara alel-alel identik yang bertemu terdapat sejumlah alel resesif yang kurang menguntungkan. Dua alel semacam ini dikatakan sebagai alel serupa (alike in state). Pertama. Frekuensi genotipe hasil kawin acak dan silang dalam Genotipe Frekuensi Kawin acak Silang dalam AA p2 p2 (1 – F) + pF Aa 2 pq 2 pq (1 – F) aa q2 q2 (1 – F) + qF Jika nilai F = 0. Jika nilai F = 1. individu A kawin dengan B menghasilkan dua anak. mereka secara fungsional sama sehingga menghasilkan fenotipe yang sama pula. Loop adalah jalan yang menghubungkan kedua orang tua C D X (C dan D) melewati leluhur bersama (A dan B). Perubahan frekuensi alel yang disebabkan oleh terjadinya silang dalam dapat dihitung dari perubahan frekuensi genotipe seperti pada Tabel 15. 2 pq. Sebaliknya. Tabel 15. kakak beradik C dan D kawin. Hal ini berarti bahwa peluang bertemunya alel-alel identik yang berasal dari leluhur bersama.3. yaitu C dan D.mempunyai dua buah alel yang sama pada lokus tersebut. pembuahan sendiri dapat mencapai homozigositas 100% pada generasi keenam. Jika hal ini yang terjadi. mempunyai anak X. maka frekuensi genotipe AA.3. dan biasanya dilambangkan dengan F. nilai F individu X (FX) pada contoh soal tersebut di atas adalah (½)3(1 + 0) + (½)3(1 + 0) = ¼. 0. Nilai F sama dengan 0 apabila kedua alel pada individu homozigot tidak mempunyai asal. dan q. Hal ini berarti di dalam populasi hanya tinggal individu homozigot. baik pada loop CAD maupun CBD) FA = koefisien silang dalam leluhur bersama (pada soal ini FA dan FB masing-masing sama dengan 0 karena dianggap sebagai individu hasil kawin acak) Dengan demikian. pada individu X besarnya ¼. Makin besar nilai F. maka frekuensi genotipe AA. Pada soal ini terdapat dua X loop. dan aa masing-masing adalah p2. mereka berasal dari hasil replikasi sebuah alel pada generasi sebelumnya. nilai F sama dengan 1 apabila kedua alel sepenuhnya merupakan alel identik atau berasal dari leluhur bersama (common ancestor) yang sangat dekat.3. dan q2 . Besarnya nilai F dapat dihitung dari diagram silsilah seperti contoh pada Gambar 15. Misalnya. Untuk menggambarkan besarnya peluang bahwa dua buah alel yang sama pada individu homozigot merupakan alel identik digunakan suatu nilai yang disebut sebagai koefisien silang dalam (inbreeding coefficient). yaitu CAD dan CBD. Nilai ini besarnya berkisar dari 0 hingga 1. Kemungkinan kedua.Contoh diagram silsilah *Hitung jumlah individu yang terdapat pada tiap loop sebagai nilai n. Sebagai gambaran. sementara perkawinan antara saudara kandung baru mencapainya pada generasi keenam belas. Frekuensi tersebut ternyata sama dengan frekuensi genotipe hasil kawin acak. * Hitung nilai F dengan rumus : F = Σ (½)n(1 + FA) n = jumlah individu yang terdapat pada tiap loop (pada soal ini terdapat 3 individu. baik A maupun B. Persamaan di antara dua alel pada genotipe homozigot dapat terjadi dengan dua kemungkinan. makin cepat diperoleh tingkat homozigositas yang tinggi. Koefisien silang dalam individu X dapat dihitung sebagai berikut. Aa. maka kedua alel tersebut dikatakan seasal atau identik (identical by descent). Selanjutnya.

jika silang dalam dapat menyebabkan terjadinya tekanan silang dalam yang berpengaruh buruk terhadap individu yang dihasilkan. akan menciptakan variasi genetik yang berguna untuk mengantisipasi perubahan kondisi lingkungan yang sewaktu- . antara lain untuk merakit varietas jagung hibrida. sebagai tetua betina dapat digunakan baik hibrid H maupun hibrid I karena kedua-duanya mempunyai tongkol yang besar. Di samping itu. Namun. Agak berbeda dengan silang tiga arah. jagung hibrida yang dipasarkan biasanya bukan hasil silang tunggal (single cross) seperti itu. pada silang ganda hibrid H disilangkan dengan hibrid I hasil silang tunggal antara galur murni C dan D. ada alel A yang menyebabkan akar tanaman tumbuh kuat sementara alel a menjadikan akar tanaman lemah. silang luar akan meningkatkan frekuensi heterozigot. Peristiwa mutasi atau perubahan materi genetik. di samping segregasi dan rekombinasi. Ada beberapa teori mengenai mekanisme genetik yang menjelaskan terjadinya heterosis. Fenomena keunggulan yang diperlihatkan oleh individu hibrid hasil persilangan dua tetua galur murni (homozigot) disebut sebagai vigor hibrida atau heterosis.dijumpai lagi. Sementara itu. maka jumlah bijinya menjadi sedikit dan tidak cukup untuk dijual kepada petani. batang kuat) akan menghasilkan hibrid AaBb yang mempunyai akar dan batang kuat. Misalnya. Fenomena heterosis sudah sering sekali dimanfaatkan pada bidang pemuliaan tanaman. Persilangan antara galur murni AAbb (akar kuat. yang agar dapat melaksanakannya materi genetik harus mempunyai kemampuan untuk melakukan mutasi. sedang alel b menyebabkan batang lemah. melainkan hasil silang tiga arah (three-way cross) atau silang ganda (double cross). Galur murni A disilangkan dengan galur murni B. mendapatkan hibrid H. MUTASI Fungsi ketiga materi genetik adalah fungsi evolusi. yang pada prinsipnya menyebutkan bahwa alel-alel reseif merugikan yang dibawa oleh masing-masing galur murni akan tertutupi oleh alel dominan pada individu hibrid yang heterozigot. Pada silang tiga arah hibrid H digunakan sebagai tetua betina untuk disilangkan lagi dengan galur murni lain sehingga biji hibrid yang dihasilkan akan dibawa oleh tongkol hibrid H yang ukurannya besar. karena biji hibrid H ini dibawa oleh tongkol tetuanya (A atau B) yang kecil. batang lemah) dan aaBB (akar lemah. Oleh karena itu. 11/03/2009 Posted by zaifbio | Genetika Dasar | 2 Komentar MUTASI BAB XI MUTASI • Pengertian Mutasi • Mekanisme Molekuler Mutasi • Mutasi Spontan dan Mutasi Induksi • Estimasi Laju Mutasi Spontan dengan Metode Clb • Mutagen Kimia dan Fisika • Mekanisme Perbaikan DNA • Mutasi Balik dan Mutasi Penekan • Uji Ames BAB XI. Silang luar Berkebalikan dengan silang dalam. alel B menyebabkan batang menjadi kokoh. silang luar justru dapat memunculkan individu hibrid dengan sifat-sifat yang lebih baik daripada kedua tetuanya yang homozigot. Salah satu di antaranya adalah teori dominansi. Dalam silang ganda ini.

digantikan atau disubstitusi oleh valin. Mutasi yang terjadi pada sebuah atau sepasang basa pada DNA disebut sebagai mutasi titik (point mutation). ada tidaknya pengaruh substitusi suatu asam amino terhadap perubahan sifat protein bergantung kepada peran asam amino tersebut dalam struktur dan fungsi protein. Hemoglobin penderita anemia bulan sabit akan mengalami kristalisasi ketika tidak bereaksi dengan oksigen sehingga akan mengendap di pembuluh darah dan menyumbatnya. Akan tetapi. mengakibatkan perubahan struktur hemoglobin dan juga eritrosit yang membawanya. substitusi asam amino yang tidak menghasilkan perubahan sifat protein atau perubahan fenotipik pun dapat dikatakan sebagai mutasi tenang. Mekanisme Molekuler Mutasi Meskipun tidak selalu. pada organisme diploid pengaruh mutasi juga bergantung kepada dominansi alel. Pengaruh fenotipik yang ditimbulkan oleh mutasi sangat bervariasi. perubahan urutan asam amino tidak selalu menyebabkan perubahan sifat-sifat biologi protein atau menghasilkan fenotipe mutan. Namun. perubahan sebuah basa pada DNA tidak selamanya disertai oleh substitusi asam amino karena sebuah asam amino dapat disandi oleh lebih dari sebuah triplet kodon (lihat Bab X). mulai dari perubahan kecil yang hanya dapat dideteksi melalui analisis biokimia hingga perubahan pada prosesproses esensial yang dapat mengakibatkan kematian sel atau bahkan organisme yang mengalaminya. Alel-alel hasil mutasi somatis tidak akan diwariskan kepada keturunan individu yang mengalaminya karena mutasi ini tidak mempengaruhi sel-sel germinal. Dalam hal ini. Mutasi somatis akan menyebabkan terbentuknya khimera. yaitu (1) substitusi basa dan (2) perubahan rangka baca akibat adanya penambahan basa (adisi) atau kehilangan . Demikian juga. yang bermuatan negatif. Kita mengenal berbagai macam peristiwa mutasi sesuai dengan kriteria yang digunakan untuk mengelompokkannya. Substitusi asam glutamat. Jadi. pada penderita anemia bulan sabit (sickle cell anemia) salah satu asam amino pada polipeptida β. alel mutan resesif tidak akan memunculkan pengaruh fenotipik selama berada di dalam individu heterozigot karena tertutupi oleh alel dominannya yang normal. Mekanisme terjadinya mutasi titik ini ada dua macam. Namun. oleh valin. Contoh yang paling sering dikemukakan adalah perubahan sifat biologi yang terjadi pada molekul hemoglobin. sedangkan mutasi somatis terjadi pada sel-sel selain sel germinal. Hemoglobin pada individu dewasa normal terdiri atas dua rantai polipeptida α yang identik dan dua rantai polipeptida β yang identik juga. Hal ini karena pelipatan rantai polipeptida sebagai penentu struktur tiga dimensi molekul protein sangat bergantung kepada interaksi di antara asam-asam amino dengan muatan yang berlawanan. Seperti dikatakan di atas. Perubahan atau mutasi basa pada DNA yang tidak menyebabkan substitusi asam amino atau tidak memberikan pengaruh fenotipik dinamakan mutasi tenang (silent mutation). yaitu individu dengan jaringan normal dan jaringan yang terdiri atas sel-sel somatis mutan. misalnya substitusi histidin oleh lisin. eritrositnya menjadi lonjong dan mudah pecah. Setiap perubahan asam amino disebabkan oleh perubahan urutan basa nukleotida pada molekul DNA. Selain itu. yang tidak bermuatan atau netral. perubahan urutan asam amino pada suatu protein dapat menyebabkan perubahan sifat-sifat biologi protein tersebut. yakni asam glutamat. Mutasi germinal terjadi pada sel-sel germinal atau sel-sel penghasil gamet. Pada organisme multiseluler dapat dibedakan antara mutasi germinal dan mutasi somatis. Substitusi sebuah asam amino oleh asam amino lain yang muatannya sama. sering kali tidak berpengaruh terhadap struktur molekul protein atau fenotipe individu. Pada tanaman tingkat tinggi mutasi somatis justru sering kali menghasilkan varietas-varietas yang diinginkan dan untuk perbanyakannya harus dilakukan secara vegetatif.waktu dapat terjadi. Jenis sel dan tahap perkembangan individu menentukan besar kecilnya pengaruh mutasi.

basa (delesi). Mutasi titik yang disebabkan oleh substitusi basa dinamakan mutasi substitusi basa, sedangkan mutasi yang terjadi karena perubahan rangka baca dinamakan mutasi rangka baca (frameshift mutation) seperti telah disinggung pada Bab X. Apabila substitusi basa menyebabkan substitusi asam amino seperti pada kasus hemoglobin anemia bulan sabit, maka mutasinya dinamakan mutasi salah makna (missense mutation). Sementara itu, jika substitusi basa menghasilkan kodon stop, misalnya UAU (tirosin) menjadi UAG (stop), maka mutasinya dinamakan mutasi tanpa makna (nonsense mutation) atau mutasi terminasi rantai (chain termination mutation). Substitusi basa pada sebuah triplet kodon dapat menghasilkan sembilan kemungkinan perubahan triplet kodon karena tiap basa mempunyai tiga kemungkinan substitusi. Sebagai contoh, kodon UAU dapat mengalami substitusi basa menjadi AAU (asparagin), GAU (asam aspartat), CAU (histidin), UUU (fenilalanin), UGU (sistein), UCU (serin), UAA (stop), UAG (stop), dan UAC (tirosin). Kita bisa melihat bahwa perubahan yang terakhir, yakni UAC, tidak menghasilkan substitusi asam amino karena baik UAC maupun UAU menyandi asam amino tirosin. Mutasi substitusi basa dapat dibedakan menjadi dua kelompok, yaitu transisi dan transversi. Pada transisi terjadi substitusi basa purin oleh purin atau substitusi pirimidin oleh pirimidin, sedangkan pada transversi terjadi substitusi purin oleh pirimidin atau pirimidin oleh purin. Secara skema kedua macam substitusi basa tersebut dapat dilihat pada Gambar 11.1. A TC G Gambar 11.1. Skema substitusi basa nukleotida transisi transversi Sementara itu, mutasi rangka baca akan mengakibatkan perubahan rangka baca semua triplet kodon di belakang tempat terjadinya mutasi tersebut. Akan tetapi, adisi atau pun delesi sebanyak kelipatan tiga basa pada umumnya tidak akan menimbulkan pengaruh fenotipik mutasi rangka baca. Demikian pula, seperti dikatakan pada Bab X adisi satu basa yang diimbangi oleh delesi satu basa di tempat lain, atau sebaliknya, akan memperbaiki kembali rangka baca di belakang tempat tersebut. Selain itu, apabila adisi atau delesi terjadi pada daerah yang sangat dekat dengan ujung karboksil suatu protein, maka mutasi rangka baca yang ditimbulkannya tidak akan menyebabkan sintesis protein nonfungsional. Dengan perkataan lain, mutasi tidak memberikan pengaruh fenotipik. Mutasi Spontan Perubahan urutan basa nukleotida berlangsung spontan dan acak. Tidak ada satu pun cara yang dapat digunakan untuk memprediksi saat dan tempat akan terjadinya suatu mutasi. Meskipun demikian, setiap gen dapat dipastikan mengalami mutasi dengan laju tertentu sehingga memungkinkan untuk ditetapkan peluang mutasinya. Artinya, kita dapat menentukan besarnya peluang bagi suatu gen untuk bermutasi sehingga besarnya peluang untuk mendapatkan suatu alel mutan dari gen tersebut di dalam populasi juga dapat dihitung. Terjadinya suatu peristiwa mutasi tidak dapat dikatakan sebagai hasil adaptasi sel atau organisme terhadap kondisi lingkungannya. Kebanyakan mutasi memperlihatkan pengaruh yang sangat bervariasi terhadap tingkat kemampuan adaptasi sel atau organisme, mulai dari netral (sangat adaptable) hingga letal (tidak adaptable). Oleh karena itu, tidak ada korelasi yang nyata antara mutasi dan adaptasi. Namun, pemikiran bahwa mutasi tidak ada sangkut pautnya dengan adaptasi tidak diterima oleh sebagian besar ahli biologi hingga akhir tahun 1940-an ketika Joshua dan Esther Lederberg melalui percobaannya pada bakteri

membuktikan bahwa mutasi bukanlah hasil adaptasi. Dengan teknik yang dinamakan replica plating koloni-koloni bakteri pada kultur awal (master plate) dipindahkan ke medium baru (replica plate) menggunakan velvet steril sehingga posisi setiap koloni pada medium baru akan sama dengan posisinya masing-masing pada kultur awal. Medium baru dibuat dua macam, yaitu medium nonselektif seperti pada kultur awal dan medium selektif yang mengandung lebih kurang 109 fag T1. Hanya koloni-koloni mutan yang resisten terhadap infeksi fag T1 (mutan T1-r) yang dapat tumbuh pada medium selektif ini. Dari percobaan tersebut terlihat bahwa koloni-koloni mutan T1-r yang tumbuh pada medium selektif tidak terbentuk sebagai hasil adaptasi terhadap kehadiran fag T1, tetapi sebenarnya sudah ada semenjak pada kultur awal. Dengan demikian, teknik selektif semacam itu hanya akan menyeleksi mutan-mutan yang telah ada sebelumnya di dalam suatu populasi. master plate transfer replica plate replica plate (medium nonselektif) (medium selektif) Gambar 11.2. Percobaan transfer koloni (replica plating) = koloni mutan T1-r Teknik selektif seperti yang diuraikan di atas memberikan dasar bagi pemahaman tentang munculnya resistensi berbagai populasi hama dan penyakit terhadap senyawa kimia yang digunakan untuk mengendalikannya. Sebagai contoh, sejumlah populasi lalat rumah saat ini nampak sangat resisten terhadap insektisida DDT. Hal ini menunjukkan betapa seleksi telah memunculkan populasi lalat rumah dengan kombinasi mekanisme enzimatik, anatomi, dan perilaku untuk dapat resisten terhadap atau menghindari bahan kimia tersebut. Begitu pula, gejala peningkatan resistensi terhadap antibiotik yang diperlihatkan oleh berbagai macam bakteri penyebab penyakit pada manusia tidak lain merupakan akibat proses seleksi untuk memunculkan dominansi strain-strain mutan tahan antibiotik yang sebenarnya memang telah ada sebelumnya. Laju mutasi Laju mutasi adalah peluang terjadinya mutasi pada sebuah gen dalam satu generasi atau dalam pembentukan satu gamet. Pengukuran laju mutasi penting untuk dilakukan di dalam genetika populasi, studi evolusi, dan analisis pengaruh mutagen lingkungan. Mutasi spontan biasanya merupakan peristiwa yang sangat jarang terjadi sehingga untuk memperkirakan peluang kejadiannya diperlukan populasi yang sangat besar dengan teknik tertentu. Salah satu teknik yang telah digunakan untuk mengukur laju mutasi adalah metode ClB yang ditemukan oleh Herman Muller. Metode ClB mengacu kepada suatu kromosom X lalat Drosophila melanogaster yang memiliki sifat-sifat tertentu. Teknik ini dirancang untuk mendeteksi mutasi yang terjadi pada kromosom X normal. Kromosom X pada metode ClB mempunyai tiga ciri penting, yaitu (1) inversi yang sangat besar (C), yang menghalangi terjadinya pindah silang pada individu betina heterozigot; (2) letal resesif (l); dan (3) marker dominan Bar (B) yang menjadikan mata sempit (lihat Bab VII). Dengan adanya letal resesif, individu jantan dengan kromosom tersebut dan individu betina homozigot tidak akan bertahan hidup. Persilangan pertama dilakukan antara betina heterozigot untuk kromosom ClB dan jantan dengan kromosom X normal. Di antara keturunan yang diperoleh, dipilih individu betina yang mempunyai mata Bar untuk selanjutnya pada persilangan kedua dikawinkan dengan jantan normal. Individu betina dengan mata Bar ini jelas mempunyai genotipe heterozigot

karena menerima kromosom ClB dari tetua betina dan kromosom X normal dari tetua jantannya. Hasil persilangan kedua yang diharapkan adalah dua betina berbanding dengan satu jantan. Ada tidaknya individu jantan hasil persilangan kedua ini digunakan untuk mengestimasi laju mutasi letal resesif. Oleh karena pindah silang pada kromosom X dihalangi oleh adanya inversi (C) pada individu betina, maka semua individu jantan hasil persilangan hanya akan mempunyai genotipe + . Kromosom X pada individu jantan ini berasal dari tetua jantan awal (persilangan pertama). Sementara itu, individu jantan dengan kromosom X ClB selalu mengalami kematian. Meskipun demikian, kadang-kadang pada persilangan kedua tidak diperoleh individu jantan sama sekali. Artinya, individu jantan yang mati tidak hanya yang membawa kromosom ClB, tetapi juga individu yang membawa kromosom X dari tetua jantan awal. Jika hal ini terjadi, kita dapat menyimpulkan bahwa kromosom X pada tetua jantan awal yang semula normal berubah atau bermutasi menjadi kromosom X dengan letal resesif. Dengan menghitung frekuensi terjadinya kematian pada individu jantan yang seharusnya hidup ini, dapat dilakukan estimasi kuantitatif terhadap laju mutasi yang menyebabkan terbentuknya alel letal resesif pada kromosom X. Ternyata, lebih kurang 0,15% kromosom X terlihat mengalami mutasi semacam itu selama spermatogenesis, yang berarti bahwa laju mutasi untuk mendapatkan letal resesif per kromosom X per gamet adalah 1,5 x 10-3. betina Bar ClB + jantan normal ClB ? + ? ClB + letal betina Bar (dipilih untuk disilangkan dengan jantan normal) ClB ? + ClB + ? + ClB ? letal letal jika X-nya membawa letal resesif Gambar 11.3. Metode ClB untuk mengestimasi laju mutasi = kromosom X yang berasal dari tetua jantan pada persilangan pertama Pada metode ClB tidak diketahui laju mutasi gen tertentu karena kita tidak dapat memastikan banyaknya gen pada kromosom X yang apabila mengalami mutasi akan berubah menjadi alel resesif yang mematikan. Namun, semenjak ditemukannya metode ClB berkembang pula sejumlah metode lain untuk mengestimasi laju mutasi pada berbagai organisme. Hasilnya menunjukkan bahwa laju mutasi sangat bervariasi antara gen yang satu dan lainnya. Sebagai contoh, laju mutasi untuk terbentuknya tubuh berwarna kuning pada Drosophila adalah 10-4 per gamet per generasi, sementara laju mutasi untuk terbentuknya resitensi terhadap streptomisin pada E. coli adalah 10-9 per sel per generasi. Asal-mula terjadinya mutasi spontan Ada tiga mekanisme yang paling penting pada mutasi spontan, yaitu (1) kesalahan selama replikasi, (2) perubahan basa nukleotida secara spontan, dan (3) peristiwa-peristiwa yang berkaitan dengan penyisipan (insersi) dan pemotongan (eksisi) unsur-unsur yang dapat

Sitosin yang seharusnya berpasangan dengan guanin berubah menjadi timin yang berpasangan dengan adenin sehingga terjadilah mutasi transisi (purin menjadi purin. Pada Bab IX telah kita bicarakan bahwa enzim Pol I dan Pol III adakalanya membuat kesalahan dengan menyisipkan basa yang salah ketika replikasi DNA sedang berlangsung. Selanjutnya. Namun. Kadang-kadang ada juga kesalahan pasangan basa yang tidak dikenalinya. Bukti pertama bahwa agen eksternal dapat meningkatkan laju mutasi diperoleh dari penelitian H. Mutasi Induksi Laju mutasi spontan yang sangat rendah ternyata dapat ditingkatkan dengan aplikasi berbagai agen eksternal. Jika hal ini terjadi.4. Pada saat penggabungan berlangsung. ada sistem lain yang berfungsi dalam perbaikan kesalahan replikasi DNA. seperti halnya mekanisme penyuntingan oleh DNA polimerase. 5’ GAGTCGAATC 3’ untai cetakan 3’ CTCAGTTTAG 5’ untai baru GAGTCGAATC CTC AG AGTTT segmen dengan perbaikan eksisi basa yang salah GAGTCGAATC CTCAGCTTAG untai yang telah diperbaiki Gambar 11. Aktivitas penyuntingan oleh DNA polimerase boleh dikatakan sangat efisien meskipun tidak berarti sempurna benar. Sistem perbaikan salah pasangan. Agen yang dapat menyebabkan terjadinya mutasi seperti sinar X ini dinamakan mutagen. Dalam hal ini hilangnya gugus amino dari sitosin yang telah termetilasi tidak dapat dikenali oleh sistem perbaikan salah pasangan. Muller pada tahun 1927 yang memperlihatkan bahwa sinar X dapat menyebabkan mutasi pada Drosophila. Mutasi dengan laju yang ditingkatkan ini dinamakan mutasi induksi. segmen DNA yang membawa basa yang salah dibuang sehingga terdapat celah (gap) di dalam untai DNA. Mekanisme perbaikan salah pasangan Basa-basa tautomerik adakalanya dapat tergabung dengan benar ke dalam molekul DNA. . Akan tetapi. tidaklah sempurna sama sekali. dengan bantuan enzim Pol I celah ini akan diisi oleh segmen baru yang membawa basa yang telah diperbaiki. Sistem ini dikenal sebagai sistem perbaikan salah pasangan (mismatch repair). jika segmen yang membawa kesalahan basa tersebut telah mengalami metilasi. maka sistem perbaikan salah pasangan tidak dapat membedakan antara untai cetakan dan untai baru. basa tersebut akan membentuk ikatan hidrogen yang benar dengan basa pada untai DNA cetakan sehingga fungsi penyuntingan oleh DNA polimerase tidak dapat mengenalinya. Caranya. timbullah mutasi spontan. Sumber mutasi spontan lainnya adalah perubahan basa sitosin yang telah termetilasi menjadi timin karena hilangnya gugus amino. tetapi mengenali kesalahan basa di dalam untai DNA. pirimidin menjadi pirimidin). enzim-enzim DNA polimerase ini juga diketahui mempunyai kemampuan untuk memperbaiki kesalahan (proof reading) melalui aktivitas eksonukleasenya dengan cara memotong basa yang salah pada ujung 3’ untai DNA yang sedang dipolimerisasi. Hal ini akan menimbulkan mutasi spontan. Sistem perbaikan salah pasangan akan mengoreksi kesalahan semacam itu. Berbeda dengan sistem penyuntingan oleh DNA polimerase. dan basa timin yang seharusnya sitosin tersebut tidak dilihat sebagai basa yang salah.berpindah (transposable elements). Kadang-kadang suatu kesalahan replikasi luput dari mekanisme penyuntingan tersebut. Akan tetapi. sistem perbaikan salah pasangan tidak bekerja pada ujung 3’ untai DNA yang sedang tumbuh.

BU sebagai basa yang analog dengan timin juga dapat menghambat sintesis dCTP. Hal ini karena suatu basa analog dapat berpasangan dengan basa tertentu pada untai DNA cetakan. Namun. Dengan mutagen-mutagen ini dapat diperoleh bermacam-macam mutan pada beberapa spesies organisme. yaitu keto dan enol sehingga dapat membentuk ikatan hidrogen dengan dua macam cara. bisa juga masuknya sebuah basa analog terkoreksi melalui mekanisme penyuntingan oleh enzim DNA polimerase. akan meningkat. Mekanisme penyuntingan dan perbaikan salah pasangan sebenarnya dapat membuang basa timin yang salah berpasangan dengan guanin tersebut. Sementara itu. Konsentrasi deoksinukleosida trifofat (dNTP) di dalam sel pada umumnya diatur oleh konsentrasi deoksitimidin trifosfat (dTTP). BU telah menginduksi mutasi tautomerik berupa transisi GC menjadi AT. dan pada putaran replikasi berikutnya. jika BU berada dalam bentuk enol. Akan tetapi. berbagai mutagen fisika dan kimia digunakan untuk meningkatkan laju mutasi. Basa ini analog dengan basa timin karena hanya berbeda pada posisi gugus metil yang diganti dengan atom bromium. A=T substitusi T oleh BU (keto) A=BU replikasi 1 A=T G=BU pengikatan G oleh BU (enol) replikasi 2 A=T A=T G=C A=BU transisi Gambar 11. yang seharusnya GC.Semenjak penemuan Muller tersebut. Sebagai contoh. maka basa analog ini dikatakan bersifat mutagenik. Percobaan-percobaan berikutnya menunjukkan bahwa mekanisme mutagenesis BU dapat terjadi dengan cara lain. Dengan perkataan lain. maka dTTP akan disintesis dalam jumlah normal tetapi sintesis dCTP akan sangat terhambat. Pada putaran replikasi berikutnya basa timin pada pasangan GT akan berpasangan dengan adenin sehingga posisi yang seharusnya ditempati oleh GC sekarang diganti dengan AT. keberadaan BU ternyata menyebabkan laju perbaikan menjadi tertinggal oleh laju salah pasangan. Penggantian ini belum dapat dikatakan sebagai peristiwa mutasi. Jika BU ditambahkan ke dalam medium pertumbuhan. nisbah dTTP terhadap dCTP menjadi sangat tinggi dan frekuensi salah pasangan GT. maka akan terjadi hambatan dalam sintesis dCTP.5. Akan tetapi. molekul DNA yang baru akan mempunyai pasangan basa GC pada posisi yang seharusnya ditempati oleh pasangan basa AT. Apabila suatu basa analog dapat membentuk ikatan hidrogen dengan dua macam cara. Jika sel yang akan dimutasi ditumbuhkan pada medium yang mengandung BU dalam bentuk keto. dapat mempunyai dua macam bentuk. Artinya. maka BU akan berpasangan dengan guanin (GBU). basa 5-bromourasil (BU) yang diketahui mudah sekali bergabung dengan DNA bakteri dan virus. mutagen kimia dapat mengakibatkan mutasi pada DNA baik yang sedang . konsentrasi dTTP akan menentukan konsentrasi ketiga dNTP lainnya untuk keperluan sintesis DNA. Apabila suatu saat dTTP terdapat dalam jumlah yang sangat berlebihan. maka selama replikasi DNA adakalanya timin digantikan oleh BU sehingga pasangan basa AT berubah menjadi ABU. Mutasi tautomerik (transisi) akibat basa analog 5-bromourasil Mutagen-mutagen kimia Berbeda dengan basa analog yang hanya bersifat mutagenik ketika DNA sedang melakukan replikasi. telah terjadi mutasi tautomerik berupa transisi dari AT ke GC (Gambar 11.5). Dengan demikian. Akibatnya. Basa analog Basa analog merupakan senyawa kimia yang struktur molekulnya sangat menyerupai basa nukleotida DNA sehingga dapat menjadi bagian yang menyatu di dalam molekul DNA selama berlangsungnya replikasi normal.

mutasi yang ditimbulkan bukanlah mutasi tautomerik. memiliki struktur molekul berupa tiga cincin sehingga sangat menyerupai pasangan basa purin – pirimidin atau pirimidin – purin. misalnya asam nitros (HNO2). maka untai DNA hasil replikasi akan ada yang mengalami adisi dan ada yang mengalami delesi pada posisi terjadinya interkalasi. Agen alkilasi etilmetan sulfonat (EMS) dan mustard nitrogen merupakan mutagen-mutagen kimia yang banyak digunakan dalam penelitian genetika. dan guanin menjadi gugus keto (=O) sehingga spesifisitas pengikatan hidrogen pada basa-basa tersebut juga mengalami perubahan. O CH2 – CH2 – Cl CH3 – CH2 – O – S – CH3 HN O CH2 – CH2 – Cl etilmetan sulfonat mustard nitrogen Gambar 11. maka agen-agen alkilasi sangat efektif untuk digunakan pada sistem eukariot. memberikan pengaruh dengan spektrum yang luas.6. akridin dapat menyisip di antara dua pasangan basa yang berdekatan pada molekul DNA.bereplikasi maupun yang tidak sedang bereplikasi. beberapa lainnya. menimbulkan perubahan yang sangat khas. Dengan struktur yang sangat menyerupai sebuah pasangan basa. HNO2 bekerja sebagai mutagen dengan mengubah gugus amino (NH2) pada basa adenin. misalnya agen-agen alkilasi. Pengaruh interkalasi terhadap molekul DNA adalah terjadinya perenggangan jarak antara dua pasangan basa yang berurutan. yang salah satu contohnya adalah proflavin (Bab X). maka replikasi akan terhenti tepat di depan celah dan kemudian dimulai lagi dengan menyisipkan basa adenin pada posisi yang komplementer dengan celah tersebut. Kedua-duanya akan memberikan gugus etil (C2H5) atau sejenisnya kepada basa DNA. Oleh karena itu pada posisi celah tersebut terjadi perubahan dari GC menjadi TA atau purin-pirimidin menjadi pirimidin-purin. Jika HNO2 terbukti sangat bermanfaat pada sistem prokariot. Interkalasi Senyawa kimia akridin. sitosin. Struktur molekul dua agen alkilasi yang umum digunakan Fenomena lain yang dapat muncul akibat terjadinya alkilasi guanin adalah depurinasi. Dengan mekanisme serupa. Besarnya perenggangan sama dengan tebal molekul akridin. Pengaruh ini disebabkan oleh terjadinya perubahan kimia pada . deaminasi sitosin yang menghasilkan urasil akan mengakibatkan transisi GC menjadi AT melalui AU. Depurinasi tidak selalu bersifat mutagenik karena celah yang terbentuk dengan hilangnya basa purin tadi dapat segera diperbaiki. Selain itu. yaitu hilangnya basa purin yang telah mengalami alkilasi tersebut dari molekul DNA karena patahnya ikatan yang menghubungkannya dengan gula deoksiribosa. Namun. yang berpasangan dengan sitosin. setelah replikasi basa adenin di posisi celah tersebut akan berpasangan dengan timin atau terjadi pasangan TA. Akibatnya. Alkilasi pada basa G atau T akan menyebabkan terjadinya salah pasangan yang mengarah kepada transisi AT→ GC dan GC → AT. Beberapa di antara mutagen kimia. Apabila DNA yang membawa akridin tadi melakukan replikasi. Iradiasi ultraviolet Sinar ultraviolet (UV) dapat menghasilkan pengaruh. EMS dapat juga bereaksi dengan A dan C. melainkan mutasi rangka baca. Deaminasi adenin akan menghasilkan hipoksantin (H). Dengan demikian. Jika hal ini terjadi. Padahal seharusnya pasangan basa pada posisi celah tersebut adalah GC (bukankah yang hilang adalah G?). Akan tetapi. garpu replikasi sering kali terlebih dahulu telah mencapai celah tersebut sebelum perbaikan sempat dilakukan. Hal ini mengakibatkan terjadinya transisi AT menjadi GC melaui HC. baik letal maupun mutagenik. Peristiwa penyisipan semacam ini dinamakan interkalasi. pada semua jenis virus dan sel. Perubahan ini tidak lain merupakan mutasi tautomerik jenis transversi.

Ketika DNA polimerase sampai pada suatu dimer. baik ketika ada cahaya maupun tidak ada cahaya. Dengan adanya timin dimer. Pada celah yang terbentuk akibat pemotongan tersebut segera terjadi sintesis segmen baru dengan urutan basa yang benar. Fotoreaktivasi Mekanisme perbaikan ini bergantung kepada cahaya. Untuk jelasnya.c). Pembuangan segmen ini kemudian diikuti oleh sintesis segmen baru yang akan menggantikannya dengan bantuan enzim DNA polimerase I. segmen yang baru tersebut diligasi dengan untai DNA sehingga untai DNA ini sekarang tidak lagi membawa dimer. DNA yang membawa dimer pada kedua untainya melakukan replikasi (Gambar 11. untai DNA hasil polimerisasi akan mempunyai celah pada posisi dimer. Pada mekanisme pertama.a) sehingga pada waktu garpu replikasi mencapai dimer akan terbentuk celah pada kedua untai DNA yang baru (Gambar 11. Akibatnya. sekarang kedua untai DNA cetakan selain membawa dimer juga mempunyai celah. perbaikan kerusakan DNA dengan cara rekombinasi terjadi setelah replikasi berlangsung. Eksisi Perbaikan dengan cara eksisi merupakan proses enzimatik bertahap yang diawali dengan pembuangan dimer dari molekul DNA. Akhirnya. Oleh karena itu. Akibatnya. Akan tetapi. Rekombinasi Berbeda dengan dua mekanisme yang telah dijelaskan sebelumnya. segmen yang membawa dimer akan terlepas dari untai DNA. dan SOS. maka polimerisasi akan terhenti sejenak untuk kemudian dimulai lagi dari posisi setelah dimer. mekanisme ini sering juga dikatakan sebagai rekombinasi pascareplikasi. Mekanisme rekombinasi pada prinsipnya merupakan cara untuk menutup celah tersebut menggunakan segmen yang sesuai pada untai DNA cetakan yang membawa dimer.basa DNA akibat absorpsi energi dari sinar tersebut. Ada dua mekanisme eksisi yang agak berbeda. Seperti pada mekanisme yang pertama. Pengaruh terbesar yang ditimbulkan oleh iradiasi sinar UV adalah terbentuknya pirimidin dimer. rekombinasi. Namun.d). Pada mekanisme yang kedua pemotongan mula-mula hanya terjadi pada satu tempat.8. Akibatnya. yaitu saling terikatnya dua molekul timin yang berurutan pada sebuah untai DNA. Hasilnya berupa . yakni di sekitar dimer. aktivasinya memerlukan spektrum biru cahaya sehingga enzim tersebut hanya bisa bekerja apabila ada cahaya. eksisi. yaitu fotoreaktivasi. Celah akan diisi oleh segmen yang sesuai dari masingmasing untai DNA cetakan yang membawa dimer. dan diakhiri oleh ligasi segmen tersebut dengan untai DNA.b). ikatan antara timin dan timin akan terputus oleh suatu enzim tertentu. pada untai DNA cetakan terdapat segmen yang hilang. Dengan adanya cahaya. Akhirnya. sedangkan kedua untai DNA baru tidak mempunyai celah lagi (Gambar 11. segmen penutup celah akan terligasi dengan sempurna pada masing-masing untai DNA baru (Gambar 11. kerusakan DNA ini pada umumnya dapat diperbaiki melalui salah satu di antara empat macam mekanisme. Sebenarnya enzim tersebut telah mengikat dimer. khususnya timin dimer. proses ini diakhiri dengan ligasi segmen yang baru tadi dengan untai DNA.8. skema mekanisme tersebut dapat dilihat pada Gambar 11. Pada waktu yang sama terjadi pemotongan lagi pada segmen yang membawa dimer sehingga segmen ini terlepas dari untai DNA. Mekanisme SOS Mekanisme perbaikan DNA dengan sistem SOS dapat dilihat sebagai jalan pintas yang memungkinkan replikasi tetap berlangsung meskipun harus melintasi dimer.8. Jadi. replikasi DNA akan terhalang pada posisi terjadinya timin dimer tersebut.8.8. diikuti oleh resintesis segmen DNA baru. enzim endonuklease melakukan pemotongan (eksisi) pada dua tempat yang mengapit dimer.

Namun. dan sinar γ. sistem penyuntingan oleh DNA polimerase III justru menjadi tidak aktif. mutasi tetap terjadi. Sistem penyuntingan tidak dapat memperbaiki kesalahan ini karena tidak aktif. a) b) d) c) Gambar 11. frekuensi letal resesif pada kromosom X Drosophila meningkat linier sejalan dengan meningkatnya dosis radiasi sinar X.7.8. dimer pemotongan di dua tempat pemotongan di satu tempat di sekitar dimer resintesis segmen baru oleh Pol I pemotongan segmen ligasi yang membawa dimer ligasi Gambar 11. Frekuensi mutasi yang diinduksi oleh sinar X sebanding dengan dosis radiasi yang diberikan. Pengaruh mutagenik iradiasi UV memang hampir selalu merupakan akibat perbaikan yang rentan terhadap kesalahan. Intensitas radiasi pengion dinyatakan secara kuantitatif dengan beberapa macam cara. β. Dengan sendirinya. Untai DNA yang baru akan mempunyai dua basa adenin berurutan pada posisi dimer (dalam kasus timin dimer). Mekanisme eksisi untuk memperbaiki DNA Ketika sistem SOS aktif. karena jumlah dimer di dalam setiap sel yang mengalami iradiasi UV biasanya begitu banyak. maka sistem perbaikan salah pasangan tidak dapat memperbaiki semua kesalahan yang ada. Hal ini dimaksudkan agar polimerisasi tetap dapat berjalan melintasi dimer. Semua bentuk radiasi pengion akan menyebabkan pengaruh mutagenik dan letal pada virus dan sel. mekanisme SOS dapat dikatakan sebagai sistem perbaikan yang rentan terhadap kesalahan. Pemaparan sebesar 1000 rad meningkatkan . Akibatnya. Radiasi pengion meliputi sinar X beserta partikel-partikelnya dan radiasi yang dihasilkan oleh unsur-unsur radioaktif seperti partikel α.untai DNA yang utuh tetapi sering kali sangat defektif. Oleh karena itu. sedangkan sistem perbaikan salah pasangan sebenarnya dapat memperbaikinya. Ukuran yang paling lazim digunakan adalah rad. yang didefinisikan sebagai besarnya radiasi yang menyebabkan absorpsi energi sebesar 100 erg pada setiap gram materi. kedua adenin ini tidak dapat berpasangan dengan timin karena kedua timin berada dalam bentuk dimer. Sebagai contoh. Skema mekanisme rekombinasi pascareplikasi = pirimidin dimer = penutupan celah oleh segmen dari untai DNA cetakan yang membawa dimer Radiasi pengion Radiasi pengion mempunyai energi yang begitu besar sehingga molekul air dan senyawa kimia lainnya yang terkena olehnya akan terurai menjadi fragmen-fragmen bermuatan listrik.

atau sering dikatakan sebagai mutasi ke depan (forward mutation). mutasi akan tetap terinduksi. dan perubahan basa nukleotida. maka pembacaan rangka baca akan menghasilkan fenotipe normal. Pada prinsipnya perlakuan ini dimaksudkan untuk meningkatkan frekuensi kerusakan kromosom pada sel-sel yang sedang mengalami mitosis. kerusakan pada kedua untai. Cara yang pertama telah kita jelaskan pada Bab X. pada beberapa organisme terdapat sistem yang dapat memperbaiki kerusakan kromosom tersebut meskipun perbaikan yang dilakukan sering mengakibatkan delesi. Pada cara yang kedua tidak terjadi adisi dan delesi pada urutan basa. Oleh karena itu. Pengaruh mutagenik dan letal yang ditimbulkan oleh radiasi pengion terutama berkaitan dengan kerusakan DNA. Radiasi pengion banyak digunakan dalam terapi tumor. semua sel tumor akan rusak.15% menjadi 3%. terjadi penekanan intragenik. Mutasi semacam ini dinamakan mutasi balik atau reversi. yang disandi oleh gen trpA pada. coli.maupun intergenik. Salah satu di antara dua polipeptida yang menyusun enzim tersebut adalah polipeptida A yang terdiri atas 268 asam amino. maka sel tumor yang dirusak akan jauh lebih banyak daripada sel normal yang dirusak. Perubahan glisin menjadi asam glutamat sebenarnya . Ada tiga macam kerusakan DNA yang disebabkan oleh radiasi pengion. dan translokasi. inversi. mutasi penekan dapat juga terjadi di dalam gen yang lain atau bahkan di dalam kromosom yang lain sehingga peristiwanya dinamakan penekanan intergenik. Namun. yang biasanya bersifat letal. Namun. Ada dua mekanisme yang berbeda pada mutasi balik. Artinya. Mutasi penekan dapat terjadi di suatu tempat di dalam gen yang sama dengan mutasi pertama yang ditekannya. Penekanan intragenik Pada garis besarnya ada dua macam cara penekanan intragenik. iradiasi biasanya dilakukan dengan selang waktu beberapa hari agar sel-sel tumor yang semula sedang beristirahat kemudian melakukan mitosis. tetapi perubahan suatu asam amino yang mengakibatkan hilangnya aktivitas protein akan diimbangi oleh perubahan asam amino lainnya yang memulihkan aktivitas protein tersebut. betapapun rendahnya dosis radiasi. Akan tetapi. Mutasi Balik dan Mutasi Penekan Kebanyakan mutasi yang telah kita bicarakan hingga saat ini adalah perubahan dari bentuk alami atau normal ke bentuk mutan. seperti telah disinggung pada Bab X. Diharapkan setelah iradiasi diberikan selama kurun waktu tertentu. Sebagai contoh dapat dikemukakan penekanan mutasi enzim triptofan sintetase pada E. duplikasi. Kebanyakan mutasi penekan. Dengan perkataan lain. Pada eukariot radiasi pengion dapat menyebabkan kerusakan kromosom. tidak semua sel tumor mengalami mitosis pada waktu yang sama. Mekanisme mutasi balik berupa mutasi penekan jauh lebih umum dijumpai daripada mekanisme yang pertama. baik intra. Pada Drosophila tidak terdapat ambang bawah dosis pemaparan yang yang tidak menyebabkan mutasi. yaitu perbaikan rangka baca dengan kompensasi adisi-delesi sehingga rangka baca yang bergeser sebagian besar dapat dikembalikan seperti semula. Akan tetapi. maka enzim triptofan sintetase menjadi tidak aktif. yaitu kerusakan pada salah satu untai. yaitu (1) perubahan urutan basa pada DNA mutan sehingga benar-benar pulih seperti urutan basa pada fenotipe normalnya dan (2) terjadinya mutasi kedua di suatu tempat lainnya di dalam genom yang mengimbangi atau menekan pengaruh mutasi pertama sehingga mutasi yang kedua tersebut sering disebut sebagai mutasi penekan (suppressor mutation). Jika asam amino glisin ini berubah menjadi asam glutamat. tidak dapat sepenuhnya memulihkan mutan ke fenotipe normalnya seperti yang akan diuraikan di bawah ini. Pada strain normal asam amino yang ke-210 adalah glisin. Oleh karena tumor mengandung banyak sekali sel yang mengalami mitosis sementara jaringan normal tidak. mutasi dapat juga berlangsung dari bentuk mutan ke bentuk normal. Jika bagian yang tidak dapat dipulihkan bukan merupakan urutan yang esensial.frekuensi mutasi dari laju mutasi spontan sebesar 0.

