BAB XV GENETIKA POPULASI • Populasi Mendelian • Frekuensi Genotipe dan Frekuensi Alel • Polimorfisme Lokus sebagai Indeks Keanekaragaman

Genetik • Hukum Keseimbangan Hardy-Weinberg • Perubahan Frekuensi Alel BAB XV. GENETIKA POPULASI Pola pewarisan suatu sifat tidak selalu dapat dipelajari melalui percobaan persilangan buatan. Pada tanaman keras atau hewan-hewan dengan daur hidup panjang seperti gajah, misalnya, suatu persilangan baru akan memberikan hasil yang dapat dianalisis setelah kurun waktu yang sangat lama. Demikian pula, untuk mempelajari pola pewarisan sifat tertentu pada manusia jelas tidak mungkin dilakukan percobaan persilangan. Pola pewarisan sifat pada organisme-organisme semacam itu harus dianalisis menggunakan data hasil pengamatan langsung pada populasi yang ada. Seluk-beluk pewarisan sifat pada tingkat populasi dipelajari pada cabang genetika yang disebut genetika populasi. Ruang lingkup genetika populasi secara garis besar oleh beberapa penulis dikatakan terdiri atas dua bagian, yaitu (1) deduksi prinsip-prinsip Mendel pada tingkat populasi, dan (2) mekanisme pewarisan sifat kuantitatif. Bagian yang kedua ini berkaitan dengan penjelasan pada Bab XIV bahwa analisis genetik sifat-sifat kuantitatif hanya dapat dilakukan pada tingkat populasi karena individu tidak informatif. Namun, beberapa penulis lainnya, seperti halnya Bab XV ini, menyebutkan bahwa materi yang dibahas dalam genetika populasi hanya meliputi deduksi prinsip-prinsip Mendel pada tingkat populasi. Populasi dalam arti Genetika Untuk mempelajari pola pewarisan sifat pada tingkat populasi terlebih dahulu perlu difahami pengertian populasi dalam arti genetika atau lazim disebut juga populasi Mendelian. Populasi mendelian ialah sekelompok individu suatu spesies yang bereproduksi secara seksual, hidup di tempat tertentu pada saat yang sama, dan di antara mereka terjadi perkawinan (interbreeding) sehingga masing-masing akan memberikan kontribusi genetik ke dalam lungkang gen (gene pool), yaitu sekumpulan informasi genetik yang dibawa oleh semua individu di dalam populasi. Deskripsi susunan genetik suatu populasi mendelian dapat diperoleh apabila kita mengetahui macam genotipe yang ada dan juga banyaknya masing-masing genotipe tersebut. Sebagai contoh, di dalam populasi tertentu terdapat tiga macam genotipe, yaitu AA, Aa, dan aa. Maka, proporsi atau persentase genotipe AA, Aa, dan aa akan menggambarkan susunan genetik populasi tempat mereka berada. Adapun nilai proporsi atau persentase genotipe tersebut dikenal dengan istilah frekuensi genotipe. Jadi, frekuensi genotipe dapat dikatakan sebagai proporsi atau persentase genotipe tertentu di dalam suatu populasi. Dengan perkataan lain, dapat juga didefinisikan bahwa frekuensi genotipe adalah proporsi atau persentase individu di dalam suatu populasi yang tergolong ke dalam genotipe tertentu. Pada contoh di atas jika banyaknya genotipe AA, Aa, dan aa masing-masing 30, 50, dan 20 individu, maka frekuensi genotipe AA = 0,30 (30%), Aa = 0,50 (50%), dan aa = 0,20 (20%). Di samping dengan melihat macam dan jumlah genotipenya, susunan genetik suatu populasi dapat juga dideskripsi atas dasar keberadaan gennya. Hal ini karena populasi dalam arti genetika, seperti telah dikatakan di atas, bukan sekedar kumpulan individu, melainkan kumpulan individu yang dapat melangsungkan perkawinan sehingga terjadi transmisi gen

dari generasi ke generasi. Dalam proses transmisi ini, genotipe tetua (parental) akan dibongkar dan dirakit kembali menjadi genotipe keturunannya melalui segregasi dan rekombinasi gen-gen yang dibawa oleh tiap gamet yang terbentuk, sementara gen-gen itu sendiri akan mengalami kesinambungan (kontinyuitas). Dengan demikian, deskripsi susunan genetik populasi dilihat dari gen-gen yang terdapat di dalamnya sebenarnya justru lebih bermakna bila dibandingkan dengan tinjauan dari genotipenya. Susunan genetik suatu populasi ditinjau dari gen-gen yang ada dinyatakan sebagai frekuensi gen, atau disebut juga frekuensi alel, yaitu proporsi atau persentase alel tertentu pada suatu lokus. Jika kita gunakan contoh perhitungan frekuensi genotipe tersebut di atas, maka frekuensi alelnya dapat dihitung sebagai berikut. AA Aa aa Total Banyaknya individu 30 50 20 100 Banyaknya alel A 60 50 - 110 Banyaknya alel a - 50 40 90 Karena di dalam tiap individu AA terdapat dua buah alel A, maka di dalam populasi yang mempunyai 30 individu AA terdapat 60 alel A. Demikian juga, karena tiap individu Aa membawa sebuah alel A, maka populasi yang mempunyai 50 individu Aa akan membawa 50 alel A. Sementara itu, pada individu aa dengan sendirinya tidak terdapat alel A, sehingga secara keseluruhan banyaknya alel A di dalam populasi tersebut adalah 60 + 50 + 0 = 110. Dengan cara yang sama dapat dihitung banyaknya alel a di dalam populasi, yaitu 0 + 50 + 40 = 90. Oleh karena itu, frekuensi alel A = 110/200 = 0,55 (55%), sedang frekuensi a = 90/200 = 0,45 (45%). Frekuensi alel berkisar dari 0 hingga 1. Suatu populasi yang mempunyai alel dengan frekuensi = 1 dikatakan mengalami fiksasi untuk alel tersebut. Hubungan matematika antara frekuensi genotipe dan frekuensi alel Seandainya di dalam suatu populasi terdapat genotipe AA, Aa, dan aa, masing-masing dengan frekuensi sebesar P, H, dan Q, sementara diketahui bahwa frekuensi alel A dan a masing-masing adalah p dan q, maka antara frekuensi genotipe dan frekuensi alel terdapat hubungan matematika sebagai berikut. p = P + ½ H dan q = Q + ½ H Dalam hal ini P + H + Q = 1 dan p + q = 1. Agar diperoleh gambaran yang lebih jelas mengenai hubungan tersebut, kita perhatikan contoh perhitungan berikut ini. Data frekuensi golongan darah sistem MN pada orang Eskimo di Greenland menurut Mourant (1954) menunjukkan bahwa frekuensi golongan darah M, MN, dan N masingmasing sebesar 83,5 %, 15,6%, dan 0,9% dari 569 sampel individu. Kita telah mengetahui pada Bab II bagian alel ganda bahwa genotipe golongan darah M, MN, dan N masing-masing adalah IMIM, IMIN, dan ININ. Maka, dari data frekuensi genotipe tersebut dapat dihitung besarnya frekuensi alel IM dan IN. Frekuensi alel IM = 83,5% + ½ (15,6%) = 91,3%, sedang frekuensi alel IN = 0,9% + ½ (15,6%) = 8,7%. Hasil perhitungan frekuensi alel dapat digunakan untuk menentukan sifat lokus tempat alel tersebut berada. Suatu lokus dikatakan bersifat polimorfik jika frekuensi alelnya yang terbesar sama atau kurang dari 0,95. Sebaliknya, suatu lokus dikatakan bersifat monomorfik jika frekuensi alelnya yang terbesar melebihi 0,95. Jadi, pada contoh golongan darah sistem MN tersebut lokus yang ditempati oleh alel IM dan IN adalah lokus polimorfik karena frekuensi alel terbesarnya ( IM = 91,3%), masih lebih kecil dari 0,95. Proporsi lokus polimorfik pada suatu populasi sering kali digunakan sebagai salah satu indeks keanekaragaman genetik. Nilai lainnya yang juga sering digunakan sebagai indeks keanekaragaman genetik suatu populasi adalah heterozigositas rata-rata atau frekuensi heterozigot (H) rata-rata. Pada contoh di atas besarnya nilai H untuk lokus MN adalah 15,6%.

Seandainya dapat diperoleh nilai H untuk lokus-lokus yang lain, maka dapat dihitung nilai heterozigositas rata-rata pada populasi tersebut. Perhitungan frekuensi alel menggunakan data elektroforesis Frekuensi alel pada suatu populasi spesies organisme dapat dihitung atas dasar data elektroforesis protein/enzim atau zimogram yang menampilkan pita-pita sebagai gambaran mobililitas masing-masing polipeptida penyusun protein (Gambar 15.1). Elektroforesis merupakan teknik pemisahan molekul yang berbeda-beda ukuran dan muatan listriknya. Oleh karena itu, molekul-molekul yang akan dipisahkan tersebut harus bermuatan listrik seperti halnya protein dan DNA. Jarak migrasi (cm) 4 3 2 1 Individu 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Genotipe CL LL LL CL CL CL LL CL CL CL LL CL LL LL CL Gambar 15.1. Zimogram esterase dari ikan sidat (Anguilla sp) di kawasan Segara Anakan, Cilacap (Sumber : Susanto, 2003) Prinsip kerja elektroforesis secara garis besar dapat dijelaskan sebagai berikut. Sampel ditempatkan pada salah satu ujung media berupa gel, kemudian kedua ujung gel tersebut diberi aliran listrik selama beberapa jam sehingga komponen-komponen penyusun sampel akan bergerak menuju kutub yang muatan listriknya berlawanan dengannya. Kecepatan gerakan (mobilitas) tiap komponen ini akan berbeda-beda sesuai dengan ukuran molekulnya. Makin besar ukuran molekul, makin lambat gerakannya. Akibatnya, dalam satuan waktu yang sama molekul berukuran besar akan menempuh jarak migrasi yang lebih pendek daripada jarak migrasi molekul berukuran kecil. Pola pita seperti pada zimogram esterase di atas sebenarnya merupakan gambaran fenotipe, bukan genotipe. Namun, analisis variasi fenotipe terhadap kebanyakan enzim pada berbagai macam organisme sering kali dapat memberikan dasar genetik secara sederhana. Seperti diketahui, tiap enzim dapat mengandung sebuah polipeptida atau lebih dengan susunan asam amino yang berbeda sehingga menghasilkan fenotipe berupa pita-pita dengan mobilitas yang berbeda. Variasi fenotipe ini disebabkan oleh perbedaan alel yang menyusun genotipe. Jika alel-alel yang menyebabkan perbedaan polipeptida pada enzim tertentu terletak pada suatu lokus, maka bentuk alternatif enzim yang diekspresikannya dikenal sebagai alozim. Alel yang mengatur alozim biasanya bersifat kodominan, yang berarti dalam keadaan heterozigot kedua-duanya akan diekspresikan. Dengan demikian, individu pada Gambar 15.1 yang menampilkan pita lambat dan pita cepat (nomor 1, 4, 5, 6, 8, 9, 10, 12, dan 15) memiliki genotipe heterozigot, yaitu CL (C=cepat; L=lambat). Sementara itu, individu yang hanya menampilkan pita lambat (nomor 2, 3, 7, 11, 13, dan 14) adalah homozigot LL. Begitu pula individu dengan hanya satu pita cepat (kebetulan pada zimogram tersebut tidak ada) dikatakan mempunyai genotipe homozigot CC. Dari data genotipe yang diturunkan dari data variasi fenotipe tersebut, kita dengan mudah dapat menghitung baik frekuensi genotipe maupun frekuensi alelnya. Frekuensi genotipe CC, CL, dan LL masing-masing adalah 0, 9/15, dan 6/15. Frekuensi alel C = 0 + ½ (9/15) = 9/30, sedang frekuensi alel L = 6/15 + ½ (9/15) = 21/30. Hukum Keseimbangan Hardy-Weinberg Populasi mendelian yang berukuran besar sangat memungkinkan terjadinya kawin acak

Dari populasi generasi tetua ini akan dihasilkan dua macam gamet.1 terlihat bahwa tiga macam genotipe zigot akan terbentuk. Di samping kawin acak. Frekuensi alel a = q2 + ½ (2pq) = q2 + pq = q (p + q) = q. masing-masing dengan frekuensi p2. Aa..Weinberg. frekuensi gamet a sama dengan frekuensi alel a (q). dan (3) dari genotipe zigot kepada frekuensi alel pada generasi keturunan. Pada Tabel 15. sedang frekuensi alel a adalah q.1. Pembentukan zigot pada kawin acak Gamet-gamet dan frekuensinya A (p) a (q) Gamet-gamet dan frekuensinya A (p) AA (p2) Aa (pq) a (q) Aa (pq) aa (q2) Oleh karena frekuensi genotipe zigot telah didapatkan. mutasi. terjadinya peristiwa-peristiwa ini serta sistem kawin yang tidak acak akan mengakibatkan perubahan frekuensi alel. ahli matematika dari Inggris. sedang individu tt tidak. Dengan perkatan lain. dokter dari Jerman. frekuensi alel A adalah p. Prinsip ini dirumuskan oleh G. maka frekuensi alel pada populasi zigot atau populasi generasi keturunan dapat dihitung. tiap individu memiliki peluang yang sama untuk bertemu dengan individu lain. sehingga selanjutnya dikenal sebagai hukum keseimbangan Hardy-Weinberg. Hardy. Sementara itu. yakni AA. Pada suatu pengujian terhadap 228 orang diperoleh bahwa hanya . yaitu (1) dari tetua kepada gamet-gamet yang dihasilkannya. masingmasing dengan frekuensi P. Dengan berlangsungnya kawin acak. Individu dengan genotipe TT dan Tt dapat merasakan PTC. dan W. H. dan seleksi.H. Secara lebih rinci ketiga langkah ini dapat dijelaskan sebagai berikut. Deduksi terhadap hukum keseimbangan Hardy-Weinberg meliputi tiga langkah. 2pq. Tabel 15. yaitu A dan a. dan aa. dan q2. frekuensi alel akan senantiasa konstan dari generasi ke generasi. Frekuensi gamet A sama dengan frekuensi alel A (p). Aa. baik dengan genotipe yang sama maupun berbeda dengannya. Kembali kita misalkan bahwa pada generasi tetua terdapat genotipe AA. dapat dilihat bahwa frekuensi alel pada generasi keturunan sama dengan frekuensi alel pada generasi tetua.(panmiksia) di antara individu-individu anggotanya. zigot-zigot yang terbentuk akan memilki frekuensi genotipe sebagai hasil kali frekuensi gamet yang bergabung. (2) dari penggabungan gamet-gamet kepada genotipe zigot yang dibentuk. Fekuensi alel A = p2 + ½ (2pq) = p2 + pq = p (p + q) = p. yaitu tidak terjadi migrasi. Artinya. Oleh karena itu. dan aa. Begitu juga. Dengan adanya sistem kawin acak ini. Dengan demikian. maka terjadi penggabungan gamet A dan a secara acak pula. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel autosomal Kemampuan sesesorang untuk merasakan zat kimia feniltiokarbamid (PTC) disebabkan oleh alel autosomal dominan T. ada persyaratan lain yang harus dipenuhi bagi berlakunya hukum keseimbangan Hardy-Weinberg. dan Q.

11. Frekuensi golongan darah A adalah penjumlahan frekuensi genotipe IA IA dan IA I0 . dari 500 mahasiswa Fakultas Biologi Unsoed diketahui 196 orang bergolongan darah A.2 berikut ini. dan I0.45. dari data frekuensi golongan darah (fenotipe) dapat dihitung besarnya frekuensi alel.55 dan frekuensi alel T = 1 – 0. Agar lebih jelas dapat dilihat Tabel 15. Tabel 15.45)(0.55) = 0. Jika TT dijumlahkan dengan Tt.20. yaitu IA. yang merupakan akar kuadrat frekuensi O. q. sedang frekuensi genotipe Tt = 2(0.20 x 228 =46. Hubungan matematika antara fekuensi alel rangkai X dan frekuensi genotipe Homogametik Heterogametik Genotipe AA Aa aa A a Frekuensi genotipe P H Q R S Alel A a A a Frekuensi alel pm = P + ½H qm = Q + ½H pt = R qt = S pm = frekuensi alel A pada individu homogametik qm = frekuensi alel a pada individu homogametik pt = frekuensi alel A pada individu heterogametik qt = frekuensi alel a pada individu heterogametik Untuk seluruh populasi frekuensi alel A dapat dihitung. Dari 160 orang ini dapat dihitung individu yang bergenotipe TT dan Tt sebagai berikut.55 = 0. Namun. sementara individu heterogametik memberikan . maka sebaran frekuensi genotipenya = (p + q + r)2 = p2 + 2pq + 2pr + q2 + 2qr + q2. Banyaknya individu yang bergenotipe TT = 0. Dengan demikian.30. 205 O. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel ganda Salah satu contoh alel ganda yang sering dikemukakan adalah alel pengatur golongan darah sistem ABO pada manusia. dan O pada suatu populasi dapat dicari dari sebaran frekuensi tersebut. Misalnya. Sebaliknya. Pada jenis kelamin ini tiap individu hanya membawa sebuah alel untuk masing-masing lokus pada kromosom X-nya. frekuensi IB (q) = 1 – akar kuadrat frekuensi A + O = 1 – √(196 + 205)/500 = 0. yang semuanya dapat merasakan PTC. Dengan cara yang sama dapat diperoleh frekuensi alel IA (p) = 1 – √(73 + 205)/500 = 0.25.45)2 = 0. Selanjutnya.50. pada jenis kelamin heterogametik formula tersebut tidak berlaku karena frekuensi alel rangkai X benar-benar sama dengan frekuensi genotipe. Dengan mudah dapat diperoleh frekuensi alel t = √ 0. sedang individu yang bergenotipe Tt = 0. Kontribusi alel sebanyak 2/3 bagian oleh individu homogametik disebabkan oleh keberadaan dua buah kromosom X pada individu tersebut. frekuensi I0 = √ 205/500 = 0. Selanjutnya. Aplikasi hukum Hardy-Weinberg untuk perhitungan frekuensi alel rangkai X Telah kita ketahui bahwa pada manusia dan beberapa spesies organisme lainnya dikenal adanya jenis kelamin homogametik (XX) dan heterogametik (XY).30 = 0. Seperti telah kita bicarakan pada Bab II. jumlah frekuensi A dan O = p2 + 2pr + r2 = (p + r)2 = (1 – q) 2 sehingga akar kuadrat frekuensi A + O = 1 – q. Demikian pula. frekuensi golongan darah B. yakni p2 + 2pr. IB. Dengan cara yang sama dapat dihitung pula frekuensi alel a pada seluruh populasi.64. Jika frekuensi ketiga alel tersebut masing-masing adalah p. Pada jenis kelamin homogametik hubungan matematika antara frekuensi alel yang terdapat pada kromosom X (rangkai X) dan frekuensi genotipenya mengikuti formula seperti pada autosom.160 di antaranya yang dapat merasakan PTC. frekuensi genotipe TT = (0. dan r. Jadi. 73 golongan B. maka diperoleh individu sebanyak 160 orang.2. yaitu q = 2/3 qm + 1/3 qt = 1/3 (2 qm + qt) = 1/3 (2Q + H + S). AB. dan 26 AB. yaitu p = 2/3 pm + 1/3 pt = 1/3 (2 pm + pt) = 1/3 (2P + H + R).50 x 228 = 114. sistem ini diatur oleh tiga buah alel. Alel yang langsung dapat dihitung frekuensinya adalah I0 . Individu yang tidak dapat merasakan PTC (genotipe tt) jumlahnya 228 – 160 = 68 sehingga frekuensi genotipe tt = 68/228 = 0.

54 betina tortoise shell (Bb). yaitu p = 1/3 (2. 7 betina kuning (bb). Namun. jika pada tiap generasi sebanyak 80 dari 1000 ekor ikan normal digantikan oleh ikan albino.08 atau 8%. kuantifikasi migrasi dalam bentuk laju migrasi (lazim dilambangkan sebagai m). dan juga tingkat kesuburan (fertilitas). Mutasi berlangsung dari A ke a dengan laju mutasi sebesar u. Sekarang kita dapat menghitung frekuensi alel B pada seluruh populasi. Migrasi Di atas telah disebutkan bahwa migrasi merupakan salah satu syarat yang harus dipenuhi bagi berlakunya hukum keseimbangan Hardy-Weinberg. Dengan demikian. yang rendah. Sementara itu. Jika persamaan ini dielaborasi.0. Dari kenyataan tersebut di atas dapat dimengerti bahwa mutasi hanya akan memberikan pengaruh nyata terhadap perubahan frekuensi alel jika mutasi berlangsung berulang kali (recurrent mutation) dan mutan yang dihasilkan memiliki kemampuan untuk beradaptasi dengan lingkungan yang ada.12) = 0. Secara matematika. yaitu P = 277 / (277+54+7) = 0.16 + 0. maka dikatakan bahwa laju migrasinya 0. individu-individu mutan biasanya mempunyai daya hidup (viabilitas). dan 42 jantan kuning (b). maka . vqo = upo. perubahan frekuensi alel A akibat mutasi adalah ∆p = vqo – upo. yaitu q = 1/3 (2.16 + 0. sedang frekuensi genotipe b. pn – P = (po – P)(1 – m)n pn = frekuensi alel pada populasi yang diamati setelah n generasi migrasi P = frekuensi alel pada populasi migran po = frekuensi alel pada populasi awal (sebelum terjadi migrasi) m = laju migrasi n = jumlah generasi Mutasi Faktor lain yang dapat menyebabkan terjadinya perubahan frekuensi alel adalah mutasi. sedang perubahan frekuensi alel a akibat mutasi adalah ∆q = upo – vqo. Misalnya. Selain itu.82. yaitu R = 311 / (311+42) = 0. Hal ini berarti bahwa peristiwa migrasi akan menyebabkan terjadinya perubahan frekuensi alel. masing-masing dengan frekuensi awal po dan qo. hubungan antara perubahan frekuensi alel dan laju migrasi dapat dilihat sebagai persamaan berikut ini. Sebagai contoh.89. atau secara umum vq = up. peristiwa yang sangat mendasari proses evolusi ini sebenarnya tidak begitu nyata pengaruhnya dalam perubahan frekuensi alel.88) = 0. Dari data ini dapat dihitung frekuensi genotipe BB pada populasi kucing betina. dan frekuensi alel b pada seluruh populasi.02. di dalam suatu populasi terdapat alel A dan a.12. frekuensi genotipe Bb (H) = 54 / (277+54+7) = 0. Hal ini terutama karena laju mutasi yang umumnya terlalu rendah untuk dapat menyebabkan terjadinya perubahan frekuensi alel.88. Misalnya.02 + 0. yaitu S = 42 / (311+42) = 0. Oleh karena itu. dalam suatu populasi terdapat 277 ekor kucing betina berwarna hitam (BB).kontribusi alel 1/3 bagian karena hanya mempunyai sebuah kromosom X. 311 kucing jantan hitam (B). Ketika dicapai keseimbangan di antara kedua arah mutasi tersebut nilai ∆p dan ∆q adalah 0. Hubungan matematika antara laju mutasi dan perubahan frekuensi alel dapat dirumuskan seperti pada contoh berikut ini. Di antara populasi kucing jantan frekuensi genotipe B. Laju migrasi dapat didefinisikan sebagai proporsi atau persentase alel tertentu di dalam suatu populasi yang digantikan oleh alel migran pada tiap generasi.82 + 0.11. laju mutasi alel a menjadi A adalah v.0. Sebaliknya.16 dan frekuensi genotipe bb (Q) = 7 / (277+54+7) = 0. Lebih jauh. misalnya perbedaan frekuensi golongan darah sistem ABO yang terlihat sangat nyata antara ras yang satu dan lainnya. Sebagai contoh perhitungan frekuensi alel rangkai X dapat dikemukakan alel rangkai X yang mengatur warna tortoise shell pada kucing. sering kali digunakan untuk menjelaskan adanya perbedaan frekuensi alel tertentu di antara berbagai populasi.

Dengan perkataan lain. atau disebut juga genotipe baku. sementara untuk genotipe-genotipe lainnya nilai fitnes relatif besarnya kurang dari 1.2 c) genotipe ini memberikan kontribusi genetik sama besar dengan kontribusi genotipe AA. individu heterozigot HbSHbA justru memiliki ketahanan yang lebih tinggi terhadap . Namun. Kondisi dominansi ketiga genotipe ini berdasarkan atas nilai fitnes relatifnya dapat dilihat pada Gambar 15. aa Aa AA (1-s) (1-½s) 1 a) aa Aa AA (1-s) (1-½s) 1 b) aa AA/Aa (1-s) 1 c) aa AA Aa (1-s2) (1-s1) 1 d) Fitnes relatif Gambar 15. Individu-individu dapat memberikan kontribusi genetik yang berbeda karena mereka mempunyai daya hidup dan tingkat kesuburan yang berbeda.2 berikut ini. Namun. Seleksi Sebegitu jauh kita mengasumsikan bahwa semua individu di dalam populasi akan memberikan kontribusi jumlah keturunan yang sama kepada generasi berikutnya. dikatakan memiliki nilai fitnes relatif sama dengan 1. Berbagai kondisi dominansi dilihat dari nilai fitnes relatifnya a) Semi dominansi b) Dominansi parsial c) Dominansi penuh d) Overdominansi Pada kondisi semi dominansi dan dominansi parsial (Gambar 15. Kembali kita misalkan bahwa di dalam suatu populasi terdapat genotipe AA. sehingga individu ini akan menderita anemia berat dan biasanya meninggal pada usia muda. dan aa. Genotipe superior di dalam suatu populasi.2. sedang pada kondisi dominansi penuh (Gambar 15.2 a dan b) genotipe Aa memberikan kontribusi genetik yang lebih kecil bila dibandingkan dengan kontribusi genotipe baku (AA). Dominansi heterozigot (kondisi overdominansi) ini dapat dijumpai misalnya pada kasus resistensi individu karier anemia bulan sabit (sickle cell anemia) terhadap penyakit malaria. Individu dengan genotipe homozigot HbSHbS akan mengalami pengkristalan molekul hemoglobin. dan eritrositnya berbentuk seperti bulan sabit. Proporsi pengurangan kontribusi genetik suatu genotipe bila dibandingkan dengan kontribusi genetik genotipe baku disebut koefisien seleksi (s) genotipe tersebut. Nilai fitnes relatif berkisar antara 0 dan 1. genotipe Aa menjadi genotipe baku dan kontribusi genetiknya justru lebih besar daripada kontribusi genotipe AA. kenyataan yang sebenarnya sering dijumpai tidaklah demikian. Proporsi atau persentase kontribusi genetik suatu individu kepada generasi berikutnya dikenal sebagai fitnes relatif atau nilai seleksi individu tersebut. Aa.akan didapatkan p = v/(u + v) dan q = u/(u + v). nilai fitnes relatif genotipe ini adalah 1 – s. Bahkan pada kondisi overdominansi.

sampai dengan generasi ketiga saja sudah terlihat bahwa frekuensi genotipe homozigot. perkawinan asortatif negatif dan silang luar akan meningkatkan frekuensi genotipe heterozigot. 1/4 Aa. Pada perkawinan asortatif positif individu-individu yang mempunyai fenotipe sama cenderung untuk lebih sering bertemu bila dibandingkan dengan individu-individu dengan fenotipe berbeda. sedang silang luar adalah perkawinan di antara individu-individu yang secara genetik tidak memiliki hubungan kekerabatan. Silang dalam adalah perkawinan di antara individu-individu yang secara genetik memiliki hubungan kekerabatan. maka ∆q = q1 – q = q2(1 – s ) + pq / 1-sq2 – q. sedang frekuensi heterozigot Aa berkurang. Sebaliknya. dan aa masing-masing sebanyak 1/4. Sistem Kawin Tidak Acak Faktor lain yang meyebabkan gangguan keseimbangan Hardy-Weinberg adalah sistem kawin tidak acak (non random mating). sedang individu normal HbAHbA mempunyai nilai fitnes relatif kurang dari 1. perubahan frekuensi alel dapat dihitung sebagai berikut. Jika dilihat dari segi fenotipe. pada perkawinan asortatif negatif individu-individu yang mempunyai fenotipe berbeda cenderung untuk lebih sering bertemu bila dibandingkan dengan individu-individu dengan fenotipe yang sama. Pada kondisi dominansi penuh. Di tempat-tempat yang menjadi endemi penyakit malaria. Sistem kawin semacam ini dapat dibedakan menjadi dua macam. Oleh karena terjadi penyerbukan sendiri di antara genotipe Aa. misalnya. Pada generasi ketiga genotipe AA dan aa akan bertambah 1/8 bagian yang berasal dari segregasi genotipe Aa pada generasi kedua. Sebaliknya. Perubahan frekuensi alel akibat seleksi berlangsung sesuai dengan kondisi dominansi yang ada. dan 1/4 bagian. 1/4 Aa. Dengan perkataan lain. maka pada generasi kedua dari seluruh populasi akan terdapat genotipe AA. Genotipe AA Aa aa Total Frekuensi awal p2 2pq q2 1 Fitnes relatif 1 1 1 – s Kontribusi genetik p2 2pq q2(1 – s ) 1 – sq2 Terlihat bahwa kontribusi genetik total mejadi lebih kecil dari 1 karena genotipe aa mempunyai nilai fitnes relatif 1 – s. Perkawinan asortatif dapat berupa perkawinan asortatif positif atau asortatif negatif (disasortatif). Aa. 1/2. Genotipe homozigot untuk suatu lokus tertentu – jika kita berbicara individu normal diploid – . genotipe Aa akan berkurang menjadi 1/4 bagian sehingga populasi generasi ketiga akan terdiri atas (1/4+1/8) AA. perkawinan asortatif adalah sistem kawin tidak acak yang didasarkan atas fenotipe. baik AA maupun aa. Dari rumus hubungan matematika antara frekuensi alel dan frekuensi genotipe dapat dihitung besarnya frekuensi alel a setelah seleksi. Katakanlah generasi pertama suatu populasi tanaman menyerbuk sendiri hanya terdiri atas individu-individu dengan genotipe Aa.infeksi parasit penyebab malaria bila dibandingkan dengan individu normal (HbAHbA). Di samping perkawinan asortatif ada pula sistem kawin tidak acak yang tidak memandang fenotipe individu tetapi dilihat dari hubungan genetiknya. genotipe HbSHbA merupakan genotipe baku (fitnes relatif = 1). Jika perubahan frekuensi alel a dilambangkan dengan ∆q. ada sistem kawin tidak acak yang dikenal sebagai perkawinan asortatif. yaitu silang dalam (inbreeding) dan silang luar (outbreeding). dan (1/4+1/8) aa atau 3/8 AA. Dengan demikian. mengalami peningkatan. Sebaliknya. yaitu q1 = q2(1 – s ) + pq / 1-sq2. 3/8 aa. Untuk kondisi dominansi yang lain besarnya perubahan frekuensi alel akibat seleksi dapat dirumuskan dengan cara seperti di atas. Perkawinan asortatif positif dan silang dalam akan meningkatkan frekuensi genotipe homozigot. Silang dalam Contoh silang dalam yang paling ekstrim dapat dilihat pada tanaman yang melakukan penyerbukan sendiri. Setelah persamaan ini kita elaborasi akan didapatkan ∆q = – sq2( 1 – q) / 1 – sq2.

Frekuensi tersebut ternyata sama dengan frekuensi genotipe hasil kawin acak. Gambar 15. Sebaliknya. sementara perkawinan antara saudara kandung baru mencapainya pada generasi keenam belas. nilai F individu X (FX) pada contoh soal tersebut di atas adalah (½)3(1 + 0) + (½)3(1 + 0) = ¼. Pertama. Kemungkinan kedua.Contoh diagram silsilah *Hitung jumlah individu yang terdapat pada tiap loop sebagai nilai n. Dua alel semacam ini dikatakan sebagai alel serupa (alike in state). mereka berasal dari hasil replikasi sebuah alel pada generasi sebelumnya. Tabel 15. nilai F sama dengan 1 apabila kedua alel sepenuhnya merupakan alel identik atau berasal dari leluhur bersama (common ancestor) yang sangat dekat.3. individu A kawin dengan B menghasilkan dua anak. dan q2 . Hal ini berarti di dalam populasi hanya tinggal individu homozigot. Perubahan frekuensi alel yang disebabkan oleh terjadinya silang dalam dapat dihitung dari perubahan frekuensi genotipe seperti pada Tabel 15. dan aa masing-masing menjadi p. Aa. maka frekuensi genotipe AA. Sebagai gambaran. Peningkatan homozigositas akibat silang dalam dapat menimbulkan tekanan silang dalam (inbreeding depression) apabila di antara alel-alel identik yang bertemu terdapat sejumlah alel resesif yang kurang menguntungkan. pembuahan sendiri dapat mencapai homozigositas 100% pada generasi keenam. Aa. yaitu CAD dan CBD. pada individu X besarnya ¼. baik pada loop CAD maupun CBD) FA = koefisien silang dalam leluhur bersama (pada soal ini FA dan FB masing-masing sama dengan 0 karena dianggap sebagai individu hasil kawin acak) Dengan demikian. dan aa masing-masing adalah p2. A B * Hitung jumlah loop. 0. Loop adalah jalan yang menghubungkan kedua orang tua C D X (C dan D) melewati leluhur bersama (A dan B). Jika nilai F = 1.3. Untuk menggambarkan besarnya peluang bahwa dua buah alel yang sama pada individu homozigot merupakan alel identik digunakan suatu nilai yang disebut sebagai koefisien silang dalam (inbreeding coefficient). mereka secara fungsional sama sehingga menghasilkan fenotipe yang sama pula. Misalnya. baik A maupun B. kakak beradik C dan D kawin. 2 pq. Pada soal ini terdapat dua X loop. Nilai F sama dengan 0 apabila kedua alel pada individu homozigot tidak mempunyai asal. sedang individu heterozigot tidak . mempunyai anak X. * Hitung nilai F dengan rumus : F = Σ (½)n(1 + FA) n = jumlah individu yang terdapat pada tiap loop (pada soal ini terdapat 3 individu. dan q. Hal ini berarti bahwa peluang bertemunya alel-alel identik yang berasal dari leluhur bersama. Makin besar nilai F. Jika hal ini yang terjadi.3.mempunyai dua buah alel yang sama pada lokus tersebut. maka frekuensi genotipe AA. dan biasanya dilambangkan dengan F. maka kedua alel tersebut dikatakan seasal atau identik (identical by descent). Besarnya nilai F dapat dihitung dari diagram silsilah seperti contoh pada Gambar 15.usul yang sama atau merupakan hasil kawin acak. Nilai ini besarnya berkisar dari 0 hingga 1. yaitu C dan D. makin cepat diperoleh tingkat homozigositas yang tinggi. Selanjutnya.3. Frekuensi genotipe hasil kawin acak dan silang dalam Genotipe Frekuensi Kawin acak Silang dalam AA p2 p2 (1 – F) + pF Aa 2 pq 2 pq (1 – F) aa q2 q2 (1 – F) + qF Jika nilai F = 0. Persamaan di antara dua alel pada genotipe homozigot dapat terjadi dengan dua kemungkinan. Koefisien silang dalam individu X dapat dihitung sebagai berikut.

Sementara itu. Silang luar Berkebalikan dengan silang dalam. Peristiwa mutasi atau perubahan materi genetik. di samping segregasi dan rekombinasi. antara lain untuk merakit varietas jagung hibrida. Ada beberapa teori mengenai mekanisme genetik yang menjelaskan terjadinya heterosis. Salah satu di antaranya adalah teori dominansi. yang pada prinsipnya menyebutkan bahwa alel-alel reseif merugikan yang dibawa oleh masing-masing galur murni akan tertutupi oleh alel dominan pada individu hibrid yang heterozigot. silang luar justru dapat memunculkan individu hibrid dengan sifat-sifat yang lebih baik daripada kedua tetuanya yang homozigot. pada silang ganda hibrid H disilangkan dengan hibrid I hasil silang tunggal antara galur murni C dan D. sedang alel b menyebabkan batang lemah. melainkan hasil silang tiga arah (three-way cross) atau silang ganda (double cross). Namun. 11/03/2009 Posted by zaifbio | Genetika Dasar | 2 Komentar MUTASI BAB XI MUTASI • Pengertian Mutasi • Mekanisme Molekuler Mutasi • Mutasi Spontan dan Mutasi Induksi • Estimasi Laju Mutasi Spontan dengan Metode Clb • Mutagen Kimia dan Fisika • Mekanisme Perbaikan DNA • Mutasi Balik dan Mutasi Penekan • Uji Ames BAB XI. Pada silang tiga arah hibrid H digunakan sebagai tetua betina untuk disilangkan lagi dengan galur murni lain sehingga biji hibrid yang dihasilkan akan dibawa oleh tongkol hibrid H yang ukurannya besar. Fenomena heterosis sudah sering sekali dimanfaatkan pada bidang pemuliaan tanaman. ada alel A yang menyebabkan akar tanaman tumbuh kuat sementara alel a menjadikan akar tanaman lemah. silang luar akan meningkatkan frekuensi heterozigot. maka jumlah bijinya menjadi sedikit dan tidak cukup untuk dijual kepada petani.dijumpai lagi. Galur murni A disilangkan dengan galur murni B. yang agar dapat melaksanakannya materi genetik harus mempunyai kemampuan untuk melakukan mutasi. batang kuat) akan menghasilkan hibrid AaBb yang mempunyai akar dan batang kuat. jagung hibrida yang dipasarkan biasanya bukan hasil silang tunggal (single cross) seperti itu. Fenomena keunggulan yang diperlihatkan oleh individu hibrid hasil persilangan dua tetua galur murni (homozigot) disebut sebagai vigor hibrida atau heterosis. Di samping itu. akan menciptakan variasi genetik yang berguna untuk mengantisipasi perubahan kondisi lingkungan yang sewaktu- . karena biji hibrid H ini dibawa oleh tongkol tetuanya (A atau B) yang kecil. mendapatkan hibrid H. batang lemah) dan aaBB (akar lemah. Oleh karena itu. MUTASI Fungsi ketiga materi genetik adalah fungsi evolusi. Persilangan antara galur murni AAbb (akar kuat. alel B menyebabkan batang menjadi kokoh. Agak berbeda dengan silang tiga arah. Misalnya. sebagai tetua betina dapat digunakan baik hibrid H maupun hibrid I karena kedua-duanya mempunyai tongkol yang besar. jika silang dalam dapat menyebabkan terjadinya tekanan silang dalam yang berpengaruh buruk terhadap individu yang dihasilkan. Dalam silang ganda ini.

Substitusi sebuah asam amino oleh asam amino lain yang muatannya sama. yaitu individu dengan jaringan normal dan jaringan yang terdiri atas sel-sel somatis mutan. Akan tetapi. sedangkan mutasi somatis terjadi pada sel-sel selain sel germinal. Hemoglobin penderita anemia bulan sabit akan mengalami kristalisasi ketika tidak bereaksi dengan oksigen sehingga akan mengendap di pembuluh darah dan menyumbatnya. perubahan sebuah basa pada DNA tidak selamanya disertai oleh substitusi asam amino karena sebuah asam amino dapat disandi oleh lebih dari sebuah triplet kodon (lihat Bab X). Mutasi yang terjadi pada sebuah atau sepasang basa pada DNA disebut sebagai mutasi titik (point mutation). substitusi asam amino yang tidak menghasilkan perubahan sifat protein atau perubahan fenotipik pun dapat dikatakan sebagai mutasi tenang. digantikan atau disubstitusi oleh valin. Jadi. misalnya substitusi histidin oleh lisin. Alel-alel hasil mutasi somatis tidak akan diwariskan kepada keturunan individu yang mengalaminya karena mutasi ini tidak mempengaruhi sel-sel germinal. yaitu (1) substitusi basa dan (2) perubahan rangka baca akibat adanya penambahan basa (adisi) atau kehilangan . Pada tanaman tingkat tinggi mutasi somatis justru sering kali menghasilkan varietas-varietas yang diinginkan dan untuk perbanyakannya harus dilakukan secara vegetatif. eritrositnya menjadi lonjong dan mudah pecah. Substitusi asam glutamat. pada penderita anemia bulan sabit (sickle cell anemia) salah satu asam amino pada polipeptida β. Perubahan atau mutasi basa pada DNA yang tidak menyebabkan substitusi asam amino atau tidak memberikan pengaruh fenotipik dinamakan mutasi tenang (silent mutation).waktu dapat terjadi. yakni asam glutamat. Mekanisme Molekuler Mutasi Meskipun tidak selalu. perubahan urutan asam amino tidak selalu menyebabkan perubahan sifat-sifat biologi protein atau menghasilkan fenotipe mutan. Selain itu. Hal ini karena pelipatan rantai polipeptida sebagai penentu struktur tiga dimensi molekul protein sangat bergantung kepada interaksi di antara asam-asam amino dengan muatan yang berlawanan. Namun. mengakibatkan perubahan struktur hemoglobin dan juga eritrosit yang membawanya. Pengaruh fenotipik yang ditimbulkan oleh mutasi sangat bervariasi. Jenis sel dan tahap perkembangan individu menentukan besar kecilnya pengaruh mutasi. yang bermuatan negatif. Mutasi somatis akan menyebabkan terbentuknya khimera. Mutasi germinal terjadi pada sel-sel germinal atau sel-sel penghasil gamet. Mekanisme terjadinya mutasi titik ini ada dua macam. alel mutan resesif tidak akan memunculkan pengaruh fenotipik selama berada di dalam individu heterozigot karena tertutupi oleh alel dominannya yang normal. perubahan urutan asam amino pada suatu protein dapat menyebabkan perubahan sifat-sifat biologi protein tersebut. yang tidak bermuatan atau netral. mulai dari perubahan kecil yang hanya dapat dideteksi melalui analisis biokimia hingga perubahan pada prosesproses esensial yang dapat mengakibatkan kematian sel atau bahkan organisme yang mengalaminya. Kita mengenal berbagai macam peristiwa mutasi sesuai dengan kriteria yang digunakan untuk mengelompokkannya. Demikian juga. ada tidaknya pengaruh substitusi suatu asam amino terhadap perubahan sifat protein bergantung kepada peran asam amino tersebut dalam struktur dan fungsi protein. Dalam hal ini. pada organisme diploid pengaruh mutasi juga bergantung kepada dominansi alel. sering kali tidak berpengaruh terhadap struktur molekul protein atau fenotipe individu. Hemoglobin pada individu dewasa normal terdiri atas dua rantai polipeptida α yang identik dan dua rantai polipeptida β yang identik juga. Seperti dikatakan di atas. Contoh yang paling sering dikemukakan adalah perubahan sifat biologi yang terjadi pada molekul hemoglobin. Pada organisme multiseluler dapat dibedakan antara mutasi germinal dan mutasi somatis. Setiap perubahan asam amino disebabkan oleh perubahan urutan basa nukleotida pada molekul DNA. oleh valin. Namun.

