Forum Inovasi Teknologi Akuakultur 2010

ABSTRAK PRESENTASI ORAL

Forum Inovasi Teknologi Akuakultur 2010

FF 01
PERFORMA IKAN NILA BEST DALAM MEDIA SALINITAS
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: =2,1±0,23; W = 7,0±0.29; = 139,8±6.72; 7,5ppt = 2,3±0.06; 0ppt 0ppt 0ppt L B L W7,5ppt = 8,2 ± 0,42;7,5ppt = 164.3 ± 8,46; 5ppt = 2.3 ± 0,21; 15ppt 7.8 ± 0,45; B = 155,6 ± 8,95. Pengamatan setelah W B L1 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-5 : 4,0±0,34; 3: 4,8±0,27; 5- : 7,4±0,35; 5: 9,2±0,98. 5 15ppt8 0ppt8 15pptPengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
0ppt 15ppt

KATA KUNCI:

nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
PENGUJIAN LANGSUNG EMPAT STRAIN IKAN NILA (Oreochromis niloticus) PADA SALINITAS 40‰
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen ) dengan 8 ulangan dari masing-masing strain. Analisa 50 (LT data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise

Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata 50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru LT (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT
50

0351–0. cereviceae 2%). genetik. Gesit. OPC-14. Universitas Padjadjaran ABSTRAK Penelitian ditujukan untuk menentukan persentase terbaik dari S.6667%. OPA-04. cereviceae 3%). dengan nilai heterozigositas 0. nila merah FF 04 ANALISIS KERAGAMAN GENETIK LIMA POPULASI NILA HITAM (Oreochromis sp. dan lokal Bogor. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. Nirwana. dan OPC-15. KATA KUNCI: RAPD. cereviceae 1%). cereviceae). cereviceae sebagai perlakuan dan lima kali ulangan. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. dan A (penambahan S.Forum Inovasi Teknologi Akuakultur 2010 FF 03 PENGGUNAAN Saccharomyces Cereviceae PADA FERMENTASI PAKAN BUATAN UNTUK MENINGKATKAN PERTUMBUHAN NILA MERAH (Oreochromis Niloticus) Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan. ikan nila. Sebagai perlakuan 0 adalah A (tanpa penambagan S. Pertumbuhan terbaik diperoleh pada penambahan S. Otong Zenal Arifin.) DENGAN ANALISA SIDIK RAGAM RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD) Iskandariah. lokal Kuningan. cereviceae sebesar 2% KATA KUNCI: Saccaromyces cereviceae. 1 2 3 Hasil penelitian menunjukkan penggunaan S. A (penambahan S.3333%–46. Bogor ABSTRAK Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi. dengan menggunakan primer OPA-03. Oreochromis . fermentasi.1952 dan jarak genetik antar populasi 0.5797. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. Populasi yang diamati meliputi jenis nila BEST. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah.1765– 0. A (penambahan S. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD). Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. pakan buatan. populasi.

Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. Pada perkembangannya. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. genotipe. Sukamandi **) Dept. Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). Untuk kontrol. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. Fakultas Perikanan dan Ilmu Kelautan.01%. 106. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. dan differensial leukosit dilakukan analisa sidik ragam (Anova). SR). agalactiae. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. XY. Oreochromis niloticus Angela Mariana Lusiastuti*). DAN YY Didik Ariyanto*).81% dan 83. agalactiae pada tingkat kepadatan 108. Komar Sumantadinata**). Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. tidak cukup untuk memberikan protektif terhadap S. limfosit perlakuan tidak berbeda nyata dengan kontrol. yaitu genotype XX. Data sintasan (Survival Rate. KATA KUNCI: vaksin sel utuh. Kata kunci : Ikan nila. dan YY melalui evaluasi nisbah kelamin yang dihasilkan. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. Tetapi setelah uji tantang. Pada uji tantang setelah minggu keenam. 106.Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. pengukuran bobot individu rata-rata dan penghitungan sintasan. Uni Purwaningsih*). agalactiae secara intra peritoneal pada ikan uji sebanyak 0. titer antibodi. agalactiae. S. XY. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. ikan uji disuntik dengan PBS. Selain ditentukan secara genotipe. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.1 mL/ekor. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. Budidaya Perairan. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. ikan nila . seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. Perlakuan dengan injeksi sel utuh S. Hasil yang diperoleh bahwa sel utuh (whole cell) S. diferensiasi kelamin. 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga. titer antibodinya menurun. Genotipe XX mencirikan betina dan XY untuk jantan. Pada akhir pendederan dilakukan identifikasi jenis kelamin.55% sedangkan genotipe XY dan YY masing-masing sebesar 79.

ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. terutama dalam hal manajemen pemberian pakan.5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. B=106. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. kecerahan. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. NH . TDS. serta data status kegiatan 3 2 3 budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. pH. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. C=104. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. dan Joni Haryadi Pusat Riset Perikanan Budidaya. BOD. pemanasan. total nitrogen. DO. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar.5). Anjang Bangun Prasetio.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. ortofosfat dan total fosfat. Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. Selain itu. dengan variasi perbedaan kepadatan bakteri vaksin (A=108. Selain itu. karena pada kondisi perairan yang kurang . Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. NO . Angela Mariana Lusiastuti. Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. turbiditas. melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). D=102 cfu/mL dan E=kontrol). Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. adalah septikemia dan meningoencephalitis. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. Pemberian pakan tidak boleh berlebihan. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. NO . KATA KUNCI: Streptococcus agalictiae.

KATA KUNCI: manajemen pakan.baik akan menyebabkan stres pada ikan. lingkungan perairan . keramba jaring apung (KJA). Danau Maninjau.

Sukamandi selama lima bulan. Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia).74%). Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (2. Budidaya Perairan.05) bila dibandingkan dengan dua populasi lainya. tebal (0.64% bobot badan (bt)/hari. oreochromis niloticus . Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat. tinggi (3. tidak berbeda nyata (P<0. Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49. tinggi.44%).94%).82%).80%. sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2. bobot ( -2. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. lebar (0. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4.21%). dan sintasan(1. tebal. Sukamandi **) Dept.65%). KATA KUNCI: heterosis. Parameter yang diamati meliputi keragaan pertumbuhan (panjang. tebal (-1.53 % bt/hari.06%).20%. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2.87%) dan sintasan (0. persilangan.22%). Fakultas Perikanan dan Ilmu Kelautan. IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi. bobot (-2.48%). sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74.48% bt/hari dan 2.35% bt/hari.Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*). bobot) dan sintasan. Nunuk Listiyowati. SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2. Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Komar Sumantadinata**).

81±0. Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan. agalactiae (N3M.9823–4. Penelitian dilakukan di Instalasi 50 (LC Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung.7138 mg/L (0. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. benih ikan.1295).13 dan 1. Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar.5480). uji stabilitas dan LC50–24. 3. Data diolah dengan analisis probit program LC50. Konfirmasi taksonomis hingga level spesies isolat bakteri S. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). iniae (N2O). dan nilai terbesar dimiliki oleh bakteri S. 48. N4M.6297–0. agalactiae (N4M) memiliki nilai terkecil. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar. Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan.55±0. Bogor. 72. 3.0678 (1.08 g.5805). 0. N14G. Hasil penapisan menunjukkan bahwa bakteri S. NK1) dan 1 isolat S.0930). 48.8532).4227– 4. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration ) 24. dan 96 jam terhadap benih ikan mas adalah 4.5094 (2. 0. N17O. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN.6578–2. dan 96 jam. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1. 50 LD iniae (N2O). pemanasan. Hasil penelitian menunjukan bahwa Nilai LC 24. dan 96 jam. 2.6799–13. Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp. agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik. 72. dan sonikasi.9421 mg/L (1. 48. SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA.3354 (3. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah. .0430 (4. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S.9237(0. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis.7877–2.1100).6904– 5. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila.0839(2. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin.8090) dan benih ikan nila 5. 50 KATA KUNCI: toksisitas.8101–1. 1.7504).

streptococciasis. vaksin. ikan nila .KATA KUNCI: penapisan.

66%. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia.0 g. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20. kekuatan tarik 2. Ikan ini relatif sensitif dengan perubahan lingkungan. dompet.5 g. dan 80 ekor/m3 selama 5 bulan masing.94%.2 g. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi). sarung tangan.00.00 pagi hari. namun sintasannya masih rendah yaitu sekitar 1%–3%.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi. karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. Telur yang ada dalam kolektor dapat diambil jam 07.12 kg/cm. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. Pembenihan ikan ini mulai berkembang di sekitar Gondol.184. 103. suhu kerut 88°C. Ikan ini mudah terserang parasit seperti cryptocarion. benedinia.0–3. untuk dijadikan kulit tersamak. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak. dan 15% . Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa . Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. kadar abu 2.00–08. kambing dan ikan pari yaitu berisi. garmen.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.46 N/ cm2 atau 222. kakap putih.62%. liat. tas.00 sampai jam 03. lemas. Sulawesi. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g. sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. Dalam pembesaran. dan sebagainya. simetris. KATA KUNCI: bahan penyamak kron.76 kg/cm2.masing mencapai ukuran 127. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. kekuatan jahit 1. yang merupakan limbah perikanan dari perusahaan filet ikan. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. Waktu pemijahannya sekitar jam 24. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan. 40. kadar air 13.5 kg. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. 10%. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. dan Sumatera.93% dan kadar Cr O 1. kadar lemak 6. Selain itu. kambing. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat.97% sehingga sangat prospektif untuk 2 3 dijadikan barang-barang kerajinan kulit. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1.53 N/cm atau 138. Nusa Tenggara Timur. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek. dan 102.354. dan corak permukaannya spesifik. kekuatan regang (kemuluran) 66. dan cacing.

Tenggara Barat. KATA KUNCI: pembenihan. kerapu sunu . pembesaran.

Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). mikroinjeksi. Cromileptes altivelis Slamet Subyakto*). sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. transfer gen. lama kejut 30 ms. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. KATA KUNCI: transfeksi.1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. Ratu Siti Aliah*****). Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. jarak waktu antar kejutan 0. mikroinjeksi. hormon pertumbuhan. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. mikroinjeksi. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. elektroporasi. ikan kerapu tikus . dan Gemi Triastutik*) *) Balai Budidaya Air Payau. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. di antaranya Indonesia. Sasmito Jati****). M. Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. Komar Sumantadinata***). dan 3 detik. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. 2. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). 10 µg/mL. Situbondo **) Fakultas Perikanan dan Kelautan. Rustidja**). jumlah kejutan 5. Metode elektroporasi dilakukan dengan voltase 50 V. dan 20 µg/ mL. Alimuddin***). Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. Irvan Faizal*****). Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. Namun demikian.

68 g) dan panjang total (6. KATA KUNCI: benih kerapu sunu.25) dan efisiensi pakan (80. Salah satu faktor yang berperan adalah lingkungan pemeliharaan. Materi yang digunakan adalah larva kerapu sunu sebanyak 4. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. dan efisiensi pakan pada benih kerapu sunu. pertumbuhan panjang larva.42±0. oksigen . B (oksigen).95 mm).19%) dan panjang total spesifik (1. Pakan yang digunakan adalah pakan pelet komersial. optimasi pakan. C (probiotik). Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0. dan 15% dari total biomassa benih. D (kontrol).20-4. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen). selanjutnya perlakuan C (64. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu.19±0.20 cm. probiotik. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus). Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU.50-0. Sampling dilakukan setiap minggu.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut.02%) serta nisbah konversi pakan (1. Peubah yang diamati adalah sintasan. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3.19%) harian serta laju pertumbuhan bobot badan spesifik (6. serta terakhir perlakuan D (47.000 ekor/bak. laju pertumbuhan spesifik. dan kualitas air. Kendala yang dihadapi terutama terjadi pada stadia awal. efisiensi pakan.31±0. 10%. Pemberian pakan dilakukan tiga kali sehari.86 mm).90±0. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan. yaitu 5%. Namun.69 g dan panjang total awal 3.00%) yang baik bagi benih kerapu sunu. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. pertumbuhan. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal.69 mm). dan perlakuan B (63. Nilai pertambahan panjang tertinggi A (72.73%) dan panjang total (9.39±0.35 cm). KATA KUNCI: larva kerapu sunu. laju pertumbuhan bobot badan harian (10.52±0. nisbah konversi pakan. Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva. laju pertumbuhan harian. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan.35 mm). Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut.

Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan. terutama infeksi virus. sedangkan kontrol hanya disuntik dengan PBS.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol. kerapu macan . Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. Perlakuan B: 4 kali/hari pada umur 7-20 hari. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari.03% dan perlakuan C adalah 8.5 ± 2. Bejo Slamet. Perlakuan A dan B tidak berbeda nyata. Epinephelus fuscoguttatus Irwan Setyadi.50%. infeksi.20 ± 0. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. perlakuan B adalah 6. Mulai larva umur 2 hari diberikan Nannochloropsis sp. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan.65%. indeks fagositik sebesar 1.00%.08 ± 1.62 ± 2.62%. serta bobot badan pada perlakuan A: 192. Des Roza.0x105 sell/mL. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0.04 ± 0. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari. imunstimulan.55 mm dan C: 26. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN. mencapai ukuran panjang total pada perlakuan A: 24. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L.08 ± 2. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Ikan kerapu macan. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6. Masing-masing perlakuan diulang 3 kali. B: 24.87.95 mg.68 mm. KATA KUNCI: pakan buatan.81 ± 0. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind.12 mg dan C: 211. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny.96 mg. larva kerapu macan.57 mm.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular.5 ± 4. KATA KUNCI: Epinephelus fuscoguttatus. Anak Agung Ketut Alit. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. dengan kepadatan 1. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun non.87 cm dan sintasan setelah diuji tantang sebesar 72. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim.1 ± 2. aktivitas lisosim sebesar 1. B: 196. Perlakuan C: 5 kali/hari pada umur 7-20 hari. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster./mL dan mulai umur 17 hari diberikan nauplii Artemia.spesifik ikan kerapu macan.

Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya. KATA KUNCI: efisiensi. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. pembenihan. generasi kedua (F-2).72% dan panjang total 18. yang kurang baik. Sampai dengan bulan Oktober telah berhasil memijah. dan dilihat perkembangan oositnya. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. perkembangan oosit . Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu. pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. pada bak A : ikan rucah + cumi-cumi + vitamin. KATA KUNCI: kerapu bebek (Humpback grouper). Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. Setiap bulan dilakukan pengamatan pertumbuhan bobot. Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp.86 mm. kerapu bebek (Cromileptes altivelis). Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. panjang. Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor. konsentrat yang bisa dibeli di pasaran. konsentrat mempunyai sintasan 19.10% dan panjang total 21. sedangkan pada bak B : pakan pelet kering. dengan sintasan 6.

Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. pemeliharaan dilakukan hingga yuwana (2 bulan).2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. Ketut Mahardika. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. KATA KUNCI: kerapu bebek. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). Sampel larva diambil pada umur 1. 17. mutu benih kerapu. Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. 20. 7. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. produksi massal . Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. 5. 2. manajemen air media pemeliharaan dan manajemen pakan. Indah Mastuti. Tangki pemeliharaan yang digunakan ukuran 8-10 m3.masing sebanyak 10-20 ekor. 3.8%-41. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D15). histologi. Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. 13. 25. 10. Selain itu. dan 32 hari setelah menetas masing. 4. Cromileptes altivelis Yasmina Nirmala Asih. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor. KATA KUNCI: pemeliharaan larva. 15.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Tetapi tingkat sintasan yang didapatkan masih rendah.

dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. catfish seed. Sumber protein utama pada pakan adalah tepung ikan.Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. siklus pertama. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. (pakan kontrol). KATA KUNCI: innate immunity. survival rate. Oleh karena itu. dan siklus kedua menggunakan larva dengan kekebalan bawaan. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar.651 ekor benih untuk setiap induknya. di lain pihak hasil tangkapan cenderung menurun. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. 10%. I Nyoman Adiasmara Giri. dan ketiga menggunakan larva tanpa kekebalan bawaan. laju pertumbuhan spesifik. Pangasius hypophthalmus . Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR). 15%. 5%. dan 20% dalam pakan. akibat serangan penyakit dan kondisi media. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. Ketut Suwirya. Oleh karena itu. tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. Pakan penelitian berupa pelet kering dengan kandungan PST 0%. Lies Emmawati*). 10%. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan.4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. pertambahan bobot. Hasil penelitian menunjukkan bahwa nilai bobot akhir. KATA KUNCI: protein sel tunggal. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. Kematian larva umumnya terjadi pada hari keempat. Tingkat kematian larva dapat mencapai 40%–80%. Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. perlu alternatif lain sebagai substitusi tepung ikan. 15% (P>0. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). Pakan diberikan 2 kali secara “adlibitum”. Salah satu sumber protein alternatif adalah protein sel tunggal (PST).05). Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan.797–457.