Akibatnya. Dengan tRNA mutan. maka struktur pelipatan enzim yang telah berubah karena glisin digantikan oleh asam glutamat justru akan dipulihkan oleh interaksi sistein dengan asam glutamat. mutasi tRNA telah memulihkan mutasi tanpa makna. Mutasi semacam itu pertama kali ditemukan pada strain-strain E. perubahan ini mengakibatkan perubahan struktur pelipatan enzim sehingga secara tidak langsung akan mempengaruhi tapak aktifnya. dan (4) mutasi aminoasil sintetase yang kadang-kadang salah mengasilasi tRNA. asam amino normal yang ke-174 adalah tirosin. aktivitas enzim pun dapat dipulihkan. perubahan glisin menjadi asam glutamat akan ditekan pengaruhnya oleh perubahan tirosin menjadi sistein. Strain yang mengalami mutasi penekan ini ternyata juga dapat menekan mutasi pada sejumlah gen yang terdapat pada genom bakteri sendiri. terminasi dapat dibatalkan. (2) mutasi pada tRNA yang mengubah sebuah basa di dekat antikodon sehingga tRNA dapat mengenali dua kodon yang berbeda. maka pengaruhnya akan ditekan oleh perubahan glisin menjadi asam glutamat. kebanyakan karsinogen juga merupakan mutagen. Mutasi penekan intergenik dapat memulihkan baik mutasi tanpa makna (nonsense) maupun mutasi salah makna (missense). mutasi penekan diberi lambang sup diikuti dengan angka (atau kadang-kadang huruf) yang membedakan penekan yang satu dengan penekan lainnya. Pada notasi konvensional. Mutasi ini dapat ditekan oleh molekul tRNA mutan yang membawa triptofan dengan antikodon AUC. Penekanan mutasi tanpa makna disebabkan oleh mutasi gen penyandi tRNA sehingga terjadi perubahan antikodon pada tRNA yang memungkinkannya untuk mengenali kodon stop hasil mutasi. yakni UAC dapat berubah menjadi kodon stop UAG. Apabila tirosin berubah menjadi sistein. Substitusi ini dapat terjadi dengan empat macam cara. Namun. Beberapa di antaranya dikenal potensial sebagai mutagen. Antikodon pada molekul tRNA normal yang membawa triptofan adalah AAC. Sementara itu. Sel yang tidak mempunyai penekan dilambangkan dengan sup0. Contoh yang paling dikenal dapat dilihat pada gen-gen penyandi tRNA. Begitu pula sebaliknya. kodon UAG yang seharusnya merupakan kodon stop berubah menjadi kodon yang menyandi triptofan. (3) mutasi di luar kala (loop) antikodon yang memungkinkan aminoasil sintetase mengenali tRNA sehingga terjadi asilasi yang menyebabkan tRNA ini membawa asam amino yang lain. Penekanan mutasi salah makna oleh mutasi penekan intergenik antara lain dapat dilihat contohnya pada pemulihan aktivitas protein yang hilang akibat perubahan valin (tidak bermuatan) menjadi asam aspartat (bermuatan negatif).tidak menyebabkan inaktivasi enzim secara langsung karena glisin tidak terletak pada tapak aktif. atau dengan perkataan lain. coli yang dapat menekan mutan-mutan fag T4 tertentu. yang interaksinya dengan asam amino ke-210 menentukan aktivitas enzim. jika perubahan tirosin menjadi sistein terjadi terlebih dahulu. Dengan demikian. Selain itu. Oleh karena itu. Sebagai contoh. Pengaruh yang ditimbulkannya adalah mengubah kekhususan pengenalan kodon pada mRNA oleh antikodon pada tRNA. yaitu (1) mutasi antikodon yang memungkinkan tRNA untuk mengenali kodon yang berbeda seperti halnya yang terjadi pada pemulihan mutasi tanpa makna. Mutasi balik sebagai cara untuk mendeteksi mutagen dan karsinogen Dewasa ini terjadi peningkatan jumlah dan macam bahan kimia yang mencemari lingkungan. Penekanan intergenik Penekanan intergenik yang paling umum dijumpai adalah penekanan oleh suatu produk mutasi gen terhadap pengaruh mutasi yang ditimbulkan oleh sejumlah gen lainnya. Mutan-mutan ini gagal untuk membentuk plak (lihat Bab XII) pada strain bakteri standar tetapi dapat membentuk plak pada strain yang mengalami mutasi penekan. uji mutagenesis terhadap bahan-bahan kimia . salah satu kodon untuk tirosin. Pemulihan terjadi karena asam aspartat digantikan oleh alanin (tidak bermuatan). Jadi.

Mutan-mutan Hismembawa baik mutasi tautomerik maupun mutasi rangka baca. pestisida. Frekuensi mutasi balik ternyata bergantung kepada konsentrasi bahan kimia yang diuji. Uji Ames saat ini telah banyak digunakan pada beribu-ribu senyawa seperti pengawet makanan. dan pada karsinogen tertentu juga nampak adanya korelasi dengan efektivitasnya pada hewan. Analisis kuantitatif terhadap frekuensi mutasi balik dapat dilakukan juga dengan membuat variasi jumlah mutagen potensial tersebut di dalam medium. Di dalam uji Ames mutan-mutan bakteri Salmonella typhimurium yang memerlukan pemberian histidin eksternal atau disebut dengan mutan His. Pemberian fraksi mikrosomal yang berasal dari hati tikus ke dalam medium pertumbuhan bakteri memungkinkan dilakukannya deteksi mutagenisitas. Akibat dilakukannya uji Ames. strain-strain bakteri tersebut dibuat menjadi lebih sensitif terhadap mutagenesis dengan menggabungkan beberapa alel mutan yang dapat menginaktifkan sistem perbaikan eksisi dan menjadikannya lebih permiabel terhadap molekul-molekul asing. diikuti dengan penaburan (plating) suatu mutan bakteri dalam jumlah tertentu. 11/03/2009 Posted by zaifbio | Genetika Dasar | 8 Komentar . Banyaknya koloni revertan (fenotipe normal hasil mutasi balik) yang muncul dihitung.semacam ini perlu dilakukan. Apabila bahan kimia yang diuji adalah mutagen atau diubah menjadi mutagen. banyak industri terpaksa mereformulasi produk-produknya. ketika enzim-enzim itu bertemu dengan bahan kimia tertentu. cara seperti tersebut di atas tidak dapat digunakan untuk memperlihatkan mutagenesis sejumlah besar karsinogen yang potensial. Akan tetapi. maka koloni bakteri akan terbentuk. Cara yang paling sederhana untuk melihat mutagenesis suatu bahan kimia adalah uji mutasi balik menggunakan mutan nutrisional pada bakteri. Reaksireaksi enzimatik tersebut terjadi di dalam organ hati hewan dan tidak ada kesepadanannya di dalam sel bakteri. Enzim-enzim tersebut terdapat di dalam komponen sel-sel hati yang dinamakan fraksi mikrosomal. Bukti terakhir tentang karsinogenisitas suatu bahan kimia ditentukan atas dasar hasil uji pembentukan tumor pada hewan-hewan percobaan. pewarna rambut.digunakan untuk menguji mutagenisitas senyawa kimia atas dasar mutasi baliknya menjadi His+. Oleh karena beberapa mutagen hanya bekerja pada DNA yang sedang melakukan replikasi. Jadi. diikuti dengan penaburan bakteri. Senyawa yang dicurigai potensial sebagai mutagen ditambahkan ke dalam medium padat. maka mereka akan mengubah bahan tersebut dari sifatnya yang semula tidak mutagenik menjadi mutagenik. Perlakuan ini mendasari teknik pemeriksaan karsinogen menggunakan metode yang dinamakan uji Ames. Hal ini karena banyak sekali senyawa kimia yang tidak langsung bersifat mutagenik / karsinogenik. Fungsi normal enzim-enzim itu adalah melindungi organisme dari berbagai bahan beracun dengan cara mengubahnya menjadi bahan yang tidak beracun. tetapi harus melalui beberapa reaksi enzimatik terlebih dahulu sebelum menjadi mutagen. Fraksi mikrosomal dari hati tikus disebarkan ke permukaan medium. Frekuensi mutasi balik yang tinggi tidak serta-merta berarti bahwa senyawa yang diuji adalah karsinogen. tetapi setidak-tidaknya memperlihatkan adanya peluang seperti itu. dan kosmetika. maka medium pertumbuhan yang digunakan harus mengandung histidin dalam jumlah yang cukup untuk mendukung beberapa putaran replikasi tetapi tidak cukup untuk memungkinkan terbentuknya koloni yang dapat dilihat. Peningkatan frekuensi revertan yang tajam apabila dibandingkan dengan frekuensi yang diperoleh di dalam medium tanpa senyawa kimia yang dicurigai tersebut mengindikasikan bahwa senyawa yang diuji adalah mutagen. Ke dalam medium tersebut kemudian ditambahkan mutagen potensial yang akan diuji. Di samping itu. Meskipun demikian. uji Ames sebenarnya hanya berperan dalam mengurangi jumlah bahan kimia yang harus diuji menggunakan hewan percobaan.

Setiap protein tersusun dari sejumlah asam amino dengan urutan tertentu. Jadi. dikenal sebagai dogma sentral genetika molekuler. dan setiap asam amino pembentukannya disandi (dikode) oleh urutan basa nitrogen di dalam molekul DNA. Fenotipe organisme sangat ditentukan oleh hasil interaksi protein-protein di dalam sel. Rangkaian proses ini. DNA replikasi RNA transkripsi translasi asam amino Gambar 10. . Urutan basa DNA yang pada akhirnya menyandi urutan asam amino disebut sebagai gen. mulai dari DNA hingga terbentuknya asam amino.1. secara kimia gen adalah urutan basa nitrogen tertentu pada molekul DNA yang dapat dieskpresikan melalui tahap-tahap transkripsi dan translasi menjadi urutan asam amino tertentu. proses tanskripsi dan translasi dapat dilihat sebagai tahaptahap ekspresi urutan basa DNA. Artinya. EKSPRESI GEN Pada Bab IX telah disebutkan bahwa salah satu fungsi dasar yang harus dijalankan oleh DNA sebagai materi genetik adalah fungsi fenotipik. Namun. tidak semua urutan basa DNA akan diekspresikan menjadi urutan asam amino. DNA harus mampu mengatur pertumbuhan dan diferensiasi individu organisme sehingga dihasilkan suatu fenotipe tertentu. Dengan demikian. khususnya pada Prokariot Kode Genetik Mekanisme Pengaturan Ekspresi Gen pada Prokariot Mekanisme Pengaturan Ekspresi Gen pada Eukariot BAB X. sedangkan penerjemahan urutan basa RNA menjadi urutan asam amino suatu protein dinamakan translasi. Diagram dogma sentral genetika molekuler Perubahan urutan basa di dalam molekul DNA menjadi urutan basa molekul RNA dinamakan transkripsi.EKSPRESI GEN BAB X EKSPRESI GEN         Dogma Sentral Genetika Molekuler Perkembangan Konsep tentang Gen Transkripsi Tiga Macam RNA Translasi.

setiap molekul protein sendiri dapat dilihat sebagai gabungan beberapa subunit yang dinamakan polipeptida. yang untuk mendapatkannya dilakukan silang balik dengan strain tipe liar. dan satu macam vitamin. mempelajari mutasi gen pada jamur Neurospora crassa dengan menumbuhkan berbagai strain mutan hasil iradiasi menggunakan sinar X atau sinar ultraviolet pada medium lengkap dan medium minimal. Garrod. disebabkan oleh satu gen mutan resesif. Mutan hasil silang balik dengan nisbah keturunan tipe liar : mutan = 1 : 1 dipastikan sebagai mutan dengan hanya satu kelainan (mutasi). Namun. misalnya alkaptonuria. mengajukan konsep satu gen mutan – satu hambatan metabolisme. Sebagai contoh.Di atas telah kita katakan bahwa sejumlah asam amino dengan urutan (sekuens) tertentu akan menyusun sebuah molekul protein. W. Medium minimal adalah medium untuk pertumbuhan mikroorganisme yang hanya mengandung garam-garam anorganik. Beadle dan E. Sir Archibald E. sebuah gula sederhana. dengan mengorelasikan hasil analisis genetik dengan hasil analisis biokimia terhadap strainstrain mutan Neurospora tersebut dapat diketahui bahwa tiap mutasi menyebabkan hilangnya satu aktivitas enzim. sinarX atau sinar uv . muncul pertanyaan tentang hakekat sebuah gen : tiap gen menyandi satu protein ataukah tiap gen menyandi satu polipeptida ? Perkembangan konsep tentang gen dapat diikuti semenjak awal abad ke-20 ketika seorang dokter sekaligus ahli biokimia dari Inggris. Sekitar 50 tahun kemudian dua orang peneliti.L. setelah diketahui bahwa sebagian besar enzim tersusun dari beberapa polipetida. Garrod mempelajari sejumlah penyakit metabolik bawaan pada manusia dan menyimpulkan bahwa setiap gangguan metabolisme bawaan yang menimbulkan penyakit tertentu. yaitu polipeptida α dan polipeptida β. maka konsep terbaru tentang gen yang dianut hingga kini adalah satu gen – satu polipeptida. Strain tipe liar. sedangkan strain mutan hanya mampu tumbuh pada medium lengkap. enzim triptofan sintetase pada Escherichia coli terdiri atas dua buah polipeptida. Selanjutnya. Strain-strain mutan ini kemudian dianalisis lebih lanjut untuk mengetahui macam faktor pertumbuhan yang diperlukannya dengan cara melakukan variasi penambahannya ke dalam medium minimal. Maka. sedangkan polipeptida β merupakan produk gen trpB. Dalam perkembangan berikutnya. sebagai kontrol. Polipeptida α merupakan produk gen trpA. Sebagai contoh. G. mampu tumbuh baik pada medium lengkap maupun pada medium minimal. Dengan cara seperti ini Beadle dan Tatum memperlihatkan bahwa tiap mutasi menyebabkan kebutuhan akan pemberian satu macam faktor pertumbuhan. konsep satu gen mutan – satu hambatan metabolisme bergeser menjadi satu gen – satu enzim. Tatum. dan masing-masing polipeptida merupakan produk gen yang berbeda. mutan yang hanya tumbuh pada medium minimal yang ditambah dengan tiamin adalah mutan yang mengalami mutasi pada gen untuk biosintesis tiamin. Mutan yang digunakan adalah mutan dengan hanya satu kelainan. Oleh karena itu.

Adanya sumber basa nitrogen berupa nukleosida trifosfat.2. Diagram percobaan yang memperlihatkan satu gen – satu enzim Transkripsi Tahap pertama ekspresi gen adalah transkripsi atau sintesis molekul RNA dari DNA (gen). Jadi. Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. Bedanya dengan sumber basa untuk DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi tetapi digantikan oleh urasil.trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. Adanya molekul cetakan berupa untai DNA. Gugus 3’. Jadi. dan uridin trifosfat (UTP). 2.spora seksual konidia tipe liar silang balik medium lengkap medium minimal riboflavin piridoksin tiamin asam pantotenat kholin asam folat asam nukleat niasin inositol Gambar 10. Meskipun demikian. dan disebut sebagai pita antisens. 3. sitidin trifosfat (CTP). bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. 4. guanosin trifosfat (GTP). melainkan RNA polimerase. Reaksi ini jelas sama dengan reaksi polimerisasi DNA. Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. yang mempunyai urutan basa sama dengan urutan basa RNA. yaitu 1. Sementara itu.OH pada suatu nukleotida bereaksi dengan gugus 5’. untai DNA pasangannya. Hanya saja enzim yang bekerja bukannya DNA polimerase. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada . Sintesis RNA mempunyai ciri-ciri kimiawi yang serupa dengan sintesis DNA. disebut sebagai pita sens.

3. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. Hal ini mengakibatkan perbedaan kekuatan ekspresi gen. RNA polimerase akan terikat pada suatu tempat di dekat daerah promoter. sedangkan pada eukariot urutan konsensusnya adalah TATAAAT dan disebut kotak TATA. maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 10. Enzim RNA polimerase mengikat untai DNA cetakan pada suatu daerah yang mempunyai urutan basa tertentu sepanjang 20 hingga 200 basa. 2. Di antara keduanya terminasi diri lebih umum dijumpai. Daerah ini dinamakan promoter.kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. Baik pada prokariot maupun eukariot. 1. Setelah mengalami pengikatan oleh promoter. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. Tahap-tahap transkripsi Transkripsi berlangsung dalam empat tahap. segera terlepas dari untai DNA cetakan begitu enzim tersebut mencapai urutan basa pengakhir (terminasi). Nukleosida trifosfat pertama akan diletakkan di tempat ini dan sintesis RNA pun segera dimulai. 4. Selama sintesis RNA berlangsung RNA polimerase bergerak di sepanjang molekul DNA cetakan sambil menambahkan nukleotida demi nukleotida kepada untai RNA yang sedang diperpanjang. 3. elongasi. dan juga enzim RNA polimerase. urutan penyela 5’ ATTAAAGGCTCCTTTTGGAGCCTTTTTTTT T A A T T T C C G A G GA AA A C C T C G G A A AAA A AA 3’ 5’ 3’ DNA transkripsi . Urutan konsensus akan menunjukkan kepada RNA polimerase tempat dimulainya sintesis. yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). Pada prokariot urutan konsensusnya adalah TATAAT dan disebut kotak Pribnow. yaitu pengenalan promoter. inisiasi. Kekuatan pengikatan RNA polimerase oleh promoter yang berbeda sangat bervariasi. Terminasi dapat terjadi oleh dua macam sebab. Masing-masing akan dijelaskan sebagai berikut. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). Molekul RNA yang baru saja selesai disintesis. dan teminasi. promoter selalu membawa suatu urutan basa yang tetap atau hampir tetap sehingga urutan ini dikatakan sebagai urutan konsensus. yang dinamakan tempat awal polimerisasi.

3 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. Pembuangan intron dan . sedangkan pada eukariot transkrip primernya harus mengalami prosesing RNA terlebih dahulu sebelum menjadi mRNA. yaitu modifikasi kedua ujung transkrip primer dan pembuangan urutan basa pada transkrip primer yang tidak akan ditranslasi (disebut intron). Prosesing RNA ini mencakup dua peristiwa. Hanya saja. sedangkan ujung 3’ dimodifikasi dengan urutan poliadenosin (poli A) sepanjang lebih kurang 200 basa. Sementara itu. Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda.U U U C C U C G G A A 5’ A U U G G A G C C U U A U 3’ RNA U U U U U U Gambar 10. Secara umum mekanisme transkripsi pada prokariot dan eukariot hampir sama. pada prokariot produk langsung transkripsi atau transkrip primernya adalah mRNA (akan dijelaskan di bawah). tetapi segmen yang mengandung ujung 5’ (gugus cap) tidak pernah dibuang. Setelah intron dibuang. promoter dapat mengikat RNA polimerase yang lain. panjang intron yang harus dibuang dapat mencapai 50% hingga 90% dari panjang transkrip primer. Ujung 5’ dimodifikasi dengan penambahan guanosin dalam ikatan 5’-5’ yang tidak umum hingga terbentuk suatu gugus terminal yang dinamakan cap. segmensegmen sisanya (disebut ekson) segera digabungkan menjadi mRNA. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida.

penggabungan ekson menjadi molekul mRNA dinamakan penyatuan RNA atau RNA splicing. Macam-macam RNA Transkripsi DNA menghasilkan molekul RNA yang kemudian akan mengalami diferensiasi struktur sesuai dengan fungsinya masing-masing. Kita mengenal tiga macam RNA, yaitu 1. RNA duta atau messenger RNA (mRNA), yang mempunyai struktur linier kecuali bagian ujung terminasinya yang berbentuk batang dan kala (Gambar 10.3). Molekul mRNA membawa urutan basa yang sebagian di antaranya akan ditranslasi menjadi urutan asam amino. Urutan basa yang dinamakan urutan penyandi (coding sequences) ini dibaca tiga demi tiga. Artinya, tiap tiga basa akan menyandi pembentukan satu asam amino sehingga tiap tiga basa ini dinamakan triplet kodon. Daftar triplet kodon beserta asam amino yang disandinya dapat dilihat pada Tabel 10.1. Pada prokariot bagian mRNA yang tidak ditranslasi terletak di depan urutan penyandi (disebut pengarah atau leader) dan di antara dua urutan penyandi (disebut spacer sequences atau noncoding sequences). Sementara itu, pada eukariot di samping kedua bagian tadi ada juga bagian di dalam urutan penyandi yang tidak ditranslasi. Bagian inilah yang dinamakan intron seperti telah dijelaskan di atas. Molekul mRNA pada prokariot sering kali membawa sejumlah urutan penyandi bagi beberapa polipeptida yang berbeda. Molekul mRNA seperti ini dinamakan mRNA polisistronik. Dengan adanya mRNA polisistronik, sintesis beberapa protein yang masih terkait satu sama lain dapat diatur dengan lebih efisien karena hanya dibutuhkan satu sinyal. Pada eukariot hampir tidak pernah dijumpai mRNA polisistronik. 2. RNA pemindah atau transfer RNA (tRNA), yang strukturnya mengalami modifikasi hingga berbentuk seperti daun semanggi. Seperti halnya struktur ujung terminasi mRNA, struktur seperti daun semanggi ini terjadi karena adanya urutan palindrom yang diselingi oleh beberapa basa (Gambar 10.4). Pada salah satu kalanya, tRNA membawa tiga buah basa yang komplemeter dengan triplet kodon pada mRNA. Ketiga basa ini dinamakan antikodon. Sementara itu, pada ujung 3’-nya terdapat tempat pengikatan asam amino tertentu. Pengikatan yang membentuk molekul aminoasil-tRNA ini terjadi dengan bantuan enzim aminoasil-tRNA sintetase. Dalam hal ini gugus hidroksil (OH) pada ujung 3’ tRNA terikat sangat kuat dengan gugus karboksil (COOH) asam amino. Macam asam amino yang dibawa ditentukan oleh urutan basa pada antikodon. Jadi, ada beberapa macam aminoasil-tRNA sesuai dengan antikodon dan macam asam amino yang dibawanya. antikodon

5’

3’ (tempat pengikatan asam amino) Gambar 10.4. Diagram struktur tRNA

3. RNA ribosomal atau ribosomal RNA (rRNA), yang strukturnya merupakan bagian struktur ribosom. Lebih kurang separuh struktur kimia ribosom berupa rRNA dan separuh lainnya berupa protein. Molekul rRNA, dan juga tRNA, dapat dikatakan sebagai RNA struktural dan tidak ditranslasi menjadi asam amino/protein. Akan tetapi, mereka adalah bagian mesin sel yang menyintesis protein (lihat uraian tentang translasi di bawah ini). Translasi Bila dibandingkan dengan transkripsi, translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel, maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. Empat puluh hingga 60 molekul tRNA yang berbeda 4. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi, elongasi, dan terminasi polipeptida. Translasi, atau pada hakekatnya sintesis protein, berlangsung di dalam ribosom, suatu struktur organel yang banyak terdapat di dalam sitoplasma. Ribosom terdiri atas dua subunit, besar dan kecil, yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). Pada kebanyakan prokariot ribosom mempunyai ukuran 70S, sedangkan pada eukariot biasanya sekitar 80S. Tiap ribosom mempunyai dua tempat pengikatan tRNA, yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A, sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. 1. Molekul mRNA ditranslasi dengan arah 5’→ 3’, tetapi tidak dari ujung 5’ hingga ujung 3’. 2. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil. Sebagai contoh, sintesis protein yang mempunyai urutan NH2-Met-Pro- . . . -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 10.5. Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. Sementara itu, pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA. Selanjutnya, berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya.

Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh, khususnya pada prokariot, akan diberikan di bawah ini. arah gerakan ribosom

ribosom AUC UAG ACC UGG

aa 5’

aa CUG GGG 3’ mRNA

GAC COOH aa tRNA aa NH2 aa NH2 COOH aminoasil-tRNA

ikatan peptida Gambar 10.5. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus, yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet). Hal ini berarti bahwa sintesis semua polipeptida selalu dimulai dengan metionin. Khusus pada prokariot akan terjadi formilasi

Selain itu. Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom. Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet). dan metionil-tRNAfMet terikat pada tapak P. serta sebuah molekul GTP. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A.tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. kedua subunit ribosom pun memisah. IF-2. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). tRNA di tapak P. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. Sebagai contoh. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. misalnya penyandi serin.tRNAala. misalnya alanil. yang melibatkan (1) perpindahan f-met-ala. dan IF-3). Langkah berikutnya adalah translokasi. baik pada prokariot maupun eukariot. Selanjutnya. Selain itu. dan rantai polipeptida dari ribosom. IF-2. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasil-tRNAfMet berikutnya yang akan masuk ke tapak A. kompleks inisiasi bergabung dengan subunit besar ribosom (50S). Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin. dan subunit kecil ribosom (30S) dengan bantuan protein IF-1.gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa f-metionin. Dengan berlangsungnya kedua proses tersebut secara bersamaan. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. suatu enzim yang terikat pada subunit ribosom 50S. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. Terminasi ditandai oleh terlepasnya mRNA. Kompleks inisiasi pada prokariot terbentuk antara mRNA. ke tapak A memerlukan proteinprotein elongasi EF-Ts dan EF-Tu. . Pengikatan aminoasil-tRNAfMet berikutnya. Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom. Triplet kodon berikutnya. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. yaitu RF-1 dan RF-2. Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. dan IF-3. metionil-tRNAfMet.

seperti yang akan dijelaskan nanti. Kode genetik Penetapan triplet kodon pada mRNA sebagai pembawa informasi genetik atau kode genetik yang akan menyandi pembentukan suatu asam amino tertentu berawal dari pemikiran bahwa macam basa nitrogen jauh lebih sedikit daripada macam asam amino. Basa nitrogen pada mRNA hanya ada empat macam. sedangkan translasi terjadi di sitoplasma (ribosom).1. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. tidak demikian halnya pada eukariot. kombinasi dua basa hanya akan menghasilkan 42 atau 16 macam duplet. juga menjadi sangat efisien. jelas tidak mungkin tiap asam amino disandi oleh satu basa. melebihi jumlah macam asam amino. sedangkan asam amino ada 20 macam. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. satu macam asam amino dapat disandi oleh lebih dari satu macam triplet kodon. Oleh karena itu. Dalam hal ini. masih lebih sedikit daripada macam amino yang ada. Kombinasi tiga basa akan menghasilkan 43 atau 64 triplet. Tabel 10. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. Kode genetik Basa I (5’) Basa II U Phe Phe Leu Leu Leu Leu Leu Leu ILe Ile ILe Met Val Val Val Val C Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala A Tyr Tyr Stop Stop His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu G Cys Cys Stop Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly U C A G U C A G U C A G U C A G Basa III (3’) U C A G . Salah satu di antaranya seperti telah kita bicarakan di atas. Transkripsi terjadi di dalam nukleus. Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma.ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn on-turn off) ekspresi gen. Namun. Begitu juga.

maka mekanisme semacam itu kecil sekali kemungkinannya untuk terjadi dan dugaan tersebut nampaknya tidak benar. Crick dan kawan-kawannya yang mempelajari mutasi pada lokus rIIB bakteriofag T4. Mutasi yang disebabkan oleh perubahan rangka baca akibat kelebihan atau kekurangan pasangan basa disebut sebagai mutasi rangka baca (frameshift mutation) (lihat Bab XI). suatu molekul yang dapat menyisip di sela-sela pasangan basa nitrogen sehingga kesalahan replikasi DNA dapat terjadi sewaktu-waktu. Begitu pula sebaliknya. sekali kita gunakan tanda + untuk mutan delesi berarti strain + adalah mutan delesi. Rangka baca yang baru ini akan menghasilkan urutan asam amino yang masih sama fungsinya dengan urutan sebelum terjadi mutasi. Jika mutan (hasil mutasi) rangka baca yang diinduksi oleh proflavin ditumbuhkan pada medium yang mengandung proflavin. yaitu strain + dan strain -. Namun. strain + tidak harus selalu mutan adisi. Mutasi tersebut diinduksi oleh proflavin. yaitu urutan pembacaan basa-basa nitrogen untuk diterjemahkan menjadi urutan asam amino tertentu. akan diperoleh beberapa fag tipe liar sehingga mutasi seolah-olah dapat dipulihkan atau terjadi mutasi balik (reverse mutation). mutasi balik terjadi karena efek mutasi awal akibat penambahan basa ditekan oleh mutasi kedua akibat pengurangan basa sehingga mutasi yang kedua ini disebut juga sebagai mutasi penekan (suppressor mutation). Hal ini akan menyebabkan perubahan rangka baca (reading frame). Jika dua strain mutan T4 yang satu sama lain mengalami mutasi berbeda di dalam bagian protein rIIB disilangkan melalui infeksi campuran pada suatu inang. karena mutasi bersifat acak. sekali kita menggunakan tanda + untuk mutan adisi berarti strain + adalah mutan adisi. maka T4 tipe liar akan diperoleh sebagai hasil rekombinasi genetik antara kedua tempat mutasi yang berbeda itu. ternyata tidak selalu diperoleh tipe liar. Hasil ini menunjukkan bahwa strain-strain mutan dapat dibagi menjadi dua kelompok. Akan tetapi.H. menghasilkan DNA yang kelebihan atau kekurangan satu pasangan basa. ketika kedua strain mutan rIIB yang disilangkan merupakan strain-strain yang diseleksi secara acak (tidak harus mengalami mutasi yang berbeda). Namun. Dengan perkataan lain. dan strain – tidak harus selalu mutan delesi.Keterangan : phe = fenilalanin leu = leusin ile = isoleusin met = metionin val = valin ser = serin pro = prolin thr = treonin ala = alanin tyr = tirosin his = histidin gln = glutamin asn = asparagin lys = lisin asp = asam aspartat glu = asam glutamat cys = sistein trp = triptofan arg = arginin gly = glisin AUG (kodon metionin) dapat menjadi kodon awal (start codon) stop = kodon stop (stop codon) Bukti bahwa kode genetik berupa triplet kodon diperoleh dari hasil penelitian F. Pada awalnya mutasi balik diduga karena kelebihan pasangan basa dibuang dari rangka baca yang salah sehingga rangka baca tersebut telah diperbaiki menjadi seperti semula. Crick dan kawan-kawannya menjelaskan bahwa mutasi balik disebabkan oleh hilangnya (delesi) satu pasangan basa lain yang letaknya tidak terlalu jauh dari pasangan basa yang menyisip (adisi). Dalam hal ini.C. Protein rIIB pada T4 mempunyai bagian-bagian yang di dalamnya dapat terjadi perubahan urutan asam amino. . Perubahan ini dapat berpengaruh atau tidak berpengaruh terhadap fungsi proteinnya.

CCC UAG met ile ser lys gly phe pro stop mRNA ‘tipe liar’ urutan asam urutan asam amino tipe liar amino yang berubah Gambar 10. . . maka akan terjadi pemulihan rangka baca hasil persilangan tersebut. persilangan antara starin + dan – akan menyebabkan terjadinya mutasi penekan (adisi ditekan oleh delesi atau delesi ditekan oleh adisi) atau hanya menghasilkan mutasi pada urutan asam amino yang tidak berpengaruh terhadap fungsi protein sehingga diperoleh fenotipe tipe liar. kode genetik berupa duplet. . sesuai dengan hasil kenyataannya. Hal ini memperlihatkan bahwa kode genetik terdiri atas tiga basa. CCU AG . Apabila kode genetik berupa triplet. . rekombinasi antara tiga + atau tiga – akan menghasilkan tipe liar. maka persilangan teoretis sesama + atau sesama – akan menghasilkan fenotipe mutan. CCC UAG met phe pro lys gly phe pro stop mRNA tipe liar penambahan pasangan basa A=T (mutasi rangka baca I) AUG AUU UCC CAA AGG GUU U . . Kenyataannya tidak demikian. . . . .6. Pemulihan rangka baca akibat mutasi penekan justru terjadi apabila persilangan dilakukan antara strain + dan strain -. AUG UUU CCC AAA GGG UUU . . Hal ini karena persilangan sesama + atau sesama – akan menyebabkan adisi atau delesi ganda sehingga selalu menghasilkan fenotipe mutan. kode genetik jelas tidak mungkin terdiri atas dua basa. Seandainya. .Persilangan antara strain + dan strain – hanya menghasilkan rekombinasi berupa fenotipe tipe liar. Sementara itu. sedangkan persilangan antara sesama + atau sesama – tidak pernah menghasilkan tipe liar. Mutasi penekan yang memulihkan rangka baca Oleh karena persilangan sesama + atau sesama – tidak pernah menghasilkan tipe liar. . . . . Namun. . . mRNA mutan met ile ser gln arg val leu pengurangan pasangan basa G = G(mutasi rangka baca II) AUG AUU UCC AAA GGG UUU .

urutan yang bila berubah tidak berpengaruh urutan yang bila berubah berpengaruh tipe liar AB CD EF GH IJ KL protein tipe liar +1 AB C1 DE FG HI JK +2 AB CD E2 FG HI JK -1 AB DE FG HI JK LM -2 AB CD FG HI JK LM +1 x +2 AB C1 DE 2F GH IJ KL liar -1 x -2 AB CD EF GH IJ KL liar +1 x -1 AB C1 DE FG HI JK mutan MN OP QR ST UV WX LM NO PQ RS TU VW X protein mutan LM NO PQ RS TU VW X protein mutan NO PQ RS TU VW X NO PQ RS TU VW X MN OP QR ST UV WX protein mutan protein mutan protein tipe MN OP QR ST UV WX protein tipe LM NO PQ RS TU VW X protein a) urutan yang bila berubah tidak berpengaruh urutan yang bila berubah berpengaruh tipe liar ABC DEF GHI JKL protein tipe liar +1 AB1 CDE FGH IJK +2 ABC DE2 FGH IJK +3 ABC DEF GHI J3K +1 x +2 AB1 CDE 2FG HIJ mutan +1 x +2 x +3 AB1 protein tipe liar CDE 2FG HIJ 3KL MNO PQR STU VWX LMN OPQ RST UVW X LMN OPQ RST UVW X LMN OPQ RST UVW X protein mutan protein mutan protein mutan protein KLM NOP QRS TUV WX MNO PQR STU VWX .

dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. Diagram persilangan mutan rIIB pada T4 yang memperlihatkan bahwa kode genetik berupa triplet kodon a) Jika kode genetik berupa duplet. jika sebuah molekul protein rata-rata tersusun dari 400 asam amino. Kemudian. Kode genetik bersifat degenerate atau redundant. satu antikodon pada tRNA dapat mengenali lebih dari satu macam kodon pada mRNA. Artinya. yang artinya bahwa basa ketiga dapat berubah-ubah tanpa selalu disertai perubahan macam asam amino yang disandinya. bakteriofag фX174 mempunyai 11 protein yang secara keseluruhan terdiri atas 2300 asam amino. 2. tRNA. Sifat ini erat kaitannya dengan sifat wobble basa ketiga. Di samping itu. Kode genetik bersifat universal. Sifat-sifat kode genetik Kode genetik mempunyai sifat-sifat yang akan dijelaskan sebagai berikut. Oleh karena tiap kodon terdiri atas tiga buah basa. hasil persilangan teoretis sesuai dengan kenyataan yang diperoleh. atau pun C. Pengaturan Ekspresi Gen Produk-produk gen tertentu seperti protein ribosomal. b) Jika kode genetik berupa triplet. mempunyai tiga rangka baca yang berbeda (open reading frame). rRNA. jelaslah bahwa dari urutan basa DNA yang ada tidak hanya digunakan sebuah rangka baca. atau berarti juga DNA. ACA. kode genetik berlaku sama hampir di setiap spesies organisme. Dengan perkataan lain. Seandainya dari urutan basa ini hanya digunakan sebuah rangka baca.7. Gen-gen yang menyandi . Dengan demikian. Sebagai contoh. dan urutan basa yang diekspresikan (gen) dapat tumpang tindih satu sama lain. treonin dapat disandi oleh ACU. ACC. maka tiap urutan basa mRNA. Padahal kenyataannya. hasil persilangan teoretis tidak sesuai dengan kenyataan yang diperoleh. Diketahuinya sifat wobble bermula dari penemuan basa inosin (I) sebagai basa pertama pada antikodon tRNAala ragi. 1. di dalam suatu segmen tertentu pada DNA dapat terjadi transkripsi dan translasi urutan basa dengan panjang yang berbeda. RNA polimerase. U. suatu segmen DNA dapat terdiri atas lebih dari sebuah gen yang saling tumpang tindih (overlapping). maka akan terdapat sekitar 1700 asam amino yang dapat disintesis. bakteriofag фX174 mempunyai sebuah untai tunggal DNA yang panjangnya lebih kurang hanya 5000 basa. yaitu bahwa satu macam asam amino dapat disandi oleh lebih dari satu triplet kodon. 3. yang ternyata dapat berpasangan dengan basa A. Dengan demikian. Sebagai contoh. maka dari sekitar 1700 asam amino tersebut hanya akan terbentuk 4 hingga 5 buah molekul protein. dan ACG.b) Gambar 10.

Peristiwa ini berkenaan dengan laju sintesis enzim. Jadi. Ekspresi gen yang berurutan ini telah terprogram secara genetik sehingga gen-gen tersebut tidak akan dapat diekspresikan di luar urutan. dalam keadaan normal. prosesing mRNA. baik pada prokariot maupun pada eukariot. Selain mempunyai kemampuan untuk memecah suatu molekul (katabolisme). Pada mekanisme sirkit. bagi eukariot mekanisme ini nampaknya tidak terlalu penting karena pada organisme ini sel justru cenderung merespon sinyal-sinyal yang datang dari dalam tubuh. bukan dengan aktivitas enzim. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. sistem sirkulasi akan menjadi penyangga bagi sel terhadap perubahan kondisi lingkungan yang mendadak tersebut. dalam contoh ini laktosa merupakan induser. Bakteri ini secara alami hidup di dalam usus besar manusia dengan memanfaatkan sumber karbon yang umumnya berupa glukosa. Sebaliknya. paling banyak terjadi pada tahap transkripsi. Oleh karena urutan ekspresinya berupa sirkit. sedangkan zat atau molekul yang menyebabkan terjadinya induksi disebut sebagai induser. Mekanisme pengaturan transkripsi. yaitu ketika tersedia glukosa sebagai sumber karbon. yaitu (1) mekanisme yang melibatkan penyalapadaman (turn on and turn off) ekspresi gen sebagai respon terhadap perubahan kondisi lingkungan dan (2) sirkit ekspresi gen yang telah terprogram (preprogramed circuits). Sementara itu. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. Namun. gen-gen penyandi berbagai enzim yang terlibat dalam pemanfaatan laktosa akan diekspresikan (turned on). dan di sisi lain. sesuatu yang tidak biasa dilakukannya. maka mekanisme tersebut dinamakan sirkit ekspresi gen. Sebagai contoh. bakteri juga dapat menyintesis (anabolisme) berbagai molekul organik yang diperlukan bagi pertumbuhannya. misalnya transkripsi. Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. maka gen-gen tersebut tidak diekspresikan (turned off). Untuk itu. produk gen kedua akan menekan transkripsi gen kedua dan memacu transkripsi gen ketiga. Dalam medium pertumbuhan yang tidak . Induksi secara molekuler terjadi pada tingkat transkripsi.pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. khususnya pada prokariot. Sebaliknya. bukan peningkatan laju sintesisnya. Induksi dan represi pada prokariot Escherichia coli merupakan bakteri yang sering dijadikan model untuk mempelajari berbagai mekanisme genetika molekuler. demikian seterusnya. Pada pengaktifan enzim suatu molekul kecil akan terikat pada enzim sehingga akan terjadi peningkatan aktivitas enzim tersebut. Mekanisme penyalapadaman sangat penting bagi mikroorganisme untuk menyesuaikan diri terhadap perubahan lingkungan yang seringkali terjadi secara tiba-tiba. atau translasi. secara garis besar dapat dibedakan menjadi dua kategori utama. maka enzim pemecah laktosa akan disintesis. Proses yang terjadi ketika ekspresi gen merupakan respon terhadap keberadaan suatu zat di lingkungannya dikenal sebagai induksi. banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. coli ditumbuhkan pada medium yang sumber karbonnya bukan glukosa melainkan laktosa. Salmonella typhimurium mempunyai sejumlah gen yang menyandi enzim-enzim untuk biosintesis triptofan. Apabila suatu ketika E. produk suatu gen akan menekan transkripsi gen itu sendiri dan sekaligus memacu transkripsi gen kedua.