basa (delesi). Mutasi titik yang disebabkan oleh substitusi basa dinamakan mutasi substitusi basa, sedangkan mutasi yang terjadi karena perubahan rangka baca dinamakan mutasi rangka baca (frameshift mutation) seperti telah disinggung pada Bab X. Apabila substitusi basa menyebabkan substitusi asam amino seperti pada kasus hemoglobin anemia bulan sabit, maka mutasinya dinamakan mutasi salah makna (missense mutation). Sementara itu, jika substitusi basa menghasilkan kodon stop, misalnya UAU (tirosin) menjadi UAG (stop), maka mutasinya dinamakan mutasi tanpa makna (nonsense mutation) atau mutasi terminasi rantai (chain termination mutation). Substitusi basa pada sebuah triplet kodon dapat menghasilkan sembilan kemungkinan perubahan triplet kodon karena tiap basa mempunyai tiga kemungkinan substitusi. Sebagai contoh, kodon UAU dapat mengalami substitusi basa menjadi AAU (asparagin), GAU (asam aspartat), CAU (histidin), UUU (fenilalanin), UGU (sistein), UCU (serin), UAA (stop), UAG (stop), dan UAC (tirosin). Kita bisa melihat bahwa perubahan yang terakhir, yakni UAC, tidak menghasilkan substitusi asam amino karena baik UAC maupun UAU menyandi asam amino tirosin. Mutasi substitusi basa dapat dibedakan menjadi dua kelompok, yaitu transisi dan transversi. Pada transisi terjadi substitusi basa purin oleh purin atau substitusi pirimidin oleh pirimidin, sedangkan pada transversi terjadi substitusi purin oleh pirimidin atau pirimidin oleh purin. Secara skema kedua macam substitusi basa tersebut dapat dilihat pada Gambar 11.1. A TC G Gambar 11.1. Skema substitusi basa nukleotida transisi transversi Sementara itu, mutasi rangka baca akan mengakibatkan perubahan rangka baca semua triplet kodon di belakang tempat terjadinya mutasi tersebut. Akan tetapi, adisi atau pun delesi sebanyak kelipatan tiga basa pada umumnya tidak akan menimbulkan pengaruh fenotipik mutasi rangka baca. Demikian pula, seperti dikatakan pada Bab X adisi satu basa yang diimbangi oleh delesi satu basa di tempat lain, atau sebaliknya, akan memperbaiki kembali rangka baca di belakang tempat tersebut. Selain itu, apabila adisi atau delesi terjadi pada daerah yang sangat dekat dengan ujung karboksil suatu protein, maka mutasi rangka baca yang ditimbulkannya tidak akan menyebabkan sintesis protein nonfungsional. Dengan perkataan lain, mutasi tidak memberikan pengaruh fenotipik. Mutasi Spontan Perubahan urutan basa nukleotida berlangsung spontan dan acak. Tidak ada satu pun cara yang dapat digunakan untuk memprediksi saat dan tempat akan terjadinya suatu mutasi. Meskipun demikian, setiap gen dapat dipastikan mengalami mutasi dengan laju tertentu sehingga memungkinkan untuk ditetapkan peluang mutasinya. Artinya, kita dapat menentukan besarnya peluang bagi suatu gen untuk bermutasi sehingga besarnya peluang untuk mendapatkan suatu alel mutan dari gen tersebut di dalam populasi juga dapat dihitung. Terjadinya suatu peristiwa mutasi tidak dapat dikatakan sebagai hasil adaptasi sel atau organisme terhadap kondisi lingkungannya. Kebanyakan mutasi memperlihatkan pengaruh yang sangat bervariasi terhadap tingkat kemampuan adaptasi sel atau organisme, mulai dari netral (sangat adaptable) hingga letal (tidak adaptable). Oleh karena itu, tidak ada korelasi yang nyata antara mutasi dan adaptasi. Namun, pemikiran bahwa mutasi tidak ada sangkut pautnya dengan adaptasi tidak diterima oleh sebagian besar ahli biologi hingga akhir tahun 1940-an ketika Joshua dan Esther Lederberg melalui percobaannya pada bakteri

membuktikan bahwa mutasi bukanlah hasil adaptasi. Dengan teknik yang dinamakan replica plating koloni-koloni bakteri pada kultur awal (master plate) dipindahkan ke medium baru (replica plate) menggunakan velvet steril sehingga posisi setiap koloni pada medium baru akan sama dengan posisinya masing-masing pada kultur awal. Medium baru dibuat dua macam, yaitu medium nonselektif seperti pada kultur awal dan medium selektif yang mengandung lebih kurang 109 fag T1. Hanya koloni-koloni mutan yang resisten terhadap infeksi fag T1 (mutan T1-r) yang dapat tumbuh pada medium selektif ini. Dari percobaan tersebut terlihat bahwa koloni-koloni mutan T1-r yang tumbuh pada medium selektif tidak terbentuk sebagai hasil adaptasi terhadap kehadiran fag T1, tetapi sebenarnya sudah ada semenjak pada kultur awal. Dengan demikian, teknik selektif semacam itu hanya akan menyeleksi mutan-mutan yang telah ada sebelumnya di dalam suatu populasi. master plate transfer replica plate replica plate (medium nonselektif) (medium selektif) Gambar 11.2. Percobaan transfer koloni (replica plating) = koloni mutan T1-r Teknik selektif seperti yang diuraikan di atas memberikan dasar bagi pemahaman tentang munculnya resistensi berbagai populasi hama dan penyakit terhadap senyawa kimia yang digunakan untuk mengendalikannya. Sebagai contoh, sejumlah populasi lalat rumah saat ini nampak sangat resisten terhadap insektisida DDT. Hal ini menunjukkan betapa seleksi telah memunculkan populasi lalat rumah dengan kombinasi mekanisme enzimatik, anatomi, dan perilaku untuk dapat resisten terhadap atau menghindari bahan kimia tersebut. Begitu pula, gejala peningkatan resistensi terhadap antibiotik yang diperlihatkan oleh berbagai macam bakteri penyebab penyakit pada manusia tidak lain merupakan akibat proses seleksi untuk memunculkan dominansi strain-strain mutan tahan antibiotik yang sebenarnya memang telah ada sebelumnya. Laju mutasi Laju mutasi adalah peluang terjadinya mutasi pada sebuah gen dalam satu generasi atau dalam pembentukan satu gamet. Pengukuran laju mutasi penting untuk dilakukan di dalam genetika populasi, studi evolusi, dan analisis pengaruh mutagen lingkungan. Mutasi spontan biasanya merupakan peristiwa yang sangat jarang terjadi sehingga untuk memperkirakan peluang kejadiannya diperlukan populasi yang sangat besar dengan teknik tertentu. Salah satu teknik yang telah digunakan untuk mengukur laju mutasi adalah metode ClB yang ditemukan oleh Herman Muller. Metode ClB mengacu kepada suatu kromosom X lalat Drosophila melanogaster yang memiliki sifat-sifat tertentu. Teknik ini dirancang untuk mendeteksi mutasi yang terjadi pada kromosom X normal. Kromosom X pada metode ClB mempunyai tiga ciri penting, yaitu (1) inversi yang sangat besar (C), yang menghalangi terjadinya pindah silang pada individu betina heterozigot; (2) letal resesif (l); dan (3) marker dominan Bar (B) yang menjadikan mata sempit (lihat Bab VII). Dengan adanya letal resesif, individu jantan dengan kromosom tersebut dan individu betina homozigot tidak akan bertahan hidup. Persilangan pertama dilakukan antara betina heterozigot untuk kromosom ClB dan jantan dengan kromosom X normal. Di antara keturunan yang diperoleh, dipilih individu betina yang mempunyai mata Bar untuk selanjutnya pada persilangan kedua dikawinkan dengan jantan normal. Individu betina dengan mata Bar ini jelas mempunyai genotipe heterozigot

karena menerima kromosom ClB dari tetua betina dan kromosom X normal dari tetua jantannya. Hasil persilangan kedua yang diharapkan adalah dua betina berbanding dengan satu jantan. Ada tidaknya individu jantan hasil persilangan kedua ini digunakan untuk mengestimasi laju mutasi letal resesif. Oleh karena pindah silang pada kromosom X dihalangi oleh adanya inversi (C) pada individu betina, maka semua individu jantan hasil persilangan hanya akan mempunyai genotipe + . Kromosom X pada individu jantan ini berasal dari tetua jantan awal (persilangan pertama). Sementara itu, individu jantan dengan kromosom X ClB selalu mengalami kematian. Meskipun demikian, kadang-kadang pada persilangan kedua tidak diperoleh individu jantan sama sekali. Artinya, individu jantan yang mati tidak hanya yang membawa kromosom ClB, tetapi juga individu yang membawa kromosom X dari tetua jantan awal. Jika hal ini terjadi, kita dapat menyimpulkan bahwa kromosom X pada tetua jantan awal yang semula normal berubah atau bermutasi menjadi kromosom X dengan letal resesif. Dengan menghitung frekuensi terjadinya kematian pada individu jantan yang seharusnya hidup ini, dapat dilakukan estimasi kuantitatif terhadap laju mutasi yang menyebabkan terbentuknya alel letal resesif pada kromosom X. Ternyata, lebih kurang 0,15% kromosom X terlihat mengalami mutasi semacam itu selama spermatogenesis, yang berarti bahwa laju mutasi untuk mendapatkan letal resesif per kromosom X per gamet adalah 1,5 x 10-3. betina Bar ClB + jantan normal ClB ? + ? ClB + letal betina Bar (dipilih untuk disilangkan dengan jantan normal) ClB ? + ClB + ? + ClB ? letal letal jika X-nya membawa letal resesif Gambar 11.3. Metode ClB untuk mengestimasi laju mutasi = kromosom X yang berasal dari tetua jantan pada persilangan pertama Pada metode ClB tidak diketahui laju mutasi gen tertentu karena kita tidak dapat memastikan banyaknya gen pada kromosom X yang apabila mengalami mutasi akan berubah menjadi alel resesif yang mematikan. Namun, semenjak ditemukannya metode ClB berkembang pula sejumlah metode lain untuk mengestimasi laju mutasi pada berbagai organisme. Hasilnya menunjukkan bahwa laju mutasi sangat bervariasi antara gen yang satu dan lainnya. Sebagai contoh, laju mutasi untuk terbentuknya tubuh berwarna kuning pada Drosophila adalah 10-4 per gamet per generasi, sementara laju mutasi untuk terbentuknya resitensi terhadap streptomisin pada E. coli adalah 10-9 per sel per generasi. Asal-mula terjadinya mutasi spontan Ada tiga mekanisme yang paling penting pada mutasi spontan, yaitu (1) kesalahan selama replikasi, (2) perubahan basa nukleotida secara spontan, dan (3) peristiwa-peristiwa yang berkaitan dengan penyisipan (insersi) dan pemotongan (eksisi) unsur-unsur yang dapat

Agen yang dapat menyebabkan terjadinya mutasi seperti sinar X ini dinamakan mutagen. Sumber mutasi spontan lainnya adalah perubahan basa sitosin yang telah termetilasi menjadi timin karena hilangnya gugus amino. Akan tetapi. Namun. Jika hal ini terjadi. Mekanisme perbaikan salah pasangan Basa-basa tautomerik adakalanya dapat tergabung dengan benar ke dalam molekul DNA. Akan tetapi. maka sistem perbaikan salah pasangan tidak dapat membedakan antara untai cetakan dan untai baru. segmen DNA yang membawa basa yang salah dibuang sehingga terdapat celah (gap) di dalam untai DNA. Muller pada tahun 1927 yang memperlihatkan bahwa sinar X dapat menyebabkan mutasi pada Drosophila. Sistem perbaikan salah pasangan. sistem perbaikan salah pasangan tidak bekerja pada ujung 3’ untai DNA yang sedang tumbuh. ada sistem lain yang berfungsi dalam perbaikan kesalahan replikasi DNA. Kadang-kadang suatu kesalahan replikasi luput dari mekanisme penyuntingan tersebut. dengan bantuan enzim Pol I celah ini akan diisi oleh segmen baru yang membawa basa yang telah diperbaiki. Berbeda dengan sistem penyuntingan oleh DNA polimerase. Sistem ini dikenal sebagai sistem perbaikan salah pasangan (mismatch repair). Sitosin yang seharusnya berpasangan dengan guanin berubah menjadi timin yang berpasangan dengan adenin sehingga terjadilah mutasi transisi (purin menjadi purin. Bukti pertama bahwa agen eksternal dapat meningkatkan laju mutasi diperoleh dari penelitian H. Caranya. enzim-enzim DNA polimerase ini juga diketahui mempunyai kemampuan untuk memperbaiki kesalahan (proof reading) melalui aktivitas eksonukleasenya dengan cara memotong basa yang salah pada ujung 3’ untai DNA yang sedang dipolimerisasi. 5’ GAGTCGAATC 3’ untai cetakan 3’ CTCAGTTTAG 5’ untai baru GAGTCGAATC CTC AG AGTTT segmen dengan perbaikan eksisi basa yang salah GAGTCGAATC CTCAGCTTAG untai yang telah diperbaiki Gambar 11. seperti halnya mekanisme penyuntingan oleh DNA polimerase. Mutasi dengan laju yang ditingkatkan ini dinamakan mutasi induksi. basa tersebut akan membentuk ikatan hidrogen yang benar dengan basa pada untai DNA cetakan sehingga fungsi penyuntingan oleh DNA polimerase tidak dapat mengenalinya. . Kadang-kadang ada juga kesalahan pasangan basa yang tidak dikenalinya.4. Dalam hal ini hilangnya gugus amino dari sitosin yang telah termetilasi tidak dapat dikenali oleh sistem perbaikan salah pasangan. Pada Bab IX telah kita bicarakan bahwa enzim Pol I dan Pol III adakalanya membuat kesalahan dengan menyisipkan basa yang salah ketika replikasi DNA sedang berlangsung. Sistem perbaikan salah pasangan akan mengoreksi kesalahan semacam itu. Aktivitas penyuntingan oleh DNA polimerase boleh dikatakan sangat efisien meskipun tidak berarti sempurna benar. Selanjutnya. Hal ini akan menimbulkan mutasi spontan.berpindah (transposable elements). Mutasi Induksi Laju mutasi spontan yang sangat rendah ternyata dapat ditingkatkan dengan aplikasi berbagai agen eksternal. Pada saat penggabungan berlangsung. timbullah mutasi spontan. pirimidin menjadi pirimidin). jika segmen yang membawa kesalahan basa tersebut telah mengalami metilasi. dan basa timin yang seharusnya sitosin tersebut tidak dilihat sebagai basa yang salah. tidaklah sempurna sama sekali. tetapi mengenali kesalahan basa di dalam untai DNA.

Namun. maka akan terjadi hambatan dalam sintesis dCTP. Konsentrasi deoksinukleosida trifofat (dNTP) di dalam sel pada umumnya diatur oleh konsentrasi deoksitimidin trifosfat (dTTP). Basa analog Basa analog merupakan senyawa kimia yang struktur molekulnya sangat menyerupai basa nukleotida DNA sehingga dapat menjadi bagian yang menyatu di dalam molekul DNA selama berlangsungnya replikasi normal. Apabila suatu saat dTTP terdapat dalam jumlah yang sangat berlebihan. basa 5-bromourasil (BU) yang diketahui mudah sekali bergabung dengan DNA bakteri dan virus. BU sebagai basa yang analog dengan timin juga dapat menghambat sintesis dCTP. yang seharusnya GC. Apabila suatu basa analog dapat membentuk ikatan hidrogen dengan dua macam cara. yaitu keto dan enol sehingga dapat membentuk ikatan hidrogen dengan dua macam cara. Mutasi tautomerik (transisi) akibat basa analog 5-bromourasil Mutagen-mutagen kimia Berbeda dengan basa analog yang hanya bersifat mutagenik ketika DNA sedang melakukan replikasi. maka basa analog ini dikatakan bersifat mutagenik. molekul DNA yang baru akan mempunyai pasangan basa GC pada posisi yang seharusnya ditempati oleh pasangan basa AT. Percobaan-percobaan berikutnya menunjukkan bahwa mekanisme mutagenesis BU dapat terjadi dengan cara lain. Pada putaran replikasi berikutnya basa timin pada pasangan GT akan berpasangan dengan adenin sehingga posisi yang seharusnya ditempati oleh GC sekarang diganti dengan AT. Basa ini analog dengan basa timin karena hanya berbeda pada posisi gugus metil yang diganti dengan atom bromium. Artinya. jika BU berada dalam bentuk enol. dapat mempunyai dua macam bentuk. berbagai mutagen fisika dan kimia digunakan untuk meningkatkan laju mutasi. Jika BU ditambahkan ke dalam medium pertumbuhan. Sebagai contoh. Dengan mutagen-mutagen ini dapat diperoleh bermacam-macam mutan pada beberapa spesies organisme. akan meningkat. maka BU akan berpasangan dengan guanin (GBU). Akibatnya. Penggantian ini belum dapat dikatakan sebagai peristiwa mutasi. telah terjadi mutasi tautomerik berupa transisi dari AT ke GC (Gambar 11. bisa juga masuknya sebuah basa analog terkoreksi melalui mekanisme penyuntingan oleh enzim DNA polimerase. Jika sel yang akan dimutasi ditumbuhkan pada medium yang mengandung BU dalam bentuk keto. keberadaan BU ternyata menyebabkan laju perbaikan menjadi tertinggal oleh laju salah pasangan. mutagen kimia dapat mengakibatkan mutasi pada DNA baik yang sedang . A=T substitusi T oleh BU (keto) A=BU replikasi 1 A=T G=BU pengikatan G oleh BU (enol) replikasi 2 A=T A=T G=C A=BU transisi Gambar 11. Akan tetapi. maka dTTP akan disintesis dalam jumlah normal tetapi sintesis dCTP akan sangat terhambat. nisbah dTTP terhadap dCTP menjadi sangat tinggi dan frekuensi salah pasangan GT. BU telah menginduksi mutasi tautomerik berupa transisi GC menjadi AT. dan pada putaran replikasi berikutnya. konsentrasi dTTP akan menentukan konsentrasi ketiga dNTP lainnya untuk keperluan sintesis DNA.Semenjak penemuan Muller tersebut. Mekanisme penyuntingan dan perbaikan salah pasangan sebenarnya dapat membuang basa timin yang salah berpasangan dengan guanin tersebut.5). Akan tetapi. Dengan demikian. maka selama replikasi DNA adakalanya timin digantikan oleh BU sehingga pasangan basa AT berubah menjadi ABU. Sementara itu. Dengan perkataan lain.5. Hal ini karena suatu basa analog dapat berpasangan dengan basa tertentu pada untai DNA cetakan.

misalnya asam nitros (HNO2). Iradiasi ultraviolet Sinar ultraviolet (UV) dapat menghasilkan pengaruh. Akibatnya. maka replikasi akan terhenti tepat di depan celah dan kemudian dimulai lagi dengan menyisipkan basa adenin pada posisi yang komplementer dengan celah tersebut. Interkalasi Senyawa kimia akridin. maka agen-agen alkilasi sangat efektif untuk digunakan pada sistem eukariot. Padahal seharusnya pasangan basa pada posisi celah tersebut adalah GC (bukankah yang hilang adalah G?). Perubahan ini tidak lain merupakan mutasi tautomerik jenis transversi. Dengan mekanisme serupa. sitosin. HNO2 bekerja sebagai mutagen dengan mengubah gugus amino (NH2) pada basa adenin. melainkan mutasi rangka baca.6. Alkilasi pada basa G atau T akan menyebabkan terjadinya salah pasangan yang mengarah kepada transisi AT→ GC dan GC → AT. Besarnya perenggangan sama dengan tebal molekul akridin. EMS dapat juga bereaksi dengan A dan C. Oleh karena itu pada posisi celah tersebut terjadi perubahan dari GC menjadi TA atau purin-pirimidin menjadi pirimidin-purin. maka untai DNA hasil replikasi akan ada yang mengalami adisi dan ada yang mengalami delesi pada posisi terjadinya interkalasi. Selain itu. Agen alkilasi etilmetan sulfonat (EMS) dan mustard nitrogen merupakan mutagen-mutagen kimia yang banyak digunakan dalam penelitian genetika. Depurinasi tidak selalu bersifat mutagenik karena celah yang terbentuk dengan hilangnya basa purin tadi dapat segera diperbaiki. Namun. beberapa lainnya. pada semua jenis virus dan sel. baik letal maupun mutagenik. Jika HNO2 terbukti sangat bermanfaat pada sistem prokariot. Pengaruh interkalasi terhadap molekul DNA adalah terjadinya perenggangan jarak antara dua pasangan basa yang berurutan. Peristiwa penyisipan semacam ini dinamakan interkalasi. Struktur molekul dua agen alkilasi yang umum digunakan Fenomena lain yang dapat muncul akibat terjadinya alkilasi guanin adalah depurinasi. yang salah satu contohnya adalah proflavin (Bab X). Pengaruh ini disebabkan oleh terjadinya perubahan kimia pada . Hal ini mengakibatkan terjadinya transisi AT menjadi GC melaui HC. yaitu hilangnya basa purin yang telah mengalami alkilasi tersebut dari molekul DNA karena patahnya ikatan yang menghubungkannya dengan gula deoksiribosa. Beberapa di antara mutagen kimia. yang berpasangan dengan sitosin. setelah replikasi basa adenin di posisi celah tersebut akan berpasangan dengan timin atau terjadi pasangan TA. garpu replikasi sering kali terlebih dahulu telah mencapai celah tersebut sebelum perbaikan sempat dilakukan. Kedua-duanya akan memberikan gugus etil (C2H5) atau sejenisnya kepada basa DNA. memberikan pengaruh dengan spektrum yang luas. deaminasi sitosin yang menghasilkan urasil akan mengakibatkan transisi GC menjadi AT melalui AU. misalnya agen-agen alkilasi.bereplikasi maupun yang tidak sedang bereplikasi. memiliki struktur molekul berupa tiga cincin sehingga sangat menyerupai pasangan basa purin – pirimidin atau pirimidin – purin. Apabila DNA yang membawa akridin tadi melakukan replikasi. mutasi yang ditimbulkan bukanlah mutasi tautomerik. akridin dapat menyisip di antara dua pasangan basa yang berdekatan pada molekul DNA. Jika hal ini terjadi. dan guanin menjadi gugus keto (=O) sehingga spesifisitas pengikatan hidrogen pada basa-basa tersebut juga mengalami perubahan. Dengan demikian. menimbulkan perubahan yang sangat khas. Akan tetapi. Dengan struktur yang sangat menyerupai sebuah pasangan basa. Deaminasi adenin akan menghasilkan hipoksantin (H). O CH2 – CH2 – Cl CH3 – CH2 – O – S – CH3 HN O CH2 – CH2 – Cl etilmetan sulfonat mustard nitrogen Gambar 11.

Akibatnya. Eksisi Perbaikan dengan cara eksisi merupakan proses enzimatik bertahap yang diawali dengan pembuangan dimer dari molekul DNA. Hasilnya berupa .8. segmen penutup celah akan terligasi dengan sempurna pada masing-masing untai DNA baru (Gambar 11. Seperti pada mekanisme yang pertama. Mekanisme rekombinasi pada prinsipnya merupakan cara untuk menutup celah tersebut menggunakan segmen yang sesuai pada untai DNA cetakan yang membawa dimer. Dengan adanya cahaya. Dengan adanya timin dimer. Mekanisme SOS Mekanisme perbaikan DNA dengan sistem SOS dapat dilihat sebagai jalan pintas yang memungkinkan replikasi tetap berlangsung meskipun harus melintasi dimer. Oleh karena itu. Akibatnya. Jadi.8.8. segmen yang membawa dimer akan terlepas dari untai DNA. rekombinasi. sedangkan kedua untai DNA baru tidak mempunyai celah lagi (Gambar 11. perbaikan kerusakan DNA dengan cara rekombinasi terjadi setelah replikasi berlangsung.b). proses ini diakhiri dengan ligasi segmen yang baru tadi dengan untai DNA. Pembuangan segmen ini kemudian diikuti oleh sintesis segmen baru yang akan menggantikannya dengan bantuan enzim DNA polimerase I. Namun. Fotoreaktivasi Mekanisme perbaikan ini bergantung kepada cahaya. dan diakhiri oleh ligasi segmen tersebut dengan untai DNA. sekarang kedua untai DNA cetakan selain membawa dimer juga mempunyai celah. eksisi.basa DNA akibat absorpsi energi dari sinar tersebut. dan SOS. diikuti oleh resintesis segmen DNA baru. Pada mekanisme yang kedua pemotongan mula-mula hanya terjadi pada satu tempat. aktivasinya memerlukan spektrum biru cahaya sehingga enzim tersebut hanya bisa bekerja apabila ada cahaya. baik ketika ada cahaya maupun tidak ada cahaya. ikatan antara timin dan timin akan terputus oleh suatu enzim tertentu. Untuk jelasnya. yaitu saling terikatnya dua molekul timin yang berurutan pada sebuah untai DNA. Pada waktu yang sama terjadi pemotongan lagi pada segmen yang membawa dimer sehingga segmen ini terlepas dari untai DNA. skema mekanisme tersebut dapat dilihat pada Gambar 11. mekanisme ini sering juga dikatakan sebagai rekombinasi pascareplikasi. Akhirnya. khususnya timin dimer.c). Pengaruh terbesar yang ditimbulkan oleh iradiasi sinar UV adalah terbentuknya pirimidin dimer. Akhirnya. Rekombinasi Berbeda dengan dua mekanisme yang telah dijelaskan sebelumnya. Sebenarnya enzim tersebut telah mengikat dimer. yaitu fotoreaktivasi. yakni di sekitar dimer. Pada mekanisme pertama. Ada dua mekanisme eksisi yang agak berbeda. Akan tetapi. untai DNA hasil polimerisasi akan mempunyai celah pada posisi dimer. enzim endonuklease melakukan pemotongan (eksisi) pada dua tempat yang mengapit dimer. Akibatnya. DNA yang membawa dimer pada kedua untainya melakukan replikasi (Gambar 11. maka polimerisasi akan terhenti sejenak untuk kemudian dimulai lagi dari posisi setelah dimer.8. Ketika DNA polimerase sampai pada suatu dimer.d). Pada celah yang terbentuk akibat pemotongan tersebut segera terjadi sintesis segmen baru dengan urutan basa yang benar.8. Celah akan diisi oleh segmen yang sesuai dari masingmasing untai DNA cetakan yang membawa dimer. replikasi DNA akan terhalang pada posisi terjadinya timin dimer tersebut. segmen yang baru tersebut diligasi dengan untai DNA sehingga untai DNA ini sekarang tidak lagi membawa dimer. pada untai DNA cetakan terdapat segmen yang hilang. kerusakan DNA ini pada umumnya dapat diperbaiki melalui salah satu di antara empat macam mekanisme.a) sehingga pada waktu garpu replikasi mencapai dimer akan terbentuk celah pada kedua untai DNA yang baru (Gambar 11.

mutasi tetap terjadi. maka sistem perbaikan salah pasangan tidak dapat memperbaiki semua kesalahan yang ada.8. frekuensi letal resesif pada kromosom X Drosophila meningkat linier sejalan dengan meningkatnya dosis radiasi sinar X. sedangkan sistem perbaikan salah pasangan sebenarnya dapat memperbaikinya. Frekuensi mutasi yang diinduksi oleh sinar X sebanding dengan dosis radiasi yang diberikan. Mekanisme eksisi untuk memperbaiki DNA Ketika sistem SOS aktif. kedua adenin ini tidak dapat berpasangan dengan timin karena kedua timin berada dalam bentuk dimer. Pemaparan sebesar 1000 rad meningkatkan . β. dimer pemotongan di dua tempat pemotongan di satu tempat di sekitar dimer resintesis segmen baru oleh Pol I pemotongan segmen ligasi yang membawa dimer ligasi Gambar 11. Untai DNA yang baru akan mempunyai dua basa adenin berurutan pada posisi dimer (dalam kasus timin dimer). karena jumlah dimer di dalam setiap sel yang mengalami iradiasi UV biasanya begitu banyak. Skema mekanisme rekombinasi pascareplikasi = pirimidin dimer = penutupan celah oleh segmen dari untai DNA cetakan yang membawa dimer Radiasi pengion Radiasi pengion mempunyai energi yang begitu besar sehingga molekul air dan senyawa kimia lainnya yang terkena olehnya akan terurai menjadi fragmen-fragmen bermuatan listrik. a) b) d) c) Gambar 11. Dengan sendirinya. Namun. Intensitas radiasi pengion dinyatakan secara kuantitatif dengan beberapa macam cara. Semua bentuk radiasi pengion akan menyebabkan pengaruh mutagenik dan letal pada virus dan sel. yang didefinisikan sebagai besarnya radiasi yang menyebabkan absorpsi energi sebesar 100 erg pada setiap gram materi. dan sinar γ. Oleh karena itu. Ukuran yang paling lazim digunakan adalah rad. Pengaruh mutagenik iradiasi UV memang hampir selalu merupakan akibat perbaikan yang rentan terhadap kesalahan. Radiasi pengion meliputi sinar X beserta partikel-partikelnya dan radiasi yang dihasilkan oleh unsur-unsur radioaktif seperti partikel α. Akibatnya. sistem penyuntingan oleh DNA polimerase III justru menjadi tidak aktif.untai DNA yang utuh tetapi sering kali sangat defektif. Sebagai contoh. Hal ini dimaksudkan agar polimerisasi tetap dapat berjalan melintasi dimer. Sistem penyuntingan tidak dapat memperbaiki kesalahan ini karena tidak aktif.7. mekanisme SOS dapat dikatakan sebagai sistem perbaikan yang rentan terhadap kesalahan.

Salah satu di antara dua polipeptida yang menyusun enzim tersebut adalah polipeptida A yang terdiri atas 268 asam amino. yaitu kerusakan pada salah satu untai.15% menjadi 3%. Cara yang pertama telah kita jelaskan pada Bab X. semua sel tumor akan rusak. Pengaruh mutagenik dan letal yang ditimbulkan oleh radiasi pengion terutama berkaitan dengan kerusakan DNA. Ada tiga macam kerusakan DNA yang disebabkan oleh radiasi pengion. Diharapkan setelah iradiasi diberikan selama kurun waktu tertentu. maka sel tumor yang dirusak akan jauh lebih banyak daripada sel normal yang dirusak. Pada eukariot radiasi pengion dapat menyebabkan kerusakan kromosom. Pada prinsipnya perlakuan ini dimaksudkan untuk meningkatkan frekuensi kerusakan kromosom pada sel-sel yang sedang mengalami mitosis.frekuensi mutasi dari laju mutasi spontan sebesar 0. yaitu perbaikan rangka baca dengan kompensasi adisi-delesi sehingga rangka baca yang bergeser sebagian besar dapat dikembalikan seperti semula. Perubahan glisin menjadi asam glutamat sebenarnya . Kebanyakan mutasi penekan. Ada dua mekanisme yang berbeda pada mutasi balik. Mutasi semacam ini dinamakan mutasi balik atau reversi. pada beberapa organisme terdapat sistem yang dapat memperbaiki kerusakan kromosom tersebut meskipun perbaikan yang dilakukan sering mengakibatkan delesi. yang biasanya bersifat letal. Mutasi penekan dapat terjadi di suatu tempat di dalam gen yang sama dengan mutasi pertama yang ditekannya. mutasi dapat juga berlangsung dari bentuk mutan ke bentuk normal. tidak semua sel tumor mengalami mitosis pada waktu yang sama. Akan tetapi. dan perubahan basa nukleotida. Pada Drosophila tidak terdapat ambang bawah dosis pemaparan yang yang tidak menyebabkan mutasi. seperti telah disinggung pada Bab X. Sebagai contoh dapat dikemukakan penekanan mutasi enzim triptofan sintetase pada E. Mutasi Balik dan Mutasi Penekan Kebanyakan mutasi yang telah kita bicarakan hingga saat ini adalah perubahan dari bentuk alami atau normal ke bentuk mutan. Oleh karena itu. terjadi penekanan intragenik. tidak dapat sepenuhnya memulihkan mutan ke fenotipe normalnya seperti yang akan diuraikan di bawah ini. Akan tetapi. Mekanisme mutasi balik berupa mutasi penekan jauh lebih umum dijumpai daripada mekanisme yang pertama. Jika asam amino glisin ini berubah menjadi asam glutamat. Namun. kerusakan pada kedua untai. Penekanan intragenik Pada garis besarnya ada dua macam cara penekanan intragenik. iradiasi biasanya dilakukan dengan selang waktu beberapa hari agar sel-sel tumor yang semula sedang beristirahat kemudian melakukan mitosis. atau sering dikatakan sebagai mutasi ke depan (forward mutation). inversi. dan translokasi. coli. baik intra. Pada cara yang kedua tidak terjadi adisi dan delesi pada urutan basa.maupun intergenik. yaitu (1) perubahan urutan basa pada DNA mutan sehingga benar-benar pulih seperti urutan basa pada fenotipe normalnya dan (2) terjadinya mutasi kedua di suatu tempat lainnya di dalam genom yang mengimbangi atau menekan pengaruh mutasi pertama sehingga mutasi yang kedua tersebut sering disebut sebagai mutasi penekan (suppressor mutation). duplikasi. Artinya. Radiasi pengion banyak digunakan dalam terapi tumor. betapapun rendahnya dosis radiasi. Jika bagian yang tidak dapat dipulihkan bukan merupakan urutan yang esensial. mutasi penekan dapat juga terjadi di dalam gen yang lain atau bahkan di dalam kromosom yang lain sehingga peristiwanya dinamakan penekanan intergenik. Pada strain normal asam amino yang ke-210 adalah glisin. tetapi perubahan suatu asam amino yang mengakibatkan hilangnya aktivitas protein akan diimbangi oleh perubahan asam amino lainnya yang memulihkan aktivitas protein tersebut. Dengan perkataan lain. maka enzim triptofan sintetase menjadi tidak aktif. maka pembacaan rangka baca akan menghasilkan fenotipe normal. yang disandi oleh gen trpA pada. mutasi akan tetap terinduksi. Oleh karena tumor mengandung banyak sekali sel yang mengalami mitosis sementara jaringan normal tidak. Namun.

Substitusi ini dapat terjadi dengan empat macam cara. mutasi penekan diberi lambang sup diikuti dengan angka (atau kadang-kadang huruf) yang membedakan penekan yang satu dengan penekan lainnya. Beberapa di antaranya dikenal potensial sebagai mutagen. Pemulihan terjadi karena asam aspartat digantikan oleh alanin (tidak bermuatan). Sebagai contoh. asam amino normal yang ke-174 adalah tirosin. perubahan glisin menjadi asam glutamat akan ditekan pengaruhnya oleh perubahan tirosin menjadi sistein. Akibatnya. Antikodon pada molekul tRNA normal yang membawa triptofan adalah AAC. Apabila tirosin berubah menjadi sistein. Pada notasi konvensional. kebanyakan karsinogen juga merupakan mutagen. Penekanan intergenik Penekanan intergenik yang paling umum dijumpai adalah penekanan oleh suatu produk mutasi gen terhadap pengaruh mutasi yang ditimbulkan oleh sejumlah gen lainnya. (2) mutasi pada tRNA yang mengubah sebuah basa di dekat antikodon sehingga tRNA dapat mengenali dua kodon yang berbeda. (3) mutasi di luar kala (loop) antikodon yang memungkinkan aminoasil sintetase mengenali tRNA sehingga terjadi asilasi yang menyebabkan tRNA ini membawa asam amino yang lain. coli yang dapat menekan mutan-mutan fag T4 tertentu. Sementara itu. Selain itu. jika perubahan tirosin menjadi sistein terjadi terlebih dahulu. salah satu kodon untuk tirosin. Dengan tRNA mutan. Sel yang tidak mempunyai penekan dilambangkan dengan sup0.tidak menyebabkan inaktivasi enzim secara langsung karena glisin tidak terletak pada tapak aktif. yang interaksinya dengan asam amino ke-210 menentukan aktivitas enzim. kodon UAG yang seharusnya merupakan kodon stop berubah menjadi kodon yang menyandi triptofan. Penekanan mutasi salah makna oleh mutasi penekan intergenik antara lain dapat dilihat contohnya pada pemulihan aktivitas protein yang hilang akibat perubahan valin (tidak bermuatan) menjadi asam aspartat (bermuatan negatif). Namun. Mutasi penekan intergenik dapat memulihkan baik mutasi tanpa makna (nonsense) maupun mutasi salah makna (missense). Mutasi ini dapat ditekan oleh molekul tRNA mutan yang membawa triptofan dengan antikodon AUC. Pengaruh yang ditimbulkannya adalah mengubah kekhususan pengenalan kodon pada mRNA oleh antikodon pada tRNA. Begitu pula sebaliknya. maka pengaruhnya akan ditekan oleh perubahan glisin menjadi asam glutamat. Dengan demikian. Contoh yang paling dikenal dapat dilihat pada gen-gen penyandi tRNA. dan (4) mutasi aminoasil sintetase yang kadang-kadang salah mengasilasi tRNA. Mutasi semacam itu pertama kali ditemukan pada strain-strain E. atau dengan perkataan lain. Jadi. Strain yang mengalami mutasi penekan ini ternyata juga dapat menekan mutasi pada sejumlah gen yang terdapat pada genom bakteri sendiri. terminasi dapat dibatalkan. uji mutagenesis terhadap bahan-bahan kimia . Mutasi balik sebagai cara untuk mendeteksi mutagen dan karsinogen Dewasa ini terjadi peningkatan jumlah dan macam bahan kimia yang mencemari lingkungan. yaitu (1) mutasi antikodon yang memungkinkan tRNA untuk mengenali kodon yang berbeda seperti halnya yang terjadi pada pemulihan mutasi tanpa makna. mutasi tRNA telah memulihkan mutasi tanpa makna. Mutan-mutan ini gagal untuk membentuk plak (lihat Bab XII) pada strain bakteri standar tetapi dapat membentuk plak pada strain yang mengalami mutasi penekan. perubahan ini mengakibatkan perubahan struktur pelipatan enzim sehingga secara tidak langsung akan mempengaruhi tapak aktifnya. Oleh karena itu. Penekanan mutasi tanpa makna disebabkan oleh mutasi gen penyandi tRNA sehingga terjadi perubahan antikodon pada tRNA yang memungkinkannya untuk mengenali kodon stop hasil mutasi. maka struktur pelipatan enzim yang telah berubah karena glisin digantikan oleh asam glutamat justru akan dipulihkan oleh interaksi sistein dengan asam glutamat. yakni UAC dapat berubah menjadi kodon stop UAG. aktivitas enzim pun dapat dipulihkan.

Analisis kuantitatif terhadap frekuensi mutasi balik dapat dilakukan juga dengan membuat variasi jumlah mutagen potensial tersebut di dalam medium. Di samping itu. Enzim-enzim tersebut terdapat di dalam komponen sel-sel hati yang dinamakan fraksi mikrosomal. pewarna rambut. diikuti dengan penaburan (plating) suatu mutan bakteri dalam jumlah tertentu. Pemberian fraksi mikrosomal yang berasal dari hati tikus ke dalam medium pertumbuhan bakteri memungkinkan dilakukannya deteksi mutagenisitas. Mutan-mutan Hismembawa baik mutasi tautomerik maupun mutasi rangka baca. Bukti terakhir tentang karsinogenisitas suatu bahan kimia ditentukan atas dasar hasil uji pembentukan tumor pada hewan-hewan percobaan. Banyaknya koloni revertan (fenotipe normal hasil mutasi balik) yang muncul dihitung. uji Ames sebenarnya hanya berperan dalam mengurangi jumlah bahan kimia yang harus diuji menggunakan hewan percobaan. cara seperti tersebut di atas tidak dapat digunakan untuk memperlihatkan mutagenesis sejumlah besar karsinogen yang potensial. Perlakuan ini mendasari teknik pemeriksaan karsinogen menggunakan metode yang dinamakan uji Ames. Akan tetapi. Cara yang paling sederhana untuk melihat mutagenesis suatu bahan kimia adalah uji mutasi balik menggunakan mutan nutrisional pada bakteri. Peningkatan frekuensi revertan yang tajam apabila dibandingkan dengan frekuensi yang diperoleh di dalam medium tanpa senyawa kimia yang dicurigai tersebut mengindikasikan bahwa senyawa yang diuji adalah mutagen. dan kosmetika. tetapi harus melalui beberapa reaksi enzimatik terlebih dahulu sebelum menjadi mutagen. Hal ini karena banyak sekali senyawa kimia yang tidak langsung bersifat mutagenik / karsinogenik. Fungsi normal enzim-enzim itu adalah melindungi organisme dari berbagai bahan beracun dengan cara mengubahnya menjadi bahan yang tidak beracun. Fraksi mikrosomal dari hati tikus disebarkan ke permukaan medium. diikuti dengan penaburan bakteri. Apabila bahan kimia yang diuji adalah mutagen atau diubah menjadi mutagen. Senyawa yang dicurigai potensial sebagai mutagen ditambahkan ke dalam medium padat. Ke dalam medium tersebut kemudian ditambahkan mutagen potensial yang akan diuji. tetapi setidak-tidaknya memperlihatkan adanya peluang seperti itu. Frekuensi mutasi balik yang tinggi tidak serta-merta berarti bahwa senyawa yang diuji adalah karsinogen. 11/03/2009 Posted by zaifbio | Genetika Dasar | 8 Komentar . Di dalam uji Ames mutan-mutan bakteri Salmonella typhimurium yang memerlukan pemberian histidin eksternal atau disebut dengan mutan His. maka mereka akan mengubah bahan tersebut dari sifatnya yang semula tidak mutagenik menjadi mutagenik. dan pada karsinogen tertentu juga nampak adanya korelasi dengan efektivitasnya pada hewan. maka medium pertumbuhan yang digunakan harus mengandung histidin dalam jumlah yang cukup untuk mendukung beberapa putaran replikasi tetapi tidak cukup untuk memungkinkan terbentuknya koloni yang dapat dilihat. Frekuensi mutasi balik ternyata bergantung kepada konsentrasi bahan kimia yang diuji. Meskipun demikian.semacam ini perlu dilakukan. Jadi. maka koloni bakteri akan terbentuk. strain-strain bakteri tersebut dibuat menjadi lebih sensitif terhadap mutagenesis dengan menggabungkan beberapa alel mutan yang dapat menginaktifkan sistem perbaikan eksisi dan menjadikannya lebih permiabel terhadap molekul-molekul asing. Reaksireaksi enzimatik tersebut terjadi di dalam organ hati hewan dan tidak ada kesepadanannya di dalam sel bakteri. Akibat dilakukannya uji Ames. ketika enzim-enzim itu bertemu dengan bahan kimia tertentu. pestisida. banyak industri terpaksa mereformulasi produk-produknya. Uji Ames saat ini telah banyak digunakan pada beribu-ribu senyawa seperti pengawet makanan.digunakan untuk menguji mutagenisitas senyawa kimia atas dasar mutasi baliknya menjadi His+. Oleh karena beberapa mutagen hanya bekerja pada DNA yang sedang melakukan replikasi.

Dengan demikian. sedangkan penerjemahan urutan basa RNA menjadi urutan asam amino suatu protein dinamakan translasi. Setiap protein tersusun dari sejumlah asam amino dengan urutan tertentu. DNA harus mampu mengatur pertumbuhan dan diferensiasi individu organisme sehingga dihasilkan suatu fenotipe tertentu. Rangkaian proses ini. proses tanskripsi dan translasi dapat dilihat sebagai tahaptahap ekspresi urutan basa DNA. Diagram dogma sentral genetika molekuler Perubahan urutan basa di dalam molekul DNA menjadi urutan basa molekul RNA dinamakan transkripsi. DNA replikasi RNA transkripsi translasi asam amino Gambar 10.1. dikenal sebagai dogma sentral genetika molekuler. Fenotipe organisme sangat ditentukan oleh hasil interaksi protein-protein di dalam sel. mulai dari DNA hingga terbentuknya asam amino. tidak semua urutan basa DNA akan diekspresikan menjadi urutan asam amino. khususnya pada Prokariot Kode Genetik Mekanisme Pengaturan Ekspresi Gen pada Prokariot Mekanisme Pengaturan Ekspresi Gen pada Eukariot BAB X. . secara kimia gen adalah urutan basa nitrogen tertentu pada molekul DNA yang dapat dieskpresikan melalui tahap-tahap transkripsi dan translasi menjadi urutan asam amino tertentu. EKSPRESI GEN Pada Bab IX telah disebutkan bahwa salah satu fungsi dasar yang harus dijalankan oleh DNA sebagai materi genetik adalah fungsi fenotipik. Urutan basa DNA yang pada akhirnya menyandi urutan asam amino disebut sebagai gen. dan setiap asam amino pembentukannya disandi (dikode) oleh urutan basa nitrogen di dalam molekul DNA. Artinya. Namun.EKSPRESI GEN BAB X EKSPRESI GEN         Dogma Sentral Genetika Molekuler Perkembangan Konsep tentang Gen Transkripsi Tiga Macam RNA Translasi. Jadi.

Mutan yang digunakan adalah mutan dengan hanya satu kelainan. Strain-strain mutan ini kemudian dianalisis lebih lanjut untuk mengetahui macam faktor pertumbuhan yang diperlukannya dengan cara melakukan variasi penambahannya ke dalam medium minimal. mutan yang hanya tumbuh pada medium minimal yang ditambah dengan tiamin adalah mutan yang mengalami mutasi pada gen untuk biosintesis tiamin. Beadle dan E. Polipeptida α merupakan produk gen trpA. konsep satu gen mutan – satu hambatan metabolisme bergeser menjadi satu gen – satu enzim. sebuah gula sederhana. setiap molekul protein sendiri dapat dilihat sebagai gabungan beberapa subunit yang dinamakan polipeptida. Garrod. Medium minimal adalah medium untuk pertumbuhan mikroorganisme yang hanya mengandung garam-garam anorganik. yaitu polipeptida α dan polipeptida β. W. muncul pertanyaan tentang hakekat sebuah gen : tiap gen menyandi satu protein ataukah tiap gen menyandi satu polipeptida ? Perkembangan konsep tentang gen dapat diikuti semenjak awal abad ke-20 ketika seorang dokter sekaligus ahli biokimia dari Inggris. mengajukan konsep satu gen mutan – satu hambatan metabolisme.Di atas telah kita katakan bahwa sejumlah asam amino dengan urutan (sekuens) tertentu akan menyusun sebuah molekul protein. Strain tipe liar. mampu tumbuh baik pada medium lengkap maupun pada medium minimal. sedangkan polipeptida β merupakan produk gen trpB. dan masing-masing polipeptida merupakan produk gen yang berbeda. Maka. dengan mengorelasikan hasil analisis genetik dengan hasil analisis biokimia terhadap strainstrain mutan Neurospora tersebut dapat diketahui bahwa tiap mutasi menyebabkan hilangnya satu aktivitas enzim. Dalam perkembangan berikutnya. misalnya alkaptonuria. sinarX atau sinar uv . Garrod mempelajari sejumlah penyakit metabolik bawaan pada manusia dan menyimpulkan bahwa setiap gangguan metabolisme bawaan yang menimbulkan penyakit tertentu. mempelajari mutasi gen pada jamur Neurospora crassa dengan menumbuhkan berbagai strain mutan hasil iradiasi menggunakan sinar X atau sinar ultraviolet pada medium lengkap dan medium minimal. disebabkan oleh satu gen mutan resesif.L. Dengan cara seperti ini Beadle dan Tatum memperlihatkan bahwa tiap mutasi menyebabkan kebutuhan akan pemberian satu macam faktor pertumbuhan. Sebagai contoh. dan satu macam vitamin. Sebagai contoh. Tatum. Namun. sebagai kontrol. setelah diketahui bahwa sebagian besar enzim tersusun dari beberapa polipetida. Mutan hasil silang balik dengan nisbah keturunan tipe liar : mutan = 1 : 1 dipastikan sebagai mutan dengan hanya satu kelainan (mutasi). Sir Archibald E. enzim triptofan sintetase pada Escherichia coli terdiri atas dua buah polipeptida. maka konsep terbaru tentang gen yang dianut hingga kini adalah satu gen – satu polipeptida. Selanjutnya. sedangkan strain mutan hanya mampu tumbuh pada medium lengkap. G. yang untuk mendapatkannya dilakukan silang balik dengan strain tipe liar. Sekitar 50 tahun kemudian dua orang peneliti. Oleh karena itu.

sitidin trifosfat (CTP). Adanya sumber basa nitrogen berupa nukleosida trifosfat.2. untai DNA pasangannya. Meskipun demikian. dan disebut sebagai pita antisens. Diagram percobaan yang memperlihatkan satu gen – satu enzim Transkripsi Tahap pertama ekspresi gen adalah transkripsi atau sintesis molekul RNA dari DNA (gen). sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA.trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. Adanya molekul cetakan berupa untai DNA. yaitu 1. 4. melainkan RNA polimerase. Jadi. dan uridin trifosfat (UTP). Gugus 3’. Sementara itu. Sintesis RNA mempunyai ciri-ciri kimiawi yang serupa dengan sintesis DNA. disebut sebagai pita sens. Reaksi ini jelas sama dengan reaksi polimerisasi DNA. yang mempunyai urutan basa sama dengan urutan basa RNA.spora seksual konidia tipe liar silang balik medium lengkap medium minimal riboflavin piridoksin tiamin asam pantotenat kholin asam folat asam nukleat niasin inositol Gambar 10. Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. Jadi. 2.OH pada suatu nukleotida bereaksi dengan gugus 5’. keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP). Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada . 3. Hanya saja enzim yang bekerja bukannya DNA polimerase. Sintesis berlangsung dengan arah 5’→ 3’ seperti halnya arah sintesis DNA. guanosin trifosfat (GTP). Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA hasil transkripsinya. Bedanya dengan sumber basa untuk DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi tetapi digantikan oleh urasil.