4%) berbeda nyata lebih tinggi dibanding pakan E (68.32% per hari menjadi 4. sintasan serta beberapa parameter kualitas air. (B) 2‰. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya.8%).763±0.35±0. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin. pakan C (98.1%) berbeda nyata lebih tinggi dibanding pakan D (97.223±0. Ikan patin sebayak 15 ekor. Kecernaan P pakan B (98. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan. KATA KUNCI: salinitas. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm. dan sintasan .49 cm). Ikan uji yang digunakan berukuran 2 ± 0.1%) dan pakan E (95. KATA KUNCI: fitase . benih.07 cm). yang dilanjutkan dengan uji Tukey. Dade Jubaedah. Pakan diberikan 3 kali sehari secara at satiation.5 g/ekor. C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati. diikuti salinitas 2‰ (28.204±0. dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor. dan (C) 3‰ dengan tiga kali ulangan.00%).140±0. Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter. D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase).46% per hari. kemudian salinitas 3‰ (4. Kecernaan protein juga meningkat akibat penambahan enzim fitase. Pangasius hypopthalmus Mohamad Amin. Kecernaan protein tertinggi berturut-turut pakan C (82.75±0.4%). Ade Dwi Sasanti. ikan patin. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan.93%) dan terendah salinitas 3‰ (25. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32. Pangasius djambal. sedangkan laju pertumbuhan panjang harian meningkat dari 1.3%). dan salinitas 1‰ (3. Data diperoleh dianalisis sidik ragam. dan A (98. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰.13% per hari. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). Analisis data dilakukan secara deskriptif.14%). Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3.010±0.1%).884±2.674±2.114±0. Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4. Parameter yang diamati adalah laju pertumbuhan panjang badan. pakan B (82. pakan A (82.25±0. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. selama 30 hari.910±0.3%) dan pakan D (80.17% per hari menjadi 1.92 cm). B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak). Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan.2%).Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN. dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan.0%).764±3.

sintasan ikan. B (95.42±0.08 g dan 3.2%). Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. Pupuk anorganik + organik + probiotik dan C. udang liar) serta jenis serangga air. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan.9%). Akmal.7.5%-9. namun perlakuan B (7 ekor/m2) .5 juta ha (rata-rata 20 juta ha).Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari.74±0. Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah. Pemberian pakan dengan pelet apung sebanyak 5% per hari. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam. Sularto. dan C (95. penetasan telur dan pemeliharaan larva di kolam. dan Syafrudin Balai Budidaya Air Tawar. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan ikan. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk.60±10.49±1. dan C (10 ekor/m2) dengan 3 kali ulangan. 0. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam. dan C (613. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut. predator yaitu antara lain: Ikan liar (gabus. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masingmasing perlakuan: A.37 cm C 16. Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11. Padat tebar larva yang digunakan adalah 100 ekor/m2. nila. B. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. Patin Siam. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2). komposisi pakan alami kolam. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia. B (660 g). yaitu antara 13. sepat. Pupuk anorganik + organik. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4. Larva yang ditebar berumur 20 jam setelah menetas. 0. belut. Pemupukan.27±0. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. betok. Pupuk anorganik + organik yang difermentasi + Probiotik.26 cm. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan.19±0.3 g) dan SR perlakuan A (91. pemijahan. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. B (7 ekor/m2).7% rendahnya sintasan ini diduga karena adanya faktor hama. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g). pengecekan induk. Jika luas gambut Indonesia adalah 20 juta ha.51 g dan 11.526. Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut.12 g dan 3.5). Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam. dan sintasan Kata kunci: Intensifikasi.31 cm B.

memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95. ikan patin. KATA KUNCI: budidaya. lahan marjinal .2%.

000 ekor atau kepadatan 10 ekor/m2. 10. Evi Tahapari***). Kata kunci: padat tebar.54 g dan panjang awal antara 10. KATA KUNCI: patin pasupati. Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Jakarta **) Balai Riset Perikanan Bididaya Air Tawar. Percobaan dilakukan selama 100 hari pemeliharaan.71). dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3. JAWA TENGAH Ongko Praseno*).74 g) dan 20 ekor/m2 (61. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2.60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97.46 g). Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. Padat tebar yang digunakan adalah 5. di samping itu. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%.30%). Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda. 15 dan 20 ekor/m2 dengan bobot awal antara 15. pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela.76%).17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari.52%) dan terendah pada 20 ekor/m2 (91.000 ekor atau kepadatan 5 ekor/m2. pertumbuhan.5 m. Zafril Imran Azwar**). Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95. nasutus . Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih. 15 ekor/m2 (70. sedangkan petakan kedua ditebar sebanyak 2.06%) dan terendah pada kepadatan 20 ekor/m2 (7. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin.10%/hari.09 cm dan 1.36 cm. salinitas.76 cm dan 2.18) dan terendah pada 10 ekor/m2 (1. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES. dan Sularto***) *) Pusat Riset Perikanan Budidaya.47 g).43–11. diikuti dengan kepadatan 10 ekor/m2 (92. Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan. Evi Tahapari. pertumbuhan. Sifat biologi pertumbuhannya belum banyak diketahui. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8.45 g). Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1.70–20. Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3.80%. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99.

107. Jakarta **) Balai Besar Riset Perikanan Budidaya Laut. 10 ekor/L. Bogor ***) Pusat Riset Perikanan Budidaya. 106. Perlakuan kedua adalah padat tebar: 5 ekor/L. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan. Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. Evi Tahapari*). perendaman. KATA KUNCI: probiotik. Angela Mariana Lusiana**). dan pertumbuhan . diikuti dosis 0.001 mg/L (86. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air. Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah.55 ± 0. dan (C) 0. 108. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*). sebagai perlakuan yaitu: (A) 0. benih. Ikan uji yang digunakan berukuran 1–2 inci.35 cm).67%). Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. kemudian perlakuan dosis 0. kemudian dosis 0. Nurbakti Listyanto*). intraperitonial. Pengamatan dilakukan selama 15 hari setelah perlakuan. dan kontrol.003 mg/L (81. Kata kunci: uji tantang Aeromonas hydrophila.002 mg/ L.60 ± 0. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%.49 cm). dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air. dan kontrol (placebo).002 mg/L (83. 109.14 cm). 108. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. yaitu: cara perendaman dan cara penyuntikan intraperitonial. sintasan. Sukamandi.003 mg/L dengan tiga kali ulangan.003 mg/L (4.67%). Ikan uji yang digunakan berukuran 3–4 inci. Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109.001 mg/L.002 mg/L (4. Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. dosis. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar.001 mg/L (4. Parameter yang diamati adalah insidensi dan sintasannya. Analisis data dilakukan secara deskriptif.35 ± 0. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*). (B) 0. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0.33%) dan terendah perlakuan dosis 0. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan 15 ekor/L. Probiotik diberikan dengan dosis yang berbeda. Uji tantang dilakukan dengan dua cara. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.

yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu.000 µm. 75% ampas tahu:25% tapioka. Bambang Iswanto. rearing. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129. 50% ampas tahu:50% tapioka. substitusi protein 0% (kontrol) (pakan A). larva. KATA KUNCI oosit. substitusi protein 4. Penelitin ini terdiri atas dua tahap.850 µm. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Derajat penetasan patin nasutus berkisar 44. yakni pengamatan perkembangan gonad dan fertilisasi. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. dan tahap 5 (atresis) dengan diameter oosit 300–1. Pangasius nasutus .200 µm dan pada saat berumur 10 hari panjang larva mencapai 11.52% (pakan B).03% (pakan C).900 µm.700– 4. Zafril Imran Azwar.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati.250–1. artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai.130–22. substitusi protein 2. hatching. Ukuran panjang total larva yang baru menetas berkisar 3.05% dengan lama inkubasi 22–25 jam. Perkembangan oosit patin nasutus bersifat sinkronis grup. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu.58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4.04% (pakan D). ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad.03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. dan 25% ampas tahu:75% tapioka. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari.41±0.700 µm. tahap 3 (granula kuning telur) dengan diameter oosit 700–1. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar. ampas tahu. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. KATA KUNCI: fermentasi. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologireproduksi berkaitan dengan kapasitas produksinya.16%–79. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. Ke dalam wadah ditebar ikan patin ukuran 11. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. dan substitusi protein 6. Aspergillus niger. tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm.

KATA KUNCI: patin albino.02 g/ekor. dan D. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0.62 g) dan panjang (2.71±0. 0. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER. 75% zeolit + 25% bioball. berukuran panjang total 3.33%.01±0.89±0. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A. C. 89.10–1. biofilter. C. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih.69 cm/ekor diikuti B.60 cm/ekor. dan D. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D.03±0. B.42±0.13 mm.54 cm). 25% zeolit + 75% bioball. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE. 1.84 g/ekor dan terendah A.20 mm.1±0. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D. C. dengan kantung kuning telur berukuran 0.56 cm/ekor.47±0.42.31ab. 2. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi.98±0.67%.34±0. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D. 95.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A. B.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam.24) x 103.01±0. 79.14 mm. 0. diikuti perlakuan B. dengan kantung kuning telur berukuran 0. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var. 100% zeolit B. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus. C.35 cm/ekor dan A.20. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A. 1.25 g/ekor. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan. masing-masing perlakuan diulang sebanyak empat kali.27a.58%. 2.30a.6±0. 88. 1.64±0.45 g/ekor. 4. 0. berukuran panjang total 3.43b. 4. 75.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi. B. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat.08 mm3 yang terserap 50% pada umur 30 jam .30ab. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi. 91. diikuti perlakuan C. 92. pertumbuhan.1.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. C. 50% zeolit + 50% bioball dan D.75% dan terendah perlakuan A. 1. 88.

Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20.28%. nasutus . tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus. Kata kunci: embriogenesis. hibrida. larva.23%. siam.dan habis terserap pada umur 60 jam. jambal. sedangkan patin hibrida siam-jambal sebesar -4.

umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak.2% untuk bahan kering. KATA KUNCI: pengelolaan. 88. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. Oleh karena itu. Neltje Nobertine Palinggi*). Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. padat penebaran udang windu. dan Anugriati Balai Riset Perikanan Budidaya Air Payau.0% untuk protein dan 81. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. Pakan tersebut digiling ulang. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur.1% untuk Corganik. 21% dan 26%. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya. dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. lalu ditambahkan kromium oksida (Cr O ) sebagai indikator kecernaan. Oleh karena itu. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Dedi Jusadi**). tambak.6%–83. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2. Hasil penelitian menunjukkan bahwa. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein .2 kg/ha/musim.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. Akhmad Mustafa. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. Eddy Supriyono**). Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok. lama pemeliharaan ikan bandeng. Untuk menentukan 2 3 total limbah N termasuk eksresi amonia. produksi. lama ikan bandeng digelondongkan. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah.2%–78. Jika bioflok terbentuk. Maros **) Fakultas Perikanan dan Ilmu Kelautan.6%–90. Enang Harris**).990 kg/ha/musim dengan rata-rata 292. ikan bandeng.

N waste. 2. Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok).76 g N untuk pakan berprotein 21%.28% untuk pakan berprotein 26%.27 g N untuk pakan berprotein 17%. diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%.pakan yaitu 2. milk fish. KATA KUNCI: feed digestibility. dan 3. heterotrof bakteria .

Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan. growing.54% per tahun kurun waktu tahun 2005–2009. Penyusun utama bioflok ini adalah bakteri heterotrof. Molase digunakan sebagai sumber C. Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL.000 ton dan mengalami kenaikan sebesar 14. dan Pekalongan. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol. Oleh karena itu. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng. Eddy Supriyono**). Pati. dan Rasidi Pusat Riset Perikanan Budidaya. Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). KATA KUNCI: Heterotrofic bakteria. Hatim Albasri. kendala. Khususnya di wilayah Pantai Utara yaitu Kendal.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). DAN PEKALONGAN ) Anjang Bangun Prasetio. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau.66% dari tahun-tahun sebelumnya.975 ha. bandeng.) cenderung meningkatkan kandungan asam amino bioflok. Enang Harris**). Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya. Penambahan inokulasi bakteri komersial (Bacillus sp. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L.250 ton. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12. opsi kebijakan . Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan.726 ha dan yang layak untuk budidaya sekitar 6.000 ton dan mengalami kenaikan rata-rata 13. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. Pada tahun yang sama. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. Dedi Jusadi**). dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. PATI. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia.organik. KATA KUNCI: budidaya.

gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan. Data dianalisis secara deskriptif. DKH-e yang diinjeksi dengan â-aktin-GFP (25.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel.33±1. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0. sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik.03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi. FMIPA.00±1. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi.67%). Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10. Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi.66±1. KATA KUNCI: promoter. ikan lele . dan 15. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. Komar Sumantadinata**). Hasil penelitian menunjukkan bahwa DKH-e (63. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. Ekspresi gen gfp tidak tampak lagi pada saat telur menetas. Konstruksi gen dalam bentuk plasmid mBA-gfp. 18.65%) dan heat shock-GFP (18. HEAT SHOCK DAN KERATIN PADA IKAN LELE. keratin-GFP (21. Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein.63±10.Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN.66%) relatif sama.34%) dan DP (63. Alimuddin**).33±3.0%). Clarias sp. sedangkan DP dihitung ketika semua telur telah menetas. mikroinjeksi. Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji. GFP. dan heat shock-GFP berturutturut adalah 20.65%.00±3.67%.0%). Gusrina*).34±1.0%) dan yang terendah â-aktin-GFP (3. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC.****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA).00±1.GFP. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout.3±0.0±0.33%.0±10. DKHe dihitung sebelum telur menetas. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi. DP untuk â-aktin-GFP. menyusul heat shock-GFP (10. keratin.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20. Fakultas Perikanan dan Ilmu Kelautan. dan Utut Widyastuti***).

34% kadar air.15%) dibandingkan dengan pakan tenggelam (yakni 79. pegagan Centella asiatical [L] Urb. KATA KUNCi: A. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif).47±4. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak.05).37% kadar abu. KATA KUNCI: kecernaan pakan.71±2. 5.23% kadar abu tak larut asam. aerasi. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus). bahan aktif. pagi dan sore. 6. Pemberian pakan sebesar 5% dari biomassa per harinya. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%. Taukhid.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB.25% sehingga tidak berbeda nyata dengan pakan terapung. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. Angela Mariana Lusiastuti. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam. Melalui penambahan aerasi.39% kadar asiaticosid. hydrophila.30±2. Pada perlakuan tanpa aerasi. pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92.41 mg/L) dengan dosis efektif 250 mg/L.74±1. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5. pakan tenggelam. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. Kandungan bahan aktif hasil pengekstrasian pegagan segar. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang.53%) (P<0.. Feces yang dihasilkan diambil setiap hari. 0.33% kadar sari dalam air.47±4.05) dari 79. ikan lele dumbo (Clarias gariepinus). Ikan lele dumbo berukuran 41. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0.623. Rita Febrianti. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus). dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A. 24. Bak diisi air sebanyak 100 liter.83% kadar sari dalam alkohol.53% menjadi 92. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo. 39. hydrophila menjadi penyakit endemis di Indonesia. pakan terapung . 1.