Jadi. Represi tidak menghambat aktivitas enzim. jika suatu saat ke dalam medium pertumbuhannya ditambahkan triptofan. tetapi menekan laju sintesisnya. dan molekul efektor. Molekul efektor pada induksi adalah induser. operator (O). sedangkan zat yang menyebabkan terjadinya represi disebut sebagai korepresor. dengan operator. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. Di luar operon terdapat gen regulator (R) beserta promoternya (PR). Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). atau bahkan tumpang tindih. Represi sering dikacaukan dengan inhibisi umpan balik (feedback inhibition). S. molekul protein represor yang dihasilkan oleh gen regulator. menyebabkan terhalangnya transkripsi gen-gen struktural. dan gen-gen struktural (GS). maka gen-gen tersebut tidak perlu diekspresikan (turned off). operon PR R PO O GS1 GS2 GS3 represor a) efektor (induser atau korepresor) RNA polimerase induser RNA polimerase berjalan . yaitu penghambatan aktivitas enzim akibat pengikatan produk akhir reaksi yang dikatalisis oleh enzim itu sendiri. Proses pemadaman (turn off) ekspresi gen sebagai respon terhadap keberadaan suatu zat di lingkungannya dinamakan represi. typhimurium akan mengekspresikan (turned on) gen-gen tersebut. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. Monod pada tahun 1961. Akan tetapi. Pada kondisi tertentu represor akan berikatan dengan operator.mengandung triptofan. sedangkan pada represi adalah korepresor. Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. Model operon Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model yang diajukan oleh F. Jacob dan J. Seperti halnya induksi. dalam contoh ini triptofan merupakan korepresor. represi juga terjadi pada tahap transkripsi.

Salah satu contohnya adalah operon lac. . dengan terikatnya represor oleh induser. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang. Jadi. Akibatnya.8. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator. transkripsi gen-gen struktural tidak dapat berlangsung. Akan tetapi. Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Pada Gambar 10.transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 10.8 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi. promoter operon menjadi terbuka bagi RNA polimerase sehingga gengen struktural dapat ditranskripsi dan selanjutnya ditranslasi. Namun. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas. Dengan demikian. Dengan pengikatan ini. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor. gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. Sebaliknya. dengan adanya korepresor. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi.

memegang peran yang sangat penting dalam proses diferensiasi sel. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. Demikian pula.Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik. hormon. dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. Beberapa produk gen dibutuhkan dalam jumlah yang jauh lebih besar daripada produk gen lainnya sehingga terdapat nisbah kebutuhan di antara produk-produk gen yang berbeda. . nampaknya tidak begitu penting pada eukariot. Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. Produk gen A dapat 20 kali lebih banyak daripada produk gen B apabila terdapat 20 salinan (kopi) gen A untuk setiap salinan gen B. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. mRNA di dalam selsel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. Katakanlah. ada gen A dan gen B yang ditranskripsi dan ditranslasi dengan efisiensi yang sama. Operon trp. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau mirip operon. Selain itu. Dosis gen dan amplifikasi gen Kebutuhan akan produk-produk gen pada eukariot dapat sangat bervariasi. Untuk memenuhi nisbah kebutuhan ini antara lain dapat ditempuh melalui dosis gen. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. dan juga prosesing mRNA. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. Sebagai contoh. Jadi. Operon. terindikasi juga bahwa diferensiasi sel sedikit banyak melibatkan ekspresi seperangkat gen yang telah terprogram (preprogramed). Untuk menyintesis histon dalam jumlah besar yang dibutuhkan dalam pembentukan kromatin. molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. Contoh yang nyata dapat dilihat pada gen-gen penyandi histon. Dengan perkataan lain. Namun. kalau pun ada. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi. yaitu hanya membawa urutan sebuah gen struktural. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing.

Molekul rRNA tidak diperlukan lagi ketika oosit telah matang hingga saat terjadinya fertilisasi. coli. Molekul mRNA salinan tunggal dan semiprevalen masing-masing menyandi enzim dan protein struktural. Salah satu regulator yang diketahui berperan dalam transkripsi eukariot adalah hormon. Di sisi lain.kebanyakan sel mempunyai beratus-ratus kali salinan gen histon daripada jumlah salinan gen yang diperlukan untuk replikasi DNA. yaitu (1) mRNA salinan tunggal (single copy). penetrasi hormon ke dalam sel target dan pengangkutannya ke dalam nukleus merupakan proses yang jauh lebih rumit bila dibandingkan dengan induksi oleh laktosa pada E. Cara lain untuk mengatasi kebutuhan protein tersebut adalah dengan meningkatkan masa hidup mRNA (lihat bagian pengaturan translasi). amplifikasi gen terjadi selama perkembangan oosit katak Xenopus laevis. Secara garis besar pengaturan transkripsi oleh hormon dimulai dengan masuknya hormon ke dalam sel target melewati membran sel. maka selama dan setelah amplifikasi gen tersebut akan berada di dalam gulungan-gulungan kecil yang mengalami replikasi. Untuk itu dibutuhkan sejumlah besar ribosom. molekul mRNA dapat dibagi menjadi tiga kelompok. Setelah kompleks ini terbentuk biasanya reseptor akan mengalami modifikasi struktur kimia. amplifikasi gen sebenarnya tidak perlu dilakukan. Sebagai contoh. Namun. yang kemudian ditangkap oleh reseptor khusus yang terdapat di dalam sitoplasma sehingga terbentuk kompleks hormon-reseptor. Pengaturan transkripsi Berdasarkan atas banyaknya salinan di dalam tiap sel. gen rRNA yang telah begitu banyak disalin kemudian didegradasi kembali oleh berbagai enzim intrasel. molekul protein kecil yang dibawa dari sel tertentu menuju ke sel target. Oleh karena itu. yaitu peningkatan jumlah gen sebagai respon terhadap sinyal tertentu. . Sementara itu. Pembentukan oosit dari prekursornya (oogonium) merupakan proses kompleks yang membutuhkan sejumlah besar sintesis protein. sel-sel eritroblas di dalam sumsum tulang belakang mempunyai sejumlah besar mRNA yang dapat ditranslasi menjadi globin matang. Jika waktu yang tersedia untuk melakukan sintesis sejumlah besar protein cukup banyak. sel-sel prekursor tidak mempunyai gen penyandi rRNA dalam jumlah yang mencukupi untuk sintesis molekul tersebut dalam waktu yang relatif singkat. hanya sedikit sekali atau bahkan tidak ada globin yang dihasilkan oleh sel-sel prekursor yang belum berkembang menjadi eritroblas. sejalan dengan perkembangan oosit terjadi peningkatan jumlah gen rRNA hingga 4000 kali sehingga dari sebanyak 600 gen yang ada pada prekursor akan diperoleh sekitar dua juta gen setelah amplifikasi. (2) mRNA semiprevalen dengan jumlah salinan lebih dari satu hingga beberapa ratus per sel. Mekanisme kerja hormon dalam mengatur transkripsi eukariot lebih kurang dapat disetarakan dengan induksi pada prokariot. Kita mengetahui bahwa ribosom antara lain terdiri atas molekulmolekul rRNA. Namun. Sebagai contoh. mRNA superprevalen biasanya dihasilkan sejalan dengan terjadinya perubahan di dalam suatu tahap perkembangan organisme eukariot. Dengan demikian. kita dapat memastikan adanya suatu mekanisme pengaturan ekspresi gen penyandi mRNA superprevalen pada tahap transkripsi eukariot meskipun hingga kini belum terlalu banyak rincian prosesnya yang dapat diungkapkan. dan (3) mRNA superprevalen dengan jumlah salinan beberapa ratus hingga beberapa ribu per sel. Jika sebelum amplifikasi ke-600 gen rRNA berada di dalam satu segmen DNA linier. Salah satu pengaruh dosis gen adalah amplifikasi gen. Padahal.

Telur yang tidak dibuahi secara biologi bersifat statis. Pada tikus. khususnya pada penyatuan (splicing) mRNA. Sel telur ini akan mempertahankan diri untuk tidak mengalami pertumbuhan atau perkembangan. Hal ini karena sel-sel atau jaringan lainnya tidak mempunyai reseptor hormon estrogen di dalam sitoplasmanya. Akan tetapi. Pengaturan pada tahap prosesing mRNA Dua jenis sel yang berbeda dapat membuat protein yang sama tetapi dalam jumlah yang berbeda meskipun transkripsi di dalam kedua sel tersebut terjadi pada gen yang sama.Kompleks hormon-reseptor yang termodifikasi kemudian menembus dinding nukleus untuk memasuki nukleus. Hal ini menunjukkan bahwa di dalam sel telur yang belum dibuahi akan dijumpai sejumlah mRNA yang menantikan datangnya sinyal untuk translasi. Jadi. akan mengalami salah satu di antara beberapa peristiwa. Namun. Sintesis ini akan terus berlanjut selama estrogen diberikan. Proses selanjutnya belum banyak diketahui. sejumlah protein akan disintesis. yaitu (1) pengikatan langsung pada DNA. tetapi rupanya berperan dalam pembentukan kompleks ribosom-mRNA. Kelenjar ludah menghasilkan α-amilase lebih banyak daripada yang dihasilkan oleh jaringan hati meskipun gen yang ditranskripsi sama. Jika ayam disuntik dengan estrogen. Pengaturan umur mRNA juga dijumpai pada telur yang belum dibuahi. dalam hal ini transkrip primernya sebenarnya sama. ditemukan bahwa perbedaan sintesis enzim α-amilase oleh berbagai mRNA yang berasal dari gen yang sama dapat terjadi karena adanya perbedaan pola pembuangan intron. (2) pengikatan pada suatu protein efektor. Fenomena ini seringkali berkaitan dengan adanya molekul-molekul mRNA yang berbeda. Pengaturan translasi Berbeda dengan translasi mRNA pada prokariot yang terjadi dalam jumlah yang lebih kurang sama. misalnya. tetapi rupanya di dalam nukleus kompleks tersebut. atau mungkin hormonnya saja. Contoh induksi transkripsi oleh hormon antara lain dapat dilihat pada stimulasi sintesis ovalbumin pada saluran telur (oviduktus) ayam oleh hormon kelamin estrogen. pada eukariot ada mekanisme pengaturan translasi. (3) aktivasi protein yang terikat DNA. laju sintesis protein menjadi sangat rendah. Hingga kini belum diketahui hakekat unsur tersebut. sedangkan molekul mRNA yang belum ditranslasi itu dinamakan mRNA tersembunyi (masked mRNA). yang akan ditranslasi dengan efisiensi berbeda pula. dan (5) perubahan struktur kromatin agar DNA terbuka bagi enzim RNA polimerase. tetapi kemudian ada perbedaan mekanisme prosesing. (2) pengaturan umur (lifetime) molekul mRNA. dan hanya sel-sel oviduktus yang akan menyintesis mRNA tersebut. Dengan demikian. Macam-macam pengaturan tersebut adalah (1) kondisi bahwa mRNA tidak akan ditranslasi sama sekali sebelum datangnya suatu sinyal. begitu fertilisasi terjadi. jaringan-jaringan oviduktus akan memberikan respon berupa sintesis mRNA untuk ovalbumin. (4) inaktivasi represor. dan (3) pengaturan laju seluruh sintesis protein. Sinyal tersebut tidak lain adalah fertilisasi oleh spermatozoon. . melainkan karena terbatasnya ketersediaan suatu unsur yang dinamakan faktor rekrutmen. hal ini bukan akibat kurangnya pasokan mRNA.

yakni sintesis poliprotein. Sebagai contoh. Zat ini diisolasi dari nukleus sel nanah manusia dan kemudian dikenal dengan nama nuklein atau asam nukleat. tetapi ada kondisi yang dapat disetarakan dengannya. waktu itu fungsinya sama sekali belum diketahui. konsentrasi suatu jenis molekul antibodi dipertahankan konstan oleh mekanisme inhibisi atau penghambatan diri dalam proses translasi. Tempattempat pemotongan ini tidak akan berfungsi serempak. pada eukariot tidak pernah dijumpai mRNA polisistronik. molekul antibodi tersebut berikatan secara khusus dengan molekul mRNA yang menyandinya sehingga inisiasi translasi akan terhambat. Meskipun ternyata asam nukleat selalu dapat diisolasi dari nukleus berbagai macam sel.Sintesis beberapa protein tertentu diatur oleh aktivitas protein itu sendiri terhadap mRNA. Tiap protein ini dapat dilihat sebagai produk satu gen tunggal. Jadi. Poliprotein adalah polipeptida berukuran besar yang setelah berakhirnya translasi akan terpotong-potong untuk menghasilkan sejumlah molekul protein yang utuh. 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar MATERI GENETIK BAB IX MATERI GENETIK       Pembuktian DNA sebagai Materi Genetik Pembuktian RNA sebagai Materi Genetik pada Virus Tertentu Model Struktur Molekul DNA menurut Watson-Crick Tiga Fungsi Materi Genetik Replikasi Semi Konservatif Replikasi Θ dan Replikasi Lingkaran Menggulung BAB IX. . J. Miescher. MATERI GENETIK Pada tahun 1868 seorang mahasiswa kedokteran di Swedia. tetapi bergantian mengikuti suatu urutan. Dalam sistem semacam itu urutan penyandi pada masing-masing gen tidak saling dipisahkan oleh kodon stop dan kodon awal.F. tetapi dipisahkan oleh urutan asam amino tertentu yang dikenal sebagai tempat pemotongan (cleavage sites) oleh enzim protease tertentu. menemukan suatu zat kimia bersifat asam yang banyak mengandung nitrogen dan fosfor. Sintesis beberapa protein dari satu segmen DNA Pada prokariot terdapat mRNA polisistronik yang menyandi semua produk gen. Sebaliknya.

Akan tetapi. Sebaliknya. Ternyata dengan perlakuan ini mencit mengalami kematian. nukleus hasil meiosis baik pada tumbuhan maupun hewan mempunyai kandungan DNA separuh kandungan DNA di dalam nukleus sel somatisnya. bakteri pneumokokus akan membentuk koloni dengan kenampakan halus mengkilap. Di samping itu. yaitu asam deoksiribonukleat atau deoxyribonucleic acid (DNA) dan asam ribonukleat atau ribonucleic acid (RNA). Masingmasing akan diuraikan berikut ini. Meskipun demikian. dalam kurun waktu yang cukup lama fakta semacam itu tidak cukup kuat untuk meyakinkan bahwa DNA adalah materi genetik. sedangkan kandungan RNA dan proteinnya berbeda-beda antara satu sel dan sel yang lain. Sementara itu. Mencit yang diinfeksi dengan pneumokokus S akan mengalami kematian. DNA sebagai Materi Genetik Ada dua bukti percobaan yang menunjukkan bahwa DNA adalah materi genetik. mencit yang diinfeksi dengan strain R dapat bertahan hidup. mencit yang diinfeksi dengan strain S yang sebelumnya telah dipanaskan terlebih dahulu akan dapat bertahan hidup. protein dengan variasi kimia yang tinggi sangat memenuhi syarat sebagai materi genetik. Demikian juga. selama bertahun-tahun protein lebih diyakini sebagai materi genetik. DNA atau protein. dan akibatnya tidak bersifat virulen. sementara DNA hanya merupakan kerangka struktur kromosom. sedangkan strain mutannya yang tidak virulen dilambangkan dengan R. Hasil yang mengundang pertanyaan adalah ketika mencit diinfeksi dengan campuran antara strain S yang telah dipanaskan dan strain R yang masih hidup. dan dari organ paru-parunya dapat diisolasi strain S yang masih hidup. Griffith pada tahun 1928 melakukan percobaan infeksi bakteri pneumokokus (Streptococcus pneumonia) pada mencit. Jika ditumbuhkan pada medium padat. Oleh karena itu. Strain mutan ini akan membentuk koloni dengan kenampakan kasar apabila ditumbuhkan pada medium padat. Bakteri penyebab penyakit pneumonia ini dapat menyintesis kapsul polisakarida yang akan melindunginya dari mekanisme pertahanan tubuh hewan yang terinfeksi sehingga bersifat virulen (menimbulkan penyakit). Pada tahun 1924 studi mikroskopis menunjukkan bahwa DNA terdapat di dalam kromosom. Di sisi lain. pada pertengahan tahun 1940-an terbukti bahwa justru DNA-lah yang merupakan materi genetik pada sebagian besar organisme. Dugaan DNA sebagai materi genetik secara tidak langsung sebenarnya dapat dibuktikan dari kenyataan bahwa hampir semua sel somatis pada spesies tertentu mempunyai kandungan DNA yang selalu tetap. Hal ini terutama karena dari hasil analisis kimia secara kasar terlihat kurangnya variasi kimia pada molekul DNA. selain DNA di dalam kromosom juga terdapat protein sehingga muncul perbedaan pendapat mengenai hakekat materi genetik.Dari hasil analisis kimia yang dilakukan sekitar empat puluh tahun kemudian ditemukan bahwa asam nukleat ada dua macam. Percobaan transformasi F. Pneumokokus yang virulen sering dilambangkan dengan S. yang waktu itu telah diketahui sebagai organel pembawa gen (materi genetik). ada pula strain mutan pneumokokus yang kehilangan kemampuan untuk menyintesis kapsul polisakarida sehingga menjadi tidak tahan terhadap sistem kekebalan tubuh hewan inangnya. . Namun. dan dari organ paru-parunya dapat diisolasi strain S tersebut.

Avery. maka transformasi tidak terjadi. kultur strain S ekstraksi DNA ekstrak DNA + protein kontaminan ditambahkan ke kultur strain R protease kultur strain R RNase kultur strain R DNase kultur strain R strain R + S strain R + S strain R Gambar 9. pada tahun 1944 tiga orang peneliti. bukan RNA atau protein. Jika pada percobaan Avery dan kawan-kawannya itu ditambahkan enzim RNase (pemecah RNA) atau enzim protease (pemecah protein). transformasi tetap berjalan atau strain R berubah juga menjadi S. Namun. dan penambahan tersebut ternyata menyebabkan strain R berubah menjadi S seperti pada percobaan Griffith. Diagram percobaan transformasi yang membuktikan DNA sebagai materi genetik Percobaan infeksi bakteriofag . strain R tidak berubah menjadi strain S. yakni O. jika enzim yang diberikan adalah DNase (pemecah DNA).Dengan hasil tersebut Griffith menyimpulkan bahwa telah terjadi perubahan (transformasi) sifat strain R menjadi S. Transformasi terjadi karena ada sesuatu yang dipindahkan dari selsel strain S yang telah mati (dipanaskan) ke strain R yang masih hidup sehingga strain R yang semula tidak dapat membentuk kapsul berubah menjadi strain S yang dapat membentuk kapsul dan bersifat virulen. adalah DNA. Percobaan Griffith sedikit pun tidak memberikan bukti tentang materi genetik. Mereka melakukan percobaan transformasi secara in vitro. Akan tetapi.1. Artinya. C. Di dalam ekstrak DNA ini terdapat juga sejumlah protein kontaminan. McCarty melakukan percobaan untuk mengetahui hakekat materi yang dipindahkan dari strain S ke strain R. Hal ini jelas membuktikan bahwa materi yang bertanggung jawab atas terjadinya transformasi pada bakteri pneumonia. dan M. yaitu dengan menambahkan ekstrak DNA dari strain S yang telah mati kepada strain R yang ditumbuhkan di medium padat. dan ternyata juga pada hampir semua organisme. MacLeod.

DNA yang sangat banyak mengandung fosfor tetapi tidak mengandung sulfur dilabeli dengan radioisotop 32P. bukannya protein. coli sehingga memungkinkan terjadinya penggandaan partikel T2 di dalam sel inangnya itu. coli adalah materi yang dilabeli dengan 32P atau DNA. yang umumnya banyak mengandung sulfur tetapi tidak mengandung fosfor dilabeli dengan radioisotop 35S. coli. coli ditemukan banyak sekali radiosiotop 32P. maka di dalam sel-sel E. yaitu Escherichia coli. Ketika hasil penggandaan partikel T2 telah mencapai jumlah yang sangat besar. coli akan mengalami lisis. Mula-mula partikel T2 melekatkan ujung ekornya pada dinding sel E. dan siklus reproduksi tadi akan terulang kembali. Untuk memastikan sifat kimia materi genetik yang dimasukkan ke dalam sel inang dilakukan pelabelan terhadap molekul protein dan DNAnya. Percobaan dilakukan dengan mengamati reproduksi bakteriofag (virus yang menyerang bakteri) T2 di dalam sel bakteri inangnya.2. Bakteriofag T2 diketahui mempunyai kandungan protein dan DNA dalam jumlah yang lebih kurang sama. Akhirnya. coli yang membuktikan DNA sebagai materi genetik didapatkan 32 P Bakteriofag T2 dengan protein yang telah dilabeli diinfeksikan pada E. sel E. cara berlangsungnya infeksi T2 pada E. Chase. Dengan sentrifugasi. sel-sel E. Daur hidup bakteriofag T2 dan diagram percobaan infeksi T2 pada E. materi genetik masuk dilabeli dengan 35S dan 32P ke sel inang banyak didapatkan 35 S sel inang lisis banyak Gambar 9. Sebaliknya. Ternyata di dalam sel-sel E. sedangkan pada partikel-partikel T2 hanya ada sedikit sekali radioisotop tersebut. sedangkan pada partikel-partikel T2 masih banyak didapatkan radioisotop tersebut. partikel-partikel T2 yang keluar akan mencari sel inang yang baru. RNA sebagai Materi Genetik pada Beberapa Virus . Apabila dengan cara yang sama digunakan bakteriofag T2 yang dilabeli DNAnya.Percobaan lain yang membuktikan bahwa DNA adalah materi genetik dilaporkan pada tahun 1952 oleh A. coli. Protein. coli sangat sedikit ditemukan radioisotop 35S. Hershey dan M. coli telah diketahui (lihat Bab XII). diikuti oleh masuknya materi genetik T2 ke dalam sel E. coli ini kemudian dipisahkan dari partikel-partikel T2 yang sudah tidak melekat lagi pada dinding selnya. Hasil percobaan ini jelas menunjukkan bahwa materi genetik yang dimasukkan oleh bakteriofag T2 ke dalam sel E. Sebelumnya.

dan basa nukleotida atau basa nitrogen (basa siklik yang mengandung nitrogen).3. Virus ini mengandung molekul RNA yang terbungkus di dalam selubung protein. dapat disimpulkan bahwa materi genetik pada virus-virus yang tidak mempunyai DNA. Jadi. Oleh karena itu. TMV hasil penggandaan ternyata merupakan strain A jika RNAnya berasal dari strain A dan merupakan strain B jika RNAnya berasal dari strain B. adalah RNA. Sebaliknya. bukan protein. faktor yang menentukan strain hasil penggandaan adalah RNA. sedangkan pada RNA adalah ribosa. Mereka melakukan penelitian pada virus mozaik tembakau atau tobacco mozaic virus (TMV). Fraenkel-Conrat dan B. Nukleotida yang satu dengan nukleotida berikutnya dihubungkan oleh ikatan fosfodiester yang sangat kuat. yaitu gugus fosfat. protein RNA pemisahan RNA dari protein Gambar 9. Untuk memastikan di antara kedua makromolekul tersebut yang berperan sebagai materi genetik. Dengan perlakuan kimia tertentu molekul RNA dapat dipisahkan dari selubung proteinnya untuk kemudian digabungkan (direkonstitusi) dengan selubung protein dari strain TMV yang lain. tetapi hanya tersusun dari RNA dan protein. antara lain telah dilakukan percobaan rekonstitusi yang dilaporkan oleh H. Tiap nukleotida terdiri atas tiga komponen. Kedua TMV hasil rekonstitusi ini kemudian diinfeksikan ke inangnya (daun tembakau) agar mengalami penggandaan. Komposisi Kimia Asam Nukleat Hasil analisis kimia asam nukleat menunjukkan bahwa makromolekul ini tersusun dari subunit-subunit berulang (monomer) yang disebut nukleotida sehingga asam nukleat dapat juga dikatakan sebagai polinukleotida. Gula pentosa pada DNA adalah 2-deoksiribosa. Pada DNA basa nitrogen berikatan secara kimia dengan gula pentosa membentuk molekul yang disebut nukleosida sehingga setiap nukleotida pada DNA dapat disebut juga sebagai nukleosida monofosfat. Singer pada tahun 1957. penomoran atom C pada gula pentosa dilakukan menggunakan tanda aksen (’) untuk membedakannya dengan penomoran atom C pada basa nitrogen. yaitu virus yang menyebabkan timbulnya penyakit mozaik pada daun tembakau. Menurut kebiasaan. gula pentosa (gula dengan lima atom karbon). RNA dari strain B direkonstitusi dengan protein dari strain A. seperti halnya TMV. Atom C pada gula pentosa yang berikatan dengan basa nitrogen ditentukan sebagai atom C pertama .Beberapa virus tertentu diketahui tidak mempunyai DNA. Percobaan yang membuktikan RNA sebagai materi genetik pada TMV = TMV strain A = TMV strain B rekonstitusi infeksi ke daun tembakau RNA dari strain A direkonstitusi dengan protein strain B.

(1’). tetapi mengikat gugus H sehingga gula pentosanya dinamakan deoksiribosa. O O O P=O gugus fosfat 5’CH2OH OH 4’ H 3’ H O 5’CH2OH OH 1’ H H 4’ H 3’ H O 1’ H 2’ H 2’ OH H OH OH gula ribosa gula 2-deoksiribosa NH2 O . sedangkan basa pirimidin pada DNA dapat berupa sitosin (C) atau timin (T). sedangkan RNA adalah polinukleotida untai tunggal. Biasanya DNA mempunyai struktur sebagai molekul polinukleotida untai ganda. baik pada DNA maupun RNA. basa nitrogen ada dua macam. Sementara tu. Pada RNA tidak terdapat basa timin. yakni basa dengan cincin rangkap atau disebut purin dan basa dengan cincin tunggal atau disebut pirimidin. tetapi diganti dengan urasil (U). Basa purin. dapat berupa adenin (A) atau guanin (G). Atom C nomor 2’ pada DNA tidak mengikat gugus OH seperti halnya pada RNA. Ini merupakan perbedaan lain di antara kedua macam asam nukleat tersebut.

Hasil analisis kimia yang dilakukan oleh E. Crick. Akan tetapi. Chargaff terhadap kandungan basa nitrogen molekul DNA dari berbagai organisme selalu menunjukkan bahwa konsentrasi adenin sama dengan timin. Komponen kimia asam nukleat Model Struktur DNA Watson-Crick Model struktur fisik molekul DNA pertama kali diajukan pada tahun 1953 oleh J.N N 1 H 2 3 N adenin 4 N H 9 6 5 7 8 H N H N 1 NH2 2 3 N guanin 4 N H 9 6 5 7 8 H NH2 4 N3 5 H H O 4 N3 5 CH3 H O 4 N3 5 H 2 O 1 6 H 2 O 1 6 NH H 2 O 1 6 H NH NH sitosin timin urasil Gambar 9. konsentrasi basa purin total menjadi sama dengan konsentrasi basa pirimidin total. Watson dan F. Dengan sendirinya. sedangkan guanin sama dengan sitosin. nisbah konsentrasi adenin + timin terhadap konsentrasi guanin + sitosin sangat bervariasi dari spesies ke spesies.C. .4.H.D. Ada dua dasar yang digunakan dalam melakukan deduksi terhadap model tersebut. yaitu 1.

Di salah satu ujung untai polinukleotida. dan begitu pula sebaliknya. Ikatan ini menghubungkan atom C nomor 3’ dengan atom C nomor 5’ pada gula deoksiribosa. Hal ini menyebabkan nisbah A+T terhadap G+C mempengaruhi stabilitas molekul DNA. sedangkan antara basa G dan C yang berpasangan terdapat ikatan hidrogen rangkap tiga. Setiap pasangan basa berjarak 3. Satu sama lain arahnya sejajar tetapi berlawanan (antiparalel). Di ujung lainnya atom C nomor 5’ akan mengikat gugus fosfat sehingga ujung ini dinamakan ujung 5’ atau ujung P. basa G pada satu untai selalu berpasangan dengan basa C pada untai lainnya melalui ikatan hidrogen. Basa-basa nitrogen menghadap ke arah dalam sumbu.4 Å dengan pasangan basa berikutnya. Di dalam satu kali pilinan (360°) terdapat 10 pasangan basa. Pola difraksi yang diperoleh dari hasil pemotretan molekul DNA menggunakan sinar X oleh M. ujung ini dinamakan ujung 3’ atau ujung OH. Franklin. maka untai komplementernya mempunyai arah dari ujung 3’ ke 5’. dan para koleganya menunjukkan bahwa basabasa nitrogen tersusun vertikal di sepanjang sumbu molekul dengan interval 3. nukleotida-nukleotida yang berurutan dihubungkan oleh ikatan fosfodiester. Begitu pula. Kedudukan antiparalel di antara kedua untai polinukleotida sebenarnya dilihat dari ujung-ujung ini. maka urutan basa pada untai lainnya dapat ditentukan pula. Makin tinggi nisbah tersebut. makin rendah stabilitas molekul DNAnya. Seperti telah disebutkan di atas.F. Antara basa A dan T yang berpasangan terdapat ikatan hidrogen rangkap dua.2. Gugus fosfat dan gula terletak di sebelah luar sumbu. dan terjadi ikatan hidrogen antara basa A pada satu untai dan basa T pada untai lainnya.4 Å. Menurut model ini kedua untai polinukleotida saling memilin di sepanjang sumbu yang sama. Jika untai yang satu mempunyai arah dari ujung 5’ ke 3’. Wilkins. begitu urutan basa pada satu untai polinukleotida diketahui. atom C nomor 3’ tidak lagi dihubungkan oleh ikatan fosfodiester dengan nukleotida berikutnya. Oleh karena itu.H. Dari data kimia Chargaff serta difraksi sinar X Wilkins dan Franklin tersebut Watson dan Crick mengusulkan model struktur DNA yang dikenal sebagai model tangga berpilin (double helix). tetapi akan mengikat gugus OH. Oleh karena itu. Adanya perpasangan yang khas di antara basa-basa nitrogen itu menyebabkan kedua untai polinukleotida komplementer satu sama lain. R. OH(3’) P(5’) P P P .

Materi genetik sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah. materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. Meskipun demikan. yang dilaksanakan melalui replikasi. Fungsi ini merupakan fungsi genotipik.5 Diagram struktur molekul DNA = adenin = timin = guanin = sitosin Fungsi Materi Genetik Setelah terbukti bahwa DNA merupakan materi genetik pada sebagian besar organisme. Tanpa perubahan semacam ini. Fungsi ini merupakan fungsi evolusioner. 3. yang sekarang ternyata adalah DNA. 2. . Bagian setelah ini akan membahas replikasi DNA. 1. Artinya.P P P P P P(5’) OH(3’) = gula Gambar 9. harus dapat menjalankan tiga fungsi pokok berikut ini. Materi genetik harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya. yang dilaksanakan melalui ekspresi gen (Bab X). dari generasi ke generasi. Materi genetik harus mengatur perkembangan fenotipe organisme. Fungsi ini merupakan fungsi fenotipik. yang dilaksanakan melalui peristiwa mutasi (Bab XI). sifat-sifat molekulernya baru sedikit sekali terungkap. Dalam beberapa dasawarsa pertama semenjak gen dikemukakan sebagai faktor yang diwariskan dari generasi ke generasi. ketika itu telah disepakati bahwa gen sebagai materi genetik. evolusi tidak akan pernah berlangsung. kita akan melihat fungsi yang harus dapat dilaksanakan oleh molekul tersebut sebagai materi genetik.

semikonservatif. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru. dan dispersif. Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. Namun. Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru.Replikasi DNA Ada tiga cara teoretis replikasi DNA yang pernah diusulkan. Sementara itu. yaitu konservatif. . pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat. masing-masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. Kemudian.

S. DNAnya mempunyai kerapatan tinggi. Selanjutnya. Akibatnya.6.724 g/cm3. Tiga cara teoretis replikasi DNA = untai lama = untai baru Di antara ketiga cara replikasi DNA yang diusulkan tersebut.W. coli yang ditumbuhkan pada medium 15N terlihat menempati dasar tabung. coli yang semula ditumbuhkan pada medium 15N selama beberapa generasi.700 g/cm3. maka akan terjadi keseimbangan tingkat kerapatan.coli telah ditumbuhkan selama beberapa generasi pada medium 14 N. Kemudian. sedangkan kerapatan larutan 6M CsCl adalah 1. Sebagai perbandingan. katakanlah 30.708 g/cm3 dan 1.coli dengan basa nitrogen yang mengandung isotop 14N dan 15N masingmasing adalah 1.konservatif semikonservatif dispersif Gambar 9. sedangkan DNA yang berada di bagian tengah tabung tetap. DNA yang diekstrak dari sel E. DNA yang diekstrak dari sel E. Hal ini karena molekul-molekul garam tersebut akan mengendap ke dasar tabung sentrifuga akibat adanya gaya sentrifugal. Stahl. Molekul DNA dengan tingkat kerapatan tertentu akan menempati kedudukan yang sama dengan kedudukan larutan garam yang tingkat kerapatannya sama dengannya. maka Meselson dan Stahl dapat mengikuti perubahan tingkat kerapatan DNA sel-sel bakteri E. pada generasi 14N yang pertama. Meselson dan Stahl menjelaskan bahwa pada generasi 15 N. Ketika E.000 rpm. atau dianggap sebagai generasi 0. kemudian dikembalikan ke medium normal 14N selama beberapa generasi berikutnya. Molekul DNA mempunyai kerapatan yang lebih kurang sama dengan kerapatan larutan garam yang sangat pekat seperti larutan 6M CsCl (sesium khlorida). Percobaan ini dilaporkan hasilnya pada tahun 1958 oleh M. Molekul DNA dengan basa nitrogen yang mengandung 15N mempunyai tingkat kerapatan (berat per satuan volume) yang lebih tinggi daripada DNA normal (14N). DNAnya merupakan hibrid . basa-basa nitrogen pada molekul DNA sel-sel bakteri tersebut akan memiliki 15N yang berat. kerapatan DNA E. Mereka menumbuhkan bakteri Escherichia coli selama beberapa generasi di dalam medium yang mengandung isotop nitrogen 15N untuk menggantikan isotop nitrogen normal 14N yang lebih ringan. Oleh karena molekul-molekul dengan tingkat kerapatan yang berbeda dapat dipisahkan dengan cara sentrifugasi tersebut di atas. Pada generasi kedua setelah E. Meselson dan F.000 hingga 50. DNAnya nampak makin banyak berada di bagian atas tabung. Ketika larutan 6M CsCl yang di dalamnya terdapat molekul DNA disentrifugasi dengan kecepatan sangat tinggi. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation. sementara di sisi lain difusi akan menggerakkan molekul-molekul garam kembali ke atas tabung.coli yang pertama kali dipindahkan kembali ke medium 14N terlihat menempati bagian tengah tabung. atau disebut sebagai generasi 1.coli ditumbuhkan pada medium 14N ternyata DNAnya menempati bagian tengah dan atas tabung. dalam waktu 48 hingga 72 jam.

7 terlihat bahwa interpretasi data hasil percobaan sentrifugasi ini jelas sejalan dengan cara pembentukan molekul DNA melalui replikasi semikonservatif. DNA hibrid akan tetap jumlahnya. Pada Gambar 9. sedangkan DNA baru dengan kerapatan rendah akan makin banyak dijumpai. medium 15N (generasi 0) ekstrak DNA ekstrak DNA medium 14N (generasi 1) ekstrak DNA (generasi 2) medium 14N . Pada generasi 2 DNA hibridnya masih ada.antara DNA dengan kerapatan tinggi dan rendah. Demikian seterusnya. tetapi muncul pula DNA baru dengan kerapatan rendah.

khloroplas. Dengan kedua teknik ini terlihat bahwa DNA berbagai virus.ekstrak DNA medium 14N (generasi 3) interpretasi data hasil sentrifugasi DNA Gambar 9.8). Diagram percobaan Meselson dan Stahl yang memperlihatkan replikasi DNA secara semikonservatif Pada percobaan Meselson dan Stahl ekstrak DNA yang diperoleh dari sel-sel E. Replikasi ini diawali dengan pemotongan ikatan fosfodiester pada daerah tertentu yang menghasilkan ujung 3’ dan ujung 5’. Pembentukan (sintesis) untai DNA baru terjadi dengan penambahan deoksinukleotida pada ujung 3’ yang diikuti oleh pelepasan ujung 5’ dari lingkaran molekul DNA. Replikasi DNA kromosom dalam keadaan utuh _ yang pada prokariot ternyata berbentuk melingkar atau sirkular _ baru dapat diamati menggunakan teknik autoradiografi dan mikroskopi elektron. pada sejumlah bakteri dan organisme eukariot dikenal pula replikasi yang dinamakan replikasi lingkaran menggulung (rolling circle replication). Replikasi lingkaran menggulung = untai lama = untai baru pemanjangan ’ekor’ . Selain replikasi θ. penambahan nukleotida ujung 3’ tempat ujung 5’ pelepasan ujung 5’ terpotongnya ikatan fosfodiester Gambar 9.7. ujung 5’ akan makin terlepas dari lingkaran tersebut sehingga membentuk ’ekor’ yang makin memanjang (Gambar 9. Sejalan dengan berlangsungnya replikasi di seputar lingkaran DNA. coli berada dalam keadaan terfragmentasi sehingga replikasi molekul DNA dalam bentuknya yang utuh sebenarnya belum diketahui.8. dan mitokhondria melakukan replikasi yang dikenal sebagai replikasi θ (theta) karena autoradiogramnya menghasilkan gambaran seperti huruf Yunani tersebut.

Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. Keempat molekul ini berfungsi sebagai sumber basa nukleotida. G . selain terjadi replikasi dua arah. Segmen asam nukleat pendek. . . 2. DNA cetakan T A G C T A C. Biasanya. yang mempunyai gugus 3’. . Salah satu diantaranya adalah enzim DNA polimerase. 1. diperlukan tiga komponen reaksi.Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam lingkaran molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori). Hasil penambahan yang diperoleh adalah molekul DNA yang terdiri atas empat nukleotida (A-C-A-G)... T A dGTP 3’ P 5’ 5’ 3’ P G C T A PPi 3’ P 5’ OH 3’ DNA polimerase P Mg2+ 5’ 5’ 5’ 3’ P 5’ 3’ P 3’ P OH C . dan deoksitimidin trifosfat (dTTP). . Kita lihat bahwa sintesis DNA (penambahan basa demi basa) berlangsung dari ujung 5’ ke ujung 3’. Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan. terjadi dua arah (bidireksional).. deoksiguanosin trifosfat (dGTP).9. Dua buah atom fosfat (PPi) dilepaskan dari dGTP karena sebuah atom fosfatnya diberikan ke primer dalam bentuk nukleotida dengan basa G atau deoksinukleosida monofosfat (dGMP). Penambahan dGTP terjadi karena untai DNA cetakannya mempunyai urutan basa T-G-TC. Reaksi sintesis DNA secara skema dapat dilihat pada Gambar 9. . . Pada eukariot. melibatkan sejumlah reaksi kimia yang diatur oleh beberapa enzim. yaitu 1. yang terdiri atas deoksiadenosin trifosfat (dATP).OH bebas.. . Agar DNA polimerase dapat bekerja mengatalisis reaksi sintesis DNA.. Enzim-enzim yang berperan dalam replikasi DNA Replikasi DNA. Deoksinukleosida trifosfat. deoksisitidin trifosfat (dCTP). yang mengatur pembentukan ikatan fosfodiester antara dua nukleotida yang berdekatan sehingga akan terjadi pemanjangan untai DNA (polinukleotida). dapat berupa DNA atau RNA. inisiasi replikasi DNA. Dalam gambar tersebut sebuah molekul dGTP ditambahkan ke molekul primer yang terdiri atas tiga nukleotida (A-CA).. baik pada prokariot maupun eukariot. Molekul yang dinamakan primer ini diperlukan karena tidak ada enzim DNA polimerase yang diketahui mampu melakukan inisiasi sintesis DNA. atau sintesis DNA. yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi. Untai DNA yang akan digunakan sebagai cetakan (template). ori dapat ditemukan di beberapa tempat. .

enzim DNA polimerase untuk sintesis DNA kromosom pada eukariot disebut polimerase α. yang masing-masing mempunyai arah 5’→ 3’. Dalam sintesis DNA. Kedua enzim ini berperan dalam pembukaan pilinan di antara kedua untai DNA sehingga kedua untai tersebut dapat saling memisah. coli ada dua macam. pemotongan terjadi dari ujung 3’ ke arah ujung 5’.9. Enzim ini bekerja pada tahap inisiasi dengan cara mengatur pembentukan molekul primer di daerah ori. tetapi pada kedua-duanya. Sementara itu. Selain mampu melakukan pemanjangan atau polimerisasi DNA. Enzim lain yang berperan dalam proses sintesis DNA adalah primase.Gambar 9. sedangkan enzim Pol I memegang peran sekunder. Aktivitas nuklease dapat dibedakan menjadi (1) eksonuklease atau pembuangan nukleotida dari ujung polinukleotida dan (2) endonuklease atau pemotongan ikatan fosfodiester di dalam untai polinukleotida. yang bisa saja terjadi meskipun sangat jarang (sekitar satu di antara sejuta basa !). Pada bagian berikut ini akan dijelaskan bahwa sintesis DNA baru tidak hanya terjadi pada salah satu untai DNA. Namun. coli mempunyai aktivitas eksonuklease yang hanya bekerja pada ujung 3’. Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. misalnya A dengan C. yaitu DNA polimerase I (Pol I) dan DNA polimerase III (Pol III). Artinya. Tahap inisiasi sintesis DNA juga melibatkan enzim DNA girase dan protein yang mendestabilkan pilinan (helix destabilizing protein). Enzim Pol I dan Pol III dari E. Hal ini bermanfaat untuk memperbaiki kesalahan sintesis DNA atau kesalahan penambahan basa. Skema reaksi sintesis DNA Enzim DNA polimerase yang diperlukan untuk sintesis DNA pada E. Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. yaitu pembuangan molekul nukleotida dari untai polinukleotida. Fungsi perbaikan kesalahan yang dijalankan oleh enzim Pol I dan III tersebut dinamakan fungsi penyuntingan (proofreading). Hanya saja sintesis DNA pada salah satu untai berlangsung tidak kontinyu sehingga menghasilkan fragmen yang terputus-putus. Setelah primer terbentuk barulah DNA polimerase melakukan elongasi atau pemanjangan untai DNA. sebagian besar enzim DNA polimerase mempunyai aktivitas nuklease. Kesalahan penambahan basa pada untai polinukleotida yang sedang tumbuh (dipolimerisasi) menjadikan basa-basa salah berpasangan. Pol III merupakan enzim replikasi yang utama. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). Untuk menyambung fragmen-fragmen ini diperlukan enzim yang disebut DNA ligase. Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. Terjadinya sintesis . sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. Khusus enzim Pol I ternyata juga mempunyai aktivitas eksonuklease 5’→ 3’ di samping aktivitas eksonuklease 3’→5’ (lihat juga Bab XI).