1. Tahap-tahap transkripsi Transkripsi berlangsung dalam empat tahap. Kekuatan pengikatan RNA polimerase oleh promoter yang berbeda sangat bervariasi. promoter selalu membawa suatu urutan basa yang tetap atau hampir tetap sehingga urutan ini dikatakan sebagai urutan konsensus. Masing-masing akan dijelaskan sebagai berikut. yang dinamakan tempat awal polimerisasi. Urutan konsensus akan menunjukkan kepada RNA polimerase tempat dimulainya sintesis. Setelah mengalami pengikatan oleh promoter. segera terlepas dari untai DNA cetakan begitu enzim tersebut mencapai urutan basa pengakhir (terminasi). RNA polimerase akan terikat pada suatu tempat di dekat daerah promoter. Daerah ini dinamakan promoter. inisiasi. yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). elongasi. Enzim RNA polimerase mengikat untai DNA cetakan pada suatu daerah yang mempunyai urutan basa tertentu sepanjang 20 hingga 200 basa. dan juga enzim RNA polimerase. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu. Molekul RNA yang baru saja selesai disintesis. Terminasi dapat terjadi oleh dua macam sebab.3. dan teminasi. maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 10.kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. Di antara keduanya terminasi diri lebih umum dijumpai. Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. sedangkan pada eukariot urutan konsensusnya adalah TATAAAT dan disebut kotak TATA. 4. Hal ini mengakibatkan perbedaan kekuatan ekspresi gen. Pada prokariot urutan konsensusnya adalah TATAAT dan disebut kotak Pribnow. urutan penyela 5’ ATTAAAGGCTCCTTTTGGAGCCTTTTTTTT T A A T T T C C G A G GA AA A C C T C G G A A AAA A AA 3’ 5’ 3’ DNA transkripsi . 3. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). Nukleosida trifosfat pertama akan diletakkan di tempat ini dan sintesis RNA pun segera dimulai. Selama sintesis RNA berlangsung RNA polimerase bergerak di sepanjang molekul DNA cetakan sambil menambahkan nukleotida demi nukleotida kepada untai RNA yang sedang diperpanjang. yaitu pengenalan promoter. Baik pada prokariot maupun eukariot. 2.

segmensegmen sisanya (disebut ekson) segera digabungkan menjadi mRNA. promoter dapat mengikat RNA polimerase yang lain. Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. Hanya saja.U U U C C U C G G A A 5’ A U U G G A G C C U U A U 3’ RNA U U U U U U Gambar 10.3 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. sedangkan ujung 3’ dimodifikasi dengan urutan poliadenosin (poli A) sepanjang lebih kurang 200 basa. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida. pada prokariot produk langsung transkripsi atau transkrip primernya adalah mRNA (akan dijelaskan di bawah). Prosesing RNA ini mencakup dua peristiwa. Pembuangan intron dan . Ujung 5’ dimodifikasi dengan penambahan guanosin dalam ikatan 5’-5’ yang tidak umum hingga terbentuk suatu gugus terminal yang dinamakan cap. panjang intron yang harus dibuang dapat mencapai 50% hingga 90% dari panjang transkrip primer. Setelah intron dibuang. Secara umum mekanisme transkripsi pada prokariot dan eukariot hampir sama. tetapi segmen yang mengandung ujung 5’ (gugus cap) tidak pernah dibuang. yaitu modifikasi kedua ujung transkrip primer dan pembuangan urutan basa pada transkrip primer yang tidak akan ditranslasi (disebut intron). sedangkan pada eukariot transkrip primernya harus mengalami prosesing RNA terlebih dahulu sebelum menjadi mRNA. Sementara itu.

penggabungan ekson menjadi molekul mRNA dinamakan penyatuan RNA atau RNA splicing. Macam-macam RNA Transkripsi DNA menghasilkan molekul RNA yang kemudian akan mengalami diferensiasi struktur sesuai dengan fungsinya masing-masing. Kita mengenal tiga macam RNA, yaitu 1. RNA duta atau messenger RNA (mRNA), yang mempunyai struktur linier kecuali bagian ujung terminasinya yang berbentuk batang dan kala (Gambar 10.3). Molekul mRNA membawa urutan basa yang sebagian di antaranya akan ditranslasi menjadi urutan asam amino. Urutan basa yang dinamakan urutan penyandi (coding sequences) ini dibaca tiga demi tiga. Artinya, tiap tiga basa akan menyandi pembentukan satu asam amino sehingga tiap tiga basa ini dinamakan triplet kodon. Daftar triplet kodon beserta asam amino yang disandinya dapat dilihat pada Tabel 10.1. Pada prokariot bagian mRNA yang tidak ditranslasi terletak di depan urutan penyandi (disebut pengarah atau leader) dan di antara dua urutan penyandi (disebut spacer sequences atau noncoding sequences). Sementara itu, pada eukariot di samping kedua bagian tadi ada juga bagian di dalam urutan penyandi yang tidak ditranslasi. Bagian inilah yang dinamakan intron seperti telah dijelaskan di atas. Molekul mRNA pada prokariot sering kali membawa sejumlah urutan penyandi bagi beberapa polipeptida yang berbeda. Molekul mRNA seperti ini dinamakan mRNA polisistronik. Dengan adanya mRNA polisistronik, sintesis beberapa protein yang masih terkait satu sama lain dapat diatur dengan lebih efisien karena hanya dibutuhkan satu sinyal. Pada eukariot hampir tidak pernah dijumpai mRNA polisistronik. 2. RNA pemindah atau transfer RNA (tRNA), yang strukturnya mengalami modifikasi hingga berbentuk seperti daun semanggi. Seperti halnya struktur ujung terminasi mRNA, struktur seperti daun semanggi ini terjadi karena adanya urutan palindrom yang diselingi oleh beberapa basa (Gambar 10.4). Pada salah satu kalanya, tRNA membawa tiga buah basa yang komplemeter dengan triplet kodon pada mRNA. Ketiga basa ini dinamakan antikodon. Sementara itu, pada ujung 3’-nya terdapat tempat pengikatan asam amino tertentu. Pengikatan yang membentuk molekul aminoasil-tRNA ini terjadi dengan bantuan enzim aminoasil-tRNA sintetase. Dalam hal ini gugus hidroksil (OH) pada ujung 3’ tRNA terikat sangat kuat dengan gugus karboksil (COOH) asam amino. Macam asam amino yang dibawa ditentukan oleh urutan basa pada antikodon. Jadi, ada beberapa macam aminoasil-tRNA sesuai dengan antikodon dan macam asam amino yang dibawanya. antikodon

5’

3’ (tempat pengikatan asam amino) Gambar 10.4. Diagram struktur tRNA

3. RNA ribosomal atau ribosomal RNA (rRNA), yang strukturnya merupakan bagian struktur ribosom. Lebih kurang separuh struktur kimia ribosom berupa rRNA dan separuh lainnya berupa protein. Molekul rRNA, dan juga tRNA, dapat dikatakan sebagai RNA struktural dan tidak ditranslasi menjadi asam amino/protein. Akan tetapi, mereka adalah bagian mesin sel yang menyintesis protein (lihat uraian tentang translasi di bawah ini). Translasi Bila dibandingkan dengan transkripsi, translasi merupakan proses yang lebih rumit karena melibatkan fungsi berbagai makromolekul. Oleh karena kebanyakan di antara makromolekul ini terdapat dalam jumlah besar di dalam sel, maka sistem translasi menjadi bagian utama mesin metabolisme pada tiap sel. Makromolekul yang harus berperan dalam proses translasi tersebut meliputi 1. Lebih dari 50 polipeptida serta 3 hingga 5 molekul RNA di dalam tiap ribosom 2. Sekurang-kurangnya 20 macam enzim aminoasil-tRNA sintetase yang akan mengaktifkan asam amino 3. Empat puluh hingga 60 molekul tRNA yang berbeda 4. Sedikitnya 9 protein terlarut yang terlibat dalam inisiasi, elongasi, dan terminasi polipeptida. Translasi, atau pada hakekatnya sintesis protein, berlangsung di dalam ribosom, suatu struktur organel yang banyak terdapat di dalam sitoplasma. Ribosom terdiri atas dua subunit, besar dan kecil, yang akan menyatu selama inisiasi translasi dan terpisah ketika translasi telah selesai. Ukuran ribosom sering dinyatakan atas dasar laju pengendapannya selama sentrifugasi sebagai satuan yang disebut satuan Svedberg (S). Pada kebanyakan prokariot ribosom mempunyai ukuran 70S, sedangkan pada eukariot biasanya sekitar 80S. Tiap ribosom mempunyai dua tempat pengikatan tRNA, yang masing-masing dinamakan tapak aminoasil (tapak A) dan tapak peptidil (tapak P). Molekul aminoasil-tRNA yang baru memasuki ribosom akan terikat di tapak A, sedangkan molekul tRNA yang membawa rantai polipeptida yang sedang diperpanjang terikat di tapak P. Gambaran penting sintesis protein adalah bahwa proses ini berlangsung dengan arah tertentu sebagai berikut. 1. Molekul mRNA ditranslasi dengan arah 5’→ 3’, tetapi tidak dari ujung 5’ hingga ujung 3’. 2. Polipeptida disintesis dari ujung amino ke ujung karboksil dengan menambahkan asam-asam amino satu demi satu ke ujung karboksil. Sebagai contoh, sintesis protein yang mempunyai urutan NH2-Met-Pro- . . . -Gly-Ser-COOH pasti dimulai dengan metionin dan diakhiri dengan serin. Mekanisme sintesis protein secara skema garis besar dapat dilihat pada Gambar 10.5. Sebuah molekul mRNA akan terikat pada permukaan ribosom yang kedua subunitnya telah bergabung. Pengikatan ini terjadi karena pada mRNA prokariot terdapat urutan basa tertentu yang disebut sebagai tempat pengikatan ribosom (ribosom binding site) atau urutan Shine-Dalgarno. Sementara itu, pada eukariot pengikatan ribosom dilakukan oleh ujung 5’ mRNA. Selanjutnya, berbagai aminoasil-tRNA akan berdatangan satu demi satu ke kompleks ribosom-mRNA ini dengan urutan sesuai dengan antikodon dan asam amino yang dibawanya.

Urutan ini ditentukan oleh urutan triplet kodon pada mRNA. Ikatan peptida terbentuk di antara asam-asam amino yang terangkai menjadi rantai polipeptida di tapak P ribosom. Penggabungan asam-asam amino terjadi karena gugus amino pada asam amino yang baru masuk berikatan dengan gugus karboksil pada asam amino yang terdapat pada rantai polipeptida yang sedang diperpanjang. Penjelasan tentang mekanisme sintesis protein yang lebih rinci disertai contoh, khususnya pada prokariot, akan diberikan di bawah ini. arah gerakan ribosom

ribosom AUC UAG ACC UGG

aa 5’

aa CUG GGG 3’ mRNA

GAC COOH aa tRNA aa NH2 aa NH2 COOH aminoasil-tRNA

ikatan peptida Gambar 10.5. Skema garis besar sintesis protein Inisiasi sintesis protein dilakukan oleh aminoasil-tRNA khusus, yaitu tRNA yang membawa metionin (dilambangkan sebagai metionil-tRNAiMet). Hal ini berarti bahwa sintesis semua polipeptida selalu dimulai dengan metionin. Khusus pada prokariot akan terjadi formilasi

misalnya penyandi serin. Translokasi memerlukan aktivitas faktor elongasi berupa enzim yang biasa dilambangkan dengan EF-G. dan IF-3. Pada prokariot translasi seringkali dimulai sebelum transkripsi berakhir. Dalam contoh ini triplet kodon yang bergeser dari tapak A ke P tersebut adalah triplet kodon untuk alanin. Selain itu. yaitu RF-1 dan RF-2. kedua subunit ribosom pun memisah. baik pada prokariot maupun eukariot.tRNAala. Sebagai contoh. Pemanjangan atau elongasi rantai polipeptida akan terus berlangsung hingga suatu tripet kodon yang menyandi terminasi memasuki tapak A. Kompleks translasi yang terdiri atas sebuah mRNA dan beberapa ribosom ini dinamakan poliribosom atau polisom. yang melibatkan (1) perpindahan f-met-ala. kompleks inisiasi bergabung dengan subunit besar ribosom (50S). Kompleks inisiasi pada prokariot terbentuk antara mRNA. tRNA di tapak P. Hal ini dimungkinkan terjadi karena tidak adanya dinding nukleus yang memisahkan antara transkripsi dan translasi. akan masuk ke tapak A dan proses seperti di atas hingga translokasi akan terulang kembali. misalnya alanil. tetapi molekul ini akan bereaksi dengan protein-protein tertentu yang berfungsi sebagai faktor inisiasi (IF-1. dan IF-3). Pada umumnya sebuah mRNA akan ditranslasi secara serempak oleh beberapa ribosom yang satu sama lain berjarak sekitar 90 basa di sepanjang molekul mRNA. dan subunit kecil ribosom (30S) dengan bantuan protein IF-1. Sebelum suatu rantai polipeptida selesai disintesis terlebih dahulu terjadi deformilisasi pada f-metionin menjadi metionin. Dengan berlangsungnya kedua proses tersebut secara bersamaan.tRNAala dari tapak A ke tapak P dan (2) pergeseran posisi mRNA pada ribosom sepanjang tiga basa sehingga triplet kodon yang semula berada di tapak A masuk ke tapak P. serta sebuah molekul GTP. Berpasangannya triplet kodon inisiasi pada mRNA dengan antikodon pada metionil-tRNAfMet di tapak P menentukan urutan triplet kodon dan aminoasil-tRNAfMet berikutnya yang akan masuk ke tapak A. metionil-tRNAfMet. ke tapak A memerlukan proteinprotein elongasi EF-Ts dan EF-Tu. Terminasi ditandai oleh terlepasnya mRNA. Reaksi ini menghasilkan dipeptida yang terdiri atas f-metionin dan alanin yang terikat pada tRNAala di tapak A. Triplet kodon berikutnya. Besarnya polisom sangat bervariasi dan berkorelasi dengan ukuran polipeptida yang akan disintesis. dan metionil-tRNAfMet terikat pada tapak P. Langkah berikutnya adalah translokasi. IF-2. Selain itu. suatu enzim yang terikat pada subunit ribosom 50S. Pada eukariot metionil-tRNAiMet tidak mengalami formilasi gugus amin. Pengikatan aminoasil-tRNAfMet berikutnya. Selanjutnya. terdapat pula metionil-tRNA yang metioninnya bukan merupakan asam amino awal (dilambangkan sebagai metionil-tRNAMet). .gugus amino pada metionil-tRNAiMet (dilambangkan sebagai metionil-tRNAfMet) yang mencegah terbentuknya ikatan peptida antara gugus amin tersebut dengan gugus karboksil asam amino pada ujung polipetida yang sedang diperpanjang sehingga asam amino awal pada polipeptida prokariot selalu berupa f-metionin. Pada terminasi diperlukan aktivitas dua protein yang berperan sebagai faktor pelepas atau releasing factors. Pembentukan ikatan peptida antara gugus karboksil pada metionil-tRNAfMet di tapak P dan gugus amino pada alanil-tRNAala di tapak A dikatalisis oleh enzim peptidil transferase. rantai hemoglobin yang tersusun dari sekitar 150 asam amino disintesis oleh polisom yang terdiri atas lima buah ribosom (pentaribosom). Pembentukan kompleks inisiasi ini diduga difasilitasi oleh perpasangan basa antara suatu urutan di dekat ujung 3’ rRNA berukuran 16S dan sebagian urutan pengarah (leader sequence) pada mRNA. IF-2. dan rantai polipeptida dari ribosom. Sesungguhnya setiap mRNA tidak hanya ditranslasi oleh sebuah ribosom.

tidak demikian halnya pada eukariot. faktor-faktor apa yang menentukan saat dan tempat translasi? Sayangnya. Kombinasi tiga basa akan menghasilkan 43 atau 64 triplet. Tabel 10. juga menjadi sangat efisien. seperti yang akan dijelaskan nanti. jelas tidak mungkin tiap asam amino disandi oleh satu basa. Begitu juga. Transkripsi terjadi di dalam nukleus. sedangkan translasi terjadi di sitoplasma (ribosom). yaitu bahwa mRNA hasil transkripsi (transkrip primer) pada eukariot memerlukan prosesing terlebih dahulu sebelum dapat ditranslasi. Kode genetik Penetapan triplet kodon pada mRNA sebagai pembawa informasi genetik atau kode genetik yang akan menyandi pembentukan suatu asam amino tertentu berawal dari pemikiran bahwa macam basa nitrogen jauh lebih sedikit daripada macam asam amino. Namun.ekspresi gen menjadi sangat cepat dan mekanisme nyala-padam (turn on-turn off) ekspresi gen. Oleh karena itu. Kita baru mengetahui bahwa transkripsi dan translasi pada eukariot jauh lebih rumit daripada proses yang ada pada prokariot. sedangkan asam amino ada 20 macam. Kode genetik Basa I (5’) Basa II U Phe Phe Leu Leu Leu Leu Leu Leu ILe Ile ILe Met Val Val Val Val C Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala A Tyr Tyr Stop Stop His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu G Cys Cys Stop Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly U C A G U C A G U C A G U C A G Basa III (3’) U C A G . Pertanyaan yang muncul adalah bagaimana mRNA hasil transkripsi dipindahkan dari nukleus ke sitoplasma. melebihi jumlah macam asam amino. satu macam asam amino dapat disandi oleh lebih dari satu macam triplet kodon. hingga kini kita belum dapat menjawab pertanyaan-pertanyaan tersebut dengan memuaskan. masih lebih sedikit daripada macam amino yang ada. kombinasi dua basa hanya akan menghasilkan 42 atau 16 macam duplet. Basa nitrogen pada mRNA hanya ada empat macam.1. Dalam hal ini. Salah satu di antaranya seperti telah kita bicarakan di atas.

Jika mutan (hasil mutasi) rangka baca yang diinduksi oleh proflavin ditumbuhkan pada medium yang mengandung proflavin. Begitu pula sebaliknya. Mutasi tersebut diinduksi oleh proflavin. Namun. sekali kita menggunakan tanda + untuk mutan adisi berarti strain + adalah mutan adisi. yaitu urutan pembacaan basa-basa nitrogen untuk diterjemahkan menjadi urutan asam amino tertentu. akan diperoleh beberapa fag tipe liar sehingga mutasi seolah-olah dapat dipulihkan atau terjadi mutasi balik (reverse mutation). Crick dan kawan-kawannya yang mempelajari mutasi pada lokus rIIB bakteriofag T4. maka mekanisme semacam itu kecil sekali kemungkinannya untuk terjadi dan dugaan tersebut nampaknya tidak benar. menghasilkan DNA yang kelebihan atau kekurangan satu pasangan basa.Keterangan : phe = fenilalanin leu = leusin ile = isoleusin met = metionin val = valin ser = serin pro = prolin thr = treonin ala = alanin tyr = tirosin his = histidin gln = glutamin asn = asparagin lys = lisin asp = asam aspartat glu = asam glutamat cys = sistein trp = triptofan arg = arginin gly = glisin AUG (kodon metionin) dapat menjadi kodon awal (start codon) stop = kodon stop (stop codon) Bukti bahwa kode genetik berupa triplet kodon diperoleh dari hasil penelitian F. karena mutasi bersifat acak. dan strain – tidak harus selalu mutan delesi.H. Hasil ini menunjukkan bahwa strain-strain mutan dapat dibagi menjadi dua kelompok. . Jika dua strain mutan T4 yang satu sama lain mengalami mutasi berbeda di dalam bagian protein rIIB disilangkan melalui infeksi campuran pada suatu inang. Crick dan kawan-kawannya menjelaskan bahwa mutasi balik disebabkan oleh hilangnya (delesi) satu pasangan basa lain yang letaknya tidak terlalu jauh dari pasangan basa yang menyisip (adisi). Mutasi yang disebabkan oleh perubahan rangka baca akibat kelebihan atau kekurangan pasangan basa disebut sebagai mutasi rangka baca (frameshift mutation) (lihat Bab XI). Akan tetapi. Rangka baca yang baru ini akan menghasilkan urutan asam amino yang masih sama fungsinya dengan urutan sebelum terjadi mutasi. Dalam hal ini. maka T4 tipe liar akan diperoleh sebagai hasil rekombinasi genetik antara kedua tempat mutasi yang berbeda itu. suatu molekul yang dapat menyisip di sela-sela pasangan basa nitrogen sehingga kesalahan replikasi DNA dapat terjadi sewaktu-waktu. strain + tidak harus selalu mutan adisi. Hal ini akan menyebabkan perubahan rangka baca (reading frame). Dengan perkataan lain. Namun.C. Pada awalnya mutasi balik diduga karena kelebihan pasangan basa dibuang dari rangka baca yang salah sehingga rangka baca tersebut telah diperbaiki menjadi seperti semula. mutasi balik terjadi karena efek mutasi awal akibat penambahan basa ditekan oleh mutasi kedua akibat pengurangan basa sehingga mutasi yang kedua ini disebut juga sebagai mutasi penekan (suppressor mutation). ketika kedua strain mutan rIIB yang disilangkan merupakan strain-strain yang diseleksi secara acak (tidak harus mengalami mutasi yang berbeda). yaitu strain + dan strain -. Perubahan ini dapat berpengaruh atau tidak berpengaruh terhadap fungsi proteinnya. ternyata tidak selalu diperoleh tipe liar. sekali kita gunakan tanda + untuk mutan delesi berarti strain + adalah mutan delesi. Protein rIIB pada T4 mempunyai bagian-bagian yang di dalamnya dapat terjadi perubahan urutan asam amino.

persilangan antara starin + dan – akan menyebabkan terjadinya mutasi penekan (adisi ditekan oleh delesi atau delesi ditekan oleh adisi) atau hanya menghasilkan mutasi pada urutan asam amino yang tidak berpengaruh terhadap fungsi protein sehingga diperoleh fenotipe tipe liar.6. . . . . CCC UAG met phe pro lys gly phe pro stop mRNA tipe liar penambahan pasangan basa A=T (mutasi rangka baca I) AUG AUU UCC CAA AGG GUU U . Sementara itu. . . Seandainya. . kode genetik berupa duplet. . sedangkan persilangan antara sesama + atau sesama – tidak pernah menghasilkan tipe liar. rekombinasi antara tiga + atau tiga – akan menghasilkan tipe liar. kode genetik jelas tidak mungkin terdiri atas dua basa. . mRNA mutan met ile ser gln arg val leu pengurangan pasangan basa G = G(mutasi rangka baca II) AUG AUU UCC AAA GGG UUU . AUG UUU CCC AAA GGG UUU . . CCC UAG met ile ser lys gly phe pro stop mRNA ‘tipe liar’ urutan asam urutan asam amino tipe liar amino yang berubah Gambar 10.Persilangan antara strain + dan strain – hanya menghasilkan rekombinasi berupa fenotipe tipe liar. Namun. . . maka akan terjadi pemulihan rangka baca hasil persilangan tersebut. Mutasi penekan yang memulihkan rangka baca Oleh karena persilangan sesama + atau sesama – tidak pernah menghasilkan tipe liar. . Apabila kode genetik berupa triplet. . maka persilangan teoretis sesama + atau sesama – akan menghasilkan fenotipe mutan. Pemulihan rangka baca akibat mutasi penekan justru terjadi apabila persilangan dilakukan antara strain + dan strain -. . Hal ini memperlihatkan bahwa kode genetik terdiri atas tiga basa. CCU AG . Hal ini karena persilangan sesama + atau sesama – akan menyebabkan adisi atau delesi ganda sehingga selalu menghasilkan fenotipe mutan. sesuai dengan hasil kenyataannya. Kenyataannya tidak demikian. . .

urutan yang bila berubah tidak berpengaruh urutan yang bila berubah berpengaruh tipe liar AB CD EF GH IJ KL protein tipe liar +1 AB C1 DE FG HI JK +2 AB CD E2 FG HI JK -1 AB DE FG HI JK LM -2 AB CD FG HI JK LM +1 x +2 AB C1 DE 2F GH IJ KL liar -1 x -2 AB CD EF GH IJ KL liar +1 x -1 AB C1 DE FG HI JK mutan MN OP QR ST UV WX LM NO PQ RS TU VW X protein mutan LM NO PQ RS TU VW X protein mutan NO PQ RS TU VW X NO PQ RS TU VW X MN OP QR ST UV WX protein mutan protein mutan protein tipe MN OP QR ST UV WX protein tipe LM NO PQ RS TU VW X protein a) urutan yang bila berubah tidak berpengaruh urutan yang bila berubah berpengaruh tipe liar ABC DEF GHI JKL protein tipe liar +1 AB1 CDE FGH IJK +2 ABC DE2 FGH IJK +3 ABC DEF GHI J3K +1 x +2 AB1 CDE 2FG HIJ mutan +1 x +2 x +3 AB1 protein tipe liar CDE 2FG HIJ 3KL MNO PQR STU VWX LMN OPQ RST UVW X LMN OPQ RST UVW X LMN OPQ RST UVW X protein mutan protein mutan protein mutan protein KLM NOP QRS TUV WX MNO PQR STU VWX .

Oleh karena tiap kodon terdiri atas tiga buah basa. suatu segmen DNA dapat terdiri atas lebih dari sebuah gen yang saling tumpang tindih (overlapping). yang ternyata dapat berpasangan dengan basa A. tRNA. satu antikodon pada tRNA dapat mengenali lebih dari satu macam kodon pada mRNA. dan urutan basa yang diekspresikan (gen) dapat tumpang tindih satu sama lain. Gen-gen yang menyandi . jelaslah bahwa dari urutan basa DNA yang ada tidak hanya digunakan sebuah rangka baca. Sebagai contoh. dan enzim-enzim yang mengatalisis berbagai reaksi metabolisme yang berkaitan dengan fungsi pemeliharaan sel merupakan komponen esensial bagi semua sel. atau berarti juga DNA. maka akan terdapat sekitar 1700 asam amino yang dapat disintesis. Kode genetik bersifat degenerate atau redundant. ACA. Kode genetik bersifat universal. Sifat-sifat kode genetik Kode genetik mempunyai sifat-sifat yang akan dijelaskan sebagai berikut. atau pun C. Dengan demikian. Sebagai contoh. kode genetik berlaku sama hampir di setiap spesies organisme. hasil persilangan teoretis tidak sesuai dengan kenyataan yang diperoleh. RNA polimerase. hasil persilangan teoretis sesuai dengan kenyataan yang diperoleh.b) Gambar 10. Artinya. Pengaturan Ekspresi Gen Produk-produk gen tertentu seperti protein ribosomal. yang artinya bahwa basa ketiga dapat berubah-ubah tanpa selalu disertai perubahan macam asam amino yang disandinya. dan ACG. U. b) Jika kode genetik berupa triplet. Padahal kenyataannya. yaitu bahwa satu macam asam amino dapat disandi oleh lebih dari satu triplet kodon. Di samping itu. di dalam suatu segmen tertentu pada DNA dapat terjadi transkripsi dan translasi urutan basa dengan panjang yang berbeda. rRNA.7. Kemudian. Dengan perkataan lain. maka dari sekitar 1700 asam amino tersebut hanya akan terbentuk 4 hingga 5 buah molekul protein. Dengan demikian. 1. 2. bakteriofag фX174 mempunyai 11 protein yang secara keseluruhan terdiri atas 2300 asam amino. treonin dapat disandi oleh ACU. 3. jika sebuah molekul protein rata-rata tersusun dari 400 asam amino. maka tiap urutan basa mRNA. ACC. Sifat ini erat kaitannya dengan sifat wobble basa ketiga. Diketahuinya sifat wobble bermula dari penemuan basa inosin (I) sebagai basa pertama pada antikodon tRNAala ragi. Diagram persilangan mutan rIIB pada T4 yang memperlihatkan bahwa kode genetik berupa triplet kodon a) Jika kode genetik berupa duplet. mempunyai tiga rangka baca yang berbeda (open reading frame). Seandainya dari urutan basa ini hanya digunakan sebuah rangka baca. bakteriofag фX174 mempunyai sebuah untai tunggal DNA yang panjangnya lebih kurang hanya 5000 basa.

Proses yang terjadi ketika ekspresi gen merupakan respon terhadap keberadaan suatu zat di lingkungannya dikenal sebagai induksi. yaitu (1) mekanisme yang melibatkan penyalapadaman (turn on and turn off) ekspresi gen sebagai respon terhadap perubahan kondisi lingkungan dan (2) sirkit ekspresi gen yang telah terprogram (preprogramed circuits). banyak pula gen lainnya yang ekspresinya sangat ditentukan oleh kondisi lingkungan sehingga mereka hanya akan diekspresikan pada waktu dan di dalam jenis sel tertentu. maka gen-gen tersebut tidak diekspresikan (turned off). Mekanisme pengaturan transkripsi. Induksi secara molekuler terjadi pada tingkat transkripsi. Peristiwa ini berkenaan dengan laju sintesis enzim. Mekanisme penyalapadaman sangat penting bagi mikroorganisme untuk menyesuaikan diri terhadap perubahan lingkungan yang seringkali terjadi secara tiba-tiba. sejumlah data hasil penelitian menunjukkan bahwa pengaturan ekspresi gen. produk suatu gen akan menekan transkripsi gen itu sendiri dan sekaligus memacu transkripsi gen kedua. Pada pengaktifan enzim suatu molekul kecil akan terikat pada enzim sehingga akan terjadi peningkatan aktivitas enzim tersebut. Salmonella typhimurium mempunyai sejumlah gen yang menyandi enzim-enzim untuk biosintesis triptofan. atau translasi. Bakteri ini secara alami hidup di dalam usus besar manusia dengan memanfaatkan sumber karbon yang umumnya berupa glukosa. dalam contoh ini laktosa merupakan induser. Pada mekanisme sirkit. bagi eukariot mekanisme ini nampaknya tidak terlalu penting karena pada organisme ini sel justru cenderung merespon sinyal-sinyal yang datang dari dalam tubuh. coli ditumbuhkan pada medium yang sumber karbonnya bukan glukosa melainkan laktosa. Selain mempunyai kemampuan untuk memecah suatu molekul (katabolisme). dan di sisi lain. Sebagai contoh. Namun. misalnya transkripsi. Induksi dan represi pada prokariot Escherichia coli merupakan bakteri yang sering dijadikan model untuk mempelajari berbagai mekanisme genetika molekuler. Jadi.pembentukan produk semacam itu perlu diekspresikan terus-menerus sepanjang umur individu di hampir semua jenis sel tanpa bergantung kepada kondisi lingkungan di sekitarnya. Pengaturan ekspresi gen dapat terjadi pada berbagai tahap. bukan peningkatan laju sintesisnya. Ekspresi gen yang berurutan ini telah terprogram secara genetik sehingga gen-gen tersebut tidak akan dapat diekspresikan di luar urutan. demikian seterusnya. yaitu ketika tersedia glukosa sebagai sumber karbon. maka enzim pemecah laktosa akan disintesis. maka mekanisme tersebut dinamakan sirkit ekspresi gen. bukan dengan aktivitas enzim. khususnya pada prokariot. baik pada prokariot maupun pada eukariot. sistem sirkulasi akan menjadi penyangga bagi sel terhadap perubahan kondisi lingkungan yang mendadak tersebut. produk gen kedua akan menekan transkripsi gen kedua dan memacu transkripsi gen ketiga. sedangkan zat atau molekul yang menyebabkan terjadinya induksi disebut sebagai induser. Apabila suatu ketika E. Oleh karena urutan ekspresinya berupa sirkit. Sebaliknya. Sementara itu. bakteri juga dapat menyintesis (anabolisme) berbagai molekul organik yang diperlukan bagi pertumbuhannya. sesuatu yang tidak biasa dilakukannya. gen-gen penyandi berbagai enzim yang terlibat dalam pemanfaatan laktosa akan diekspresikan (turned on). Untuk itu. prosesing mRNA. dalam keadaan normal. Untuk gen-gen semacam ini harus ada mekanisme pengaturan ekspresinya. secara garis besar dapat dibedakan menjadi dua kategori utama. Sebaliknya. paling banyak terjadi pada tahap transkripsi. Dalam medium pertumbuhan yang tidak .

maka gen-gen tersebut tidak perlu diekspresikan (turned off). Akan tetapi. molekul protein represor yang dihasilkan oleh gen regulator. operator (O). Menurut model yang dikenal sebagai operon ini ada dua unsur yang mengatur transkripsi gen struktural penyandi enzim. Jadi. represi juga terjadi pada tahap transkripsi. dalam contoh ini triptofan merupakan korepresor. yaitu gen regulator (gen represor) dan operator yang letaknya berdekatan dengan gen-gen struktural yang diaturnya. dan molekul efektor. yaitu penghambatan aktivitas enzim akibat pengikatan produk akhir reaksi yang dikatalisis oleh enzim itu sendiri.mengandung triptofan. Secara keseluruhan setiap operon terdiri atas promoter operon atau promoter bagi gen-gen struktural (PO). atau bahkan tumpang tindih. dengan operator. operon PR R PO O GS1 GS2 GS3 represor a) efektor (induser atau korepresor) RNA polimerase induser RNA polimerase berjalan . typhimurium akan mengekspresikan (turned on) gen-gen tersebut. Represi tidak menghambat aktivitas enzim. Represi sering dikacaukan dengan inhibisi umpan balik (feedback inhibition). Model operon Mekanisme molekuler induksi dan represi telah dapat dijelaskan menurut model yang diajukan oleh F. Monod pada tahun 1961. dan gen-gen struktural (GS). Jacob dan J. Hal ini terjadi karena enzim RNA polimerase tidak dapat memasuki promoter yang letaknya berdekatan. S. Proses pemadaman (turn off) ekspresi gen sebagai respon terhadap keberadaan suatu zat di lingkungannya dinamakan represi. menyebabkan terhalangnya transkripsi gen-gen struktural. tetapi menekan laju sintesisnya. Molekul efektor pada induksi adalah induser. Seperti halnya induksi. sedangkan zat yang menyebabkan terjadinya represi disebut sebagai korepresor. Gen regulator menyandi pembentukan suatu protein yang dinamakan represor. sedangkan pada represi adalah korepresor. Di luar operon terdapat gen regulator (R) beserta promoternya (PR). Pada kondisi tertentu represor akan berikatan dengan operator. jika suatu saat ke dalam medium pertumbuhannya ditambahkan triptofan.

Salah satu contohnya adalah operon lac. gen-gen struktural akan diekspresikan apabila terdapat molekul induser yang mengikat represor. Operon yang terdiri atas gen-gen yang ekspresinya terinduksi dinamakan operon induksi. RNA polimerase tidak dapat memasuki promoter operon sehingga transkripsi gen-gen struktural menjadi terhalang. Sebaliknya. Dengan demikian. transkripsi gen-gen struktural tidak dapat berlangsung. Jadi. Dengan pengikatan ini. pada represi secara normal represor tidak berikatan dengan operator sehingga RNA polimerase dapat memasuki promoter operon dan transkripsi gen-gen struktural dapat terjadi.8 terlihat bahwa terikatnya represor pada operator terjadi dalam keadaan yang berkebalikan antara induksi dan represi.transkripsi kompleks represor-induser translasi b) RNA polimerase berjalan transkripsi korepresor translasi kompleks represor-korepresor c) Gambar 10.8. dengan adanya korepresor. akan terbentuk kompleks represor-korepresor yang kemudian berikatan dengan operator. ekspresi gen-gen struktural akan terepresi apabila terdapat molekul korepresor yang berikatan dengan represor. Akibatnya. yang terdiri atas gen-gen penyandi enzim pemecah laktosa seperti telah disebutkan di atas. Model operon untuk pengaturan ekspresi gen a) komponen operon b) induksi c) represi Pada Gambar 10. Pada induksi represor secara normal akan berikatan dengan operator sehingga RNA polimerase tidak dapat memasuki promoter operon. Akan tetapi. . promoter operon menjadi terbuka bagi RNA polimerase sehingga gengen struktural dapat ditranskripsi dan selanjutnya ditranslasi. dengan terikatnya represor oleh induser. Namun.

Operon. Selain itu. Bukti paling nyata mengenai adanya keharusan urutan pembacaan program pada waktu dan tempat tertentu dapat dilihat pada kasus mutasi yang terjadi pada lalat Drosophila. hormon. Hanya pada eukariot tingkat rendah seperti jamur dapat ditemukan satuan-satuan operon atau mirip operon. terindikasi juga bahwa diferensiasi sel sedikit banyak melibatkan ekspresi seperangkat gen yang telah terprogram (preprogramed). hanya ada dua hingga lima persen urutan DNA mencit yang akan terepresentasikan pada mRNA di dalam sel-sel hatinya. yang terdiri atas gen-gen penyandi enzim untuk biosintesis triptofan merupakan contoh operon represi. Beberapa produk gen dibutuhkan dalam jumlah yang jauh lebih besar daripada produk gen lainnya sehingga terdapat nisbah kebutuhan di antara produk-produk gen yang berbeda. ada gen A dan gen B yang ditranskripsi dan ditranslasi dengan efisiensi yang sama. . Untuk menyintesis histon dalam jumlah besar yang dibutuhkan dalam pembentukan kromatin. sebagian besar urutan basa DNA di dalam genom eukariot tingkat tinggi tidak terepresentasikan di antara populasi mRNA yang ada di dalam sel atau jaringan tertentu. Untuk memenuhi nisbah kebutuhan ini antara lain dapat ditempuh melalui dosis gen. mRNA di dalam selsel otak katak Xenopus hanya merepresentasikan delapan persen urutan DNAnya. Dengan mempelajari mutasi-mutasi semacam ini diharapkan akan diperoleh pengetahuan tentang mekanisme pengaturan ekspresi gen selama perkembangan normal individu. Dengan perkataan lain. Operon trp. Jadi. dan juga prosesing mRNA. yaitu hanya membawa urutan sebuah gen struktural. dan rangsangan dari lingkungan memicu dimulainya pembacaan program-program dengan urutan tertentu pada waktu dan tempat yang tepat selama perkembangan individu. Pada eukariot tingkat tinggi kurang dari 10 persen gen yang terdapat di dalam seluruh genom akan terepresentasikan urutan basanya di antara populasi mRNA yang telah mengalami prosesing. Contoh yang nyata dapat dilihat pada gen-gen penyandi histon. Transkrip primer yang adakalanya menyerupai polisistronik pun akan diproses menjadi mRNA yang monosistronik. Semua mRNA pada eukariot tingkat tinggi adalah monosistronik. Dosis gen dan amplifikasi gen Kebutuhan akan produk-produk gen pada eukariot dapat sangat bervariasi. molekul mRNA yang dihasilkan dari perangkat gen yang berbeda akan dijumpai di dalam sel atau jaringan yang berbeda pula. kalau pun ada. Pengaturan ekspresi gen pada eukariot Hingga sekarang kita baru sedikit sekali mengetahui mekanisme pengaturan ekspresi gen pada eukariot. misalnya munculnya sayap di kepala di tempat yang seharusnya untuk mata. Sebagai contoh. Berbagai macam sinyal seperti molekul-molekul sitoplasmik. kita telah mengetahui bahwa pada eukariot tingkat tinggi gen-gen yang berbeda akan ditranskripsi pada jenis sel yang berbeda. Produk gen A dapat 20 kali lebih banyak daripada produk gen B apabila terdapat 20 salinan (kopi) gen A untuk setiap salinan gen B. nampaknya tidak begitu penting pada eukariot. Hal ini menunjukkan bahwa mekanisme pengaturan pada tahap transkripsi. Katakanlah.Gen-gen yang ekspresinya dapat terepresi merupakan komponen operon yang dinamakan operon represi. memegang peran yang sangat penting dalam proses diferensiasi sel. Demikian pula. Namun.

Oleh karena itu. Salah satu regulator yang diketahui berperan dalam transkripsi eukariot adalah hormon. mRNA superprevalen biasanya dihasilkan sejalan dengan terjadinya perubahan di dalam suatu tahap perkembangan organisme eukariot. molekul protein kecil yang dibawa dari sel tertentu menuju ke sel target. Untuk itu dibutuhkan sejumlah besar ribosom. Jika sebelum amplifikasi ke-600 gen rRNA berada di dalam satu segmen DNA linier. penetrasi hormon ke dalam sel target dan pengangkutannya ke dalam nukleus merupakan proses yang jauh lebih rumit bila dibandingkan dengan induksi oleh laktosa pada E. molekul mRNA dapat dibagi menjadi tiga kelompok. Sebagai contoh. Mekanisme kerja hormon dalam mengatur transkripsi eukariot lebih kurang dapat disetarakan dengan induksi pada prokariot. Padahal. yang kemudian ditangkap oleh reseptor khusus yang terdapat di dalam sitoplasma sehingga terbentuk kompleks hormon-reseptor. Namun. sejalan dengan perkembangan oosit terjadi peningkatan jumlah gen rRNA hingga 4000 kali sehingga dari sebanyak 600 gen yang ada pada prekursor akan diperoleh sekitar dua juta gen setelah amplifikasi. coli.kebanyakan sel mempunyai beratus-ratus kali salinan gen histon daripada jumlah salinan gen yang diperlukan untuk replikasi DNA. Di sisi lain. Pembentukan oosit dari prekursornya (oogonium) merupakan proses kompleks yang membutuhkan sejumlah besar sintesis protein. hanya sedikit sekali atau bahkan tidak ada globin yang dihasilkan oleh sel-sel prekursor yang belum berkembang menjadi eritroblas. Sementara itu. yaitu peningkatan jumlah gen sebagai respon terhadap sinyal tertentu. Salah satu pengaruh dosis gen adalah amplifikasi gen. Molekul rRNA tidak diperlukan lagi ketika oosit telah matang hingga saat terjadinya fertilisasi. Dengan demikian. Jika waktu yang tersedia untuk melakukan sintesis sejumlah besar protein cukup banyak. Namun. Molekul mRNA salinan tunggal dan semiprevalen masing-masing menyandi enzim dan protein struktural. Pengaturan transkripsi Berdasarkan atas banyaknya salinan di dalam tiap sel. dan (3) mRNA superprevalen dengan jumlah salinan beberapa ratus hingga beberapa ribu per sel. Cara lain untuk mengatasi kebutuhan protein tersebut adalah dengan meningkatkan masa hidup mRNA (lihat bagian pengaturan translasi). maka selama dan setelah amplifikasi gen tersebut akan berada di dalam gulungan-gulungan kecil yang mengalami replikasi. gen rRNA yang telah begitu banyak disalin kemudian didegradasi kembali oleh berbagai enzim intrasel. sel-sel prekursor tidak mempunyai gen penyandi rRNA dalam jumlah yang mencukupi untuk sintesis molekul tersebut dalam waktu yang relatif singkat. sel-sel eritroblas di dalam sumsum tulang belakang mempunyai sejumlah besar mRNA yang dapat ditranslasi menjadi globin matang. Secara garis besar pengaturan transkripsi oleh hormon dimulai dengan masuknya hormon ke dalam sel target melewati membran sel. amplifikasi gen terjadi selama perkembangan oosit katak Xenopus laevis. Kita mengetahui bahwa ribosom antara lain terdiri atas molekulmolekul rRNA. amplifikasi gen sebenarnya tidak perlu dilakukan. Sebagai contoh. Setelah kompleks ini terbentuk biasanya reseptor akan mengalami modifikasi struktur kimia. (2) mRNA semiprevalen dengan jumlah salinan lebih dari satu hingga beberapa ratus per sel. yaitu (1) mRNA salinan tunggal (single copy). . kita dapat memastikan adanya suatu mekanisme pengaturan ekspresi gen penyandi mRNA superprevalen pada tahap transkripsi eukariot meskipun hingga kini belum terlalu banyak rincian prosesnya yang dapat diungkapkan.

dan (3) pengaturan laju seluruh sintesis protein. hal ini bukan akibat kurangnya pasokan mRNA. (4) inaktivasi represor. (2) pengikatan pada suatu protein efektor. dan (5) perubahan struktur kromatin agar DNA terbuka bagi enzim RNA polimerase. tetapi rupanya di dalam nukleus kompleks tersebut. Proses selanjutnya belum banyak diketahui. pada eukariot ada mekanisme pengaturan translasi. Namun. Dengan demikian.Kompleks hormon-reseptor yang termodifikasi kemudian menembus dinding nukleus untuk memasuki nukleus. Pengaturan pada tahap prosesing mRNA Dua jenis sel yang berbeda dapat membuat protein yang sama tetapi dalam jumlah yang berbeda meskipun transkripsi di dalam kedua sel tersebut terjadi pada gen yang sama. Hal ini karena sel-sel atau jaringan lainnya tidak mempunyai reseptor hormon estrogen di dalam sitoplasmanya. khususnya pada penyatuan (splicing) mRNA. sejumlah protein akan disintesis. Akan tetapi. yaitu (1) pengikatan langsung pada DNA. begitu fertilisasi terjadi. (2) pengaturan umur (lifetime) molekul mRNA. atau mungkin hormonnya saja. . Telur yang tidak dibuahi secara biologi bersifat statis. Pengaturan umur mRNA juga dijumpai pada telur yang belum dibuahi. tetapi kemudian ada perbedaan mekanisme prosesing. Macam-macam pengaturan tersebut adalah (1) kondisi bahwa mRNA tidak akan ditranslasi sama sekali sebelum datangnya suatu sinyal. Contoh induksi transkripsi oleh hormon antara lain dapat dilihat pada stimulasi sintesis ovalbumin pada saluran telur (oviduktus) ayam oleh hormon kelamin estrogen. melainkan karena terbatasnya ketersediaan suatu unsur yang dinamakan faktor rekrutmen. Kelenjar ludah menghasilkan α-amilase lebih banyak daripada yang dihasilkan oleh jaringan hati meskipun gen yang ditranskripsi sama. Sinyal tersebut tidak lain adalah fertilisasi oleh spermatozoon. (3) aktivasi protein yang terikat DNA. ditemukan bahwa perbedaan sintesis enzim α-amilase oleh berbagai mRNA yang berasal dari gen yang sama dapat terjadi karena adanya perbedaan pola pembuangan intron. dan hanya sel-sel oviduktus yang akan menyintesis mRNA tersebut. misalnya. Jadi. Sintesis ini akan terus berlanjut selama estrogen diberikan. yang akan ditranslasi dengan efisiensi berbeda pula. Fenomena ini seringkali berkaitan dengan adanya molekul-molekul mRNA yang berbeda. Sel telur ini akan mempertahankan diri untuk tidak mengalami pertumbuhan atau perkembangan. Hal ini menunjukkan bahwa di dalam sel telur yang belum dibuahi akan dijumpai sejumlah mRNA yang menantikan datangnya sinyal untuk translasi. sedangkan molekul mRNA yang belum ditranslasi itu dinamakan mRNA tersembunyi (masked mRNA). Pengaturan translasi Berbeda dengan translasi mRNA pada prokariot yang terjadi dalam jumlah yang lebih kurang sama. laju sintesis protein menjadi sangat rendah. akan mengalami salah satu di antara beberapa peristiwa. Hingga kini belum diketahui hakekat unsur tersebut. dalam hal ini transkrip primernya sebenarnya sama. jaringan-jaringan oviduktus akan memberikan respon berupa sintesis mRNA untuk ovalbumin. tetapi rupanya berperan dalam pembentukan kompleks ribosom-mRNA. Jika ayam disuntik dengan estrogen. Pada tikus.

Jadi. tetapi bergantian mengikuti suatu urutan. Sebagai contoh. J. waktu itu fungsinya sama sekali belum diketahui. tetapi ada kondisi yang dapat disetarakan dengannya.F. 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar MATERI GENETIK BAB IX MATERI GENETIK       Pembuktian DNA sebagai Materi Genetik Pembuktian RNA sebagai Materi Genetik pada Virus Tertentu Model Struktur Molekul DNA menurut Watson-Crick Tiga Fungsi Materi Genetik Replikasi Semi Konservatif Replikasi Θ dan Replikasi Lingkaran Menggulung BAB IX. pada eukariot tidak pernah dijumpai mRNA polisistronik. Zat ini diisolasi dari nukleus sel nanah manusia dan kemudian dikenal dengan nama nuklein atau asam nukleat.Sintesis beberapa protein tertentu diatur oleh aktivitas protein itu sendiri terhadap mRNA. konsentrasi suatu jenis molekul antibodi dipertahankan konstan oleh mekanisme inhibisi atau penghambatan diri dalam proses translasi. . Miescher. Meskipun ternyata asam nukleat selalu dapat diisolasi dari nukleus berbagai macam sel. tetapi dipisahkan oleh urutan asam amino tertentu yang dikenal sebagai tempat pemotongan (cleavage sites) oleh enzim protease tertentu. Sebaliknya. Tiap protein ini dapat dilihat sebagai produk satu gen tunggal. menemukan suatu zat kimia bersifat asam yang banyak mengandung nitrogen dan fosfor. MATERI GENETIK Pada tahun 1868 seorang mahasiswa kedokteran di Swedia. Dalam sistem semacam itu urutan penyandi pada masing-masing gen tidak saling dipisahkan oleh kodon stop dan kodon awal. Sintesis beberapa protein dari satu segmen DNA Pada prokariot terdapat mRNA polisistronik yang menyandi semua produk gen. molekul antibodi tersebut berikatan secara khusus dengan molekul mRNA yang menyandinya sehingga inisiasi translasi akan terhambat. Tempattempat pemotongan ini tidak akan berfungsi serempak. Poliprotein adalah polipeptida berukuran besar yang setelah berakhirnya translasi akan terpotong-potong untuk menghasilkan sejumlah molekul protein yang utuh. yakni sintesis poliprotein.

yang waktu itu telah diketahui sebagai organel pembawa gen (materi genetik). Meskipun demikian. mencit yang diinfeksi dengan strain S yang sebelumnya telah dipanaskan terlebih dahulu akan dapat bertahan hidup. pada pertengahan tahun 1940-an terbukti bahwa justru DNA-lah yang merupakan materi genetik pada sebagian besar organisme. Hasil yang mengundang pertanyaan adalah ketika mencit diinfeksi dengan campuran antara strain S yang telah dipanaskan dan strain R yang masih hidup. protein dengan variasi kimia yang tinggi sangat memenuhi syarat sebagai materi genetik. Masingmasing akan diuraikan berikut ini. sedangkan strain mutannya yang tidak virulen dilambangkan dengan R. sementara DNA hanya merupakan kerangka struktur kromosom. DNA atau protein. Demikian juga. DNA sebagai Materi Genetik Ada dua bukti percobaan yang menunjukkan bahwa DNA adalah materi genetik. Pada tahun 1924 studi mikroskopis menunjukkan bahwa DNA terdapat di dalam kromosom. Strain mutan ini akan membentuk koloni dengan kenampakan kasar apabila ditumbuhkan pada medium padat. selama bertahun-tahun protein lebih diyakini sebagai materi genetik. dan dari organ paru-parunya dapat diisolasi strain S tersebut. dan dari organ paru-parunya dapat diisolasi strain S yang masih hidup. Griffith pada tahun 1928 melakukan percobaan infeksi bakteri pneumokokus (Streptococcus pneumonia) pada mencit.Dari hasil analisis kimia yang dilakukan sekitar empat puluh tahun kemudian ditemukan bahwa asam nukleat ada dua macam. Bakteri penyebab penyakit pneumonia ini dapat menyintesis kapsul polisakarida yang akan melindunginya dari mekanisme pertahanan tubuh hewan yang terinfeksi sehingga bersifat virulen (menimbulkan penyakit). Akan tetapi. nukleus hasil meiosis baik pada tumbuhan maupun hewan mempunyai kandungan DNA separuh kandungan DNA di dalam nukleus sel somatisnya. Ternyata dengan perlakuan ini mencit mengalami kematian. selain DNA di dalam kromosom juga terdapat protein sehingga muncul perbedaan pendapat mengenai hakekat materi genetik. yaitu asam deoksiribonukleat atau deoxyribonucleic acid (DNA) dan asam ribonukleat atau ribonucleic acid (RNA). Percobaan transformasi F. Dugaan DNA sebagai materi genetik secara tidak langsung sebenarnya dapat dibuktikan dari kenyataan bahwa hampir semua sel somatis pada spesies tertentu mempunyai kandungan DNA yang selalu tetap. Di sisi lain. Namun. Hal ini terutama karena dari hasil analisis kimia secara kasar terlihat kurangnya variasi kimia pada molekul DNA. Sementara itu. Di samping itu. dalam kurun waktu yang cukup lama fakta semacam itu tidak cukup kuat untuk meyakinkan bahwa DNA adalah materi genetik. Mencit yang diinfeksi dengan pneumokokus S akan mengalami kematian. . mencit yang diinfeksi dengan strain R dapat bertahan hidup. Sebaliknya. dan akibatnya tidak bersifat virulen. Pneumokokus yang virulen sering dilambangkan dengan S. Jika ditumbuhkan pada medium padat. bakteri pneumokokus akan membentuk koloni dengan kenampakan halus mengkilap. sedangkan kandungan RNA dan proteinnya berbeda-beda antara satu sel dan sel yang lain. ada pula strain mutan pneumokokus yang kehilangan kemampuan untuk menyintesis kapsul polisakarida sehingga menjadi tidak tahan terhadap sistem kekebalan tubuh hewan inangnya. Oleh karena itu.