Forum Inovasi Teknologi Akuakultur 2010

FF 45
PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus)
Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar

ABSTRAK
Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. Wadah percobaan yang digunakan adalah bak beton ukuran 1,0 m x 1,0 m x 0,8 m, dan dirancang sistem resirkulasi. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9,33±0,10 g sebanyak 40 ekor. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol); 7,92%; 13,28%; 19,56%; dan 25,81% dalam formulasi pakan. Setiap perlakuan dengan 3 ulangan. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar, tapioka, dan molase. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11,96%, dan penurunan lemak 61,85%, dari perlakuan kontrol. Laju pertumbuhan spesifik, penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7,90%, namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25,83% tidak memperlihat perbedaan dengan perlakuan kontrol.
KATA KUNCI: maggot, fermentasi, formulasi, lele dumbo

FF 46
ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA
Tutik Kadarini, Siti Subandiyah, Sulasy Rohmi, dan Darti Satyani Balai Riset Budidaya Ikan Hias

ABSTRAK
Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2,3–3,1 cm. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0, 10, 20, dan 30 g/40 liter masing- masing diulang 3 kali. Jenis pakan berupa cacing tubifex, bloodworm, dan cuk yang diberikan diselang-seling secara adlibitum. Parameter yang diamati sintasan dan pertumbuhan (bobot, panjang, dan perkembangan gonad), kualitas air (suhu, pH, amonia, alkalinitas, oksigen, dan karbondioksida). Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3,8–4,7 cm mencapai TKG III.
KATA KUNCI: gurame coklat, reproduksi, ikan, dan gonad

Forum Inovasi Teknologi Akuakultur 2010

FF 47
APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC.) DI JAWA
Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi, Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman, yaitu seperti daun talas. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa, yaitu di Jawa timur (Blitar dan Tukung Agung), Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Dari hasil penelitian menunjukkan bahwa di daerah Blitar, Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan, penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat, sehingga petani tidak mengalami banyak kerugian.
KATA KUNCI: fish TB, Mycobacteriosis, Mycobacterium fortuitum, biokimia, PCR

FF 48
PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI
Bambang Gunadi, Lamanto, dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Ikan gurame termasuk ikan dengan fekunditas rendah. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang, produksi telur per sarang, dan tingkat fertilitas telur yang dihasilkan. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang), dan injuk sebagai bahan pembuat sarang. Induk gurami yang digunakan berbobot 2-3 kg/ekor, dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. Pakan yang diberikan berupa daun sente sebanyak 3,5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. Perlakuan yang diterapkan adalah kadar protein 38%, 33%, dan 14% sesuai dengan label pada kemasan masing-masing. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. Masing-masing perlakuan mempunyai 2 ulangan. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0,09). Pemberian pakan tambahan dengan kadar protein 38%, 33%, dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10.351 butir, 4.546 butir dan 2.730 butir. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2.774 butir per sarang. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92,23% dibandingkan dengan pemberian pakan dengan kadar protein 33%, 14% dan kontrol yakni masing-masing 79,05%, 28,86%, dan 71,94% (P=0,26). Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0,75 buah, lebih rendah dibandingkan dengan yang

diberikan pakan tambahan berkadar protein 33%, yakni 0,88 buah, namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0,13 buah) dan hanya daun sente (0,5 buah).
KATA KUNCI: ikan gurame, pakan buatan, daun sente, keragaan reproduksi

dedak padi fermentasi. polar. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari.33%. dengan padat penebaran ikan uji 30 ekor per akuarium. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan.3’). Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T. Parameter yang diuji meliputi bobot akhir rata-rata. dan pada Silver carp sebesar 1123 bp. Bogor dan terdiri atas dua tahap. dan 6 hari. dan polar fermentasi. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas.14% dan kadar lemaknya turun sebesar 19. Wadah percobaan yang digunakan yaitu akuarium volume 100 L.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG. protein efisiensi rasio. retensi lemak. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. Kandungan protein dedak padi naik 19. dengan ditandai tumbuhnya koloni transforman berwarna putih. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. 4. pertambahan bobot relatif.02% sedangkan kandungan lemaknya turun 13.28%. oligosporus yaitu 2. Kadar protein polar naik 38. Retensi lemak tertinggi (35. dan selanjutnya polar dan dedak padi. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ – GATGAAACTCGAGTAGCCCTTGCTCTTC. dan koloni berwarna biru tidak mengandung DNA sisipan. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. dan polar fermentasi berbeda nyata (P<0.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan . Reza Samsudin. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. Retensi protein dedak padi fermentasi. mud carp sebesar 1127 bp. dan sintasan. yang menunjukkan terbentuknya plasmid rekombinan. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar.47 g/ekor. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar.05) dengan dedak padi tanpa fermentasi. polar. retensi protein. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5.

oligosphorus. fermentasi. Sintasan ikan uji berkisar antara 96. KATA KUNCI: R. dedak padi. dedak polar.67%–100%. ikan mas .05) dengan perlakuan lainnya.berbeda nyata (P<0.

kemudian ikan mas galur kuningan sebesar 1.akhir ini banyak lahan yang tidak digunakan (marginal). Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak.41 g/hari. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. Achmad Sudradjat. Provinsi Banten. tambak . serta keramba jaring apung di danau maupun waduk. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. Ongko Praseno. sawah. ukuran panen. Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. sedangkan yang lainnya sebagai kolam konvensional. Sedangkan sintasan. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. sintasan. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. Data setiap sampling dijadikan ulangan. Kabupaten Tangerang. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. dan parameter kualitas air yang lain dianalisis secara deskriptif. Di mana satu di antaranya di desain sebagai kolam akuaponik. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan.86 g/hari. KATA KUNCI: ammonia.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). ukuran panen.25 kali lebih besar dibanding pada kolam konvensional. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. Benih ikan mas ukuran 18. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. Lilis Sofiarsih*). Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. dengan lokasi penelitian di Desa Kronjo. Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. dan ikan mas galur majalaya sebesar 0. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. dengan padat tebar 20 ekor/m3. salinitas rendah. Parameter yang diuji adalah kualitas air terutama kandungan ammonia.15 g/hari. akuaponik. Penelitian telah dilaksanakan dari bulan Nopember 2009 —Pebruari 2010. karena akhir. KATA KUNCI: ikan mas. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. pertumbuhan. wildan. Sutrisno*).64 kali lebih banyak dengan ukuran panen 1.28 g/ ekor yang digunakan sebagai hewan uji. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1.

Afifah. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2. Siti Zuhriyyah. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. KATA KUNCI: survival rate. fry performance. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. Siti Zuhriyyah Musthofa. KATA KUNCI: artemia nauplii. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. dapat dikembangkan di bak terkontrol maupun di KJA. lasted time feeding . Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. Masing-masing perlakuan diulang 3 kali.58 cm dan 17. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian. cobia larvae.07%) relatif lebih tinggi dari pada perlakuan B dan C. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal.42%. memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata. Hasil penelitian menunjukkan bahwa pertumbuhan panjang. (B) umur 10 hari dan (C) umur 15 hari. serta mempunyai respons yang baik terhadap pakan buatan. kemudian diberikan sebagai pakan larva. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam.067mg) serta kelangsungan hidup (12.

Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. budidaya. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. plasma nutfah . Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. Herno Minjoyo*). termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. KATA KUNCI: cobia.Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). Lucky Marzuki Nasution*). dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. Lebih dari 100 spesies. Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Stakeholder. KATA KUNCI: ikan hias. Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam.

226 g. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. Afrika. infeksi penyakit (cacing. pakan alami. multifocal granuloma . sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia. kondisi daya dukung lingkungan yang terus menurun. dengan 6 kali ulangan. dan Tubifex sp.Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*). Eni Kusrini*). diam dan kepalanya menyembul tepat di bawah permukaan badan air. Tubifex sp. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh.. peacock bass. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. bakteri.. Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. KATA KUNCI: deformity. laju pertumbuhan harian sebesar 32. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish.586%. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. dan pertambahan panjang total sebesar 1. Peacock bass ini akhirnya berenangnya jadi terbalik. virus). Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. Depok ABSTRAK Deformity (dysmorphism. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. Deformity dapat disebabkan oleh : mutasi genetic. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. diikuti Artemia. dan yang terendah Moina. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. KATA KUNCI: Synodontis nigriventris. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. granuloma. Artemia sp. karena belum banyak yang membudidayakannya. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias. pertumbuhan. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias. dan selalu berusaha mendekati sumber oksigen (aerator).778 cm. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan.

KATA KUNCI: banggai cardinal fish. density. Variabel yang diamati meliputi.3 cm dan bobot 2.50 g. Bastiar Nur.87 ± 0. dan Ahmad Musa Balai Riset Budidaya Ikan Hias. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai . juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF). udang jembret (mysids) dan larva nyamuk. 60 ekor/bak. Rainbow Papua . Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. Hasil penelitian menunjukkan. Jhon Harianto Hutapea. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. zat pemicu warna. T3. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. induk diberi pakan berupa naupli artemia/artemia pra dewasa. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati.9 ± 0. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: maggot. wortel dan tepung kepala udang.Sulawesi Tengah. yaitu : astaxanthin. Selama penelitian. Hewan uji yang digunakan berukuran panjang total 5. 40 ekor/bak.Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. 20 ekor/bak. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. T2. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai.

009 gram. Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0. Sintasan terendah dihasilkan oleh perlakuan KB . Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). Nina Meilisza. pertumbuhan panjang.67%). namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. Masing-masing perlakuan dilakukan dengan 3 ulangan. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2.05).6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. KO (air kontrol+oksitetrasiklin). 20. oksitetrasiklin.5 x 0. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin. AO (aqua+oksitetrasiklin). namun tidak berbeda nyata dengan perlakuan AO (81. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. dan 105 dan dianalisis secara deskriptif. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2.0 cm. 55.67%). Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari. KO (76. 70. dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar. ukuran ekspor 1 inci (2. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich).Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. AF (aqua+formalin). Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air. sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. KATA KUNCI: benih botia. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2.33%. KF (air kontrol+formalin). Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. KF (71. Selama pemeliharaan. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia.05). ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza.5 m dan tinggi air 40 cm. Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium. I Wayan Subamia.5 cm (ukuran ekspor). 35.5 cm dan panjang tertinggi sebesar 3. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis).5 x 0. AB (aqua+blitz ich).67%). dan blitz ich) akan dilakukan melalui rancangan faktorial. Pada akhir penelitian (hari ke 105).0 cm dan bobot rata-rata 0.

67% namun tidak berbeda nyata dengan perlakuan AB (55%). larva Tetraodon palembangensis . sintasan. media air. KATA KUNCI: prophylaksis.sebesar 51.

namun belum banyak diketahui data embriologinya. pembuahan. Asep Permana. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias. hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina. KATA KUNCI: palmas albino. Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy.). antara lain sinodontis (Synodontys sp. masa inkubasi .4°C. sehingga produksinya masih mengandalkan impor dari luar negeri. penyuntikan hormon.). Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0. daya tetas telur 80. platidoras (Platydoras sp). Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. inkubasi telur dan perawatan larva. polypterus senegalus albino.15%. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73.75 mL/kg untuk induk betina di bagian intraperitoneal. Asep Permana. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar. dan redfin shark (Ephalzeorhynchos sp. Depok ABSTRAK Ikan palmas (Polypterus sp.5 ml/kg untuk induk jantan dan 0. tiger catfish (Platysoma sp. albino) masih sulit untuk memijah dalam wadah terkontrol.6°C–29. dan Bastiar Nur Balai Riset Budidaya Ikan Hias. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol. aligator (Lepisosteus oculatus). perkembangan embrio. KATA KUNCI: Neocaridina heteropoda. Pemijahan tersebut terdiri atas seleksi induk.31% dan menghasilkan larva normal sebanyak 218 ekor.). SR (0-10 hari) 83.91%. Ikan palmas jenis albino (Polypterus senegalus var.

9 cm dengan bobot 0.5 cm dengan bobot 0. Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2. Rendy Ginanjar. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungai. Asep Permana. Udang diberi pakan berupa moina beku sekali dalam setiap hari.042 pg/mL.0518 g. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai. dipelihara selama 6 bulan. matang gonad. Rina Hirnawati. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah. dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias.1272–0.3–2. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. hormon. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana.sungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka.7–1. sedang induk jantan belum ada yang mengandung sperma. KATA KUNCI: Neocaridina heteropoda. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya). Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20. Pada ikan yang baru di domestikasi. murah dan aplikatif. oocyt . dan Darti Satyani Balai Riset Budidaya Ikan Hias. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. KATA KUNCI: induk.1630 g dan dua ekor induk jantan yang berukuran panjang 1. budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A). Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96.725 pg/mL. LHRH 100 mg dan testosteron 50 mg (B). implantasi.0488–0. Tutik Kadarini. panjang 40– 60 cm. Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks. Kepadatan 10 ekor induk dengan bobot 65–600 g. LHRH 50 mg dan testosteron 50 mg (C).

05 significant level. male. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. suhu. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. Based on LSD test. because of residual effects to human caused cancer. The concluded that the optimum dose to produce male guppy is 50 mL/L. Therefore.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias.71%. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control). guppy fish . The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. 50 mL/L. carotenoid. The result showed that the percentage of male guppy at 50 mL/ L is 64. KEYWORDS: honey.07 ± 9. Honey is a natural substance which have crysin. but between treatments not significant different. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. the treatments gave significant different with control. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam. The proportions test showed dose 50 mL/L have significant different to control. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. 25 mL/L. kemudian dipisahkan antara tangkai dan kelopaknya. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit.000-4. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2. chrysin.000 mg/kg). as the curative effort is not applicable.6%). The observation to sexual secondary characteristic guppy can be observed at least two months old. The research was conducted experimental with completely randomized design. the alternative masculinization application of natural substance like honey. and 75 mL/L. KATA KUNCI: bunga tai kotok. yeast (30–800 mg/kg) dan sumber lainnya.

Forum Inovasi Teknologi Akuakultur 2010

FF 69
PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA
Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. Induk dipelihara dalam 8 buah bak berukuran 1,5 m x 1,5 m x 1,0 m dengan kepadatan 24 ekor/bak. Lama penelitian berlangsung selama 6 bulan. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&), 1:2 (B&:@&), 1:3 (B&:@&), dan 2:1(B&:@&). Pada awal percobaan, semua induk secara individu dalam keadaan TKG=O. Peubah biologis yang diamati meliputi: jumlah induk memijah, jumlah telur, diameter telur, dan daya tetas telur. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor, jumlah telur 237.865–335.837 butir/ekor, diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%, rasio (1:2) jumlah induk memijah 30 ekor, jumlah telur 129.534–393.333 butir/ekor, diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%, rasio (1:3) jumlah induk memijah 35 ekor, jumlah telur 272.837–344.975 butir/ekor, diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor, jumlah telur 227.945– 350.140 butir/ekor. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama.pada induk beronang.
KATA KUNCI: Siganus guttatus, pemijahan, jumlah telur, diameter telur, daya tetas telur

FF 70
SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG, Siganus guttatus
Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22,05±6,4 g dengan padat tebar 15 ekor/keramba. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut, B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan, masing- masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0,05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0,05) dengan rasio efisiensi proteinnya.
KATA KUNCI: tepung ikan, tepung rumput laut, substitusi, pakan ikan beronang, S. guttatus

Forum Inovasi Teknologi Akuakultur 2010

FF 71
PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH
Rusmaedi, Idil Ardi, dan Wartono Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan, yaitu menggunakan tingkat teknologi tradisional plus, memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Dengan teknologi yang diterapkan, diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Penelitian ini dilakukan pada tambak di daerah Betok Mati, Kecamatan Cilebar, Karawang, Empat petak tambak masing-masing berukuran 3.500 m2 digunakan untuk percobaan. Sebelum penebaran, dilakukan pengolahan tanah tambak,n pengapuran sebanyak 175 kg/petak, kemudian dikeringkan sekitar satu minggu. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. Setelah dua hari, pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Pemeliharaan dilakukan selama tiga bulan, pada bulan pertama udang tidak diberi pakan, sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak, penebaran dilakukan setelah satu bulan dari penebaran tokolan. Dari pemeliharaan udang selama tiga bulan, diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34,5 g, produksi 81,1 kg dan sintasan 11,2%. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3, yaitu pertambahan berat rata-rata 230 g, produksi 78,8 kg dan kelangsungan hidup 100%.
KATA KUNCI: Karawang udang windu, salinitas rendah, tokolan,