Mulai tahap ini kedua sel (ekskonjugan) secara genetik menjadi sama.DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. yang tujuh di antaranya akan mengalami degenerasi. Satu mikronukleus yang tersisa mengalami mitosis menjadi dua mikronuklei haploid. Seperti telah dikemukakan di atas. ori 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ untai baru kontinyu untai pengarah fragmen-fragmen 5’ 3’ 3’ 5’ Okazaki untai tertinggal 5’ 3’ Gambar 9. yang kemudian mengalami dua kali mitosis menjadi . Kedua mikronuklei ini bergabung membentuk satu mikronukleus diploid. Selanjutnya. Sementara itu. sesuai dengan nama penemunya. Fase aseksual juga diawali dengan meiosis mikronuklei menjadi delapan mikronuklei haploid. membran sel di tempat kedua sel berlekatan akan rusak sehingga terjadi pertukaran salah satu mironuklei antarsel. yang tujuh di antaranya mengalami degenerasi. yang diikuti dengan fusi kedua mikronuklei menjadi satu mikronukleus diploid. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). Satu mikronukleus yang tersisa mengalami mitosis menjadi dua mikronuklei yang juga haploid. fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. Diagram replikasi pada kedua untai DNA 11/01/2009 Posted by zaifbio | Genetika Dasar | 3 Komentar Sterilitas Jantan pada Jagung hingga dihasilkan delapan mikronuklei haploid.10.

Kemungkinan ke dua terjadi pertukaran materi sitoplasmik di antara kedua sel (Gambar 8. Sebaliknya sel pembunuh (Kk) melalui autogami dapat menghasilkan sel bukan pembunuh (kk) karena partikel kappa tidak akan mampu bertahan di dalam sitoplasma tanpa adanya gen K. Hal yang perlu untuk diketahui pada fase aseksual ini adalah bahwa meskipun sel yang mengalami autogami pada awalnya heterozigot. yaitu sterilitas jantan sitoplasmik pada jagung. Dengan demikian.a) sehingga diperoleh dua kelompok sel. genotipe KK dapat menghasilkan fenotipe bukan pembunuh jika di dalam sitoplasma tidak terdapat partikel kappa. Keberadaan kappa bergantung kepada gen kromosomal dominan K. Sonneborn. Tanaman jagung dikatakan steril atau mandul jantan sitoplasmik apabila tidak mampu menghasilkan polen yang aktif dalam jumlah normal sementara proses reproduksi dan fertilitas betinanya normal. maka akan diperoleh sel pembunuh (KK) dan sel bukan pembunuh (kk) dengan nisbah 1 : 1. Sterilitas Jantan pada Jagung Di bidang pertanian ada satu contoh fenomena pewarisan sitoplasmik yang sangat penting. kedua sel tidak bertukar materi sitoplasmik tetapi hanya bertukar mikronuklei (Gambar 8. peristiwa autogami pada hakekatnya sangat menyerupai pembuahan sendiri. yakni sel pembunuh yang bergenotipe Kk. Jadi.M. maka ada dua kemungkinan yang dapat terjadi. Dari hasil autogami dapat dipelajari bahwa pewarisan suatu sifat diatur oleh gen-gen kromosomal ataukah sitoplasmik. Apabila strain pembunuh melakukan konjugasi dengan strain bukan pembunuh (pada suatu kondisi yang memungkinkan strain bukan pembunuh untuk bertahan hidup). mengamati bahwa sel P.5. seperti T. Jika masing-masing sel ini melakukan autogami. Sterilitas jantan sitoplasmik tidak diatur oleh gen-gen kromosomal tetapi diwariskan melalui sitoplasma gamet betina dari .5 b) sehingga hanya diperoleh satu kelompok sel. Kedua mikronuklei yang tersisa mengalami mitosis menjadi empat mikronuklei diploid. Beberapa peneliti. sedangkan partikel-partikel kappa ternyata merupakan bakteri simbion yang kemudian dikenal dengan nama Caedobacter taeniospiralis. aurelia yang mengandung partikel-partikel kappa akan menghasilkan senyawa beracun yang dapat mematikan strainstrain protozoa lainnya yang ada di sekitarnya. dari hasil tersebut tampak jelas bahwa sifat pembunuh atau bukan pembunuh ditentukan oleh ada tidaknya partikel kappa di dalam sitoplasma walaupun partikel itu sendiri keberadaannya bergantung kepada gen K di dalam nukleus. Setelah terjadi sitokinesis (pemisahan sel) diperoleh dua buah sel masing-masing dengan dua mikronuklei dan satu makronukleus yang semuanya diploid. Pada strain tertentu Paramecium aurelia ditemukan adanya fenomena ‘pembunuh’ (killer) yang berkaitan dengan keberadaan sejumlah partikel yang disebut sebagai kappa di dalam sitoplasmanya. Pertama. Jika sel-sel ini melakukan autogami. maka akan diperoleh sel pembunuh (KK) dan sel bukan pembunuh (kk) yang berasal dari sel pembunuh (Kk) serta sel bukan pembunuh (baik KK maupun kk) yang berasal dari sel bukan pembunuh (Kk). yakni sel pembunuh dan sel bukan pembunuh yang kedua-duanya bergenotipe Kk. Dua di antara mikronuklei ini berkembang menjadi makronuklei. yang artinya bakteri pembunuh berbentuk pita spiral. khususnya dalam hal peningkatan homozigositas. sel-sel yang dihasilkan semuanya akan menjadi homozigot karena sel awal heterozigot tersebut terlebih dahulu mengalami meiosis menjadi sel haploid. Senyawa beracun ini selanjutnya disebut sebagai paramesin.empat mikronuklei diploid. Dengan demikian.

Rhoades melalui percobaan persilangan pada jagung.6. mutan poki juga memperoleh energi untuk pertumbuhannya . cerevisae dalam hal pertumbuhannya yang lambat dan kerusakan fungsi mitokondrianya. sel kehilangan kemampuan untuk membentuk protein yang diperlukan dalam metabolisme oksidatif. Sebaliknya.generasi ke generasi. persilangan antara betina tipe liar dan jantan poki menghasilkan keturunan yang semuanya normal. Mutan poki menyerupai mutan petit pada S. Individu mandul jantan sebagai tetua betina disilangkan dengan individu normal sebagai 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar Materi Genetik di dalam Kloroplas. Pola pewarisan sterilitas jantan pertama kali dipelajari oleh M. Jenis sterilitas ini telah banyak digunakan dalam produksi biji jagung hibrida. Secara biokimia kelainan ini berupa gangguan pada sistem sintesis protein mitokondria yang diatur oleh materi genetik di dalam mitokondria. yang secara skema dapat dilihat pada Gambar 8. betina tersebut dinamakan mutan poki (poky mutant). Persilangan antara betina poki dan jantan tipe liar menghasilkan keturunan yang semuanya poki. Akibatnya. Seperti halnya mutan petit.

khususnya daun. Selsel pada bagian yang berwarna hijau mempunyai kloroplas yang mengandung klorofil. bagian yang belang-belang . Dia mengamati bahwa pewarisan warna tersebut semata-mata ditentukan oleh tetua betina dan berkaitan dengan ada tidaknya kloroplas di dalam sitoplasma. dan belang-belang hjau-putih (variegated). pada beberapa tanaman tertentu seperti bunga pukul empat (Mirabilis jalapa). Materi Genetik di dalam Kloroplas.melalui jalur fermentasi anaerob yang sangat tidak efisien. putih. Sementara itu. sedang sel-sel pada bagian yang berwarna putih tidak mempunyai kloroplas tetapi berisi plastida yang tidak berwarna. Carl Correns pada tahun 1908 melihat adanya perbedaan hasil persilangan resiprok pada pewarisan warna bagian vegetatif tanaman. Suatu tanaman bunga pukul empat dapat memiliki bagian vegetatif yang berbedabeda warnanya. yaitu hijau.

hijau. Model yang menjelaskan pewarisan maternal ini dapat dilihat pada Gambar 8. baik sebagai sumber polen (tetua jantan) maupun sebagai pembawa putik (tetua betina). sementara polen hanya sedikit sekali atau bahkan sama sekali tidak memiliki kloropas. Ketiga macam bagian tanaman tersebut dapat menghasilkan bunga. hijau. Tabel 8.1 Hasil persilangan pada tanaman bunga pukul empat Fenotipe cabang yang membawa bunga sebagai tetua betina putih putih putih hijau hijau hijau belang-belang belang-belang belang-belang Fenotipe cabang yang membawa bunga sebagai tetua jantan Putih Hijau belang-belang Putih Hijau belang-belang Putih Hijau belang-belang Fenotipe keturunan putih putih putih hijau hijau hijau belang-belang. Hal ini karena seperti telah dikatakan di atas bahwa warna hijau bergantung kepada ada tidaknya kloroplas. yakni mt + dan mt .1 bahwa fenotipe keturunan akan selalu sama dengan fenotipe tetua betina atau terjadi pewarisan maternal. yang hasilnya dapat dilihat pada Tabel 8. sehingga dimungkinkan adanya sembilan kombinasi persilangan. atau putih belang-belang. hijau. Jelas dapat disimpulkan dari Tabel 8.1. baik dengan maupun tanpa kloroplas. yakni mengenai pewarisan sifat ketahanan terhadap antibiotik.terdiri atas sel-sel. atau putih belang-belang. Kedua macam sel haploid ini dapat bergabung membentuk zigot diploid. kontribusi kloroplas kepada zigot dapat dipastikan hanya berasal dari sel kelamin betina. Ada dua macam sel pada Chlamydomonas bila dilihat dari tipe kawinnya.2. atau putih Penelitian tentang pewarisan sitoplasmik telah dilakukan pula pada alga uniseluler Chlamydomonas reinhardii. Dengan demikian. yang selanjutnya . Sel alga ini memiliki sebuah kloroplas yang besar ukurannya dan di dalamya terdapat sejumlah materi genetik.

maka kontribusi sitoplasma kepada zigot yang terbentuk akan sama banyaknya.akan mengalami meiosis untuk menghasilkan tetrad yang terdiri atas empat buah sel haploid. putih hijau belang-belang sel telur x polen x x x x zigot Gambar 8. Oleh karena kedua sel tipe kawin tersebut ukurannya sama besar. Model pewarisan maternal pada tanaman bunga pukul empat = plastida tanpa klorofil . Sel-sel haploid di dalam tetrad dapat ditumbuhkan pada medium selektif padat dan membentuk koloni yang menunjukkan genotipenya. = kloroplas .2.

maka tidak mungkin terjadi pewarisan uniparental. Dengan demikian. Secara skema persilangan tersebut dapat digambarkan seperti pada Gambar 8.menghasilkan keturunan yang semuanya tahan streptomisin (str+) sementara persilangan mt+ str . yakni menghasilkan keturunan dengan nisbah 1 : 1. maka sifat ini jelas dibawa oleh kloroplas. pewarisan sifat ketahanan terhadap antibiotik pada Chlamydomonas merupakan pewarisan ekstrakromosomal atau pewarisan sitoplasmik. Berbagai penelitian mengenai ketahanan terhadap antibiotik selain streptomisin telah dilakukan pula pada Chlamydomonas. Jadi.zigot mt – str+ mt+ mt – mt+ mt – mt+ mt – mt+ mt – .Persilangan resiprok antara tipe liar (rentan antibiotik) dan mutan-mutan yang tahan antibiotik memberikan hasil yang berbeda-beda.mt+ str . dalam hal ini mt+. pewarisan alel str mengikuti pola pewarisan uniparental. Dengan perkataan lain. yang menunjukkan bahwa alel tersebut terletak di dalam kromosom nukleus. pewarisan sifat ketahanan terhadap streptomisin berlangsung uniparental atau bergantung kepada genotipe salah satu tetuanya. kloroplas dapat dipastikan berasal dari salah satu tipe kawin saja. Jadi. Sebagai contoh. Analisis biokimia membuktikan bahwa sifat ketahanan terhadap antibiotik berhubungan dengan kloroplas.dengan mt .str+ menghasilkan keturunan yang semuanya rentan streptomisin (str -) .3. Dengan perkataan lain. kloroplas dari mt – akan hilang oleh suatu sebab yang hingga kini beluim diketahui. Jika kloroplas ini berasal dari penggabungan kloroplas kedua sel tipe kawin yang digunakan sebagai tetua dengan nisbah yang sama. Persilangan mt+ str+ dengan mt – str . dan semuanya memperlihatkan terjadinya pewarisan uniparental. mt+ str+ zigot mt – str . persilangan antara tipe liar dan mutan yang tahan terhadap streptomisin menghasilkan keturunan yang sifat ketahanannya terhadap streptomisin bergantung kepada tetua mt+. Meskipun demikian. Seperti telah kita ketahui bahwa sel haploid Chlamydomonas hanya mempunyai sebuah kloroplas. Keturunan hasil persilangan antara kedua tipe kawin selalu mempunyai genotipe seperti salah satu tetuanya. Oleh karena pewarisan sifat ketahanan terhadap antibiotik selalu ditentukan oleh tetua mt +. yang berarti sejalan dengan pola pewarisan kloroplas. Hal ini didukung oleh penelitian menggunakan penanda fisik untuk membedakan kloroplas dari kedua tipe kawin yang telah menunjukkan bahwa setelah terjadi penggabungan. kloroplas yang diwariskan hanya berasal dari tetua mt +. alel yang menentukan tipe kawin itu sendiri (alel mt) tampak bersegregasi mengikuti pola Mendel.

str+ mt+str .=rentan streptomisin) 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar PEWARISAN SITOPLASMIK BAB VIII PEWARISAN SITOPLASMIK      Kriteria Pewarisan Sitoplasmik Organel Sitoplasmik Pembawa Materi Genetik Pengaruh Genetik Simbion Sitoplasmik pada Paramaecium Mekanisme Sterilitas Jantan pada Jagung Pengaruh Maternal dan Pewarisan Maternal BAB VIII. Meskipun demikian. str+ = tahan streptomisin . Diagram pewarisan sifat ketahanan terhadap streptomisin pada Chlamydomonas (mt = tipe kawin .mt – str – Gambar 8. str .3.semuanya str+ semuanya str – mt+ str+ mt . sesekali pernah pula dilaporkan bahwa ada sejumlah sifat genetik pada eukariot yang . PEWARISAN SITOPLASMIK Sebegitu jauh pembicaraan kita tentang pewarisan sifat pada eukariot selalu dikaitkan dengan gen-gen yang terletak di dalam kromosom/nukleus. Kenyataannya gengen kromosomal ini memang memegang peranan utama di dalam pewarisan sebagian besar sifat genetik.

. Namun. ini tidak mengikuti pola Mendel. kloroplas (pada tumbuhan). setidaktidaknya lima hal di bawah ini dapat digunakan untuk keperluan tersebut. Di bagian akhir dibicarakan pula suatu fenomena lain yang masih ada sangkut pautnya dengan pewarisan sitoplasmik. dan beberapa komponen sitoplasmik lainnya. Perbedaan hasil perkawinan resiprok merupakan penyimpangan dari pola Mendel. Jika dalam hal ini pengaruh rangkai kelamin (Bab VI) dikesampingkan. Begitu juga virus dan partikel mirip bakteri dapat bertindak sebagai pembawa sifat herediter sitoplasmik. 1. hasil persilangan antara betina A dan jantan B tidak sama dengan hasil persilangan antara betina B dan jantan A. Pewarisan sifat sitoplasmik diatur oleh materi genetik yang terdapat di dalam organel-organel seperti mitokondria. maka perbedaan hasil perkawinan resiprok tersebut menunjukkan bahwa salah satu tetua (biasanya betina) memberikan pengaruh lebih besar daripada pengaruh tetua lainnya dalam pewarisan suatu sifat tertentu. Pada Bab VIII ini akan dibahas berbagai contoh kasus yang termasuk dalam pewarisan sitoplasmik. Pewarisan ekstranukleus. Sebagai contoh.pewarisannya diatur oleh unsur-unsur di luar nukleus. atau dikenal pula sebagai pewarisan sitoplasmik. Kriteria Pewarisan Sitoplasmik Sebenarnya tidak ada kriteria yang dapat berlaku universal untuk membedakan pewarisan sitoplasmik dengan pewarisan gen-gen kromosomal.

Oleh karena itu. sangat dimungkinkan bahwa materi genetik tersebut terdapat di dalam sitoplasma 4. Organel dan simbion di dalam sitoplasma dimungkinkan untuk diisolasi dan dianalisis untuk mendukung pembuktian tentang adanya transmisi maternal dalam pewarisan sifat. yang memiliki molekul DNA (lihat Bab IX) dan dapat melakukan replikasi subseluler sendiri. Beberapa hasil . Sel kelamin betina biasanya membawa sitoplasma dan organel sitoplasmik dalam jumlah lebih besar daripada sel kelamin jantan.2. Tidak adanya nisbah segregasi Mendel menunjukkan bahwa pewarisan sifat tidak diatur oleh gen-gen kromosomal tetapi oleh materi sitoplasmik. maka pewarisan tersebut terjadi karena pengaruh materi sitoplasmik. maka dapat dipastikan bahwa pewarisan sifat tersebut merupakan pewarisan sitoplasmik. Gen-gen kromosomal menempati loki tertentu dengan jarak satu sama lain yang tertentu pula sehingga dapat membentuk kelompok berangkai (Bab V). Oleh karena itu. Organel Sitoplasmik Pembawa Materi Genetik Di dalam sitoplasma antara lain terdapat organel-organel seperti mitokondria dan kloroplas. 5. jika ada suatu materi penentu sifat tidak dapat dipetakan ke dalam kelompok-kelompok berangkai yang ada. Substitusi nukleus dapat memperjelas pengaruh relatif nukleus dan sitoplasma. Jika pewarisan suatu sifat berlangsung tanpa adanya pewarisan gen-gen kromosomal. Jika materi sitoplasmik terbukti berkaitan dengan pewarisan sifat tertentu. 3. kedua organel ini sering kali disebut sebagai organel otonom.

Mutan Mitokondria Pada suatu penelitian menggunakan khamir Saccharomyces cerevisae B. Pada alga hijau plastida diduga membawa mekanisme genetik lainnya. kloroplas sebagai organel fotosintetik pada tumbuhan dan beberapa mikroorganisme membawa sejumlah materi genetik yang diperlukan bagi struktur dan fungsinya dalam melaksanakan proses fotosintesis. Gen-gen ini di antaranya bertanggung jawab atas struktur mitokondria itu sendiri dan juga pengaturan berbagai bentuk metabolisme energi. Klorofil beserta kelengkapan untuk sintesisnya telah dirakit ketika kloroplas masih dalam bentuk alga yang hidup bebas. yang nanti akan dibicarakan pada bagian lain bab ini. Enzim-enzim untuk keperluan respirasi sel dan produksi energi terdapat di dalam mitokondria. yang merupakan bahan bakar bagi berbagai reaksi biokomia. misalnya mekanisme ketahanan terhadap antibiotik streptomisin pada Chlamydomonas. diduga membawa hingga lebih kurang 50 gen di dalam molekul DNAnya. Dalam kurun waktu yang sangat panjang mereka kemudian membangun simbiosis turun-temurun dengan sel inang eukariotnya dan akhirnya berkembang menjadi organel yang menetap di dalam sel. Mitokondria. yang dijumpai pada semua jenis organisme eukariot. Ephrusi menemukan sejumlah . Sementara itu.penelitian memberikan petunjuk bahwa mitokondria dan kloroplas pada awalnya masing-masing merupakan bakteri dan alga yang hidup bebas. Begitu juga bahan makanan akan dioksidasi di dalam organel ini untuk menghasilkan senyawa adenosin trifosfat (ATP).

Hal ini menunjukkan bahwa petit segregasional ditimbulkan oleh mutasi di dalam nukleus. Namun. Tipe pertama memperlihatkan segregasi Mendel seperti biasanya sehingga dinamakan petit segregasional.1. Selain itu. Persilangan dengan tipe liarnya menghasilkan zigot diploid yang normal. Jika zigot ini mengalami pembelahan meiosis. Hasil pengamatan mikroskopis menunjukkan bahwa selsel pada koloni tersebut berukuran normal. Analisis genetik terhadap hasil persilangan antara mutan petit dan tipe liarnya memperlihatkan adanya tiga tipe mutan petit seperti dapat dilihat pada Gambar 8. Mutan petit melakukan metabolisme karbon bukan dengan respirasi menggunakan oksigen. oleh karena zigot diploid mempunyai fenotipe normal. maka dapat . akan diperoleh empat askopora haploid dengan nisbah fenotipe 2 normal : 2 petit. melainkan melalui fermentasi glukosa secara anaerob yang jelas jauh kurang efisien bila dibandingkan dengan respirasi aerob. Koloni-koloni ini dinamakan mutan petit (petite mutant). hasil studi fisiologi menunjukkan bahwa sel-sel tersebut mengalami petumbuhan yang sangat lambat karena adanya kelainan dalam metabolisme senyawa karbon.koloni berukuran sangat kecil yang kadang-kadang terlihat ketika sel ditumbuhkan pada medium padat.

Berlangsungnya pewarisan uniparental tersebut disebabkan oleh hilangnya sebagian besar atau seluruh materi genetik di dalam mitokondria yang menyandi sintesis enzim respirasi oksidatif pada kebanyakan petit netral.dipastikan bahwa alel yang mengatur mutan petit merupakan alel resesif. Ketika sel petit netral bertemu dengan sel tipe liar. fenotipe keturunan hanya ditentukan oleh tetua normalnya. . Keempat askospora ini semuanya normal. Dengan perkataan lain. Tipe ke dua. yang disebut petit netral. pewarisan sifatnya merupakan pewarisan uniparental. Jadi. sitoplasma sel tipe liar akan menjadi sumber materi genetik mitokhodria bagi spora-spora hasil persilangan petit dengan tipe liar sehingga semuanya akan mempunyai fenotipe normal. berbeda dengan tipe pertama jika dilihat dari keempat askopora hasil pembelahan meiosis zigot diploid. Hasil yang sama akan diperoleh apabila zigot diploid disilang balik dengan tetua petitnya.

Segregasional Supresif Netral ha ploid : x x x zigot diploid : normal normal petit askospor a: 2 normal : 2 petit normal 4 4 petit .

yang hingga kini belum dapat dijelaskan dengan baik. yang pewarisannya berlangsung uniparental melalui tetua betina (pewarisan maternal) meskipun sebenarnya pada jamur ini belum ada perbedaan jenis kelamin yang nyata. pada petit supresif alel penyebab petit bertindak sebagai penghambat (supresor) dominan terhadap aktivitas mitokondria tipe liar. Selain pada khamir S. nukleus bergaris untuk pembentukan petit) mendatar membawa alel Tipe ke tiga disebut petit supresif. seperti halnya pada tipe petit netral. Dengan demikian. kasus mutasi mitokondria juga dijumpai pada jamur Neurospora. cerevisae. Bedanya. Pada persilangannya dengan tipe liar dihasilkan zigot diploid dengan fenotipe petit. Mutan mitokondria pada Neurospora yang diwariskan melalui tetua 10/31/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar . Pewarisan mutasi petit pada persilangan dengan tipe liarnya (lingkaran kecil menggambarkan sel petit . pewarisan uniparental juga terjadi pada tipe petit supresif. Petit supresif juga mengalami kerusakan pada materi genetik mitokondrianya tetapi kerusakannya tidak separah pada petit netral.Gambar 8. Selanjutnya.1. hasil meiosis zigot petit ini adalah empat askospora yang semuanya mempunyai fenotipe petit.

melanogaster tersebut. Gen-gen yang terletak pada kromosom kelamin dinamakan gen rangkai kelamin (sex-linked genes) sementara fenomena yang melibatkan pewarisan gen-gen ini disebut peristiwa rangkai kelamin (linkage). yang meliputi urutan dan jaraknya satu sama lain. terutama hewan dan juga manusia. mempunyai kromosom kelamin. menghasilkan peta kromosom untuk spesies tersebut. Pemberian nama ini karena strukturnya pada individu jantan dan individu betina memperlihatkan perbedaan sehingga dapat digunakan untuk membedakan jenis kelamin individu. Keberadaan gen berangkai pada suatu spesies organisme. misalnya peta kromosom pada lalat Drosophila melanogaster yang terdiri atas empat kelompok gen berangkai (Gambar 5. Seperti halnya gen berangkai (autosomal).4). RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN Pada Bab V telah kita pelajari pola pewarisan sifat yang diatur oleh gen-gen berangkai atau gen-gen yang terletak pada satu kromosom. yaitu kromosom yang pada individu jantan dan betina sama strukturnya sehingga tidak dapat digunakan untuk membedakan jenis kelamin. Adapun gen berangkai yang dibicarakan pada Bab V adalah gengen yang terletak pada kromosom selain kromosom kelamin. dalam hal ini kromosom nomor 1. individu-individu yang dihasilkan melalui kombinasi gamet tersebut memperlihatkan nisbah . gen-gen rangkai kelamin tidak mengalami segregasi dan penggabungan secara acak di dalam gamet-gamet yang terbentuk. disebut sebagai kromosom kelamin. Salah satu dari keempat kelompok gen berangkai atau keempat pasang kromosom pada D. Kromosom semacam ini dinamakan autosom. Ternyata banyak sekali spesies organisme lainnya.RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN BAB VI RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN ·     Kromosom Kelamin dan Autosom Gen Rangkai Kelamin Tipe Penentuan Jenis Kelamin Organisme Kromatin Kelamin dan Hipotesis Lyon Pengaruh Hormon Kelamin dalam Penentuan Jenis Kelamin BAB VI. Akibatnya.

Hasil persilangan Morgan tersebut. Di samping itu. jika pada percobaan Mendel perkawinan resiprok (genotipe tetua jantan dan betina dipertukarkan) menghasilkan keturunan yang sama. Secara skema pewarisan warna mata pada Drosophila dapat dilihat pada Gambar 6. Biasanya. tidak demikian halnya untuk sifat-sifat yang diatur oleh gen rangkai kelamin.fenotipe dan genotipe yang menyimpang dari hukum Mendel. maka gen rangkai kelamin dapat menjadi gen rangkai X (Xlinked genes) dan gen rangkai Y (Y-linked genes). Dia menyilangkan lalat D. dapat dilambangkan dengan tanda +. Oleh karena itu. Persilangan resiprok dengan hasil yang berbeda ini memberikan petunjuk bahwa pewarisan warna mata pada Drosophila ada hubungannya dengan jenis kelamin. dalam hal ini kromosom X. gen pengatur warna mata ini dikatakan sebagai gen rangkai X. Selain itu.H Morgan pada tahun 1910. Pada bab ini akan dijelaskan cara pewarisan macam-macam gen rangkai kelamin tersebut serta beberapa sistem penentuan jenis kelamin pada berbagai spesies organisme. misalnya pengatur warna mata merah ini. dan ternyata kemudian memang diketahui bahwa gen yang mengatur warna mata pada Drosophila terletak pada kromosom kelamin. gen tipe alami bersifat dominan terhadap alel mutannya.1. khususnya pada generasi F1. ternyata berbeda jika tetua jantan yang digunakan adalah tipe alami (bermata merah) dan tetua betinanya bermata putih. perkawinan resiprok menghasilkan keturunan yang berbeda. Kromosom X dan Y masimg-masing lazim dilambangkan dengan tanda dan . meskipun tidak selalu. Pewarisan Rangkai X Percobaan yang pertama kali mengungkapkan adanya peristiwa rangkai kelamin dilakukan oleh T. melanogaster jantan bermata putih dengan betina bermata merah. Oleh karena kromosom kelamin pada umumnya dapat dibedakan menjadi kromosom X dan Y. P: x betina normal jantan mata putih + + w x betina mata putih jantan normal P: w w + F1 : + w + F1: + w w betina normal jantan normal betina normal jantan mata putih . Gen rangkai kelamin dapat dikelompok-kelompokkan berdasarkan atas macam kromosom kelamin tempatnya berada. Dengan perkataan lain. Gen semacam ini dinamakan gen rangkai kelamin tak sempurna (incompletely sex-linked genes). sedang gen pengatur tipe alami. Lalat bermata merah lazim dianggap sebagai lalat normal atau tipe alami (wild type). ada pula beberapa gen yang terletak pada kromosom X tetapi memiliki pasangan pada kromosom Y.

waktu itu kematian akibat perdarahan ini hanya dianggap sebagai takdir semata.b. Melalui dua dari keempat cucu yang heterozigot inilah penyakit hemofilia tersebar di kalangan keluarga Kerajaan Rusia dan Spanyol. individu betina membawa dua buah kromosom X. Individu jantan ini dikatakan bersifat heterogametik. Sebaliknya. Sementara itu. yaitu gangguan dalam proses pembekuan darah. yaitu normal/merah. individu betina ini dikatakan bersifat homogametik. Sebaliknya. Rangkai Z pada ayam . anggota keluarga Kerajaan Inggris saat ini yang merupakan keturunan putra/putri normal Ratu Victoria bebas dari penyakit hemofilia. Rangkai X pada kucing Warna bulu pada kucing ditentukan oleh suatu gen rangkai X. Individu dengan gen dominan yang terdapat pada satu-satunya kromosom X dikatakan hemizigot dominan. individu jantan yang hanya membawa sebuah kromosom X akan menghasilkan dua macam gamet yang berbeda. Pada Drosophila. individu yang memilikinya disebut hemizigot resesif. individu homozigot dominan (betina) dan hemizigot dominan (jantan) mempunyai bulu berwarna hitam. yaitu putih. Oleh karena itu.a) b) Gambar 6. salah seorang di antara putra Ratu Victoria menderita hemofilia sementara dua di antara putrinya karier atau heterozigot. Dalam keadaan heterozigot gen ini menyebabkan warna bulu yang dikenal dengan istilah tortoise shell. Awalnya. dan juga beberapa spesies organisme lainnya. Rangkai X pada manusia Salah satu contoh gen rangkai X pada manusia adalah gen resesif yang menyebabkan penyakit hemofilia.1. Sebaliknya. Istilah hemizigot digunakan untuk menyebutkan genotipe individu dengan sebuah kromosom X. jika gen tersebut resesif. Oleh karena genotipe heterozigot untuk gen rangkai X hanya dapat dijumpai pada individu betina. maka kucing berbulu tortoise shell hanya terdapat pada jenis kelamin betina. Pewarisan sifat semacam ini disebut sebagai criss cross inheritance. Namun. Dari kedua putri yang heterozigot ini lahir tiga cucu laki-laki yang menderita hemofilia dan empat cucu wanita yang heterozigot. kasus hemofilia telah dijumpai sejak lama di negara-negara Arab ketika beberapa anak laki-laki meninggal akibat perdarahan hebat setelah dikhitan. akan nampak bahwa lalat F1 betina mempunyai mata seperti tetua jantannya.1. Diagram persilangan rangkai X pada Drosophila Jika kita perhatikan Gambar 6. Hemofilia baru menjadi terkenal dan dipelajari pola pewarisannya setelah beberapa anggota keluarga Kerajaan Inggris mengalaminya. Sebenarnya. lalat F1 jantan warna matanya seperti tetua betinanya. sehingga gamet-gamet yang dihasilkannya akan mempunyai susunan gen yang sama. Sementara itu. yang dengan sendirinya homolog. Individu homozigot resesif (betina) dan hemizigot resesif (jantan) akan berbulu kuning. yaitu gamet yang membawa kromosom X dan gamet yang membawa kromosom Y.

Contoh gen rangkai Z yang lazim dikemukakan adalah gen resesif br yang menyebabkan pemerataan pigmentasi bulu secara normal pada ayam. Alelnya. maka gen rangkai Y diduga merupakan gen yang sangat stabil. pada kasus ini alel resesif justru dianggap sebagai tipe alami atau normal (dilambangkan dengan +). ternyata ada bagian atau segmen tertentu pada kedua kromosom tersebut yang homolog satu sama lain. Biasanya suatu gen/alel dapat dideteksi keberadaannya apabila fenotipe yang dihasilkannya adalah abnormal. P: + + x b b P: b b x + + jantan normal betina normal jantan bulu pendek betina bulu pendek . ada beberapa gen pada kromosom X yang mempunyai alel pada kromosom Y. sedang individu heterogametik (ZW) adalah betina. Individu homogametik (ZZ) adalah jantan. Oleh karena fenotipe abnormal yang disebabkan oleh gen rangkai Y jumlahnya sangat sedikit. Hanya saja. Oleh karena itu. gen-gen pada segmen kromosom X dan Y yang homolog ini disebut juga gen rangkai kelamin tak sempurna. Dengan perkataan lain.2. dan berlangsung seperti halnya pewarisan gen autosomal. kalau pada rangkai X individu homogametik berjenis kelamin pria/jantan sementara individu heterogametik berjenis kelamin wanita/betina. Pewarisan Rangkai Y Pada umumnya kromosom Y hanya sedikit sekali mengandung gen yang aktif. menyebabkan bulu ayam menjadi burik. Pewarisan Rangkai Kelamin Tak Sempurna Meskipun dari uraian di atas secara tersirat dapat ditafsirkan bahwa kromosom X tidak homolog dengan kromosom Y. Contoh gen holandrik pada manusia adalah Hg dengan alelnya hg yang menyebabkan bulu kasar dan panjang. Pada D. sedang alel dominannya merupakan alel mutan. Jumlah yang sangat sedikit ini mungkin disebabkan oleh sulitnya menemukan alel mutan bagi gen rangkai Y yang dapat menghasilkan fenotipe abnormal.Pada dasarnya pola pewarisan sifat rangkai Z sama dengan pewarisan sifat rangkai X. Gen rangkai Y jelas tidak mungkin diekspresikan pada individu betina/wanita sehingga gen ini disebut juga gen holandrik. Ht dengan alelnya ht yang menyebabkan pertumbuhan bulu panjang di sekitar telinga. pada rangkai Z justru terjadi sebaliknya. Br. dan Wt dengan alelnya wt yang menyebabkan abnormalitas kulit pada jari. Jadi. Pewarisan sifat yang diatur oleh gen semacam ini dapat dikatakan tidak dipengaruhi oleh jenis kelamin. Pewarisan gen yang bersifat resesif ini dapat dilihat pada Gambar 6. melanogaster terdapat gen rangkai kelamin tak sempurna yang menyebabkan pertumbuhan bulu pendek.

Dia berhasil menyimpulkan bahwa sistem penentuan jenis kelamin pada organisme tersebut berkaitan dengan nisbah banyaknya kromosom X terhadap banyaknya autosom. Berikut ini akan dijelaskan beberapa di antaranya. dan tidak ada hubungannya dengan kromosom Y. Di dalam sel somatisnya.F1 : + b betina normal a) + b jantan normal F1: + b betina normal b) + b jantan normal Gambar 6. misalnya belalang. pada ayam individu jantan justru homogametik (ZZ) sementara individu betinanya heterogametik (ZW). Sistem Penentuan Jenis Kelamin Telah disebutkan di atas bahwa pada manusia dan mamalia. mengikuti sistem ZW.1. Sebagai contoh. Penentuan jenis kelamin pada lalat Drosophila Σ kromosom X 1 Σ autosom 2 nibah X/A 0. Secara ringkas penentuan jenis kelamin dengan sistem X/A pada lalat Drosophila dapat dilihat pada Tabel 6. masih banyak sistem penentuan jenis kelamin lainnya. sedang pada individu jantannya hanya ada 13 kromosom. Tabel 6.2. pada sistem XO individu jantan tidak mempunyai kromosom Y. sedang pada ayam. Wilson menemukan bahwa sel somatis serangga Protenor betina mempunyai 14 kromosom. dan unggas lainnya serta ikan tertentu. Sistem nisbah X/A C. Sebaliknya. individu betina memiliki dua buah kromosom X sementara individu jantan hanya mempunyai sebuah kromosom X.1.B. pewarisan gen rangkai kelamin tak sempurna mempunyai pola seperti pewarisan gen autosomal. hal ini mirip dengan sistem XY. E. Sistem XO Sistem XO dijumpai pada beberapa jenis serangga. Penentuan jenis kelamin pada manusia/mamalia dikatakan mengikuti sistem XY. individu pria/jantan adalah heterogametik (XY) sementara wanita/betina adalah homogametik (XX). Jadi. Selain kedua sistem tersebut. Bedanya.5 jenis kelamin jantan .B.2 bahwa perkawinan resiprok untuk gen rangkai kelamin tak sempurna akan memberikan hasil yang sama seperti halnya hasil yang diperoleh dari perkawinan resiprok untuk gen-gen autosomal. Jadi. Diagram pewarisan gen rangkai kelamin tak sempurna Dapat dilihat pada Gambar 6. Dengan demikian. dalam hal ini kucing. jumlah kromosom sel somatis individu betina lebih banyak daripada jumlah pada individu jantan. Bridge melakukan serangkaian penelitian mengenai jenis kelamin pada lalat Drosophila. Dalam hal ini kromosom Y hanya berperan mengatur fertilitas jantan.

Adanya kromosom X yang didapatkan melebihi jumlah kromosom X pada individu normal (diploid) ini disebabkan oleh terjadinya peristiwa yang dinamakan gagal pisah (non disjunction). betina triploid dan tetraploid. serta interseks.5 1.67 0. Lalat ini dikatakan mengalami mozaik seksual atau biasa disebut dengan istilah ginandromorfi.1 akan terlihat bahwa ada beberapa individu yang jumlah kromosom X-nya lebih dari dua buah.2 3 4 4 3 3 2 2 1 2 2 3 4 3 4 3 4 3 1 1.33 betina metabetina metabetina betina 4n betina 3n interseks interseks jantan metajantan Jika kita perhatikan kolom pertama pada Tabel 6.33 1 1 0.75 0.3.5 0. Dalam hal ini ada sel yang menerima dua kromosom X tetapi ada pula yang hanya menerima satu kromosom X. Pada Drosophila terjadinya gagal pisah dapat menyebabkan terbentuknya beberapa individu abnormal seperti nampak pada Gambar 6. Diagram munculnya beberapa individu abnormal pada Drosophila akibat peristiwa gagal pisah Di samping kelainan-kelainan tersebut pernah pula dilaporkan adanya lalat Drosophila yang sebagian tubuhnya memperlihatkan sifat-sifat sebagai jenis kelamin jantan sementara sebagian lainnya betina. yakni individu dengan jenis kelamin metabetina. P: E AAXX x AAXY G gagal pisah gamet : F1 : AXX AO AX AAXXY AY AAXO letal AAOY AAXXX betina betina super jantan steril Gambar 6. yaitu gagal berpisahnya kedua kromosom X pada waktu pembelahan meiosis. Partenogenesis . Penyebabnya adalah ketidakteraturan distribusi kromosom X pada masa-masa awal pembelahan mitosis zigot.3.

atau dengan perkataan lain. dan gen Ts.. Sementara itu. lebah. yaitu melalui telur yang tidak dibuahi. Struktur semacam ini ternyata tidak dijumpai pada sel-sel kucing jantan. Barr. yang mengatur pembentukan bunga jantan. yang mengatur pembentukan bunga betina. tetapi didasarkan atas keberadaan gen tertentu. F. individu jantan berkembang dengan cara partenogenesis. Pada sel somatis wanita terdapat sebuah kromatin kelamin sementara sel somatis pria tidak memilikinya. individu jantan ini hanya memiliki sebuah genom atau perangkat kromosomnya haploid. Pada manusia dilaporkan pula bahwa sel-sel somatis pria. dapat dibedakan dengan sel somatis wanita atas dasar ada tidaknya struktur tertentu yang kemudian dikenal dengan nama kromatin kelamin atau badan Barr. Pada jagung dikenal sistem penentuan jenis kelamin yang tidak bergantung. misalnya sel epitel selaput lendir mulut. Oleh karena itu. bunga betina tetap terbentuk seakan-akan tidak ada alel sk. wanita normal mempunyai sebuah . Selanjutnya diketahui bahwa banyaknya kromatin kelamin ternyata sama dengan banyaknya kromosom X dikurangi satu. Jadi. cacing yang hidup di lingkungan betina dewasa akan mendekati dan memasuki saluran reproduksi cacing betina dewasa tersebut untuk kemudian berkembang menjadi individu jantan yang parasitik. Hal ini misalnya dijumpai pada cacing laut Bonellia. Meskipun demikian. Kromatin Kelamin Seorang ahli genetika dari Kanada.L. khususnya pada lebah. sedang jagung skskTs_ adalah jantan diosius. berkembang dari telur yang dibuahi sehingga perangkat kromosomnya adalah diploid. Sistem gen Sk-Ts Di atas disebutkan bahwa sistem penentuan jenis kelamin pada lebah tidak berhubungan dengan kromosom kelamin. Jagung normal monosius (berumah satu) mempunyai gen Sk. jagung dengan fenotipe Sk_tsts adalah betina diosius (berumah dua). M. Pengaruh lingkungan Sistem penentuan jenis kelamin bahkan ada pula yang bersifat nongenetik. Sebaliknya. Oleh karena itu. sistem tersebut masih ada kaitannya dengan jumlah perangkat kromosom. baik kepada kromosom kelamin maupun jumlah genom. individu betina dan golongan pekerja. Baltzer menemukan bahwa cacing Bonellia yang berasal dari sebuah telur yang diisolasi akan berkembang menjadi individu betina. dapat dikatakan bahwa partenogenesis merupakan sistem penentuan jenis kelamin yang tidak ada sangkut pautnya sama sekali dengan kromosom kelamin tetapi hanya bergantung kepada jumlah genom (perangkat kromosom). Jagung monosius ini mempunyai fenotipe Sk_Ts_. yang jenis kelaminnya semata-mata ditentukan oleh faktor lingkungan. dan tawon. Jagung sksktsts berjenis kelamin betina karena ts dapat mengatasi pengaruh sk. pada tahun 1949 menemukan adanya struktur tertentu yang dapat memperlihatkan reaksi pewarnaan di dalam nukleus sel syaraf kucing betina. alel-alel resesif sk dan ts masing-masing menghalangi pembentukan bunga betina dan mensterilkan bunga jantan. Sementara itu. Dengan demikian.Pada beberapa spesies Hymenoptera seperti semut.