Akan tetapi. Transformasi terjadi karena ada sesuatu yang dipindahkan dari selsel strain S yang telah mati (dipanaskan) ke strain R yang masih hidup sehingga strain R yang semula tidak dapat membentuk kapsul berubah menjadi strain S yang dapat membentuk kapsul dan bersifat virulen. Mereka melakukan percobaan transformasi secara in vitro. McCarty melakukan percobaan untuk mengetahui hakekat materi yang dipindahkan dari strain S ke strain R.1. dan ternyata juga pada hampir semua organisme. strain R tidak berubah menjadi strain S. Jika pada percobaan Avery dan kawan-kawannya itu ditambahkan enzim RNase (pemecah RNA) atau enzim protease (pemecah protein). maka transformasi tidak terjadi. dan penambahan tersebut ternyata menyebabkan strain R berubah menjadi S seperti pada percobaan Griffith. Diagram percobaan transformasi yang membuktikan DNA sebagai materi genetik Percobaan infeksi bakteriofag . Di dalam ekstrak DNA ini terdapat juga sejumlah protein kontaminan. dan M. yaitu dengan menambahkan ekstrak DNA dari strain S yang telah mati kepada strain R yang ditumbuhkan di medium padat. adalah DNA. bukan RNA atau protein. kultur strain S ekstraksi DNA ekstrak DNA + protein kontaminan ditambahkan ke kultur strain R protease kultur strain R RNase kultur strain R DNase kultur strain R strain R + S strain R + S strain R Gambar 9. transformasi tetap berjalan atau strain R berubah juga menjadi S. Artinya. Hal ini jelas membuktikan bahwa materi yang bertanggung jawab atas terjadinya transformasi pada bakteri pneumonia. Percobaan Griffith sedikit pun tidak memberikan bukti tentang materi genetik. C. MacLeod. Namun. Avery.Dengan hasil tersebut Griffith menyimpulkan bahwa telah terjadi perubahan (transformasi) sifat strain R menjadi S. pada tahun 1944 tiga orang peneliti. jika enzim yang diberikan adalah DNase (pemecah DNA). yakni O.

cara berlangsungnya infeksi T2 pada E. sel-sel E. yaitu Escherichia coli. coli akan mengalami lisis. yang umumnya banyak mengandung sulfur tetapi tidak mengandung fosfor dilabeli dengan radioisotop 35S. sel E. Dengan sentrifugasi. Akhirnya. coli yang membuktikan DNA sebagai materi genetik didapatkan 32 P Bakteriofag T2 dengan protein yang telah dilabeli diinfeksikan pada E. coli telah diketahui (lihat Bab XII). RNA sebagai Materi Genetik pada Beberapa Virus . coli ditemukan banyak sekali radiosiotop 32P. bukannya protein. Sebaliknya. coli ini kemudian dipisahkan dari partikel-partikel T2 yang sudah tidak melekat lagi pada dinding selnya. materi genetik masuk dilabeli dengan 35S dan 32P ke sel inang banyak didapatkan 35 S sel inang lisis banyak Gambar 9. Bakteriofag T2 diketahui mempunyai kandungan protein dan DNA dalam jumlah yang lebih kurang sama. Percobaan dilakukan dengan mengamati reproduksi bakteriofag (virus yang menyerang bakteri) T2 di dalam sel bakteri inangnya. maka di dalam sel-sel E. diikuti oleh masuknya materi genetik T2 ke dalam sel E. coli sangat sedikit ditemukan radioisotop 35S. Chase. Apabila dengan cara yang sama digunakan bakteriofag T2 yang dilabeli DNAnya. coli.2. Ternyata di dalam sel-sel E. Mula-mula partikel T2 melekatkan ujung ekornya pada dinding sel E. sedangkan pada partikel-partikel T2 hanya ada sedikit sekali radioisotop tersebut. sedangkan pada partikel-partikel T2 masih banyak didapatkan radioisotop tersebut. Ketika hasil penggandaan partikel T2 telah mencapai jumlah yang sangat besar. partikel-partikel T2 yang keluar akan mencari sel inang yang baru.Percobaan lain yang membuktikan bahwa DNA adalah materi genetik dilaporkan pada tahun 1952 oleh A. Hasil percobaan ini jelas menunjukkan bahwa materi genetik yang dimasukkan oleh bakteriofag T2 ke dalam sel E. DNA yang sangat banyak mengandung fosfor tetapi tidak mengandung sulfur dilabeli dengan radioisotop 32P. Sebelumnya. coli adalah materi yang dilabeli dengan 32P atau DNA. Protein. coli. Daur hidup bakteriofag T2 dan diagram percobaan infeksi T2 pada E. Untuk memastikan sifat kimia materi genetik yang dimasukkan ke dalam sel inang dilakukan pelabelan terhadap molekul protein dan DNAnya. dan siklus reproduksi tadi akan terulang kembali. coli sehingga memungkinkan terjadinya penggandaan partikel T2 di dalam sel inangnya itu. Hershey dan M.

seperti halnya TMV. adalah RNA. Jadi. faktor yang menentukan strain hasil penggandaan adalah RNA. Virus ini mengandung molekul RNA yang terbungkus di dalam selubung protein. Oleh karena itu. Untuk memastikan di antara kedua makromolekul tersebut yang berperan sebagai materi genetik.3. Kedua TMV hasil rekonstitusi ini kemudian diinfeksikan ke inangnya (daun tembakau) agar mengalami penggandaan. Sebaliknya. bukan protein. yaitu gugus fosfat. Gula pentosa pada DNA adalah 2-deoksiribosa. protein RNA pemisahan RNA dari protein Gambar 9. Singer pada tahun 1957. dapat disimpulkan bahwa materi genetik pada virus-virus yang tidak mempunyai DNA. dan basa nukleotida atau basa nitrogen (basa siklik yang mengandung nitrogen). TMV hasil penggandaan ternyata merupakan strain A jika RNAnya berasal dari strain A dan merupakan strain B jika RNAnya berasal dari strain B. Menurut kebiasaan. antara lain telah dilakukan percobaan rekonstitusi yang dilaporkan oleh H. yaitu virus yang menyebabkan timbulnya penyakit mozaik pada daun tembakau. sedangkan pada RNA adalah ribosa. Dengan perlakuan kimia tertentu molekul RNA dapat dipisahkan dari selubung proteinnya untuk kemudian digabungkan (direkonstitusi) dengan selubung protein dari strain TMV yang lain. Tiap nukleotida terdiri atas tiga komponen. RNA dari strain B direkonstitusi dengan protein dari strain A. gula pentosa (gula dengan lima atom karbon). Mereka melakukan penelitian pada virus mozaik tembakau atau tobacco mozaic virus (TMV). Atom C pada gula pentosa yang berikatan dengan basa nitrogen ditentukan sebagai atom C pertama . Percobaan yang membuktikan RNA sebagai materi genetik pada TMV = TMV strain A = TMV strain B rekonstitusi infeksi ke daun tembakau RNA dari strain A direkonstitusi dengan protein strain B. Nukleotida yang satu dengan nukleotida berikutnya dihubungkan oleh ikatan fosfodiester yang sangat kuat.Beberapa virus tertentu diketahui tidak mempunyai DNA. Pada DNA basa nitrogen berikatan secara kimia dengan gula pentosa membentuk molekul yang disebut nukleosida sehingga setiap nukleotida pada DNA dapat disebut juga sebagai nukleosida monofosfat. penomoran atom C pada gula pentosa dilakukan menggunakan tanda aksen (’) untuk membedakannya dengan penomoran atom C pada basa nitrogen. Fraenkel-Conrat dan B. Komposisi Kimia Asam Nukleat Hasil analisis kimia asam nukleat menunjukkan bahwa makromolekul ini tersusun dari subunit-subunit berulang (monomer) yang disebut nukleotida sehingga asam nukleat dapat juga dikatakan sebagai polinukleotida. tetapi hanya tersusun dari RNA dan protein.

Basa purin. sedangkan basa pirimidin pada DNA dapat berupa sitosin (C) atau timin (T). O O O P=O gugus fosfat 5’CH2OH OH 4’ H 3’ H O 5’CH2OH OH 1’ H H 4’ H 3’ H O 1’ H 2’ H 2’ OH H OH OH gula ribosa gula 2-deoksiribosa NH2 O . Sementara tu. tetapi diganti dengan urasil (U). basa nitrogen ada dua macam. sedangkan RNA adalah polinukleotida untai tunggal. Atom C nomor 2’ pada DNA tidak mengikat gugus OH seperti halnya pada RNA. dapat berupa adenin (A) atau guanin (G). tetapi mengikat gugus H sehingga gula pentosanya dinamakan deoksiribosa. baik pada DNA maupun RNA. Pada RNA tidak terdapat basa timin. yakni basa dengan cincin rangkap atau disebut purin dan basa dengan cincin tunggal atau disebut pirimidin. Biasanya DNA mempunyai struktur sebagai molekul polinukleotida untai ganda. Ini merupakan perbedaan lain di antara kedua macam asam nukleat tersebut.(1’).

D. Crick. nisbah konsentrasi adenin + timin terhadap konsentrasi guanin + sitosin sangat bervariasi dari spesies ke spesies.C. Hasil analisis kimia yang dilakukan oleh E. Watson dan F.H. Chargaff terhadap kandungan basa nitrogen molekul DNA dari berbagai organisme selalu menunjukkan bahwa konsentrasi adenin sama dengan timin.4. Komponen kimia asam nukleat Model Struktur DNA Watson-Crick Model struktur fisik molekul DNA pertama kali diajukan pada tahun 1953 oleh J. konsentrasi basa purin total menjadi sama dengan konsentrasi basa pirimidin total. Akan tetapi. Ada dua dasar yang digunakan dalam melakukan deduksi terhadap model tersebut. Dengan sendirinya. . sedangkan guanin sama dengan sitosin. yaitu 1.N N 1 H 2 3 N adenin 4 N H 9 6 5 7 8 H N H N 1 NH2 2 3 N guanin 4 N H 9 6 5 7 8 H NH2 4 N3 5 H H O 4 N3 5 CH3 H O 4 N3 5 H 2 O 1 6 H 2 O 1 6 NH H 2 O 1 6 H NH NH sitosin timin urasil Gambar 9.

Seperti telah disebutkan di atas. Di ujung lainnya atom C nomor 5’ akan mengikat gugus fosfat sehingga ujung ini dinamakan ujung 5’ atau ujung P. Pola difraksi yang diperoleh dari hasil pemotretan molekul DNA menggunakan sinar X oleh M.4 Å dengan pasangan basa berikutnya. dan para koleganya menunjukkan bahwa basabasa nitrogen tersusun vertikal di sepanjang sumbu molekul dengan interval 3. Di salah satu ujung untai polinukleotida. Gugus fosfat dan gula terletak di sebelah luar sumbu. makin rendah stabilitas molekul DNAnya. Satu sama lain arahnya sejajar tetapi berlawanan (antiparalel). basa G pada satu untai selalu berpasangan dengan basa C pada untai lainnya melalui ikatan hidrogen. atom C nomor 3’ tidak lagi dihubungkan oleh ikatan fosfodiester dengan nukleotida berikutnya. Dari data kimia Chargaff serta difraksi sinar X Wilkins dan Franklin tersebut Watson dan Crick mengusulkan model struktur DNA yang dikenal sebagai model tangga berpilin (double helix). begitu urutan basa pada satu untai polinukleotida diketahui. Antara basa A dan T yang berpasangan terdapat ikatan hidrogen rangkap dua. dan begitu pula sebaliknya. Setiap pasangan basa berjarak 3. maka untai komplementernya mempunyai arah dari ujung 3’ ke 5’. Kedudukan antiparalel di antara kedua untai polinukleotida sebenarnya dilihat dari ujung-ujung ini. Wilkins. Oleh karena itu. Hal ini menyebabkan nisbah A+T terhadap G+C mempengaruhi stabilitas molekul DNA. ujung ini dinamakan ujung 3’ atau ujung OH.F. R. Ikatan ini menghubungkan atom C nomor 3’ dengan atom C nomor 5’ pada gula deoksiribosa. Basa-basa nitrogen menghadap ke arah dalam sumbu. tetapi akan mengikat gugus OH. Franklin. nukleotida-nukleotida yang berurutan dihubungkan oleh ikatan fosfodiester. Oleh karena itu. Begitu pula.4 Å. Menurut model ini kedua untai polinukleotida saling memilin di sepanjang sumbu yang sama. Di dalam satu kali pilinan (360°) terdapat 10 pasangan basa. dan terjadi ikatan hidrogen antara basa A pada satu untai dan basa T pada untai lainnya. sedangkan antara basa G dan C yang berpasangan terdapat ikatan hidrogen rangkap tiga. Jika untai yang satu mempunyai arah dari ujung 5’ ke 3’.H. OH(3’) P(5’) P P P .2. maka urutan basa pada untai lainnya dapat ditentukan pula. Adanya perpasangan yang khas di antara basa-basa nitrogen itu menyebabkan kedua untai polinukleotida komplementer satu sama lain. Makin tinggi nisbah tersebut.

5 Diagram struktur molekul DNA = adenin = timin = guanin = sitosin Fungsi Materi Genetik Setelah terbukti bahwa DNA merupakan materi genetik pada sebagian besar organisme. Fungsi ini merupakan fungsi fenotipik. 2. Fungsi ini merupakan fungsi genotipik. Dalam beberapa dasawarsa pertama semenjak gen dikemukakan sebagai faktor yang diwariskan dari generasi ke generasi. yang dilaksanakan melalui peristiwa mutasi (Bab XI). Bagian setelah ini akan membahas replikasi DNA. sifat-sifat molekulernya baru sedikit sekali terungkap.P P P P P P(5’) OH(3’) = gula Gambar 9. Materi genetik sewaktu-waktu harus dapat mengalami perubahan sehingga organisme yang bersangkutan akan mampu beradaptasi dengan kondisi lingkungan yang berubah. 3. harus dapat menjalankan tiga fungsi pokok berikut ini. Materi genetik harus mampu menyimpan informasi genetik dan dengan tepat dapat meneruskan informasi tersebut dari tetua kepada keturunannya. Artinya. kita akan melihat fungsi yang harus dapat dilaksanakan oleh molekul tersebut sebagai materi genetik. Materi genetik harus mengatur perkembangan fenotipe organisme. evolusi tidak akan pernah berlangsung. Fungsi ini merupakan fungsi evolusioner. yang dilaksanakan melalui replikasi. 1. Tanpa perubahan semacam ini. materi genetik harus mengarahkan pertumbuhan dan diferensiasi organisme mulai dari zigot hingga individu dewasa. Meskipun demikan. yang sekarang ternyata adalah DNA. . ketika itu telah disepakati bahwa gen sebagai materi genetik. yang dilaksanakan melalui ekspresi gen (Bab X). dari generasi ke generasi.

Namun. Pada replikasi semikonservatif tangga berpilin mengalami pembukaan terlebih dahulu sehingga kedua untai polinukleotida akan saling terpisah. . masing-masing untai ini tetap dipertahankan dan akan bertindak sebagai cetakan (template) bagi pembentukan untai polinukleotida baru. dan dispersif. Pada replikasi konservatif seluruh tangga berpilin DNA awal tetap dipertahankan dan akan mengarahkan pembentukan tangga berpilin baru. yaitu konservatif. fragmen-fragmen polinukleotida yang terbentuk akan menjadi cetakan bagi fragmen nukleotida baru sehingga fragmen lama dan baru akan dijumpai berselang-seling di dalam tangga berpilin yang baru. semikonservatif. Kemudian. Sementara itu. pada replikasi dispersif kedua untai polinukleotida mengalami fragmentasi di sejumlah tempat.Replikasi DNA Ada tiga cara teoretis replikasi DNA yang pernah diusulkan.

Sebagai perbandingan. Kemudian.coli dengan basa nitrogen yang mengandung isotop 14N dan 15N masingmasing adalah 1. maka akan terjadi keseimbangan tingkat kerapatan. Hal ini karena molekul-molekul garam tersebut akan mengendap ke dasar tabung sentrifuga akibat adanya gaya sentrifugal. pada generasi 14N yang pertama.coli ditumbuhkan pada medium 14N ternyata DNAnya menempati bagian tengah dan atas tabung.coli yang pertama kali dipindahkan kembali ke medium 14N terlihat menempati bagian tengah tabung. dalam waktu 48 hingga 72 jam. DNAnya merupakan hibrid . Oleh karena molekul-molekul dengan tingkat kerapatan yang berbeda dapat dipisahkan dengan cara sentrifugasi tersebut di atas. Tiga cara teoretis replikasi DNA = untai lama = untai baru Di antara ketiga cara replikasi DNA yang diusulkan tersebut. sedangkan kerapatan larutan 6M CsCl adalah 1. Meselson dan F.S.700 g/cm3.konservatif semikonservatif dispersif Gambar 9.coli telah ditumbuhkan selama beberapa generasi pada medium 14 N. kemudian dikembalikan ke medium normal 14N selama beberapa generasi berikutnya. sedangkan DNA yang berada di bagian tengah tabung tetap. kerapatan DNA E. Meselson dan Stahl menjelaskan bahwa pada generasi 15 N. DNA yang diekstrak dari sel E.6. atau disebut sebagai generasi 1. Akibatnya. DNAnya mempunyai kerapatan tinggi. DNA yang diekstrak dari sel E.000 hingga 50. hanya cara semikonservatif yang dapat dibuktikan kebenarannya melalui percobaan yang dikenal dengan nama sentrifugasi seimbang dalam tingkat kerapatan atau equilibrium density-gradient centrifugation. maka Meselson dan Stahl dapat mengikuti perubahan tingkat kerapatan DNA sel-sel bakteri E. katakanlah 30. Ketika larutan 6M CsCl yang di dalamnya terdapat molekul DNA disentrifugasi dengan kecepatan sangat tinggi. basa-basa nitrogen pada molekul DNA sel-sel bakteri tersebut akan memiliki 15N yang berat.724 g/cm3. Stahl. Pada generasi kedua setelah E. sementara di sisi lain difusi akan menggerakkan molekul-molekul garam kembali ke atas tabung. Mereka menumbuhkan bakteri Escherichia coli selama beberapa generasi di dalam medium yang mengandung isotop nitrogen 15N untuk menggantikan isotop nitrogen normal 14N yang lebih ringan. DNAnya nampak makin banyak berada di bagian atas tabung. atau dianggap sebagai generasi 0.000 rpm.W. Percobaan ini dilaporkan hasilnya pada tahun 1958 oleh M. Ketika E. Molekul DNA dengan basa nitrogen yang mengandung 15N mempunyai tingkat kerapatan (berat per satuan volume) yang lebih tinggi daripada DNA normal (14N).708 g/cm3 dan 1. coli yang semula ditumbuhkan pada medium 15N selama beberapa generasi. Molekul DNA dengan tingkat kerapatan tertentu akan menempati kedudukan yang sama dengan kedudukan larutan garam yang tingkat kerapatannya sama dengannya. Selanjutnya. Molekul DNA mempunyai kerapatan yang lebih kurang sama dengan kerapatan larutan garam yang sangat pekat seperti larutan 6M CsCl (sesium khlorida). coli yang ditumbuhkan pada medium 15N terlihat menempati dasar tabung.

7 terlihat bahwa interpretasi data hasil percobaan sentrifugasi ini jelas sejalan dengan cara pembentukan molekul DNA melalui replikasi semikonservatif.antara DNA dengan kerapatan tinggi dan rendah. sedangkan DNA baru dengan kerapatan rendah akan makin banyak dijumpai. DNA hibrid akan tetap jumlahnya. Demikian seterusnya. Pada generasi 2 DNA hibridnya masih ada. tetapi muncul pula DNA baru dengan kerapatan rendah. Pada Gambar 9. medium 15N (generasi 0) ekstrak DNA ekstrak DNA medium 14N (generasi 1) ekstrak DNA (generasi 2) medium 14N .

khloroplas. Dengan kedua teknik ini terlihat bahwa DNA berbagai virus. Replikasi lingkaran menggulung = untai lama = untai baru pemanjangan ’ekor’ . Selain replikasi θ. Pembentukan (sintesis) untai DNA baru terjadi dengan penambahan deoksinukleotida pada ujung 3’ yang diikuti oleh pelepasan ujung 5’ dari lingkaran molekul DNA. ujung 5’ akan makin terlepas dari lingkaran tersebut sehingga membentuk ’ekor’ yang makin memanjang (Gambar 9. Diagram percobaan Meselson dan Stahl yang memperlihatkan replikasi DNA secara semikonservatif Pada percobaan Meselson dan Stahl ekstrak DNA yang diperoleh dari sel-sel E. penambahan nukleotida ujung 3’ tempat ujung 5’ pelepasan ujung 5’ terpotongnya ikatan fosfodiester Gambar 9.8). pada sejumlah bakteri dan organisme eukariot dikenal pula replikasi yang dinamakan replikasi lingkaran menggulung (rolling circle replication). coli berada dalam keadaan terfragmentasi sehingga replikasi molekul DNA dalam bentuknya yang utuh sebenarnya belum diketahui. Replikasi DNA kromosom dalam keadaan utuh _ yang pada prokariot ternyata berbentuk melingkar atau sirkular _ baru dapat diamati menggunakan teknik autoradiografi dan mikroskopi elektron. Sejalan dengan berlangsungnya replikasi di seputar lingkaran DNA.7.ekstrak DNA medium 14N (generasi 3) interpretasi data hasil sentrifugasi DNA Gambar 9. Replikasi ini diawali dengan pemotongan ikatan fosfodiester pada daerah tertentu yang menghasilkan ujung 3’ dan ujung 5’.8. dan mitokhondria melakukan replikasi yang dikenal sebagai replikasi θ (theta) karena autoradiogramnya menghasilkan gambaran seperti huruf Yunani tersebut.

Penambahan dGTP terjadi karena untai DNA cetakannya mempunyai urutan basa T-G-TC. atau sintesis DNA. Untai DNA yang akan digunakan sebagai cetakan (template). terjadi dua arah (bidireksional).. yang terdiri atas deoksiadenosin trifosfat (dATP). Dalam gambar tersebut sebuah molekul dGTP ditambahkan ke molekul primer yang terdiri atas tiga nukleotida (A-CA). yang mempunyai gugus 3’. baik pada prokariot maupun eukariot. Deoksinukleosida trifosfat... deoksiguanosin trifosfat (dGTP). Biasanya. selain terjadi replikasi dua arah. G . Molekul yang dinamakan primer ini diperlukan karena tidak ada enzim DNA polimerase yang diketahui mampu melakukan inisiasi sintesis DNA. deoksisitidin trifosfat (dCTP).. Keempat molekul ini berfungsi sebagai sumber basa nukleotida. . Reaksi sintesis DNA secara skema dapat dilihat pada Gambar 9. . .Dimulainya (inisiasi) replikasi DNA terjadi di suatu tempat tertentu di dalam lingkaran molekul DNA yang dinamakan titik awal replikasi atau origin of replication (ori). Dalam hal ini dua garpu replikasi akan bergerak melebar dari ori menuju dua arah yang berlawanan. diperlukan tiga komponen reaksi. dapat berupa DNA atau RNA. . Kita lihat bahwa sintesis DNA (penambahan basa demi basa) berlangsung dari ujung 5’ ke ujung 3’. Salah satu diantaranya adalah enzim DNA polimerase. yang mengatur pembentukan ikatan fosfodiester antara dua nukleotida yang berdekatan sehingga akan terjadi pemanjangan untai DNA (polinukleotida). 2. inisiasi replikasi DNA. T A dGTP 3’ P 5’ 5’ 3’ P G C T A PPi 3’ P 5’ OH 3’ DNA polimerase P Mg2+ 5’ 5’ 5’ 3’ P 5’ 3’ P 3’ P OH C . ori dapat ditemukan di beberapa tempat. Segmen asam nukleat pendek. . Proses inisiasi ini ditandai oleh saling memisahnya kedua untai DNA. Agar DNA polimerase dapat bekerja mengatalisis reaksi sintesis DNA. 1. dan deoksitimidin trifosfat (dTTP).OH bebas. Hasil penambahan yang diperoleh adalah molekul DNA yang terdiri atas empat nukleotida (A-C-A-G).. Enzim-enzim yang berperan dalam replikasi DNA Replikasi DNA. DNA cetakan T A G C T A C. yaitu 1. . .9. melibatkan sejumlah reaksi kimia yang diatur oleh beberapa enzim. Pada eukariot.. . Dua buah atom fosfat (PPi) dilepaskan dari dGTP karena sebuah atom fosfatnya diberikan ke primer dalam bentuk nukleotida dengan basa G atau deoksinukleosida monofosfat (dGMP). yang masing-masing akan berperan sebagai cetakan bagi pembentukan untai DNA baru sehingga akan diperoleh suatu gambaran yang disebut sebagai garpu replikasi.

Skema reaksi sintesis DNA Enzim DNA polimerase yang diperlukan untuk sintesis DNA pada E. Aktivitas nuklease dapat dibedakan menjadi (1) eksonuklease atau pembuangan nukleotida dari ujung polinukleotida dan (2) endonuklease atau pemotongan ikatan fosfodiester di dalam untai polinukleotida. Selain mampu melakukan pemanjangan atau polimerisasi DNA. Artinya. Untai DNA tersebut sering dinamakan untai pengarah (leading strand). misalnya A dengan C. Sintesis DNA baru pada untai pengarah ini berlangsung secara kontinyu dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai pengarah dari ujung 3’ ke ujung 5’. Kedua enzim ini berperan dalam pembukaan pilinan di antara kedua untai DNA sehingga kedua untai tersebut dapat saling memisah.9. sedangkan enzim Pol I memegang peran sekunder. Pol III merupakan enzim replikasi yang utama. coli mempunyai aktivitas eksonuklease yang hanya bekerja pada ujung 3’. Untuk menyambung fragmen-fragmen ini diperlukan enzim yang disebut DNA ligase. sintesis DNA pada untai yang satu ini tidak berjalan kontinyu sehingga menghasilkan fragmen terputus-putus. Fungsi perbaikan kesalahan yang dijalankan oleh enzim Pol I dan III tersebut dinamakan fungsi penyuntingan (proofreading). enzim DNA polimerase untuk sintesis DNA kromosom pada eukariot disebut polimerase α. yaitu pembuangan molekul nukleotida dari untai polinukleotida. pemotongan terjadi dari ujung 3’ ke arah ujung 5’. yaitu DNA polimerase I (Pol I) dan DNA polimerase III (Pol III). Tahap inisiasi sintesis DNA juga melibatkan enzim DNA girase dan protein yang mendestabilkan pilinan (helix destabilizing protein). Pada untai DNA pasangannya ternyata juga terjadi sintesis DNA baru dari ujung 5’ ke ujung 3’ atau bergerak di sepanjang untai DNA cetakannya ini dari ujung 3’ ke ujung 5’. Replikasi pada kedua untai DNA Proses replikasi DNA yang kita bicarakan di atas sebenarnya barulah proses yang terjadi pada salah satu untai DNA. Setelah primer terbentuk barulah DNA polimerase melakukan elongasi atau pemanjangan untai DNA. Namun. coli ada dua macam. Khusus enzim Pol I ternyata juga mempunyai aktivitas eksonuklease 5’→ 3’ di samping aktivitas eksonuklease 3’→5’ (lihat juga Bab XI). Enzim lain yang berperan dalam proses sintesis DNA adalah primase. Enzim ini bekerja pada tahap inisiasi dengan cara mengatur pembentukan molekul primer di daerah ori. Terjadinya sintesis . yang bisa saja terjadi meskipun sangat jarang (sekitar satu di antara sejuta basa !). tetapi pada kedua-duanya. Enzim Pol I dan Pol III dari E. Kesalahan penambahan basa pada untai polinukleotida yang sedang tumbuh (dipolimerisasi) menjadikan basa-basa salah berpasangan. Sementara itu. yang masing-masing mempunyai arah 5’→ 3’. sebagian besar enzim DNA polimerase mempunyai aktivitas nuklease. Pada bagian berikut ini akan dijelaskan bahwa sintesis DNA baru tidak hanya terjadi pada salah satu untai DNA. Hal ini bermanfaat untuk memperbaiki kesalahan sintesis DNA atau kesalahan penambahan basa.Gambar 9. Hanya saja sintesis DNA pada salah satu untai berlangsung tidak kontinyu sehingga menghasilkan fragmen yang terputus-putus. Dalam sintesis DNA.

DNA yang tidak kontinyu sebenarnya disebabkan oleh sifat enzim DNA polimerase yang hanya dapat menyintesis DNA dari arah 5’ ke 3’ serta ketidakmampuannya untuk melakukan inisiasi sintesis DNA. fragmen-fragmen Okazaki akan disatukan menjadi sebuah untai DNA yang utuh dengan bantuan enzim DNA ligase. ori 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ untai baru kontinyu untai pengarah fragmen-fragmen 5’ 3’ 3’ 5’ Okazaki untai tertinggal 5’ 3’ Gambar 9. yang tujuh di antaranya mengalami degenerasi. membran sel di tempat kedua sel berlekatan akan rusak sehingga terjadi pertukaran salah satu mironuklei antarsel. sesuai dengan nama penemunya. Untai DNA yang menjadi cetakan bagi sintesis DNA tidak kontinyu itu disebut untai tertinggal (lagging strand). yang diikuti dengan fusi kedua mikronuklei menjadi satu mikronukleus diploid. fragmen-fragmen DNA yang dihasilkan dari sintesis yang tidak kontinyu dinamakan fragmen Okazaki. Sementara itu. Seperti telah dikemukakan di atas. Satu mikronukleus yang tersisa mengalami mitosis menjadi dua mikronuklei yang juga haploid. Fase aseksual juga diawali dengan meiosis mikronuklei menjadi delapan mikronuklei haploid. Satu mikronukleus yang tersisa mengalami mitosis menjadi dua mikronuklei haploid. Mulai tahap ini kedua sel (ekskonjugan) secara genetik menjadi sama.10. Kedua mikronuklei ini bergabung membentuk satu mikronukleus diploid. yang tujuh di antaranya akan mengalami degenerasi. yang kemudian mengalami dua kali mitosis menjadi . Diagram replikasi pada kedua untai DNA 11/01/2009 Posted by zaifbio | Genetika Dasar | 3 Komentar Sterilitas Jantan pada Jagung hingga dihasilkan delapan mikronuklei haploid. Selanjutnya.

Jadi. dari hasil tersebut tampak jelas bahwa sifat pembunuh atau bukan pembunuh ditentukan oleh ada tidaknya partikel kappa di dalam sitoplasma walaupun partikel itu sendiri keberadaannya bergantung kepada gen K di dalam nukleus. Keberadaan kappa bergantung kepada gen kromosomal dominan K. Apabila strain pembunuh melakukan konjugasi dengan strain bukan pembunuh (pada suatu kondisi yang memungkinkan strain bukan pembunuh untuk bertahan hidup). Sterilitas jantan sitoplasmik tidak diatur oleh gen-gen kromosomal tetapi diwariskan melalui sitoplasma gamet betina dari . peristiwa autogami pada hakekatnya sangat menyerupai pembuahan sendiri. Dari hasil autogami dapat dipelajari bahwa pewarisan suatu sifat diatur oleh gen-gen kromosomal ataukah sitoplasmik. yang artinya bakteri pembunuh berbentuk pita spiral. yakni sel pembunuh dan sel bukan pembunuh yang kedua-duanya bergenotipe Kk.5 b) sehingga hanya diperoleh satu kelompok sel.M. seperti T. Jika sel-sel ini melakukan autogami. Pertama. Tanaman jagung dikatakan steril atau mandul jantan sitoplasmik apabila tidak mampu menghasilkan polen yang aktif dalam jumlah normal sementara proses reproduksi dan fertilitas betinanya normal. Senyawa beracun ini selanjutnya disebut sebagai paramesin. maka ada dua kemungkinan yang dapat terjadi. sedangkan partikel-partikel kappa ternyata merupakan bakteri simbion yang kemudian dikenal dengan nama Caedobacter taeniospiralis. Dua di antara mikronuklei ini berkembang menjadi makronuklei. yaitu sterilitas jantan sitoplasmik pada jagung. Hal yang perlu untuk diketahui pada fase aseksual ini adalah bahwa meskipun sel yang mengalami autogami pada awalnya heterozigot. Dengan demikian.5. khususnya dalam hal peningkatan homozigositas. kedua sel tidak bertukar materi sitoplasmik tetapi hanya bertukar mikronuklei (Gambar 8. Sebaliknya sel pembunuh (Kk) melalui autogami dapat menghasilkan sel bukan pembunuh (kk) karena partikel kappa tidak akan mampu bertahan di dalam sitoplasma tanpa adanya gen K. Dengan demikian.empat mikronuklei diploid. aurelia yang mengandung partikel-partikel kappa akan menghasilkan senyawa beracun yang dapat mematikan strainstrain protozoa lainnya yang ada di sekitarnya. Beberapa peneliti. sel-sel yang dihasilkan semuanya akan menjadi homozigot karena sel awal heterozigot tersebut terlebih dahulu mengalami meiosis menjadi sel haploid. Kedua mikronuklei yang tersisa mengalami mitosis menjadi empat mikronuklei diploid. Kemungkinan ke dua terjadi pertukaran materi sitoplasmik di antara kedua sel (Gambar 8. maka akan diperoleh sel pembunuh (KK) dan sel bukan pembunuh (kk) dengan nisbah 1 : 1. Pada strain tertentu Paramecium aurelia ditemukan adanya fenomena ‘pembunuh’ (killer) yang berkaitan dengan keberadaan sejumlah partikel yang disebut sebagai kappa di dalam sitoplasmanya. Sterilitas Jantan pada Jagung Di bidang pertanian ada satu contoh fenomena pewarisan sitoplasmik yang sangat penting. yakni sel pembunuh yang bergenotipe Kk.a) sehingga diperoleh dua kelompok sel. Sonneborn. genotipe KK dapat menghasilkan fenotipe bukan pembunuh jika di dalam sitoplasma tidak terdapat partikel kappa. Setelah terjadi sitokinesis (pemisahan sel) diperoleh dua buah sel masing-masing dengan dua mikronuklei dan satu makronukleus yang semuanya diploid. Jika masing-masing sel ini melakukan autogami. mengamati bahwa sel P. maka akan diperoleh sel pembunuh (KK) dan sel bukan pembunuh (kk) yang berasal dari sel pembunuh (Kk) serta sel bukan pembunuh (baik KK maupun kk) yang berasal dari sel bukan pembunuh (Kk).

6.generasi ke generasi. persilangan antara betina tipe liar dan jantan poki menghasilkan keturunan yang semuanya normal. Seperti halnya mutan petit. Akibatnya. betina tersebut dinamakan mutan poki (poky mutant). sel kehilangan kemampuan untuk membentuk protein yang diperlukan dalam metabolisme oksidatif. Sebaliknya. cerevisae dalam hal pertumbuhannya yang lambat dan kerusakan fungsi mitokondrianya. Pola pewarisan sterilitas jantan pertama kali dipelajari oleh M. Individu mandul jantan sebagai tetua betina disilangkan dengan individu normal sebagai 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar Materi Genetik di dalam Kloroplas. Secara biokimia kelainan ini berupa gangguan pada sistem sintesis protein mitokondria yang diatur oleh materi genetik di dalam mitokondria. Persilangan antara betina poki dan jantan tipe liar menghasilkan keturunan yang semuanya poki. Jenis sterilitas ini telah banyak digunakan dalam produksi biji jagung hibrida. mutan poki juga memperoleh energi untuk pertumbuhannya . Mutan poki menyerupai mutan petit pada S. yang secara skema dapat dilihat pada Gambar 8. Rhoades melalui percobaan persilangan pada jagung.

putih.melalui jalur fermentasi anaerob yang sangat tidak efisien. Materi Genetik di dalam Kloroplas. Selsel pada bagian yang berwarna hijau mempunyai kloroplas yang mengandung klorofil. dan belang-belang hjau-putih (variegated). bagian yang belang-belang . sedang sel-sel pada bagian yang berwarna putih tidak mempunyai kloroplas tetapi berisi plastida yang tidak berwarna. Suatu tanaman bunga pukul empat dapat memiliki bagian vegetatif yang berbedabeda warnanya. Sementara itu. Carl Correns pada tahun 1908 melihat adanya perbedaan hasil persilangan resiprok pada pewarisan warna bagian vegetatif tanaman. pada beberapa tanaman tertentu seperti bunga pukul empat (Mirabilis jalapa). khususnya daun. Dia mengamati bahwa pewarisan warna tersebut semata-mata ditentukan oleh tetua betina dan berkaitan dengan ada tidaknya kloroplas di dalam sitoplasma. yaitu hijau.

Ada dua macam sel pada Chlamydomonas bila dilihat dari tipe kawinnya. baik sebagai sumber polen (tetua jantan) maupun sebagai pembawa putik (tetua betina). atau putih belang-belang.1 bahwa fenotipe keturunan akan selalu sama dengan fenotipe tetua betina atau terjadi pewarisan maternal. Kedua macam sel haploid ini dapat bergabung membentuk zigot diploid. Tabel 8. yang selanjutnya . hijau. atau putih belang-belang. Jelas dapat disimpulkan dari Tabel 8.1. Sel alga ini memiliki sebuah kloroplas yang besar ukurannya dan di dalamya terdapat sejumlah materi genetik. Model yang menjelaskan pewarisan maternal ini dapat dilihat pada Gambar 8. yakni mengenai pewarisan sifat ketahanan terhadap antibiotik.terdiri atas sel-sel. yang hasilnya dapat dilihat pada Tabel 8. Dengan demikian. Ketiga macam bagian tanaman tersebut dapat menghasilkan bunga.2. sehingga dimungkinkan adanya sembilan kombinasi persilangan. hijau. atau putih Penelitian tentang pewarisan sitoplasmik telah dilakukan pula pada alga uniseluler Chlamydomonas reinhardii. yakni mt + dan mt . baik dengan maupun tanpa kloroplas. hijau. sementara polen hanya sedikit sekali atau bahkan sama sekali tidak memiliki kloropas. Hal ini karena seperti telah dikatakan di atas bahwa warna hijau bergantung kepada ada tidaknya kloroplas.1 Hasil persilangan pada tanaman bunga pukul empat Fenotipe cabang yang membawa bunga sebagai tetua betina putih putih putih hijau hijau hijau belang-belang belang-belang belang-belang Fenotipe cabang yang membawa bunga sebagai tetua jantan Putih Hijau belang-belang Putih Hijau belang-belang Putih Hijau belang-belang Fenotipe keturunan putih putih putih hijau hijau hijau belang-belang. kontribusi kloroplas kepada zigot dapat dipastikan hanya berasal dari sel kelamin betina.

maka kontribusi sitoplasma kepada zigot yang terbentuk akan sama banyaknya. Oleh karena kedua sel tipe kawin tersebut ukurannya sama besar.2.akan mengalami meiosis untuk menghasilkan tetrad yang terdiri atas empat buah sel haploid. = kloroplas . Sel-sel haploid di dalam tetrad dapat ditumbuhkan pada medium selektif padat dan membentuk koloni yang menunjukkan genotipenya. putih hijau belang-belang sel telur x polen x x x x zigot Gambar 8. Model pewarisan maternal pada tanaman bunga pukul empat = plastida tanpa klorofil .

alel yang menentukan tipe kawin itu sendiri (alel mt) tampak bersegregasi mengikuti pola Mendel. dalam hal ini mt+. kloroplas dari mt – akan hilang oleh suatu sebab yang hingga kini beluim diketahui. yang berarti sejalan dengan pola pewarisan kloroplas. Dengan perkataan lain. persilangan antara tipe liar dan mutan yang tahan terhadap streptomisin menghasilkan keturunan yang sifat ketahanannya terhadap streptomisin bergantung kepada tetua mt+. Analisis biokimia membuktikan bahwa sifat ketahanan terhadap antibiotik berhubungan dengan kloroplas.3.zigot mt – str+ mt+ mt – mt+ mt – mt+ mt – mt+ mt – . mt+ str+ zigot mt – str .mt+ str . Sebagai contoh. Berbagai penelitian mengenai ketahanan terhadap antibiotik selain streptomisin telah dilakukan pula pada Chlamydomonas. Keturunan hasil persilangan antara kedua tipe kawin selalu mempunyai genotipe seperti salah satu tetuanya. maka tidak mungkin terjadi pewarisan uniparental. kloroplas dapat dipastikan berasal dari salah satu tipe kawin saja.dengan mt . Dengan perkataan lain. pewarisan sifat ketahanan terhadap antibiotik pada Chlamydomonas merupakan pewarisan ekstrakromosomal atau pewarisan sitoplasmik. Jadi.str+ menghasilkan keturunan yang semuanya rentan streptomisin (str -) . dan semuanya memperlihatkan terjadinya pewarisan uniparental. Jika kloroplas ini berasal dari penggabungan kloroplas kedua sel tipe kawin yang digunakan sebagai tetua dengan nisbah yang sama. Seperti telah kita ketahui bahwa sel haploid Chlamydomonas hanya mempunyai sebuah kloroplas. maka sifat ini jelas dibawa oleh kloroplas. Meskipun demikian. Hal ini didukung oleh penelitian menggunakan penanda fisik untuk membedakan kloroplas dari kedua tipe kawin yang telah menunjukkan bahwa setelah terjadi penggabungan. Jadi. Oleh karena pewarisan sifat ketahanan terhadap antibiotik selalu ditentukan oleh tetua mt +. pewarisan sifat ketahanan terhadap streptomisin berlangsung uniparental atau bergantung kepada genotipe salah satu tetuanya. kloroplas yang diwariskan hanya berasal dari tetua mt +. yakni menghasilkan keturunan dengan nisbah 1 : 1. Persilangan mt+ str+ dengan mt – str . Secara skema persilangan tersebut dapat digambarkan seperti pada Gambar 8. pewarisan alel str mengikuti pola pewarisan uniparental.Persilangan resiprok antara tipe liar (rentan antibiotik) dan mutan-mutan yang tahan antibiotik memberikan hasil yang berbeda-beda.menghasilkan keturunan yang semuanya tahan streptomisin (str+) sementara persilangan mt+ str . Dengan demikian. yang menunjukkan bahwa alel tersebut terletak di dalam kromosom nukleus.

sesekali pernah pula dilaporkan bahwa ada sejumlah sifat genetik pada eukariot yang .3.=rentan streptomisin) 11/01/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar PEWARISAN SITOPLASMIK BAB VIII PEWARISAN SITOPLASMIK      Kriteria Pewarisan Sitoplasmik Organel Sitoplasmik Pembawa Materi Genetik Pengaruh Genetik Simbion Sitoplasmik pada Paramaecium Mekanisme Sterilitas Jantan pada Jagung Pengaruh Maternal dan Pewarisan Maternal BAB VIII. str+ = tahan streptomisin .semuanya str+ semuanya str – mt+ str+ mt . Kenyataannya gengen kromosomal ini memang memegang peranan utama di dalam pewarisan sebagian besar sifat genetik. str .mt – str – Gambar 8. PEWARISAN SITOPLASMIK Sebegitu jauh pembicaraan kita tentang pewarisan sifat pada eukariot selalu dikaitkan dengan gen-gen yang terletak di dalam kromosom/nukleus.str+ mt+str . Meskipun demikian. Diagram pewarisan sifat ketahanan terhadap streptomisin pada Chlamydomonas (mt = tipe kawin .

setidaktidaknya lima hal di bawah ini dapat digunakan untuk keperluan tersebut. Jika dalam hal ini pengaruh rangkai kelamin (Bab VI) dikesampingkan. Namun. dan beberapa komponen sitoplasmik lainnya. Di bagian akhir dibicarakan pula suatu fenomena lain yang masih ada sangkut pautnya dengan pewarisan sitoplasmik. kloroplas (pada tumbuhan). . Sebagai contoh. Perbedaan hasil perkawinan resiprok merupakan penyimpangan dari pola Mendel. Begitu juga virus dan partikel mirip bakteri dapat bertindak sebagai pembawa sifat herediter sitoplasmik. Kriteria Pewarisan Sitoplasmik Sebenarnya tidak ada kriteria yang dapat berlaku universal untuk membedakan pewarisan sitoplasmik dengan pewarisan gen-gen kromosomal. Pewarisan sifat sitoplasmik diatur oleh materi genetik yang terdapat di dalam organel-organel seperti mitokondria. Pada Bab VIII ini akan dibahas berbagai contoh kasus yang termasuk dalam pewarisan sitoplasmik.pewarisannya diatur oleh unsur-unsur di luar nukleus. atau dikenal pula sebagai pewarisan sitoplasmik. Pewarisan ekstranukleus. maka perbedaan hasil perkawinan resiprok tersebut menunjukkan bahwa salah satu tetua (biasanya betina) memberikan pengaruh lebih besar daripada pengaruh tetua lainnya dalam pewarisan suatu sifat tertentu. ini tidak mengikuti pola Mendel. 1. hasil persilangan antara betina A dan jantan B tidak sama dengan hasil persilangan antara betina B dan jantan A.