FF 72
PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT
Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1,5–50 m3 dengan rata-rata kepadatan akhir N. oculata 13,1±0,04 juta sel/mL dan rotifer 186±5.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. Pemadatan (flokulasi) N. oculata dengan NaOH dosis 75, 100, dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368, 427, dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. Tingkat total ammonium terlarut dalam air laut produksi masal N. oculata relatif tinggi (4,3–8,2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. oculata relatif rendah (3,6%) dengan rasio DHA/EPA hanya 0,2.
KATA KUNCI: pakan alami, marine chlorella, Nannochloropsis oculata, rotifer Brachionus rotundiformis, semi-continuous system

Forum Inovasi Teknologi Akuakultur 2010

FF 73
PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus)
Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi, juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). Wadah penelitian yang digunakan adalah jaring berukuran 1,0 m x 1,0 m x 2,0 m, yang ditempatkan pada keramba jaring apung di laut. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19,2 ± 0,67 cm/ ekor dan bobot 155,3 ± 10,79 g/ekor, ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%, (B) 9%, dan (C) 13%, masing- masing terdiri atas 3 ulangan. Pemberian pakan dilakukan 3 kali/hari (pukul 08.00, 11.00, dan 17.00). Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. Hasil penelitian menunjukkan bahwa kadar lemak 5%, 9%, dan 13% dalam pakan berpengaruh tidak nyata (P<0,05) terhadap pertumbuhan dan sintasan ikan beronang.
KATA KUNCI: kadar lemak, pertumbuhan, sintasan, Siganus guttatus

FF 74
ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA
Lies Emmawati Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. Jika tidak ada efek rumah kaca, suhu dipermukaan bumi akan turun secara drastis. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia. Permasalahan ini perlu dipikirkan solusinya, karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Padahal dalam upaya peningkatan produktivitas perikanan budidaya, plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global.
KATA KUNCI: pemuliaan, ikan langka, budidaya, konservasi

dan insang. parasit . kecepatan arus. 2009. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. Kualitas air perairan yang diukur adalah: pH. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. Akhmad Mustafa. neon tetra. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. penyakit.59 ha. (Dinoflagelata). Trichodina sp. salinitas. dan besi. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. Gyrodatylus spp. Chiclidae. dan Dactylogyrus spp. kecerahan. dan Ichthyophthirius multifiliis (Ciliata).18 ha. Red Fin Albino. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. cukup sesuai 512. 98% terinfeksi parasit. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. Trematoda). Pulau Bekengkeng. perairan Kalukku. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. Synodontis. (Monogenea).Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. budidaya laut. sirip. keramba jaring apung. cat fish. perairan Papalan. KATA KUNCI: kesesuaian lahan. nitrat. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. (metacercaria. fosfat. mas koki. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. (Copepoda) dan Centrocestus sp. kedalaman. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. sympilum dan Characidae. dan platydoras. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. Dari Sampel yang diperiksa 33. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. Sampel ikan hias antara lain dari golongan cyprinidae. Argulus sp. kapiat albino.41 ha dan kurang sesuai 52. Pulau Kambunong.18 ha yang terdiri dari sangat sesuai seluas 133. arah arus. KATA KUNCI: ikan hias air tawar. dan Tanjung Dapuran. Oleh karena itu. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau.

Tahapan penelitian meliputi: penentuan lokasi. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. pencemaran. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. Cd. Variabel yang diamati adalah konsentrasi kandungan Pb. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar.98 ton/bulan.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. preparasi. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. pengambilan contoh. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan. KATA KUNCI: logam berat. badan air Sungai Citarum dan Sungai Cimeta. Cd. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet.8214 ton/bulan dan 1. Cd. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. muara Sungai Citarum. Contoh yang diambil berupa air. Perairan Waduk Cirata sudah tercemar oleh parameter Zn. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. Organofosfat. sedimen (lumpur/tanah). pestisida. inlet.86 ton/bulan. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. residu . diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. identifikasi dan analisis data serta pelaporan. Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. dan Zn dalam air dan daging ikan. KATA KUNCI: lahan perikanan budidaya. CD. zona 2 Purwakarta. Piretroid. serta debit air dari muara sungai yang masuk ke perairan waduk. dan Karbamat. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS.88 mg/L/kg daging ikan. batas daerah bahaya. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. muara Sungai Cisokan. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian.

Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri. dan Cadas Bodas. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu. selanjutnya digunakan untuk analisa genetik. pada region mitokondria 16SRNA.17-9. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393.33. Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). fitoplankton. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. KATA KUNCI: Glass eel.nebulosa .75 ind.75–4887.65– 0.marmorata. A. Bacillariophyceae. Patok Batas. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR.75– 993. KATA KUNCI: komunitas.5 ind. bicolor. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur.31. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar. PELABUHAN RATU. indeks dominansi (C) = 0. dan Protozoa. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat.12–3. dan sebanyak 150 ekor disimpan dalam alkohol absolut.83./L dan zooplankton berkisar antara 93. 2–4. dikelompokan pada jenis A. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2.n./L. Sukabumi.52) dikelompokan pada jenis A. nebulosa. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor. Maleber. A.7) dikelompokan jenis A.71–19. dan 4–6 m.) DI PERAIRAN SUNGAI CIMANDIRI. dan nilai kemerataan (E) = 0. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. (13. Cyanophyceae. A. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies. Pelabuhan Ratu. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias.35).marmorata dan (4.072–0. Dinophyceae. Copepoda. dan Desmiceae dari zooplankton ditemukan jenis Rotifer. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi. bicolor bicolor. Palumbon. Sungai Cimandiri. Ciputri.

Forum Inovasi Teknologi Akuakultur 2010

FF 81
POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN
Afifah*), Titiek Aslianti*), dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut, Gondol **) Mahasiswa Universitas Gadjah Mada, Jogjakarta

ABSTRAK
Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL), terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. rotifer, B. gonad kerang, dan C. kuning telur) dan 3 ulangan. Pemberian pakan awal di mulai saat larva berumur D-2—D-10, selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan, selanjutnya secara periodik 5 hari sampai dengan D-30. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan,. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10,99 mm; 27,10 g; dan 21,97%) dibanding perlakuan A (10,27 mm; 21,94 g; dan 1790%) dan C (11,01 mm; 25,20 g; dan 17,17%). Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan, namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.
KATA KUNCI: larva ikan kuwe, pakan awal, pola pemangsaan

FF 82
KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT
Mulyasari*), Dinar Tri Soelistyowati**), Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya

ABSTRAK
Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan, adalah dengan program pemuliaan. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra- dan inter-populasi ikan nilem di Jawa Barat. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin), sirip dada (pectoral fin), sirip perut (ventral fin), dan sirip anal (anal fin). Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata.
KATA KUNCI: ikan nilem, Osteochilus hasselti, meristik

Forum Inovasi Teknologi Akuakultur 2010

FF 83
EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti)
Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Pakan memegang peranan penting dalam budidaya ikan nilem. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan, Balai Riset Perikanan Budidaya Air Tawar, Bogor. Ikan uji yang digunakan adalah ikan nilem dengan bobot rata- rata 5,0±0,3 g/ekor. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%, 19%, dan 20%. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Ikan dipelihara selama 40 hari. Parameter yang diamati yaitu pertumbuhan spesifik, konversi pakan, serta sintasan ikan. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0,05) yaitu sebesar 1,56%. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0,05).
KATA KUNCI: nilem, protein, pertumbuhan, pakan

FF 84
EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI, KABUPATEN BATANG)
Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan, Jakarta

ABSTRAK
Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. Penelitian dilakukan di Kabupaten Brebes dan Batang. Metode penelitian dilakukan secara studi kasus. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Harga pakan hanya Rp 2.800,-–Rp 3.000,-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6.500,-–Rp 7.000,-/kg. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya.
KATA KUNCI: efisiensi usaha, pakan buatan, bahan baku lokal, ikan patin

Forum Inovasi Teknologi Akuakultur 2010

FF 85
PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN
Jhon Harianto Hutapea, Irwan Setiadi, Gunawan, dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg). Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2,5 m3 (diameter 2 m dan tinggi 0,8 m) dan bak fiberglass berbentuk oval volume 2,1 m3 (lebar 1,4 m dengan panjang 2,1 m dan tinggi 0,7 m. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari.
KATA KUNCI: penanganan calon induk, ikan tuna sirip kuning, sintasan

FF 86
KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON
Gleni Hasan Huwoyon, Irin Iriana Kusmini, dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. Pada beberapa jenis ikan, warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2,1±0,19; hitam: 1,7±0,20), pertumbuhan mutlak (merah: 6,8±1,02; hitam: 5,6±0,30) dan laju pertumbuhan spesifik (merah: 0,65±0,06; hitam: 0,57±0,02).
KATA KUNCI: warna, tengadak, Barbonymus schwanenfeldii, genetika

Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau.01).5% molasses + 0. KATA KUNCI: khamir laut. Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator.5% molasses + 0. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan. Hasil penelitian menunjukkan bahwa: pH. protein kasar. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu. dan energi di antara perlakuan berbeda nyata (P<0. R4 = Daun mengkudu + 2.5% molasses + 0. Jepara. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia).08% khamir laut. dan abu di antara perlakuan tidak berbeda nyata (P>0. Setelah kering. daun mengkudu. dan TSP. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. silase. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan.05). BETN. pupuk .5% molasses + 0. Berdasarkan hasil penelitian. urea. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2.06% khamir laut. bahan kering.05).00% khamir laut.5% molasses + 0. Setelah 5 hari dipanen. E = Daun mengkudu + 2. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. gula. lemak kasar.04% khamir laut. B = Daun mengkudu + 2.02% khamir laut. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0. serat kasar. R = Daun 3 mengkudu + 2.

penggunaan sarana produksi yang ramah lingkungan. BL542 bulan III. tambak marjinal .07. Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau. ditebari bandeng (10.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA. Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I. bandeng (3.1 ton/ha/16 mg menjadi 1. udang windu. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu.000 ekor/ha).48 kg/ha.000 ekor/ha) dan rumput laut (1 ton/ha).73% dengan produksi sebesar 217. MY1112 bulan II. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik./ha) dan petak II : bandeng (3. KABUPATEN TAKALAR Muharijadi Atmomarsono. di mana termasuk cara budidaya udang.000 ekor/ha) dan rumput laut (1 ton/ha). Erfan Andi Hendradjat. Perlakuan B.-/musim tanam dengan B/C rasio 2. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik. rumput laut (2 ton/ha) dan tiram (40. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1.46% dengan produksi udang windu sebesar 249.000 ind. petak I ditebari bandeng (10.000.5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara. Brata Pantjara. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. CBIB. KATA KUNCI: udang windu. Sulawesi Selatan. serta manajemen pakan dan air secara benar.977. Pada akhir penelitian diperoleh sintasan 63. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen. rumput laut (2 ton/ha) dan tiram (20. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I. KATA KUNCI: biofilter. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. rumput laut. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram.000 ekor/ha). Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40.000 ekor/ha.000 ind/ha) dan petak II. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram.

Oleh karena itu. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. total bakteri. NO3. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39.7 kg/ha/90 hari). Nurbaya.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). BL542 bulan III. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan 3 selama penelitian relatif lebih tinggi pada perlakuan yang NH tidak menggunakan probiotik dengan dosis pakan 100%. kandungan BOT di atas 30 mg/L. (C1) probiotik komersial dengan dosis pakan 100%. (D2) kontrol 2. Hasil penelitian menunjukkan. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. dan total Vibrio. Nurbaya.35% dan 448. survival rate. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. Pengamatan sintasan udang windu dilakukan pada akhir penelitian. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau.7 kg/ha/90 hari). Sintasan udang windu tertinggi didapatkan pada . Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak.7 kg/ha/90 hari). menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau. NO2. (C2) probiotik komersial dengan dosis pakan 50%. air laut salinitas 28 ppt sebanyak 15 L. Maros. B) Pergiliran probiotik BT951 bulan I. terutama salinitas yang mencapai 56 ppt. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah. tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani. Balai Riset Perikanan Budidaya Air Payau. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masingmasing 3 kali dan lama pemeliharaan 10 minggu. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. Penelitian dilakukan di laboratorium basah. KATA KUNCI: probiotic bacteria. NH 3. PO4. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. production. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. Penelitian dilaksanakan selama 90 hari.8% dan 228. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. Muliani. diikuti perlakuan kombinasi probiotik A (50. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. MY1112 bulan II. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%.05% dan 298. dan C) Kontrol (tanpa probiotik).

KATA KUNCI: probiotik.05) pada akhir penelitian. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial. dosis pakan.perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60. sintasan. udang windu . sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11.11%.

masing adalah 66. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya. dan kontrol (tanpa aplikasi probiotik).masing-masing dengan dua kali ulangan. yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1. serta 99. Maros selama 90 Hari.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13.4 ha. rumput laut dan ikan bandeng adalah perlakuan B (10. namun belum mampu menurunkan kandungan amoniak dalam media budidaya. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81. Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha).5% dengan produksi 19. Tjaronge. Tokolan udang windu (PL. Sintasan dan produksi udang windu dan ikan bandeng masing. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau. produksi. Sampling dilakukan 30 hari sekali selama 90 hari. Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). KATA KUNCI: probiotik. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak. masing-masing terdiri atas 2 ulangan. dan pertumbuhan udang serta aman bagi konsumen.7 kg. Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1.000 ekor/ha).000 ekor/ha (1 ekor/m2). Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an.9% dan 33. Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu.500 m2 dengan kedalaman 80 cm. M. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok.9 kg dan secara finansial memberikan . Selama pemeliharan tidak diberi pakan. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha). Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. 31) yang ditebar pada masing-masing tambak adalah 10. Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak.000 ek/ha bandeng) menunjukkan hasil yang terbaik.8% dan 63. Oleh karena itu. baik pada air maupun pada dasar tanah tambak.0%. Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari. kesehatan.

sintasan.-/ha /90 hari. rumput laut.572. KATA KUNCI: multitropik. produksi . ikan bandeng.keuntungan sebesar Rp 11. udang windu.000.

KATA KUNCI: promoter. Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva.1%) serta tanpa transfeksi (49. Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. 3 hari. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Promoter dikatakan aktif apabila gen penanda dapat terekspresi.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR.Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. uji tantang. Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. 12 jam. yang sampai saat ini belum bisa diatasi secara secara tuntas. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. danAndi Tenriulo*) **) Balai Riset Perikanan Budidaya Air Payau.3% dan tidak berbeda nyata (P>0. transfeksi. Ketika ditantang dengan WSSV. KATA KUNCI: ekspresi. Alimuddin**). Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. Bunga Rante Tampangallo. Aan Fibro Widodo. gen PmAV menunjukkan respons meningkat (up-regulation). Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. 2 hari. 1 hari. Selain itu.0%). Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia. IPB.05) dibandingkan dengan kontrol. termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). Syarifuddin Tonnek. ekspresi gen. 4 hari. Fakultas Perikanan dan Ilmu Kelautan. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. udang windu . EGFP. Sukenda**). Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. gen anti virus. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. Maros **) Departemen Budidaya Perairan. Komar Sumantadinata**).

pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. karena relatif mudah dan murah. serta berpeluang untuk digunakan secara langsung di lapangan. Teknik serologi.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. antibodi monoklonal . hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. cepat dan akurat. khususnya ELISA. Penelitian dilakukan untuk membuat. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. KATA KUNCI: White Spot Syndrom Virus (WSSV). Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. monodon dengan melihat gejala klinis dan studi histopatologi. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. Antibodi monoklonal memiliki kespesifikan yang tinggi. KATA KUNCI: ELISA. serta epidemi penyakit di lapangan. menyeleksi. Setelah pengujian. sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. dan disertai ulserasi lapisan mukosa epitel. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. Nurhidayah. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. Pewarnaan jaringan menggunakan Hematoxilin eosin. White Spot Syndrome Virus (WSSV). dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV).