Sebaliknya. Mary F. Sebaliknya. pria normal tidak mempunyai kromatin kelamin karena kromosom X-nya hanya satu.2. Mekanisme kompensasi dosis diusulkan karena adanya fenomena bahwa suatu gen rangkai X akan mempunyai dosis efektif yang sama pada kedua jenis kelamin. Selanjutnya. seorang ahli genetika dari Inggris mengajukan hipotesis bahwa kromatin kelamin merupakan kromosom X yang mengalami kondensasi atau heterokromatinisasi sehingga secara genetik menjadi inaktif. Pada hewan tingkat tinggi dan manusia hormon kelamin disintesis oleh ovarium. Lyon.kromatin kelamin karena kromosom X-nya ada dua. sistem hormon akan mengatur kondisi fisiologi dalam tubuh individu sehingga mempengaruhi perkembangan sifat kelamin sekunder. gen autosomal H yang mengatur pembentukan tanduk pada domba akan bersifat dominan pada individu jantan tetapi resesif pada individu betina. mempunyai sebuah kromatin kelamin yang seharusnya tidak dimiliki oleh seorang pria normal. Dewasa ini keberadaan kromatin kelamin sering kali digunakan untuk menentukan jenis kelamin serta mendiagnosis berbagai kelainan kromosom kelamin pada janin melalui pengambilan cairan amnion embrio (amniosentesis). alelnya h. Oleh karena itu. Dengan perkataan lain. testes. Ekspresi gen terpengaruh kelamin pada domba . wanita penderita sindrom Turner (XO) tidak mempunyai kromatin kelamin yang seharusnya ada pada wanita normal. Tabel 6. Demikian pula. Hormon dan Diferensiasi Kelamin Dari penjelasan mengenai berbagai sistem penentuan jenis kelamin organisme diketahui bahwa faktor genetis memegang peranan utama dalam ekspresi sifat kelamin primer. Sebagai contoh. misalnya penderita sindrom Klinefelter (XXY). gen rangkai X pada individu homozigot akan diekspesikan sama kuat dengan gen rangkai X pada individu hemizigot. Individu betina heterozigot memperlihatkan fenotipe mozaik yang jelas berbeda dengan ekspresi gen semidominan (warna antara yang seragam). dan kelenjar adrenalin. Hipotesis ini dilandasi hasil pengamatannya atas ekspresi gen rangkai X yang mengatur warna bulu pada mencit. Gen terpengaruh kelamin Gen terpengaruh kelamin (sex influenced genes) ialah gen yang memperlihatkan perbedaan ekspresi antara individu jantan dan betina akibat pengaruh hormon kelamin. untuk dapat bertanduk domba betina harus mempunyai dua gen H (homozigot) sementara domba jantan cukup dengan satu gen H (heterozigot). Hipotesis Lyon juga menjelaskan adanya mekanisme kompensasi dosis pada mamalia. kelenjar adrenalin menghasilkan steroid yang secara kimia berhubungan erat dengan gonad. yaitu sebagai penghasil sel kelamin (gamet) dan sebagai penghasil hormon kelamin. bersifat dominan pada domba betina tetapi resesif pada domba jantan. Kromosom X yang aktif pada suatu sel mungkin membawa gen dominan sementara pada sel yang lain mungkin justru membawa gen resesif. Pria dengan kelainan kromosom kelamin. Sementara itu. Ovarium dan testes masing-masing mempunyai fungsi ganda. Hal ini menunjukkan bahwa hanya ada satu kromosom X yang aktif di antara kedua kromosom X pada individu betina.

. 10/31/2009 Posted by zaifbio | Genetika Dasar | 7 Komentar BERANGKAI BAB V BERANGKAI     Dua Gen Berangkai dan Pindah Silang Tiga Gen Berangkai dan Pindah Silang Ganda Pemetaan Kromosom Pemetaan Kromosom pada Manusia BAB V. telah menghasilkan dua hukum Mendel. Akibatnya. Gen yang hanya dapat diekspresikan pada salah satu jenis kelamin dinamakan gen terbatasi kelamin (sex limited genes). tetapi memungkinkan pula kombinasi gen resesif untuk warna biji (k) dengan gen resesif untuk bentuk biji (b). Namun. Oleh karena peluang terjadinya kombinasi-kombinasi tersebut sama besar. serta gen k dengan gen B.Genotipe HH Hh hh Domba jantan bertanduk bertanduk tidak bertanduk Domba betina bertanduk tidak bertanduk tidak bertanduk Contoh lain gen terpengaruh kelamin adalah gen autosomal B yang mengatur kebotakan pada manusia. Sebaliknya. Gen terbatasi kelamin Selain mempengaruhi perbedaan ekspresi gen di antara jenis kelamin. dan juga kombinasi gen K dengan gen b. maka akan terlihat bahwa gamet-gamet yang terbentuk tidak hanya mengandung kombinasi gen dominan untuk warna biji (K) dengan gen dominan untuk bentuk biji (B). sedang wanita heterozigot akan normal. Contoh gen semacam ini adalah gen yang mengatur produksi susu pada sapi perah. Untuk dapat mengalami kebotakan seorang wanita harus mempunyai gen B dalam keadaan homozigot. BERANGKAI Percobaan-percobaan persilangan pada kacang ercis yang dilakukan oleh Mendel. Gen B dominan pada pria tetapi resesif pada wanita. yang dengan sendirinya hanya dapat diekspresikan pada individu betina. individu jantan dengan genotipe tertentu sebenarnya juga mempunyai potensi untuk menghasilkan keturunan dengan produksi susu yang tinggi sehingga keberadaannya sangat diperlukan dalam upaya pemuliaan ternak tersebut. baik monohibrid maupun dihibrid. gen b dominan pada wanita tetapi resesif pada pria. yakni hukum segegasi dan hukum pemilihan bebas. pria heterozigot akan mengalami kebotakan. hormon kelamin juga dapat membatasi ekspresi gen pada salah satu jenis kelamin. Jika kembali kita perhatikan persilangan dihibrid menyangkut pewarisan warna biji dan bentuk biji.

Dari konsep mengenai berangkai ini selanjutnya berkembang pengetahuan mengenai pindah silang (crossing over) dan pemetaan kromosom. Akan tetapi. dalam keadaan gen dominan berangkai dengan gen resesif. H. Muller. yaitu KB. sedang fenomenanya sendiri dinamakan berangkai (linkage). gamet yang mengandung kombinasi gen dominanresesif akan lebih banyak jumlahnya daripada gamet dengan kandungan gen sesama dominan dan sesama resesif. Sebagai contoh. Fenomena berangkai pertama kali ditemukan pada percobaan dihibrid oleh W. jika gen A dan gen B berangkai pada suatu kromosom sementara alel-alel resesifnya. Morgan. Sebaliknya. dapat menjelaskan mekanisme pewarisan gen-gen berangkai pada lalat Drosophila melanogaster.H.J. Gen-gen yang terdapat pada kromosom yang sama dinamakan gen-gen berangkai (linked genes). Saat ini kita telah mengetahui bahwa banyaknya gen pada kacang ercis. Inilah keuntungan lain yang diperoleh Mendel di samping secara kebetulan tanaman yang digunakan adalah diploid. sedang gen pengatur bentuk biji terletak pada kromosom 7. barangkali Mendel tidak akan berhasil merumuskan hukum pemilihan bebas. mereka tidak dapat memberikan interpretasi terhadap hasil persilangan yang diperoleh. Baru sekitar lima tahun kemudian seorang ahli genetika dan embriologi dari Amerika Serikat. Bridges. a dan b. Seandainya gen pengatur warna biji dan gen pengatur bentuk biji terletak pada kromosom yang sama. kB. dan gen a berangkai dengan gen B. Adanya perbedaan jumlah di antara macam gamet yang terbentuk tersebut disebabkan oleh kecenderungan gen-gen berangkai untuk selalu berada bersama-sama. akan mempunyai nisbah 1 : 1 : 1 : 1. jika gen A berangkai dengan gen b. Artinya. Gen pengatur warna biji terletak pada kromosom 1. dan ab dengan nisbah n : 1 : 1 : n. pola segregasi dan rekombinasinya tidak bebas sehingga tiap macam gamet yang dihasilkannya pun menjadi tidak sama jumlahnya. dan kb. jauh lebih banyak daripada jumlah kromosomnya. maka gamet yang mengandung gen-gen dominan dan gamet yang mengandung gen-gen resesif akan dijumpai lebih banyak daripada gamet dengan kombinasi gen dominan-resesif. maka nisbah gamet AB : Ab : aB : ab menjadi 1 : n : n : 1. Artinya. akan menjadi pokok bahasan pada Bab V ini.B.C Punnet pada tahun 1906. dan A.H. yang sebagian besar melibatkan karya Morgan dan para mahasiswanya seperti C. Dalam hal ini n merupakan bilangan positif dengan nilai lebih dari satu. T.maka keempat macam gamet yang dihasilkan. Gen-gen yang mengatur warna biji dan bentuk biji dewasa ini telah diketahui letaknya masing-masing. Sturtevant. Seluk-beluk mengenai gen-gen berangkai. Kb. di dalam sebuah kromosom tertentu dapat dijumpai lebih dari sebuah gen. termasuk cara memetakannya pada kromosom tempat mereka berada. Ab.Bateson dan R. Demikian pula. dan juga pada setiap spesies organisme lainnya. kalau gen-gen yang berangkai adalah sesama dominan dan sesama resesif. aB. maka gamet-gamet yang dihasilkan akan terdiri atas AB. Jadi. Dua Gen Berangkai Dua buah gen yang berangkai akan mengalami segregasi dan rekombinasi dengan pola yang tidak mengikuti hukum Mendel. juga berangkai pada kromosom homolognya. .

a) memperlihatkan pola segregasi dan rekombinasi gen-gen yang terjadi secara bebas karena keduanya tidak berangkai.1. Gamet tipe parental mempunyai susunan gen yang sama dengan susunan gen pada individu. dan ditulis sebagai Ab/aB jika kedudukan berangkainya adalah trans. Gambar 5.1.b) dan 5. Dua gen yang berangkai cenderung untuk selalu bersama-sama atau tidak bersegregasi di dalam gametgamet yang terbentuk. ditulis sebagai AB/ab jika kedua gen tersebut berangkai dengan kedudukan sis. Kedudukan gen berangkai semacam ini dinamakan sis atau coupling phase. penulisan AaBb hanya digunakan apabila kedua gen tersebut tidak berangkai. pada Gambar 5. Baik pada kedudukan sis maupun trans terdapat dua macam gamet. yang masing-masing disebut sebagai gamet tipe parental dan gamet tipe rekombinasi. maka kedudukannya dinamakan trans atau repulsion phase. Jadi. Sementara itu.c) tampak bahwa segregasi dan rekombinasi kedua gen tidak terjadi secara bebas. Pada Gambar 5.c). Gamet yang terbentuk dari individu dihibrid a) Kedua gen tidak berangkai b) Kedua gen berangkai dengan kedudukan sis c) Kedua gen berangkai dengan kedudukan trans Kedudukan Dua Gen Berangkai Kalau kita perhatikan lagi Gambar 5.1 di bawah ini secara skema dapat diperbandingkan tiga kemungkinan segregasi dan rekombinasi gen-gen pada individu dihibrid AaBb. misalnya. individu dihibrid AaBb akan menghasilkan gamet tipe parental AB dan ab serta gamet tipe rekombinasi Ab dan aB jika kedua gen tersebut berangkai dengan kedudukan sis. . Jadi. Sebaliknya.Untuk lebih jelasnya pada Gambar 5. jika gen dominan berangkai dengan gen resesif seperti pada Gambar 5. akan tampak bahwa dua buah gen yang berangkai dapat berada pada dua macam kedudukan atau konfigurasi yang berbeda. Kedudukan gen berangkai harus tercerminkan pada notasi individu yang bersangkutan.b) gen dominan A berangkai dengan gen dominan B dan gen resesif a berangkai dengan gen resesif b. Individu dihibrid AaBb. A a gamet : A A a a a) B b B b 1 1 1 1 A a A a b) B b b B c) n n 1 1 A a A a b B B b n n 1 1 B b A a B b A a b B Gambar 5.1.1.1. sedang gamet tipe rekombinasi susunan gennya merupakan rekombinasi susunan gen pada individu.1.1.

maka hal ini berarti kedua gen tidak berangkai. di antara keduanya masih terdapat pula kemungkinan untuk mengalami segregasi dan rekombinasi sehingga akan diperoleh kombinasi gen-gen seperti yang dijumpai pada gamet tipe rekombinasi. Pindah Silang Telah disebutkan bahwa dua buah gen yang berangkai akan cenderung untuk tetap bersamasama di dalam gamet yang terbentuk. Sebenarnya hubungan linier antara jarak dua gen berangkai dan persentase gamet tipe rekombinasi hanya berlaku lebih kurang hingga nilai 20%. maka jarak antara kedua gen berangkai tersebut dikatakan sama dengan 20% atau 20 satuan peta atau 20 Morgan. Di atas nilai ini peningkatan jarak tidak terus-menerus diikuti oleh peningkatan persentase gamet tipe rekombinasi. Sebaliknya. Di atas telah dikatakan bahwa gamet tipe parental adalah gamet dengan susunan gen yang sama dengan susunan gen pada individu. sedang gamet tipe rekombinasi adalah gamet yang susunan gennya merupakan rekombinasi susunan gen pada individu. jika kedua gen tersebut berangkai dengan kedudukan trans. Setiap satuan peta ditetapkan sebagai jarak antara dua gen berangkai yang dapat menghasilkan gamet tipe rekombinasi sebanyak 1%. Seperti telah dijelaskan. misalnya jarak terpanjang antara dua gen berangkai pada kromosom 1 tanaman jagung yang mencapai 161%. Dari pengertian pindah silang tersebut kita dapat menyederhanakan batasan tentang gamet tipe parental dan gamet tipe rekombinasi. Terjadinya segregasi dan rekombinasi dua buah gen berangkai ini tidak lain karena mereka mengalami peristiwa yang dinamakan pindah silang (crossing over). merupakan mekanisme penting yang mendasari pembentukan keanekaragaman genetik karena kedua-duanya akan menghasilkan kombinasi baru di antara gen-gen yang terdapat pada individu sebelumnya. makin besar persentase gamet tipe rekombinasi yang dihasilkan. yaitu pertukaran materi genetik (gen) di antara kromosom-kromosom homolog. atau dengan perkataan lain sama sekali tidak terdapat gamet tipe rekombinasi. atau persentase. maka kedua gen dikatakan mempunyai loki (tempat gen pada kromosom) yang sangat berdekatan. Dengan perkataan lain. sedang gamet tipe rekombinasi berkisar dari 0% hingga 50%. Sekarang dengan lebih mudah dapat kita katakan bahwa gamet tipe parental adalah gamet bukan hasil pindah silang. Jika gamet tipe parental sama banyaknya dengan gamet tipe rekombinasi (masing-masing 50% atau nisbah gamet = 1 : 1 : 1 : 1). jika suatu individu dihibrid dengan gen-gen yang berangkai menghasilkan gamet tipe parental sebanyak 80% atau gamet tipe rekombinasi sebanyak 20%. Selanjutnya. Makin panjang jarak antara dua gen berangkai. bersama-sama dengan pemilihan bebas (hukum Mendel II). Akan tetapi. gamet tipe rekombinasi jumlahnya paling banyak hanya 50%. sedang gamet tipe rekombinasi adalah gamet hasil pindah silang. Peristiwa pindah silang. Sebagai contoh. gamet tipe rekombinasi oleh A. seleksi alam akan bekerja untuk mempertahankan . gamet tipe parental jumlahnya berkisar dari 50% hingga 100%. jika semua gamet yang ada merupakan gamet tipe parental. Besar kecilnya jumlah. maka gamet tipe parentalnya adalah Ab dan aB sementara gamet tipe rekombinasinya adalah AB dan ab. Sturtevant digunakan untuk menggambarkan jarak fisik antara dua gen berangkai. Gamet tipe parental jumlahnya selalu lebih besar atau setidak-tidaknya sama dengan jumlah gamet tipe rekombinasi.Kebalikannya. Di sisi lain jarak antara dua gen berangkai dapat mencapai lebih dari 100%.H.

Dengan adanya miselium haploid inilah.2 di bawah ini. Oleh karena itulah. Pola askus A b A a a a B B b B a B a B binasi A b A b A b 100% rekom- Meiosis I Mitosis a) Meiosis II. keberadaan gen-gen resesif dapat dideteksi karena ekspresinya tidak tertutup oleh gen dominan.genotipe-genotipe dengan kombinasi gen yang adaptif saja. Selanjutnya. Pada saat terbentuknya konfigurasi tetrad inilah pindah silang terjadi. Bukti bahwa pindah silang terjadi sesudah kromosom homolog mengalami duplikasi diperoleh dari hasil analisis genetik pada percobaan menggunakan kapang Neurospora crassa. . Secara skema bukti yang menujukkan bahwa pindah silang terjadi pascaduplikasi kromosom dapat dilihat pada Gambar 5. Kapang ini sangat cocok untuk keperluan analisis genetik terutama karena dalam fase reproduksi aseksualnya terdapat askosopra haploid yang akan mengalami pembelahan mitosis sehingga berkecambah dan tumbuh menjadi miselium multisel yang juga haploid. Pindah silang terjadi pascaduplikasi kromosom Pada profase I meiosis kedua kromosom homolog akan mengalami duplikasi menjadi empat buah kromatid (lihat Bab IV). banyak ilmuwan yang menganggap bahwa pindah silang dan pemilihan bebas sangat penting bagi berlangsungnya proses evolusi. keempat kromatid ini akan membentuk sinapsis yang dinamakan tetrad.

2. pada Gambar 5.2.2.a) pindah silang terjadi sebelum kromosom mengalami duplikasi. Gambar 5. Tampak bahwa kedelapan askospora yang terbentuk terdiri atas dua macam. Ternyata dilihat dari kedelapan askospora hasil pembelahan mitosis gamet dapat dipastikan bahwa keempat gamet yang dihasilkan seluruhnya merupakan gamet tipe rekombinasi atau sama sekali tidak ada gamet tipe parental.Pola askus parental A A a a a B B b b b a a B b a a B b A A B B A B A b A b rekombinasi parental Meiosis I Mitosis b) Meiosis II. maka dapat disimpulkan bahwa pindah silang terjadi setelah kromosom mengalami duplikasi.b) pindah silang terjadi sesudah kromosom mengalami duplikasi.b) ini masuk akal. Di antara askospora tipe parental masih dapat dibedakan lagi askopora dari parental pertama (AB) dengan askospora dari parental kedua (ab). yaitu askospora yang berasal dari gamet tipe parental dan askosopra yang berasal dari gamet tipe rekombinasi. Hal ini jelas sesuatu yang tidak mungkin terjadi karena dari penjelasan sebelumnya kita mengetahui bahwa persentase gamet tipe rekombinasi berkisar dari 0 hingga 50%.2. Hasil pindah silang dilihat dari pola askus pada Neurospora crassa Pada Gambar 5. Persentase pindah silang menggambarkan jarak antara dua gen berangkai . Sebaliknya. Oleh karena kemungkinan pada Gambar 5.

Sementara itu. ABc dan abC (hasil pindah silang II). persentase gamet tipe rekombinasi sampai dengan batas tertentu (lebih kurang 20%) memperlihatkan korelasi positif dengan jarak fisik antara dua gen berangkai. Kalau kita misalkan bahwa kedudukan ketiga gen berangkai tersebut seperti pada Gambar 5. ada juga gamet tipe parental.3. Dengan demikian. gamet tipe rekombinasi merupakan gamet hasil pindah silang. pindah silang terjadi antara B dan C atau pindah silang pada interval II. Sesuai dengan banyaknya macam pindah silang yang terjadi. maka gamet tipe rekombinasi yang dihasilkan adalah Abc dan aBC (hasil pindah silang I). dan gamet tipe rekombinasi hasil pindah silang ganda. atau seperti disebutkan di atas. Kemungkinan yang terakhir ini dinamakan pindah silang ganda (double crossing over). besarnya persentase pindah silang juga menggambarkan jarak fisik antara dua gen berangkai. gamet tipe rekombinasi yang dihasilkan ada tiga macam. Pertama. yaitu gamet tipe rekombinasi hasil pindah silang pada interval I. yaitu ABC dan abc. Selain itu. gamet tipe rekombinasi hasil pindah silang pada interval II. Ke tiga. Tiga Gen Berangkai Di antara tiga buah gen berangkai. serta AbC dan aBc (hasil pindah silang ganda). Ke dua.Peristiwa pindah silang akan menyebabkan terbentuknya gamet tipe rekombinasi. A a interval I B b interval II C c A A B B C C a a b b c c . dapat terjadi tiga kemungkinan pindah silang. pindah silang terjadi antara A dan B atau pindah silang pada interval I. pindah silang terjadi antara A dan B sekaligus antara B dan C. misalnya gen-gen dengan urutan A-B-C.

A-B-cc. Silang Uji Tiga Titik Silang uji. aabbC-. sesuai dengan nisbah gamet individu ABC/abc. Dengan demikian. Kelompok pertama adalah gamet tipe parental (ABC dan abc). individu trihibrid AaBbCc disilang uji dengan aabbcc. Begitu pula sebaliknya. Sementara itu. maka hasil persilangannnya ada delapan macam fenotipe. yaitu A-B-C-. gamet tipe parental dengan sendirinya paling besar persentasenya. jika gen A berangkai dengan gen B dan gen C. Silang uji terhadap individu trihibrid dinamakan silang uji tiga titik (three-point test cross).3. dan kelompok ke empat gamet hasil pindah silang ganda (AbC dan aBc). gamet dari individu ABC/abc dapat dibagi menjadi empat kelompok. A-bbC-. Jika A-B lebih panjang daripada B-C. Pindah silang di antara tiga gen berangkai Dari delapan macam gamet yang dihasilkan tersebut. yang masing-masing terdiri atas dua macam fenotipe. aaB-C-. gamet hasil pindah silang II akan dijumpai lebih banyak daripada gamet hasil pindah silang I jika jarak B-C lebih panjang daripada jarak A-B. maka nisbah fenotipe yang dihasilkan tidak akan sama tetapi bergantung kepada jumlah tiap macam gamet individu trihibrid tersebut.A A B b C C a a B b c c Gambar 5. yakni abc. maka gamet hasil pindah silang I lebih banyak daripada gamet hasil pindah silang II. Abbcc. kelompok ke dua gamet hasil pindah silang di daerah I (Abc dan aBC). dari individu homozigot resesif aabbcc (abc/abc) hanya akan dihasilkan satu macam gamet. sedang gamet yang paling kecil persentasenya adalah gamet tipe rekombinasi hasil pindah silang ganda. Seperti pada penjelasan Gambar 5. Jika di antara ketiga gen tersebut tidak ada yang berangkai. kelompok ke tiga gamet pindah silang di daerah II (ABc dan abC). Namun.3. dengan nisbah 1 : 1 : 1 : 1 : 1 : 1 : 1 : 1. Sebagai contoh. seperti telah dijelaskan pada Bab II. Bagaimana dengan gamet hasil pindah silang I dan gamet hasil pindah silang II ? Mana di antara kedua kelompok gamet tipe rekombinasi tersebut yang lebih besar persentasenya ? Jawabannya tentu saja bergantung kepada besarnya jarak A-B dan jarak B-C. adalah persilangan suatu individu dengan individu homozigot resesif. fenotipe sekaligus genotipe hasil silang ujinya akan ada empat kelompok. karena baik gamet tipe parental maupun rekombinasi akan mempunyai susunan gen yang sama. aaB-cc. ABC/abc tipe parental (persentasenya terbesar) abc/abc . dan aabbcc.

Oleh karena itu. Pemetaan Kromosom Data hasil silang uji tiga titik dapat dimanfaatkan untuk membuat peta kromosom. yaitu abc. Jadi. kita cari . cukup ditulis dengan ABC. biasanya notasi fenotipe/genotipe individu hasil silang uji untuk gen-gen berangkai sama dengan notasi untuk gametnya masing-masing. ABC = 265 ABc = 133 AbC = 6 aBC = 441 Abc = 435 aBc = 4 abC = 139 abc = 227 Untuk menentukan urutan gen yang benar pertama-tama kita cari individu tipe parental di antara kedelapan genotipe tersebut. Sebagai contoh. Dengan demikian. Keduanya dipasangkan menjadi aBC/Abc. Di dalam peta kromosom tiap kromosom disebut sebagai satu kelompok gen berangkai (linkage group). yang terdiri atas sederetan gen-gen dengan urutan dan jarak tertentu. pada prinsipnya pembuatan peta kromosom meliputi penentuan urutan gen pada satu kromosom dan penghitungan jarak antara gen yang satu dan lainnya. Begitu juga untuk ketujuh genotipe lainnya penulisannya cukup seperti notasi gametnya saja.Abc/abc tipe rekombinasi hasil pindah silang antara A dan B (persentasenya bergantung kepada posisi lokus B) aBC/abc ABc/abc tipe rekombinasi hasil pindah silang antara B dan C (persentasenya bergantung kepada posisi lokus B) abC/abc AbC/abc tipe rekombinasi hasil pindah silang ganda (persentasenya terkecil) aBc/abc Salah satu kromosom homolog pada tiap fenotipe/genotipe hasil silang uji tersebut di atas selalu membawa gen-gen dengan susunan yang sama. Kemudian. yaitu dua individu yang persentase atau jumlahnya terbesar (aBC dan Abc). misalnya. Langkah-langkah untuk membuat peta kromosom dari data hasil silang uji dapat dijelaskan dengan contoh berikut ini.4. individu ABC/abc. pada lalat Drosophila melanogaster telah ditemukan adanya empat kelompok gen berangkai seperti dapat dilihat pada Gambar 5.

dapat disimpulkan bahwa urutan loki gen yang benar adalah A-C-B atau B-C-A. maka akan diperoleh BAC/bac. 0 y (yellow body) 0 ci (cubitus interruptus eyes) w (whirte eyes) (bent wings) N (Notch wings) (shaven bristles) ec (echinus eyes) rb (ruby eyes) bo (bordeaux eyes) cv (crossveinless wings) ov (oval eyes) ct (cut wings) sn (singed bristles) ed (echinoid eyes) dp (dumpy wings) cl (clot eyes) spd (spade wings) lys (lysine accumulation) jv (javelin bristles) Hn (Henna eyes) fs(3) G2 (betina steril) Cy (Curly wings) net (net wings) 0 ru (roughoid eyes) 0 S (Star eyes) R (Roughened eyes) bt 3 sv IV t (tan body) ras (raspberry eyes) m (miniature wings) wy (wavy wings) g (garnet eyes) pl (pleated wings) tu-48 (abdominal tumors) fy (fuzzy hairs) corr (corrugated wings) J (Jammed wings) se (sepia eyes) cur (curvoid wings) rs (rose eyes) Gl (Glued eyes) st (scarlet eyes) b (black body) eg (eagle wings) . Individu parental dengan urutan gen seperti ini (lokus C di tengah) jika mengalami psg akan menjadi acB/ACb. individu parental harus kita ubah urutan gennya.individu hasil pindah silang ganda. Ini juga kita pasangkan menjadi AbC/aBc. Individu parental disimulasi untuk mengalami pindah silang ganda (psg). Alternatif ke tiga (terakhir) adalah mengubah urutan gen pada individu parental menjadi aCB/Acb. yang ternyata cocok dengan AbC/aBc. Jika individu ini mengalami psg. Artinya. Oleh karena itu. yang ternyata masih belum cocok juga dengan AbC/aBc. Dengan demikian. aBC/Abc disimulasi untuk mengalami psg menjadi abC/ABc. yaitu dua individu yang jumlahnya terkecil (AbC dan aBc). misalnya menjadi BaC/bAc. Setelah hasil simuasi ini dicocokkan dengan individu psg yang ada ternyata susunan gennya tidak sama (abC/ABc tidak sama dengan AbC/aBc).

Peta kromosom pada lalat Drosophila melanogaster = sentromir Kromosom I = kromosom kelamin .4.sd (scalloped wings) r (rudimentary wings) B (Bar eyes) car (carnation eyes) rd (reduced bristles) stw (straw bristles) cn (cinnabar eyes) che (cherub wings) cu (curly wings) bx (bithorax body) sr (stripe body) bb (bobbed bristles) 68 I c (curved wings) Amy (Amylase) rf (roof wings) nw (narrow wings) vg (vestigial wings) U (Upturmed wings) Dl (Delta wings) e (ebony body) cd (cardinal eyes) obt (obtuse wings) dsr (disrupted wings) hy (humpy body) ra (rase britles) a (arc wings) Frd (Freckled body) M(2)c (Minute body) 106 108 II Pr (Prickly bristles) r sd (raised wings) ca (claret eyes) M(3)g (Minute body) III Gambar 5.

pindah silang ganda adalah dua peristiwa pindah silang yang terjadi bersama-sama pada dua daerah yang berurutan. AcB. dan ACb.Mutan yang diawali dengan huruf besar = mutan dominan Setelah urutan gen yang benar diketahui. yang merupakan nisbah psg O terhadap psg E.4%. interferensi ini menunjukkan bahwa pindah silang di suatu tempat akan menghalangi terjadinya pindah silang di dekatnya. Nilai KK = 1 menggambarkan adanya independensi yang sempurna di antara dua peristiwa pindah silang yang berurutan sehingga psg O sama besarnya dengan psg E. A 30. Dengan demikian. 17. Namun. Derajad interferensi secara kuantitatif diukur dengan suatu nilai yang disebut koefisien koinsidensi (KK).2%. ACB.2% = 0. nilai KK = 0 menunjukkan bahwa dua peristiwa pindah silang yang berurutan benar-benar saling menghalangi. Sementara itu. Pada soal tersebut di atas persentase pindah silang ganda yang diharapkan atau seharusnya terjadi (psg E) sama dengan 30. dan dinamakan interferensi kromosom atau interferensi kiasma. Oleh karena itu. sehingga jarak C-B = (139 + 133 + 4 + 6) / 1650 x 100% = 17. Oleh karena individu parentalnya aCB/Acb. individu hasil pindah silang antara C dan B masingmasing aCb.6% / 5.6%. Sebaliknya. Nilai ini merupakan persentase pindah silang ganda yang benar-benar terjadi (psg O). seperti telah dijelaskan sebelumnya. Biasanya psg O lebih kecil daripada psg E. maka individu hasil pindah silang antara A dan C terdiri atas acb. dan ACb. Jadi.J. data hasil silang uji tersebut di atas diubah urutan gennya sehingga menjadi ACB = 265 AcB = 133 ACb = 6 aCB = 441 Acb = 435 acB = 4 aCb = 139 acb = 227 Selanjutnya. kita dapat menghitung jarak antara dua gen berurutan (A-C dan C-B).1% C B .1%. nilai KK berbanding terbalik dengan besarnya interferensi. dan pada contoh soal di atas nilai KK = 0.4% x 17. jarak A-C = (227 + 265 + 4 + 6) / 1650 x 100% = 30. Nilai KK berkisar dari 0 hingga 1. Muller pada tahun 1916. Fenomena ini pertama kali ditemukan oleh H. Seandainya kedua pindah silang ini benar-benar independen satu sama lain. jarak A-C sama dengan pindah silang antara A dan C. sedang jarak C-B sama dengan pindah silang antara C dan B. maka secara teori besarnya persentase pindah silang ganda seharusnya sama dengan hasil kali masing-masing pindah silang (lihat teori peluang pada Bab II).4% Interferensi Kromosom Pada contoh soal tersebut di atas terlihat bahwa banyaknya individu hasil pindah silang ganda ada (4 + 6) / 1650 x 100% = 0. acB. acB.12. Jadi. yang masing-masing sama dengan persentase pindah silang di antara kedua gen yang diukur jaraknya (ingat ! besarnya persentase pindah silang menggambarkan jarak fisik antara dua gen berangkai).1% = 5.

kedua pindah silang makin menghalangi satu sama lain atau makin besar interferensinya. dapat disimpulkan bahwa gen yang mengatur sintesis timidin kinase terletak pada kromosom nomor 17. diperlukan cara lain untuk dapat mengetahui susunan gen pada suatu kromosom tertentu. Terlihat bahwa kromosom 17 merupakan satu-satunya kromosom yang keberadaannya berkorelasi positif dengan aktivitas timidin kinase. Teknik hibridisasi sel somatis pertama kali digunakan oleh G. Selain dengan virus Sendai. nilai KI juga berkisar dari 0 hingga 1 tetapi berbanding lurus dengan besarnya interferensi. frekuensi fusi tersebut dapat ditingkatkan dengan penambahan sejenis virus.Makin besar KK. Bahkan dewasa ini teknik DNA rekombinan dapat digunakan untuk isolasi dan identifikasi keberadaan masingmasing gen di dalam molekul DNA kromosom. Sejalan dengan penemuan ini berkembang pula teknik sitologi yang memungkinkan dilakukannya identifikasi kromosom dan segmen kromosom manusia.1. keberadaan gen yang mengatur sintesis enzim timidin kinase dapat diketahui dari data seperti pada Tabel 5. yaitu sekitar satu di antara sejuta sel. Cara yang sama digunakan untuk menentukan bahwa pada suatu kromosom terdapat gen-gen tertentu. Tabel 5. Pemetaan Kromosom pada Manusia Pada manusia dengan sendirinya tidak dapat dilakukan pembuatan peta kromosom menggunakan data hasil silang uji. Di antara sel-sel hibrid hasil mitosis ini selalu terjadi pengurangan jumlah kromosom manusia sementara jumlah kromosom mencitnya tetap. Barski dan koleganya pada tahun 1960 untuk menggabungkan sel somatis mencit dengan sel somatis manusia secara in vitro. Data hibridisasi sel somatis Nomor Aktivitas Kromosom manusia . Sel hibrid yang terbentuk kemudian mengalami pembelahan mitosis sehingga dihasilkan sejumlah besar sel hibrid. Oleh karena itu.1. Artinya. Dengan demikian. dapat ditentukan keberadaan gen tertentu pada suatu kromosom atas dasar aktivitas enzim yang dihasilkan. Cara yang paling lama dikenal adalah analisis silsilah keluarga dengan mengamati pola pewarisan suatu sifat. kedua pindah silang makin independen sehingga makin kecil interferensinya. Dengan demikian. makin besar KI. Pada tahun 1960-an terjadi kemajuan yang pesat dalam pembuatan peta kromosom pada manusia berkat ditemukannya suatu teknik yang dikenal sebagai hibridisasi sel somatis. yakni virus Sendai. yang telah diinaktifkan dengan radiasi ultraviolet. Sebagai contoh. Dengan adanya variasi jumlah kromosom manusia pada sel hibrid. Untuk menggambarkan derajad interferensi dapat pula digunakan koefisien interferensi (KI). Namun. frekuensi fusi dapat juga ditingkatkan dengan pemberian bahan kimia polietilen glikol. Dalam hal ini kromosom 17 selalu dijumpai pada setiap sel hibrid yang memperlihatkan aktivitas timidin kinase dan tidak dijumpai pada sel hibrid yang tidak memperlihatkan aktivitas enzim tersebut. Penggabungan (fusi) sel ini berlangsung dengan tingkat keberhasilan yang sangat rendah. yang nilainya sama dengan 1 – KK.

– = tidak ada) X Y 1 2 4 7 + + + + + + + + + + + + + + - 9 + + + 10 + + - 15 + + + 17 + + + + - 18 + - 21 + + - 10/31/2009 Posted by zaifbio | Genetika Dasar | 5 Komentar GENOM ORGANISME .sel hibrid 1 2 3 4 5 timidin kinase aktif aktif aktif aktif tidak aktif (+ = ada.

sejumlah sifat lainnya diatur oleh pasangan-pasangan gen tersendiri. ketika itu belum dapat diungkapkan mekanisme transmisi gen dari satu generasi ke generasi berikutnya. khususnya selama . sifat tinggi tanaman kacang ercis diatur oleh pasangan gen D dan d. Sebagai contoh. maka untuk mempelajari mekanisme transmisi gen perlu dilakukan pengamatan terhadap perilaku kromosom.BAB III GENOM ORGANISME    Pengertian Genom Struktur Kromosom Jumlah Kromosom BAB III. Demikian pula. hukum Mendel II (pemilihan bebas) hanya mengemukakan bahwa segregasi pasangan gen yang satu tidak bergantung kepada segregasi pasangan gen lainnya. melalui studi pada lalat buah Drosophila melanogaster mengajukan konsep bahwa gen merupakan satuan-satuan diskrit (terpisah satu sama lain) di dalam kromosom. Salah satu kelompok peneliti. T. Selanjutnya. soma=badan). Beberapa tahun kemudian barulah diketahui bahwa gen terdapat di dalam struktur intranukeus yang dinamakan kromosom (chromo=warna . Morgan dan koleganya. Dalam hukum Mendel I (segregasi) hanya disebutkan bahwa tiap pasangan gen akan dipisahkan ke dalam gamet-gamet yang terbentuk. GENOM ORGANISME Analisis hasil percobaan persilangan yang dilakukan oleh Mendel telah memberikan pemahaman bahwa satuan-satuan herediter yang mengatur pemunculan sifat atau fenotipe individu bersifat diskrit (terpisah satu sama lain). Jadi. Begitu juga. Meskipun demikian. masing-masing pasangan gen tersebut merupakan satuan-satuan herediter yang terpisah satu sama lain. Oleh karena gen terdapat di dalam kromosom. sedangkan bentuk bijinya diatur oleh pasangan gen W dan w.H. rekombinasi gen akan berlangsung pada saat terjadi penggabungan gamet jantan dengan gamet betina melalui perkawinan.

jumlah kromosom ini tidak ada kaitannya dengan ukuran atau kompleksitas biologi suatu organisme. Lalu bagaimanakah hubungan antara genom dan kromosom? Organisme prokariot seperti bakteri diketahui hanya mempunyai sebuah kromosom yang tidak dikemas di dalam suatu nukleus sejati. Pada Bab III ini hanya akan dibahas sekilas kedudukan gen di dalam kromosom. Sementara itu. genom organisme prokariot dikatakan hanya terdiri atas sebuah kromosom tunggal (lihat juga Bab XII).1. Selain itu. Contoh deretan lokus sejumlah gen di dalam suatu kromosom eukariot dapat dilihat pada Gambar 5. Oleh karena itu. Kromosom ini berbentuk lingkaran (sirkuler). dan semua gen tersusun di sepanjang lingkaran tersebut. Jumlah kromosom dasar di dalam genom haploid pada umumnya berbeda-beda antara satu spesies dan spesies lainnya. genom suatu organisme adalah kumpulan semua gen yang dimiliki oleh organisme tersebut pada setiap selnya.berlangsungnya pembelahan sel (lihat Bab IV). Namun. genom eukariot tersusun dari beberapa buah kromosom. Gambar 3. sel-sel lainnya (sel somatis) hampir selalu mempunyai dua buah genom. atau dikatakan mempunyai genom diploid. Pengertian Genom Secara keseluruhan kumpulan gen-gen yang terdapat di dalam setiap sel individu organisme disebut sebagai genom. baik pada prokariot maupun pada eukariot.4 (Bab V). yang menampilkan peta kromosom pada lalat D. melanogaster. Kebanyakan spesies mempunyai 10 hingga 40 . Genom Eukariot Di atas telah disinggung bahwa genom eukariot terdiri atas beberapa buah kromosom. kromosom eukariot mempunyai bentuk linier. Genom/kromosom prokariot Berbeda dengan genom prokariot. Sel-sel kelamin (gamet) pada manusia merupakan contoh sel yang mempunyai seperangkat kromosom haploid. atau berarti hanya mempunyai sebuah genom. yang ditempati oleh suatu gen disebut sebagai lokus (jamak: loki) bagi gen tersebut. Tiap kromosom membawa sederetan gen tertentu. Dengan perkataan lain. Posisi di dalam kromosom. Jumlah kromosom dasar di dalam genom suatu organisme eukariot (biasa dilambangkan dengan n) dikatakan sebagai jumlah kromosom haploid (lihat juga Bab VII).