Tidak adanya nisbah segregasi Mendel menunjukkan bahwa pewarisan sifat tidak diatur oleh gen-gen kromosomal tetapi oleh materi sitoplasmik. Sel kelamin betina biasanya membawa sitoplasma dan organel sitoplasmik dalam jumlah lebih besar daripada sel kelamin jantan. Beberapa hasil . Oleh karena itu. jika ada suatu materi penentu sifat tidak dapat dipetakan ke dalam kelompok-kelompok berangkai yang ada. 5. yang memiliki molekul DNA (lihat Bab IX) dan dapat melakukan replikasi subseluler sendiri. 3. maka pewarisan tersebut terjadi karena pengaruh materi sitoplasmik. Jika materi sitoplasmik terbukti berkaitan dengan pewarisan sifat tertentu. Organel dan simbion di dalam sitoplasma dimungkinkan untuk diisolasi dan dianalisis untuk mendukung pembuktian tentang adanya transmisi maternal dalam pewarisan sifat. sangat dimungkinkan bahwa materi genetik tersebut terdapat di dalam sitoplasma 4. Organel Sitoplasmik Pembawa Materi Genetik Di dalam sitoplasma antara lain terdapat organel-organel seperti mitokondria dan kloroplas. Jika pewarisan suatu sifat berlangsung tanpa adanya pewarisan gen-gen kromosomal. maka dapat dipastikan bahwa pewarisan sifat tersebut merupakan pewarisan sitoplasmik. Substitusi nukleus dapat memperjelas pengaruh relatif nukleus dan sitoplasma. kedua organel ini sering kali disebut sebagai organel otonom.2. Oleh karena itu. Gen-gen kromosomal menempati loki tertentu dengan jarak satu sama lain yang tertentu pula sehingga dapat membentuk kelompok berangkai (Bab V).

Enzim-enzim untuk keperluan respirasi sel dan produksi energi terdapat di dalam mitokondria. Ephrusi menemukan sejumlah . Pada alga hijau plastida diduga membawa mekanisme genetik lainnya. diduga membawa hingga lebih kurang 50 gen di dalam molekul DNAnya. Mitokondria. Gen-gen ini di antaranya bertanggung jawab atas struktur mitokondria itu sendiri dan juga pengaturan berbagai bentuk metabolisme energi. misalnya mekanisme ketahanan terhadap antibiotik streptomisin pada Chlamydomonas. Dalam kurun waktu yang sangat panjang mereka kemudian membangun simbiosis turun-temurun dengan sel inang eukariotnya dan akhirnya berkembang menjadi organel yang menetap di dalam sel. Mutan Mitokondria Pada suatu penelitian menggunakan khamir Saccharomyces cerevisae B. yang merupakan bahan bakar bagi berbagai reaksi biokomia. yang nanti akan dibicarakan pada bagian lain bab ini.penelitian memberikan petunjuk bahwa mitokondria dan kloroplas pada awalnya masing-masing merupakan bakteri dan alga yang hidup bebas. Klorofil beserta kelengkapan untuk sintesisnya telah dirakit ketika kloroplas masih dalam bentuk alga yang hidup bebas. kloroplas sebagai organel fotosintetik pada tumbuhan dan beberapa mikroorganisme membawa sejumlah materi genetik yang diperlukan bagi struktur dan fungsinya dalam melaksanakan proses fotosintesis. Sementara itu. yang dijumpai pada semua jenis organisme eukariot. Begitu juga bahan makanan akan dioksidasi di dalam organel ini untuk menghasilkan senyawa adenosin trifosfat (ATP).

Hal ini menunjukkan bahwa petit segregasional ditimbulkan oleh mutasi di dalam nukleus. maka dapat . Koloni-koloni ini dinamakan mutan petit (petite mutant). Analisis genetik terhadap hasil persilangan antara mutan petit dan tipe liarnya memperlihatkan adanya tiga tipe mutan petit seperti dapat dilihat pada Gambar 8. oleh karena zigot diploid mempunyai fenotipe normal. Persilangan dengan tipe liarnya menghasilkan zigot diploid yang normal. Namun. Mutan petit melakukan metabolisme karbon bukan dengan respirasi menggunakan oksigen. akan diperoleh empat askopora haploid dengan nisbah fenotipe 2 normal : 2 petit. hasil studi fisiologi menunjukkan bahwa sel-sel tersebut mengalami petumbuhan yang sangat lambat karena adanya kelainan dalam metabolisme senyawa karbon. melainkan melalui fermentasi glukosa secara anaerob yang jelas jauh kurang efisien bila dibandingkan dengan respirasi aerob. Selain itu. Jika zigot ini mengalami pembelahan meiosis. Hasil pengamatan mikroskopis menunjukkan bahwa selsel pada koloni tersebut berukuran normal.koloni berukuran sangat kecil yang kadang-kadang terlihat ketika sel ditumbuhkan pada medium padat.1. Tipe pertama memperlihatkan segregasi Mendel seperti biasanya sehingga dinamakan petit segregasional.

Keempat askospora ini semuanya normal. Jadi. fenotipe keturunan hanya ditentukan oleh tetua normalnya. berbeda dengan tipe pertama jika dilihat dari keempat askopora hasil pembelahan meiosis zigot diploid. sitoplasma sel tipe liar akan menjadi sumber materi genetik mitokhodria bagi spora-spora hasil persilangan petit dengan tipe liar sehingga semuanya akan mempunyai fenotipe normal. pewarisan sifatnya merupakan pewarisan uniparental. . Berlangsungnya pewarisan uniparental tersebut disebabkan oleh hilangnya sebagian besar atau seluruh materi genetik di dalam mitokondria yang menyandi sintesis enzim respirasi oksidatif pada kebanyakan petit netral.dipastikan bahwa alel yang mengatur mutan petit merupakan alel resesif. Tipe ke dua. Ketika sel petit netral bertemu dengan sel tipe liar. yang disebut petit netral. Dengan perkataan lain. Hasil yang sama akan diperoleh apabila zigot diploid disilang balik dengan tetua petitnya.

Segregasional Supresif Netral ha ploid : x x x zigot diploid : normal normal petit askospor a: 2 normal : 2 petit normal 4 4 petit .

Dengan demikian. cerevisae. Pewarisan mutasi petit pada persilangan dengan tipe liarnya (lingkaran kecil menggambarkan sel petit . yang pewarisannya berlangsung uniparental melalui tetua betina (pewarisan maternal) meskipun sebenarnya pada jamur ini belum ada perbedaan jenis kelamin yang nyata. Mutan mitokondria pada Neurospora yang diwariskan melalui tetua 10/31/2009 Posted by zaifbio | Genetika Dasar | Tinggalkan sebuah Komentar . Selain pada khamir S. seperti halnya pada tipe petit netral. kasus mutasi mitokondria juga dijumpai pada jamur Neurospora. nukleus bergaris untuk pembentukan petit) mendatar membawa alel Tipe ke tiga disebut petit supresif.1. yang hingga kini belum dapat dijelaskan dengan baik. hasil meiosis zigot petit ini adalah empat askospora yang semuanya mempunyai fenotipe petit. Selanjutnya.Gambar 8. Bedanya. Petit supresif juga mengalami kerusakan pada materi genetik mitokondrianya tetapi kerusakannya tidak separah pada petit netral. pewarisan uniparental juga terjadi pada tipe petit supresif. Pada persilangannya dengan tipe liar dihasilkan zigot diploid dengan fenotipe petit. pada petit supresif alel penyebab petit bertindak sebagai penghambat (supresor) dominan terhadap aktivitas mitokondria tipe liar.

individu-individu yang dihasilkan melalui kombinasi gamet tersebut memperlihatkan nisbah . disebut sebagai kromosom kelamin. Akibatnya. Keberadaan gen berangkai pada suatu spesies organisme. Salah satu dari keempat kelompok gen berangkai atau keempat pasang kromosom pada D. menghasilkan peta kromosom untuk spesies tersebut. RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN Pada Bab V telah kita pelajari pola pewarisan sifat yang diatur oleh gen-gen berangkai atau gen-gen yang terletak pada satu kromosom. melanogaster tersebut. terutama hewan dan juga manusia. misalnya peta kromosom pada lalat Drosophila melanogaster yang terdiri atas empat kelompok gen berangkai (Gambar 5. Gen-gen yang terletak pada kromosom kelamin dinamakan gen rangkai kelamin (sex-linked genes) sementara fenomena yang melibatkan pewarisan gen-gen ini disebut peristiwa rangkai kelamin (linkage). mempunyai kromosom kelamin.4). Seperti halnya gen berangkai (autosomal). Ternyata banyak sekali spesies organisme lainnya. yaitu kromosom yang pada individu jantan dan betina sama strukturnya sehingga tidak dapat digunakan untuk membedakan jenis kelamin.RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN BAB VI RANGKAI KELAMIN DAN PENENTUAN JENIS KELAMIN ·     Kromosom Kelamin dan Autosom Gen Rangkai Kelamin Tipe Penentuan Jenis Kelamin Organisme Kromatin Kelamin dan Hipotesis Lyon Pengaruh Hormon Kelamin dalam Penentuan Jenis Kelamin BAB VI. dalam hal ini kromosom nomor 1. Kromosom semacam ini dinamakan autosom. gen-gen rangkai kelamin tidak mengalami segregasi dan penggabungan secara acak di dalam gamet-gamet yang terbentuk. Adapun gen berangkai yang dibicarakan pada Bab V adalah gengen yang terletak pada kromosom selain kromosom kelamin. yang meliputi urutan dan jaraknya satu sama lain. Pemberian nama ini karena strukturnya pada individu jantan dan individu betina memperlihatkan perbedaan sehingga dapat digunakan untuk membedakan jenis kelamin individu.

Kromosom X dan Y masimg-masing lazim dilambangkan dengan tanda dan .H Morgan pada tahun 1910. Pada bab ini akan dijelaskan cara pewarisan macam-macam gen rangkai kelamin tersebut serta beberapa sistem penentuan jenis kelamin pada berbagai spesies organisme. Gen semacam ini dinamakan gen rangkai kelamin tak sempurna (incompletely sex-linked genes). Gen rangkai kelamin dapat dikelompok-kelompokkan berdasarkan atas macam kromosom kelamin tempatnya berada.1. Selain itu. ternyata berbeda jika tetua jantan yang digunakan adalah tipe alami (bermata merah) dan tetua betinanya bermata putih. jika pada percobaan Mendel perkawinan resiprok (genotipe tetua jantan dan betina dipertukarkan) menghasilkan keturunan yang sama. sedang gen pengatur tipe alami. Persilangan resiprok dengan hasil yang berbeda ini memberikan petunjuk bahwa pewarisan warna mata pada Drosophila ada hubungannya dengan jenis kelamin. misalnya pengatur warna mata merah ini. maka gen rangkai kelamin dapat menjadi gen rangkai X (Xlinked genes) dan gen rangkai Y (Y-linked genes). perkawinan resiprok menghasilkan keturunan yang berbeda. dapat dilambangkan dengan tanda +. melanogaster jantan bermata putih dengan betina bermata merah. Di samping itu. Dengan perkataan lain. dan ternyata kemudian memang diketahui bahwa gen yang mengatur warna mata pada Drosophila terletak pada kromosom kelamin. khususnya pada generasi F1. Lalat bermata merah lazim dianggap sebagai lalat normal atau tipe alami (wild type). gen pengatur warna mata ini dikatakan sebagai gen rangkai X. ada pula beberapa gen yang terletak pada kromosom X tetapi memiliki pasangan pada kromosom Y. Oleh karena itu. dalam hal ini kromosom X. Dia menyilangkan lalat D. P: x betina normal jantan mata putih + + w x betina mata putih jantan normal P: w w + F1 : + w + F1: + w w betina normal jantan normal betina normal jantan mata putih . Hasil persilangan Morgan tersebut.fenotipe dan genotipe yang menyimpang dari hukum Mendel. tidak demikian halnya untuk sifat-sifat yang diatur oleh gen rangkai kelamin. Oleh karena kromosom kelamin pada umumnya dapat dibedakan menjadi kromosom X dan Y. Secara skema pewarisan warna mata pada Drosophila dapat dilihat pada Gambar 6. Pewarisan Rangkai X Percobaan yang pertama kali mengungkapkan adanya peristiwa rangkai kelamin dilakukan oleh T. meskipun tidak selalu. Biasanya. gen tipe alami bersifat dominan terhadap alel mutannya.

1.a) b) Gambar 6. lalat F1 jantan warna matanya seperti tetua betinanya. yaitu putih. Rangkai X pada kucing Warna bulu pada kucing ditentukan oleh suatu gen rangkai X. individu jantan yang hanya membawa sebuah kromosom X akan menghasilkan dua macam gamet yang berbeda.b. akan nampak bahwa lalat F1 betina mempunyai mata seperti tetua jantannya. Diagram persilangan rangkai X pada Drosophila Jika kita perhatikan Gambar 6. Individu jantan ini dikatakan bersifat heterogametik. yaitu gamet yang membawa kromosom X dan gamet yang membawa kromosom Y. kasus hemofilia telah dijumpai sejak lama di negara-negara Arab ketika beberapa anak laki-laki meninggal akibat perdarahan hebat setelah dikhitan. Istilah hemizigot digunakan untuk menyebutkan genotipe individu dengan sebuah kromosom X. individu betina membawa dua buah kromosom X. Melalui dua dari keempat cucu yang heterozigot inilah penyakit hemofilia tersebar di kalangan keluarga Kerajaan Rusia dan Spanyol. anggota keluarga Kerajaan Inggris saat ini yang merupakan keturunan putra/putri normal Ratu Victoria bebas dari penyakit hemofilia. individu betina ini dikatakan bersifat homogametik. salah seorang di antara putra Ratu Victoria menderita hemofilia sementara dua di antara putrinya karier atau heterozigot. Pada Drosophila. Rangkai Z pada ayam . Dari kedua putri yang heterozigot ini lahir tiga cucu laki-laki yang menderita hemofilia dan empat cucu wanita yang heterozigot. Individu dengan gen dominan yang terdapat pada satu-satunya kromosom X dikatakan hemizigot dominan. waktu itu kematian akibat perdarahan ini hanya dianggap sebagai takdir semata. yaitu normal/merah. Sebaliknya. sehingga gamet-gamet yang dihasilkannya akan mempunyai susunan gen yang sama. Pewarisan sifat semacam ini disebut sebagai criss cross inheritance. Oleh karena itu. Hemofilia baru menjadi terkenal dan dipelajari pola pewarisannya setelah beberapa anggota keluarga Kerajaan Inggris mengalaminya. individu yang memilikinya disebut hemizigot resesif. Rangkai X pada manusia Salah satu contoh gen rangkai X pada manusia adalah gen resesif yang menyebabkan penyakit hemofilia. maka kucing berbulu tortoise shell hanya terdapat pada jenis kelamin betina. Sebenarnya. jika gen tersebut resesif. Sebaliknya. Oleh karena genotipe heterozigot untuk gen rangkai X hanya dapat dijumpai pada individu betina. Individu homozigot resesif (betina) dan hemizigot resesif (jantan) akan berbulu kuning. Sementara itu. dan juga beberapa spesies organisme lainnya. Dalam keadaan heterozigot gen ini menyebabkan warna bulu yang dikenal dengan istilah tortoise shell. Namun. yang dengan sendirinya homolog. individu homozigot dominan (betina) dan hemizigot dominan (jantan) mempunyai bulu berwarna hitam. Awalnya. yaitu gangguan dalam proses pembekuan darah. Sebaliknya. Sementara itu.1.

Hanya saja. ternyata ada bagian atau segmen tertentu pada kedua kromosom tersebut yang homolog satu sama lain. Contoh gen holandrik pada manusia adalah Hg dengan alelnya hg yang menyebabkan bulu kasar dan panjang. maka gen rangkai Y diduga merupakan gen yang sangat stabil. P: + + x b b P: b b x + + jantan normal betina normal jantan bulu pendek betina bulu pendek . Biasanya suatu gen/alel dapat dideteksi keberadaannya apabila fenotipe yang dihasilkannya adalah abnormal. Oleh karena itu. pada kasus ini alel resesif justru dianggap sebagai tipe alami atau normal (dilambangkan dengan +). menyebabkan bulu ayam menjadi burik. Jumlah yang sangat sedikit ini mungkin disebabkan oleh sulitnya menemukan alel mutan bagi gen rangkai Y yang dapat menghasilkan fenotipe abnormal. Alelnya. Br. melanogaster terdapat gen rangkai kelamin tak sempurna yang menyebabkan pertumbuhan bulu pendek. sedang individu heterogametik (ZW) adalah betina. Contoh gen rangkai Z yang lazim dikemukakan adalah gen resesif br yang menyebabkan pemerataan pigmentasi bulu secara normal pada ayam. pada rangkai Z justru terjadi sebaliknya. Ht dengan alelnya ht yang menyebabkan pertumbuhan bulu panjang di sekitar telinga. Pada D. Individu homogametik (ZZ) adalah jantan. gen-gen pada segmen kromosom X dan Y yang homolog ini disebut juga gen rangkai kelamin tak sempurna. kalau pada rangkai X individu homogametik berjenis kelamin pria/jantan sementara individu heterogametik berjenis kelamin wanita/betina. ada beberapa gen pada kromosom X yang mempunyai alel pada kromosom Y. Pewarisan Rangkai Y Pada umumnya kromosom Y hanya sedikit sekali mengandung gen yang aktif. dan berlangsung seperti halnya pewarisan gen autosomal. Oleh karena fenotipe abnormal yang disebabkan oleh gen rangkai Y jumlahnya sangat sedikit. dan Wt dengan alelnya wt yang menyebabkan abnormalitas kulit pada jari. Pewarisan Rangkai Kelamin Tak Sempurna Meskipun dari uraian di atas secara tersirat dapat ditafsirkan bahwa kromosom X tidak homolog dengan kromosom Y. Pewarisan gen yang bersifat resesif ini dapat dilihat pada Gambar 6. Pewarisan sifat yang diatur oleh gen semacam ini dapat dikatakan tidak dipengaruhi oleh jenis kelamin.Pada dasarnya pola pewarisan sifat rangkai Z sama dengan pewarisan sifat rangkai X. sedang alel dominannya merupakan alel mutan. Dengan perkataan lain.2. Jadi. Gen rangkai Y jelas tidak mungkin diekspresikan pada individu betina/wanita sehingga gen ini disebut juga gen holandrik.

Selain kedua sistem tersebut. mengikuti sistem ZW.1. Diagram pewarisan gen rangkai kelamin tak sempurna Dapat dilihat pada Gambar 6. Secara ringkas penentuan jenis kelamin dengan sistem X/A pada lalat Drosophila dapat dilihat pada Tabel 6.2 bahwa perkawinan resiprok untuk gen rangkai kelamin tak sempurna akan memberikan hasil yang sama seperti halnya hasil yang diperoleh dari perkawinan resiprok untuk gen-gen autosomal.B. dan tidak ada hubungannya dengan kromosom Y. Penentuan jenis kelamin pada lalat Drosophila Σ kromosom X 1 Σ autosom 2 nibah X/A 0. Dia berhasil menyimpulkan bahwa sistem penentuan jenis kelamin pada organisme tersebut berkaitan dengan nisbah banyaknya kromosom X terhadap banyaknya autosom. Sebaliknya.F1 : + b betina normal a) + b jantan normal F1: + b betina normal b) + b jantan normal Gambar 6. sedang pada ayam. Dengan demikian. Sistem nisbah X/A C. Di dalam sel somatisnya. misalnya belalang. Bedanya. Jadi. Sistem Penentuan Jenis Kelamin Telah disebutkan di atas bahwa pada manusia dan mamalia. Wilson menemukan bahwa sel somatis serangga Protenor betina mempunyai 14 kromosom.2. jumlah kromosom sel somatis individu betina lebih banyak daripada jumlah pada individu jantan. hal ini mirip dengan sistem XY. Tabel 6. Sistem XO Sistem XO dijumpai pada beberapa jenis serangga. dan unggas lainnya serta ikan tertentu. Jadi.1. dalam hal ini kucing. pada sistem XO individu jantan tidak mempunyai kromosom Y. individu betina memiliki dua buah kromosom X sementara individu jantan hanya mempunyai sebuah kromosom X. Sebagai contoh. individu pria/jantan adalah heterogametik (XY) sementara wanita/betina adalah homogametik (XX). pada ayam individu jantan justru homogametik (ZZ) sementara individu betinanya heterogametik (ZW).B. pewarisan gen rangkai kelamin tak sempurna mempunyai pola seperti pewarisan gen autosomal. Dalam hal ini kromosom Y hanya berperan mengatur fertilitas jantan. Berikut ini akan dijelaskan beberapa di antaranya. E. masih banyak sistem penentuan jenis kelamin lainnya. Penentuan jenis kelamin pada manusia/mamalia dikatakan mengikuti sistem XY. sedang pada individu jantannya hanya ada 13 kromosom.5 jenis kelamin jantan . Bridge melakukan serangkaian penelitian mengenai jenis kelamin pada lalat Drosophila.

5 1.5 0. Adanya kromosom X yang didapatkan melebihi jumlah kromosom X pada individu normal (diploid) ini disebabkan oleh terjadinya peristiwa yang dinamakan gagal pisah (non disjunction).1 akan terlihat bahwa ada beberapa individu yang jumlah kromosom X-nya lebih dari dua buah.33 1 1 0. Partenogenesis .67 0. Pada Drosophila terjadinya gagal pisah dapat menyebabkan terbentuknya beberapa individu abnormal seperti nampak pada Gambar 6. Lalat ini dikatakan mengalami mozaik seksual atau biasa disebut dengan istilah ginandromorfi.2 3 4 4 3 3 2 2 1 2 2 3 4 3 4 3 4 3 1 1.3. yakni individu dengan jenis kelamin metabetina. serta interseks. betina triploid dan tetraploid.75 0. Diagram munculnya beberapa individu abnormal pada Drosophila akibat peristiwa gagal pisah Di samping kelainan-kelainan tersebut pernah pula dilaporkan adanya lalat Drosophila yang sebagian tubuhnya memperlihatkan sifat-sifat sebagai jenis kelamin jantan sementara sebagian lainnya betina. yaitu gagal berpisahnya kedua kromosom X pada waktu pembelahan meiosis. Dalam hal ini ada sel yang menerima dua kromosom X tetapi ada pula yang hanya menerima satu kromosom X. Penyebabnya adalah ketidakteraturan distribusi kromosom X pada masa-masa awal pembelahan mitosis zigot. P: E AAXX x AAXY G gagal pisah gamet : F1 : AXX AO AX AAXXY AY AAXO letal AAOY AAXXX betina betina super jantan steril Gambar 6.33 betina metabetina metabetina betina 4n betina 3n interseks interseks jantan metajantan Jika kita perhatikan kolom pertama pada Tabel 6.3.

alel-alel resesif sk dan ts masing-masing menghalangi pembentukan bunga betina dan mensterilkan bunga jantan.L. yang mengatur pembentukan bunga jantan. Sementara itu. atau dengan perkataan lain. Jagung monosius ini mempunyai fenotipe Sk_Ts_. misalnya sel epitel selaput lendir mulut. yaitu melalui telur yang tidak dibuahi. cacing yang hidup di lingkungan betina dewasa akan mendekati dan memasuki saluran reproduksi cacing betina dewasa tersebut untuk kemudian berkembang menjadi individu jantan yang parasitik. Sistem gen Sk-Ts Di atas disebutkan bahwa sistem penentuan jenis kelamin pada lebah tidak berhubungan dengan kromosom kelamin. Sebaliknya. Struktur semacam ini ternyata tidak dijumpai pada sel-sel kucing jantan. Jagung normal monosius (berumah satu) mempunyai gen Sk. dapat dikatakan bahwa partenogenesis merupakan sistem penentuan jenis kelamin yang tidak ada sangkut pautnya sama sekali dengan kromosom kelamin tetapi hanya bergantung kepada jumlah genom (perangkat kromosom). Pada jagung dikenal sistem penentuan jenis kelamin yang tidak bergantung. Oleh karena itu. dan tawon. wanita normal mempunyai sebuah . dapat dibedakan dengan sel somatis wanita atas dasar ada tidaknya struktur tertentu yang kemudian dikenal dengan nama kromatin kelamin atau badan Barr. F. individu jantan berkembang dengan cara partenogenesis. individu jantan ini hanya memiliki sebuah genom atau perangkat kromosomnya haploid. bunga betina tetap terbentuk seakan-akan tidak ada alel sk. Hal ini misalnya dijumpai pada cacing laut Bonellia. Sementara itu.. yang jenis kelaminnya semata-mata ditentukan oleh faktor lingkungan. individu betina dan golongan pekerja.Pada beberapa spesies Hymenoptera seperti semut. Kromatin Kelamin Seorang ahli genetika dari Kanada. Selanjutnya diketahui bahwa banyaknya kromatin kelamin ternyata sama dengan banyaknya kromosom X dikurangi satu. berkembang dari telur yang dibuahi sehingga perangkat kromosomnya adalah diploid. Barr. tetapi didasarkan atas keberadaan gen tertentu. jagung dengan fenotipe Sk_tsts adalah betina diosius (berumah dua). Pengaruh lingkungan Sistem penentuan jenis kelamin bahkan ada pula yang bersifat nongenetik. pada tahun 1949 menemukan adanya struktur tertentu yang dapat memperlihatkan reaksi pewarnaan di dalam nukleus sel syaraf kucing betina. sistem tersebut masih ada kaitannya dengan jumlah perangkat kromosom. sedang jagung skskTs_ adalah jantan diosius. Meskipun demikian. Baltzer menemukan bahwa cacing Bonellia yang berasal dari sebuah telur yang diisolasi akan berkembang menjadi individu betina. yang mengatur pembentukan bunga betina. Pada manusia dilaporkan pula bahwa sel-sel somatis pria. lebah. M. Jagung sksktsts berjenis kelamin betina karena ts dapat mengatasi pengaruh sk. Oleh karena itu. baik kepada kromosom kelamin maupun jumlah genom. Pada sel somatis wanita terdapat sebuah kromatin kelamin sementara sel somatis pria tidak memilikinya. dan gen Ts. Dengan demikian. Jadi. khususnya pada lebah.

Selanjutnya. misalnya penderita sindrom Klinefelter (XXY). Hormon dan Diferensiasi Kelamin Dari penjelasan mengenai berbagai sistem penentuan jenis kelamin organisme diketahui bahwa faktor genetis memegang peranan utama dalam ekspresi sifat kelamin primer. kelenjar adrenalin menghasilkan steroid yang secara kimia berhubungan erat dengan gonad. Mary F. dan kelenjar adrenalin. Tabel 6. seorang ahli genetika dari Inggris mengajukan hipotesis bahwa kromatin kelamin merupakan kromosom X yang mengalami kondensasi atau heterokromatinisasi sehingga secara genetik menjadi inaktif. mempunyai sebuah kromatin kelamin yang seharusnya tidak dimiliki oleh seorang pria normal. gen autosomal H yang mengatur pembentukan tanduk pada domba akan bersifat dominan pada individu jantan tetapi resesif pada individu betina. Ovarium dan testes masing-masing mempunyai fungsi ganda. gen rangkai X pada individu homozigot akan diekspesikan sama kuat dengan gen rangkai X pada individu hemizigot. Mekanisme kompensasi dosis diusulkan karena adanya fenomena bahwa suatu gen rangkai X akan mempunyai dosis efektif yang sama pada kedua jenis kelamin. Dengan perkataan lain. Oleh karena itu. bersifat dominan pada domba betina tetapi resesif pada domba jantan. Individu betina heterozigot memperlihatkan fenotipe mozaik yang jelas berbeda dengan ekspresi gen semidominan (warna antara yang seragam).2. Sebagai contoh. wanita penderita sindrom Turner (XO) tidak mempunyai kromatin kelamin yang seharusnya ada pada wanita normal. Pada hewan tingkat tinggi dan manusia hormon kelamin disintesis oleh ovarium. Sebaliknya. Dewasa ini keberadaan kromatin kelamin sering kali digunakan untuk menentukan jenis kelamin serta mendiagnosis berbagai kelainan kromosom kelamin pada janin melalui pengambilan cairan amnion embrio (amniosentesis). testes. yaitu sebagai penghasil sel kelamin (gamet) dan sebagai penghasil hormon kelamin. Gen terpengaruh kelamin Gen terpengaruh kelamin (sex influenced genes) ialah gen yang memperlihatkan perbedaan ekspresi antara individu jantan dan betina akibat pengaruh hormon kelamin. Demikian pula. Sebaliknya. Hipotesis ini dilandasi hasil pengamatannya atas ekspresi gen rangkai X yang mengatur warna bulu pada mencit. Pria dengan kelainan kromosom kelamin. alelnya h. Kromosom X yang aktif pada suatu sel mungkin membawa gen dominan sementara pada sel yang lain mungkin justru membawa gen resesif. untuk dapat bertanduk domba betina harus mempunyai dua gen H (homozigot) sementara domba jantan cukup dengan satu gen H (heterozigot). pria normal tidak mempunyai kromatin kelamin karena kromosom X-nya hanya satu. Lyon. Hal ini menunjukkan bahwa hanya ada satu kromosom X yang aktif di antara kedua kromosom X pada individu betina. Hipotesis Lyon juga menjelaskan adanya mekanisme kompensasi dosis pada mamalia. Sementara itu. Ekspresi gen terpengaruh kelamin pada domba . sistem hormon akan mengatur kondisi fisiologi dalam tubuh individu sehingga mempengaruhi perkembangan sifat kelamin sekunder.kromatin kelamin karena kromosom X-nya ada dua.

10/31/2009 Posted by zaifbio | Genetika Dasar | 7 Komentar BERANGKAI BAB V BERANGKAI     Dua Gen Berangkai dan Pindah Silang Tiga Gen Berangkai dan Pindah Silang Ganda Pemetaan Kromosom Pemetaan Kromosom pada Manusia BAB V. Untuk dapat mengalami kebotakan seorang wanita harus mempunyai gen B dalam keadaan homozigot. Akibatnya.Genotipe HH Hh hh Domba jantan bertanduk bertanduk tidak bertanduk Domba betina bertanduk tidak bertanduk tidak bertanduk Contoh lain gen terpengaruh kelamin adalah gen autosomal B yang mengatur kebotakan pada manusia. yang dengan sendirinya hanya dapat diekspresikan pada individu betina. baik monohibrid maupun dihibrid. BERANGKAI Percobaan-percobaan persilangan pada kacang ercis yang dilakukan oleh Mendel. . tetapi memungkinkan pula kombinasi gen resesif untuk warna biji (k) dengan gen resesif untuk bentuk biji (b). Namun. pria heterozigot akan mengalami kebotakan. Gen B dominan pada pria tetapi resesif pada wanita. Contoh gen semacam ini adalah gen yang mengatur produksi susu pada sapi perah. yakni hukum segegasi dan hukum pemilihan bebas. Gen terbatasi kelamin Selain mempengaruhi perbedaan ekspresi gen di antara jenis kelamin. sedang wanita heterozigot akan normal. Jika kembali kita perhatikan persilangan dihibrid menyangkut pewarisan warna biji dan bentuk biji. gen b dominan pada wanita tetapi resesif pada pria. dan juga kombinasi gen K dengan gen b. serta gen k dengan gen B. maka akan terlihat bahwa gamet-gamet yang terbentuk tidak hanya mengandung kombinasi gen dominan untuk warna biji (K) dengan gen dominan untuk bentuk biji (B). Gen yang hanya dapat diekspresikan pada salah satu jenis kelamin dinamakan gen terbatasi kelamin (sex limited genes). Sebaliknya. individu jantan dengan genotipe tertentu sebenarnya juga mempunyai potensi untuk menghasilkan keturunan dengan produksi susu yang tinggi sehingga keberadaannya sangat diperlukan dalam upaya pemuliaan ternak tersebut. hormon kelamin juga dapat membatasi ekspresi gen pada salah satu jenis kelamin. Oleh karena peluang terjadinya kombinasi-kombinasi tersebut sama besar. telah menghasilkan dua hukum Mendel.

dan ab dengan nisbah n : 1 : 1 : n. Artinya. dan A. Muller. Gen-gen yang mengatur warna biji dan bentuk biji dewasa ini telah diketahui letaknya masing-masing.H. dan gen a berangkai dengan gen B. Artinya. Akan tetapi. a dan b. Saat ini kita telah mengetahui bahwa banyaknya gen pada kacang ercis. mereka tidak dapat memberikan interpretasi terhadap hasil persilangan yang diperoleh. Dari konsep mengenai berangkai ini selanjutnya berkembang pengetahuan mengenai pindah silang (crossing over) dan pemetaan kromosom. jika gen A dan gen B berangkai pada suatu kromosom sementara alel-alel resesifnya. pola segregasi dan rekombinasinya tidak bebas sehingga tiap macam gamet yang dihasilkannya pun menjadi tidak sama jumlahnya.Bateson dan R.J. sedang fenomenanya sendiri dinamakan berangkai (linkage). .maka keempat macam gamet yang dihasilkan. Sturtevant. Sebaliknya. Dalam hal ini n merupakan bilangan positif dengan nilai lebih dari satu. maka gamet yang mengandung gen-gen dominan dan gamet yang mengandung gen-gen resesif akan dijumpai lebih banyak daripada gamet dengan kombinasi gen dominan-resesif. Ab. dan juga pada setiap spesies organisme lainnya. termasuk cara memetakannya pada kromosom tempat mereka berada. Sebagai contoh. Gen-gen yang terdapat pada kromosom yang sama dinamakan gen-gen berangkai (linked genes). sedang gen pengatur bentuk biji terletak pada kromosom 7. jika gen A berangkai dengan gen b. yaitu KB. Gen pengatur warna biji terletak pada kromosom 1. juga berangkai pada kromosom homolognya. kalau gen-gen yang berangkai adalah sesama dominan dan sesama resesif. jauh lebih banyak daripada jumlah kromosomnya. Baru sekitar lima tahun kemudian seorang ahli genetika dan embriologi dari Amerika Serikat. barangkali Mendel tidak akan berhasil merumuskan hukum pemilihan bebas. Jadi. Demikian pula. yang sebagian besar melibatkan karya Morgan dan para mahasiswanya seperti C. Adanya perbedaan jumlah di antara macam gamet yang terbentuk tersebut disebabkan oleh kecenderungan gen-gen berangkai untuk selalu berada bersama-sama. dan kb. Morgan. di dalam sebuah kromosom tertentu dapat dijumpai lebih dari sebuah gen. akan menjadi pokok bahasan pada Bab V ini. Seluk-beluk mengenai gen-gen berangkai. maka nisbah gamet AB : Ab : aB : ab menjadi 1 : n : n : 1.C Punnet pada tahun 1906. Dua Gen Berangkai Dua buah gen yang berangkai akan mengalami segregasi dan rekombinasi dengan pola yang tidak mengikuti hukum Mendel. gamet yang mengandung kombinasi gen dominanresesif akan lebih banyak jumlahnya daripada gamet dengan kandungan gen sesama dominan dan sesama resesif. Bridges. aB. kB. Kb.B.H. dapat menjelaskan mekanisme pewarisan gen-gen berangkai pada lalat Drosophila melanogaster. dalam keadaan gen dominan berangkai dengan gen resesif. Seandainya gen pengatur warna biji dan gen pengatur bentuk biji terletak pada kromosom yang sama. H. akan mempunyai nisbah 1 : 1 : 1 : 1. maka gamet-gamet yang dihasilkan akan terdiri atas AB. T. Fenomena berangkai pertama kali ditemukan pada percobaan dihibrid oleh W. Inilah keuntungan lain yang diperoleh Mendel di samping secara kebetulan tanaman yang digunakan adalah diploid.

Jadi. penulisan AaBb hanya digunakan apabila kedua gen tersebut tidak berangkai. . akan tampak bahwa dua buah gen yang berangkai dapat berada pada dua macam kedudukan atau konfigurasi yang berbeda. A a gamet : A A a a a) B b B b 1 1 1 1 A a A a b) B b b B c) n n 1 1 A a A a b B B b n n 1 1 B b A a B b A a b B Gambar 5.1 di bawah ini secara skema dapat diperbandingkan tiga kemungkinan segregasi dan rekombinasi gen-gen pada individu dihibrid AaBb.1. Sebaliknya.c). yang masing-masing disebut sebagai gamet tipe parental dan gamet tipe rekombinasi.a) memperlihatkan pola segregasi dan rekombinasi gen-gen yang terjadi secara bebas karena keduanya tidak berangkai.1.1. Sementara itu. pada Gambar 5. Baik pada kedudukan sis maupun trans terdapat dua macam gamet. Gamet yang terbentuk dari individu dihibrid a) Kedua gen tidak berangkai b) Kedua gen berangkai dengan kedudukan sis c) Kedua gen berangkai dengan kedudukan trans Kedudukan Dua Gen Berangkai Kalau kita perhatikan lagi Gambar 5. Kedudukan gen berangkai harus tercerminkan pada notasi individu yang bersangkutan.1.c) tampak bahwa segregasi dan rekombinasi kedua gen tidak terjadi secara bebas. Kedudukan gen berangkai semacam ini dinamakan sis atau coupling phase.1.b) dan 5.1. maka kedudukannya dinamakan trans atau repulsion phase. misalnya. Pada Gambar 5. Gambar 5. Individu dihibrid AaBb. Jadi. jika gen dominan berangkai dengan gen resesif seperti pada Gambar 5. Gamet tipe parental mempunyai susunan gen yang sama dengan susunan gen pada individu.b) gen dominan A berangkai dengan gen dominan B dan gen resesif a berangkai dengan gen resesif b.1.Untuk lebih jelasnya pada Gambar 5. ditulis sebagai AB/ab jika kedua gen tersebut berangkai dengan kedudukan sis. sedang gamet tipe rekombinasi susunan gennya merupakan rekombinasi susunan gen pada individu. Dua gen yang berangkai cenderung untuk selalu bersama-sama atau tidak bersegregasi di dalam gametgamet yang terbentuk. dan ditulis sebagai Ab/aB jika kedudukan berangkainya adalah trans. individu dihibrid AaBb akan menghasilkan gamet tipe parental AB dan ab serta gamet tipe rekombinasi Ab dan aB jika kedua gen tersebut berangkai dengan kedudukan sis.

sedang gamet tipe rekombinasi berkisar dari 0% hingga 50%. seleksi alam akan bekerja untuk mempertahankan . Seperti telah dijelaskan. Besar kecilnya jumlah. Gamet tipe parental jumlahnya selalu lebih besar atau setidak-tidaknya sama dengan jumlah gamet tipe rekombinasi. Sekarang dengan lebih mudah dapat kita katakan bahwa gamet tipe parental adalah gamet bukan hasil pindah silang. maka hal ini berarti kedua gen tidak berangkai. yaitu pertukaran materi genetik (gen) di antara kromosom-kromosom homolog. Sebagai contoh. gamet tipe rekombinasi jumlahnya paling banyak hanya 50%. Di atas telah dikatakan bahwa gamet tipe parental adalah gamet dengan susunan gen yang sama dengan susunan gen pada individu. atau persentase. Dengan perkataan lain. maka kedua gen dikatakan mempunyai loki (tempat gen pada kromosom) yang sangat berdekatan. sedang gamet tipe rekombinasi adalah gamet hasil pindah silang. Makin panjang jarak antara dua gen berangkai. Jika gamet tipe parental sama banyaknya dengan gamet tipe rekombinasi (masing-masing 50% atau nisbah gamet = 1 : 1 : 1 : 1). Sebaliknya. Terjadinya segregasi dan rekombinasi dua buah gen berangkai ini tidak lain karena mereka mengalami peristiwa yang dinamakan pindah silang (crossing over). di antara keduanya masih terdapat pula kemungkinan untuk mengalami segregasi dan rekombinasi sehingga akan diperoleh kombinasi gen-gen seperti yang dijumpai pada gamet tipe rekombinasi. Peristiwa pindah silang. Dari pengertian pindah silang tersebut kita dapat menyederhanakan batasan tentang gamet tipe parental dan gamet tipe rekombinasi.H. Akan tetapi.Kebalikannya. Di atas nilai ini peningkatan jarak tidak terus-menerus diikuti oleh peningkatan persentase gamet tipe rekombinasi. gamet tipe rekombinasi oleh A. maka gamet tipe parentalnya adalah Ab dan aB sementara gamet tipe rekombinasinya adalah AB dan ab. Pindah Silang Telah disebutkan bahwa dua buah gen yang berangkai akan cenderung untuk tetap bersamasama di dalam gamet yang terbentuk. maka jarak antara kedua gen berangkai tersebut dikatakan sama dengan 20% atau 20 satuan peta atau 20 Morgan. sedang gamet tipe rekombinasi adalah gamet yang susunan gennya merupakan rekombinasi susunan gen pada individu. merupakan mekanisme penting yang mendasari pembentukan keanekaragaman genetik karena kedua-duanya akan menghasilkan kombinasi baru di antara gen-gen yang terdapat pada individu sebelumnya. jika suatu individu dihibrid dengan gen-gen yang berangkai menghasilkan gamet tipe parental sebanyak 80% atau gamet tipe rekombinasi sebanyak 20%. jika semua gamet yang ada merupakan gamet tipe parental. gamet tipe parental jumlahnya berkisar dari 50% hingga 100%. atau dengan perkataan lain sama sekali tidak terdapat gamet tipe rekombinasi. makin besar persentase gamet tipe rekombinasi yang dihasilkan. bersama-sama dengan pemilihan bebas (hukum Mendel II). Di sisi lain jarak antara dua gen berangkai dapat mencapai lebih dari 100%. Sturtevant digunakan untuk menggambarkan jarak fisik antara dua gen berangkai. Sebenarnya hubungan linier antara jarak dua gen berangkai dan persentase gamet tipe rekombinasi hanya berlaku lebih kurang hingga nilai 20%. Setiap satuan peta ditetapkan sebagai jarak antara dua gen berangkai yang dapat menghasilkan gamet tipe rekombinasi sebanyak 1%. jika kedua gen tersebut berangkai dengan kedudukan trans. Selanjutnya. misalnya jarak terpanjang antara dua gen berangkai pada kromosom 1 tanaman jagung yang mencapai 161%.

keberadaan gen-gen resesif dapat dideteksi karena ekspresinya tidak tertutup oleh gen dominan. keempat kromatid ini akan membentuk sinapsis yang dinamakan tetrad. Oleh karena itulah. Kapang ini sangat cocok untuk keperluan analisis genetik terutama karena dalam fase reproduksi aseksualnya terdapat askosopra haploid yang akan mengalami pembelahan mitosis sehingga berkecambah dan tumbuh menjadi miselium multisel yang juga haploid. Secara skema bukti yang menujukkan bahwa pindah silang terjadi pascaduplikasi kromosom dapat dilihat pada Gambar 5.genotipe-genotipe dengan kombinasi gen yang adaptif saja. Pindah silang terjadi pascaduplikasi kromosom Pada profase I meiosis kedua kromosom homolog akan mengalami duplikasi menjadi empat buah kromatid (lihat Bab IV). banyak ilmuwan yang menganggap bahwa pindah silang dan pemilihan bebas sangat penting bagi berlangsungnya proses evolusi. Selanjutnya. Bukti bahwa pindah silang terjadi sesudah kromosom homolog mengalami duplikasi diperoleh dari hasil analisis genetik pada percobaan menggunakan kapang Neurospora crassa. Pada saat terbentuknya konfigurasi tetrad inilah pindah silang terjadi. . Dengan adanya miselium haploid inilah. Pola askus A b A a a a B B b B a B a B binasi A b A b A b 100% rekom- Meiosis I Mitosis a) Meiosis II.2 di bawah ini.

pada Gambar 5. Oleh karena kemungkinan pada Gambar 5. maka dapat disimpulkan bahwa pindah silang terjadi setelah kromosom mengalami duplikasi. Tampak bahwa kedelapan askospora yang terbentuk terdiri atas dua macam.2.2.b) pindah silang terjadi sesudah kromosom mengalami duplikasi. Di antara askospora tipe parental masih dapat dibedakan lagi askopora dari parental pertama (AB) dengan askospora dari parental kedua (ab).a) pindah silang terjadi sebelum kromosom mengalami duplikasi.Pola askus parental A A a a a B B b b b a a B b a a B b A A B B A B A b A b rekombinasi parental Meiosis I Mitosis b) Meiosis II.b) ini masuk akal.2. Persentase pindah silang menggambarkan jarak antara dua gen berangkai . Sebaliknya. Ternyata dilihat dari kedelapan askospora hasil pembelahan mitosis gamet dapat dipastikan bahwa keempat gamet yang dihasilkan seluruhnya merupakan gamet tipe rekombinasi atau sama sekali tidak ada gamet tipe parental. yaitu askospora yang berasal dari gamet tipe parental dan askosopra yang berasal dari gamet tipe rekombinasi. Gambar 5. Hal ini jelas sesuatu yang tidak mungkin terjadi karena dari penjelasan sebelumnya kita mengetahui bahwa persentase gamet tipe rekombinasi berkisar dari 0 hingga 50%.2. Hasil pindah silang dilihat dari pola askus pada Neurospora crassa Pada Gambar 5.

gamet tipe rekombinasi hasil pindah silang pada interval II. serta AbC dan aBc (hasil pindah silang ganda).3. ada juga gamet tipe parental. pindah silang terjadi antara A dan B sekaligus antara B dan C. dapat terjadi tiga kemungkinan pindah silang. Ke dua. maka gamet tipe rekombinasi yang dihasilkan adalah Abc dan aBC (hasil pindah silang I). Pertama. Kalau kita misalkan bahwa kedudukan ketiga gen berangkai tersebut seperti pada Gambar 5. dan gamet tipe rekombinasi hasil pindah silang ganda. ABc dan abC (hasil pindah silang II). persentase gamet tipe rekombinasi sampai dengan batas tertentu (lebih kurang 20%) memperlihatkan korelasi positif dengan jarak fisik antara dua gen berangkai.Peristiwa pindah silang akan menyebabkan terbentuknya gamet tipe rekombinasi. pindah silang terjadi antara B dan C atau pindah silang pada interval II. A a interval I B b interval II C c A A B B C C a a b b c c . Sementara itu. Ke tiga. besarnya persentase pindah silang juga menggambarkan jarak fisik antara dua gen berangkai. Selain itu. misalnya gen-gen dengan urutan A-B-C. Sesuai dengan banyaknya macam pindah silang yang terjadi. Tiga Gen Berangkai Di antara tiga buah gen berangkai. gamet tipe rekombinasi merupakan gamet hasil pindah silang. yaitu ABC dan abc. pindah silang terjadi antara A dan B atau pindah silang pada interval I. gamet tipe rekombinasi yang dihasilkan ada tiga macam. yaitu gamet tipe rekombinasi hasil pindah silang pada interval I. Kemungkinan yang terakhir ini dinamakan pindah silang ganda (double crossing over). atau seperti disebutkan di atas. Dengan demikian.

gamet dari individu ABC/abc dapat dibagi menjadi empat kelompok. maka hasil persilangannnya ada delapan macam fenotipe. adalah persilangan suatu individu dengan individu homozigot resesif. seperti telah dijelaskan pada Bab II. fenotipe sekaligus genotipe hasil silang ujinya akan ada empat kelompok. kelompok ke tiga gamet pindah silang di daerah II (ABc dan abC). sesuai dengan nisbah gamet individu ABC/abc. Sementara itu. Begitu pula sebaliknya. aaB-cc. aaB-C-. Kelompok pertama adalah gamet tipe parental (ABC dan abc). Jika A-B lebih panjang daripada B-C. Namun. dari individu homozigot resesif aabbcc (abc/abc) hanya akan dihasilkan satu macam gamet. jika gen A berangkai dengan gen B dan gen C. Pindah silang di antara tiga gen berangkai Dari delapan macam gamet yang dihasilkan tersebut. maka nisbah fenotipe yang dihasilkan tidak akan sama tetapi bergantung kepada jumlah tiap macam gamet individu trihibrid tersebut. Seperti pada penjelasan Gambar 5. Sebagai contoh. Silang uji terhadap individu trihibrid dinamakan silang uji tiga titik (three-point test cross). Silang Uji Tiga Titik Silang uji. karena baik gamet tipe parental maupun rekombinasi akan mempunyai susunan gen yang sama. A-bbC-. Jika di antara ketiga gen tersebut tidak ada yang berangkai. Bagaimana dengan gamet hasil pindah silang I dan gamet hasil pindah silang II ? Mana di antara kedua kelompok gamet tipe rekombinasi tersebut yang lebih besar persentasenya ? Jawabannya tentu saja bergantung kepada besarnya jarak A-B dan jarak B-C.3. gamet tipe parental dengan sendirinya paling besar persentasenya. Abbcc. gamet hasil pindah silang II akan dijumpai lebih banyak daripada gamet hasil pindah silang I jika jarak B-C lebih panjang daripada jarak A-B. dengan nisbah 1 : 1 : 1 : 1 : 1 : 1 : 1 : 1. dan aabbcc. yaitu A-B-C-. kelompok ke dua gamet hasil pindah silang di daerah I (Abc dan aBC). aabbC-. dan kelompok ke empat gamet hasil pindah silang ganda (AbC dan aBc). ABC/abc tipe parental (persentasenya terbesar) abc/abc .A A B b C C a a B b c c Gambar 5. A-B-cc. maka gamet hasil pindah silang I lebih banyak daripada gamet hasil pindah silang II. sedang gamet yang paling kecil persentasenya adalah gamet tipe rekombinasi hasil pindah silang ganda. yakni abc. Dengan demikian.3. individu trihibrid AaBbCc disilang uji dengan aabbcc. yang masing-masing terdiri atas dua macam fenotipe.

biasanya notasi fenotipe/genotipe individu hasil silang uji untuk gen-gen berangkai sama dengan notasi untuk gametnya masing-masing. Keduanya dipasangkan menjadi aBC/Abc. Pemetaan Kromosom Data hasil silang uji tiga titik dapat dimanfaatkan untuk membuat peta kromosom. Dengan demikian. Oleh karena itu. Di dalam peta kromosom tiap kromosom disebut sebagai satu kelompok gen berangkai (linkage group). misalnya. pada prinsipnya pembuatan peta kromosom meliputi penentuan urutan gen pada satu kromosom dan penghitungan jarak antara gen yang satu dan lainnya. yaitu dua individu yang persentase atau jumlahnya terbesar (aBC dan Abc). Sebagai contoh.4. yaitu abc. Jadi. individu ABC/abc. yang terdiri atas sederetan gen-gen dengan urutan dan jarak tertentu. cukup ditulis dengan ABC. ABC = 265 ABc = 133 AbC = 6 aBC = 441 Abc = 435 aBc = 4 abC = 139 abc = 227 Untuk menentukan urutan gen yang benar pertama-tama kita cari individu tipe parental di antara kedelapan genotipe tersebut. pada lalat Drosophila melanogaster telah ditemukan adanya empat kelompok gen berangkai seperti dapat dilihat pada Gambar 5. Kemudian.Abc/abc tipe rekombinasi hasil pindah silang antara A dan B (persentasenya bergantung kepada posisi lokus B) aBC/abc ABc/abc tipe rekombinasi hasil pindah silang antara B dan C (persentasenya bergantung kepada posisi lokus B) abC/abc AbC/abc tipe rekombinasi hasil pindah silang ganda (persentasenya terkecil) aBc/abc Salah satu kromosom homolog pada tiap fenotipe/genotipe hasil silang uji tersebut di atas selalu membawa gen-gen dengan susunan yang sama. Langkah-langkah untuk membuat peta kromosom dari data hasil silang uji dapat dijelaskan dengan contoh berikut ini. kita cari . Begitu juga untuk ketujuh genotipe lainnya penulisannya cukup seperti notasi gametnya saja.