Setiap perlakuan dengan 2 ulangan. namun terbatas pada golongan masyarakat menengah keatas (padat modal).83±8. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0.034) berbeda nyata (P<0. rasio konversi pakan dan produksi udang vaname. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11. budidaya udang intensif. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%. Selama pemeliharan 85 hari.114±0. Takalar.258). Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei). 829. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1. Instalasi BRPBAP.5±88.45 g/ekor dan ditebar kepadatan 100 ekor/bak. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei).05) dengan perlakuan A (1. dan efisiensi biaya produksi. namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan. produksi (1831. KATA KUNCI: udang vaname. benur.0328 mg/L) pada akhir penelitian. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0.257±0. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun.9). sintasan. . Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah.51). Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau. produksi (2087. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. dan kepadatan benur dan tokolan adalah 50 ekor/m2.549±0. karena berpengaruh terhadap pertumbuhan.31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya.Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.096±0. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari.085±0. tokolan. sintasan (90.120). Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12). sintasan ( 92. dan (B) pembesaran dengan tebar tokolan (PL 27).234). Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan. Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi. menggunakan 4 petak masing masing berukuran 4. Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%. sintasan.0±149. Riset ini dilaksanakan di tambak Punaga..102 CFU/mL.048). Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0.masing-masing perlakuan diulang tiga kali.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10. Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0.7 m sebanyak 9 buah. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak. Budidaya ini berkembang dengan teknologi intensif.18235 mg/L) dibandingkan dengan perlakuan A (0. RKP pada pembesaran udang vaname teknologi intensif. dan pemeliharaan berlangsung 80 hari di tambak.000 m2/petak.05) terhadap pertumbuhan.

feed. and L vannamei . survival rate.KATA KUNCI: growth.

Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0.05) terhadap pertambahan berat mutlak.6 kkal GE/g).Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN. D (protein 35%. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan.5 kkal GE/g). dan E atau komersial (protein 40. sedangkan ekskresi amonia antara 1. 5 kali sehari pada pukul 07.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2. ekskresi amonia dan stabilitas pakan.05).00.00. laju pertumbuhan harian. sintasan. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI .3%–86. Selama pemeliharaan.000 m2. C/P rasio 13. produksi. Pakan diberikan at satiation.00. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname. Fakultas Perikanan dan Ilmu Kelautan.029–2. Penelitian dilakukan di tambak percobaan Punaga Takalar. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4.00. C/ P rasio 16.INTENSIF DI TAMBAK Abdul Mansyur. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0. C (protein 33%. dan pH 8.intensif. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon). namun kurang diimbangi dengan penyediaan pakan yang sesuai.2 kkal GE/g). B (protein 31%. Jakarta Utara. Litopenaeus vannamei Deisi Heptarina*).69%.0– 8. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7. rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi . 11.39%. C/P rasio 15.8 kkal GE/g). sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0. C/P rasio 11. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. sintasan. suhu 28°C–30°C. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). Bogor **) Departemen Budidaya Perairan. fotoperiod dibuat 12 jam terang–gelap. dan 23.71%–22.464 mg/kg tubuh/jam. Kemudian dilanjutkan uji kecernaan. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. salinitas 24–25 ppt. .1 kkal GE/g). 19. Hidayat Suryanto Suwoyo. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. Agus Suprayudi**).5. C/P rasio 14. Sintasan antara 73. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum.7%. Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%. Bobot yuwana yang ditebar rata-rata 0. Ing Mokoginta**) dan Dedy Yaniharto***) *) Balai Riset Perikanan Tawar. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB). Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan. M. Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media. Perlakuan terdiri atas pakan A (protein 29%. 15. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH.00.5 g/ekor dengan kepadatan 10 ekor per akuarium.

4%–94. Kisaran nilai masing-masing parameter tersebut adalah.2–78.6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik. kecernaan total dan kecernaan protein masing.4–2. yuwana.2% serta WS berkisar antara 49.9%–79.2%.4%.4. retensi protein (RP). K ATA KUNCI: protein vannamei optimal.1% dan 65.masing 26. kecernaan total. jumlah konsumsi pakan (JKP). konversi pakan (FCR).5%–62.05). retensi lemak (RL).5%. PR 532.9%–68. kecernaan protein.1 g.Namun. pertumbuhan. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0. RL dan RP masing-masing 26.5%–36. Litopenaeus . Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13.8% dan 11.7%–1130. JKP 59. FCR 1. pertumbuhan relatif (PR).

Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. dan moribund. SOD. SOD. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . dan SP mampu berdiri sendiri. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). belum dapat diyakinkan secara pasti bahwa ekspresi EST. PGM. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. EST. toleran. Lila Gardenia. SPF. L. SOD. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. Untuk mengetahui jenis virus yang menyerang udang tersebut maka. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. Taura Syndrome Virus. Haryanti*). protein haemolimph dan ekspresi enzim (GPI. dan SP. Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. Semua gejala tersebut diduga akibat adanya serangan virus. EST. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terusmenerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). dan Rustidja**) *) Balai Besar Riset Perikanan Budiaya Laut. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). and SP) pada udang yang sehat. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. KATA KUNCI: enzim. SOD. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). PGM. Gondol **) Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. Namun demikian. toleran dan terinfeksi TSV. . toleran.Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI.

KATA KUNCI: Litopenaeus vannamei. WSSV. IHHNV. TSV. IMNV dan PvNV . MBV.

udang galah . 25%. dan D) 2 J : 4 B. 0. Musi. Penelitian meliputi pembenihan. Imron. Romy Suprapto. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). yaitu 0%. dan pembesaran. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. pendederan I. Penelitian dilakukan dengan rancangan acak lengkap. yang dilakukan selama 5 bulan.5%. berturut-turut 27%. A dan B. dan 9.20 g. 2%. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. KATA KUNCI: genetik. C. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. diberikan pada pagi dan sore. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. 0. pertumbuhan. Sebagai perlakuan adalah rasio jantan-betina. Asahan. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA).Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. beserta persilangannya. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%. yang meliputi pertambahan panjang dan bobot. B) 1 J : 2 B. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. pemijahan. Ciasem. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. B. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal.21 g. dengan lama pengujian 8 minggu. dengan sistem resirkulasi. 0. dan 13%. berdasarkan nilai heterosis yang didapat. dan tidak berbeda nyata antar perlakuan. 6. pendederan II. khususnya rasio jantan-betina. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. C) 2J : 2 B. KATA KUNCI: mortalitas. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro. berturutturut 0. dan 0. diikuti perlakuan D. 0. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.25 g. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji. Pada sistem tersebut kematian induk relatif rendah. dan D. persilangan. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. Namun demikian.27 mm.25 m2/ekor induk. Barito. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan.5% berturut-turut untuk perlakuan A. rasio kelamin.42 mm. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. reproduksi.31 mm.

dan D (perendaman dalam larutan ekstrak bawang putih). Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan dioptimalkan. B.05) terhadap kelimpahan bakteri. merupakan langkah bio-security. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C. crossbreeding.00% dan 3. Fakultas Perikanan dan Ilmu Kelautan.92. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah.6±21. dan D. tanpa penambahan desinfektan). yaitu inbreeding. Pada karakter pertumbuhan. Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan. C (perendaman dalam larutan ekstrak daun sirih). Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0. Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan.0±1. namun tidak berbeda nyata (P>0. Hewan uji yang digunakan adalah larva udang galah umur dua hari. Hasil penelitian menunjukkan bahwa pada karakter sintasan. B (perendaman dalam larutan formalin 250 mg/L). **) Jurusan Budidaya. Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. (0 cfu/mL).0. sirih. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan. larva udang galah. sintasan (SR) dan perkembangan larva (LSI). outbreeding.93.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. yaitu A. C. dengan nilai sebagai berikut: A. 37. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Harry Wuwungan**).93. Sukamandi. Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*).0%) dan populasi inbreeding (25. Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya. 4. C.4 mm) dan populasi inbreeding (21.5±28.8±7. KATA KUNCI: budidaya dapat inbreeding.8±1. dan D. B. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74.5 x 103). Tiga tipe persilangan.4%) diikuti oleh populasi hasil crossbreeding (57. (4. Perlakuan yang diberikan yaitu A (kontrol.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan.4 mm).0%). (0 cfu/mL). .5%. 45.83% dan 3.7 mm) diikuti oleh populasi hasil outbreeding (21. Dinar Soelistyawati**). 52. (8.4 x 103 cfu/mL) . formalin. keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. KATA KUNCI: bawang putih.8±1.5% dan 3. keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24. 47. desinfektan.

KATA KUNCI: kepadatan. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap.00 dan 16. larva udang pama. (C) 31%. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau. D. populasi. dan Wartono Hadie**) *) Balai Riset Budidaya Perikanan Ikan Hias. Jakarta ABSTRAK Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. (D) 16%. di mana masing-masing perlakuan di ulang tiga kali. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air. Jenis pakan yang diberikan berupa pakan alami chetoceros. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%. Kepadatan larva 50 ekor/L. dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau. dan Bone.Karawang dengan Pelabuhan Ratu lebih dekat. Pemberian pakan dilakukan setiap pagi dan sore (08. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm. Depok *) Pusat Riset Perikanan Budidaya. DAN BONE Eni Kusrini*). Lies Emmawati**). (B) 32%. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. dan (F) 10%. Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0. dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut. jarak genetik K 22 PEMELIHARAAN LARVA UDANG PAMA (Penaeus semisulcatus) DENGAN KEPADATAN BERBEDA Muslimin. KATA KUNCI: udang galah. Kepadatan larva 100 ekor/L. dan pakan buatan. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. C. E. PELABUHAN RATU. lebar 40 cm. Perlakuan yang diujicobakan adalah: A. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. Hewan uji ini ditebar dengan kepadatan berbeda. dan F. Kepadatan larva 150 ekor/L. artemia. Pelabuhan Ratu. Kepadatan larva 125 ekor/L. (E) 24%. Kepadatan larva 75 ekor/L. Maros dengan panjang awal mysis adalah 100-190 milimikron. maka ditambahkan pemanas/heater suhu 30°C. sintasan dan pertumbuhan . Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang). Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu. Kepadatan larva 25 ekor/L. B. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut.Forum Inovasi Teknologi Akuakultur 2010 K 21 VARIASI FENOTIP UDANG GALAH (Macrobrachium rosenbergii) DARI POPULASI PERAIRAN KARAWANG. diameter 15 cm dan Volume 3 L.00 wita). semisucatus) dengan kepadatan berbeda.05) terhadap laju sintasan dan pertumbuhan larva udang pama. Andi Tenriulo. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm. Sulaeman.

05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. Maros.14–7.2.06. Aan Fibro Widodo. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66. tetapi berpengaruh nyata (P<0. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak.58%. dan C (gabungan antara keduanya).9±0.1 mm dan lebar karapas 5. 40.03–0. 58. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0. Kisaran kelarutan oksigen pada awal penelitian adalah 3. Wadah percobaan yang digunakan adalah bentik jar (chamber).26–7.52 kg/250 m2. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar). estimasi K 24 POLIKULTUR KEPITING BAKAU (Scylla serrata) DAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN METODE TEBAR YANG BERBEDA Sulaeman. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP). dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0.1. 44.18±0. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. Data laju respirasi selama 2 O proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit.1 mm. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. panjang karapas 4. yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit.Forum Inovasi Teknologi Akuakultur 2010 K 23 ESTIMASI PADAT TEBAR UDANG PAMA Penaeus semisulcatus BERDASARKAN TINGKAT KONSUMSI OKSIGEN Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. bobot harian.48 mg/L dan kontrol tetap berkisar 4 mg/L. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan. Maros ABSTRAK Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1. dengan kisaran tingkat konsumsi oksigen 0. akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. BRPBAP.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan.6±0.446–6.0235 g adalah 15.96 %.27 mg/g/jam.9 mg/L dan setelah 1 jam pengukuran 0.05) terhadap pertumbuhan bobot mutlak.95 kg/250 m2 dan terendah pada perlakuan B: 60. B (metode gantung).17 kg/250 m2. Ver. disusul perlakuan C: 64. padat tebar. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4. Maros ABSTRAK Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan.03 g. .65 g/m3. KATA KUNCI: udang pama. pertumbuhan panjang dan lebar karapas mutlak dan harian. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. Oksigen terlarut diukur dengan alat pengukur (TPSTM Model WP-82 DO meters).

rumput laut . metode sebar.KATA KUNCI: kepiting bakau. polikultur.

C (375 ind. yaitu: A (625 ind. Peubah yang diamati adalah laju pemangsaan. rotifera./mL).1667 ind./larva/jam dan sintasan 86. data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. Sulaeman. kandungan liat (rs = 0. . laju pemangsaan. Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air./mL dengan laju pemangsaan sebesar 259./mL).66). jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan.05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. Sulawesi Selatan. kepiting bakau. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros. sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0.62).72). dan kandungan bahan organik (rs = 0.75). Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang. yaitu kepadatan rotifera 625 ind. dan nitrat (rs = 0. Hasil terbaik diperoleh pada perlakuan A. Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros.0%. dan Muslimin Balai Riset Perikanan Budidaya Air Payau. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0.) Aan Fibro Widodo. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton./mL). dan E (125 ind. yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang. Maros ABSTRAK Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. zoea K 26 ANALISIS DIATOM EPIPELIC SEBAGAI INDIKATOR KUALITAS AIR DAN TANAHUNTUK BUDIDAYA UDANG Supono Budidaya Perairan Universitas Lampung ABSTRAK Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. Karena hidup di dasar tambak.71)./mL). Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. TOM (rs = 0.). Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen.65). Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0. D (250 ind. Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau. B (500 ind./mL). dan peubah kualitas air. KATA KUNCI: kepadatan. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma.Forum Inovasi Teknologi Akuakultur 2010 K 25 LAJU PEMANGSAAN LARVA KEPITING BAKAU (Scylla serrata) TERHADAP PAKAN ALAMI ROTIFERA (Brachionus SP. Selain diatom epipelic. sintasan. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang.

tambak udang. kualitas sedimen .KATA KUNCI: diatom epipelic. kualitas air.

0 cm dan adanya pertambahan bobot sebesar 58. namun kemampuan produksi para pembudidaya hanya sampai 4 inci. Pertambahan bobot (71. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda. Gleni Hasan Huwoyon. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. ragam. panjang standar.6-71. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6. pertumbuhan. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. lokasi .47) terbaik adalah benih lobster air tawar asal Tangerang. benih.Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini. Bogor. Dianalisis dengan Rancangan Acak Lengkap (RAL). dan panjang total tiap individu. KATA KUNCI: Cherax quadricarinatus. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2.0±0. panjang standar. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar. simpangan baku.72). Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci.9 g. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang.6±10.9±9.74) dan panjang (7. dan panjang total). dan Tulung Agung).6-7. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan. Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci.

39 m x 0.44 µg serta 92. Ibnu Rusdi. cottonii 37.19 ± 6.613.44 ± 102. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. sangat sesuai dalam memacu pematangan gonad induk abalon H. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp. (D) Kombinasi Gracilaria sp. 38.06 µg/hari). dan Sargassum sp. (P<0.73 g..58 m x 0.52 µg/hari) dan terendah pemberian pakan Sargassum sp.854.06 ± 170.59±2. dan kombinasi keduanya. (C) Sargassum sp. kombinasi Gracilaria sp.18 mm dan 7. lebar dan bobot cangkang.92 g dan 219. + Ulva sp. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang.1 ± 4. + Sargassum sp. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30.99 mm dan 36. (B) Ulva sp.89 µm dan 38. pakan (B)= E.23 g dan 121. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0. dan C berturut-turut adalah 120.16 g dan -86. (7. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata.31 m.. cottonii : 40. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali.0 ± 0. Sargassum. KATA KUNCI: Haliotis squamata. dilakukan dengan menerapkan 4 perlakuan pemberian pakan. yaitu: (A) Gracilaria sp. masing-masing 58. yaitu pada perlakuan pemberian pakan Gracilaria sp.05).02 g. (13.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON. (13.39 mm dan 10.03 ± 1.39 g. pakan (B) dengan R² = 0. squamata.17 ± 2. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A. + Sargassum sp.26 ± 10. dan pakan (C) dengan R² = 0. + Sargassum sp. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0.50 g dan 217. + Ulva sp.73±2. Ulva. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga. + Ulva sp. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan.68 µg/hari). I Nyoman Adiasmara Giri. (5. 73. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto. B. Bambang Susanto. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m. serta pakan (C)= kombinasi Gracilaria + E. Riani Rahmawati.05) antar perlakuan.17 ± 25. Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp. (rasio 1:1:1).00 µm dan 38.80 sampai 31.37 mm.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria. cottoni.82 µg/hari).44 µg. Gracilaria.05 mm dan 10.891.. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut. Ulva sp. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi. Riani Rahmawati.9 ± 1. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon.56 ± 48. E.44 µm .06 g.