1). kromosom nomor 1 dari genom pertama akan berpasangan dengan kromosom nomor 1 pula dari genom kedua. sejenis rusa kecil dari Asia. Kromosom-kromosom yang berpasangan ini dinamakan kromosom homolog.1. Artinya. . Demikian seterusnya hingga pasangan kromosom yang ke-n. hanya mempunyai tiga buah kromosom.buah kromosom di dalam genom haploidnya (Tabel 3. Tabel 3. sedangkan beberapa spesies paku-pakuan diketahui mempunyai beratus-ratus kromosom di dalam genom haploidnya. Jumlah kromosom pada genom haploid beberapa spesies organisme eukariot Spesies organisme Jumlah kromosom haploid (n) 16 7 17 10 21 12 6 11 5 4 3 18 6 14 25 17 39 20 36 24 23 Eukariot sederhana Saccharomyces cerevisiae Neurospora crassa Chlamydomonas reinhardtii Tumbuhan Zea mays Triticum aestivum Lycopersicon esculentum Vicia faba Sequoia sempivirens Arabidopsis thaliana Hewan avertebrata Drosophila melanogaster Anopheles culicifacies Asterias forbesi Caenorhabditis elegans Mytilus edulis Hewan vertebrate Esox lucius Xenopus laevis Gallus domesticus Mus musculus Felis domesticus Pan tryglodites Homo sapiens Pada organisme diploid kedua genom akan berpasangan pada setiap kromosom yang sesuai. Muntjac.

Struktur kromosom ini dapat dilihat dengan jelas ketika pembelahan sel berada pada tahap anafase.Dengan adanya kromosom-kromosom homolog. Pada bentuk submetasentrik sentromir terletak di antara tengah dan ujung kromosom sehingga memberikan kenampakan kromosom seperti huruf J. Sebagai contoh. Klasifikasi struktur kromosom menjadi metasentrik. dan kedua lengan kromosom semakin jelas beda panjangnya. Bentuk yang ketiga. Demikian pula. Terlebih penting lagi. dan akrosentrik. Bentuk submetasentrik menghasilkan dua lengan kromosom yang tidak sama panjangnya. yaitu metasentrik. bentuk metasentrik ini menghasilkan dua lengan kromosom yang kira-kira sama panjangnya.2. jika pada kedua kromosom homolog gen a berpasangan dengan gen a. maka akan diperoleh genotipe heterozigot. ternyata dapat dikelompokkan menurut kedudukan sentromirnya. Oleh karena itu. Sentromir adalah suatu daerah pada kromosom yang merupakan tempat melekatnya benang-benang spindel dari sentriol selama berlangsungnya pembelahan sel (Bab IV). sedang lengan yang pendek p. istilah-sitilah tersebut sangat berguna untuk memberikan gambaran fisik tentang kromosom. maka akan didapatkan genotipe homozigot resesif. Jika pada kromosom yang satu terdapat gen A dan pada kromosom homolognya terdapat gen a. evolusi kromosom sering kali cenderung mempertahankan jumlah lengan kromosom tanpa mempertahankan jumlah kromosom. gen A (dominan) pada suatu kromosom dapat berpasangan dengan gen A pada kromosom homolognya sehingga terbentuk genotipe homozigot dominan untuk lokus tersebut. Klasifikasi struktur kromosom eukariot Kromosom eukariot. dijumpai apabila sentromir terletak hampir di ujung kromosom sehingga memberikan kenampakan kromosom seperti huruf I. Akan tetapi. akrosentrik. tiap gen yang terletak pada lokus tertentu di dalam suatu kromosom dapat berpasangan dengan gen yang sesuai pada kromosom homolognya. dan akrosentrik tadi sebenarnya agak dipaksakan. Sebagai contoh. yang telah kita ketahui berbentuk linier. submetasentrik. lalat Drosophila melanogaster mempunyai dua buah . s s a) s b) c) Gambar 3. submetasentrik. Dilihat dari kedudukan sentromirnya. dikenal ada tiga macam struktur kromosom eukariot. Struktur kromosom pada anafase a) metasentrik b) submetasentrik c) akrosentrik s = sentromir Pada metasentrik kedudukan sentromir lebih kurang berada di tengah-tengah kromosom sehingga memberikan kenampakan kromosom seperti huruf V. Lengan yang panjang biasanya dilambangkan dengan huruf q.

Akan tetapi. akan nampak bahwa tiap lengan kromosom metasentrik pada D. yakni pada tahap S di dalam daur sel (lihat Bab IV).autosom metasentrik yang besar sementara banyak spesies Drosophila lainnya mempunyai empat autosom akrosentrik yang kecil. Dalam hal ini. Demikian juga. Jika peta kromosom kedua kelompok Drosophila ini dibandingkan. yang satu sama lain dihubungkan pada daerah sentromir. simpanse dan manusia sama-sama mempunyai 22 pasang autosom yang secara morfologi sangat mirip. Tiap kromatid membawa sebuah molekul DNA yang strukturnya berupa untai ganda (Bab IX) sehingga di dalam kedua kromatid terdapat dua molekul DNA. telomir (ujung kromosom) sentromir (konstriksi primer) kinetokor kromatid kembar (sister chromatids) . yaitu suatu protein struktural yang berperan dalam pergerakan kromosom selama berlangsungnya pembelahan sel. manusia mempunyai sepasang autosom metasentrik yang tidak dimiliki oleh simpanse. Pada Bab X akan dijelaskan bahwa bagian-bagian tertentu molekul DNA merupakan gen-gen yang mengekspresikan fenotipenya masing-masing sehingga DNA dapat juga dilihat sebagai materi genetik. Kromatid Kromosom yang sedang mengalami pengandaan. pada simpanse terdapat dua pasang autosom akrosentrik yang tidak ada pada manusia. melanogaster sesuai dengan lengan panjang kromosom akrosentrik pada Drosophila lainnya itu. Letak sentromir berbeda-beda. masing-masing lengan metasentrik pada manusia homolog dengan lengan panjang akrosentrik pada simpanse. Sebaliknya. Pada sentromir terdapat kinetokor. Bahan penyusun kromosom adalah DNA (asam deoksiribonukleat) dan protein. dan perbedaan letak ini dapat digunakan sebagai dasar untuk klasifikasi struktur kromosom seperti telah diuraikan di atas. Autosom adalah kromosom yang bentuknya sama pada kedua jenis kelamin (Bab VI). terdiri atas dua buah kromatid kembar (sister chromatids).

3. Gambaran umum struktur kromosom eukariot yang sedang mengalami penggandaan a) kromosom b) molekul DNA 10/31/2009 Posted by zaifbio | Genetika Dasar | 2 Komentar « Entri Sebelumnya SINOPSIS BLOG INI BERISI SEMUA MATERI TENTANG BIOLOGI DAN PENDIDIKAN YANG DIBUAT OLEH ORANG YANG HAUS AKAN ILMU DAN BERCITA-CITA TINGGI UNTUK MENJADI DOSEN DAN MEMAJUKAN ILMU PENGETAHUAN DIMANAPUN DIA BERADA DAN MENGABDI .a) b) Gambar 3.

3. 425083907-039:-.203.9:  2#8./8.9079039: $0-.9:5033.7.28.3.3:9.. 80 80570:78479/.80390780-:9.75.302:/.3/7#/..709200..387580:.9:7.7 2#..80-:9:.03-.3 907/.3202-:9:.8897:9:72.2:3 503097.709 0.39:3.5..5.251..749.7:/48803..3 9.032397..749 $0-.9:797.40-07-.0-.38090.80-0:2./.3:2.803.9:7..8.397.9/809.749 ..9.8. 09.8../07974-.39/.33/:840 .:-.7./.3802570.3574903 897:9:7./.7570:78473.7.032.30-/.7.2.5.3-0:2907.803 .34489/.80:2..8 .709/.3.3.: -.3/.8  $..907-039:4250847243 70805947 $090.803907./..:2.  .38758 07/.3.3:39:203.03/03..//.-07.././.././ 9.9907.2705./. 708543907.. 03.5.749 2085:33.34080 80570:7847.8 !02-039:.383908880:2.3 203..780-.3/2#8:507570.9./5033.8  !03.0380-.47243  240:5749030.9:20.3-0..9.5.../.50702-.3 907.8  0../3...8 40:7#9/.9:70:.9: 80203307 2.9:83.251.-08.9/-.80  .3.8.3.29.78-08.7490-:7.3.3-07.5...28:. 4443:2 207:5.3.802-..2809.8.3 4489.8//.3 80:2.3/03.3 88.8 03..39:3.3.9:503..35748083.251.9:7.3:2.703.9./.3.33.9./.3.7.3/03.3//.303 .70805947.8..570:7847.2 ::3.7.9:7.83203.302:/.3//07. 47243/.10798.380.3.8:.9-.2.3 ::3.574.9//..4  $0.73./.8.3/03.5./03.32033..83 2.3/.3.0.5../..4-3.3.3 57490390780-:9.80/980.7.3  $.3.9.387580:.3.2 3:0:8207:5.3/03.8.3 .28945.9.9183.8.3.9:3.9:8.-0-07.7.3/50740809.73./4-32.9/:3.583../.347././.2.597.3//.3 90..3/-.80./.5..9:9..9:850780 /.251.3/507:.8./.9/.2:3 80.297.-08.3203.03503.224/1.3503.387580:.251..9/97.507:/.7839088574903 &39:9:/-:9:.82.3802025:3.28:28:29:..4394 80 8007974-.397.:./507:.380 .3038943/.8240: 240:7# !.3820 503./:52# .3 57480842508.7809079039:203::0809..54070805947:8:8.-08. $02039.2809.38.9.3  2# 8:507570.3/032/.550702-..77-4842 9.2203../03.8472430/.3.370.3/09...5.33.//./.-0-07..03 /03.507:-.9.32025:3.7574903.3203.9: 037#.-08.89.78.803.::5:39:839088240:90780-:9/.8.9:8 7.387584047243/2:.3.3/02...:0-7:29-. .:-07507.4394 .:39:20.3.2 :2. ..3.3/.80  037#-07.308570803503.251.8.3.3../-.9202-7..3..  .3203..9:.035..04254 .39.9.9: 2#8:507570..3/9..9..0345:8.2.5.::5-.3:39:705.7503.382007.380:2.3/.3503.9:. :9..580 240:2#/. 830.80380-03.3.3:2.32.3:2.:.3.947.0/.8:3.:-.3574808.3-0:2-0702-.8.2025:3./.38.038090.7-4842.9202.3/3.3 .32..3 97../80.8203.8.3907/7..350702-.7/:.3/../3.-09:-.448990..3-0-07.38200:.9  .30.34489907.  .7-:50780 40: 2#8.8-.948.037#3..45   2#802570.20309./.390780/./.472430 /.33/:8 5.5.

...0897403/-07..28.-07.2.8.9/.3/03..7.34. .3.2 /8:39/03./.032#54207.-:235.//.5.9.35.9:574903010947   .2.:7.3 .82.95.320302-:8/3/33:0:8:39: 202..9:7.20/:.5./.507-0/.:2:33472433.-0-07.73...   503.70805947472430897403//.38758//.3.3907.7..3-07-0/.387584047243.3203.3839088032.2025:3.38..3.9:  503.3 -07-0/.39.9574903./.8839088 4.3   507:-.3/.35....03880.3202-07.80  43943/:897.3018038-07-0/.390:7 4.03.3./.3.240472430. /902:./:9:8.73.  .9./.-:23 $390883.2.57:5.3-07-0/.9:8 28.9.8.3  /.-./.80 804..3.  !..50789.7907-:. 8:.3..8574903.-0:2-.3.5/.3-.9..240: 240:2#.3.3:980...3.3203390882#90780-:9 .703.5.2 3:0:84250890780-:9 .2085:397.9   3.2:2./.39.9.3/97..230897403 .892:. .38073.3.390724/1./5.8..5:.8/03.3907:8-07. 8390882#:39:4.80 80 .3897:9:7742.8:3:0:8 !7480880./.9/.4250847243 70805947.93.:./.30897403 .3.73.3708543-07:5.802:/.38:35.38./09.3:93./:9:8.38.9202-:..8090780-:9907..: 909..  !03.870570847 /..  034203.9:/ .33.3.9./:9:8 ..9.9.557480832# :.909.28945.

./.2./.5..8. .8..3.3.339743 003.8040-07-.7:/.507-0/./.703. 2#.703.3.38.203.2. 502-:.354.3-07.9907./.

.2#.340.3/3.3-0:2/97.0.9:38:790780-:9 909.3240:2# .3..9:7.503../ /./.32# 20.320.9.:.//.3909.9:. .387588.2:2.38..2503.3/97.5.3875572073.83.3907.3 2#  !03.  43/8-.3-0:2 /-:..8.947707:9203 3.84.73.3.507-0/..3-:..90780-:99/.   503.3.//.39/.907-.9:7.3-0:2/09.80-03.90:7.2..9:7.3.38.38.9:7.800--./  80:2./03.3-0:2/-:.80-0:2/..3 85.749.5.75.80.9.3.3 /02./.3./.390780-:9 .38:.397.3203:3:.3.8:.203..9.84085072.3 /..:50702-. -07507.397.3 .9: 83.80.9.33..2 2.3-.28090:7..0:.10798.3203.9703/.83.3.89:/3.8.3 97./.3 1.3  503.92085:303.3 03.2./8.574903.3.9:7.2:3 .3.574.. 909.:839088574903203.2. $090:73.8 07-0/.8  $3.38.94443 80/.5 -09:10798.3/.3:2:72#:.38.2..39..397.. 5.3.9:7..3.3820503.2.3425087-4842 2#  .20.3 8.3.30-:7...98 .73..3/.8 .-.7..3/:25.2.3 2025079.989.3/7:39:9/.-44-0781.2.9::38:7./-:. .3:2:7 10920 240:2# /.88.57:5.33./.38205748083  :8:83.3/97.32#907802-:3 2.././:25.502:/..3. 5./.9:7.33.:80:7: 839088574903  %0:7..25079:2-:.:39:97.2502-039:..2.2#9/.703.090780/.././.82#5./..3/839088 .8907..749.38.80:2.80/2#  !03.

/.3.3/7/.85749039:803/7907.55749033/.9.7499/..38.92#54889743.3/802:.-07.. 909.78.38203-8..9:80203 !..980-.52#  $0-.08908 4003257490.3503.3 404/438945/./.8.38.9.340:7:9.2-.380:2.29::7:9.34389./.:8:8/03.340 20.3/3...3203./.8 .3:9: %.95024943.4394 4380397.5.9  $39088-0-07. 240:574903.339/.7.5.3203:98:..8.3203.3/03.8 97. 909.39-4//5079.5.9 9025.9:039:3.2..-07::7.3 .:503.33.9.9: :7:9.390754943 54943:39:203.83 2.0:./ 240:.3240:2#.2.$39088-0-07.9/.80-.88:.7.73.34/43.9.5.83039/..38090..9025.97. .257480897.9 /809.38..545059/.5073.0.380.3/58.8.574/:8.3-071:38807025.5/58.809079039: %025.95024943..8.2349079039:.3 /03.9:740.574.39-4/ 90780-:9-07./.  .9.3.803.9:038240:.3.749907/..3/5..39./:25.3 -08.288902802.3/.383908854574903 !4574903../..3    .8...7.5749039079039:/.  5.43/8.5..5.2-..5-07.38..574903/.574/:03 $0-.3907.2#54889743 909.

.

8.8$0243807.8.7%3..1-40309.7 %#%   %#% O O O O O O !02-:9.380-:.3#80-..9843 7./.380-..:38.. !4890/-.90703095.9070309 #05..'7:8%079039: 4/0$97:9:740:203:7:9. %.9070309 !02-:9..91 #05..42039.

3-.9: .:  .83.9.3/$0/..73:0:8-07-.   08..2.:38047.33.3:03.8.07 20302:.23:0./.9  085:39073.3.-0781.8/.2.9.:/./.303::3  %#% !.9/84.9:9:1:383.8.8.2.88.-0:2/09.7 3:0:8803.8.3#05.80.8/./03.3:8.2..23:0..92.32.280  ..302:/.3.5./.9.3/:3397403/.3148147 .203.3/03.38:.980.:.9.0/4907.7.2.93/84.

381472......9/3108/03.3.9070309 .././.3#/.3 /.3907:9.3/.2.3.7:3.47.-503../.9/84.2 .920203:8.80842.39:-:0.3907.20/:2 5.5.:8203.3:. 203.9.9070309 /..3..8.3897.5./.3 5.9 ./..:320.3907-:9-.3..3203.2.39/.3/:3.3.3 8.:/047-43:.3..32:9.30502-./...907530:244:8 $970594.3 90.5..3.3/:7..29:9/.5.3/:3.3.:909../.3 .3//.8.3$90780-:9 $0-..9 -..5.95::9.3 /..38:380-03./.9070309  0.9/84.8.9:.3507..03 2.-0781.8.9.920303.90. -0/.93.23:0.39...3$.3  574903/03.90703095.202.73.3 02.9075030-./5. 5.7:038073/..25:.2:7:3.9..09.9070309  802039.802.58:548..-07-0/..7.7/.3..9530:243.38205079..3.3.7 03.32:9.35079.3202-039:443/03.3 203:3/../9/.58:548.207:5.:80-.747.-:9507..82..4-.83...9: 80. 203.3.3-.3.:389:/ 2748458203:3:.7:.9.907/.897.303..7:3.3203:3:.3:39:20339088.5.5..3 /./.9.9.2.3 -08.240: 88.9..3./.3897.3/.2.7.380...7:03/.33108-.30.3/:3./.3938..32.3-.907530:244:8.:8530:243.3/.32025:3.380.20/:25.-.9.3503/..3-07:93  !07.::5 :.3202-039:443/03.0..3..9.7..2.3503.9/-:9.983. /09.3#  03../:./  /.9../9:2-:.7.9 !30:244:8.3 .9//.3.380-.82.3/902:.35749033..27424842 .3 3.33.7/.3-./.307./.5./.39.9:2-:./.8.7.3/3108/03.:3 9.747.9574903803.9.80-.5 80/.9:7.33203..:302:/.3.32.3-.3.0.9 203.8 .9..9070309 .7:03 $97.80.3820  80-./9:2-:.3$.35..9.8897./03.5 $02039.9070309 .25:7.5.8/:5 %073.32.985.2/0487-43:0.:574903  :.4-.803.9./. .8.907030980.5:./.3..3#/..8/:5  .9 .::../5..3.5.2 7424842:.3/..3.3#.:.882.7: 5. /.7: 5.2:3.:.9/..:3 .-.203.25...2:3 5.7907.2.5 80.7.33.23:0:880 842.3 9..8897.39073108803.3203/:33.7../ # !.3.202..3 80-0:23.3507.:897: .703.33..3/:5 .:7-43:.2.-079.3/03.8508089079039:2025:3.3.8.:5:3 0..9: 80/..2539: 3:0:8.3/:3.3$..3//..9/.3/3108/03./.897.9:.3207:5.9070309 .9.380-.39070-/.3/:5 02./.8.303..9 20339088.747.907/.9:39:20..257802:.507903.25./.3809.8.5 8890200-.897:9:77424842 ..1.0.9:9:90.203.3$ 80/.9.3.3/.3/..9: .3897.4-..3.720.83 2.203.35.3/..7.3.3530:244:8$.::5.3.2.32.27-43:0.9-079./.9..7.3909.3530:244:8.9 2.:.39:-: 0.3...7.9.8.32:9./:.7025.3 5./.3.  085:3/02.7.3805.9.2.5.:507-0/..3 897.3.3 -..397.3/03.7:03 2032-:.820488-.-0781. ./.9-079..3.4.882.:35749030-/.8  71195.2-.980-.5.3/3108/03.703.33..2-.7....

2-.9070309 ..3#.5.03.897..20897.3# 57490./3.80 5020.2507..3897.9:/9./ 793.3.23.380-.3820  ./.390780-:99073. 574903439.905.30:9:7897..3 /.47.47.3 .3 97.3#  ..907.3$ 0897.04/ /..:574903    :9:7897.32.390.203.7.907530:243./.80.3#9/.37119 .07/.9.0.350309 .3$.80 5020.3 802:.3 /9.3# $897.3/53/.3#.3 .9202-039: .3711980/95:39/.3:3..58:-07:-.381472.3#  070. 9.:..9 /5.8  81.:.974 ./.-./.5-07.907.2-..3203.907.4-.3$ .381472.3507.7920.3/20/:2 5.9:/03. 97.2-./$ .3..:.9.:39.203.3#203.7:03  !07.7897..2.3909.2-.3-.80 :9:7:9:7:9:7 897.4-./$8050795./507:-.3/.90741.85. 507.9 /..3-:99039.89/.9.7.3$...5 .30.:03257490.381472.397.3.80 5020./. ..3:39:20309.3.5.:.92.3 0897. 897..80#.032./ 897./.9070309 !07.3#897.33108-.:.3-0781.3-./.9.4-.574903439./.3#.90..574903 97..4-..381472.9.203..2-.381472.3#897.97.397./.# .9.3# $897.32./$ %7.3/9:2-:.7  .3/-07.2030-.80:2.703.8/:5803.203..3$0897.3.381472./.202-07.2:3 5.9/.4-.3#.9897.3 ..8 0897.23.5.3-079.8202-:9.907.20.3 0897.2.507.58:/..5.-.880.39073.-07:-.3#-07:-.3/..890780-:9711920325:. 2.4-.9202-039:..9:./897.3 202-:9.3 .897./.33.3/53/.. -:.3#-07:-..2.257802:./.8907.381472..3/.9.7897./.5..3907/.390.-.3 507.3032 #..9:..8.3$.808:.8.780 80897.4-.8907.3#  897.:897..8909. /..07  .3.3 503..2.

.790%../09./.3/:3148147/.203.790 5.3/.3-.5.38.-0/03.547.790%90.3-.:3 40 0780/. //.7: /.0-07.9/.8-.7803.3.33.3-..35.3.9.381.330.3  -.3108%5.37.3/03. .33108%5.3/.90703092.907 %//./.38:33. .203..2./3/380 .3907.3574903/..5.8:3.//.280 80 ./.:7 /:5 -./..203.89. 200.%/09.7 80 .:2025:3.!07.38:/.4 03.4/902:.90741.- :.. 5.8 203:3:.90703095.%/03.790%//..3203.3 7.35.5240:574903/.3 80-.3-.8:.-0/03.3/:38:1:7909.790%200../..280 3.3./484945! 80/..3/.-03. !74903 .3202-:9.35..4.37.3./484945!  2.9070309%0/.-0/03.8 80 80 .5.35.3:2:23.: .-0./48494590780-:9 .3/./.2803.  2.33.2.5.9070309. -..288  73.-0/03.3/.75.5./.3907:./484945$  $0-.203.790 5.9..3 .3203.3-.90741.2.9070309  .3.33.9..3!0803.92.4-.9.7:8.9.907.2-.3.9-.-0/3108.07...%/. //.7./.280 .9.7.59/.970574/:8 -.-.3 5.8503.3/:3.5.2:2.3203..38.: -:.388  -.3  !   .4-.4.35.3 907./.2.:.790 5. &39:202.8:./.3!./:3.4803.8: /.3/58.90741.9-08.3/./.3-.5..9: 8.37./.90741. 2:.80 !07.4.2.9073..3..3.48.5.%0/.'7:8 .59/. .4302:/...2.490.980/9/902:. .9.90741..7.3/2.790 5.390.3/:3148147909.4-.7.-07.340-.3/.80/980.3$/..3 803971:.203.3..90741..2./.  ./.350.3/.30:. .9070309.80..9./484945$ 80/.8507.38.4 $0-0:23.790%2. 5.202:33.7.2.3::30473.3.3... ..5.2507..503...790%.3.9070309/..4  /:9402.320307./484945 90780-:9 5.3574903.7   .3.:. %073.9: 09.3202-:9.3  $    803.//./3./.3.%.3.302-.7..3.4-.3/2.38..30/.574903  #80-.3/.280 80 .33.280  .3.:2./03.....38:8 70574/:89.9.30- :7.3/:38:1:7 /.//. .2./3/3803.280-.790%.

2025:3.././.5.3 40 7. /:-:3.89..7  !07.780:-:35749033./.3/.3574903  0../.3/80-:9 3:048/.882..35.9078:8:3/.803.3%'.7.80-. 909.907/7.503948..3.5. #/.8.: .9203:3:.3/.9 .#3.3 /7043899:8/03.:3  070..  03:7:90-.:././.207:5. ..2.89.3. 24341481./ 1.3#80-.3 897.9.32.87043899:8302:/.2.397403 942 5.-:3.2503..9:.7902-.:39: 02:/.2-..2.3/80-:93:049/.3207:5.2:0.7:89079039:/09./..030 437.397403/9039:.23:0.-07.3/.3574903/.-.8.380:-:3574903/.7897.3 .7897.8 503.3907-:3:8//. 80/.3-.8..3 $0-. /0487-48.# -:.:3902-.202-039:240:.397403 -.5.8.503948..924..38.2.2025:3.53:049/..3507./.3 #/.8.9:.7-48.7# /.%'.39.3574903 &39:202.:  '7:83203.33:049/.3202-:9. /.424./. 805079.314814/08907./03./.803 :39:202-0/.3/..7897.9 :....3574903897.547.3/.:94-.: 574903 .942...8.:.9 :.23:0.3:048/.9/.8.9:/03.3..39..280:-:3574903 03.3.3/03.../.3-.543:049/.%' %'897.3..:./.7897.9.9.8.39/.5.3 5034247./.9.3 507....3/:3397403 !.:.7203.8.350309..9/.9 %.9..3203:3.392-:3. 4254303 .3897...9  :.380-.2.9070309 ..3203./03.340.33.90703095.:.33./.74240:39078:8:3/.703.37043899:831080/.:-.3  574903 # 5028.3 80-.9/80-:9:./..3./.809.902-.7897./.#.8.0/:.3897.3-.5..9..4-./.3 0/:.#  4254882.803.2..7.7.8.35034247./. :.4-.9/58.503948.7 8:-:39 8:-:39-07:.-.7:8 .:./. 397403-07..5.35.-07:93.7:8. :049/.32.3.907 03095.#3.3.3.3/:3240:#..39073...20.7:8.3%'897.-.3 /7043899:8 /03.32030-.7897.0-07.:9/.3-07.3.38.3-..3/7043899:8/03.3-07507.503948.5. 3:049/.5.37043899:8.3 $3075..8.503948.9.7:824.3/.9..3/.9425079.9: /.:3902-.9/825:.9079039:240:#/.3203039:.3 2434207 ..3./03.39.2.3 %'.7-43 /..3.3/.3:.380./..:3 #/.303.3..7:8 %' .53:049/.3 /3108.:.8 503.9425.5. .74240:90780-:9.%' .503./.3.3/.947.8./.390.9.9:::81481.380-.9425.8.-07.

80/.9-07:5.5:73 -.203.9-07:5.503948.33  80/.3....897:9:780-.9.3.2025:3.3.0/:.9/.3.3/0487-48./...5.3 #./03.5./.:5:3# /.8. /0487-48.39/03..3/.5.3.8 &  .3:7.397403./03.7-48.89483  .8./.923 909.#9/.9.2.       ..9.  $02039.3.5 /.9: -.907/.39.3. 94234247 5./3.543:049/././..990780-:9    ! ::81481..7. 2.:.8.8.39:3.3.5 203.2 ..9:3.5..5. 2.:39.:.572/35./.3-.3-.:39. 3207:5.7. /.9.9                            :.8.8./:.3-.3.9::8 805079.5.:/80-:9 5:73/.240:543:049/.3/.3.23:0.3.9::8803.:923 % !.::./033  .8..37.9-.3507-0/.# 909.2.8.2.:/80-:9572/3 ./.

33              89483923:7.3/.3-. 397403240:/.8./.3-.7.389483  03..5:73949./.2./0338.524/0 90780-:9 .47..9 4/0$97:9:7.. 4/0897:9:718240:5079.2. 4380397.9843 /.8-. .:.3/:3./03.7. /.34380397.8  .220./:.2.././033 923907.7-07-./.8.78508080850808  .8.7./.:.33 894838.382080. 4380397./03.3/.8.8:.3803/73.:./.340 .9:   .3/0/:8907./8.35.8..572/3949.3./033:.23:0./03.8 -.3:.:203:3:.8.9.      ..3/:3.3.9-07.4380397.8.8/.7  42543032.:340  .5.2..11907.9843 7.5 4380397.3909.2-.5 38-..8.3   7.203.882.3.338.3923 80/.

/.39338-.7::3 ::33 ./805./80-0.3-.3.7..543:049/.9.3 .3.7/.8240: .:.::33/3.28.35:.8.3-075.:.8.3 8:2-:.3./.7.9/.-.543:049/.3 14814/08907/03.89.8.3907.883./.24/09.079.94234247 ..5-07.8..9 .3/74037.73.: -075.-. 80/.7..55./.395.28:2-: /.8.8.3.3703/.5075.8.3-.39.39.8.8. 09:5:. 39.3  $09.8. 8./0487-48.35.7.9.7.8.8 240:3.3.3.5.9.33 /. 3:049/./.2.8.37.7.38:2-:240:/03.7:89.5.2.3::3 .314814/08907 .3907/.3.5.9.3./.3./.5.35.8..90780-:9 2.42502039078.-.8.9/9039:.543:049/.:::3  ::3. ?  .2./.3. /.80-.118079.3-.3-075.0/:.340.9::8   0..-.-07:93.33.5. 397403203. 909.94234247 /03. 8.2.543:049/.3 203. 53.5  202503.397403 9:2030-.38.3.3240:203:3.9:::3:39.3-.33.9.5.:39.9. :39./17.850249709.8..50.80. 8..324/0897:9:7.203:8:.3 7.8. -.3.3.3-09:5:.30/:././..-9.3 .5.8.9.3/03.7.:39.8  3:049/.3.39.3-07:7:9..8. -.703..3/./. 2025:3.5./.9::39.3  S 907/.8.9.9/.8./.8..80.3/50740/.340.2.:::3! 0/:/:.9.40. /.3-.-.3/:-:3. $.7.8.3-.80-.94234247 5.33.8.90709..3/74037.395..8.8./.9843/.38.9:2025:3.33:049/.738/..7.9803.9 .:39.-.3907/.8.3%.7.338-.39..3.: 2.7.3..3./17.3.-07.7 40   38 # 7./80-:9.3390780-:9.3:.9 5..:39.8/. . -.9:8.3/03.7::3 0 2.2.94234247 9/. ?/03.42502039073.0 .7::3 0    !   !  !  !  . ..32023/805./:-:3.  !4.-.:39..80-03.3.0/.78:2-: $0507990./.7.33.32030-.-0753 /4:-00 03:7:924/030/:.3203.-07:93../. %907.33 203:-:3.-9./.7./.5.9::39.7..3974039078:8:3.59.20.703. /.3-./09.203:3:.5/:.7.3.7909.3/7403.:39.3/7403  0.9::81481.  ::81481..%5.5.543:049/.:..3-.9:8.8.383.3.9:  ::33/3. -.9:  -09::7:9.3::3 .:7:9.3.33907.9.3. .3.9.3..9::39.8..:39.9:.

320.3 /..09:7:3.3 09...25:-07..31:3803495 .38090.3. .2897:9:7240: :...-.8 .380-.-07.5.9203.9203.7:8/./.8.-  .907-:9-.5.5.39.3.8. %.3/03.7:80/980..3/..9.3.3905.!  !  !  !  !  !     .320.35073...3820 9.3/.3103495047.3.. .78.3202-.78.9:750702-.3802.3.907 0309.9070309 .5./...32.3 -07:-..2.5.70307.3/./033923:.32.80 0307./.3820 .2-.38:3  :383207:5.80203.907:3..70307.9-..9/.3.8..03/02:.7.2.80309/.91:38..4:89/.4:84307 .7:8/.05.59../.9:.7:8/.33.3:9.9:90.35079:2-:./805.507:-.331472...3.3389483 :38.847. :383207:5. 2:9.749 3..340240:90780-:980-.9070309 $090.3 20.23 0.9070309.9 20307:8.3-078.25:20325.800307.8 ..7:82.331472.890780-:9/.31:380.8 :383207:5.1:38544-07:93    ..:50789..320. 2..3803.2-0-07.7909:.5  085:3/02.8.907030980.-    .3/..947.8705..35.9070309../.7:8203..8/03.0380-.80-.3/.2.38202:. /..3/107038./.8 81.3-08.47.2507:-.31:38103495 .3820 793.9: ./:/0.9 81.7.1.8.9/..3/.90703095.3 80.3..:08570803 ..3.7:8203.8.: 705.5079.8    .747.343/83:3.7..907 0309 .3.39073.7 .207:5.9240:073.

-0753.7.919..3-.203543:049/.7:.7:  $02039.09.5/5079.-.3 9025..9.39070-/.3907-039:.203.3.2.8/ 80:2.9:43807./..390758.8.3502-039:.-0753.3.3-.83:39.91  80243807.3. -0780.2:3 2.543:049/.8 /..3/:25.9 02:/.29...3 .9025.83 2.2033:049/./:8:.38.../.-0753-.7..3203..3 803//.#05.3.39..3.9180:7:9..705.17.80-.217.3/850781 !./.3-0793/.7: !./ ...0/:.8 80243807..705.7:803..843807. .3.3909.09.705.2502-:.543:049/.:39.203 17.35073.3/.:39..2039.3..-.7.-0753203.5/5079. 909..3 .91 /.8/8507810/:..9: 5.::803./..90 -.502-039:.17.203.7:                     ..3/.3 17.3:39..3203.3-... 543:049/.9047098705.

30-03.8..507-.75.2.397403.9.33.3/:384945397403 :39:203.9805079.3/:8:..5.20/:280.5.390780-:9 .8802-.8.-./03.943 !07..3   $9.3974035.:39.9.80243807./.30-:7.83.3849453974033472.  40:2025:3.3.5.480.080843/..5.0307.9.7./.7.38.7:9..4-..07.5../..3/02-.39.9047098705.907 .3-..3203..5.293.91/850781 . 80.803971:.  .240:80 80-./9:2-:.0307.3 -.3 5.8 :39.3.5.7.3/03.397403..3/3./.3.07.5. 43807.:06:-7:2/0389 7.3/.93.3/:384945 /.5.907.8//. -.3-.83 2.9.3 .3.3 202.9.203:2-:.907.8-07:93.2-.09.2..9..2. 3472.8 02:/.5.83.7:  .703.9 /58./.393.0307.4:20 .240: 240:/03.7  %.5.3/03.3-07.890780-:9/.705.7.2.95078.3 .20.8.3-.3$9.-0-07.91 .2.-0-07.3  07..380 80-.03971:.7.4/03.3.9 203:9507:-..9/-:9.:340 $ 080843/.3802:.:507.7.3.3020/:23472. -.547.39.5. $0-..3..3 -07..9 40:/03...   0.9.907.3-07-0/.307.9:.2.38.9078./039 .30-93/..93.9.3 0-73. 803971:.950.3.3203.3/:3 2025:3.4.3.9..33.38 808:247/.9180243807.220/:2 .-0-07.33/.8.8.90790780-:9.393.2.4-.3203.  070./.3/./03.9.5.32.../.8 2.7:9.3..5.7.907.

.3 .2/.

.2 80/.307.3.3.5.7:9.9..38.   ./.

9-.3903./.20/:2   3./53/.-:3803971:.. 8090.5.30/:/:.780 ..993 .3.3-.3-7/ .3 0.7:9..3.703.79.203025. .580-. .-:3 80/.907/.3././.-:3 $0.4/9:2-:.35079.9.  802039.9.90/:/:.9.393./88./.3.3.0307./-.9.3203025..780 . /.8   .393 02:/.33.0307.2..9.240: 240: .320303/. .9.:/80-:980-..3/9:2-:.7.39079039:./.9.3/1:8...380..320307.20/:2 9073.3903.3 -07. .2.35.2.3903.2025:3.9.3:93.25.-.9.907.8.8/03.9./03.9240:/803971:./.2.05.5./-./.3.23./...290780-:9.4.:/.9.9.3  5.0307.202-.3/0897.-0-07.7.5 080843/.35079.2.50/.35..3.3.2. .85./9:2-:.9. 752 /.8.89.3 02-...393.2. 3.38.3//.4.3.8 9.-:3909.33.5./.3907.3.907...9:3./.3.3...3 .80/:..8 3.3.5.3 8.7.3-./0802-.8.8.7:9.-07.-:3 !.9203025.0307.490./.  .7.-:3 40:/03.2030.3$9.9 /.3.3.3.020/:2 907.9.8 3.207:5.2  09.3/0897.9-.38.0.89.07.5.-:3 09.20/:2907.803971:..2..5.8.0307.0307./03.79...2 2.5.907.393..9..9203025.3240: 240:.

3.:705..39075709.307.3703/.7.0307...3-.5:2. /:25.380907:83.307.5.9.7:/03.83 0.91       20/:2 0897. 0307.4-. 80/.7:/03.3240:20.5.880243807.3909.3-..2..9-.:5:.880.52:3.3703/.8..3/03.8      0897. !.8-7/3.3703/.9./.502-039:..8/.2-.8      0897. !. 20/:2  0307.3.3.7 907.3.7. 02.9.3803971:..8507..9.32. 0307. -7/ .5././.-.393/.307.  909./03..39.8  20/:2    ..

2-.80:2.4-07.3 503.80243807..91  !.9.7:8 4745.7: .3274845009743 03.2.780 80 .3/03.3$9.7.3.3/:9405005.3080843/./.2-039:3.3203::3 :39.8 /.8.390780-:9803..35024943.8803.20.8/./47.314814/08907 .314814/089075.3:9:*. 574.3.3::3 502.7.3705.2.3 ..7.23.3/0483:049/./.:947..9-.2-.329443/7.:.8803971:.7  #05.5.2-..:39.30/:.3 047  907549433.3 903..83/./.73..35.7..3240: $0.73.0897.0705..880./.3 90780-:9 $0.3::3 !02-039:.9/.3203::3 743.83.2.83.: #05..  0897.3 839088 :39.507.7..9203:3.3/03.. 705.::3 .-..73.7:907. 705.3  ::3 .32.8Û 909.3/3.38:33.9079039:./.202-039: 047 .-07-039:203..9033907..3080843/.8240:/.3705.8/805:9..3 705.4-. ::3  9025.3/50740/..390705..8 .9.38200:.9.1/.3:9: 80-03.3.7.7499073.8  39075709.3::3 /.9.7     503.3-07.7.3.2507.705.//03.3$9..8. ..8Û 5.7 3.3.-../03.7  .87424842/..8.2-..3705.3202507.5.3805079:7:1:3.-.7.8.2039.. /./47./.203.9./.5:.7*-..80-.3 203.:947.32.3::3 /.20.-0:2/09.943  #05.703.8.7.9::3 5005.8/.347./.749/03.7:/. 20/:2  0307.4-.705..907/.3 3:049/.20.9.07.7.2-.8.3 202. -07-.390717.2-.:87:./...

8 .3.9/.24341481.3.95..3:39.3/80-:980-.3907.5.//:.%  %       .9.3/..:# .8 705.200-.2-.8/048.80/.3/:..3/-0-07.:839088 20-.032 $.9.790780-:9 80-:.32025:3.8./.3907/7.90    $0203.8.3057207/.3203.3..80!!!!           ./.8./-07.8.240:/%!/9..:47341705.3803.3-07507.7/..8907.09.9.2705./.3/507408:.39.3.3:049/../705.943 47 !74808 38.9503/0 /.:2.9421481./03483971481.203.33. 425430370.93. /02-.2-.9.7/%!.8..3:39.80 ..3907/7.883908880...8.2./.30240:57207..9-07:5.3.8 .9025. 9/.9:/.8 .3572073/507:.5.9.:7:9.9 /%!  /048:..240:.39..    !03.3-07/0.//8:.408.7:803.80-:.83.9.502-039:.39.38:3/.0/:..839088 503..3.3/50740..70..2-.314814/08907.3/3./.7::3 0::3  %%     . . ::8  -0-...3/%!907..7.380-.:39.703.2.    &39.754207.8.9: .3:049/.3-.2-.9-..83/9. 574. -07.9 /%%! 0025.2025:3.8/:.3/..:5:30:. 2:.5.3./:.7. ..8 #05..9.380:2.3-07.03254207.0:.8 839088  #0.3/09.3 -07507.3/:3./../.380-..9 /%! /04889/3971481.8:2-07-.3 240:. 47/.2-.09.75:705.2-039:3:049/.9:740 -0-07.3 !.8.749 80.23:0.7.: /0483:048/..7.25:20.8.5.3-.3.3907/7.03254207./03.32.9 3:049/.3 9025.749 907.89.9 /! 9.3-0707.3/.75:705.7  .9.09.9.8 40:...8025.2-.8 ..9. 543:049/.82..3483971481.3/.971481.5.9 /%! /.  .8 -..8870. -/70843./..5..32028.9421481. 38.8503..09.9/902:.9240:3-071:3880-..3/3..     :.9 .747203::/:.8705.2.3.7.3/04892/3 971481.9:   0483:048/. ..9 !! /05.3.7.3-.703..3:049/.80.9:9025.7492.:.9-007..2....9  32 032.8.338..-:..3./ 502.703.9.9:7 502-039:.3.5..7..3-.8839088 /507:.83 2..23.3%%        /%!!!         !!! 54207.:39...399.802.99079039://..-.. 38.7.3 907.705.2-..

3/507:./:. 0:.8.3032705.2839088 !4 207:5./.749/80-:954207.80./.9:54207.2  .3 80:3/07 $02039..70.80 !4 .9: 03254207..2.80:39:83908874248425..80 !4 /.7.3507. .354207.3.2..3032!42020.2-.80..3:39:8390885.7  $02. 80/.4.8839088 3254207./.3:9.