Alternatif ke tiga (terakhir) adalah mengubah urutan gen pada individu parental menjadi aCB/Acb. individu parental harus kita ubah urutan gennya. Oleh karena itu. Individu parental dengan urutan gen seperti ini (lokus C di tengah) jika mengalami psg akan menjadi acB/ACb. maka akan diperoleh BAC/bac. Individu parental disimulasi untuk mengalami pindah silang ganda (psg). Artinya. misalnya menjadi BaC/bAc. Jika individu ini mengalami psg. Setelah hasil simuasi ini dicocokkan dengan individu psg yang ada ternyata susunan gennya tidak sama (abC/ABc tidak sama dengan AbC/aBc). 0 y (yellow body) 0 ci (cubitus interruptus eyes) w (whirte eyes) (bent wings) N (Notch wings) (shaven bristles) ec (echinus eyes) rb (ruby eyes) bo (bordeaux eyes) cv (crossveinless wings) ov (oval eyes) ct (cut wings) sn (singed bristles) ed (echinoid eyes) dp (dumpy wings) cl (clot eyes) spd (spade wings) lys (lysine accumulation) jv (javelin bristles) Hn (Henna eyes) fs(3) G2 (betina steril) Cy (Curly wings) net (net wings) 0 ru (roughoid eyes) 0 S (Star eyes) R (Roughened eyes) bt 3 sv IV t (tan body) ras (raspberry eyes) m (miniature wings) wy (wavy wings) g (garnet eyes) pl (pleated wings) tu-48 (abdominal tumors) fy (fuzzy hairs) corr (corrugated wings) J (Jammed wings) se (sepia eyes) cur (curvoid wings) rs (rose eyes) Gl (Glued eyes) st (scarlet eyes) b (black body) eg (eagle wings) . yang ternyata cocok dengan AbC/aBc. aBC/Abc disimulasi untuk mengalami psg menjadi abC/ABc. yang ternyata masih belum cocok juga dengan AbC/aBc.individu hasil pindah silang ganda. dapat disimpulkan bahwa urutan loki gen yang benar adalah A-C-B atau B-C-A. Ini juga kita pasangkan menjadi AbC/aBc. yaitu dua individu yang jumlahnya terkecil (AbC dan aBc). Dengan demikian.

Peta kromosom pada lalat Drosophila melanogaster = sentromir Kromosom I = kromosom kelamin .4.sd (scalloped wings) r (rudimentary wings) B (Bar eyes) car (carnation eyes) rd (reduced bristles) stw (straw bristles) cn (cinnabar eyes) che (cherub wings) cu (curly wings) bx (bithorax body) sr (stripe body) bb (bobbed bristles) 68 I c (curved wings) Amy (Amylase) rf (roof wings) nw (narrow wings) vg (vestigial wings) U (Upturmed wings) Dl (Delta wings) e (ebony body) cd (cardinal eyes) obt (obtuse wings) dsr (disrupted wings) hy (humpy body) ra (rase britles) a (arc wings) Frd (Freckled body) M(2)c (Minute body) 106 108 II Pr (Prickly bristles) r sd (raised wings) ca (claret eyes) M(3)g (Minute body) III Gambar 5.

Nilai KK = 1 menggambarkan adanya independensi yang sempurna di antara dua peristiwa pindah silang yang berurutan sehingga psg O sama besarnya dengan psg E. Nilai KK berkisar dari 0 hingga 1. dan pada contoh soal di atas nilai KK = 0.4% x 17. sedang jarak C-B sama dengan pindah silang antara C dan B. Sementara itu. seperti telah dijelaskan sebelumnya.1% C B . Dengan demikian. Pada soal tersebut di atas persentase pindah silang ganda yang diharapkan atau seharusnya terjadi (psg E) sama dengan 30. acB. acB.2%. yang masing-masing sama dengan persentase pindah silang di antara kedua gen yang diukur jaraknya (ingat ! besarnya persentase pindah silang menggambarkan jarak fisik antara dua gen berangkai). Jadi. jarak A-C = (227 + 265 + 4 + 6) / 1650 x 100% = 30.6% / 5. Derajad interferensi secara kuantitatif diukur dengan suatu nilai yang disebut koefisien koinsidensi (KK). interferensi ini menunjukkan bahwa pindah silang di suatu tempat akan menghalangi terjadinya pindah silang di dekatnya.1% = 5. dan ACb. ACB. Namun.2% = 0.12. yang merupakan nisbah psg O terhadap psg E.J. data hasil silang uji tersebut di atas diubah urutan gennya sehingga menjadi ACB = 265 AcB = 133 ACb = 6 aCB = 441 Acb = 435 acB = 4 aCb = 139 acb = 227 Selanjutnya. sehingga jarak C-B = (139 + 133 + 4 + 6) / 1650 x 100% = 17. Sebaliknya. maka individu hasil pindah silang antara A dan C terdiri atas acb. jarak A-C sama dengan pindah silang antara A dan C.Mutan yang diawali dengan huruf besar = mutan dominan Setelah urutan gen yang benar diketahui. dan dinamakan interferensi kromosom atau interferensi kiasma. Jadi. Oleh karena individu parentalnya aCB/Acb. Seandainya kedua pindah silang ini benar-benar independen satu sama lain.4%. AcB. Oleh karena itu. A 30.1%. Nilai ini merupakan persentase pindah silang ganda yang benar-benar terjadi (psg O). dan ACb. kita dapat menghitung jarak antara dua gen berurutan (A-C dan C-B). nilai KK berbanding terbalik dengan besarnya interferensi. Biasanya psg O lebih kecil daripada psg E. 17. nilai KK = 0 menunjukkan bahwa dua peristiwa pindah silang yang berurutan benar-benar saling menghalangi.6%. individu hasil pindah silang antara C dan B masingmasing aCb.4% Interferensi Kromosom Pada contoh soal tersebut di atas terlihat bahwa banyaknya individu hasil pindah silang ganda ada (4 + 6) / 1650 x 100% = 0. pindah silang ganda adalah dua peristiwa pindah silang yang terjadi bersama-sama pada dua daerah yang berurutan. maka secara teori besarnya persentase pindah silang ganda seharusnya sama dengan hasil kali masing-masing pindah silang (lihat teori peluang pada Bab II). Fenomena ini pertama kali ditemukan oleh H. Muller pada tahun 1916.

Makin besar KK. yang telah diinaktifkan dengan radiasi ultraviolet. Oleh karena itu. Pemetaan Kromosom pada Manusia Pada manusia dengan sendirinya tidak dapat dilakukan pembuatan peta kromosom menggunakan data hasil silang uji. Namun. frekuensi fusi dapat juga ditingkatkan dengan pemberian bahan kimia polietilen glikol. keberadaan gen yang mengatur sintesis enzim timidin kinase dapat diketahui dari data seperti pada Tabel 5. Sejalan dengan penemuan ini berkembang pula teknik sitologi yang memungkinkan dilakukannya identifikasi kromosom dan segmen kromosom manusia. Cara yang sama digunakan untuk menentukan bahwa pada suatu kromosom terdapat gen-gen tertentu.1. kedua pindah silang makin independen sehingga makin kecil interferensinya. Dengan adanya variasi jumlah kromosom manusia pada sel hibrid. makin besar KI. diperlukan cara lain untuk dapat mengetahui susunan gen pada suatu kromosom tertentu. Bahkan dewasa ini teknik DNA rekombinan dapat digunakan untuk isolasi dan identifikasi keberadaan masingmasing gen di dalam molekul DNA kromosom. frekuensi fusi tersebut dapat ditingkatkan dengan penambahan sejenis virus. Barski dan koleganya pada tahun 1960 untuk menggabungkan sel somatis mencit dengan sel somatis manusia secara in vitro. Untuk menggambarkan derajad interferensi dapat pula digunakan koefisien interferensi (KI). Dalam hal ini kromosom 17 selalu dijumpai pada setiap sel hibrid yang memperlihatkan aktivitas timidin kinase dan tidak dijumpai pada sel hibrid yang tidak memperlihatkan aktivitas enzim tersebut. Sel hibrid yang terbentuk kemudian mengalami pembelahan mitosis sehingga dihasilkan sejumlah besar sel hibrid. yakni virus Sendai. dapat ditentukan keberadaan gen tertentu pada suatu kromosom atas dasar aktivitas enzim yang dihasilkan.1. Data hibridisasi sel somatis Nomor Aktivitas Kromosom manusia . Terlihat bahwa kromosom 17 merupakan satu-satunya kromosom yang keberadaannya berkorelasi positif dengan aktivitas timidin kinase. Artinya. yaitu sekitar satu di antara sejuta sel. Dengan demikian. Penggabungan (fusi) sel ini berlangsung dengan tingkat keberhasilan yang sangat rendah. yang nilainya sama dengan 1 – KK. Selain dengan virus Sendai. Sebagai contoh. nilai KI juga berkisar dari 0 hingga 1 tetapi berbanding lurus dengan besarnya interferensi. kedua pindah silang makin menghalangi satu sama lain atau makin besar interferensinya. Teknik hibridisasi sel somatis pertama kali digunakan oleh G. Dengan demikian. Di antara sel-sel hibrid hasil mitosis ini selalu terjadi pengurangan jumlah kromosom manusia sementara jumlah kromosom mencitnya tetap. dapat disimpulkan bahwa gen yang mengatur sintesis timidin kinase terletak pada kromosom nomor 17. Pada tahun 1960-an terjadi kemajuan yang pesat dalam pembuatan peta kromosom pada manusia berkat ditemukannya suatu teknik yang dikenal sebagai hibridisasi sel somatis. Tabel 5. Cara yang paling lama dikenal adalah analisis silsilah keluarga dengan mengamati pola pewarisan suatu sifat.

sel hibrid 1 2 3 4 5 timidin kinase aktif aktif aktif aktif tidak aktif (+ = ada. – = tidak ada) X Y 1 2 4 7 + + + + + + + + + + + + + + - 9 + + + 10 + + - 15 + + + 17 + + + + - 18 + - 21 + + - 10/31/2009 Posted by zaifbio | Genetika Dasar | 5 Komentar GENOM ORGANISME .

Dalam hukum Mendel I (segregasi) hanya disebutkan bahwa tiap pasangan gen akan dipisahkan ke dalam gamet-gamet yang terbentuk. hukum Mendel II (pemilihan bebas) hanya mengemukakan bahwa segregasi pasangan gen yang satu tidak bergantung kepada segregasi pasangan gen lainnya. Beberapa tahun kemudian barulah diketahui bahwa gen terdapat di dalam struktur intranukeus yang dinamakan kromosom (chromo=warna . Meskipun demikian. rekombinasi gen akan berlangsung pada saat terjadi penggabungan gamet jantan dengan gamet betina melalui perkawinan.H. maka untuk mempelajari mekanisme transmisi gen perlu dilakukan pengamatan terhadap perilaku kromosom. soma=badan). sedangkan bentuk bijinya diatur oleh pasangan gen W dan w. masing-masing pasangan gen tersebut merupakan satuan-satuan herediter yang terpisah satu sama lain. T. melalui studi pada lalat buah Drosophila melanogaster mengajukan konsep bahwa gen merupakan satuan-satuan diskrit (terpisah satu sama lain) di dalam kromosom. sejumlah sifat lainnya diatur oleh pasangan-pasangan gen tersendiri. GENOM ORGANISME Analisis hasil percobaan persilangan yang dilakukan oleh Mendel telah memberikan pemahaman bahwa satuan-satuan herediter yang mengatur pemunculan sifat atau fenotipe individu bersifat diskrit (terpisah satu sama lain). Salah satu kelompok peneliti. Morgan dan koleganya. khususnya selama . Oleh karena gen terdapat di dalam kromosom. Demikian pula. ketika itu belum dapat diungkapkan mekanisme transmisi gen dari satu generasi ke generasi berikutnya.BAB III GENOM ORGANISME    Pengertian Genom Struktur Kromosom Jumlah Kromosom BAB III. sifat tinggi tanaman kacang ercis diatur oleh pasangan gen D dan d. Selanjutnya. Sebagai contoh. Begitu juga. Jadi.

dan semua gen tersusun di sepanjang lingkaran tersebut. Dengan perkataan lain. melanogaster.1. Sel-sel kelamin (gamet) pada manusia merupakan contoh sel yang mempunyai seperangkat kromosom haploid. Lalu bagaimanakah hubungan antara genom dan kromosom? Organisme prokariot seperti bakteri diketahui hanya mempunyai sebuah kromosom yang tidak dikemas di dalam suatu nukleus sejati. Genom Eukariot Di atas telah disinggung bahwa genom eukariot terdiri atas beberapa buah kromosom. Genom/kromosom prokariot Berbeda dengan genom prokariot. genom eukariot tersusun dari beberapa buah kromosom. Namun. Kromosom ini berbentuk lingkaran (sirkuler). Posisi di dalam kromosom. Jumlah kromosom dasar di dalam genom haploid pada umumnya berbeda-beda antara satu spesies dan spesies lainnya. Pada Bab III ini hanya akan dibahas sekilas kedudukan gen di dalam kromosom. Jumlah kromosom dasar di dalam genom suatu organisme eukariot (biasa dilambangkan dengan n) dikatakan sebagai jumlah kromosom haploid (lihat juga Bab VII).berlangsungnya pembelahan sel (lihat Bab IV). kromosom eukariot mempunyai bentuk linier. genom organisme prokariot dikatakan hanya terdiri atas sebuah kromosom tunggal (lihat juga Bab XII). Contoh deretan lokus sejumlah gen di dalam suatu kromosom eukariot dapat dilihat pada Gambar 5. Kebanyakan spesies mempunyai 10 hingga 40 . baik pada prokariot maupun pada eukariot. sel-sel lainnya (sel somatis) hampir selalu mempunyai dua buah genom. yang menampilkan peta kromosom pada lalat D. Tiap kromosom membawa sederetan gen tertentu. genom suatu organisme adalah kumpulan semua gen yang dimiliki oleh organisme tersebut pada setiap selnya. Sementara itu. atau dikatakan mempunyai genom diploid. yang ditempati oleh suatu gen disebut sebagai lokus (jamak: loki) bagi gen tersebut. Pengertian Genom Secara keseluruhan kumpulan gen-gen yang terdapat di dalam setiap sel individu organisme disebut sebagai genom. atau berarti hanya mempunyai sebuah genom. Selain itu.4 (Bab V). jumlah kromosom ini tidak ada kaitannya dengan ukuran atau kompleksitas biologi suatu organisme. Gambar 3. Oleh karena itu.

Muntjac.1. hanya mempunyai tiga buah kromosom. Jumlah kromosom pada genom haploid beberapa spesies organisme eukariot Spesies organisme Jumlah kromosom haploid (n) 16 7 17 10 21 12 6 11 5 4 3 18 6 14 25 17 39 20 36 24 23 Eukariot sederhana Saccharomyces cerevisiae Neurospora crassa Chlamydomonas reinhardtii Tumbuhan Zea mays Triticum aestivum Lycopersicon esculentum Vicia faba Sequoia sempivirens Arabidopsis thaliana Hewan avertebrata Drosophila melanogaster Anopheles culicifacies Asterias forbesi Caenorhabditis elegans Mytilus edulis Hewan vertebrate Esox lucius Xenopus laevis Gallus domesticus Mus musculus Felis domesticus Pan tryglodites Homo sapiens Pada organisme diploid kedua genom akan berpasangan pada setiap kromosom yang sesuai. sedangkan beberapa spesies paku-pakuan diketahui mempunyai beratus-ratus kromosom di dalam genom haploidnya. Demikian seterusnya hingga pasangan kromosom yang ke-n. sejenis rusa kecil dari Asia. kromosom nomor 1 dari genom pertama akan berpasangan dengan kromosom nomor 1 pula dari genom kedua.1). .buah kromosom di dalam genom haploidnya (Tabel 3. Artinya. Tabel 3. Kromosom-kromosom yang berpasangan ini dinamakan kromosom homolog.

dan akrosentrik. Oleh karena itu. bentuk metasentrik ini menghasilkan dua lengan kromosom yang kira-kira sama panjangnya. evolusi kromosom sering kali cenderung mempertahankan jumlah lengan kromosom tanpa mempertahankan jumlah kromosom. Sentromir adalah suatu daerah pada kromosom yang merupakan tempat melekatnya benang-benang spindel dari sentriol selama berlangsungnya pembelahan sel (Bab IV). Terlebih penting lagi. maka akan didapatkan genotipe homozigot resesif. dan akrosentrik tadi sebenarnya agak dipaksakan. s s a) s b) c) Gambar 3. Struktur kromosom ini dapat dilihat dengan jelas ketika pembelahan sel berada pada tahap anafase. submetasentrik.2. akrosentrik. lalat Drosophila melanogaster mempunyai dua buah . sedang lengan yang pendek p. dijumpai apabila sentromir terletak hampir di ujung kromosom sehingga memberikan kenampakan kromosom seperti huruf I. Lengan yang panjang biasanya dilambangkan dengan huruf q. submetasentrik. yaitu metasentrik. Jika pada kromosom yang satu terdapat gen A dan pada kromosom homolognya terdapat gen a. Sebagai contoh. Akan tetapi. Sebagai contoh. maka akan diperoleh genotipe heterozigot. Klasifikasi struktur kromosom eukariot Kromosom eukariot. yang telah kita ketahui berbentuk linier. istilah-sitilah tersebut sangat berguna untuk memberikan gambaran fisik tentang kromosom. Dilihat dari kedudukan sentromirnya. Bentuk submetasentrik menghasilkan dua lengan kromosom yang tidak sama panjangnya. jika pada kedua kromosom homolog gen a berpasangan dengan gen a. Bentuk yang ketiga. dan kedua lengan kromosom semakin jelas beda panjangnya. Struktur kromosom pada anafase a) metasentrik b) submetasentrik c) akrosentrik s = sentromir Pada metasentrik kedudukan sentromir lebih kurang berada di tengah-tengah kromosom sehingga memberikan kenampakan kromosom seperti huruf V. Pada bentuk submetasentrik sentromir terletak di antara tengah dan ujung kromosom sehingga memberikan kenampakan kromosom seperti huruf J. ternyata dapat dikelompokkan menurut kedudukan sentromirnya. tiap gen yang terletak pada lokus tertentu di dalam suatu kromosom dapat berpasangan dengan gen yang sesuai pada kromosom homolognya. dikenal ada tiga macam struktur kromosom eukariot. Demikian pula. gen A (dominan) pada suatu kromosom dapat berpasangan dengan gen A pada kromosom homolognya sehingga terbentuk genotipe homozigot dominan untuk lokus tersebut.Dengan adanya kromosom-kromosom homolog. Klasifikasi struktur kromosom menjadi metasentrik.

terdiri atas dua buah kromatid kembar (sister chromatids). Pada sentromir terdapat kinetokor. melanogaster sesuai dengan lengan panjang kromosom akrosentrik pada Drosophila lainnya itu. Sebaliknya. Akan tetapi. Jika peta kromosom kedua kelompok Drosophila ini dibandingkan. telomir (ujung kromosom) sentromir (konstriksi primer) kinetokor kromatid kembar (sister chromatids) . yang satu sama lain dihubungkan pada daerah sentromir. dan perbedaan letak ini dapat digunakan sebagai dasar untuk klasifikasi struktur kromosom seperti telah diuraikan di atas. Letak sentromir berbeda-beda. Bahan penyusun kromosom adalah DNA (asam deoksiribonukleat) dan protein. pada simpanse terdapat dua pasang autosom akrosentrik yang tidak ada pada manusia. manusia mempunyai sepasang autosom metasentrik yang tidak dimiliki oleh simpanse. yaitu suatu protein struktural yang berperan dalam pergerakan kromosom selama berlangsungnya pembelahan sel. masing-masing lengan metasentrik pada manusia homolog dengan lengan panjang akrosentrik pada simpanse. Tiap kromatid membawa sebuah molekul DNA yang strukturnya berupa untai ganda (Bab IX) sehingga di dalam kedua kromatid terdapat dua molekul DNA.autosom metasentrik yang besar sementara banyak spesies Drosophila lainnya mempunyai empat autosom akrosentrik yang kecil. Dalam hal ini. Pada Bab X akan dijelaskan bahwa bagian-bagian tertentu molekul DNA merupakan gen-gen yang mengekspresikan fenotipenya masing-masing sehingga DNA dapat juga dilihat sebagai materi genetik. Kromatid Kromosom yang sedang mengalami pengandaan. yakni pada tahap S di dalam daur sel (lihat Bab IV). Demikian juga. akan nampak bahwa tiap lengan kromosom metasentrik pada D. simpanse dan manusia sama-sama mempunyai 22 pasang autosom yang secara morfologi sangat mirip. Autosom adalah kromosom yang bentuknya sama pada kedua jenis kelamin (Bab VI).

3.a) b) Gambar 3. Gambaran umum struktur kromosom eukariot yang sedang mengalami penggandaan a) kromosom b) molekul DNA 10/31/2009 Posted by zaifbio | Genetika Dasar | 2 Komentar « Entri Sebelumnya SINOPSIS BLOG INI BERISI SEMUA MATERI TENTANG BIOLOGI DAN PENDIDIKAN YANG DIBUAT OLEH ORANG YANG HAUS AKAN ILMU DAN BERCITA-CITA TINGGI UNTUK MENJADI DOSEN DAN MEMAJUKAN ILMU PENGETAHUAN DIMANAPUN DIA BERADA DAN MENGABDI .

7:/48803..33.382007.34080 80570:7847.3/50740809.:-07507.47243  240:5749030.:39:20.3203.-07.8.302:/.50702-.3./.3..251. 425083907-039:-.3574903 897:9:7.8  $.: -..3 97.28945.948.3:2.3/09.3.3.5.350702-./.8.4  $0.3 907.5.80380-03.3-0:2-0702-.39.038090.80./.802-..8.251.947. :9..3 4489..38758 07/.709 0.0-.:0-7:29-.80  037#-07. .3/03.3//.4394 .9/97.709/.7809079039:203::0809.3/.3.32033.3:2.3  $..9:.8.80/980.29...-08..89.7.9  ..3 .30-/.370..03503.8 40:7#9/.//.3.  .251.3 9.5.7570:78473.3 ..3.7-4842.0345:8..40-07-.-08.3202-:9:.39:3.9./3.7.8.387584047243/2:.38200:.9:7.77-4842 9../..3:39:705.03/03.3 203..3.3  2# 8:507570..347.2 :2.8  0.9/.302:/..38090.2809.8897:9:72.907-039:4250847243 70805947 $090.28:.3 90.9:7.9:70:.3574808..2:3 80.2809...3//.3./.2 3:0:8207:5.5.9202-7./-.3203.9.9:3.:-.70805947.3-0:2907.3:2..9:7.3/03.3802025:3.3802570.9.308570803503..3//07.9/-./.38.3038943/..8.3/3.7.3203..3/././ 9./.0.383908880:2.-0-07.709200..3.749 ././4-32.3 ::3.::5-.9:  2#8.3/507:.9: 80203307 2.9:503. ./80.8-.34489907.7.9/:3.3.3./.8..597.3/02../03.3/-.7/:.3.9:5033.3 57490390780-:9.803 .75..2..380.2.3503..3:39:203. 47243/.33/:840 .9907..3..:.224/1.8.32.3.5.7.3.803.0/.83 2./.390780/..035./.8:.3..78-08.583.5..303 .297./.703.251.9183.749..-09:-.8:3.3907/7.203.3.3/.8.7.9: 2#8:507570.3..3.:-.251.10798.570:7847..04254 .9:797.5.9//.30..33/:8 5.73../.. 09.8240: 240:7# !.38.3.397.387580:.-0-07.7574903.8.3 88.8 .780-.54070805947:8:8.8472430/.2025:3.2:3 503097.7-:50780 40: 2#8..9/809.3.7490-:7.3/.8203.80390780-:9.5.3 57480842508.9:8.4394 80 8007974-./8.3-0.2.9:.032397.-08.9:8 7./../507:.507:/...8  !03..803.80-0:2..8. 03..3503.9.8./.28:28:29:.9: 037#.32.7..::5:39:839088240:90780-:9/.33.2705..73.8 03./.397.9-./3.9:850780 /./.-08.9.574.9.3-0-07.3/2#8:507570.9.4-3.80-:9:.80  .9.3/03./03.3/032/.380:2./.387580:.2. 830.2203...3/03. 80 80570:78479/..3-07.507:-.28.78.3820 503./07974-..7.5.3/9.9:9.9079039: $0-.550702-..83203.387580:.5.5.03 /03.7503./.3:9.7 2#.8 !02-039:../.3/7#/.9202.749 2085:33.5.3 907/.03-.8.037#3.9:20.3.32025:3.3 80:2..032.0380-.82.9:7.7839088574903 &39:9:/-:9:.3.. $02039./:52# .  .35748083..380 ..580 240:2#/.39/.8//.8..803907./. 708543907.9..3/.3./5033.45   2#802570.//.9.20309.2 ::3.749 $0-.  .34489/.448990.3.472430 /.3.80:2.:2. 4443:2 207:5.:.9:83.9.3:2..251.39:3.

 .. .5.3 -07-0/..-:235.3/03.390724/1.5.3-07-0/./09.34.30897403 .230897403 .9:8 28.3-07-0/.9/..33.3.9:7.35.3  /..28945.-0:2-. 8390882#:39:4.2025:3.387584047243.38.557480832# :.2.909.5.3.38:35.8.3   507:-.3..5:..2085:397./.7.3907:8-07.38073.2.  !03.9   3.03. /902:.870570847 /.3.2:2..3.3897:9:7742.3..9:/ .4250847243 70805947.  !..9:574903010947   .9/./:9:8 ./.240472430.03880.3018038-07-0/.20/:.9:  503./:9:8.9..3203.50789.73.-:23 $390883./.320302-:8/3/33:0:8:39: 202./.3-.9.8:3:0:8 !7480880.28.507-0/./5.39..:2:33472433.73.802:/....3202-07.3/.3:980.3839088032.3:93..-.8090780-:9907.7.38.7907-:.73.3 .3..3907.3/97.8839088 4. 8:.   503.:.35.9.9./.390:7 4.80 80 .240: 240:2#./:9:8.3.38.2.9./.57:5.//.3708543-07:5.39.3.032#54207..3.80  43943/:897.892:.-07.2 3:0:84250890780-:9 ..:7....3203390882#90780-:9 .8574903.93.9.8..703..5/./. .9202-:.70805947472430897403//.80 804././..  034203.9...95.3.8.9.82.-0-07.8/03.3.3.: 909.0897403/-07.38758//.2 /8:39/03.9574903.

3.5.3..203.38.8040-07-. .8.8.703././.3-07.703.354.2.9907.3.339743 003.507-0/./. 2#.7:/..2./.. 502-:.

80.3:2:72#:.3 97.8 ..38.2.3/:25.3/.9:.98 .3240:2# .2.3..2502-039:.:50702-. -07507.33.3-0:2 /-:.397.3 8.703.3.3907.397. .3.8:.390780-:9 ./03.80..2.2.2 2.84085072.2503.3./ /.800--.90:7.80:2..3.2#9/.090780/.9:7.20./8..-44-0781.2.57:5.//.574.8 07-0/./-:..3.507-0/..5 -09:10798./.3 03.3-0:2/09.3/7:39:9/.2#.3909.80/2#  !03..80-0:2/.75.:39:97.32#907802-:3 2.3-0:2/97.3 85.  43/8-.9..83../  80:2.3-.3/839088 .92085:303..8907..90780-:99/.2:3 .3820503.73.3203..2:2.3/97.9:7.9:7.502:/.2./.340./.947707:9203 3.25079:2-:.94443 80/.38205748083  :8:83.3..0.. 909.82#5.89:/3.3/97.3..32# 20.503.80-03.3/.83.3-:.. .3-0:2/-:.30-:7./.3  503.387588.907-.28090:7.3.3.   503.3/3.38./.33.38.73.-.9.38.9::38:7.:839088574903203.9:7.9703/./..3.38:..5.9: 83. 5.574903.397. $090:73./.2.3 .:.88.3 /02.//.3.39/.0:.320. .5../.203.989..9:7.:80:7: 839088574903  %0:7./.8  $3.3 1.9:38:790780-:9 909.3425087-4842 2#  .38.749.39..9..2.7.8.38..10798..84.3203:3:..749.33.3../:25.3.9:7.3:2:7 10920 240:2# /..9.3 /./.9:7.3 2025079.8.3 2#  !03.3875572073. 5.

39-4/ 90780-:9-07.340 20.3203:98:.9.33.9.9:740.-07.339/.39.34389.8.574/:8. 909..980-.2#54889743 909.88:.3203..85749039:803/7907.97.3/5.83039/..383908854574903 !4574903...3/.3 /03.92#54889743.8 97.5749039079039:/.7.5-07.38.9./ 240:.574..:503...5.../.3/7/.9 9025.5.3/802:./.8.3.38.3240:2#.3:9: %.4394 4380397.55749033/./.3    .803.545059/.9025.78.2....9 /809.3/03.2349079039:.0:.-07::7.3503.340:7:9.9:039:3.9: :7:9./..380:2.7499/.574/:03 $0-. ..7.9:80203 !..80-.2.809079039: %025.38.7./.3 -08.5/58.9/.:8:8/03.3203.38203-8.5.574903/. 909..0.95024943.5.380./:25.73.3-071:38807025.749907/.3./.9.08908 4003257490.34/43..$39088-0-07.3/3..5.95024943.3 404/438945/.52#  $0-.2-.3 .3/58.8.5.9:038240:.3907.5073.288902802.39-4//5079.2-.38.43/8.29::7:9.8.257480897.  5. 240:574903.83 2.3.38090.  .8 ..9  $39088-0-07..8.9.390754943 54943:39:203.

.

 !4890/-.380-./.1-40309..'7:8%079039: 4/0$97:9:740:203:7:9.3#80-..380-:.9070309 #05. %.8.7%3..:38.91 #05.7 %#%   %#% O O O O O O !02-:9.42039.9070309 !02-:9..9843 7..8$0243807..8..90703095.

/...8.3:03.2.3/:3397403/.:38047.2.7 3:0:8803.9.23:0.2.   08.3-.8/.9/84.32..3148147 .8/.2.3/$0/.:.7..302:/.9.07 20302:.-0:2/09..93/84.-0781.9.80.2.9  085:39073.9: .203.23:0.3#05.3.303::3  %#% !.:  .83.280  ./03.88.0/4907.33.5.92.38:.3/03.:/.8.8.3:8.73:0:8-07-./.3.9:9:1:383./.980.9.8.

8/:5 %073./..32:9./.93.3.3.2.38205079./03.747.907530:244:8.3/../:.3.3.:909. /.:3 9.2..3./..20/:25.7 03.2.5.35./..9.7/.257802:.9-079.3 /.3207:5.3530:244:8$..9.8.5 80.2:3.8.820488-.09.907030980..3-...:7-43:..3507...7..3.9 .5..9075030-.3 80-0:23.3..985.5 80/...3.3..3$ 80/.5.32025:3.983.3$90780-:9 $0-.703./:.7:.203.9.:5:3 0.3 -08.3 /.3.33././.3820  80-.3/03.7:3. ./9:2-:.5.3/3108/03.30.9:.3 9.7.9 20339088.9070309  0.3 /.9/-:9.9/.32.3.4-.39:-: 0.9.303.80842.7...203...7:03 2032-:.2..9:39:20./5.3:.3. 203.27424842 .9.33108-.3-07:93  !07..7.5.39.3/:5 02./.3.:3 .9574903803..9..3/03...9/3108/03.3:39:20339088.8 .7: 5.2:7:3.507903.9070309  802039..73.3 .7.920303.3 897.3#/...9.3 5.3/:5 .7907.203.  085:3/02.:320.882.35././..38:380-03.0.380-.8.3#.3#/..8..920203:8.802.3#  03.240: 88.5.7:3./.7:038073/.7025.5..58:548...3/3108/03.03 2.9//.:/047-43:.3907:9.82.3$.39.3203/:33./.3//.3-.9 -.::5.3/902:.380./..7.::..3202-039:443/03.8. -0/.9..9.25:.3/.3507.9.3/.32.3.3..:8530:243..80.35079.3 -.47./.381472..5..2.4-.25:7./.4-.202..82.3.2 .7:03/..7.9: 80. /09.5..3.9 2.380-./.3.::5 :.207:5.2-.907/.9530:243.39073108803.3503/./....3 203:3/..-.3/./.3 8.0.-0781..3.2539: 3:0:8.32:9. .7.3$.3/:7..3/:3.:80-.29:9/.803.95::9./..80-.9070309 .907/.9/84.747.3809../.9-079.9...33.83.58:548.3.3.3/:3.83 2.9:2-:.8897.20/:2 5.32.5 $02039.9:.3203.907530:244:8 $970594./9:2-:.9 .8.397.23:0:880 842.3907-:9-. 203.2-..3/.3897.3.9: 80/.9 203.3203:3:.9/84.-503.23:0.307.. 5.30502-.3/.2 7424842:.5 8890200-.720.90../.3907./9/.8/:5  .:302:/.3897.9070309 .:..3202-039:443/03.-.3/:3.25./..9.32.:.3 90.3  574903/03.380.7.39/.747..3/:3.3/.32:9.3 3.:35749030-/.3.8.-0781.3503...-07-0/.9.3.3-..2:3 5.3.25.3.2.5.33.9:9:90..:507-0/..33203.3/3108/03.9.35749033.2...8  71195.3909.-079..90703095.7.8.3..9070309 /.7/.3./5.5.3-.5:.8897.9./.9070309 .:574903  :..3.7..8.7:03 $97.202.3897.3530:244:8.2.9/.703..3 5.9070309 .-:9507.3805.:.3 .9.2/0487-43:0.0.980-.2.3 02.5..9:7.39:-:0.7: 5./.9.9 !30:244:8.8.3$.3.:389:/ 2748458203:3:..:8203./ # !.897:9:77424842 .9..39070-/./  /.8508089079039:2025:3.1.897.:897: .4.9: .3938..897.33.9...303.3//..27-43:0.3.882.7.

3/9:2-:.5.80 5020././..9. 507.80:2..:.4-.8 0897.3.2./ 793.:39.390.2507.3 /.8907.907530:243.880././$ .780 80897.907.20897.2.381472.7920.9:/03.4-.3/53/.3:39:20309./$ %7.3909.2:3 5...203.3#  897../.7.85.897.381472.3-.2-. 897.350309 .381472.2-.58:/.9070309 !07.390780-:99073. -:.:./. ./3.3#  070.3# $897.47.574903439.47..5.703.381472.890780-:9711920325:.2-.3 . 97..202-07.:..5-07.3 97.3203.3/.4-.89/.9.9070309 .9/.3:3.2.9./.3507.8202-:9.2-.80 5020..07  .3032 #.3.3 802:.7897.-..3#  .5.23..:.3#897.39073.32.3-:99039.4-.92.3/20/:2 5.8.507.3#-07:-.257802:..37119 .3 .7:03  !07..897.3907/.3/../ 897.2-.3 /9.905. 574903439.9202-039: ..3/53/.9.30:9:7897.203.9897.07/.3-079.3 .907..9.32./897././..9:.3# 57490.907.2030-..3$.397..30.9202-039:.2.8/:5803.90. 2. 9.80.9 /5.9.3 503.-07:-...3#203./507:-.3# $897.5.3$.0.-.90741..3-0781.7  .3 .4-.907.23..33..:574903    :9:7897..3#-07:-.8909.03.574903 97.20./.80 :9:7:9:7:9:7 897.58:-07:-.3#9/..203..8.:03257490. /..3820  ..3897..97.04/ /../.381472.9:./..3$ .3#.381472.3$.3 202-:9.381472.3$0897.# .4-.3.3#897.4-.5..9 /.3#.7.3.3$ 0897.8907.:.397.3#.3-.3 507.380-.390.9:/9.:897.3.3/-07.5 .808:./$8050795./.3 0897.3#.3.974 .33108-.032.8  81./.3711980/95:39/.7897.-.3/.9.80 5020.80#.203..3 0897.

33.:2025:3.35.59/.9/.  .9.30:.3.7: /.3/:3148147/.8:.38..:7 /:5 -.7803.3.33./.7:8./484945!  2.9.2:2.3.-07.%/09./.4-.3/:38:1:7 /..3-.5.203.203.790%//..3 5.3/2.3-.3203./.3203.:.0-07.. //..7.3203.35. .790%2.790 5. .4-.3 80-.3/03.:3 40 0780/.3/.80/980.3/.4/902:..381.574903  #80-.3/.2-.8:..: -:.4. ./.3574903/./..4  /:9402./484945 90780-:9 5.4.5.4302:/.340-. -.790%.202:33. ./3/3803.:.8503.7.//.5240:574903/.%/.3  !   .8-.790%200.5.2.907 %//.2.80..30- :7.3...8 80 80 .90741.  2.7.9: 09. .3/58.38:8 70574/:89.3.38:/./3.388  -.280  .:2..90703092..503.3 907.9: 8..3-..2.-0/03.2507.9073..90741.3/:3.3.790 5.9070309/.350.3 ..3/:3148147909.330.9.2.280 80 .90741./03.8:3.5. 5.38..33./484945$  $0-. &39:202.280 ..80 !07.9070309.203./09.4803./.3  $    803.7 80 .3/.07..547.3 803971:..8 203:3:. %073..-03.3:2:23./.280 80 ..9-08.4-..3/2.2803.9.- :.//.4.7.4-.30/.89./:3.90741. .302-..90741.5..90741.980/9/902:.%.35.288  73./.2.390..5./484945$ 80/..-0/03.35..9.48./.2.75.2.907.35.9070309..3$/.970574/:8 -.3  -.7.3108%5..33108%5.7.2.3.5....320307.9.3..8: /..7   .3574903.4 03.3!0803.'7:8 ..3/:38:1:7909./.3.3.790%90./.280-.90703095.490.203.9070309%0/.3.3907.3/.-0/3108. //.2.3::30473.4 $0-0:23../48494590780-:9 .3!.790 5. ./.280 3.3.%/03.790 5.37.3/./.!07. !74903 ./3/380 .9.9070309  .203. 5.8507.3202-:9.38:33.3.: .37.790%.790%.%0/.3. 200..3-.3/.9.59/.5.38.5.3/.37..9-./.3 7./484945! 80/./..3.3/.-.3.3907:. 2:.-0/03.-0/03.3-.//.38.-0.33.92.3-.3202-:9.9.3.

3203:3.8.%'.2.5..32..7. /.809.39.803.503948.397403 -.3202-:9.924.780:-:35749033..20.3 /7043899:8 /03..35034247.397403 942 5.9203:3:.8.89.-.3 897.38.3-.3203.3 #/.# -:.947.7:8 %' .3 $0-..3574903897.:-.9/.4-.7 8:-:39 8:-:39-07:.-./.7897.9.4-. .9 :.3/:3240:#.3-.390.2025:3.2.8./.3 5034247.3:../.5..3/.9425.3-07.8.2:0.3 40 7.3 2434207 .3 $3075.7902-./.380.9/80-:9:.3/.3574903/..9425079.3/:3397403 !...:9/.9/.3/80-:93:049/.380:-:3574903/./ 1.882. 4254303 ..7:89079039:/09.8.3203039:.3/.%' %'897.-:3..3-.7897.3./.7-48..3../.503.-07.: 574903 .#  4254882.8..9:.  03:7:90-.37043899:8./..3.3 507.543:049/. 909../.%' .3/03.74240:90780-:9.:39: 02:/.397403/9039:./. :049/.8..: .87043899:8302:/.340.#.907/7.9./.:.:  '7:83203.8.3507.9/825:.#3.8../.3.7897.3 0/:.3/.424.:. /0487-48.303.3 /3108./. 24341481.9:::81481.703.37043899:831080/.53:049/.9..0-07.9078:8:3/.503948.3/7043899:8/03.3.3-07507../..9425.380-.7897.7:8.3#80-.3/80-:9 3:048/.23:0.392-:3.3907-:3:8//.3.8 503.:.3/.503948./../.803.314814/08907..3.3/..030 437...:...0/:.32.7-43 /.503948.503948.:94-.3207:5.5...3-.9 :.9.5.39073.9: /.:3902-.23:0.907 03095.3.3/.5.3.547.9  :.9/58.7.:..9070309 ./..8 503...:3902-.350309. .3.9.9 %.8.3.7# /.2. 3:049/.280:-:3574903 03..-./.380-./03.7203.39/.5. 397403-07.8..3/.8.3%'897.53:049/.3 80-.902-.33:049/.89.7  !07.5.3:048/..35.80-.3.202-039:240:./03.7:8.3574903 &39:202...5.3 .2.33./.3 %'.38.:. #/.3  574903 # 5028.:3  070.8.5.7:8 .-07.39.2..2503.3 /7043899:8/03.803 :39:202-0/.8.3..3./03././.3/.7897.3897.-07:93.942.2025:3.7:824.9.9.#3.9:.:..9079039:240:#/..:3 #/. 80/.2-.9 .3%'.. :.9:/03.././.9.74240:39078:8:3/..2.7897..32030-. 805079.3897.2.90703095.3574903  0. /:-:3.33.9.7./.207:5.39.35.

3.9/.3/.8.3. /0487-48.3..3.9-07:5.:5:3# /..203. /../. 3207:5.2025:3./:.990780-:9    ! ::81481.9:3./.8./.3.39/03.       .9::8803.:/80-:9 5:73/.9-07:5./.8.:39.3/./.9.:923 % !...3.7.3./.23:0.5.3.5. 2.907/.5 /.89483  .#9/./033  ..2.397403.5.9: -./.3-.9                            :.# 909.5:73 -.3.3/0487-48.9..3-.3507-0/.2.8.3:7.572/35..897:9:780-./3.5.2.. 80/./03.5.543:049/.3.8.:39.9::8 805079.33  80/..37.2 .  $02039.3 #.39. 2.8.:.:.503948.0/:.8.3.240:543:049/.9./03.8.923 909.9.7.5.7-48.::.9-.5 203.3-.39:3. 94234247 5.8 &  ...:/80-:9572/3 .

47./03.3/. 4380397.7.8/.78508080850808  .2-.203.524/0 90780-:9 .4380397..34380397.7../:.3923 80/.340 .8.2. 4/0897:9:718240:5079.8.:.8.9843 /.9-07.338.:203:3:.8.2.9.5 38-.3803/73.3/:3.3-./.35..:..3/.7  42543032.3.5.:340  .5:73949./.882./.8./8.33              89483923:7.7.389483  03.9 4/0$97:9:7..23:0.2./03./0338.11907. /./.572/3949..3:. 397403240:/.3.5 4380397.8:.8-.8.      ./.382080. .:.220.3-./03./.33 894838./033 923907..7-07-.9:   . 4380397.3   7.8  .8..8 -.3909.3/:3.3.8.2.3/0/:8907.9843 7./033:.

40.8.3.:./.: -075..-07. -.5-07.33.3/:-:3.8..9 .079.8.9.7.3/03.7.3.8. -.7.8/.8.9 5./.395.3.3 14814/08907/03. /.7./.8240: .543:049/.3203./.%5.3./.5. .73.3..340.7/.9:2025:3.8.5.3-09:5:.:7:9.-.2.7::3 0 2.7.9.38.3240:203:3.33.118079.9::39.33907. /.3/7403  0.3974039078:8:3.3.3-.32030-.3-.3.3.3.9.. 80/. .3.340.3907/.543:049/. -./.5.39.395..3.55./..9:8./. :39./17.3-.90780-:9 2.:.8.7909.94234247 .3.3/03.3-07:7:9.5.8.7. 909.0/:../..:::3! 0/:/:.5.80-03.5075.  !4.3/74037.7 40   38 # 7.-9..8.20./.8.2.94234247 5./.8.203:8:.3-.3.80.9. /.9/.33 /.:39././.3.3-.:39.3390780-:9.543:049/./.397403 9:2030-.3 8:2-:./80-:9.32023/805.8.  ::81481.8.:39.5.59..80-./.9.3::3 ..39.3 203.:39.-.8.24/09. 09:5:.9. 397403203.324/0897:9:7.8..3 .-.9/.50.8.33 203:-:3.38./0487-48.39.3.-07:93.3 .9803.:39.314814/08907 ..7.3%.9 .::33/3.3/7403.9843/. 53.:39.78:2-: $0507990.-9.3-075.7.3. %907.35:./. ?  .3.9:::3:39.5.7::3 0    !   !  !  !  .3.8.39338-.3.9:8.2.3-075.5  202503.37.9::39.2.3./.90709.3-.203:3:.7./80-0.8.42502039073.3/50740/.5.7. -.3.3/74037.9.30/:.:::3  ::3.543:049/.3907/.3.9.5/:.-.738/. ?/03.3-.3  S 907/. 39.:39.8. $.8.3907.-.3703/.5.3:.9::8   0.8.8./17.3.35.35.94234247 /03.0 .9.8  3:049/./09.33.-0753 /4:-00 03:7:924/030/:.5.7::3 ::33 .33:049/.9.94234247 9/.89.9/9039:.3::3 .28..850249709..8.7.3-.33./805.3  $09..-.8..3..28:2-: /. 3:049/..703.383.9:  ::33/3.9::81481..80. 2025:3.:.9:..703.2./:-:3.42502039078.883...7.7.7.39.80-.8.38:2-:240:/03.2.7.8 240:3.9::39. .3 7.8.8.-./.: 2.-07:93.0/. 8.9:  -09::7:9.8. 8..7:89.3.543:049/. 8.3/..9..338-.