44 µg. KATA KUNCI: abalon Haliotis squamata.dan 65. aplikasi teknologi pembesaran . Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir.

dengan proporsi yang berbeda Gracilaria sp. tinggi 22 cm.6-3. Tatam Sutarmat. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. Sampel yang digunakan berasal dari Bali dan Banten.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri./Ulva sp. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal./Ulva sp. Setiap perlakuan terdiri atas 2 ulangan. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. mengingat permintaannya yang cukup tinggi. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. proporsi pakan. dan 60/40% (C) sebagai perlakuan. Pakan dengan proporsi Gracilaria sp.06). genetic monitoring. Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan.7 cm. Hirmawan Tirta Yudha. Nilai variasi genetik induk abalone asal Banten (0.2 g dan panjang cangkang 2. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. Gpi*. 60/40% memberikan pertumbuhan abalon terbaik. dengan bobot awal 2. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. dan Ulva sp. Est-2*. Gondol. penjarangan . wild. Abalon diberi pakan rumput laut Gracilaria sp.13) lebih tinggi dibandingkan dengan induk asal Bali (0. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. pembesaran. dan Ulva sp. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air. Est-4* dan Cah-3*. Est-1*. peluang pasar serta teknik budidayanya yang sederhana. KATA KUNCI: abalon Haliotis squamata. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. 80/20% (B). KATA KUNCI: allozyme. 100/0% (A). Ibnu Rusdi. Est-3*. Untuk itu. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery.52. Kepadatan awal benih abalon adalah 450 ekor per wadah. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri.

Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0. KARAKTERISASI. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis.01 mm/hari (perlakuan A).1 mm (perlakuan B). Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan.44±0. penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm. Indah Mastuti. 18. Setiap perlakuan diulang 3 kali.37±0. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon. Gondol ABSTRAK Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. pertumbuhan. Laju pertumbuhan lebar cangkang 0.69%.27±0.33%. Sintasan yang diperoleh untuk perlakuan A.44±0. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1. Vibrio cincinnatiensis.01 mm/hari (perlakuan C).33% .33%. vibriosis. dan 21.01 mm/hari (perlakuan A).55 mm (perlakuan C). dan C berturut-turut 37. Namun.16%. 71. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. Karena itu. B.03 mm/hari (perlakuan B) dan 0. KATA KUNCI: Pinctada maxima.05) dibandingkan dengan perlakuan C. 0. DAN UJI PATOGENISITAS BAKTERI VIBRIO YANG DIISOLASI DARI LARVA ABALON SAKIT DI HATCHERI Zafran. untuk memperoleh pertumbuhan dan sintasan yang baik. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia.36±0. Bali. tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. Gondol ABSTRAK Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan.85±0. Apri I. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar. yaitu media spesifik untuk bakteri Vibrio. dan 46. Perlakuan yang diberikan adalah ukuran tebar 3. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut. Haliotis squamata. sintasan.42%.00 mm/hari (perlakuan C).Forum Inovasi Teknologi Akuakultur 2010 M 05 ISOLASI. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. Supii. 0.03 mm/hari (perlakuan B) dan 0. sedangkan mortalitas pada kelompok kontrol hanya 3. Parameter yang diamati adalah laju pertumbuhan harian dan sintasan.4±0. KATA KUNCI: abalon. dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. dan 20. Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0. dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut.30±0. isolat-2. uji patogenisitas M 06 PENDEDERAN TIRAM MUTIARA (Pinctada maxima) DENGAN PERBEDAAN UKURAN TEBAR AWAL Sudewi. Oleh karena itu.67%.46±0.05 µm). Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan. Gondol. ukuran awal spat . dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13. 10.44 mm (perlakuan A).

Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari. secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. KATA KUNCI: potensi kelautan. Berdasarkan hasil pengkajian. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara. Supii*). regional maupun lokal. tiram mutiara. dan Sudewi*) *) Balai Besar Riset Perikanan Budidaya Laut. Pantai Pengambengan khususnya. Teluk Awen. Sumber Sari. tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. pada tingkat nasional. akan tetapi jika diinginkan. budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. Jembrana . Gondol **) Fakultas MIPA Universitas Udayana ABSTRAK Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan. dan Teluk Rabu. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai. Ida Ayu Astarini**). Pinctada maxima.Forum Inovasi Teknologi Akuakultur 2010 M 07 KAJIAN POTENSI KELAUTAN UNTUK BUDIDAYA TIRAM MUTIARA (Pinctada maxima) DI WILAYAH PESISIR KABUPATEN JEMBRANA-BALI Apri I. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat.

3 m.3 m. sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. 4 m. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut. Maros ABSTRAK Produksi rumput laut ditargetkan meningkat dari 2. Kappaphycus sp. pertumbuhan. vertikultur LL 2 PERBANYAKAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN KULTUR JARINGAN MENGGUNAKAN WADAH YANG BERBEDA Siti Fadilah. Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26. Pengamatan panjang tunas. mengaplikasikan metode long line. Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2. dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0.40 mm pada stoples dan 2. Rosmiati.1.Forum Inovasi Teknologi Akuakultur 2010 LL 1 PERFORMANSI PERTUMBUHAN DAN KANDUNGAN KERAGINAN RUMPUT LAUT (Kappaphycus alvarezii) DENGAN APLIKASI METODE BUDIDAYA VERTIKULTUR Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau. yakni 0.6 juta ton per tahun pada 2014. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver. metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468. verrucosa.20. 2 m. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. 3 m. di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. Sedangkan jumlah tunas dalam stoples (7. 1 m.42 mm pada botol. kandungan keraginan.50) lebih banyak dibandingkan dalam botol (7. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0. 1 m. di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. stoples . Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan.6 juta ton per tahun sekarang ini menjadi 7. KATA KUNCI: Kappaphycus alvarezii. Jawa Tengah. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu.70%) daripada botol (90. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masingmasing dengan 3 kali ulangan. Rumput laut dikumpulkan dari Kabupaten Brebes. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G.1%. dan 5 m dari permukaan perairan. 2 m. KATA KUNCI: botol. K. 3.75%). Maros ABSTRAK Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan. dan 5 m. Umumnya pembudidaya rumput laut. kepadatan eksplan. Oleh karena itu.70 dibandingkan dalam botol yang hanya 6. sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi.75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan. 4 m. jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut. Eksplan diinokulasi ke dalam media cair yang diperkaya PES.3 m. Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur).03). Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut.

Balai Riset Perikanan Budidaya Air Payau.BPPT. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan.1 second. Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV.5 mili/second.e. Kappaphycus alvarezii Muh. b-actin. Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT. cytomegalovirus/ CMV. Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%– 10%. Rajamuddin*). Pola ekspresi keempat promoter relatif sama. persentase sel berpendar rata-rata 10%. dan St. Utut Widyastuti***). dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) . promoter.Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT. Keratin dan b-actin. ZPT. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0. dan sumber karbon yang berbeda. Makassar **) Departemen Budidaya Perairan-FPIK. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. Sebagai tahap awal dalam rangka produksi rumput laut transgenik. Fadilah. panjang kejutan: 0.e dan stabil setelah jam ke9 sampai ke-12 s. puncak jam ketiga – keenam s. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. jumlah kejutan: 4 kali dan interval kejutan: 0. Alimuddin**). penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. KATA KUNCI: Kappaphycus alvarezii. Alias L.Irvan Faizal****). mulai berpendar jam pertama – kedua setelah elektroporasi (s. Rosmiati. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm.e).4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik. daya tahan penyakit. . transgenesis.

kappaphycus alvarezii. hibridisasi. fusi protoplas .KATA KUNCI: mutu genetik.

SIG. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. Rekomendasi pencegahan penyakit. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang. Pandeglang . usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. konservasi dan wisata). KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. kondisi sosek-ekonomi. KATA KUNCI: rumput laut. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. pembudidaya rumput laut. Pada umumnya. Untuk itu. dan status wilayah kawasan. khususnya di Kecamatan Sumur. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). taman nasional ujung kulon. Kabupaten Pandeglang. Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. I Nyoman Radiarta. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Erlania. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG).

Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii. kalus. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio. Ridwan*).0:0.8%). KATA KUNCI : Kappaphycus alvarezii. embrio somatik. Rajamuddin*). Pada media cair.1 mg/L) dengan konsentrasi agar (0.5 mm dapat dicapai dalam satu bulan kultur. pengggantian media dilakukan setiap minggu dengan komposisi media yang sama.0 mg/L. Pada tahap induksi kalus. Alias L.2 mg/L) dengan konsentrasi agar media induksi (0. pada rasio IAA: kinetin (0. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. 0.5%).6%. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Andi Asdar Jaya*). adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus. Pada tahap regenerasi massa sel embriogenik.4 mg/L.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm). Makassar **) Balai Riset Perikanan Budidaya Air Payau. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau.0 mg/L. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0. Perkembangan selsel embriogenik diamati pada kultur cair.6% dan 0. 0. Rosmiati.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0. 1.0:0.4%. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. morfologi. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid.8%.1:1.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati. dan 1. dan 2. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%. Pemeliharaan dilakukan selama 8 minggu.6%. KATA KUNCI: keragaman. 1.8% dan 1. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0.5:0. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh. Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen.0%. dan 0. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan.0:1. 0. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan. embriogenesis somatik .0 mg/L. Tahap (2) adalah regenerasi massa sel embriogenik somatik.0% menghasilkan persentase induksi kalus tertinggi (90%).

rasa. Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. kadar abu. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No.24 ha. dan karbohidrat) dan uji organoleptik. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. A-2 (30% tepung rumput laut dan 70% tepung terigu). Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. abu. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam pengembangan. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. Mery Sukmiwati.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. denga metode budidaya tali panjang (long line). dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. protein. produksi pada tahun 2008 sebesar 750 ton. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn .780. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat.13 ha dan 3.143. dan berpengaruh nyata terhadap rupa dan tekstur. Hasnawi. A-1 (15% tepung rumput laut dan 85% tepung terigu). A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. aroma. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. KATA KUNCI: program-program pokok strategi pengembangan. lemak. rumput laut. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. 01-2973–1992 dan SII 0177–1990. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. Parameter mutunya adalah kandungan zat gizi (air.

uji organoleptik . gizi. KATA KUNCI: rumput laut.85%. crakers.

Rachmansyah.36 dan 3. Peubah kualitas tanah yang diukur adalah: pH . Program ArcView 3. KATA KUNCI: kebutuhan kapur. tambak. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei.78% sehingga memiliki faktor konversi berturutturut sebesar 2. Kebutuhan kapur didasarkan pada tanah dengan POS nilai S mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur. pH F .60 dan 36. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan.614%. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia. Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95. tanah. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra POS S ALOS FOX AVNIR-2 akuisisi 28 Juli 2009.29 ton/ha 3 CaCO dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju.30 dan 1.2 digunakan untuk pembuatan peta distribusi tanah. namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0. Maros ABSTRAK Kabupaten Mamuju.02. Oleh karena itu.71 g/cm3 dengan rata-rata 0.09 dan 90. Adang Saputra. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta. bahan organik dan berat volume tanah. S POS .02% serta 44. . dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat POS S dan berkelanjutan.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI S POS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa.32 dan 113. Penelitian ini bertujuan untuk melakukan analisis . S .884 g/cm3 tanah berkisar antara POS dan S 0. Kapur S P KCl POSpertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur. pirit.15 dan 19.28% dengan rata-rata 7. Kebutuhan kapur untuk tambak di Kabupaten Mamuju berkisar antara 1. S . ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting.

budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan.spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG). inderaja. analisis spasial. Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut. KATA KUNCI: budidaya laut. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. Maluku . infrastruktur (jalan) dan sebaran penduduk. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan. klorofil-a dan suhu permukaan laut). SIG. Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut.

dan Sularto***) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Hatim Albasri**). Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan.400 m2 selama 3 bulan pemeliharaan. b a nd en g LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). Jakarta **) Pusat Riset Perikanan Budidaya. ikan patin. Wartono Hadie**). tambak terbengkalai. udang dan bandeng. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. Sukamandi ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. Adang Saputra**).Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). analisis location quotient. Kabupaten Brebes . Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. konversi pakan serta pertumbuhan yang cukup baik. Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. KATA KUNCI: minapolitan. analisis komoditas. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. peningkatan pendapatan. rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara. Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. rumput laut. KATA KUNCI: produktivitas tambak. Jakarta **) Pusat Riset Perikanan Budidaya. Introduksi kaji terap dilakukan dilahan seluas 2. Di samping itu. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. Evi Tahapari***). analisis komoditas unggulan dan andalan. udang. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. dan analisis usaha perikanan.

pH dan potensial redoks. Oleh karena itu. bakau. 4PO . penutup/penggunaan lahan.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. pesisir. kelapa (Cocos nucifera). kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. S . TAA. . pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent. padi (Oryza sativa). rumput. TPA. Kualitas tanah yang diukur langsung di lapangan adalah pHF. rumput. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. tanpa vegetasi. bakau. nipah. Pada kedalaman 0.75 m tanah vegetasi api-api. Hasil penelitian menunjukkan bahwa. N-total.25 m tanah jenis penutup/penggunaan lahan api-api. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. Al dan tekstur. sagu.75 m. Pada kedalaman 0-0. Marsambuana Pirzan. A.50-0. dan Kamariah Balai Riset Perikanan Budidaya Air Payau. bakau (Rhizophora apiculata). dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. OXS P KCl POS karbon organik.50-0. nipah. Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah. TSA. rumput. pirit. pH . tanah. sagu (Metroxylon sagu). nipah (Nypa fruticans). S . Kabupaten Mamuju . sedangkan yang dianalisis di laboratorium adalah pH FOX . campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. KCl KATA KUNCI: keragaman. sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. Fe. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). paku laut (Acrostichum aureum). Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. masingmasing pada kedalaman tanah 0-0.25 m dan 0.

Data lapangan (fisiko-kimia air dan tanah). sedangkan yang kurang sesuai (213.000.819 ha). data sekunder. dianalisis secara spasial dengan metode PATTERN menggunakan SIG. dan fosfat. cukup sesuai (168. tambak. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil.986 ha). nitrat. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik. KALIMANTAN BARAT Utojo. Pada umumnya yang tergolong sangat sesuai (114. salinitas. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan. walaupun dengan model regresi yang berbeda. dan bahan organik total.077 ha. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. nitrat. KATA KUNCI: kesesuaian lahan. Mempawah Hilir dan Mempawah Timur. nitrit. Sungai Kunyit. amonia. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. KATA KUNCI: klorofil. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. kualitas air. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). pH.272 ha). fosfat. pH. Sulawesi Barat . Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia. tambak. oksigen terlarut. Akhmad Mustafa.000. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. sedangkan peubah bebas adalah suhu. terdapat di Kecamatan Segedong dan Siantan. dan data citra satelit digital. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil.046 dan 22. nitrit.047 dengan rata-rata 6. amonia.398 µg/L. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. Data sekunder yang diperoleh berupa data iklim. tersebar di wilayah pesisir Kecamatan Sungai Pinyuh. Oleh karena itu. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat.

Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: mikroalga. dan BOD5. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0. Kultivasi Dunaliella sp. minyak nabati .02–8. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya. KATA KUNCI: makrobentos. dan Nematoda.. indeks diversitas dan keseragaman spesies. Proses pengayakan termasuk penyeleksian. kemudian 6. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp. identifikasi. Spesies dominan adalah Limnaea sp. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9.5 mg/L. ekstraksi. 2006). Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8.0 sel/mL. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung. Tidak terdapat perbedaan nyata (P>0. dengan menggunakan cara modifikasi (Banerjee et al. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP.. dilakukan di dalam bak. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4. Parameter kualitas air yang diamati adalah suhu. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis. Kultur ini ditempatkan diluar ruangan.75). total bahan organik (TOM). Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L.. DO. penghitungan kelimpahan. 5:4. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda. pupuk.. 2002 dan Dayananda et al. BRPBAT. pH.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6. dan penghitungan dilakukan di laboratorium. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. dan 6:3.). Chironomus sp. kecerahan.60% menggunakan perlakuan pelarut hexana. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5. kolam. Bogor. Jakarta. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan. Dunaliella.bak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. Analisis kandungan minyak nabati Dunaliella sp. Analisis data dilakukan secara deskriptif untuk komposisi jenis. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda.