32.42025:3./.32..  !.-007.3-./.7::3 0.7::3  0::3 .3043./2085:38.3/80-:9.-.317.39.3.9./03. 08. 57207907-039:-..:542078./805.7 .9..572.3.3907.33.9./.8.203.3.83:0.39:2-: /542078.::3 .353..-.8.../.3-08.9.85.8.8.3839088./.-3574903 0/:. &39.907..390780-:9/3.39.7:9/.25:20.-07./5..3503.3 503.:39.:.80843:0.5.3/./..3/.8.38.-  32.3.:08. 909.3.2.3:39. 5.7::3543:049/.3.8.839088 .3.:-0707.:.90780-:9/.3 ./5.7.55. 9..0/:.3.3.3.8 203.7.0/:..8.7.33./.31:38503:393.31.3203.34393:803./3.2574808839088..8./.80   .3502..2039075:9:8 5:9:8 .33:049/.3..8/03.3:39.9/-0/.7032 54207. 5024943.0323-07507..8..3./.7:.9.47 $090.3240:3:049/.09.5.574808.9.  32!4/.3  03/43:0.3/ $39088-..78.3907.4393:803.98..5.80/.3/.2033/507:.3574903.802025:3.//./  0843:0.3.80:9..3-.39.83:0.3 28.8.3.314814/08907//.90780-:98073/3.3 5744170.../. /:.80843:0.9:/.3 /.353.3-8..3 809.:39..2-.907.9.3-.3-07507.73.2025:3..38:39/.3 0/089.7.:39.8./805.9.3:39..7.3 17.:39.8390885./.3 2028.2-:317.7::3 0::3  !..9::39.253 .2:3  8390885.9::39. 8..839088-.8.:39./.3 -072.3/.8839088:.832025:3.7.2 502-:.:-0707.3240:57207//.7::3 0::3  .80  /8.9:502-:.80 ..9.  %07.7./3  :8:8032!49073..9:7502-039:.-.7.380/.3. -.9.-././3 897.7::3 0::3 .80.203.503.. 0.08.8 80-.8020.4393:/. !74808705..0/:./.538.543:049/.3-07.8.:5024943.8.7.9..-../.2-.3!4/.8.. 543:049/.3032.9.9..80/.2:39./.503.203.80 323-007.3 :38507-.3.   %.340032!4/.3..9:39:202507-.3.203 17.9:.  $0.::3 793. .3.80.9073.9.  .9./.880-03..7.9.3-07:93.80  #05.8.9.9: :39.9.-07.7:39.7:5.:39.30327.-075..3/0..9.07.3/.503.9.0/:. 8.203.:502.543:049/.:...38:380.8.538.5.3.3 -..2.:39.7:/..308.3.3..7.:.8.907./839088-.3:39..3 203/089.20-.83 2.9.9:39/.9.80. 5..803.39075:9:8 5:9:8  &39:203.: 502-:.80843:0.54207.9.7:.../.8.

3:9:/03.73.8 17.203 17.5.:.      :39../03. . 90793.2705.33.3 38.3203..7:4393: :39..3-../80-:.34081.39/./.-.7.3/.3/.903254207.4393:80-03.8390889/.-.7.        17.203 17.2.920339088/.3 ./80-./...3203.0/:.7 839088.4393:/3.33.50302:3. 0 8079.4393:9:/80-:9:39.. :39.3/.8.. 808:.203      .39/./.3/8.3032..203 .9.9:.3-.  $0507990.317.:39.3897.:39:20.203 .7.80      47:39.  .09/.503.39:.9: 17.7  ..203.85.7. ./02:.8839088  &39.3/ $02039.2.7.09.25:..2.80.90793.3.2-.203 17.

.

39::/.3..8 $.9:2743:0:8/54/ .39. !4890/-.3/:9/03.2743:0.8.//:./.32743:0.390788.7.530/:.7..2/00307..3203.3/0./...2 /00307.54/ $0.80-070.90/:.3204882743:0203.380/9025.5. 2743:0203.229488203.1-40309.80 0843:.29488203./8.3  80..54/ .54/ 0/:..39.39::/.9.8.9:2743:0:8/54/ :./03.9:2743:0.203..808:./8..7. 803. 203.3.302:/.3203.31:80/:.//0.7.2743:0 ..7 $9079.203.229488203.907.742039.9.  .3:.9:2743:0:8./ .54/ .2743:03-07.35.5.8..32743:0 .//:.2/:.../5079:.8.3.39. 202-7.9:2743:0:8.-:3 202-039:8.:3 3.8 $.780 .80.:./.37:8.3:93.0309203.390788....38.39.2.

2743:0.803.3802:.3 0-07..3/5074080502-:3:  /.39:305..: -:.320...825./2.9.3-:..:.8 .8 .:5:3 . 803.380-:./.31034950-:. ..32.3802:..3..3.790./.7.2.790 5.9-. 2.80-:.907.3803.2083 80/./5079:..3803/7  :8:83.8.1.207:5.3..229488203.3 /02.03 03.3-:..3.-.43941034203.2.55.8.55..3.703./423.9:0425480 ..35079.9.3/.25.5.23:0:8  02:33.82/..5.2.55.0..3502-:3: -.3.2-.35.3/.209-093.25:-079./8943088 5028.3472.3 /.034857.8/03./80.-07.5.20.380502-:3:.:8945.39079039:!.9907. $0-.3.3203.38945..91/.:3380..3.5.82.././..907/../.920307:5.9:81.82.:. 0/:.3.38945.2.5.82././50740/:.3-07.:..81.3.3502-:3:  ..3/03.:94. /:.82909.790..1034203./.33.7-.9.92743:0/54/  $090.80 .9073.25:203.3/:.3.2743:03-0702-.25..3502-:3:.9502-:3:..8-.808:.8-093.:94.9/..380 502-:3:/.3502-:3:20.3.2 8945./.2085:380.9078945.3 502-:3:  /03...03//.-.3.:70..93.80..80502-:3:  20..3 50789.39.7.7 ..025./809.39.2/.28945.9203.338-.907 502-:3:-07-039:59.0/:..3-.2 2.380-:.2.780502-:3:  8079.3.3/:3 5.35403. 502-:3:  07  .//.790.8.802./..9/.8.   $9079.32..-07..3/80-:980-..:3/.380-:.7.39./..:2.3502-:3:.82.3203.9/.33.703.8.39.2/.9079.7.72743:0 .5/.9.203.30/:.8.3897.35.3/: .. 50309 805079%  $4330-473 203.38945.7  .38.:.-.:70./.28945.72..790.790 .3.9:89079.-079:../..:2./.380-:.9:74003 037424842.3 502-:3:  .3-07.57480870574/:8/.380:2...3507::39:/09.2-.3897.:94.7909:803/70-07.3.3424489.3-07034950  .30-07.39.5.:5:3 5.9:74003 037424842.0/4-.220488203././.9.73.3.7  .//.743:0:8.3.9.857.3.: 5.3/:5 2.8.55.3..5.83 80320.:94..5 .-07034950 .5..8.8.95.3..3-07./.7.743:0  0/:.302:/.82./902:.790 5.9 203.0425480 ./ 034950/.3. $9079.3472. 2743:0/./.9:2.502-:.5033..9202.-07.9.35./.9:.90782-43 .9/.3203. 0907449 80 80.55.3 502-:3:  .3/03.809/./.39:305.55.5.82 9/.80! .8.38.7.:.8:./54/ .3502-:3:/9039:..78.897.83 2.9: 43/8./.5.3/./.  5.343:.890780-:99./025. $03..//.3 897.::203.5.7.:3 %.54/ 03.8..-:.3203.3203. 090744990780-:99070-/.82.80.:94.-..793.3897./03.310799.9/.:94./..38907.25..2.950393  .3502-:3::39:-079./.. 50./80-:9 80-..7.9078945.3502-:3: 5.3/02.5.2:2.907.3.30/:..780-:.39.3//.82.897.78.340.8945.9/50..3..3../.8.3.80 80320. 0-07.55.3/5074080502-:3:  /.28945.-079:.-07.3./42449.037424842.38:.3574944.38945./.:3..790.909.83 2./507408. 02:33.92743:0/54/ :.50.390788.8.:3 -/.83/03.3.78. 802039.9.2./:./ !079.33.3:93.9.0.2.2 2..3202:33..380 /50740/:.82  !.

4-...380.39.:3 .80-.95.740 #4.800307.3/: ./0820.2-.8390.-093.3./:3472.3.389079..802.:507.35.3/03.8./.2574/:8-./8.3.35079.3 5078.5.9/./.2.78..50...7.:3 -7/.-.8 03889079./:3./:2.39./50..380-.3/.0307./.. ..7  3/..  !4.33/.909:.

.

9070309//.3.0.3 :39:202-039:574903.3/..88902839088 57490329443/7.42039.2.39. .  -.24745..3.3..7%3./. $0.-42.2209..35420307:5.9070309//.350995.3.0/.93.9:740 2.950 ..39.5079:2-:.25:.070.7. 800.-482048/. !4890/-. 202507400307:39:5079:2-:.3 09:7:3.3 3-07:5.3.3. . $ ..7.91 $05079 .307:8.3472.35099 2:9.33.1-40309.8.8.354203.33..39.3950.3.2:9.3802:.-093.  :9.54  $0-.3.7 .354 542:9.3.302..3.35.39 !078.-093.8.7/./.3 09:7:3.3.31:38 29443/7.3.380-:. 54/.8.2.7.3.9/.3/507:.3:.3.3.3.32:9.354:..7203.229443/7..2-.39.90780-:9/3.3 /.2:9.8  -093. 5078..3802:.

 90780-:9802.3 -07..9/.82.5.-.8//.5:99/.3/03. 4745./9039:.507-0/. 203.9.3.9./.3 -0.3..3.78..2.5-0785.9.73.  $02039.3 -0. .5.9:.3....39/./.:3 5.3./.3 7085745.009.009..3.73.9-. 2.:71072039. 5::025.3.3.  $:.50.2025:3.50.3-07.9070309//.4745.3../.9.4745.20.-..2.01803  .. -0/.73.90/ $0 805.89/.39079039:805079-:3.: 2025:3.3.24745.9:9.70./. -093.2.3-0.-.3-07-0/.28945.3.: 5:9 .8 909.74770385.3.99/./.-8.919.3.3-:3./..074-.5.78.85078.3203./.3 -0.8  .9.2.:3 20. -0-07.73.9: -..3-07.3 .7.3./.3.3 8. .380 805.8.-07.9 7..73.91.340909:.3 :8:83.9 ..9 202-.3.9/.:.3.3/:3 4741 80/.: 5:9 /.8.3.3 .5::025.73.

2.39.3 !:9 .54/3/.2...9203.-:3202-039:49/54/ .3 03495009:7:3.9/.5.9..:.-0 .9.3.78.3.907/7.9. 803..703.3-08..3/.8290.95..329 /.:-. -:3.././.4745./.95.3  !0309..7/ ..9070309  /.3202-.5.2-. . 5:9 5:9 5:9 .3 -0./.3 -0..%.33.320280-:.: .80507990.3 .8.5:9 909:.3-:3.8..3907.3.:380:07 .3/02.7./50.2.9..80.9.3 4397-:8 4745.-093...9/.39:305./.9/5.. -.3:93.9/.-.3 1034950909:.8-./.329 0/:.3 !:9 .350.9/825:.9..9-07.3 -0.2.8-.3 -0.:5:3 9.-07.3 ./.3.2805./.3/ .73.4745.9/.-0 -..9..3./.2.35:..7   %.3 -:3.280.:-07.: .32.342-3.89. .7800.3  . 909:.80-.3 -0.: -0././. 80/980.: -0.3 .85078.2024745.: -0.909./:.9 80:2.8.85078.9. 909:.5./.3 !:9 .3 5:9 5:9 5:9 .: .38945.80-.3 -0./.3.80-.380. -:3.3../...2.2.5.907/.3 ..3 .390780-:9/..23-093.3/.5403.2/4243.9073./03.3./03.50.7950.78.-.381...8.2. .3.38./2:33.49/.3.: -0.:5:9 .8:2-075403 909:.3 -0.320303.5.35.103495009:7:3.3//.:5:9 -0.9073.39-49  $0.5.3 .-093.32.: -0.3 -0.32..350.5::025.83...3 -0..3 2.8 802039.3 2030.4745.9/.: .8703.-093. 4/0.35.: .380.-0   0.8 09.33..7%.880 80 -.2-..:5:9 -0.5.7::7. 034950.2.805.: .5.9 034950.8 03./.3.3.78..9.:907.39039./.502-.3202-..5.:5:380-.3 9.: .78.802-.8/.3 -0.3 -0.3.2/4243.39.:8.

9/.47414745.35.:-0.703.35.29097.2..80.390780-:9::7.    5:9.3.9-:.9 5.8 .3 -0.39097.3.2..54/  0./.4397-:88945.//.89/.2-.220488:39:203.3907/7.80950./.7  4/050.49.54///.78.3202-039:443.5::025.9073.9 /9:2-:.5.33.20/:2800915.5.3.8. $0 80..3    8090:7                                      5403                   49          .8.3203:3:.3 0349503./.2.3-:3.3907-039:.-.-08.3203.0/:.7 2../.82.38.9.8025.9../..32.9. 05.

3//::34050309.79 80./503.3.39-49202-07..39:305.3.7.3. 2:33907.3:35.3.3-07.5.3./.3802:.3.38..50.9.909.309:7:3.39-495.9/5.5.//.3.3-07-0/.7.38945./ 4745.950.3.329 897 /03..81.8/./.329 897 /03.8/-.3 .350.. !078.9:950./.7503.3408:.3950.38050795. .3.2/4243. /.2-.950..9/.7 /.39-49 -07:-:3.:2025:3. /.729 .-:3./50.202507.7.78.58970594283203.329 897 203.7039.8.9:909:.3./.3 50...8.3203:3.8 .5./.82     29 897 49 29 897 29 897 4929 897      29  29 29 29  29  29 29 29        .: .3.33./.3/.3/.80-:.9/.8.25.9: 909:.3 50.3.70/:.8 03.309:7:3.8.8.0 29 9.34745.03/0 .802.18 :39:202-0/.380-.9:80-.9..9.0349508050798.3802:.3 :35.3:35.381.090780-:990709.3.3/03.390.8 .0349508.:-07.4745.3 4745.3..8.83-07..3 09:7:3.7039.29 .3-07.3507./3.:50. -0/..78.7909:.3 .0/:./.3.3.78.30897.340909:..4745.38970594283 897  .09.58970594283-07.78.3.39...329 897 203..:.7039.8 207:5.3 4745./. .3./.09.33.. 3./.78..3.909.3203.0..78.3.3.39. 9..3-.8 /.3907.38970594283 897 802039.3503.909:.39-4980.3 -0:2/09.80.39:305.34745..-:3.3.3907..58970594283-07. 907.3897059428390.7039./03.39-49 /.3./ 50.50.:-.34745.78.5.338-.7. 085:3/02.3907.3 507.8.703.8.3-.8/..3203039:.7.89. /..3.7..3. !078.909:.8203:954.3 907. 8.3.9 09.380.-07.2-.3.7   09:7:3..8/.3.3 38-..354.29 $0.3907.85078.50309.38:3:35.29  0.2.78.381.39./.3-.8 0/:. $0-.8 2.404745.3802:.54/.3.3 90780-:9/.9.2/4243.32:9.3/02..381.3.2/4243.38.39.2025:3.9.3907.3203:3:.950..3.329 03.78.7 7039.39. 03.3.909.4394 5078.2.8.39:803/7 ..0897203:954.203:3:.78..-078070.3/03.930.5078.381.3././.32:9.8 $0507990.7424842.8090.909.5.81.3.3907....907.3/03.7039. 2.3 2:9.88-42..5..80950... 50.5.3.-..78.78. 50..274248423:0:8  07-.202-:9.8.34745.309:7:3.35:..9..3/:3../.39-4980.320303.3.:/9039:.8.5078.3708574.950.

3.7  .38970594283897 7039.802:.897 802:..381..2-.8 29950.909.250././.2/4243.3 8970594283    .7.3897 9.78.897                                                               29 897 29 897 29 897 29 897   .3907.3.589705942835. .3.

.

8.380-:.3820$9079.9 5.9.7%3.//.7..39.3!0.381.35.82 7.3..:3 !03.7:0309$2-43$945.2.. !4890/-.3/03.27424842.9073.  ' !#$$% !$ $0-09:.!0.74980./.82!02-.:/.8.!.7:...30$945.78.0:./.7 !#$$% !$ ' !#$$% !$ O O O O O 7907.303 03.3$945.7.78.78.39..1-40309.9073./.350.:502-...:2 0.9070309 !03.9039.825.0.42039.3 90709./.

5:.781.03 037424842. //.250.3 -../.9.903095./.3:9.3507.81.380-.78.3 8080.3:0:8 03.5073.3202.80:2..2./.749.33.3.0:..32020.3 ..90309  085:3/02.547.3-08..

-093.8.9-0793/...9:7402.3-.03/0 $0-.78.754.9//.73:0:8  !0.250.03/0  !0.82./../.75.5.23 .99079039:  .78.3 /-.381.9/.78../.82 !.4394.82/..2:3 809/.8 5078.5.503.39.3.7./-.0.3708574207:5.78.3907/. -.790275-.78./..3503.9: 81.3.3:39: 0507:.78.3  .7 /..5.38945..82 /03..3/.30897.907/.303 037424842.!0.7:7..3.. 202-07.7:0--08. 81.82  7907..30 47...3 70857490780-:9203:3:.3 /.30805079 29443/7.39./.3/.4394 .3.50..39/.350.2. 4745.3..8:/.35:. 09::.7907.33.32.078.8507.253.507-0/.82 -.-'3. /03.247...3$945..9070/9078945.3.: :3.33..80-.350...3 2./.3.3. 8:./.82 39/.3.9:740:38:7 :38:7/:.39.3./.2.39...9070309 .3.7:8/.3.:/03..7/-. /03.8 5.38945..9-07.8.82 $0-03.8.. 42543038945.:93..3 50325.3./.8507.8:8.78.9/:3.5.9:909:.8.-'  /08.5../.390780-:9   !07-0/.7:909:.7.9:1034203.-093.203:954.38945.78.3.98945.7.8. 50.38:.502-..3/.3503.33.3.3:0:8 .73.3.85078.9:2-:.350.3 5.3-0-07.80-.39072.:39:202-0/. .78.5:.2..2 50..9.3:95.8-07-.38945.-093. 9/.8.3.78.

.913:0:8/.703.3-.:.50.38:39.800.3:39:/84.350.92025070. 97. 503../.7.9073.38-./2:33.82..382-43/ /.907503039:81..99/./.3.47..9078945.38282./. ..50.82...8 8:-80:07803/7  0.308945.2.5./.28945..9 90780-:9207:5.8/.28945.9//.0--08.78.8070.3.2.39079039:5:.78.3202240:  . 2. .. 8.78.82907-:9-07./.82.947.9.303 8073.703.30$945.9070309 /.30 47.9: 0/:.9/5./.9:740 03 037424842.5..50.78./80-:980-.3.8:.50.39./.3/.39./.3/03./.3.75.. /.3705..8503.8 .9:8.381.99/. /.9078945..3 /.202-.949079039: /03.3-.2.920.8.-.907030990780-:9 907/.7:2.88:39:203/::3502-:9.82   03 037424842.78.3.3 ..381.9 -07.89.907 8945.38945.- /./.9:2.350./.3..30/.3.9 /509.7.5.82/.82!02-.303 03 7424842.9.803/0 203:3:.9/2:33.50.9:81.381.347..5. $00.  %/.803..82.909.5.23.3.703.82  7.30494342 0-07.82   $:-899:83:0:8/.390780-:9907.3..23-093.7 /.381.38:.7: 70.30/.203025.3907/.3  7.3.5402..35.28945.2:2..9202-039:04254-07.47./.204254 04254-07.9: .-'  0 .3.8 ..39039.8.5.250.9 .82..78.78.8945.38945..5..34745.9 9079039: 2.30 80507929443/7.5.3-.78.

27447.3/:5-0-.3.38200309..5./.5.3-.20.897:9:7 /.5.3574/:8 0307907/.802:.35748081494839088  4741-08079.08.9 %! ./.3:3.3 207:5...3...8/.3 4745.3-.907/..:5./.3907...3820 0:.  $02039..8897:9:729443/7../.30:./.29443/7..38.3.8 ./.3509:3:-.8//..2:7:3.. 20.39.3/48/.3. -079.2.202-.380:2..3820202-.3 2.3.7.50309. 28.5.3 /:5-0-.3/.89/.2/4243.9:50309.27 $.370857./...35.39-4989705942835.0 57:820302:.749 //:./..-0702-.33.3/-.5.2.3203. !.3.7493..909.9:803/7 /.247..8:.9: 4745.7..9.3:.880-.2-039:./.742.32070...47..3-0-07.3.7.03847.3.3.3202-07..3-.85.02:/.3820 09..3.8 ..5 //..-48200307  32 032:39:0507:..-. -.320309.. 9:2-:.0-:7.070.. 09::.003.503.70.83207:5.3803. .31:383.33.8. .3.3-. 03 033/./47.3. 80:2.90./03483971481.3/:25...-039:209.8 !..83 2.880/.2240:3.280  9443/7..3202-.7-. /7..39./.3203:3.9: .202-.3 -.3 03/ /.220.73.30.9070309. .3.301494839095. /.3-07-.82..-3  :9..3:3 82-4889:7:3 902:7:3/03.39443/7.8.303:39: 203.9//.4745..3.-07-.3803.8..8-442.3:39:8390883..-.//:.95.3/507:..9:7.229443/7...

703.803.493 203./-.3 20../.074-.3 /50740025..30.3.7-43-:..38.35099805079/.3 38-./. ..3 5099/..50998070.80 8090780-:9 203.3/03.10349503472.8:48.3402:9.074-  3.3 .2..3950.3-.5./.35./.8203:3.3 /03.39.3.349 /54/.9.20/:25.9.10349503472.:1072039.80/9:2-:..3.3-.32748458203:3:.38.9 .3.35099 509902:9./.8.80 805.2:9.39: 40.3.7   %505079.2:3 .44390780-:9-07::7.370857./.8.73.9  443 4433/3.3.7.8.909...703.85078.3 203:3:.54//03.32:9.5.3.3-..84547.3 907..3. /92-:.: :7. /3..3509920.8503.90.443-07::7.9..49/54/ 2025:3..80..320488 .3..3.301803-.2509:2-:.843.3.9.2-. !078.8.3/./.3950.880309907.2.3.350998070.7.8 89:/1844203:3:./.3..5099 . 2.8 03/0805079-.9/.33472.950 2:9.202507.3 /03.95.370857.3209.7-43  :9.3/3.3.-4820.2.23:0:8  $0.203..34803 20.33472.8//.2-.5.9.38070. .843..9.202507. ../.2209.2502-0.9./.-4820803.0.:.39  .73.2.

3472.3507.229443/7./ 8:2-072.2. . 09.  .10349503472.9 /.3-.3..3-08.93. .7. .9./9039:.9.38:33...0-./5.3.78. 03.8502-0.380950..-.3 :35.207:5.9.7039.7  8945.-..90703092944/7.2.3203.9:7 2:9.0./03.848/.78.3/50740.84547. 07.35099/03..38.3/80-:950993097.3909:. 3802:.3.7039./.78..9070309//..-07902:/03. 8547.7.89./03.-.70025.9.350..0708081  %500/:.80-.848547.340 909:.80 50993097.3  50./  103495009:7:3.35099207:5.80950.8.802:.85078.3..3203.3 2048849/54/ 0025./.39505079.3/83908803270857...3 203.3.7803.90780-:9/80-..33.  -07-0/.3 :35.3-.3.3.5.:80:7: 2.3 2025:3.3.3..350993097. 8547. .3472.340 .50993.82.381...3 950..49/54/ /8.50.91 5.

5099 3472.097.                                                                       3472.848547 .843.5099                                                           .5099 .$070. 3472. $:57081                                 . 54/                                                            49 /54/ 3472.

  .3-0:2/.507-0/.950.2:7 0:748547.3/03. 2085:380-03.8.9505099 3097.2.05030-.070.  $0.805.7.7202-.:.2-.73./. 50998:57081.329443/7.9 8:570847 /423.:909:.350.7 /. 3./.3:93..320.78.33.78.3..3.3 2./.31034950 5099 $0.5.35.78.9.8.-093.5./.33.95050998:57081 0/.:909:.5099 3097..3 3..7  !0998:57081:.3 -.3/.8.38050993:0:8-07. 5.10349505099 03.33.0:748547.78.5./:25.848547.27$ ./.025.3 3.5.3/03...23.3 5.907.503.3 805079./.7.7  !0.9/.0 :39:502-039:./.829443/7. 80-.3950.8:82:9.3. 2025:3.7039.35099  %5009./.3:35.203.9.30./.-5099-0793/.3802:.349/54//03. 50.909.829443/7.73.850995.9.-07.2-.78.203.3.207:8./03. !../.5..32:9.20.0 .3..5.3./ 5././.:. 5078.820488495099 3.7039././80-:950998:57081 .9..907030929443/7.30380..5 07:8.2:73-0:2. .38:3:35.9073.9.5..3 907.5078.78203/. :9..2-.9/0..3 /02.3950. .7./. 50.

.

.42039.7 .. !4890/-.7%3.380-:.1-40309.8.

2..2!03039:..7.8.8..#!%& $ ' #  !%&$ 74248420../.3 203. 03 037.381.3/-.78. ./.5..3/./:-093.3..3:8./..23 !02-07.3.35./.34.23 7.9.209 .3 907/7.3.23 3.7.2.23 7424842802..23 3/.. 3/.8.9/:3.: 03 03.33.7   $.9:850808 47./:.742484280.350.39.30380./.  3/.-:3.:94842  $05079.390709...320-.3037.1034203.897:9:73..9.2.974845.3.9.2 8070.03-07.8025.9.//././.90425403-07.-'.23 .9/:3.95.0.39.509. .9:7424842.78.3:94842 O O O O 03#.8907.897:9:73.30380.9:/.930.0 /.30380./.8.9. .9..7..33/.209..3/.303-07.3/..3/.3.74248420.2-.8.3..9.3-093.:0025./: %073.9:8. 907:9.380.8/.74248425.9. 7./.5..34.3/.374248420.3.3:39:202-0/../:./.320.3.23/.390709.3.703.3.9.3:..35..203.03 03./.3.239/.0.803.3820.9/./.3/.5.7:472430.23/3.3742484234247 /80-:980-.3/.8:.3:39: 202-0/.70025.5.93. 202507.3507-0/.5./:.2.0./: 3/..3205:9:7:9.3.3.9:74003 03-07.:42-3..8.50.-.7..3.23/3.80.3820 742.338-.0.90425403-07.354908843 !03..23 80 30/ 0308 802039./.890790780-:9 /.20990780-:9202507.-'90.303 033/80-:950789..374248425.5:303-07.0.23 %50!03039:.2.30380..20.390709.23  ' # !%&$ !.3..7424842 :39:85080890780-:9 28. 2..23/.2.7424842 0..3.9:7424842 0-07.2.3820 .8.74248420.23  03 03. 2025:3.3509.85080847..5.:94842.754.5.33.8.3503.3.  20.3803.3907-039: -.23/..2.50./..

/.9./.2.3.5././..3 2.9..73.88902503039:.2 28.3509:3:-.78.2.3.3.3.3/09..32.0.9. /.9: 03503./.3 507.2.9/./...5./..3472.9:740037.503.3 40% 47./.3909:.2 /950 80/.80.32.9.2/.203.: 03950 .5:9-093.3472.23/.3.78.2 2.2-0781.30380.3203.239.802.2.3.3.78.3./..9/04254 04254..39.03 ..5... 5:9/03.7.207. 0.8907.390780-:9 :8:83.3.-07-0/.3/:3.3-072.50789./.37424842  0.32..3202-07.235..9 20./03.3.8.3.82 2. -0-07.5:9./..7424842909.39.9 81.35.73.2 3/3.5./5079:.207.02:9.39..9. .3708574203.703.3./02.5.3 03/0507.9.1034950/.3/03..0.3/.3907.23/.7..7::203/0 $0.50.3 /...2-..3.33..5.3507.037.5.5:.9.93. 3.3-07/.9./.3.3034950..5./.35.5.3 09:7:3..037.3 ..5.73.3/.3.7424842 03802.:950.3037.2.2. .507.303503.3..9.235./037../.2.9./.3.3#.9.39: .9:7.3708574 034950909:.2.3 203..8. 74248420.2.23 /../..35079.9/.3472.3.9.23 /.30380.9203.9. 207.8025:73./.2 -072.2037.33472.73. 9/.39.-07-.3 202.5../.347.3 /.390709.9..3 203. . !07.39073.  0.8.:3 .2.8.02:/.5:9 .3.-093.2/.950.8.3  !  !   -093.0307.73.3.3.0..52025.5:9  03.-072.3708574/03.  30/0308 8.-0-07./.33.3-093.7.39.3/.0.85080847.9.3.32.3.74845.-3.9/-0/.3.34.. 2085:39/.7..-072.309:7:3.3.74845..5.8 9073.3/03.83.2-.39.3037./7424842/..74248420.239025.27424842 0.207.-07.5..78.3.5.  .:39:81.82.3/0.9.2390780-:98079. -.3/..2-.9-072.:2:23.3.3.7   7424842/.23/.4-.4-.9.320325.3.3.-093.23  037.:.9.03.93472.39.                     -093.  30/0308 /..  !078.3.9/423.  $0.39.909:.203:3.3.3-07-0/.74845.:-.7.:-:3.3..33472./.38.9.9:7950.380-.3.8.3.703..0.5.39.95.8.42509080 30/0308 !.85078. .9.2539: ./.50./.3-07-0/.50.9.3.9:7.3.3820  !0.90709..9:7..5.580-.3-093.3/.

33.33. 805079909:.-..37. .7  .3.9-093..7.5..2-.9:3472..25078.39.3. .9.507. .7  . ....74845..9.2025:3.3.25.9./.2-.2.

 0..3.9:3./:42449/423.-::.3/03.9.5:973.3.:/:..07.8.2.80-:. ./:-093.3.3.33.3 $0-.7:203.3:8.90780-.202-.3907/.209.0:./:-093..-:: -07.209 $0-.39.. :.3 .0241.947.3/03..33.9:.2:3 ../:/03.3.8090.3 0249/423..5.23-093.209./.30-.5. $0-.2./30.33788.3/:.3:39:2030-:9.7.7488 3079./.35:97.79.-.303.7424842  3/.30249708081 .33. 30.8:8 0241./7802.909074.9424.3 2025:3.9:037.3 202-.70025.9: 3/.39.-0-07.98090.73.9:9:02.  0241.:.39.95.3-07-0/..39.-. $.8.93.3..:.309074493.7.:.3./80-:9 0249708081  #.3 -093.9/:25. 0:.3. 0349500907449:39:037.90.3.3.209  #..707..3/9039:.9:  .5.../. .389.78..309074493.34 $02039./:42449708081 -093. .202-.30907449 0332030-. 8.5:97.5.3.7.38.3203/079.:.7424842 .23/80-:980-..3 .5.703.9802./:. ./:./9.3 /...3-0781..4244 803.3/./.3:8. .0390780-:9708081 3/.-.9:5:9 !0.9:.209 .95. /..7/..9.3 503.9..../..9:.23.33 /.3.32030-.3.2574808502-0:.. .-.3/. 2..73.3202-./.50...3.07./90703.7.7424842/.0241.349...3 /.80.9.3.30:.7. /.3.73.-.3:.30349503/..303/423.580-.7.-:.0380..90241.9. /.9 507/.:.9: '.7.2.20.85080847.:.788..5.39.3.:././:.7.. 3/.3378203.907/./.309:7:3.73.3.3 .2.7424842 3/./. $0-03.33.9:  3/.3207:5.380-:.3:./.3/.381..7..2 3/.90241.5./:25. .203/079..7424842/...7 0/:.9: 8.209./.30249/423.9.9 .. 3/.-09.39.32025:3.3.8:8:3.-0-07.8.4394037. $02039.07.9./.3408:.7..8047..30907449 0.9507/..5.7.3$5.9.7.3./:-093./. 503./:/03.349.3/.-0-07.8.3-0781. .209../03.3-07-::947948080./.7.9.802039.754.3#:8.#. /:.2.947948080  0..3203.03708081.5:97.:0907449 .3 -07-:::33  89.3.32023./.3. .2.:.78.3. 7424842.-093.9..5.805079 909:.703.3 . .2..3/50..3.73.3..5..207./.0  !./.39. 2033.39.3803/73./:.-::5.3025.3..0249/:3.3820.74845.9..7.

-0-.  #.5:973472.7503..3.8/.90241..947./.5. #.2 .9:'.

97..!./. .2357.78.3./:424.3.209-070380.7. 8.8..381. .97.78.50.8.:5./.54.73.3/.3.2.381.3.350./03./.

209-070380.23. 3/..3802039.39./:09074.39.7.

3.580-.33./.203..3-.3/.78.8-::80.33/..3#.037.3.32030-./.3 8././.2 203.3.9..5.:3472. .-093.02:9.950.2/02:.3.3/:303.8..3-::./:424. 3/..-093.2-.39.0/423.:897:907./ 80-.7424842.3472.3.3.3.209   ..8:.352039.207:5.3  !0.3 80/.-. 7 2030-.03708081-7./-:7 ..-. 5.3..3. /.5.:2:23.3...3 80/. .31034950.-.3/03./.9:03.02:9.3..7.3.  4394037.20302:.../:09074.3.-3472.209  .91 :2.0708081:897:/.2 03.9.3.3././ 5.8:83.7.80/980.980/932:33/80-.3408:93.3... !.9203.2./..8.3 50207.

3.3/.2:33/085708.0./.38.33.33.0/.3.3.5. //:..3/.1034950.3.9//0908 0-07.989.037.-3472.3./.980/9 2..8.-3472.  0.-...703.207:5..-.5.35.3.:2..8...303.1034950 .340037./../:-093.-  037.3/80-.89/.

9.90787.8907907/.39/03.-0-07.39.9.5.3 2030-.39/.2.3./.-.03 5.0.$025:73.9:8..8:95./503.74248429/.7:7.3 .3 9/03.3.3 .78.342448.7/.9/.3.23 /./.3/75.7.3.303.32030-.-..35079:2-:..3:8.9..9:740 03802.97080813/.35.-3472.342443/80-:9:. 742484290780-:9.0.3-07.7424842. /..                ...78./.05.37424842 9073.3-::5.3 03.95. 4244/03.8.38:3 805079./03.802037424842 /.9.703.03.3.9.32025:3.34.78.3/.7  !0.2-.9: 03 035..2..0/:.9.03.32030-..9..7903.3#. 20.034.03..3.239.:802039079039:5./.3../.5.:94842..03 3/80-:9:.5.187.3-::.803./.33472.78.381..5.239...880.  !./.-.23/.0./.39.3.3-0781.7424842 !0././.3.-::503/0.9/9.303./.50.9/.3 2030-..8025:73.037.-.3507.9/.23%.7:400380.  0.3472.3/809.3/.3-::503/0 !0.3 5079:2-:.9.3..3.9.5.7    !!  ----   -093.9037.8025:73.3/7 4394034.-.3-.3. 085:3/.39.3-::503/0-093.

.8.80507950.3:.8.30380.3/50740/.3037.2.33472.303. ..2-..54.3708574:39:037.507.3472. .3..3.23 %0.2.  $8902!03039:.-093./ 50..39.5.8-.0.3.78.3 3/.:94842. 8025:73.8025:73.5.7 -.7  ..805079.3./.7..2025:3. 8025:73. .32.239.3:8..3. ..7 507.95./: 57.3.2.239.3708574:39:03 03. - - - - -093.9. /..239.:94842.3/.39.0.250./.0./80-:9.3472./.38.3.3202-07.78. .2.78.3037.2-.9/.33472.

.09074.7..39.209  802039./.39.3..

./..209  !03039:. 5.235.09074.3/.30380.209  802039.39.209   $0-.23/..424.-093.3:897:424.3:8./:.2.7.3./.3./../: -093.

7424842 .98807.3275/03..983/.23.5.3.3.3..7.4394   84320302:. 88902 3/.80-:.39.8890290780-:9 2. 28.3./.8-.202/:.35.3:3../ .3 203:988902 80/../.35.39.983.3/.5.3.0--.7424842 80/.3/02./:./:.3 :2. 742484280842.8.7424842802039.2025:3..-:.7424842 03../.2 /./../.3..3.39.2../:.7424842  $890238-. 07:9 3.  $8902  $8902 /:25.3-0-07.9.038807.280 842.-0-07./.-0..388902 0/.3-./.39/. 2025:3../:-093./:.3 /.3/.3. 5.33.5.8./:-093.39079039: 203:9 88902  $0./.. 3/.33.7.!7490347-093.3/.3.:2.80842.2.33.88902503039:...5.39.3/0.30380.30/:. 2025:3.8079.3.39.75.3  $0-././.

9 74845.9:710799.:-:3./.   7/020.39./.3.-07.30380.3 $0.7.235..3/03.350309.3203.. ./03..39/..23/03./.8.73..88902503039:.0380./.:94842 /. 47.3.3.235.338-.3807. .5-.320303. -07507..820325:.37424842.37424842 .3.30380.382090780-:9-07.3.:.7424842907.33.388902 .3..3-.9.-.8503039:.2.

/.%../.95./..974845./.9/.:94842  3-.974845.5..235.-0   %.. Ð7424842  Ð.5.30380..-0  !03039:.

39.  0380.23 .3 .

.3 3907808 3907808 .9-.8. 8.23...39:-:3.5:.3 //.9:.-:.3.39.39.502-0.3 -093.3/3. ./: .. 7424842909.09/.5.7903403088 .507.2..5../:.2-.54/ 8079. 74845.-0758.33/.3 209.7424842 3. -093.980-.950789./.808:./:.7.58.9.3.943 .224.3/.2./..3..2.7  .3/897-:87424842 5..3/742471 !030-.-093...23 209. 209./..-.30380. 0/:..5:.3.7/:.3/.340 907..:-..5.2-.3203072.74845.9:502-0.320488  !. 2.50789.80./:/03.390780-:95073.209     -093.-./.39097.3.:3. /54/ 3/80-..-3472.58..3 0./:3472.3907808 /. ./.3 80-..7..-093.3203..22:3..  .-0-07.5.93/.3.8:507-093.3.39../.9./..                             -093././3.34425079. 343/8:3.8.907.58.-093.74248425.202507./.547. 209./.7424842..8.9754//.-093.9:7424842  !.9.5.3907.7   !  .0-/..5./3.5.-./.9:7.9.74248425. .5.3200-:2.974845.9 81.9..3890709.203072.3.3 .2530./80-:9 /03.-3. -093.32948849 .381.-3472.92030-./.58..3/.389.3.8050793.2./.-0-07..5.3.3. 80-.3/.33../.%.3907-039:3.8.25./: .-0-07..9.3.3:2.907...0380.39.3802039....-0 .

.3.980-:.7:3:3.388902503039:.:/03.83203./.39.9: .3-.:-.5907-039:80.. .3 $8902503039:./9039:.3.780-:.:-./-:. $0-.97424842  !...7.7.80842..340 1.9./.39.5..23-093.30380.9:20..8.3 :2.3.:507.98. .39/.:3/03./03.7.742.9.3..0 .7.30380.3203./:./48:8 -07:2..80.7 90:7.5:..5.0342 507././0./09.3.3-.1034950$*%8*  $02039.232.9/-0/.7:8 ./.3 /03.5.8..9.3202.974248423.0-.80 80:.507.77  !.7903403088 .43 3/.3/03.33.9: .3  -:3.9 /.39.9/. -093..89  742..7.3.803../.9: 3/..39.35:.897:9:7 9079039:.5.2./3/.3-0702-.9/.   .3..80842.-0-07.3./.507.328./:. 90:7.5.3.33./.802.8:8.3-.9857..3.39.8.5:903/72::9  /.!.9.235.39/.0-.3203..8.3203.7903403088207:5.374248420.3039079039:  .3..2.805079802:9 0-..-07.930.:33472.3./.3/:5 /3:3.233.3.3. :2.39.07080818/.3/03.85080820345907..39/..7.3:95.3:93..850.05.3././.8.3/././3/.3/02..5.3.3-093.3-:3.3./54/ 03.3  0.9:7502-039:.39:305.239073.30380.7.83 2. -093..:388%8*.3472.03$ .23 085:3/02.-07..  0.31034950$*9898..:3889898 -070380./. 2.380842.5.1:.9/. $97:9:7802.7.. /:25.3-.9.:324348:83 2025:3.3 .23.3-0781. -0702-./.9.9.08  !03./.3430. /03.98/./..20280-:.909.930.3 -093.3.907/.-093..239073.9: 2025:3.0342.23 $047.9857.:5:3:2.3507.3/84. $0.:7..32038907./.93430309 . 2.0309.80-:.-07:-:3..23802039..30380.9.3.3-07.0342 909.9.54/  $02039.5//.97424842  $890203$ %8 .3203.90780-:9:39:02:/.8503. /.3/-:.3 ./.8/80-:9./.703..8./.3-0702-.703.3 -0702-..742.3/03./:. /. 74248420.9.3.547.39.3.3502-039:.8.303%8 .39.5.7.3.9:7502-039:.9.8.9.23.:320302:.35007. /0./.3. 8.80059080.5.8.3 -:3.23:0:8808.33.80-07.930.-093..88902503039:.703.3-:3.3 /.5.3/48:8 ..:93.3-093./..370. 9: 3/.974248423.23-.370574/:8.8/.38.9..3-:3.3.9.3203/0./:-093.3/.3./.23./ .3 !.7424842/:7.39.3982.3.9../:./.-.374248420..77 5./. 28..9202507.2.742.9/.3443../.:9430./..930.3:8.35.9/. 2023.:90:7.88902503039:.. 80/./..-..8.73.3//. :8:83.3  .39/.98.897:9:79079039:.39:3 -.2025:3.../03.90720302:.3 8890290780-:92.3 02:/.39.23909.39.24348:8 -07:2./:25.3.3.80 80842.5./. .9.9473:3.9203.5.30380.9: ./:-093.:3/03./03.