3:9.7:8203.32.59.747.9240:073.9:90..1:38544-07:93    ..2-.-    ..3803.9 20307:8..38202:.7:8/.2-0-07.9070309 $090.31:3803495 .4:84307 .3/.38090..800307.7..3 20. /. :383207:5...7.31:380.3.5.3.90703095.320.9 81.907:3..3-078.907030980.907-:9-.5.3.3.: 705.3202-./.:50789.8 81.7.8 . 2.8.23 0.5..78.3-08.39..2.39073.3/. ..3 80..3 09.5..3.7:8/.9.3802.907 0309...3820 793.09:7:3.7:8/.8.890780-:9/.7909:.9070309 .9203.8.-07..7:80/980.5  085:3/02.3389483 :38.340240:90780-:980-.8 :383207:5.38:3  :383207:5.3.7:8203./.9070309.3.8..847.5./805.2.3.91:38...207:5..78.320..2.947.1.8705.80-.8/03.331472.03/02:.25:-07.35073./.3/03..3/.-  .749 3. %.3103495047..3/./.3820 .7 .9:750702-.3/107038...3/.9: ..9/.:08570803 .380-..35../033923:.!  !  !  !  !  !     ..33..507:-.5079.331472..8.320.31:38103495 .-.2507:-.05. 2:9.70307.25:20325.80309/.907 0309 .3 -07:-.47.3820 9.7:82.70307.9070309...32.0380-.9:.80 0307.2897:9:7240: :.4:89/.3.3905.3 /.8./:/0.3/.343/83:3.9/.9203.35079:2-:.80203./. ..3.8    .9-./.8 .

.3./.9:43807..2033:049/.38.3-.543:049/.9047098705.8 80243807.3..17.9./.-0753-.2:3 2.3-.3 .:39...3907-039:.09.7:./:8:..-0753.3/.203.3502-039:...35073.83:39..543:049/./../ .3..3/.705.9180:7:9..390758.3203. -0780.5/5079.-0753. 909.::803.217.705.83 2.7: !...8 /.-.8.39070-/.3.3 .2502-:.09.2039..203543:049/.5/5079.7:                     .39.843807.7.3.80-.2.203 17.3909..919.502-039:.705..3 17.203..:39.8/ 80:2.9025.3/850781 !.3/:25./.7.0/:. 543:049/....8/8507810/:...91 /.3-0793/.3-.91  80243807.9: 5.3 803//..-0753203.-.3203.29.9 02:/.3 9025.3.17.7:  $02039.90 -.3:39.3.#05. .7:803.7..

803971:.33.  .7.  40:2025:3.91/850781 ...8..33/.32.3-07-0/.5.38.3 .2.9047098705.09./.4/03.7:9.5..943 !07.7.7.-.3203.9.5.8 :39.4.07.393./.5.907././.8.4-.9805079.3/3.3.30-:7.0307.9180243807.240: 240:/03..9/-:9.20/:280.3.7:  ./.9./. -.3-07.390780-:9 .3.9.20.3.3974035.890780-:9/.9:.30-93/.5./.907.3./9:2-:.2.80243807.240:80 80-.30-03.9.9.397403.4-...5.3/03.5.38 808:247/..   0.3/:384945397403 :39:203.380 80-. $0-.2..3   $9.3-.3/:3 2025:3..93.3-.0307.3-.  070.39..2..3 -.3203..9 40:/03.3.220/:2 .7.7.3 5..3802:. 803971:.3.2.3..393...4:20 .293.-0-07.8.8 2.3/:8:.3.83.9 /58.5.75.9.7:9.480.397403.8//.7.5.39.3/:384945 /.5.8 02:/.83 2.:39.3/.83.33./039 .8-07:93..3 -07.:06:-7:2/0389 7.38.907.9078.547./03.03971:.-0-07.9. 43807.907 .3/03. 3472.3/02-.080843/.9.3849453974033472.7.07.950.3203..5.2.5.203:2-:.90790780-:9.7  %.703.2-.507-.3 202.3$9.3/.5.3...3 ..2..9./03..9 203:9507:-.8.3020/:23472.91 . -.5.307. 80.0307.-0-07.8.:340 $ 080843/.8802-.93.:507.9.705.95078..3 0-73.3  07.907.

.3 .2/.

   ..7:9.38.2 80/..307.5.3.3./.9.

79.0307.39079039:.0307..-:3 !.320303/.20/:2907.8.7:9.9.2.9.9.3 0.-:3 $0.3  5./.3-.8   ..7:9.9.80/:.3.0.9 /.703.3-7/ .2 2.9.-07..3/0897.3.290780-:9.9.89.3.3907.3.  802039.380.3.9203025.3 -07.35.907..33. 3.2.5./.9.89.240: 240: . ../.9203025.3.38.35079./-.33.3/0897./9:2-:.7.2030..9.0307.9.85.20/:2   3..202-././.2.3. 752 /..9240:/803971:.3 ..907.5.07..9-./.3 8.0307.393.2  09..79.90/:/:.993 .8.9./03.35.9.8 9./.203025..393 02:/.0307.5..0307.3.8.3:93.5.9.320307.7.3/1:8.3$9..35079./0802-.3.3903.4.9-.2.05.3903.38./.3 02-.207:5.3.2.2.9.3240: 240:.393./-.-:3 40:/03.8 3.:/80-:980-.2025:3.3/9:2-:.-..3...2.7./03.9.5 080843/.5.-0-07.4/9:2-:.3.3903... 8090.-:3803971:.5.50/.3//././88..23.-:3909./..780 .9:3. ..3.8./53/.3.3203025.-:3 80/. .-:3 09.30/:/:..8.907.490.:/. .  .20/:2 9073.5.780 ..3.020/:2 907.7.3-.393.907/.4.580-. .9. /..803971:.25.8/03./.2.3.8 3.

2-.7.7:/03. /:25..  909. !..91       20/:2 0897..2.5.3703/.5:2.83 0.3703/.3/03.393/.8/..3240:20.307./.3-.8      0897.3803971:.8      0897.8  20/:2    .9.. 0307. 80/.8507.32.9-..9.5. -7/ .0307...52:3.3703/.4-.3.3.8.307.3909.502-039:././.:5:.-.. 20/:2  0307.3-.9.39.7:/03.3.39075709.380907:83.307. !.880243807..5../03.9.7 907. 0307.880.:705.8-7/3.3. 02.7.

35.73.3/0483:049/.7.2-.7..2.3::3 /.8.73.7     503.7*-.35024943.907/.8 .-.3705.4-07.3080843/.80:2...83/./.0705..07...-.8.7 3.2-.390717.2039.3203::3 743.9/.9. 705..-07-039:203.7:/.3. -07-.705.3 839088 :39.8/..2-.880.3.9-.7499073.943  #05.3.3::3 /.8 /.9203:3.3805079:7:1:3.:947.9. /.3 705.3  ::3 .390780-:9803..9033907.705.7.3/03..3 90780-:9 $0.7..8Û 5...2-039:3.3705.7.3/03.9::3 5005../.202-039: 047 .3 202..390705.3203::3 :39.20. ::3  9025.3:9: 80-03.3/3.4-.9.7.: #05.:.7  #05.3202507.3240: $0..507.//03.2-.3705./.0897.7:907..203.2507.2.2-./47.7.8/.3 503.3.80-.3$9.20.8.2-..5..9.8240:/.3/:9405005.2.3 047  907549433.30/:.314814/089075.7./..3$9.703.3 903..7:8 4745.8803.8  39075709.9079039:.5:.80243807.347.3::3 !02-039:.3..780 80 .9.83. .:947.7: .329443/7.8/805:9.91  !.3/50740/.5.3 3:049/...87424842/.:87:.32.9.-.8.38200:.73.../.8.3::3 502.20.8Û 909.83.3274845009743 03. 705.3 203.::3 .314814/08907 .7.  0897./.8803971:. 574.8.7.3-07.-0:2/09./.38:33.749/03../03.4-.1/./47.7  .3:9:*.:39. 20/:2  0307.32.3 .23././.3080843/..

3203.9..90    $0203.9 3:049/.82.32028..9.7::3 0::3  %%     .9 . 9/.03254207. 425430370.7492.09.3-0707.9/902:..9:7 502-039:.5.3-.790780-:9 80-:.9.99079039://. 574. ./.3 240:.24341481.2-.3-07.3.:7:9.971481.95.9 /%! /.:47341705.8. ...5.%  %       .:# .8.//8:.3907/7.802..3/. .3057207/. ::8  -0-... /02-.3/50740./.3/04892/3 971481.8 705.9 /%%! 0025..2-.3 -07507.39.8705./.83/9.8 40:.70.8907.9:9025.754207.3 !.8...8 ..7.705.3.3.9.5./-07..2.8.314814/08907.../. 47/../705.80-:..3-07/0.338.203.9. 38.3/3..8870.032 $.7/%!.3 9025.3-07507.3%%        /%!!!         !!! 54207.8 .3-..80.749 80.200-..9240:3-071:3880-.89.380-..: /0483:048/.9  32 032.8.7.8./.80!!!!           ..8 .8839088 /507:.:.8:2-07-.8 .9:740 -0-07./ 502.9-07:5.749 907.3:39.9. 38.80 .3907/7.75:705.23:0.2.     :.8..5.2705.9 !! /05.. 2:.839088 503.7/..2.380:2.8/:.80/.-:./03483971481.9 /! 9.3.09.7.3/.3/3.9 /%! /04889/3971481.3../.3/%!907.3.3/:3.8 -.03254207..3.9.2025:3.9025..//:..3.09.93.33.5.9503/0 /.3-.240:.:5:30:.9.3/.943 47 !74808 38.3..8..9.747203::/:..3:39.2-.30240:57207.8 #05..703.0/:.399..5..7./.3907.:39.3:049/..2-.7.3/-0-07./.7.3-.5.883908880...    !03.9: .    &39.23. 543:049/..0:.32.9-.39.3 907.3/:.380-.32025:3.7.3/09..8025.3572073/507:.240:/%!/9.  .39.3/507408:.3907/7..3:049/...7:803.38:3/.8.3803..2-.3/....:839088 20-.2-.3.9.83.09.8/048.25:20.7  ../03.502-039:..9:   0483:048/.3:049/.9.703.75:705.-..:2. -07..8503.9421481.2-039:3:049/..9421481. -/70843.408.2.3.83 2./:.703.9-007..2-.:39.3.9 /%!  /048:.9:/.3/80-:980-.9/.7.8..3483971481.8 839088  #0.

.2. .3:9. 0:.3/507:.3507.4.2839088 !4 207:5.3032!42020.749/80-:954207.80 !4 /..80..3 80:3/07 $02039././.2-.70./.2. 80/.7.80.3:39:8390885.../:.80 !4 .3032705.80:39:83908874248425.9: 03254207.8.9:54207.354207.2  .3.7  $02.8839088 3254207.

39.09./.9.80/.-  32./3.0/:.2 502-:..3/./839088-.308.:39.2..80843:0..8.9:39/.3.9: :39./.203.:-0707...9/-0/..98.9::39.3240:3:049/./5...9.353.8.3/80-:9.8.8.3.503. 08..4393:803.2.9.80 .3.9.3!4/.2025:3.   %.7::3543:049/./.7::3 0..3.80  #05.3 /.9:7502-039:.9::39.83:0.8.80.7.3.5.9.3/....80. !74808705.3-08.7:9/.7::3 0::3  .2039075:9:8 5:9:8 .839088-..2-:317.3:39.5.3.9.-.3-.:39.-007.-.390780-:9/3.3032.3-.-.9.3.3.08.574808.55.9:.3-07.8390885.3.3/.2033/507:.8.3 ./.80:9.0/:.. 5024943.7.3. 5. 543:049/./.3907..-075.3574903.8.90780-:9/.7.3:39.7 ..9.90780-:98073/3. 9.0/:.5.42025:3.7:39.832025:3./..9073.80843:0.3/0.203.4393:/.9:/. -.:39.3907..9.07.  ...7..9./.8020...3.85.503..9././2085:38.7:5.2-.203 17./5.9.9.7::3 0::3  !.7:.7::3  0::3 .80 323-007...907...3 203/089.3/.7..-3574903 0/:.8839088:.8.20-.80.38:39/.-.839088 .8./805.7:.3...9. /:.3 0/089.31.34393:803.3-07507.3 5744170./3 897.83 2.:.203.:502.9.3839088./.503.3 -..80/.8.:08.7..7./.83:0./805.8. 57207907-039:-..3-07:93.3:39.25:20.31:38503:393.7.9.9.543:049/.:-0707.30327.907.80  /8.7::3 0::3 ..78.:39.././.3 17.: 502-:..80843:0..3502.3 2028.9:39:202507-.8/03.3./.2-.803.:39.3:39.3.3.5.7:/.:.:5024943.38.54207.0323-07507.3 503.353.  %07.33.907./.9..  32!4/.39./.8.317.9.7.9./  0843:0.32...//.:.8.39:2-: /542078./. .3/ $39088-./03.73.38:380.32.9:502-:.203.-.3.3 809.3.::3 793./.0/:.572.8.3.8.340032!4/.7.2574808839088.3-.-07.2:3  8390885.3 :38507-.8 203.538.543:049/.538.  !.802025:3.3.-07.2:39..39.8.3/.80   .33. 8.314814/08907//.::3 .3503.3203.9..33:049/.8.3.3.47 $090.3 -072.9.3043. 8.253 .3 28.7032 54207.39075:9:8 5:9:8  &39:203./3  :8:8032!49073...7. &39..  $0.3-8. 5.3240:57207//..880-03.:39.8.380/.3./.9. 0.8.3  03/43:0.8 80-.:.:542078. 909.:39.

.3 . 808:./03.3/8.39/./.:39.7:4393: :39.317.9:.33.8.503.7.3/.9: 17...3203.09.7.203 17.203 .25:./. .9.2.:39:20.  .  $0507990. 90793..5.73...09/.8390889/./80-.7  .203 . :39.-. .920339088/.80      47:39..2-.8 17.3032.903254207.7.50302:3. 0 8079.4393:9:/80-:9:39.0/:..3 38.:..7.39/.203 17.90793.4393:/3./.3/./80-:.-..2.8839088  &39.        17.7.7 839088.203      .33.2.203.3203.85.3-.3.34081.3:9:/03.39:.4393:80-03./02:.3-.3897..      :39.3/ $02039.203 17.80.2705.3/.

.

9:2743:0.  .2/:..3:93.7.808:../.2/00307..37:8.0309203.54/ .8. 803.2743:0.229488203.1-40309. 2743:0203./ .3:.7..9.//:.35..39..:3 3..8./5079:. 202-7.29488203.8 $.3/:9/03.2743:03-07.8.31:80/:..54/ 0/:.3/0.2743:0 .54/ $0..80.32743:0. !4890/-.3.:./8.3  80.39. 203.9:2743:0:8..8 $./8..907.80-070.9:2743:0:8/54/ :.38..203..2 /00307.-:3 202-039:8.5.54/ .9:2743:0:8/54/ .39::/.3203.203.742039.80 0843:.390788.8.90/:.32743:0 .3204882743:0203.302:/.2.380/9025.39.229488203.390788.530/:././/:.3.39./.7.780 ..9:2743:0:8.3.//0...3203.9.7.39::/./03.7 $9079.5.

-079:.:94.:.380 /50740/:.3-07.3 /.9.7.-.3/. 0-07.790.8-093.3502-:3:20...78.2 2.80-:.2/.55.037424842..80.28945.380-:././.3/03.33.25:203.:3 %.55.30-07.:.3 502-:3:  .3202:33.897.7.802../.3502-:3:  ..907 502-:3:-07-039:59.3./:.3//.380502-:3:.38945.9-.2 2.1.3-..39./025. 50309 805079%  $4330-473 203..9./54/ .-.9.3 0-07.38907.5033.3/5074080502-:3:  /...:94...82..3897./.790.:3/.55.7.92743:0/54/ :. 02:33.38945../.33.2743:03-0702-.7.9: 43/8.9502-:3:.-07.38945.780502-:3:  8079.8. $0-.3472. $9079.9 203.35079...55.2:2.909.:70. 0/:.9:89079.1034203.857./.3/: .:2../.38.:94.35.3./.9:74003 037424842./ 034950/..38..907.3.82.920307:5.39:305.78.950393  .5.9/.3..28945.7.9/..9/.3.  5.3.-07.380:2.2085:380.:5:3 ..:.3/:.5. 090744990780-:99070-/./ !079.82.82.825.25:-079.:.:8945.8/03.3897.3424489.//.380-:.3-:..7.3.2-.2-.80 80320.207:5. 2.5.25.83 2.743:0  0/:.3/03.3.:3 -/.72.:94.808:.3.82..20..9.8./.95. 2743:0/.9078945.39079039:!.380-:.73.82 9/.8.3502-:3: -.229488203.3/:3 5.780-:.30/:.2743:0..32..8.2.502-:.7  ..35.0/:./. 802039.../.8.3472./2.9.9907.8-.9.9/.8 .9:./.320.54/ 03.5.3.3-07.-.9./.82/../.3.-. $03.-07.703.5.3803.2.25.7.790..3/80-:980-.82909.92743:0/54/  $090.0.034857./.82.30/:.//./.897. 502-:3:  07  .3 502-:3:  .3 502-:3:  /03./809.83 80320.55.2.209-093./423.81.57480870574/:8/.3.3802:...8.025..7.   $9079.5..9/50..7-.82.302:/.93.390788.9078945..3802:. /:.:3380.2.3 897.3.:94./.343:.39.3.8..72743:0 .3/:5 2.9:74003 037424842.3897.3.7 .28945.8.80 .35403.7  .9/..3 /02.3203./80-:9 80-.9203.3502-:3: 5.3.9..5.703.03 03./..5/.338-.38:.5.9:2.03//.809/.90782-43 .790 .3502-:3:.8.39.3-07034950  .5.2.3:93..3.:.3-:./. 803.80.: 5./.8945.31034950-:.5.3574944.3803/7  :8:83.790 5.5 .7909:803/70-07.9202.9:81./50740/:.5.3203.82  !..2083 80/.907./03..3203.5.38945.8.83/03.23:0:8  02:33./.3.39..:94.220488203.-079:.: -:.3.8:.2/.-:.340.35.3.8. 50.55./8943088 5028.3/.:3..2 8945..803.3..0.55.33.380 502-:3:/..78.:70.9073..39:305...8..8 ..-07.83 2.3 50789.3/5074080502-:3:  /.91/.43941034203.793.790.25.743:0:8.907/.3/02.80502-:3:  20..3.2.380-:.3.//.50.890780-:99./42449.9.3203.3./.3507::39:/09.790..80! ./..3203.3/.3.790 5./.310799.3.9079.3.39./5079:.2.3.39.9:0425480 .0425480 ... 0907449 80 80.8..:5:3 5..203. .32./507408../.-07034950 ./902:.3-07.::203.3502-:3:.3502-:3::39:-079./80.2..0/4-.3502-:3:/9039:.:2..

3.3 5078.  !4.802.80-.3/: .380-.7  3/..39.8 03889079./:3..909:..78./:3472.3.380./50.740 #4./..33/.:3 .35079.389079..:507.:3 -7/..4-./8.50.8390.3/03.8./0820.-.7..5.././.3.2-.800307.9/.2574/:8-.39.2.0307.95...35.3/./:2. .-093.

.

.9:740 2..32:9.8.3.3.0...354:.5079:2-:. $ .2.950 .. !4890/-.3472.-093.33.3802:. $0. 54/. .3.42039.3.35099 2:9.54  $0-.2-.35../..3 :39:202-039:574903.3./.3.3.070.307:8.3 3-07:5.2:9.354 542:9.3.2:9.3 09:7:3.39 !078.2209.354203.-42.7/.7203. 800. 5078..  :9.0/.24745.302.9070309//.2.9/.8.90780-:9/3.3 /.7%3.350995.7.7 .3.-482048/.39.3.8  -093..3/.380-:.91 $05079 .3 09:7:3. .3:.3.  -. 202507400307:39:5079:2-:.7.3950.88902839088 57490329443/7.3.3.33.93.3802:.-093.39.3..8.7.25:..9070309//.39.8.3.31:38 29443/7.1-40309.3.35420307:5.229443/7.39.3/507:.

50.380 805.3.91.89/./9039:.5.9-.3-:3.73.3.39/.9070309//.-.3 -0.5-0785./.9: -./.8  . -0-07..3..3.99/.73.2.28945.3-07-0/./.9.9/.82.3-07.3 8.2025:3.3 .3 7085745.009.70.340909:.73.9.7..78.3-0.919.3..2.4745..9/.8 909.74770385.3.-.50.9:9.9 7.9.73. .01803  ../..24745.-07./.. -093.39079039:805079-:3.3/:3 4741 80/.3.-8.  $:.  $02039.9.3 .4745. 90780-:9802.: 5:9 .3./.:3 5.3 -0.5::025..3.3 -0.3-07.9.5.5:99/.9:..3.: 5:9 /.85078. 203.8.:3 20.: 2025:3..3..9 202-./. ./.78.73.3 -07.009.9 . -0/.8.2.90/ $0 805.5.074-.3.2.:71072039.20.73.3./.3.8//. 2.3.3.:.3 :8:83.3.507-0/..3.-. 5::025.3203.3/03. 4745..

9.95.380. 909:.7   %./.39039.3 .-0   0.8 03./.9/.802-.7950.78.7::7.3 1034950909:.909. 80/980.:5:9 -0.8-..3.8..: -0.: -0.:8.3  .3 .80-.38945. -:3.83.9203.907/7.2.%.:./.39:305.: .9.5.2./.54/3/..3/ .-0 -.-0 ./.2805.3 -0.3 -0..329 0/:.381./.8.3 -:3.9.2/4243.:-. .39-49  $0. .3./.:5:9 -0. ..3.3 -0..3/..:380:07 ..5. 5:9 5:9 5:9 .././..5.2.3 2. -.3 9. 4/0.5.9073.5403.80.8703.280./03.9..3 .3  !0309.3./:.8/.73.350..78.2.703.8.8 802039.9.: -0.3..3.3 -0.49/.4745.3 -0.8..3/.2.350.80507990.: ../2:33..85078.: .907/.:907.3907.3 !:9 .8 09.78...-.39.80-.9/825:..342-3.3202-.9-07.3.35.502-.320303.3 -0.9/.320280-:.329 /.380.7/ .32.4745.103495009:7:3.33.38.9.:5:9 .33.32..3.3 .3.3 !:9 .78.3/02..3.880 80 -.: .-./.8-.2.3 4397-:8 4745.50.9/5.5.805.-07.-093./..9 034950.2024745./.3.85078.3 !:9 .2/4243.4745./.5.9.5.3:93.:-07.9/.95.9070309  /..32.3//.: .9 80:2.3.5.35..: -0..9073.-093..7800.35:.3 -0.3 -0. 803.3.: .8:2-075403 909:../.2.3 ./03.39.390780-:9/.2.9./.:5:380-.:5:3 9.23-093.7%.-:3202-039:49/54/ .2-.5::025.89.3 03495009:7:3./50.3 . -:3.5:9 909:.2-..3202-.3 2030. 909:..2.3 -0..8290.-093.9..5./. 034950.3 5:9 5:9 5:9 .3 -0.80-.: .3 -0...9/.: -0..3-:3.9/.7.3-08.

3.3 -0.3 0349503.9.9 5.3907/7.703.2.9 /9:2-:.-08.    5:9..32.3907-039:.0/:.8 ./.54/  0.5::025.5.2-.2.8025.3203.3.89/.3203:3:.47414745.//.3.9-:.9073.54///.35.3202-039:443.38.8.35./.4397-:88945..:-0.5.-.80950.78. $0 80.390780-:9::7.7  4/050.7 2.3    8090:7                                      5403                   49          .82./..39097.8.220488:39:203.29097.3-:3.2./.9..49.20/:2800915.9.80..9/.33./. 05..

78.381.950.78.8203:954.9/.39.3203039:.380-.3708574.8/.8./503.3.5.3-07.950.3 38-.3:35.3-.32:9.38..3.38945.3408:.39-495.9/5..8.-07.3.3 :35. 2.78.:/9039:..09.78.4394 5078.9.8.8.354./.9/.7039. $0-.39.:-.3203:3:...274248423:0:8  07-.8 . 907.909.80950.8 .7.5.3907.3.3..3-..329 897 203..50309.090780-:990709.8./.80.7424842.39:803/7 .3897059428390./.380.3203:3.3 .8.78.2-.729 .39:305..8.3.7039.3.9:909:.39:305.39-49202-07.8 2..909:.0/:.78.35:.8. !078.33.3.3.7.329 897 203.8..3950.79 80../.5. 9.3. !078.83-07.3 90780-:9/.9.5.09.25.2.8.3/03.9:950.3/03.7 /.3 907.3.. 8...78.:.7   09:7:3.39-4980.38.50.909.7.202507.3.381.89.. .9: 909:.329 897 /03.3..309:7:3.58970594283-07.54/..29 $0.78.3.3.909.-:3.:50./ 4745.3907.85078.7039.9:80-.950. 3.. /.0897203:954..88-42.8 /..2/4243.907.39-49 /.2025:3.8 207:5.203:3:.81.4745.7039.909:.9././03.0349508050798.0 29 9.3 50.5.70/:..3..3/02.2/4243.5078.3/03.5.9.3802:..3.3-.381.8 0/:.3/.78..39-49 -07:-:3.8 03. 50.//./.: .703.34745.5078.3 4745.38970594283 897  .350.8090.29 ..309:7:3..3 -0:2/09.390.8.3//::34050309./.80-:.82     29 897 49 29 897 29 897 4929 897      29  29 29 29  29  29 29 29        .2/4243.3.29  0.34745. 085:3/02.3.3907.03/0 .3.81.3.. -0/.950.8/./.3.3.18 :39:202-0/.802.8/.909.3.:-07.3/.3 50./3.3-07-0/./. .2.3.58970594283-07.9.3 507..7 7039.4745.7039.78.39-4980.9.58970594283203..30897.3..3.381.340909:./..3./.33..3507.7503.39.7.9 09..3.3907.3.-.3.202-:9..329 03.3 4745..78.38:3:35.34745.3802:.3 09:7:3.34745./.329 897 /03./ 50.930..8 $0507990.7909:.3./50.0.0349508. 2:33907..-078070.338-.39.38050795. 50. /..-:3.78. 03...3.50..2-.3802:.3 2:9.5.3203.7.3.3.3 .3907./.:2025:3.3:35.404745.3907.8/-.3503.309:7:3./.3/:3.38970594283 897 802039. /.32:9.3.39.7.3-07.320303.

909.2/4243.3.3897 9.802:..3907.38970594283897 7039.8 29950.381./../.7  .3.3 8970594283    . .7.589705942835.897 802:.2-.78.897                                                               29 897 29 897 29 897 29 897   .3.250.

.

1-40309..!.381.:2 0.//.350.0./.:502-..9073.8.3/03.82!02-.27424842.30$945.7.7 !#$$% !$ ' !#$$% !$ O O O O O 7907..:3 !03.39..7:0309$2-43$945.35.7%3.9 5.78.82 7.78.9.9039./.42039./.3 90709.2../.8.3820$9079.825.3. !4890/-.0:.380-:.  ' !#$$% !$ $0-09:.303 03.74980.7.39.7:.78.9073...!0.3!0.3$945..:/.9070309 !03.

547.5073.3:9.250.3-08./.33. //./.3:0:8 03.3.90309  085:3/02.380-./.78.3507.3202..5:.81.3 -.749...32020.2.0:.3 .781...3 8080.9.80:2.03 037424842.903095.

.3.3$945.0.03/0 $0-.39072.2.8507.9/.78.3.3.-'  /08.3...8..35:.85078.9: 81...!0.9//..78.7:7.3:0:8 .98945.78.3:39: 0507:./. 81..9070309 ..82 !..78.253.82 -.3 5.78.3-0-07./.5.39.381.203:954.-093.33.9:1034203..-'3.390780-:9   !07-0/..4394..82 $0-03.78.33.50.32./..75.8507.8..78. 9/.3 70857490780-:9203:3:.3.9-0793/.7907. 8:.7/-.790275-.3.247../.82/.7.8.73.30805079 29443/7..7.../.8:/..80-.5..3.78.: :3.-093.3.30897.303 037424842.39.8-07-./.3  .82 /03.3 /.9:740:38:7 :38:7/:. 202-07.33.38945.3.9..3/. /03. 09::.9:909:.502-.:93.5.3:95...3907/.-093.9:7402.38945..5./.350.9:2-:.350.82.8.7 /.30 47.82 39/.38945...3 50325. 42543038945.:/03..7:909:.3-. /03.23 .2.39.8 5.4394 ..38:.2./.99079039:  .8:8.503.3.03/0  !0.3/.3.38945./.3.3 2.3.3503.3.73:0:8  !0.39. .:39:202-0/.3.7:0--08.8..3 /-.078.250.3503.9070/9078945.2:3 809/.907/.9/:3.5..39/./-.8.3.8 5078.9-07. -./.78.78. 50.7:8/.350..3.82  7907.3/.2 50.507-0/.80-.754.5:.7. 4745.3708574207:5.

30 47.82!02-.82/.2.2.3.8 .3-.9/2:33.703.7..3:39:/84././.39039.308945./..82   $:-899:83:0:8/.50. /.88:39:203/::3502-:9.9073.82.8:..5.9:2.9 .9202-039:04254-07.3202240:  .9.3  7.3 .78. $00.9 90780-:9207:5.9.89.949079039: /03..38-.907503039:81.99/.30$945..5.203025.30494342 0-07.82.38945.3907/.3-.34745.350.38282.8.703.78.3.204254 04254-07. .3 /.803/0 203:3:..30/...82   03 037424842.30 80507929443/7..7..-.382-43/ /.8 ./80-:980-.  %/.- /./.47.8/...92025070.3.5.. 8.78... 97.50.8.803./.390780-:9907.7: 70./.28945.38:39.28945.303 03 7424842.9:8./.381.78.5..50.38:.9070309 /.. 2. /.9 /509.78.2:2.381.-'  0 .82.:.9078945.3.23.82.9:81.9: 0/:. 503.907 8945.39079039:5:.5.78.28945.350.8 8:-80:07803/7  0.3-.9/5.78.3/03.75.38945...347.202-././.3/. .82  7.8945.82.381.703.9 -07.9: ..9:740 03 037424842.913:0:8/./.35.5402.381.9078945.800.50..3.9//./2:33.907030990780-:9 907/.9 9079039: 2.0--08.7:2.3.50.303 8073.82907-:9-07..7 /./.3.3.39.250.3705..947.30/.99/.47.3..78.8070.5.920./..3.2.5.5.909.8503.39.3.23-093.

202-.33./.3820 09...229443/7.-07-.8//.3.5.8./.5.2-039:.3/:5-0-.3 2.503.. /7.897:9:7 /.3-. -079. 09::.3.7./.3202-07.320309.3 03/ /.29443/7.39..8. .3..39443/7./.70.7493..4745.3820202-...08.003. 9:2-:.  $02039.907/.3:3.3/.8.0-:7.27447.202-.90.3..220..5...31:383..8897:9:729443/7.-48200307  32 032:39:0507:.303:39: 203.749 //:. 03 033/.9:7.02:/.././.070..8 .3/-.8 !.742.39.8-442.9: .73..2.3509:3:-.3-.3.35748081494839088  4741-08079.0 57:820302:..3.-039:209..:5..9:803/7 /.9:50309.3:.5. 28.3820 0:./.85.83 2.3...3-.8 .39-4989705942835.301494839095. . 80:2./.9070309.3 -..909..3803.280  9443/7.3 207:5.3803.8:.-.3-.370857./.-3  :9. .3574/:8 0307907/.83207:5...247.9: 4745.27 $...9 %! ..33. 20.3:39:8390883.3.3.7.-0702-.7-.2/4243.3. -.50309..95.3-0-07.82.../.2:7:3.03847.38.3/:25.20.3-07-.3.3:3 82-4889:7:3 902:7:3/03.2...3203:3..89/.5 //.3 /:5-0-.3907.8/...880/..3/507:.3203.380:2.30:.3 4745.30.3. !.-. /.880-.38200309.2240:3..47../47..5.3./03483971481.32070..9//.802:.3202-.//:..35.7.3..9.3/48/.

 .3.2:9..803.880309907.80/9:2-:.2502-0.2.2.90.5.2./.84547.8 89:/1844203:3:.20/:25./.30.370857.9.3 /50740025.203.3 907./.443-07::7. !078.49/54/ 2025:3.5099 ..2509:2-:./. /92-:././-.38.7   %505079.8:48.3../.9.9.2.3/3.3-..7-43-:..843.3 5099/.85078..202507.3.9 .3509920.:1072039.2-.38070.23:0:8  $0.3..3209.8.3-.7.54//03.10349503472.493 203.95..35.3-.370857.349 /54/.9./.: :7.50998070.39..074-./.350998070.2:3 .80.44390780-:9-07::7.3.3 203:3:.39  ./.9  443 4433/3.3/03. ..3.202507.909.3.8 03/0805079-.-4820.3 38-.8.7.80 805.8.3/..32:9..074-  3.3 /03.703.73.9..3950.2209.5.32748458203:3:. 2.8//.8203:3..:..950 2:9.39: 40.3.9.33472.3.38.9..34803 20. .3402:9.-4820803.3950.703.33472. /3.8.320488 ..0.3.5.3 20..35099 509902:9..3.9/.73.8503.301803-.3.7-43  :9.3.35099805079/..80 8090780-:9 203./.2-.10349503472.3 .3.843.3 /03.

38. 8547.70025.7039./ 8:2-072..2.3 203.9.89.3  50.7  8945.78. 8547.8502-0.3203.3.2.0-. .3..3 :35.3/83908803270857.207:5. .3 2048849/54/ 0025.85078.82.340 .9.0708081  %500/:.7803.3../9039:..50993.3472.38:33.3.3472.9...3.35099/03.350.3.802:.229443/7. 09..49/54/ /8././  103495009:7:3.84547.80-.3-.3.-.7. .3/80-:950993097.35099207:5.. 07.7..848547.3.90703092944/7.9.380950.10349503472.50..9:7 2:9...3-.5. 3802:.  -07-0/./5.8.91 5.33.3 :35.3909:. .3 950.0.7039.848/.3203..3507..93.3-08.3/50740..381.80950.80 50993097./03.3 2025:3.39505079./03.:80:7: 2.9 /.  .350993097.3. 03.-.340 909:.78.90780-:9/80-.9070309//.-./.-07902:/03.78...

5099                                                           . 3472.5099 .                                                                       3472. 54/                                                            49 /54/ 3472. $:57081                                 .843.5099 3472.848547 .097.$070.

9.3.5 07:8.3/.9..9/0.5.38:3:35.850995.3 5.5.78203/.5.3-0:2/. 50. 5.3. 3...3 3.31034950 5099 $0.2-.3.78.829443/7.5.:.207:8.95050998:57081 0/.350.025..5.3/03././.9073..5.3.../.320./.0 :39:502-039:./80-:950998:57081 .5099 3097.5.7  !0..78.:909:./.23./:25.070.-07.9.329443/7./03.2:73-0:2..3:93.. 2085:380-03.78./. 50.:...9505099 3097.7.3.30./.35.7202-.507-0/. 2025:3.8. .-093..7.7039.7.8./.909./.907.38050993:0:8-07.0:748547.503.203.3950.8.203.20. 50998:57081.3 -../. :9.950.9.9 8:570847 /423.:909:.8:82:9.78.78.2-.3 /02./. 5078.3 805079. .05030-./.2:7 0:748547.10349505099 03.3 907.7  !0998:57081:.30380.3 2.829443/7.349/54//03./.3./.-5099-0793/.805.  .  $0.9. !.3 3.7 /. 80-.33.848547.2-.0 .907030929443/7.3:35.3802:.820488495099 3.33.3/03.73.9/.3950.73.35099  %5009.7039.33./ 5.5078.2.27$ .32:9.

.

42039. !4890/-.7 .7%3.8..1-40309.380-:..

2-.3507-0/./: 3/.5:303-07.03-07..30380./.90425403-07.93./:.39...3.3.23  ' # !%&$ !.7.1034203.20.3.8.890790780-:9 /.7424842 0..303-07./: %073.30380.338-.3..3:39:202-0/. .: 03 03.3509.2 8070.74248420.203. .2.3/.8.23/3.2.390709.23 3./..23/.#!%& $ ' #  !%&$ 74248420.897:9:73.:42-3.703../.3. 2.5.34.5.3037.9.23 3/.374248425.209.9.3/.320.8025..930. 907:9...:94842  $05079.3 203.23/.2!03039:.95.9/:3./..90425403-07..7   $.8.380.0 /./.3503.30380.3..78.5./.2.3 907/7.35.803./:../.8.354908843 !03.20990780-:9202507.3.9:74003 03-07.8:.5.3820..239/.320-.35.74248425.:0025.//.:94842./.3.8.3742484234247 /80-:980-.3:8.8.-'.50.3803. 03 037./.3./:.23 7. 7.9.33/.34.9:/..3.209 ..9:850808 47.33.0.03 03.9/.23 7424842802.3820 .3/..  20..9./.39./.23 80 30/ 0308 802039.8907..7.3.2. 2025:3..9/:3.754.0.974845.3/.3205:9:7:9./.350...0.9. 202507.33.3820 742.2..8/.3...897:9:73.9:7424842 0-07.3:39: 202-0/.303 033/80-:950789.  3/.3-093.3/.374248420./.9...3907-039: -.390709./.9.23 %50!03039:.2.742484280.-'90.7.30380.3..23 !02-07..70025.0..3.-.3:.3/.0./:-093.8.23 .9:8. 3/.5.390709.3.7.8.3.9.381.50.7:472430.9.78.3:94842 O O O O 03#.5..-:3.3/-.2.3/.85080847. .3.23  03 03.74248420.7424842 :39:85080890780-:9 28.9:7424842.23/.80..5.2.509.23/3.

./.3820  !0..239025./.3/.3.7.9.507.3/. 74248420..0.74845.8.9: 03503./.9.23  037.9:7950.207.9-072..3-093.3-07/.3 /.2-.8.93472.3-093.02:/.37424842  0.-07-.3/. .3 507.2037.5.207.3.39.5.  $0.78.33.390709..52025.74845..-0-07.5.3 203.9/..82..3.9.3.909:.5:9  03.35.0.380-.8.3.037.0307.5./.2 /950 80/.78..74845.:39:81.02:9.3472.9203.8.39: .320325.390780-:9 :8:83.95.:-:3.8907.3..7424842909.3 /. -0-07.2-.3#.3.32./.9.3708574/03.7.3037..3 203.03 .2.3507.85080847.9:7.0.39.3/03.3.3.3.0. 0.3.3 202.3 2.3037.23 /..  30/0308 /./.309:7:3.73.23/.50../.5.3/09.0.:950.7   7424842/.2.3.3.3.3..8.3/03.73.39.950.82 2.5.3/0.39./5079:.9..38.73. 9/.3.39.2./.3  !  !   -093....9:740037.:-..-07.9/-0/.:..9.7424842 03802.-093. /...5.9/04254 04254.5./.1034950/.3034950.235.78./037.9..3..7.5.85078./.235..3509:3:-.32.8.9 81.73.3.3.3.  0.:3 .2 28.9.3203.703.2.3.4-.9.3.: 03950 ./.80..34.35.3..23 /.3.9.5..73.303503./02../7424842/.9:7.32.83.5.3/..93.3. .74248420..8.2 3/3.  30/0308 8.3 09:7:3.33472./.9.. .9.-093..78.23/.3 40% 47.580-..9.5:9.3.3/.3./.42509080 30/0308 !.30380..39./03. 3.5.5:9-093.2 -072../.037.-07-0/..3708574 034950909:. 5:9/03.9.347.203..50.9.9.2-0781.3907.50789..2.3-072.03.3-07-0/.35079.239.-072.3/:3.2.3 .90709.-072.2.5:9 .5:.:2:23..9:7.5..5.3472.23/.30380.3-07-0/.503.39.27424842 0.50.802.8 9073.3.8025:73.2/..2539: ./.32.3 03/0507.39073.88902503039:.3708574203./.33472. 207.703. !07.3./.9/.  . 2085:39/.39.9.2/.7. -.9./.9.-3.5..3.33./.7::203/0 $0.3202-07./.207.3909:.9.4-.3.3.  !078.9 20.3.39.3472./.2 2./.3.2.3.2-.203:3.2. .                     -093.5.2.3.3.9/423.9.7.2390780-:98079.

7.9.33.9.. 805079909:..7  .2-..9-093.39.9:3472.507.9.. .74845./.25. .-.5..2025:3. ...2.3.3.2-.37.7  .25078. .33.3..

7424842 .3025..309074493.74845.2:3 ./90703.-::5.79.309:7:3. $.39..5./.9.3/50.../.3.7424842  3/.707. 3/.3.7..3/:.3.3378203.9. 503. 0349500907449:39:037.7.0249/:3..73.9/:25.80-:.7488 3079.:0907449 .703..7.33..202-.0  !. /.07./..-0-07.2574808502-0:.9:037..:.7.2.9: '.9:3..73.3820.788.3. $02039.39.8090./. .207...3803/73.209  #.. /:..3.34 $02039.39.3.:.  0.7.3:.5.90780-..9424.4244 803.30:.5:973./80-:9 0249708081  #.3203/079./.3.303/423./.. .3../:.3.3207:5.7.3/.90241.20.33.3/..:.85080847.5:97.03708081.9:.7../:.3#:8.7.202-.380-:.3/03.3 $0-.8.73. .:. ./.309074493. $0-.3 0249/423.-093.9802.07.-::.3/.-:: -07.70025..23/80-:980-.9.30-.3.3 /.3 -07-:::33  89.:.203/079.9:  3/.3/9039:.3.9 507/.2.23.3408:.-09.32030-.389.0380.2.78.3202-.3 .3.580-.5.7.8:8:3./:/03.-./:-093.90241.2.8:8 0241.73.9:. 2033.33788.9.  0241.5.:.. 2.3.73.381.7. 3/.3.0:./. .947948080  0../.-0-07.5.98090.3:..2.3 2025:3..32023./:.3.. 7424842..209.23-093..5.7/.-.3:8.8./:. 30.209.-..3/03.209.7424842 3/.:/:.../:42449/423.907/..3.3.703.90.3:39:2030-:9.3 .30907449 0332030-.9:.3././:-093.32025:3.3 .9.39.9:9:02. ./30.. /.805079 909:.209 .3.3.3 ./03.7 0/:.5..3/./:42449708081 -093.9: 3/.39.8.3:8./.7:203..0241.349..3907/.209.07.3.947. /./.3 -093./.93. 0:.3-0781..-.8.80.3.2.3$5./:/03.38. .3 503.909074.9.-0-07..7.5.7424842/.303.209 $0-.7...:.-:.3-07-::947948080.7.3 /.30907449 0.. :.8047.39. .9.95.33.35:97../.30249708081 .5./... .9.9:  .9 .39..5.2..33.9./.9507/.0390780-:9708081 3/.39.9:5:9 !0.9.3 202-./7802.78.754../:25.3.50./9./:-093.3.7.3..:.9.9: 8./.30249/423.33 /.3.#.802039.349.4394037.5:97.0241. $0-03...3-0781.. .95.3203.2 3/.7424842/.-.3-07-0/.. 8.30349503/.

/.  #..2 .5:973472. #.5.3.90241.947..-0-.8/.9:'.7503.

73.3.209-070380.3.7.:5. .350./03.3. 8.8.97.381.78./.2357./:424..3.!.8..3/.381./.2.97./. .78.54.50.

23.39../:09074.7.3802039.209-070380. 3/.39.

3472.2-.3/03../:424.20302:.-093..3..3.3./...037.8..31034950.80/980./.3.33.7.2/02:.78.203.3.352039.-..3/:303.9203.33/..3  !0..3.950.209   .3-.-093. /.3.03708081-7.3.2.8.. .-.209  ./ 5.02:9..39.8:.980/932:33/80-.3..3.580-.9:03.0708081:897:/.8:83.0/423.. 5. .3 80/.9..7./.3-::.2 03.3.8-::80. 7 2030-./:09074.3.3#.-3472.02:9.207:5.5./-:7 ././.3408:93.2 203.91 :2./.:3472.3.32030-. !.9.3.3 8.7424842.5.3 50207./ 80-.3 80/.:897:907.-..3..:2:23.3.3/./.  4394037. 3/.

38.9//0908 0-07.0.33.33.3/.:2.-  037.-3472./.1034950..037...8./.2:33/085708./..5.3.-3472.3.3/.3.303.1034950 .3.703.5.3./:-093. //:.  0.35.980/9 2..8.989.3/80-.0/.-..340037.-.3.207:5.89/....

9.303.3#.78..7    !!  ----   -093.0.39.23/.9: 03 035.7.3.3 2030-.7424842 !0.-.9:8.34.3/7 4394034.9/.2-..381.239.-.39/.9.-.74248429/.33472.05./.38:3 805079.2.3507.0/:.-0-07.8.9/9.880.342448. 085:3/.35.3..3 2030-..03 3/80-:9:.3/809../.9037.9.32030-.8025:73.239.3 .034.0.3..90787.3-::5.39/03./.78.3.5.9:740 03802.3/.-3472.32030-.342443/80-:9:.9.5.3-::503/0 !0.03 5.-::503/0../.2.7:400380.703.3-.7:7.3-07.23 /.3.78./.  !.3 9/03.7424842..3..32025:3.50.3././03..39.78..37424842 9073..8025:73.3.3/75../. 4244/03.03.303.9.3472..39.802037424842 /.8907907/.0.                .  0.95./503.-.-.$025:73.9.3 ./.3 5079:2-:./. 20. /.7/.3-::.7  !0.9/.03.3-0781.9.97080813/. 742484290780-:9./.5.8:95.3...5..7903.3-::503/0-093.187..3.9.037.9/.3./.3.3:8..03.9.803.5.:94842.3/.:802039079039:5.23%.35079:2-:.3 03.

 .38.2.  $8902!03039:.3472.2.8-.3202-07.3 3/.7 -.39.78.239.3472.95./.30380.239.32.7 507.3708574:39:03 03.78.507.. .2-.2./.239./: 57..8025:73.54..3/..2-.78.3.2025:3.80507950./..2.0.0.3./80-:9. - - - - -093.3.8.3/50740/.3037.3..3.7  . 8025:73. .5..3.805079.9. 8025:73. ..:94842.3708574:39:037.7.5..9/.3:.23 %0.33472.:94842./ 50. . /.250.3:8..33472.39.303.8.-093.3037.0.3.

3..09074.39.39..7..209  802039./.

/:./.23/.209  !03039:.3.3:8.3...424.3:897:424.2./: -093.30380.209  802039.3/.09074../.7.-093.209   $0-. 5.235./.39..