25/ hari pada indoor dan 3. Departemen Pertanian. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. braunii. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. KATA KUNCI: ketahanan pangan. Berdasarkan perhitungan statistik ANOVA. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. salinitas. Botryococcus braunii . salah satunya adalah Desa Merakan di daerah Jawa Timur. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor.37.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan.33 sel/mL pada sistem indoor dan 7. Metode penelitian menggunakan metode survei. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. rawan pangan. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata.65/hari pada outdoor. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. 02 sel/mL pada sistem outdoor. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. laju pertumbuhan. dengan skor 19. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. Pengolahan data dilakukan secara deskriptif. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat. KATA KUNCI: kepadatan. dan pH. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12.

uji PCR. penanganan aspek teknis. Infeksi bakteri. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. KATA KUNCI: unit usaha. pengelolaan bisnis. Bakteri merupakan salah satu penyebab penyakit pada ikan. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. profitabilitas. KATA KUNCI: Aeromonas hydrophila. penanganan aspek teknis. pembudidayaan. sehingga AH-26 merupakan isolat yang pathogen. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. dan Balai Budidaya Laut (BBL) Ambon. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. Uji awal berupa pengecatan gram. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. tes katalase dan oksidase dilakukan sebelum uji PCR. Sedangkan dengan menggunakan spesifik primer. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. aerolysin dan primer spesifik . kemungkinan merupakan strain yang tidak pathogen. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. Isti Koesharyani. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila.

Waduk Cirata . Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. yaitu 4423. kedalaman 2 meter (B).Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat.860. KATA KUNCI: kedalaman.Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti.91. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m).81 (ind/cm2) dan 0. Winarlin.masing perlakuan 5 kali ulangan. kedalaman 3 meter(C) dan kedalaman 4 meter (D). Ani Widiyati. periphyton. Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar. namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae. Masing. Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A).

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

salinitas. Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. sintasan. Akuarium yang digunakan berukuran panjang 60 cm. 8 ppt (6–10 ppt). dan tinggi 40 cm dengan ketinggian air 15 cm. Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. Bogor *) ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. Masing. Majalaya. Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. ikan mas. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. Sidi Asih***). sintasan terendah didapatkan pada salinitas 12 ppt. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. lebar 40 cm. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*). dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. Hary Krettiawan*). teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. Jakarta **) Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. pertumbuhan . KATA KUNCI: streptococcosis. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas. telah banyak menginfeksi ikan nila. dan 12 ppt (11–15 ppt). KATA KUNCI: strain. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. ikan nila. dan Sutisna Kuningan.masing perlakuan menggunakan 2 ulangan. Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae.Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. Cianjur Wildan. dan Achmad Sudradjat*) Pusat Riset Perikanan Budidaya.

Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya.November 2009. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan.64 sedangkan FCR total sebesar 1. Dalam hal dukungan dana permodalan. yang diberi sekat jaring nilon hita. termasuk jenis ikan karnivor.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain. Iwan Malhani Al’Wazan. Pemeliharaan ikan belida dilakukan di kolam. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya.53. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan. dengan jangka waktu pengembalian modal selama 3. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4.20 siklus dan nilai RC ratio sebesar 1. KATA KUCI: ikan belida. anakan ikan nila . Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan September. pakan.36. KATA KUNCI: budidaya. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. dan kalimantan. Jawa. Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september . ekonomi. ikan belida yang banyak hidup di perairan umum Sumatera. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. Jakarta ABSTRAK Ikan karnivor.

Induk yang matang dipilih dan dilakukan pemijahan secara buatan. palm kernal meal. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) Pusat Riset Perikanan Budidaya. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. Dalam kegiatan budidaya ikan. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. KATA KUNCI: ikan nila. pelet maggot . Budidaya ikan nila dapat dilakukan di kolam. Selama proses adaptasi pada kolam pemeliharaan. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. Untuk menguasai teknologi domestikasinya. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. kurang lebih 60% pengeluaran berasal dari pakan. yang dikenal dengan nama PKM (palm kernel meal). KATA KUNCI: ikan belida. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. Jakarta **) Balai Riset Perikanan Budidaya Air Tawar. jaring tancap dan keramba jaring apung. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva.

KATA KUNCI: vaksin bakteri. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. 65 g/ ekor. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. KATA KUNCI: pertumbuhan. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. 25 – 1. Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. Masingmasing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. dan 200 ekor/m³. dan Zafran Balai Besar Riset Perikanan Budidaya Laut. sintasan. bakteri maupun berbagai jenis parasit. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. 05. baik disebabkan oleh infeksi virus. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. Rasio konversi pakan 1. 95 – 2.150. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. sedangkan kontrol hanya disuntik dengan PBS. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Pendederan ikan kerapu macan. Fris Johnny. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. Epinephelus fuscoguttatus. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. penyakit infeksi . 05) tidak mempengaruhi sintasan. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. Padat penebaran yang digunakan sebagai perlakuan adalah 100.bak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. Masing-masing perlakuan diulang 3 kali.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bak.

pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. Plectropoma laevis. dan (B) Induk asal alam. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya.25-4. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³.80.520 µm. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. aspek biologi reproduksi . Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam.004. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 . indeks somatik gonad dan diameter oocytnya. dan pada induk asal alam 20-92 % dengan SAI 2. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya. Agus Priyono.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. Kualitas telur yang dihasilkan relatif masih fluktuatif.000 butir.450. dengan jumlah 8% biomass/hari.20. Ketut Suwirya. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia. Apri I. Supii. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan.240.000 butir. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3. Tridjoko. KATA KUNCI: kerapu raja sunu.

Kata kunci : Jaring apung. Peubah yang diamati adalah sintasan. total biomass dan biaya pakan. Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. Himawan Tirta Yudha. (1988). pertambahan berat. dengan periode pemeliharaan120 hari.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. Rudy Gustiano. konversi pakan. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi. Giri Balai Besar Riset Perikanan Budidaya Laut. dan N. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. Hasil penelitian menunjukkan bahwa laju pertumbuhan. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. pertambahan berat. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. pertumbuhan. ikan tengadak. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. KATA KUNCI: truss morfometrik. tawes .A. tengadak albino. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. dibandingkan dengan perlakuan lainnya. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A.

5 mg/L). amonia (42. Perlakuan pada penelitian ini terdiri atas dua perlakuan. Sintasan (93. amonia (20.8 mg/L).67%).58%). pemakaian insektisida perlu dilakukan secara selektif. tumbuhan air. Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya.82%).05). Typha sp.05) dibandingkan kolam ikan kontrol (82. Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air. dan nitrat (11. yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air).36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0.681mg/L) dan nitrat (0. Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi. kronis .5–14.14%–92. Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat.5 mg/L). akut.11%–44. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan. dan Scirpus sp.5%–66. KATA KUNCI: substrat. Kisaran persentase efektivitas penyisihan TN (28%– 58. karbofuran.4%) pada kolam substrat 1 (pasir.849 mg/L) dan nitrat (0. Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen. juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut.lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar. Untuk itu. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan.303–1.33%). dan nitrat (37.Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar. yaitu TN (42. Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0.86%–85. produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar. Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi. amonia (0.32 %).7–1. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan.4–0. nitrogen.3 mg/L). kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur.081–0. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat). KATA KUNCI: toksisitas.82%).5%–90. karena di samping harus efektif terhadap hama tanaman padi. khususnya ikan. amonia (0.).

000. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. dan Quadriacanthus kobiensis serta menimbulkan kematian. ginjal. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10. sedangkan preparat histopatologi diambil dari organ hati.00 mg/L. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar.00 mg/L. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. (e) garam 5. Dactylogyrus. Mycobacterium fortuitum PADA IKAN GURAME. Oleh karena itu.00 mg/L dan garam 4. Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar.000. KATA KUNCI: ekstoparasit. Ada beberapa bahan nabati dan alami yang dapat digunakan. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan. yaitu (GCGAACGGGTGAGTAACACG) dan (TGCACACAGGCCACAAGGGA). Dua pasang primer. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis. Gyrodactylus. serbuk biji teh dan garam. 39 M1: T T dan primer M2: PreT (AATGGGCGCAAGCCTGATG) dan (ACCGCTACACCAGGAAT) digunakan pada penelitian 43 531 T ini.00 mg/L. dan limpa.000. yang telah dikembangkan oleh 13 beberapa peneliti. sehingga upaya pengendaliannya sering terlambat. Trichodina.00 mg/ L. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp. (f) garam 6.00 mg/L efektif untuk memberantas Trichodina dan monogenea.00 mg/L. selanjutnya dibandingkan dengan teknik diagnosa melalui uji bio.00–20. (c) biji teh 20. Hasil penelitian . Pada riset ini. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut. (b) biji teh 15. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain– Jenssen.00–6.00 mg/L (g) kontrol. limpa. (d) garam 4. Ketujuh perlakuan itu yaitu: (a) biji teh 10.kimia dan histopatologis. Sensitivitas teknik diagnosa terhadap bakteri target. dan darah. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy).

Mycobacterium fortuitum. KATA KUNCI: mycobacteriosis.menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi. Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies. dan Polymerase Chain Reactio n . gurame.

000 unit fitase/kg pakan.45 g/ekor. masing. Hasil penelitian menunjukkan bahwa penggunaan fitase 1.73 g dengan padat tebar 15 ekor/keramba. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau.500. efisiensi pakan. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. pakan ikan beronang. B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai.500 dan 2. Cijeruk dengan bobot rata-rata 8. dan 2. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap. dan tingkat sintasan. efisiensi pakan. S. pertumbuhan.V.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti. 1. dan sintasan ikan beronang. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan. nilem. Balai Riset Perikanan Budidaya Air Tawar. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG. 1. namun nilai ini tidak berbeda nyata dengan 1. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. 500. KATA KUNCI: tepung bungkil kedelai. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan. KATA KUNCI: fitase. Parameter yang diamati yaitu laju pertumbuhan spesifik. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. rasio efisiensi protein.05). substitusi. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra.15±5.05) terhadap pertumbuhan. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan.000. Bogor. guttatu s . tepung bungkil kopra. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22.000 unit/kg pakan. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah.60±0.masing diulang tiga kali dan di desain dengan rancangan acak lengkap.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang. C.

KATA KUNCI: budidaya bandeng.2 mm dan bobot 0. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M. Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan. tambak. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5.). Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. 50% ikan rucah + 50% pelet. sintasan . Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap. Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak. Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak.526. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. 100% ikan rucah jenis ikan tembang (Clupea sp. lebar karapas dan sintasan (P>0. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur).05) dengan perlakuan yang lain.850. 100% pakan buatan/pelet dan C.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus). bobot dan sintasan serta kualitas air. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm.2 ± 0.04 ± 0. Maros selama 40 Hari. KATA KUNCI: pakan rucah. pertumbuhan. rajungan. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot. B. Tjaronge Balai Riset Perikanan Budidaya Air Payau. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut.Variabel yang diamati adalah pertumbuhan lebar karapas. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif.02 g.-/tahun/ha. pelet. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis.

816%.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara.0 cm dan bobot rata-rata 0.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari.masing perlakuan adalah 15. Selama pemeliharaan. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2.5 ton/ha. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh.5 x 0.5 m dan tinggi air 40 cm. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2.-. Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10. Oleh karena itu. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia.625% dan 60. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. 55.43.5 cm dan panjang tertinggi sebesar 3. 70. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B).5 cm (ukuran ekspor). masing-masing dengan dosis 2. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional.100. dan 105 dan dianalisis secara deskriptif. Sintasan bandeng pada perlakuan A dan B. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B).5 x 0. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. Pada akhir penelitian (hari ke 105).0 cm. Nina Meilisza. B/C rasio 1. 20.98 g/ekor menjadi 232. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut. KATA KUNCI: pupuk organik. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. ampas tahu. masing-masing mencapai 56. Erfan Andi Hendradjat.6 cm . ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Padat penebaran bandeng pada masing. 35. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.467.009 gram. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran. Produksi bandeng pada perlakuan A dan B. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. bandeng. pupuk kandang dan dedak. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. masing-masing mencapai 986.9 dan 1154 kg/ha.

KATA KUNCI: benih botia. pertumbuhan panjang.5 cm) . ukuran ekspor 1 inchi (2.dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.

.98 ± 0. namun tidak berbeda nyata (P>0.01 g dan panjang total rata-rata 3. Jakarta *) ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua.09 g dan pertambahan panjang total ratarata sebesar 0.00 dengan metode pemberian sekenyangnya (adlibitum). dengan pertambahan bobot rata-rata sebesar 0.8 (sebagai kontrol). gonad. Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali. KATA KUNCI: air Melanotaenia sp.0.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp. (A) Chironomus sp.32 ± 0.00 dan 16.Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP.0-8. dan Culex sp.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor.50 ± 0. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp. ikan diberi perlakuan pemberian pakan alami yang berbeda.0 – 6. Gigih Setia Wibawa*).) Eni Kusrini*). memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp.9 dan pH 7. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula. pH pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur. Rendy Ginanjar. Depok **) Pusat Riset Perikanan Budidaya.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. Agus Priyadi*).00. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya.. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar.. 12.05) . Depok. Hasil penelitian menunjukkan bahwa perlakuan pH 7. Pakan diberikan tiga kali sehari yaitu pada pukul 8. memberikan pengaruh yang berbeda nyata (P<0. Selama 45 hari pemeliharaan.0 – 8. pH 6.24 cm.05) terhadap pertambahan bobot rata-rata ikan. dan Irsyaphiani Insan**) Balai Riset Budidaya Ikan Hias.5 – 5. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya.85 ± 0. Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal. dan (C) Tubifex sp. (B) Culex sp. Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5.

pakan alami. sintasan . pendederan. KATA KUNCI: Benih ikan pelangi. pertumbuhan.terhadap rata-rata pertambahan panjang total dan sintasannya.

07%. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara. Depok **) Universitas Diponegoro. Ikan uji yang digunakan adalah benih berukuran panjang 2. dan Jacques Slembrouck**) . Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. pertumbuhan.05) terhadap pertumbuhan. tetapi berpengaruh nyata (p<0. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi.13±0. padat tebar.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*). B. Prancis *) ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. 35 ekor/liter. 96. 25 ekor/liter. C.45%.02 cm dengan bobot 0. Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan. 95. Sintasan dari masing-masing perlakuan adalah sebagai berikut: A. Balai Riset Budidaya Ikan Hias Depok. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. resirkulasi. Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). 96. 15 ekor/liter. Lili Sholichah*). Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. Marendra Gladiyakti**) *) Balai Riset Budidaya Ikan Hias. Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi. B (2 ekor/L). 96. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. Indonesia **) Institute Recherche Pour Le Developpement.02 g.81%.22% dan E. D. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap. D. C. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia.67%. Pakan yang diberikan selama penelitian adalah nauplii artemia.67 mm. 30 ekor/liter dan E.22±0. KATA KUNCI: Metynnis hypsauchen. Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. Rendy Ginanjar*) Asep Permana*). . 20 ekor/liter. 97. ketersediaan pakan dan padat penebaran. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). B. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L).

KATA KUNCI: ikan botia. padat tebar . sintasan.

Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. KATA KUNCI: Phenotipic plasticity. ketersediaan pakan dan pemasaran. lunar. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. sedangkan factor eksternal yaitu. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. dan homing atau reproduksi. Unit produksi maggot memiliki prasyaratan sebagai berikut.) . KATA KUNCI: maggot. makanan. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. kolam budidaya dan manajement budidaya yang baik. salinitas dan arus. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. propinsi Jambi. memiliki mesin pelet. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. Kawasan Mina Pakan Mandiri. area penjemuran atau alat pengeringan pakan (drying). air tersedia dalam jumah yang cukup. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. 2) unit pengolahan pakan dan 3) unit budidaya. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. fisiologi dan tingkah laku dalam merespon perubahan lingkungan. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. temperature. biokonversi. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. Ikan Sidat (Anguilla sp. bahan pakan seperti vitamin dan dedak. memiliki bak untuk restokin. Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. memiliki bak kultur. Ikan migrasi. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). Unit budidaya ikan memiliki prasyarat sebagai berikut. Unit pengolah pakan memiliki prasyarat sebagai berikut. Migrasi terbagi menjadi migrasi vertical dan horizontal.