83/7423010907  2025:3.742.3.0.3488-07-.3.703. -0781.503././48801091.80./:803. ...9 /423.3  .-0  8570803907503.9. 503/079.57080815.23.23 $0-.8:./42-. 2025:3.380.23/839088404./.238079.39..7..9/03././  03907503.. $0-././.23 .7:0.33.7424842 3./:.8 803.7..9.1034203.23 8031:03.0309203.8.23 $02039.7:2 908908 /.2.73./42-.3. ./42-.3320..: -.. 57.3507.3 .8/4885.209 /.9:03 0907449  %./03.30380.2-.3472.9 3/.307./.3.38.3.5.3 085708.381..32.3038 0.35:.9/.909.7.9:7.  0.0380.91/.2025:3..3820/09.93 0. 02.7 43 8047.37424842.03 42449 802039.83/742%:7307  9/.7:2/.39.2.2357207  $0.39./:-093.4394  03./.1:38..23 03../703.23 03907503.73.3 .3742.7.5.30.32:33:897:202-..1.308570803802/423./.3203.9:7424842.3..703.5.3203:3:.7:83.9/03.7.3037.7./.3:9.-07:-:3.39.3203.3..472430.29:-:3/.3/:/42-./.:09074742.832025:3.74248425.930.39.3-093.380. 202503.3 5./03.9 -079.3.3./:.930.:94842..7.3.915.2.235.-093.3103495024../.03/423..39./:0249  47243/.8.2.3..3202507.3.:.30-07./42-./.35.8 085708037..930.39.03./.7.39089082./2408047.0.30./.3.7:0.3:39:203039:..23.7.3/.3/.243/038.9503.7424842 3.0/:. .5.9.0907449 202507./:3.83 2..3/.38.7.320303. .0/0308 .3-...742.7:50702-.3507-0/.343./.8/488/:8:...9: 80-.8800.37424842 0..3..7:472430.3820425038./3.-.39../703.3/.39./:-093.238073.23 28.93 0.0309...3:93.7. 5./.3. .2380:3/07  !.3.3820425038.-::5.3.3909.8.-093..3.9:743/81844/.3472.8..3:8.938.2.7378203.374248420..3507.8.3/..:.357.235.380.208570881.9..9..9/.8..503/079.38.993/../.3203.-..80./:.9:  003.393.742.3549088-./:-093..0/:.8503.90..503.3/.7:0.3.3 003./42-.2348039088 !7.2.203./.203/././:.3/08508./.75030.389074/.88902503039:.57080815.3802039.39.-07-./. $0-.3472..2 .: 503. 5.3.3  037.3203.3.9:7502-039:.9/423./:42449.80-:.3  0./.03.8.742.80.23.3/.  .3 . 7424842.8:..3107038.90.7:82025:3.3203.947030982020.9: :39:/.742./.3/.930.3.32025:3.3/. 8890247243.703.7:83./.::5/03..3/:5.20.3.23207:5.380-..2030.9: 802:33202-.3807.9:  0.91 5490883/.8472430.23 .8.234302-74 .8-07-0/./.....9.3-0781.703.9:037..2347.23.2. 03708081  54908843:.

3 -079.8.3.342449  03907-.3..3.3/03.502:.8..3/03.39073.23 80290/ 0308 439403802.909.9 /085708.9:0380.393803.33./:-093..35..7:507-0/.3803/73.. /.30349509079039:80-03..20-49.39./.90780-:9   .9202-.3  80/././.3203./.93..8.20-49.5..57080815.303907-.39.35. .33472..3/: 9/.39.308570803/. 03/423.9:0380./. 03-/423.3203.3574/:88:8:.. 2. $0-.0907449. -079.03/.-079.:94842.8085708035../..35.3/: 42-./.3.549038:39:203./.9203.5507../.39.7:0. -. 57.2025:3.3:8.2:3 3/.39.3 /.39.909.3.9:7574/:88:8:5.57...3/.8. .0380.3/: 9/.3 5.7.03.9.-079./: .9.2:5.20.8.23/3.23 $0.034950    42-.3.57080815.80...80.5.23:.35.3/: -079.3/: 4394../.:.03.3/03.5.23./.8../.2./.0-07.3..5..303907503. &39:/./.....3 09:7:3.9.73.39.0907449.38047./.-093.3/: 9/.9/085708.3202503.  .23.3203.23 472430.57.7:82025:3..8.-079.9/507:.23 03.9:70-49.

.

890780-:98.203.703.50:.-/..42-3.803708081:39:.35:...3.35.3:39:.9-.7 # ' # O O O O :.9.307.-   /03.3 :39:-039:-  909.3-0-.3-039:- 2.:.3907.2.3.209 ./.-  /03.3:8.3. !0209.3/.::203/0 .8 ..8.9.:5:3/-7/ 90.03 /03../.$.35078.37424842 5.803/423.42-3.742039.3. !4890/-.303708081:39:-039:- .3.8 /.73.303.3.3/.3/:.3907-039: 9/./.0307.3/:342-3.42-3.5202:33.0307..3:9 50.35078..4-. 2434-7/2.3!3/.209.3 %. ' # !07./.3::2502.303  0.8079.203....4-.3.3/-7/203.73.-08.3 507.3::2800.803/03..02-.7  ./.8.8 42-3.3:...3907.507..303/423.$.8./3.3!3/.1-40309.34003/0 -..78.37424842 !0209.73.

/.33207:5.3..:.8.25380.3808.9:7424842802039.3-07..3.3203..3..03/./.209.92030...38-.-07.:2.3-08.-/03.3.-07.3/:25.2.805079  7/08   :07 /.7.03503.. 0309. 3.3/.3-07....3  $9:790.3/..5.2.303503.../.3.3 708081 02.209.3..7.3..3. 38-. 30/0308 80/.7./.73./.:39:80.2.7207..3-039:-/0.:2.75./.350309.74248423.209/03.3:2.507.2./.380-.8.4394 .5.303 03-07.3 /.8207:2:8..20.3907/7.9:7.3:93./3.390.83.2..3./.2.8 907.3..303 03-07.742484242443.83 2.8/.33. 03 03-07. 03-07.303 2.3/:342-3.203:9::203/0 793.3820 50.2.9:  .83 03503. /.3.7424842 3.39./423./03. / /..30--./.302-744/.7.303-07.209..74248429079039:/.:302:/.  03 03.78.2.2.8./..5.3::2502./.354.9.:0--.5:3203. /./544-.37424842 .340 0. 8. 54.2.2.33 $0-./.3/50740 .35:.9.5..0:39:3.8:.5./.33..803/423./.3.3820.8 803.3.8:.37042-3..3.320..8/03.209 -.37042-3.3-07.3.5..5.3.5.3./.53/.32025:3..03 03 03.38.3203.9/.-07..5.5. .8070.3 # !:33095.$07./.2./03.90.3.3.03.34./.3/:3 03 03/423.507-0/.3.9 %  47.33.3/./902:..780-:.303.-'3  :.3.8 /.07  /.3./03.74248429025./. .0 .3203.2.3808.72.3.2.380./.-.:03 03 .9:7 .33.20.:-07.9:7.. 2.209.0-09:.0 7080813.2.708081 2.350209.38.3././.3.3-.9:7-039:-90709.3 9/.-/.8/.303 /423.35.3/.320303..3-07.-./..-078.8.-:.20209.75.9/:25.9...3 .28070.209. -07../9/.3 1034203../.92070...3.8.7424842.3 .339075709.3/5074003/0/ 8.39 $0: -0:20303.-90709.7.3..../.3..0  034203.5 85080847.5.:-.3-0-.3.3/:303 03708081.3.3.2.0--.95.3.748834.3 708081..  .720-.3 /.7424842.9/.8907 .3/-7/40 ..75.85078.20309.3203.35.5.7:809.2.3.803/423.8./ ..03/07:3.3 907/./.3.3/..8.3/:3..939.035./54/ $0. /.3 /.9:7 -039:-90709.90843/.74380520303.73.8.8  $.5. :.3:.303.303708081 .3.3. /.303 03-07.9.47./09..52.35.-0702-../..209/03.303503...73.-/.3./.9202-07.303808.-203.:2.2.3.4-.354891/03.3. 0-/.338-.708081  $0-.8 .209.78.3/:3./423.209 .3.3907-039:90780-:9/80-.808. .3.-0-.0025.803/7/3.39.5 2070.7.:.-07. 9072.3.:3  .92..5079.3.3-07.3909...0307.280-:. 793.0-/.9.3..809.3203.2./33 .974845./.. 2../.342-3.7. 03/09/.9: . -.3203..  /.38047.3/.209.88.:09. 2.3.307..7424842 80/.. ..

/:/-7/ .9..5.:9.2-.209 .80  0/:/:.8//./.9-07.- 3 3   . 03/423..4:535. 2.39.2-./:.209.- . 3 3   - . ./.209   ..3/../03. .303708081.3037080818050795.3/.38./03.:-078.7  .8.7. .2-.303-07.73/. $02039..7  .3  .397..3 -07. -.&39:0-0.-.3.7.03-07. /.03/423. ..8/.388 .397.37042-3.3:. !.9. 202507. 02:33.25./:/-7/.- - .7:8907..9: 5.3...3907-039:  - .-0-./80.7  .354.03/07:3:39:80./.8 :.3  3/.7 /-..3.7./03.8/..03.3.303/423.3-07-0/.9/507-.3-078.3-07.8/.30/:/:.3.  -  -      .23/3.-07.-:.3.3.03-07.349. ...20/:/:.3.-.802.2-.303 708081- 0/:/:.5.:705:8435..80  $0-.3:9./.-078070.9/.39.3907-039:/.380.0/:./.5.209./. 0/:.83./03.5.37042-3.. 0/:.039/.38 0/:/:./:/-7/./:.03.3/3.2-.-07.907.0723. 9.2.803 035.2..9.9.9..0/:. 8.-0-.-.3.38070.8 ./.703.25.:9/.3..803 03.3./03.3907.-07..388.3.9.8070..3.3./:../..3..8070.30/:/:.2-.33../.35./.:431:7./3.3.:.507..7  .2.3-07.2-.28.3-07.  ./80.2..80/:.039/.7   .83/.7.7  . 0/:/:. /9:880-..0307.802.2.303-07.3.37042-3.  . .2.

3/9:880-.0390780-:9-07.-.. /03.0/:.30/:/:.388 /.-..3.

/./:3.83 2.0/:/:.8 .38./.3.:5:397./03..-07...7039.5./.388  .2099507042-3.  .5.7039./.88:8:3..38  .3-07./03.30/:/:.5.3882.-.0390780-:99/.0/:.38907/.83 /80-:980-.2.207:5.2.-.3./: .32.8-/.3/.3.3.3203.88:8:3./.3033..3. 2025:3./: 80/.0/:.3.8:8:3.209950 7042-3.-../.2099505..209950 7042-3..2099505.2.8.3035..3..97.3.3./  3/..3035.3.2099505..-8079.3/.0/:/:./ 503:8.303.3.7039.3.0390780-:9-07.9/:..209 ./:/-7/.38:8:3.37042-3.

3.0/:./: $0.209...33.3/.3./03.-.2099505.9:5079:.9-07/0. .3.2099505.2099507042-3.39../: /-7//03.03-07../.2.9.39.8.2099507042-3./.53/.8-078.7.39 /:3.3.: 8.3.:5078039.2099507042-3.:0-:7.38.30-2:/././03.3.03.3.  !3/./03.7.3 %0.2.3907/.38:8:3.-  .74248429.2099505.3:39:203.9.38 2.3.3 -078.3.37042-3./3.7 5078039. .39.2.9035. 8.9.18./.8:2.88:8:3..03/07:3:39:909.8.39.3.3.7.3.209950 5.3-. 8008.3..3307.9203.7.5.703.:2./03. ....99..80 ..:39:2025079.3.-07. 02:33.32.3.3-07. /909.80-.3.3.9....-:.203.3-..3 .3.7.8 2.83 2.7.5.3 $0-.//.8 ::203/0  207:5...880-.0/:./.7.207:5.209/03..2099507042-3.....3.3.80.38:8:3.3.5..3-07.2099507042-3.9.03 03.-:.7./: 80/.8.209.3.7039.303 03.30/:/:.8.2099505.3035..2099507042-3.5.9.  .3/.7..3907-039: ../03. $0.33..0/:. .39.30./.39/.03-07.7424842 .3.3 .3/.3..-07.39.2./.7.3203.3-07.7039.9.38.2099507042-3.3..7039. .:/03.209 9505.390780-:99.5.840  $9:790.3.3.3.  2..3/.7.7./. .209 2..3  08.3 .3.2099507042-3.30.7.  .790/:.880-.8.7503079.:-:3.90780-:9 /.803 03805079.03-07.3507.4394 .. 9/.3.9070309 03 / ..5.8070..3-. .7.: 47.39.8:.9.8./.9./.303...3/50740 42-3.03-07./.4 9025..2099507042-3.8.2. 802:.9.8.209..95:..3-...250789.:809/. 9/.3.8.3203/.8.5.7..8.3.9.748834.39.8.  .9./.380-.3.8.7  28.3/:25.853/.03-07..38./.2070.320.3033.7.209950 5..3:2.03/.3.7/.3..039/.03-07.3.3509.7039.83 . /:.35078039.3./.8.9.9 5.3.83...3/03.3  !0789.39039.7424842 74248424244  .8-.7.9075.:3./.353/.5.209-:..2.32025:3.2099507042-3..3 .80.9.3.7039...37042-3.3.0-/./.3.-078.7 3.2099507042-3.: 38-.7502-039:.7..9:3/.7:/.9:.3.7.5.3.35078039.2../:.3.3 80/./:./:80-0:23.  88.2.9..30309 .209950 7042-3.9./.7039.2.2.3.209.39.7039.8/.2..802039. .3509..7.58.3/.703.3...07 .7  3.3-08.0/:.9.8..3 .8 .80./:...2099507042-3..:2. /:.8907/..8 %07.2099505.3.2.890.209 9505. 8.3  $0-03.3:93.03-07.0/:.3507.9.73..397.7./:.92030/07.382050393.37042-3.80.3502.8 /.3.38.28070.3.8803.3.. $09.353/./. ..3.35033. $0-..9:.03-07.8.8.3-007.2./:./03.2.8/:.9/.907:8 20307:8/:9405033.:0--08. .3.8 $0507990.2-.:2.9203..209950 7042-3.3.$.70.907/.3 .3909.3.-/. 80.5.2099507042-3.0390780-:9-07.5-078.35.3.7.3203.39.3..8 2. /0.9.207:5.2./80-:9.9.7.3-.  80/. 2.3 035.853/.3-0-.5 /./:.3/3.5.3.:..342-3..2099507042-3.0-.203.5.8.5.7.7/.3.3..8 03.7039././.7039.38:8:3.3:39:203.83.

9/.9:.907/.5918.703.8803095.9742./.9/./.-070..4.. 2:.38:33.034950 034950/03.3/.89097.88.2-./:5...2/:5.7.7.9//0908..3.9.3203.431:7..30:748547..3907.3.5.588 .-' $0...2.3202-039:83.703.8.  0.3502.8 /50740/.8.9/3./  :9-../5./..53/..3.5.8.3.3/3.3.880309907:9. .8:8   - ---  .9079:9:54003/423.3:./..329488 803../.5.2-.950393-.8.3203::.338.8.8.-:9./.3.3 .8203.80204880/:.21.3. ./808:/.2/:5../.87424842 /.9./:5.3907.54/ 03.95.74248424244203.7.9/ ./../.803.53/.507.-3..742.53/. 0857083.8 ..3.3  !4.3.802.3  $0.-7042  ..4-.3-0-.5741.280:2../3. -.8.3.3907./280:22:980.80 70574/:8.3203.    .3:93.39:2-:203.88.8.9.39097.703./025./ !.54/.2502-0..5.3907.303 03708081/.87424842 !. -07.5748080.74248424244.3203:3.7 /-...5-.3-../5.808:.54/3.2.3... 0025..3.4:39:0507:.9907-039:3. 0-07.8.848457.4:8  !3/.9 -:.                 04880488  9488 ..3..342-3.53/.3203.5.

8.3-.7424842203.7 3..3./.3.../.3.848547..7039././:.!4.329488..8...- .7039.7.84547.8.848547. /.80.8  !078039.8.7424842203.:8.8 %.207:5. 0025.8 -078.5.75.9..3203.7039.8/.7.2099507042-3.7.  0.2-.9..-./...3. .3/.2099507042-3.2:33907.703..9:.8502-0..75030.20309.30.7./ 8090.2.2/:5.5078039.9/.209950 7042-3.7..   $0-.0/:.53/..853/. 80.9/825:..-.02:33.5.7039..:-.3907.-.7  .2 /:5.7039.5.3907-039:907/7. 2.53/.9/.9/5.2099505.2-./.7039.39.7.             04880488  9488 - .2099505.9: .39/..8./.2. 5.8 %073..3/.3-07.3907.8/:.5079..7  .5.5... .7  ../.3-07.8053/.3.70/0.3.8.754.3.8.8:..3.703.2 .9/.380:7:3.03-07. 0:748547.8./.3-.2-..32.209/.3907.848547.25.8.0/0.7 5.209..  /03.8.7  .848457././. .9..2.2/:5.- 5.8:85..8 .380-0:23.9/-0/.9.-.8:8  5./. !.7039.2-.848547./..39...8808:.  --7042-3.88./808:/.9.7/. /. 53/. .9505.89.7.2./80-0:27424842203.2-.3.848547.3 5.8 .

353/.39: .2099507042-3.73/3.88.3   202507.3/.3   /.7./.7. 9: 5078039../.!0789.2.748834.-./.380.18.03-07.8 .7.:805079 /80-:9.854891/03.8../.853/.3 8079.253/.-.7.0/:/:./:.8.2 .3.209. 53/. . 53/.2099507042-3.7.80. 02:33.3 !079.3.53/.8..3/.3 /.07  $08:.8.3.9.3 .89079039: 0-:7.3.3.8207:5. /:.39.-.:53/.3907..3.3 02:33.3907.7. 03.8.3.9:.../.3/./. 53/.3.3 /02.8.8 .35.9..9.35.8.8.-.03-07..9.8. $0.2099507042-3.353/.35. .3.39.-.7. ./.8.32030-.8./..8.8.  09.3.:8.8 53/.3.3907.3907.25. /4:-0.9.39.3470.  .853/./.3. 3907..3.8.3.9./03..3.2099507042-3.5078039.3 907..2-.39.2099507042-3.3907.28.309..8...3907.8053/.   .2099507042-3.2.8.9:/.853/.9907.- ./03.0307.5.-.3.2./.3907-039:3..8.3:7:9.18.8.3./. 8./. .3-.3 5./.3.3.3 $02039.7  2.39./.3.73..    . 0/:.-/.90780-:9 8050795.3.3.7039. .3907.39. 28..7.3907..3:./.3./ .853/.:9./9.3/. .3-.03 03/03.7.9.3.8.2099507042-3.8.:53/./.7.:.7.03-07.03-07.-:.2..853/.853/.8.       ..  %..203.3907.3 -08./.2-.8.39.2099505. /.3.8.3/.3-.3.2099507042-3..9.

209.9039:8.3/...8.2..53/.3..-.03-07.38:.  .-08.2-. 2.209.21034950 .7..30.3.-. .3.8.7488 $0-.8.3././0.3&%.2093/./. .9.8 5078..7039.803.3:907.3.3-07./03.--.3/:25.333.8. .3. .7.:2.3.209950 7042-3.3: 80507990.853/.32.../.3 09:5:.4394 3/.338-.32./.09.803.7. /03..80-.2.3:9. 80/./. .3.75..--.  -- ..853/.3.853/. ..803../. 8..   $./.5.38.30--08.5078039.3..75078039..52.2099507042-3..5.73..0390780-:99/./:42449708081 $. 0-5.8....3.3.853/.9:3/./.3 3/../.39:305.%9 $.390780-:9 .39.- ./0.2.8 90780-:9.38..2....30--.75.209.8.3-08.7.04254.8.8.853/..-07..39:305.9./.75.-../.3/.3803/73.  2../03...35....7. ./8.1034950.  .35.   --.3 ..33.3 .-- /.3/.2.5078.8.303 2. .03-07./.3..2-.7  !3/.3.3..3/.209.303/.2:3 . .7.  ./:97-7//3.8.853/.38-.7  .2099505./.39./. 0-5. -   ./..3.0/:.3..7.209. 99 9700 54399089.39.5030.909.75078039.3 9/..3.3.3./:/03./03.0--.3/./.75.73/.853/.8. 5./. /.3/.3/..5-07.7/0.3./:.209.209 .209. .9:     ./:97-7/ 90780-:9 $050795../:97-7/.209/.8.3:/03.

2.7039.3/. .. -/.904254 042545079.3./. 8./.07. .3//. 203.07.--.- /.20953/./.3042540025.3..3./.-.-. -.3.9/-.209./025.  042540/:.5.853/. /..7..3..9: /.8.3//. $02039. 0425409.8. .853/.73/...-./:42449708081.209.2099505..9.

904254 ..38. 03.209 ...2093/.3.38.3.2.83907/7..-.3/./.32025:3.9.3.88.025./03.:5:3 7042-3.2099505.83 2.303.-..2.8. 2..8..7039.-.  .3:3..2.8:8:3. ..3/02.9:2.:8 034950.32.21034950 808:...703.8/:.338-../:.3 103495080.

 ..-.

7039.-. 5078039.907-08.-.803.7  . 9505..

 ..-.

-.

8./.39.-.853/.803..3.-07.39:305.54884:8  .8.. 9507042-3.7.3 5078039./.

 .-..

7.8.853/. 9507042-3./.-07.54884:8  ..39:305.3 5078039.3.-.39.-./.803.8.

 -.-..

803.-.3/..8.3.8. 9507042-3.853/. 5078039..  .9070.

 $.9:742484242445.8.9.-..51034950./..

9:..8.9: -.703.2.38:8:3.9.03 03/03.-.:202-. . 349.3:90780-:9/.  0.8 80.3.38.88.81034950.3.034950.

/:./03.83 2./ 3/.8 :39:.8./:.2.83 .88.3349.2.3.3::39:03 03-07.2093.0349503/.

.2.3/.3.38.573853.88.3/.7 .3509.9.9:/.3:7:9.7424842/.3-.9079039: 03./.9././5./.9.7/.- .3./.39.3.-./ ..0/0.20.::2.502-:....:39:09::034950.33.9509..88.3:7:9.03..0 74:5 .3..37424842 .-.9/...7.7039.73/.5.35078039.303495090780-:9 .31.9:/:. .3:9.9/0.3:7:9..3.303 03/03..9.8.75079..39.74248429.2 509.3..7.33.9509.57424842/80-:980-.3:39:202-:.5.890790.9:7424842/.90425403-07../. &39:203039:./..  !0209. 28.880/0709.3.3.3.:39:202-:. 805079/. 9..7   .303.9.3.3  09::. 8.2093.025..95.8.3 /02.3 5..34.4394  5. .3...80.3035.9.9/2.7.3.2.8.7.9.7424842 /.::5805079349.2-. $0-./:9505..3203.9:0425403-07. 0/:.503:8./:.3907/7.3 /03.5. 907-08. 3.3.974845.::5/9:8/03.5.3-03.3..4394-07:93  --./.3:/.99/.35039:3.8 .7424842205:9503039:./902:.33.8.

-. 02:/.3 9...7 .

3:.3.9.9070./:.3 ..3.3/.853/./-./:.3/.3203. -/.3/. .3.5.8.3:2.8.9:/:.

 3/...3.8:39:203../:5..8./82:. . 58 793.253/.7039.3/.

 /82:..8:39:203./.258203.-.-.

 .2.4..4.9.3.3033.9/./:58.9073.8:8:3.33/..8.882:. $090./.-.3 /03.83/.

3-..8.2.9/. /03.

9: 3/.3033.  0.7039..703. 28.. 203..:-.3.:7:9./../:5.7:89.

/:3203... .-.3/.258 2.3/50740...

8-0:2.4:.3 9073.3-./03.9.-. .4..2.

7 .3035.3/.7039../:5. 907.:7:9. 9073../.9109.203./.. 203:-./..

- 3/../..7039...203./03.3038050793 4:8/903.258../:5.3203.3 :7:9. .

3-.4...3 9073..9.4/03.

:7.49008  .-4/ 0 0.3-4/ 9:  . .008   9 9.:938 85/ 85./038 ..8907  .85-077008 1 1:.3:8008  :738 ' 7- 7:-008  -4 -47/0.9 .7008 # #4:030/008 -9 -03938   49.477 .7488.7.38 8. 0../.943 3 033.008  7.5. .-/423.38  ...9/825:..:7:9. 4.:-9:839077:59:8008   790008 $ $9.03-78908  83 830/-78908 8 830.3 /..:008 0/ 0..34/008 18   -093.3-03. 03.90/38 - -.  .709008  5 50.9:2478 80 805.4/38  2 23.9.78 . 8.7309008 89 8.:7 .3/02.3403 ..:2:..:     04-4/  309 30938  7: 74:4/008   ..3-. ..008 .8 7..03-78908  0.220/38  :0/008   .038  .90/38 78 7480008   .. .0308838 /5 /:2538  4.9:7038 .477:.

. .73.80-7908  . 7.:738  7 7:/2039./.738 89 897..7.450/38 7/ 70/:.33.38 . .8/ 8..38  & &59:720/38 0 0-43-4/   . 3:90-4/     3:90-4/      .7008 - -947.-78908   :25-4/ 78/ 7..: .80 4-9 4-9:8038  71 744138  3 3.-4/  .-78908   .974845./ .20.709008  7/ 70.0/-78908 .-.0/-4/    .34.7 .74248425.7008 .7  !09.80/38  7.8907 80397427 742484274248420. ..008  2 2.0 .:7.. .38  09..0/38 .943008 ..23 .089.77438   /87 /87:590/38 !7 !7.3 .2-.07:-38 87 89750-4/   -- -4--0/-78908 .7/3.

9..3.:9./ .3:93.3:90780-:9/.5078039.3:7:1-08.72:9.7.3 2.2.18. 8.3... ./:5.8053/.:7:9.7.703..7/09.. 3.2.7.803.8.3/::7 .7./03.3.39./ -.353/.0/:.7.3 $090.8.3  /.3  ././03.03-07:7:9./:..88.8.7.39.353/.5.838./03. 03-07.2.3.8.3/.92039:3.7.3.3.7.3 033.3/.3 80/.3/423.3-03..:7:9./.203.39...3.03.: /.3.  8.7039.3/.39./:.9-08.3203.3  0./.7. 9.7.35078039.39.303.73.8053/.2-.83 2.- $0..7.9.8/:-.- ./03.-.

.3- 03..3.853/.2./.7.3/.3 907/7.      .9. .7.8. /...3/02..3 .8./:..39.

/.3.9: 3/.83.7..83 2..3. .     $02039.39.      . /.7..853/./:.8..32.7.803.

   .3/.8907..3/.          39071070387424842 !. .853/.3.90780-:9/./.9.3.9-./:../.8.-.3.439484.

.5078039.35079.380-0:23./.- !./902:.3207:5.0/:.9.3 $0.3203.2:3 80507990.8353/.9./0.3.3.2.83.7.7:83.8.3 2.91/::7/03./:...38:.:80./3.9.9.8.9047-08.3.83 2./.    .8.8.3      .9904750:.75./:. 8.2.3.50789.399..53/.82.3/.3/3.8.3 -07:7:9.9:3.9:8.2..340   :075./.8053/.7/.:...:3907107038.  ./390710703880.5.././.53/.2.3.3.7:83.-078.3//0.3907.3/80-:9401803 438/038  ./ 39071070383203:3:.58 034203.2. .5.3/.9./.7 -03.80.3/..338-.84..58 0-0.7907. 80./-078..07.3/8:.35.7 -03.339071070387424842..3/.3/..93.35078039.3./03.439484. 2.73.9:9025.7.907. /..8./.53/.58 907..8./ 58 8.8..90780-:9/.8.2.73/0503/038.9.33-03./.3 -03.3. .:3 /..8.2.8.  07.53/.3/.8053/.8 5078039.8.7  3.35.558 ./03.8.3-.. 53/./.3207:5.3 907..3.3 ./.8053/./.7./ 58 .

53/./:.7./.3.38025:73.-08.3-03.3907107038  .-07-.2..7..73.2-.3./03.3  0.3-07:7:9.703.50789.3/3907-.53/./.7 -03.  203:3:.39.9: 3.50789./:. 3.8.78./03.3-08.3 .3-.   .8.3/0503/038.3-07:7:9.58 8.3803.358 $0-.73.3.3.3 203. 203.

3/03.8 74248422.-07.9.9/.38.8032 90780-:9 03. 7424842.32.80 .954.380842.9: 8.78.:2.9.7.3  03.3.3203.8.3 /.7/.2-.%./:3./3...7.74248425.8:97.:.3  $0-.38.98  $0.9 703/.9 20309.3.5./.909.3/07.3:8.9.80-7/ /.9.88.8.-:3./.5./.2..3203.9/825:.3 3.2240:7424842  %03-7/8.3..-7/8.3/0391.53/./503:7. .8090709. 170:0381:8/.9./. 9./:25.3.:2.30-07.7.80/.8..38.39/.9.3.3:8..3803/73.-078.3.91.8032..:.80 80-7/.7424842 203:3./:3.7:8 .3:39:84.7424842203.4394 0-07./..374248425.3:8.7:8$03/.3 9037042-3.7.5.39/.3203.380842.5.7..742484234247 .33-0702-.-07470.74248422.390.409 $0.7.83 2..98203..9/902:..985079.5409034  $0-7/.9/03.8.3203.9:7424842907/.8:.350302:.9:3.5.3-.2...2.8.32..3/.53/.38:.3 80:2.: /. .3/03.3:39:203039:./:3./.3 .7./.33.-08.9:783908803292/33.-0  ./.3.0:.9:783908892/3 3.3202:33.2.8:.8:.3039079039: 5.3503.3 /.8:.5.2-./.9:74248429079039: .35:..37.3502-:..802039..2502-:.3/02.3508.340.9:.3.3:8.35.329488803./.9.9.3.7..3. 2.880842. 2.829488380.33.34018033907107038  .5...880842..3907107038 793.9/. .95:.3.2.2502-0.:3 ./03.. !.39.3502-07.2.7.5.80.3509.32..8.9. 3742484280.7..7  0/:.3907.5-07-.3-08.5. .3-08.3:8./.38:3/03.8:2.30.5.8888.9/9039:.9:/.7  3.80-7/./..9..880842.909.903 039079039:  %.38020374248422..7424842207:5.:907.9..5..5.892/33.  &39:203.2./03.3.80/.73.3/02.33.3202507. .3...3 -./.2.:. .9:8.340 .974 !03.3/03.9.9.3-08.  !0209./0391./...9.854891/03.3 1:8 803-07.38.3-08..809. 39071070383.39.:8:8:3.-:3./.3509.80-.3 /03.9.74248422.9:903.8/.3./.78/./.703./.80 .580-7/.9 /93.9.9: /507:.9/:3.5 03.3:8.9038944.982./..5././3907107038/.80-07./.9/.9:809.9-.5.9.3/.2:3 170:0381:890780-:9/.5.7/.3 /03.303..5.780-7/ .:3 :39:203.:.93.8 92/33./.3.202507.87424842/.3:8.90-07...9.3:8.9.2.3:39:/./03.9.-0  %07.80:9./93.33/0503/03803.8/..3/./02.3 :2.3907-039:02:/.3/03.98 4247 9.393.8303//.-7/8.7:8$03/.30-07.9:7424842.9  !.8050795.9/09.380038..:/:25.3.32.3/0.7.8./03.3203.739071070383.7 0/:.33.03..78.3035.3/3:7:8/03.3:  0.3-.9.8.3.50.9:81.

80 -7/                92/3 3.91 ./.91 9/. 9/...91 .80 .91 ./.91 .                                                                            .

.

1-40309.742039. !4890/-..7   #$         .8.

33.83 2.4394 81.38..38.4-.390758. 80:2.37424842 .74845.3-07.9.3907-039: $0.5...3.9..8.8070.:.209.35078..88.3 8.2.3./09.3 07. 20.9.202-07.303.8.3.3070/907..5.:302:/.8..835.9:.8 5..2.209.9:.30342 $97:9:77424842 :2.9: 8.3 8.27424842 2..303907803/7  .9: 0425450309 %  47.3-.  0-07.8.3 $0-.38:35. ::203/0 502.8507.2::203/0 8070.209 .8-07:93.9:.9:.3:0:8.3.8..803.9:.39:305.9: 0307.3/58.3-.:39:20250./:-0781.35:.3-039:-3.:-.7:.9//.8..3503. 9.3..3/3..8.3.303.3/.382097.-07.-.8./503.5.3-.3 502.9-:.9:-0:2/.3 09.39./.30390780-:9207:5.3907.8907203.703.03907/..8/.8.9:7405.8070.7424842         #$ 3.85.5507.5.9.      #$ O O O !03079.9:9/.:.03907/..3 5..9.800307.3070/907.3:93.8.2.3.842.34003/090.2897:9:7 397.2.81.55....3.9939.9:7405..9907.2./...:507..209-093.30/.3.9:8.3.5.3828 03507:/..3 .3. 20302:.7424.3 8.303/.3/879 90758.9:7502:3..2./80-:9.3 //.:1034950 3/.382803/..340.:7424842 :8:83.3.3-.9:7405./.303. .3.03207:5.343805-.3203.3.8.3/ 80/. 8.20.9/:3./.2.3./.303 /. 20.:.3  085:3/02.2..8 ..3 02.:.8.3.9/879 90758./ 2.3 $.8 .73.34.8..3/03.3..3/.78. .9//.33.9:.27424842  0.9:8..:89:/5./.  7042-3.80.381.3.320..720.38.3 09::.-:3.3-0-.2./.382097.

03./:47...0342/.749/.080:7:.5803/.380 .3/24047.././.7.9. :-:3.-' !.9 74248423-07-039:3.-3.382090780-:95.3 9/.3.3.907/7..2809.:.749805079-. .880-:..039078:8:3/805.:-.3 87:07  /.303//.9:.3..33..7424842.809..9.5.2.880.28:./02.7.0342 03.2025:3.3507.37424842 7.3.7.3802:.8 0/:/:.:25:.8//.9//.3..80-:.3:25:.3...27424842  !03079...9..7.303 03.5803.74248429:3.3820 574.9:3:0:880.3820574.30342 $0.3820.907/09.3..9: 034247.3/-.-07./..3820 /80-:980-.7  0342.502-0.3 802:.3.2-.3907/.39.38:33.-         .390780-:9  0.9:47.9.3 03428:.703. .

23 .209  5.0390780-:9 4394 /0709.95.3.8./..0342/54/  :2.7424842 :2. -039:307 !488//.0:.574.54/ .:2025:3. 3..30342574.9.203428:..8.28:../.9:03/80-:980-.33.9.54/ .25.03//.890.2025:3.9.7424842  %.3..7424842/.7424842.39: 74248420:./83:3-.7  .9.9.2-.  .0342 .9.749 -.380-.8.80-:.3039079039: $0.33  /../03. .5.749 07-0/.9408:.74248425..32025:3.3 /9025.3850808.3203..7499078:8:3/./.79.9.9:.9.7//.20342.439480.2-.34.742484239/./:./03.4:8 ..2:3 :2.3.:5:35.7424842574.7.9: 80 80..80/0709. 80842.54/5.39..3::7.9 20..5.3509.33.3 .:425089.:2.3.80507.32025:3.5.97424842.3/03.8-0-07.-:.749 03420:.7-0-07.749 ..38200:.8..8907  0342:.:/.3./.4 -.749/.34:880:2.5.9:74248420:.749 .27424842 -.-:..8-448:.9: 850808/..98 ..-:.9:47.38508082025:3.-' $0 800.0342 $02039././.207:5.: -07.2. -0/.7492.3820 0-.03420:.9:47./...-07-0/.3:8.7//./.9/.:2:23.33.7492025:3.-' .2.7. 7424842/.57424842202-.749907/7.257 80.

3-0-07.-/9800.9.809.:039:2 '.57424842.742.3974/908 4248.54/-0-07.08.4308.703420/:.8 %79.703425079.::8 08/42089.:.3-075.37424842.-0  :2. 7424842 ..850808 47.:2 .3820 :2.1.38200:.9..8703...3.38 9:80/:8 0..0.0347.-07..74980/07.3.380907:83.3/03.47.8..3742484234247 5:.0790-7.54/3.-/45889.8025.:8 !.74248425.:8/42089.3.5.3 /09./. 742484234247/.5.2.3 0.3.-..3-075.0790-7.8..:2025:3..5.0 0:748547. 74845./.8907 345008.2/4243.3.2.3808:.:.8. .7 8. 800387:8.749 $5080847.90 84:.9:8 7.5038  !.3.3.7.: 5.54/3.34.-0  :39.-:. $.0342.45078.1./.8 .:2.3-075./.08 8907.33/3.0342.    %..7424842 80/.3.88.30 3  7424842 7424842.7424842//.0.20342.2025:3.:8 :82:8. 02.3.3.-:. $06:4.  793.20.089.2. %. .8.54/ 3                             :.3.8./.7038 7.9:87424842//...8147-08 ..7/9 %:2-:.8508085.070.35.20342..374248424244  .:8 0345:8. 0.3820/54/0/:.

07.2. $0397427./.80397 /.7.9:/.5./.35:..303.5.3.5./209./.03/07:32025079.93.7424842 $0-.5.35.7  $97:9:774248425..8897:9:77424842203.34.:-07-039:307 9073.3.5.../...-.5 89.33.5.303.8.2-.80397203.3 :2.3.303.9..3 203:7:90/:/:.5..90780-:98.3503/05 039:..9.4394 ..803970/:/:.-03.8:-209.3.8897:9:774248420:.8-0/.803978039742790709.3 03495042449708081  .3. 2.3.37424842 %070-50393.3853/0/.03.-' . 202-07.9:7424842/.25./ 80-03.5.7424842.3.4:87424842 8073.3/03.7480397 /:25.37424842805079:7:1 /.2-./.3/507400349500907449 02.390709. /03.03./.4394 03 /423.25.80397 8:-209.3 5.3 -03.503.. 03././.7424842 42443..7424842. 0.4:89079039:/ /.33. 202-07.3 .35.7424842 74248424244 9.74803979./903.8039742790709.3. 89.380 . .2.303.9: -039: 209.3.2-.89072025:3.780397480.9:209.8.35.20. 5.3.37424842.5.03.5../.0/:.. !.3 207:5.33.7480397 880397427 !.3808:. 209.03.9:907/.5.3035.8.502-0.  .703. 7.2025079.3/03.. .9200./.2.  .7424842 42443.3189039.8:.2 897:9:774248420:. .8./.3 /03.37.3:2. 2.80397./..209.5.3 0.30.37424842802..903.28:./.09.9/.3.80397./.38.803.8.3:7:16 80/.39.309..3.8.809.3 /:.5.9/.9/04254.3/:.3.3909.390.5.-:.9.38:33.3./..8.9-07:3.742484242443.374248429.5.9.5.:39: 202-07../...903.37424842805079:7:1'  0.202-07. 903.3...7480397 $97:9:7 74248423/.303.9. .8:..1...3.37424842805079:7:1 039:8:-209.  .3-.5.80  8   88 .3803974273./.73.907/.257/::37424842803.3.749 .3.903/.974845..39025.1..2.9-075.7.303.3803974273.803973203...8.25.907-039:03495042449/423. -039:8:-209. $0-.380-07.9/03.81.3803974270-:7./..7424842 803.30/:.37424842. /.3.9:7424842/. 502-0.7424842424403.3/03./.3.03.3 :39:4:890780-:9 ./.81./:.9-075.-075.749 .39/.80397 8:-209.3::37424842803.3-07.-07.80 ..8.3.3//.70/:/:.749 74248420:./5.80397 /.

/.9 .303.3..3 209.303 03.33.3 10349503..7424842.2503.0425474845./.825.3:8.3 2.380. 2471448.:39.80397427 09.8.9070309  90427 ::37424842   80397427 43897857207   309447  742.2..81.9. :94842.3 /-.9.742.3/0.3/.0380. 20.35.509. ..35.-07. 5.2025:3.3-039:3.39/.3/ .9: 02.380  ./.7 88907.9:574903897:9:7./.:94842209.3897:9:73.07.3:8.8.80397427-07-0/./:7..7480397./.83803.742..3 :.35.380/.-  803.7.9/ 7424842./03. 825.9 /.:94842..3-08.3.7480397 .5$//./.33.2.5... 025..-' 907/7.8.80397.3.-.9275 .502-0..2.74845.9:8.380 ./.:94842 209.39/.742.83 2.8/:..25.3.9/:.7802039.3507-0/.3/3.30..2./240825.3.380/.8./..37424842. /.9/02-.240: !.80397.2.5..8.8303..3574903 %.3.-.9:8:.8897:9:7742484280507990.-07:5..//.3-07507.3 /:-:3.5.83 2.2.309.803975.240:.9.3/.-:.9.3:8.8907 808:.380  742.-' .4244/03.74803975..2.8 !.9/:.85080874845.3 .74248420/:.825.38:33. .23 ../.80-:.8.5.2.37424842209.35.9/02-.5.././.3909.7 88907.380-././.3203085708.2025:3.9/907/...742.8.2/.3.2.303.2025:3. $0-.-.3742484280...34.3 .2 50707.3203.3 -.33..5..0/:.9/8    .503../.2/0487-43:0..3/.9309447 ../.8.9.-.3 /.7.9/:3./../.20/:.3503:8:37424842.74803975.5 742.5.3:8.380907/.2. -0/.805.9:. 8.:94842..7:39:.39079039:240:207:5.:780 .80397427907/.3 -.803975.9/202-./.:94842.9/8 .3.5.. 2.32..3.38.980-..5 5.

. 7424842 .2503.3/.7. .3203.3:2:2897:9:774248420:.. .240:    .749 ..2-.2-.7  .380/.3 .

.

742039.1-40309.8.7 397$0-0:23. !4890/-.. $ !$$  #$$&%#%%  ! &%  #&$&#% %% &%& $&&!%& !&# .

Sign up to vote on this title
UsefulNot useful