3-0-07.75.2 /.3.3  $0-.8-. 742484280842./:.7.7.9.3.3/. 2025:3.3./:-093.88902503039:.-0.30380.33./....!7490347-093././:.7424842  $890238-.8079./ .-:. 3/.7424842802039.202/:..5.280 842./.5.3/.39./.2.30/:../:./:..39.3/.3.23.2025:3. 5.983/../:-093.3.0--.3/02../. 88902 3/.33.983.8.39.3.5.3 :2.80-:. 28.7424842 80/. 07:9 3.3 203:988902 80/.7424842 .3.3 /.3.2. 2025:3.3.35.39.98807..39/.3275/03..3:3.35./.3/0.5.:2.  $8902  $8902 /:25.038807.7424842 03./.8.8890290780-:9 2..3-../.39.39079039: 203:9 88902  $0././.4394   84320302:.388902 0/.33..80842.3.-0-07..

388902 .3807.:.7424842907./..:-:3.235..235.5-.   7/020.9 74845.3-.30380./. .37424842 ..3.350309.820325:..2. -07507.-.-07.3.30380.3/03.:94842 /. 47.0380.382090780-:9-07.8503039:.338-.9:710799..33. .7.3..8.3.3.9.3203../03.3 $0./.88902503039:.23/03.3.37424842.320303.39./.73.39/.

%..5.-0   %.974845.5.../. Ð7424842  Ð..9/./.:94842  3-.235.95././..-0  !03039:.974845.30380.

3 .39.23 .  0380.

 .2..3/.7903403088 .-./...980-..30380.3 0.5:.943 ../:3472.9-.7/:.3./3.39097.-3472.3890709.3907.5:.39:-:3.09/. /54/ 3/80-.. 343/8:3.7.2-.907.23 209./: ./..3..202507..9:502-0.5..9 81.-0-07.3 209.54/ 8079.5..9:7.8.5..9.7  .9.2..3907-039:3. 7424842909..7424842 3..3 .0-/. 0/:.23.-././.974845.-093.3907808 /.3200-:2.92030-.9754//.-093./.34425079.25. 80-.93/.-3././:.8:507-093..../:/03.-0-07.3...58.3/.3/742471 !030-./..3./:.39.0380. 2./.5.3.%.3. 209.3/897-:87424842 5.:3./.3.9:.7424842.-.390780-:95073.320488  !..8050793.808:.3 80-..224.3./.8. -093.58.2..9:7424842  !.22:3.3..209     -093.9.58./80-:9 /03./3.-0 .58.3.                             -093.-0758.3802039.39.:-.2-.2530./.907.203072./.50789.381.-3472.5.9.3 -093.74248425.389.33/.3/.-093...74248425.9.3 3907808 3907808 ..3/..80.3 //.  . .5./..2./..5.547.8.3203.3. . -093.7   !  ./: .9.33..32948849 .74845. 8.3/3..340 907.5.507.5..39.-093. 74845.3.7.3:2.39.-:..-0-07.950789.3203072.502-0.8. 209.

3-./.77  !./.3.97424842  $890203$ %8 .3-.7.9202507.3-093.5907-039:80../...:90:7.3203.9.930./.9: .33../.89  742. $97:9:7802.35007.9/..23:0:8808.-093.9.35:.39.98.9. $0.35.805079802:9 0-.54/  $02039.340 1.703.2..3./.974248423. :2.5.7.9203.742.30380.-07.3 :2. .32038907.3//.3.:3889898 -070380.5.507.3203/0.80 80842.31034950$*9898.39./.0309.0342 909.7./.3./.3443.3 $8902503039:./.3202.-../.9857..9.909.803.:/03.:-.3/02.239073.9: ..3-0781.5.374248420.9:20.380842.3./0.20280-:.30380. 2.0-.!.8.3/84....3.3 02:/.3.88902503039:.3  0.850.7:3:3..39..7903403088 . 80/.8.3./03.0342 507.3502-039:.9857. /03.90780-:9:39:02:/.3 -:3.9.3/03.39/.5:903/72::9  /./ .3203.. 2023.3203.370574/:8.23 $047.7. /0..3982./.83203.39.05.3..3 8890290780-:92.:507.303%8 ..3 -0702-.:5:3:2./:.388902503039:./54/ 03.:3/03.7.. :8:83../.3-093.8. /:25.80059080. $0-. 2.3/03.3.5.3-.3/-:./03.24348:8 -07:2. .39./.3.5.:324348:83 2025:3.23 085:3/02.0-.930.:33472.80-:.3-0702-.39/.:3/03.39.0 .8503.5.5.9473:3.7.742.:-.39.3.3..802.5../.80842.39/.07080818/.8/./.3.88902503039:.3-:3.3.9./:.9/-0/.3 ./.-0-07.03$ ./48:8 -07:2.9./.93430309 ./..547.33.23.235.3.907/.. 9: 3/.3472.8.9.77 5.2025:3.23-093.3  .39..:7.3 -093..9: 2025:3.9.8./:.239073.9.39./.3..3430...73./09.3.328.1:.30380.39/.90720302:.8./.930.-07.8.507.23.742..8.370. 8.1034950$*%8*  $02039.08  !03.3039079039:  ..23-.3-:3.5:./.9 /.3..3.3/03.3-:3.8.. .7:8 .5.9.43 3/.3.-093.3/:5 /3:3. -0702-.3.-.9.9:7502-039:.7.9/.85080820345907.. 74248420..5..23802039.8.232.233.97424842  !.3 /.3.2..80-07./3/.23909.3 !./.3 .3/..9.9: .897:9:79079039:.:9430.33.   .3.9:7502-039:.3/. 90:7.38.2.5//.703.9/.9.930./.7 90:7.3.80.39:3 -.7424842/:7.3507..39. -093./:.7.. -093.8/80-:9./.3  -:3. /./:-093.3-0702-.3-07.9/..9: 3/.9/./.3./.3.30380./9039:.0342. 28.3203.3/48:8 .:388%8*./-:.83 2.3.:93.98/./03.39:305.80842.:320302:./3/.3-.98.7903403088207:5./:-093.39./:25.30380./..3:8.703.3:93.374248420.3:95.80 80:...897:9:7 9079039:.5.-07:-:3.3 /03.5.  0..8:8.974248423.23..780-:. /.7..9.980-:.9...

9/../  03907503.203/.9 3/. 2025:3.9 /423.3.9:  003.. .23.235.3107038.9.947030982020.8/488/:8:..938.380.343.80.0/:.7 43 8047./..3.8./03.39.7:0.3909./.3/:5.3507.-093.2357207  $0.7.3.9: 802:33202-.320303.29:-:3/.3 .5.3 085708.23207:5.2025:3.73.930.8:./:3.8.3.3.3..2030.8:. 5./:..703.7.03./:42449.7:0.238079.8.3.75030..3-./:0249  47243/.3103495024..7:2/.3742.39.7:50702-.:94842. $0-.7./48801091.57080815.9:03 0907449  %.7.3203..243/038..503..39.2.3.308570803802/423.0380.3/.7:0.23/839088404.39089082..32:33:897:202-.374248420.2.7.5.3.37424842.:.209 /.3.23 03907503.8.3.3/.9./.3 .703.235.35:./. .3  .203.7:2 908908 /.3-093.3.3.742./. ..3320.742.389074/./42-.80.8503. 8890247243.23 $0-.3472. 503/079.3/.93 0.3203./..39.23.2 .-07-.393./703./..3 .3472./.9: :39:/./.3.2.9/..3807.380.208570881.3820/09.39.2348039088 !7..3-0781.38.9.: 503./.9:037.7.234302-74 ./42-.30./././.83/742%:7307  9/.3.23 28./42-.23 .3037.3203.8..3802039.23 03.32025:3.8800././42-.. 03708081  54908843:././03.30-07.39. ....39.9.5.::5/03.3  0.8.9/03../:..3507-0/.7:472430.80-:..3/:/42-./..-07:-:3.2.90.8472430.38.703.8/4885.3 5.7.3/.37424842 0..3.38.3:9.703..0309.742. ./:-093.381..0/:.8 085708037.90.39.. 02./.9.39./..3549088-. 7424842.2.2./3.././:-093.8-07-0/.357.:.23 8031:03.503/079../.3  037.35.5.32.0..3202507.9:7.2347.7.3:93.83/7423010907  2025:3.57080815.742.993/.03.2380:3/07  !.80./..03/423././:-093.3:39:203039:.9 -079.3.1034203./:803.3472.9: 80-.23 .-093.472430..3/.83 2.8 803.0../42-.03 42449 802039..380.7:83.91/.9:  0..33.3203.7424842 3.7378203.8.3/..-::5..23 $02039.7.742.23.2-.3820425038.3.74248425.915./703.-.30380. 57..3.9:7424842..0309203.930.3.: -./.  .3.4394  03.7:82025:3.91 5490883/.0907449 202507.3:8..503.380-..73.832025:3.1:38./2408047.-.1.3/. 5.39.930.3/.93 0.9/423.3038 0. $0-.2.7:83.23..3507.7424842 3.7..909.  0.9:743/81844/.:09074742...3/08508..9503.3 003.-0  8570803907503. -0781.9/03.7.3203:3:.3/. 202503.3488-07-.9.20.88902503039:.930.30.3.307.3820425038.0/0308 ./:.9:7502-039:././.3203.8./:..3.238073.

9/085708. &39:/.57../.3.7:82025:3.5.9.2:5...23 $0.3..3/: 4394.3/: 9/.80..9/507:./.502:.:94842.23.9:7574/:88:8:5.. -.308570803/.35.0380.8.39.3  80/. 2.9.5.7:0..3 /./.. . 03-/423.23:./.7:507-0/.9..39../..33472./.././.23 472430. 57.9:70-49.3202503.2:3 3/.5..-079..0907449.8.90780-:9   .3 -079.93.3..39.303907503./.35.:../.3203.5507.35..9:0380./.8.3/03.  .57080815.3/.-079.549038:39:203.3/: -079.20.3 5.23/3.39073...3/: 9/. .3/: 42-..3.8.3/: 9/.909.30349509079039:80-03./: .3/03.3/03.7..2025:3.8.3574/:88:8:.0907449.8085708035.3./.39.9203.0-07.39.20-49.20-49.3203.33.909./.3.3:8.9 /085708.03/.35..39.034950    42-.9202-. $0-.39.342449  03907-.23 80290/ 0308 439403802.3203..-093. -079.-079.03.80. 03/423.3.5.2. /.9:0380.393803.57.3 09:7:3.8..303907-.23.03./.38047.73...23 03./.8./:-093.57080815.3803/73.

.

307.3!3/.42-3.73.303. ' # !07./.35:.35078.3 507.0307.3.3 :39:-039:-  909.3.209.3.9.803/03.$.3::2800.37424842 !0209.::203/0 .:..9.507.3/-7/203.02-.303  0.50:.73./.8 42-3.4-.2.3:.3.303/423.1-40309.42-3. !4890/-./.3/..-   /03..3-039:- 2.3.37424842 5. !0209..742039.-/.3!3/.-08.3:9 50.203.3907....5202:33.35078.3/..3..8.3/:.3/:342-3.8079..803708081:39:.8 /.8 .3907.3:39:.73..7 # ' # O O O O :.3-0-.8.209 ..803/423.703.-  /03.03 /03./.8./3.$.3::2502.890780-:98.34003/0 -.203.:5:3/-7/ 90.35.4-.3. 2434-7/2.42-3.3 %.7  ..3907-039: 9/.3:8./.78.9-.303708081:39:-039:- ..0307..

303 03-07.8 /.-07.209/03.3/.3-07.39 $0: -0:20303.0-09:.7424842./544-...0:39:3..035.3203. 793..809.2.3.303 03-07.3:.3203..95./. .9 %  47./.:302:/.9:  ..20.0307./.3.2..303808.803/423. . / /.8207:2:8.303.37042-3.3808.3820.3.3/:3.32025:3.808.3.33.92.303503.8 .3. -.  .209.8.:2..3.3909..33./.2.3/.803/423./..03/07:3.03503.-0702-.2.3 /.74380520303.338-. /./.:2.07  /./.9/:25.3...209.7.5..3.83 2../.0025.303 /423.209/03. :.3.83.8907 .2.3.:..90843/.8070.5.7424842 3.0 .90.8.3::2502.2.3-07./9/..3./.2.780-:.380. -07.8/03. .:09.390..33207:5.-07./.209./03.4-.3 ./.  /./.303 2./.35.:-. 0-/.-/03.78.320303.2.3 1034203..5:3203.3203..720-.85078.9:7 .3.5 2070.35.:39:80.03 03 03.3:2. 2.37042-3.3.8..30--.9: .7207.3..-.8  $.3/./3./.20309.:3  .28070.303 03-07.2.$07.3 /.88./03.34.3.3.38..5. 2.354.9202-07.5.974845.73.0 7080813././.9..3.3./.7.3820 50. 03/09/. 3.2.507-0/.-203.-07.3...:2.2..-:./.3203.8.3/:25..2.39.25380.7.3 708081 02.3/-7/40 .78.5 85080847.7.33 $0-.3.5079.52..350209.5.9/.209./09.9.3.-./.8/.3.:0--...209 .4394 .2.3..5..3.9:7-039:-90709.47.203:9::203/0 793./.748834.75..7:809.9:7..3.92030.03./..3.3808.0  034203.:03 03 .5.340 0./...-90709...3/5074003/0/ 8.2.2. 38-.2.3 9/.9.3  $9:790.3...320.9/.75. 54..39.209.307.20209.742484242443.209 -.-'3  :.3 708081.38.3/:3 03 03/423.9:7 -039:-90709.7.8.-078././.3/:342-3.-07.708081  $0-.3.3.7424842 80/.3-0-.7424842.302-744/.3907-039:90780-:9/80-.3-07.803/7/3.:-07.3..3907/7./33 .37424842 .38047.  03 03.3..380-./.35.3.35:.-/.9.339075709.38-..2../ .3 /.3-./423.209.8/.3-08./423.-/./54/ $0.3.354891/03.5. 8.33..3-07.7.8 803.3.3/.20./.3 .5.280-:.303...303708081 .8.92070.3 # !:33095.74248429025. /.209. /.8:.3/:303 03708081. .72.83 03503..:.5.73. 03-07.74248429079039:/..8. 03 03-07.7.0-/.3-07. 2.708081 2.939.0--..350309.342-3.3. /.8. 9072.3/50740 .8:.3203./.3.303503.3/. 0309.3...3:93.3.9.3.2.507.3 907/.3/:3.3./902:..5.9:7424842802039.3/./03.3-039:-/0.3.2./.3.03/.805079  7/08   :07 /.8 907..3203.53/.-0-..303-07... 30/0308 80/.....5.3.73.9:7./.3.5.74248423.33.3.75.

/:/-7/.-.5.- .25../.9.2-.3  .303-07.2.7  ../03./.8 ./.-07.  -  -      . 02:33.0/:.- 3 3   .38.80  $0-.03..30/:/:./:.35. 2. 03/423.2-.2.38 0/:/:.7  .3./.0/:.-0-./80./. -.802.507.23/3.3.3.20/:/:.3.2-..83.209   .303/423.4:535....-:.8 :.9/././:/-7/ .37042-3.3.2-.209.8070./.  ..3-078.7  ..:705:8435.3037080818050795.3..3.- - . /9:880-.:431:7./:.7. 202507.303-07./80./.3907.3907-039:  - .209.9../.3-07.039/.7 /-.0307.5.83/.-.3/.3.:-078.8/.7. 9. ./:/-7/.388.9..25. .7. 0/:. $02039.303 708081- 0/:/:...03/423.7  ... !.3907-039:/.907.5...-07.703.03.7:8907.0723.33.3.37042-3.39.2./. 3 3   - .37042-3.397.:9..3.28. 0/:/:.9.803 03.388 ..354.3.3.349./03.3 -07.9.397.7   .3/..3.2-.3.3. 8...380.9/507-.3./03.03-07.7.039/.:.2-. /.303708081. .39.9: 5./03.8//.209 .2-. .803 035.-07.9.3:.2. ..30/:/:.8/.3-07.-078070.3/3.3-07.8070.802.3  3/. .38070.8/.73/.9-07./3.:9/.3:9. 0/:./03..80  0/:/:..-0-.2.7  .5..03/07:3:39:80.8..3.03-07.  .3-07-0/.2./:.-.&39:0-0.80/:.

 /03.0/:.-.3.-.388 /.3/9:880-..30/:/:..0390780-:9-07.

.3.3./: .3./.3.8-/.2.2099505.8.2..83 /80-:980-..-..2099505.3203.2.30/:/:./03.88:8:3.7039.303.88:8:3.32./ 503:8.:5:397.5.0/:.9/:.-8079.8:8:3.38907/../.3882..97.3.3/.3035..3.0/:.3..2099507042-3.38  ..7039.7039.207:5..3.209950 7042-3..3.0/:/:./:3.3.0390780-:99/.-07.3/./.  .3./: 80/.-.0/:/:./03.0390780-:9-07.8 .2099505./.83 2./:/-7/..5.5.3035.3.209950 7042-3.38.3-07.209 .3033.38:8:3.-..388  ./. 2025:3.37042-3././  3/.

8. 9/.:0-:7./:.2099507042-3.83 .5.3.7.7.3./:.9.3.3  !0789./. .9.35..  88.03-07..:2.8 2.3:39:203.2099507042-3.9:3/.7.-:.7.9.38.3./.748834.3. /:..3.2./03.-/.9.3.8/:./: $0.8 %07..209 9505.3 .5.7424842 .3./.3.-:.7. .8-078.3.2.: 8..3307.209950 5.9.3-007.3 $0-.9-07/0. /0..8.80.2099507042-3.303.95:...99.7..-.  ..3.38.5.0/:.3.4394 .:-:3..3.3507.2-.8.7.3:39:203.-07.2099507042-3..2099507042-3.83..80-.:2.8..3909.9./.8803.7039.3././:./.8 /.3-.3.3..9./80-:9.:809/.3  08./.2.30.3.7.3..7/.38 2.30309 .8.3-07..80.3.8 2. .209.9.38:8:3.3  $0-03.8.9075.209950 5.203.9.8.:39:2025079. /:.3-0-..9:.5.39.38.3 -078.7 3.209 2.33.3..  . .7../:80-0:23.2099507042-3.3.3. .35078039.3502.7502-039:.03 03.8..207:5.3.039/.2.5 /.39.9.203.3.0/:.92030/07. 80.3 ..3.39../:..2099505.3-.3.5.39.5.4 9025.32025:3.3.2099507042-3.28070.3..2099507042-3.840  $9:790.18.390780-:99.5.9. 2.2.2.8.8.03-07.209950 7042-3.3 .3 .35078039.37042-3.39.39.3509.-  ..8.8.2.3-.9203.3-07.209.7.907:8 20307:8/:9405033.8.: 47.38.353/.2.3.3.3:93.5.209-:. $0.39.853/.209 9505.30/:/:.8.8-.39/.3.7039.2..250789.8:2.907/.-078.83.8 $0507990..-07.7..7039.7039.7.0390780-:9-07.3.3.  80/.380-.32.209.8/.3907-039: .3..7..5./:.8070.0/:./.880-.3.: 38-.80.7. 02:33.39 /:3.03-07. .58..7.7503079.7.3-08.7.9:.7./.3 ..3 80/..3..2099507042-3.9.2099505.7039.35033..38:8:3.3..320./03.9.//.3 ..7039..2099507042-3.53/.3509.39.03-07.2..03-07..83 2.802039.03.8 03.2099507042-3..2.7:/.7./..3/.8907/.3.3 035.3:2.$.2..7424842 74248424244  .80..209/03.. /909.9035.703.209950 7042-3.3507. 8..30-2:/.3.90780-:9 /./03./.7  28. $09.8.2099507042-3../:.3/./.2099507042-3. ...03/.3.2..803 03805079.7.2099505.7039.353/.7 5078039.8:..3..07 .3.2.5-078.8.3035.3.7.853/.3.3203.9070309 03 / .3.9.3 %0.03-07.397.2099505././03.3.33.3.209./: /-7//03.0-/.39.03/07:3:39:909.3-.9 5.03-07.80 ..37042-3.9.3./03.39039.3.2070.9203...5. 802:.8. 8.3.3/..880-.790/:.3.3/.0/:.890.38:8:3.  2.8 ..3-07.03-07.3. ... $0-.3907/...7.342-3.2099507042-3.37042-3.3203/.7039.. ..7039.3-..7.70.9.74248429...  !3/.:2.8 ::203/0  207:5.8.30.207:5./.3.382050393.9.0-./.:5078039./.5.5.2.3.3.7  3.3/3.3.:/03.88:8:3./: 80/.3/03.:0--08.9/.:.73.7/.  ./.0/:.39.3033. 9/./.3203.9. .3. 8008..5.2099505.:3.3.././03../3.3/:25..3.7.9:5079:.303 03.703./..3/.9.9.3/50740 42-3.

280:2.8.8...53/.4:39:0507:./.8.39097.53/.3-0-.. 0-07.9.3  $0.9.38:33.5.3-.3203:3.39:2-:203././.3. 2:..5./.3907.342-3...4-.5.53/.. -07..3203::..  0..-:9.8.3 .5.88.8.2.5..3:93.89097./.2/:5..803.3  !4.53/.3..5918.2.9/./808:/.87424842 !.3.5741.9//0908.74248424244.3907.9742.5-.2-.9079:9:54003/423.742.507.431:7.3.4.30:748547.9 -:.808:.8.74248424244203./5.2/:5.54/ 03.9.88.9/ .8 ./:5.2502-0.54/.9/.8:8   - ---  .703.703.3203.8.338.3907.2-.3./280:22:980..54/3.3./  :9-.9/3.95./5.3.80 70574/:8.3./:5./025.7.7 /-.3.-3.-7042  .-' $0..9907-039:3.802.303 03708081/.21..8./..5748080.3907..87424842 /./...8 /50740/.3203. -.880309907:9.3/.907/.3502.588 .3:./.... 0025.950393-.. .7..4:8  !3/.3./ !.3.3..                 04880488  9488 .848457.703.-070.3202-039:83. .329488 803.    . 0857083.9:..3/3./.3.7.80204880/:./3...8203.034950 034950/03.8803095.3203.8.

703./80-0:27424842203./.   $0-.3..80..3907..7039..3.9/5. 0025..703.8/.32.75.39.2/:5..8053/..7  .8 %073..3-.9.3.  0./ 8090.853/. ..2-.9: ..3.3.8:85.209.3/.9.8.2 .7039.848547.7.2. 5.  /03.3.0/:.848547.8.. /.-.3907.53/.7.7039.- . 53/.7424842203.3/.2 /:5./.39/..3 5.209/../.53/./808:/.8.2:33907...8 -078.848547.7039.848547.7  .-.3.3.84547.9/./.9/825:./:./..380-0:23.9.8 ..3907-039:907/7.5..2-.9/-0/.8808:.2./.8 .8 %.             04880488  9488 - .7 3.8.3-07.7039.329488.:8.75030.848457.20309.25.7/.  --7042-3.2-.9505.2.7039.5.2099507042-3. 2./.02:33.89./.8  !078039.209950 7042-3.3-07.8502-0.2/:5.7 5. /. .8.8.- 5. 0:748547.7039...848547.2099507042-3.!4.5. .5078039..2-.8.5079.3.7  .2-.3907.30.7.70/0.03-07...8.8. .7..7. !.:-.9/.. 80./.2099505.7  .39.2.7.2099505.9.5../.8.9/.-.8/:.3-.88.-..8:..380:7:3.754../.9..5.3203.7424842203.8:8  5.207:5.7./.0/0.9:..

3.2099507042-3. 02:33.3 5.2.2099507042-3.3 .. .3907.7./03.3.854891/03.3 907.8.3   202507. /:./.80. 28.39.8207:5.3.3.39.7.2 .89079039: 0-:7...25.2.!0789.3/. 53/.380.8..8 53/.3907.9.2-.3 $02039.2099507042-3.03 03/03. .8.7./.9.3.3470.9:/.853/.7...3/./.8.3   /.7. 8.853/./. 53/..8 .    .3 /02.9.7.39: .3. .2099507042-3./..39.7  2.  .853/././.18.2. 03. .3.309.:805079 /80-:9.9.-.73/3.   .39.3.3.9.7.5078039..7039.8053/.3.39.8.8. /4:-0.07  $08:.353/. 9: 5078039.:9.3 -08.3 /./.7.8.8.73.8. 53/.8.-.18.3.3-..0/:/:.8 .3907.3.:.3.-/./:. 0/:. .353/..209.8.3907..3-.88.       .2-.35.-.3././.8.53/.9907..28./03./.3:.39.03-07.3.3.:8.8.8.2099507042-3.253/.853/.853/./.3.3907.3.3.  %.0307.03-07..3 8079.3.  09.3/.32030-.2099505.:53/..3/../.2099507042-3./. /.8.8./9.3:7:9.:53/.3.2099507042-3.39.35.3 !079.8.35.-.203.03-07./ .3907.3..8.748834.8.-.3907.3907.2.-.3907-039:3.853/.7./...7.8./.8.- .3/.8...9.9:.90780-:9 8050795.8.3.9.3907.3. $0..3.03-07./.7..-:.3. 3907. .3-.2099507042-3.5.9.3 02:33.

.3&%...209..-08..2..8. . /..2093/.8 90780-:9..-07./.8. 0-5.8 5078.   $.3.  .35.75078039.3 .4394 3/.   --. /03.3:9./.803./.209.5078039.75.52.73/.2099505./:97-7/ 90780-:9 $050795.853/../8.3 .9039:8...7. 80/./03..39:305.853/.03-07. .853/.3.--..333.3-07.2.3.3/:25.0390780-:99/.- . 99 9700 54399089.7039.8.75.853/.75078039. 5.9.3.33./..09.7.209.1034950.3/.3/.8./.3.9:3/.8.3 09:5:.5078.8.3:/03.38:.3/.9:     ./0.7.. .3.2099507042-3.5030. .53/.39. .303 2.3/.5-07.%9 $.../03.3.5.8.338-.3.3/..7/0.03-07.2.38.209950 7042-3.3803/73. 2.303/.7.-- /../.75.853/.3 9/..853/.3.3. -   .3/.  -- ./03. 0-5..3:907.80-.3.--.853/..21034950 .39.7.7./.3.3/.7.39.2..3. .2-..209.32..  2.30. .8./.../. 8. ..5.0/:.-..././:42449708081 $.  ..0--.30--08./.2:3 .3 3/..3./:/03.39:305.390780-:9 .8.8.75.209/.../:97-7//3..38../.7  .2. .3./0.3.-...9.3.3.04254./:.30--..38-.35.././:97-7/.7  !3/..3.803.209. .3.3-08.8././.3: 80507990.803..3.73.-.  .2-.209.909.32./.:2./..8.7488 $0-.209 .209.

 .-. $02039.3..9: /. 0425409.9. 203. -.3.3//./.2099505.8.-.07.3.7.853/...209.3/.07.--.  042540/:./.20953/../. -/. .2.3//.73/.-..8.853/. 8..3042540025.9/-.- /./025.5.904254 042545079. ./.7039../:42449708081..209.3.3. /.

8./.703.83 2.303.9.38..8...025.. 03.2.209 .338-...3/.83907/7..32025:3.8/:.3/02.:5:3 7042-3.. 2.-..88.904254 .7039.3.2093/.9:2.:8 034950.-.21034950 808:.2099505.3:3.2.8:8:3.3./03..-..3 103495080.2..3./:. .32.38.  .

-.  ..

7039.803.-..907-08. 9505.7  .-. 5078039.

.-. .

-.

-.8.39.39:305./.-07.7.3..8.853/.. 9507042-3.54884:8  ./.803.3 5078039.

-. ..

3. 9507042-3.-07./.853/.3 5078039..-.803.8.8.7.39:305./.39.54884:8  .-.

.-. -.

8.803.9070. 5078039.8.-.3.. 9507042-3..  .3/.853/.

-./.8. $.9..51034950..9:742484242445.

88.9:.703.034950.3.  0.9.38.8 80..3:90780-:9/.81034950.2.9: -. 349.03 03/03.8.38:8:3. .3.:202-.-.

88.0349503/./:.83 2.3349./:./03.3::39:03 03-07.8 :39:.83 .2.2.8./ 3/.2093.3.

. 0/:. $0-.502-:.9.3.38.39. ./5.8.3 5.7424842/. 9.33.8 .3907/7.7   ..2093.95.75079.::2./.31.3509./../902:.3./.7.303495090780-:9 .4394  5.0/0.3:7:9.-.4394-07:93  --.73/.7/./. 8....0 74:5 .3.9/.5...890790.7.3.74248429.3.3/.9../:.3.37424842 . 3.34.7./ .88.7 .9/2.3. 28.::5/9:8/03.503:8.- .9.9.3.9:/..3 /02.:39:202-:. 907-08./..7424842205:9503039:./.88.3.880/0709.3035.3:7:9.7424842 /.5..::5805079349.5.90425403-07..2 509.3203..9.8.3:7:9.3-.33.9509. .025.3/.3.9.9:7424842/.-..573853.303.3 /03.3.9/0.57424842/80-:980-. 805079/.3  09::.99/.3:9.2.5..303 03/03.3-03..80.3.../.2.8.33.2-..7.35078039.9509.9:/:..3:39:202-:..39.7039.:39:09::034950.20.35039:3.3:/.9:0425403-07.8.3.9079039: 03.9.. &39:203039:./:9505.3.974845.03.  !0209.

3 9..-. 02:/.7 ..

/:.3.9070.3/.8.3/.9.3.3203. ./:./-.9:/:.5.3/.3 ..8. -/. 3:.3.3:2.853/.

8..7039.253/..  3/. 58 793.3/.. ..3./:5.8:39:203./82:.

8:39:203.-. /82:.-..258203./.

882:.9./:58../.-.3033.33/.2.9/.4.3.3 /03. ..4.83/.8.9073. $090.8:8:3.

2.9/. /03.8.3-..

28.7039./:5..:7:9.7:89..  0.3./.703..:-.. 203.9: 3/.3033.

-. ..3/50740.258 2.../:3203..3/.

. .2.-./03.3 9073.4:.4.3-.9.8-0:2.

7 ./:5.203./..3/./.3035. 9073.7039./.9109. 203:-. 907.:7:9....

..- 3/../:5.3038050793 4:8/903.7039.203.. ..3203./03.258.3 :7:9./.

9...4/03.3-.3 9073..4.

:     04-4/  309 30938  7: 74:4/008   .03-78908  0..7309008 89 8./.:938 85/ 85.:008 0/ 0.477:.  .38 8.0308838 /5 /:2538  4.78 .9.3/02.8 7..:7 .7008 # #4:030/008 -9 -03938   49..:7.90/38 78 7480008   ..3-.943 3 033.90/38 - -. 8.:-9:839077:59:8008   790008 $ $9.7.3:8008  :738 ' 7- 7:-008  -4 -47/0.49008  . .4/38  2 23. 03. 0.477 .008  7.:7:9.03-78908  83 830/-78908 8 830.709008  5 50.038  ..3-03.-4/ 0 0. .38  .. 4.34/008 18   -093..7488./038 .85-077008 1 1:.. .220/38  :0/008   .-/423.008   9 9.9:2478 80 805..5.9 .8907  ..9/825:.3-4/ 9:  . .:2:.3 /...008 ..9:7038 .3403 .

2-. 3:90-4/     3:90-4/      . .0/-78908 .450/38 7/ 70/:.20.33.38  09./ . .-78908   :25-4/ 78/ 7.80/38  7.7/3..7008 - -947.38 .7 .0 . 7.974845.:7.34.089.0/38 . .7008 .8/ 8.: ...38  & &59:720/38 0 0-43-4/   .77438   /87 /87:590/38 !7 !7.7.80 4-9 4-9:8038  71 744138  3 3.74248425.738 89 897..709008  7/ 70.80-7908  .-78908   .0/-4/    .73.-.008  2 2.8907 80397427 742484274248420.7  !09.. .23 .07:-38 87 89750-4/   -- -4--0/-78908 ./...3 .943008 .-4/  ..:738  7 7:/2039.

8053/.8.3.3/.72:9.39. 03-07.303.8.- .7./03.3  /.83 2.92039:3./03.803.353/..838.7.7/09.353/.7.:9./ -.7.0/:.703.3.8.3/::7 .3:7:1-08.././03./:5.3:93.3.2.35078039.7..5078039.7./03.203.2-./:.- $0. ... 9.5.8.7.: /.9-08. 8./:.3/423.3 $090.-.3.3  ..3.03-07:7:9..7.18.8/:-.:7:9.3..3 033.3. 3.7039.73.9.3/.03.3 80/.9./.3.39.7.:7:9.  8././ ...3 2.8053/.7.3203.88.7.3  0.2.39.39.3:90780-:9/.3-03.2.3/.39.

9.3/02.././:..8.. /.3.3- 03. .853/.39.2.3 ....3 907/7.      .8.7.3/.7.

7.      .39. ./.83.803.3.. /.83 2.32..3..9: 3/.8.     $02039./:.853/..7.7.

3/./:.-.853/.   .3.90780-:9/.439484./..9.9-.          39071070387424842 !.8.3/.8907.3.3.. ./.

8.8.3 -07:7:9.3907.7:83.35078039.:3 /.9.    .8053/.9:3../..58 034203./..7:83. .3/8:.8.73./.3/3...3/80-:9401803 438/038  .558 ...3-.73/0503/038. 53/..3.7 -03./-078.84.  07.83 2.7907.7. /.../0.3.9904750:.07./.3 -03.8353/.3 2.53/.9.3.-078.2.50789.3.  ..8./03./:.340   :075.53/.8.8.2.35.8.2:3 80507990.8.53/.2.3203.2. 8.3/.9./:.80.399.75..3//0.3      .8053/.338-.7 -03.3/.5./03.8.3/. 2.3.380-0:23.82..3.:3907107038.83.90780-:9/.5078039.9:9025./.3 .7/../.3..7./902:.7./.3/.8053/.8.:80.9.91/::7/03./ 39071070383203:3:.3 $0.2..3.907.439484./.53/.8 5078039.:./. .93.339071070387424842.9..58 907.3 907.3207:5.8./.5./390710703880.33-03.- !.38:.9.58 0-0.3/.0/:..9047-08.7  3.3207:5..3.8./.8. 80.2.35079./ 58 .3/./ 58 8./3.2.9:8.35.

/03.3-08.8.7. 203.73.38025:73.3/3907-.703./.3907107038  .7 -03.9: 3.3803.3./:.3-07:7:9.3.39.-07-../:.50789.58 8.   . 3.53/.2-.3  0.53/.3-07:7:9.3.73.8..3/0503/038.358 $0-.78.3-.3 203./03.3.-08.2.7.50789.3 .3-03.  203:3:./.

 170:0381:8/.7.8:.9 703/.3-08.-7/8.5..3203.9.9:3..8 74248422.3 .5.340 .53/.9.35.78. .809.5.8.3.33-0702-.8/.3.-:3.393..8:.2.703././. . .9/.7.580-7/.5.74248422../:3. .3-08.98203.80-7/ /.0:.7424842207:5./03.73.8.3:39:/.32.7.9...880842.8032 90780-:9 03.././.3:8.3.9: 8..9/03.74248422..3.3:8.-0  ./.3:8./.2240:7424842  %03-7/8.3/3:7:8/03.9038944.3203.3..90-07.78.9.3509.3/03.2.9/.880842.80:9.3.:./03.80/.3:39:84..9.8303//.35:..8 92/33.3.3 /03.3/0391.3-08.3..2.9 /93.91.3  $0-.8888.39/.9.3.:.37.3508.903 039079039:  %.2:3 170:0381:890780-:9/.9:809. 7424842.9:./02..380842.3 1:8 803-07.3.3/02./93.854891/03.7./..:8:8:3.8. 9.9.38.3 :2...2.3.9/...30-07..3502-07.3202:33.9.7/../.8.2.3203.2.9.3.742484234247 .3-08.39/.3 9037042-3.985079.780-7/ .340.80-.9.7 0/:.409 $0.8./.9/:3.9: /507:.5-07-.7..3203.53/.38.83 2.38.3.:3 .39.9.880842.32./.2.909.3/03.5../.7..380038..2.7/..7..3:39:203039:.3.9:7424842907/.9.8:2./:3.-0  %07. .-07470.9:903.8/. .9/825:.3.32.34018033907107038  .9 20309./.:2.3509.2502-0.2502-:.3/03.95:..3 /.3 80:2. 39071070383.8050795.3 /.3203.8.5.974 !03.80 80-7/.2-./.  !0209.9.3:  0.33.5.3:8.3039079039: 5.3:8.8032.-:3.7:8$03/.38:3/03.7424842 203:3.30.3 -.5.:..3:8.7:8 .5.3:8.80-07.9/9039:.3202507..5 03.9:7424842.80-7/.3907107038 793.:2.9.303.7./:3.3 /03.3907. 3742484280.80/./3.829488380.3 3./.3503.3/.9/902:.802039./03.329488803.8:.202507.-7/8./0391.98  $0.-08.9:8.39.3/03.3:8.98 4247 9../03.374248425.9:783908892/3 3.3  03..5.%.3/.50. !.7.80 .9  !.3-..5.3/0.350302:./.32.9.2-.3502-:.80 ..80.8.:/:25.9-./.30-07.7  3.3803/73..3/07.9:74248429079039: .3035.-07.8:97.3907-039:02:/.9.:3 :39:203. 2..7  0/:.7:8$03/./:25.3-.5.2.9.8.7.78/.9:/./.7424842203.33.:907.892/33.3.38020374248422././.5.3.4394 0-07./.9.982.5.8090709.74248425.9:783908803292/33.7..3/./503:7.: /..././.:.5409034  $0-7/.9.390.380842.33.33.. 2.03.33/0503/03803.739071070383.38:.8:..9.3/02.5.93./3907107038/.9.954.88.38..9/09.5.909.9:81.  &39:203.-078.87424842/.

.91 .91 9/..80 .91 .                                                                            ./. 9/.91 .91 .80 -7/                92/3 3./.

.

1-40309..8.7   #$         .742039. !4890/-.

8070.3 07.35078.3.4394 81.9:..3. 9.9939.3  085:3/02.3-.9//.382097. .38...88.202-07.3/.8.3 5..78.2./.35:..34003/090.2.5.9: 0425450309 %  47.9.3907-039: $0.3-039:-3.9:.3.9/879 90758.8.3.39:305.9:..30390780-:9207:5..209 ..33..3 $0-.3 ./.2::203/0 8070.9/:3.5.3070/907.74845.340.381.209-093.3. 20302:.3/3..20..390758.      #$ O O O !03079.:89:/5.  0-07. ::203/0 502.55.3 8..3 8./.3203.3503..9:7405.8/.3070/907.842./.9:8.303.9:.3 502.3/58.303 /.3/ 80/.3/03.:.8.3.3828 03507:/.8 5.7:.3 8.835.303907803/7  .9.2.34. 20.3-.720.3:0:8.5.-:3.8.8./:-0781.8.:507..3..8 .9: 0307.2.-...9:7405./. .:302:/.73.9.83 2.38:35.-07.8907203.8507..3.3-..  7042-3.8070./503.9:7502:3.30/.9//.3 02.9:8.3..3 $..303.8.8.3 //.9-:.:.:.382803/.8.03907/.3-0-.3.9:-0:2/.800307.3 09::.2.5.2897:9:7 397.209.3-.38.3/879 90758.27424842 2.3.2...:1034950 3/.7424842         #$ 3..9: 8..803../09.9907.3 09.27424842  0.8-07:93.4-.:.9:. 80:2.303.9:9/.3.3.3-07.38.2.8.3.:-.3/.85.382097.3.209.320...:39:20250.8.3:93.:7424842 :8:83.8 .9:.3907. 8.3.81.343805-.3..5./.5507.39./ 2.37424842 .2.30342 $97:9:77424842 :2..303/.9.7424.9:7405.03907/.80./..8.33.8.9.. 20.2.703.03207:5.3./80-:9.

. .390780-:9  0./.0342/.9.3.3820 /80-:980-.9..39.880-:.74248429:3.380 ./:47.8 0/:/:../.3 03428:.0342 03.3 87:07  /.80-:.7424842..7.2-.-07.3 9/.8//.303 03.3802:.3:25:.039078:8:3/805.502-0.5.080:7:.907/09..27424842  !03079.880.7.5803..2.3/-.3.3820574.2809..3507.749/..3.5803/.3 802:.38:33.:-.303//.9.-         .9:47.:25:.907/7.03..7..37424842 7.809. :-:3.9.3.9:3:0:880.9:.3907/.:...3.3820.9//..382090780-:95.703.749805079-.3820 574. .28:.3.3/24047./..30342 $0.-3.7.33.3..-' !.3./02.9: 034247.7  0342..9 74248423-07-039:3.2025:3.

32025:3.203428:.:2025:3.574.3::7.0342 $02039.33.207:5./.3..3.-' $0 800..2025:3.8-0-07.9:03/80-:980-.439480.54/ ..3.9.7424842 :2.38200:.27424842 -.3 . 7424842/.749 ./.7  .7//.39.:425089.33  /..5.:2:23.9:74248420:.7492.9.2-.03//.25.80/0709.5.95./.9.80507.3820 0-.8-448:.20342..749 ..9:.749907/7.80-:./03.9:47.3.3/03.. 80842.9 20.38508082025:3.-' .0:.74248425.5.54/ ../:.23 .7//.9.34:880:2./.7424842  %..:5:35.-:.8./.33.257 80.9.7424842/.4 -.7-0-07.57424842202-..9:47.39: 74248420:..0342/54/  :2.0342 .0390780-:9 4394 /0709..3:8.749 -..34.9.-:..209  5./.8.8907  0342:. -039:307 !488//.749 07-0/.:/.2:3 :2.3.98 .9408:.7./83:3-.7424842574.54/5..79.2-.:2.3850808. -0/.3 /9025.32025:3.749/.749 03420:.7499078:8:3/.-:...9.03420:.-07-0/.28:.3039079039: $0.9: 80 80.3203./.9: 850808/.8..: -07.2.742484239/..5.9./03./.2. .3509.33.890.30342574.97424842. 3.7.380-.  .4:8 .7424842.7492025:3.9/.8.

3742484234247 5:.8147-08 .3..749 $5080847.7424842 80/.7/9 %:2-:..:..-/45889.7424842//.5038  !.0342. .20342.2025:3.74980/07.38 9:80/:8 0.0347. 74845.35. 02.-07.3.34.8 .-0  :39. 742484234247/.9.3/03.3820/54/0/:.:8 :82:8.54/ 3                             :. %.7.5.703420/:.54/3..33/3.0 0:748547./. $.08 8907.20.:2.7 8.8508085.850808 47..2.9.3 0.57424842.-0  :2.8703.38200:./.0790-7..9:87424842//.3.3820 :2.30 3  7424842 7424842.1.-/9800./..:2 .:8/42089.-:.1.8.3-075.8025..90 84:.47.-. $06:4.: 5.374248424244  .0.0790-7.::8 08/42089.3. .3.08..:2025:3. 7424842 .  793.45078.37424842.3808:.3-075.089.3. 800387:8.8907 345008.3-0-07../.809.742.3.74248425.3.3./.4308.2.0342.070..703425079.5.8.:8 !.54/3.7038 7.2.3974/908 4248..:8 0345:8.3 /09.380907:83.:.    %.3.20342.8.3.9:8 7.54/-0-07.8 %79..5. 0..-:.8.3-075.8.88..:039:2 '.2/4243.0.

/.5.7424842.3-.37424842805079:7:1 /.380 .7424842 42443./.4394 03 /423.. 2.974845.7480397 880397427 !.903/..-' .3.9:209.809.3/:.907/./.37424842 %070-50393.9.90780-:98..9-075.9/04254.3 :2.3853/0/..8..9:/.9-075.5. $0397427.35..7424842 $0-.0/:.7424842424403..803.3:2.5.93.502-0./.7.7424842 42443.803970/:/:.3 03495042449708081  .3503/05 039:. 502-0.3.5.3./.-075.3803974273.257/::37424842803. 2.303.5.03.30/:. !. 209..3 .3.3.3.390709..5.80397.703.5.390.780397480..03..3 5. 7.3 0.-:.3.9/03.3.503.80397 8:-209.374248429.903.30.3.09.1.5.8./ 80-03.3.3803974270-:7.3 203:7:90/:/:.3.9.-.37424842805079:7:1'  0. .80397.35:.8:.38:33./903. ...5.3035.2..25.80397 8:-209.. 89.39.3.38.303.7  $97:9:774248425.9/.7480397 $97:9:7 74248423/. /.3 /03.39/.  .2 897:9:774248420:.5.9200.3.33.3:7:16 80/.9.8.3 /:.803978039742790709.3 207:5./.7424842.-07.07.80397203././.8.3-07..380-07.209.9/.80397 /.3803974273./../.:39: 202-07././.303.8:-209.35.25..8:.-03.5. /03..309.:-07-039:307 9073.903.4394 .7480397 /:25./.3.5.202-07..9:7424842/..3/03.3.8../.70/:/:.8.33.3.742484242443.3808:.2-.3189039.37.5 89..3//.03/07:32025079.5.37424842..3.2. $0-.7.2-.1..3.33.3..9:907/.20.3::37424842803..303.3 :39:4:890780-:9 ./:./.34.03../. 202-07.7424842 803.5.749 .749 .8897:9:77424842203.8-0/.9: -039: 209.. 903.03.37424842802.2.4:87424842 8073.8.8./.749 74248420:.303..7424842 74248424244 9.2-.303. 0. 202-07.89072025:3.80 .35.3909.80  8   88 .803973203.  ./.3.73. -039:8:-209.2.81./209. .8897:9:774248420:.2025079.9:7424842/././5.4:89079039:/ /.5.5.74803979.9. .81./.39025..3.8.37424842.3/03.9-07:3.5.37424842805079:7:1 039:8:-209. 5.25.907-039:03495042449/423.28:. 03.3/507400349500907449 02.3 -03.8039742790709...3/03.  .9.80397 /.03.

9/907/.9.-:.3203../240825././.3. 5.980-..3 . 825.3 /-.35.33..3.:94842 209.38:33.9.380  742./.3/ .85080874845.80397.5 742.9/202-.5 5.35.380/./.3-039:3./.9.3/0.9/8 .20/:.80397427-07-0/.7424842..9309447 .5.7480397.80-:./.38.80397427 09.3 2.-07.8303.2503..25.502-0./.742.3203085708. 8.309.2.5.2./.-' ..380-.. .3 209.9: 02.9/:..:94842209.37424842209.8/:.34.:39.5.380 .742.. 2471448.74845.39/.5.3./.3:8.3 :..3574903 %./03.742.3-07507. 025....2/.2025:3..37424842..3.0/:.4244/03.5.80397427907/./:7..240:.3.3/.7480397 .2025:3.:94842.2.8897:9:7742484280507990.32.742.9/02-.5. $0-.0425474845.9/02-. .//./.07.2/0487-43:0..9.8.83 2...5.5$//.3 /:-:3.3-08.9:574903897:9:7.39/.2.509.-  803./.380.9/:3./.30.3..7.8.825.503. :94842.2025:3..803975.9 ...2 50707..35.. -0/.7802039./.9.7:39:.:94842.3.3:8.74803975.83 2.2.3./.7 88907..80397.8.3 -.8...74803975.7 88907.-.3897:9:73.:780 .9:.240: !./.3 10349503.2.-./.3742484280.8.803975.23 .83803.3/3.9070309  90427 ::37424842   80397427 43897857207   309447  742.3503:8:37424842.9:8.825.303...2.9 /.33.3 ./.303 03..74248420/:.380  . /.8 !.2.-' 907/7.3:8.3507-0/. 2.3 -.7. 20.8.380/.:94842.3.3/.805.39079039:240:207:5.9:8:.81.8907 808:.2.-...35.8.0380.2.9275 .9/8    ./.33.-07:5.303.-.8.3:8.9/ 7424842.3909.5.3 /.9/:.3/..380907/.

7424842 ..3 .2-.3203.380/. .7  . .2-.2503.3/.240:    ..7..749 .3:2:2897:9:774248420:.

.

8. $ !$$  #$$&%#%%  ! &%  #&$&#% %% &%& $&&!%& !&# .1-40309.7 397$0-0:23. !4890/-.742039..

Sign up to vote on this title
UsefulNot useful