Aktivitas reduksi nitrat terjadi dari awal inkubasi.28 mM. terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&).236 – 0. Didik Ariyanto. Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST.Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Oreochromis niloticus . NIRWANA (nila ras wanayasa). Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Iman Rusmana**). Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan.560).16 mM. untuk mengamati variasi genetik benih persilangan ikan nila. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*). Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi. juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut.mossambicus).h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. nila merah (Red NIFI).h-1 dan 0. Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. nila BEST (Bogor Enhancement Strain of Tilapia). Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik. mossambicus) Nunuk Listiyowati. dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Jarak genetik 15 populasi persilangan berkisar (0.mossambicus). Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM.15%). Hasil dari persentase polimorfik (berkisar 5. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA.26% – 63. Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. Sukamandi. Ikan yang di gunakan adalah hasil persilangan 4 strain.17 mM. Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD). dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. Kata kunci: Randomly Amplified Polymorphic DNA (RAPD). Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O.40 mM dan 0. tetapi yang menghasilkan benih hanya 15 populasi. Persilangan. Selain itu. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan . Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi. jarak genetik. mujair (O.

dengan Pseudomonas aeruginosa. Kata kunci: denitrifikasi. nitrogen anorganik. reduksi nitrat .

ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma. Isdy Sulistyo2). distibusi.8%. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral.09% menjadi 4. Sukamandi **) Universitas Jenderal Soedirman. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.74% menjadi 5. bungkil sawit. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. menurunkan lemak bungkil sawit dari 14. Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. Osphronemus goramy. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi. kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. rasio inti sel:sitoplasma yang besar.) Priadi Setyawan1).. 6 hari (D3).37% dan meningkatkan kadar protein dari 13. sebagai bahan baku pakan ikan patin. fermentasi.37% setelah proses fermentasi. Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. KATA KUNCI: PGC. Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). PGC terdistribusi secara berkelompok di bagian ventral. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. nutrisi dan serat kasar . migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. Pada tahap pembentukan mata.91% menjadi 15. 4 hari (D2). Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC. KATA KUNCI: Bacillus sp. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia.

anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). di antaranya daerah Bogor dan Subang. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. dkk. Depok ABSTRAK Ikan patin (Pangasius sp. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi. Jakarta **) Pusat Riset Perikanan Budidaya. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP. Wartono Hadie**). dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. Lusiastuti***). 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. dan kluster pemeliharaan larva dan benih. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil . Perbedaan dari kedua sistem ini adalah sifat produksinya. Eni Kusrini****). Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. dan Labuan (Merak).. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. demikian juga ditinjau dari segi higienis dan kesehatan benih. Tipe integrasi bersifat soliter. pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. dengan masing-masing hatchery terpisah lokasinya. kluster penetasan telur. Jakarta ***) . dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. KATA KUNCI: UPR. integrasi. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor. patin. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*).1994). Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. salah satunya melalui Catfish Club Indonesia. Pengambilan data melalui responden dilakukan dengan cara purposive sampling. Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat.Balai Riset Perikanan Budidaya Air Tawar. Bogor ****) Balai Riset Budidaya Ikan Hias. Angela M. Subang.

sex reversal. sebagai materi kegiatan tahun mendatang. jantan fungsional. kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. KATA KUNCI: ikan nilem.persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. betina homogamet .

pH. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. salinitas. memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut. Anang H K. KATA KUNCI: seleksi generasi.2 gram. Diketahui estimasi nilai heritabilitas rata-rata h²( + ) = 0. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva.57 % dalam satu generasi. pertumbuhan. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. KATA KUNCI: sintasan. larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. sintasan dan kualitas air (meliputi suhu. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). amonia. 10 butir/liter (perlakuan H). 15 butir/ liter perlakuan (I).37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar. M H Fariddudin A. dan nitrit). Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia. Agus Priyono.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva). oksigen terlarut/DO. kepadatan. intensitas cahaya. ikan mas strain rajadanu .27 pada ukuran konsumsi S D dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431.1.

Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik. KATA KUNCI: antibakteri. Hambali Supriyadi. penanggulangan. Klaten.Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. penyakit streptococcosis . karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. dan Lila Gardenia Pusat Riset Perikanan Budidaya. Survei dilakukan di beberapa daerah yaitu Cianjur. bakteri probiotik.dan Tasikmalaya. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus). eksplorasi.

Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. Untuk menjamin keberlangsungan usaha budidaya kerang hijau. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Provinsi Banten. Secara umum. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. di perairan Panimbang Kabupaten Pandeglang. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). KATA KUNCI: kerang hijau. Hatim Albasri.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. budidaya laut. Pandeglang . Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. Kabupaten Pandeglang. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. Erlania. Kabupaten Pandeglang. SIG. Teluk Lada. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan.

BBAP Samas-Yogya(Jateng).Wartono Hadie*).Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. Jateng. tingkat kesembuhan. BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). BBUG Klungkung.. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset. kelompok kedua adalah penghasil benih. Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan. manajemen. dan Spiranura sp. Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. induk. Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol. Imron**). KATA KUNCI: udang.. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya.) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Zoopthalmium sp. dan kelompok ketiga ialah pembudidaya. . Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. kelompok kedua adalah penghasil benih. padahal permintaan cukup besar. dan Jatim. Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP SamasYogyakarta. Parameter yang diamati meliputi pemeriksaan parasit. Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas. serta UPR yang mengembangkan usaha perbenihan udang galah. Carchecium sp. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76. dan kelompok ketiga ialah pembudidaya. Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*).. Ikhsan Khasani**). Bali. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP.). dan Opercularia plikatilis. Vorticella sp. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya. sedangkan dari kelompok protozoa adalah Epistylis sp. tingkat sintasan. kelompok kedua adalah BBU Pamarican (Jabar). Bali. Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro..Bali. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp.. Retna Utami**).42%.UPU Probolinggo (Jatim). dan diferensial hemosit.Forum Inovasi Teknologi Akuakultur 2010 pK 01 1.

).KATA KUNCI: huna (Cherax sp. tembakau (Tobacum nikotiana) .

yaitu pertambahan berat rata-rata 230 g. Karawang. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. Penelitian ini dilakukan pada tambak di daerah Betok Mati. pengapuran dan pemupukan.2 %. Kecamatan Cilebar. Dengan teknologi yang diterapkan.8 kg dan kelangsungan hidup 100 %. produksi . Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. salinitas rendah. Sebelum penebaran. namun berbeda tidak nyata (P>0. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. pemberantasan hama.000 kg/ha rumput laut. dan Wartono Hadie Pusat Riset Perikanan Budidaya. Dari pemeliharaan udang selama tiga bulan.84 kg/ha. kemudian dikeringkan sekitar satu minggu. survival rate. yaitu menggunakan tingkat teknologi tradisional plus.500 m2 digunakan untuk percobaan. dilakukan pengolahan tanah tambak. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. produksi 81. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3.6 kg/ha. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2. masing-masing dengan dua ulangan. pengeringan. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54. Gracilaria verrucosa. penebaran dilakukan setelah satu bulan dari penebaran tokolan. pada bulan pertama udang tidak diberi pakan. Setelah dua hari.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35.n pengapuran sebanyak 175 kg/petak. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Idil Ardi. Pemeliharaan dilakukan selama tiga bulan. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. KATA KUNCI: udang windu. sedangkan pada dua bulan berikutnya diberi pakan pellet udang.66% dan 108. Hewan uji yang digunakan adalah udang vaname PL-48. tokolan.5 g. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. Empat petak tambak masing-masing berukuran 3.22% dan 72. KATA KUNCI: vaname. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak.1 kg dan kelangsungan hidup 11. namun polikultur udang vaname dan rumput laut masih kurang informasinya. polikultur. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. produksi 78.

penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). dan metabolit udang. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. dan Rotatoria. dan perlakuan D = tanpa sumber karbohidrat. pola intensif. pola tradisional. menggunakan bak kayu ukuran 1 m x 1 m x 0. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. Pada budidaya udang windu intensif. dan Cyanophyceae. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. Dinophyceae. Hal tersebut perlu mendapat dukungan dari penelitian.05) terhadap kelimpahan dan jumlah jenis plankton. pelakuan B = sagu. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. KATA KUNCI: tepung tapioka. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. 25. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. Pada budidaya udang vaname pola tradisional plus.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. indeks keseragaman menunjukkan komunitas plankton pada . kotoran.6 m sebanyak 12 buah. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. masing-masing dengan 3 ulangan. perlakuan C = tapioka. Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Polychaeta.3 g dengan padat tebar 50 ekor/bak. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk.

KATA KUNCI: plankton. udang windu . probiotik. indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil.perlakuan D relatif lebih merata dibanding perlakuan lainnya.

Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. serta Oscillatoria dari kelas Cyanophyceae. suhu. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing- . setiap 15 hari. NO . Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang. dan perlakuan C = dedak padi halus.05) terhadap pertumbuhan udang vaname. C = 4 mg/L. Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. dan indeks dominasi plankton selama pemeliharaan udang windu. Abdul Malik Tangko. pertumbuhan. dan Pleurosigma dari Kelas Bacillariophyceae. Nitzschia. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea. Hasil penelitian menunjukkan perlakuan berpengaruh tidak 4 2 3 nyata (P>0.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: probiotik. indeks keragaman. sintasan. sintasan. BOT. B = 2 mg/L. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. oksigen terlarut.000 ekor/petak). Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0.05) pada sintasan dan produksi udang vaname. perlakuan B = kotoran sapi.05) terhadap jmlah jenis dan kelimpahan plankton. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik.5 m dengan volume air 400 L. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. indeks keseragaman. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname. dan produksi udang vaname. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. NO . Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. PO . Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0. namun berpengaruh tidak nyata (P>0. pH. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan.

362). udang windu. indeks keseragaman (0. KATA KUNCI: dinamika plankton. tambak .689–0.427).324– 0.masing: indeks keragaman (1.780) dan indeks dominansi (0.199–1. pupuk organik.

Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0. budidaya. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A). dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau. Penelitian dilaksanakan pada tambak ukuran luas 4. Perlakuan yang diujicobakan dalam penelitian ini adalah A. Substrak tanah sawah. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak. biaya produksi. Substrak tanah lumpur.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2. dan C. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak. KATA KUNCI: substrak. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka.. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau.8±0. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru. Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan.634. substrak tanah sawah. biaya pakan pada perlakuan A dan B masing-masing Rp 11. Substrak tanah tambak.984.sedangkan pada perlakuan A dan B masing-masing 2.14 dan 2. di mana masing-masing perlakuan diulang tiga kali. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan.03±0. dan substak tanah lumpur. B. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak). KATA KUNCI: efisiensi.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak.0±5. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L.239. Machluddin Amin.24.01 g. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1.. masing-masing dengan dua ulangan.3±1. umur pemeliharaan.05) antara perlakuan substrak tanah tambak. udang windu .5 dan 21. udang pama..2 cm dan bobot awal 0.650.6. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda.875.dan Rp 19.

Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan.28-13. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20.64 kg/bak atau rata-rata 11.975 dan lebih .7%. kisaran produksi 12. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan.86 g/ekor. di mulai setelah satu minggu penebaran.767. Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar.masing bak mempunyai ukuran panjang. Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan.15%. Maros. lebih tinggi daripada perlakuan B = 41.2 kg/500 m2 = 506 kg/ha. 1. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang. masing. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.5 m dan 1 m. dengan rata-rata berat 11. lebar dan kedalaman secara berurutan adalah 10 m.1 ± 13. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali. pertumbuhan udang. KATA KUNCI: tepung tapioka. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C).7% dan perlakuan C = 36.235 kg/ha). Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah.7%. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25.92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90. namun tidak berakibat terjadi kematian massal. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2. kisaran produksi 9. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2.45 kg/bak atau rata-rata 12.2 ± 13.7 kg/500 m2 = 320 kg/ha.6813. B).Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau.66 kg/bak (7.66 g/ekor. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A. Namun demikian.998. dengan rata-rata berat 12. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau.86 kg/bak (8.3 ± 7. fermentasi probiotik. ukuran 84 sampai dengan 89 ekor/kg) dan C (16.4 ± 0. ukuran 80 sampai dengan 96 ekor/kg). Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B).0 ± 2.6 kg/500 m2 = 406 kg/ha.3 ± 5.61%.

rendah dibandingkan perlakuan B yang mencapai 1.325. KATA KUNCI: molase. salinitas rendah . udang vaname.

Pemberian probiotik B dengan konsentrasi 5.001 mL/L. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab. Rhodococcus sp. Pemberian probiotik B dengan konsentrasi 7. terdiri atas: O. Pemberian probiotik A dengan konsentrasi 0. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji.001 mL/L menghasilkan sintasan sebesar 81. udang galah. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan. dan Rhodobacter sp.25%.003 mL/L. Kontrol (tanpa pemberian probiotik A). P. Nitrobacter sp. Kontrol (tanpa pemberian probiotik B). Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang. Aplikasi probiotik setiap tiga hari sekali. C.0 mg/L. 5 ‰.6±0.. sedangkan juvenil dan udang dewasa hidup diperairan tawar. Parameter yang diukur adalah kualitas air. sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. Penelitian II pengujian probiotik B. Pemberian probiotik A memberikan pengaruh terhadap rata-rata .57 hari . Pemberian probiotik A dengan konsentrasi 0. 1995). Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah.75%.50%.0 hari. 85%. sintasan.25%. Pemberian bakteri probiotik A (Bacillus sp. Penelitian I adalah pengujian probiotik A. waktu inkubasi. dan R. Universitas Padjadjaran. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter).). Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL). Q. terdiri atas: A. laterosporus.75%–68. Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata.002 mL/L.. sebelum diaplikasikan di tambak. dan 0‰ sebesar 11. 85%.5 mg/L. sebagai dasar perbaikan sistem penyediaan larva udang galah. KATA KUNCI: salinitas. Masing-masing perlakuan diulang sebanyak empat kali. diikuti perlakuan 5‰ sebesar 10±0. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6. B. karena secara alamiah larva hidup di periran bersalinitas. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62. Dengan meneliti dua jenis probiotik. Pengaruh perlakuan terhadap sintasan. dan kontrol 66. Pemberian bakteri dengan konsentrasi 0.) berpengaruh nyata terhadap sintasan benih udang windu. dan D.. Pemberian probiotik A dengan konsentrasi 0. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F.Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.) dan probiotik B (mengandung bakteri Bacillus polimyxa. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol). 10 ‰.3±1. Nitrosomonas sp. Pemberian probiotik B dengan konsentrasi 2. B. Tingkat sintasan yang diberi probiotik B berkisar antara 63.) yang berukuran PL-20.15..5 mg/L. yaitu probiotik A (mengandung bakteri Bacillus sp. dan pertumbuhan udang. dan tiga ulangan. 88%.

KATA KUNCI: probiotik. kualitas air. udang windu.4440 g dan kontrol 0.001 mL/L menghasilkan pertumbuhan tertinggi (0.8935 g). pemberian dengan konsentrasi 0. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata.4255–0. pertumbuhan . Ratarata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0.3660 g. sintasan.pertumbuhan mutlak benih udang windu.

salinitas. dan ukuran templat. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH. 10 ppt (kontrol). Hasil yang diperoleh adalah pada salinitas 5 ppt. Sukamandi. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. sedangkan sintasan pada perlakuan 25 ppt mencapai 61. Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten.09 cm. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau.33±0. udang galah . populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. KATA KUNCI: pertumbuhan. 10 ppt. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi. yaitu templat dengan berat molekul tinggi (1). RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten. 15 ppt.05). Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor.92±0. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. Ditinjau dari keragaan pertumbuhan.67%. Selain itu. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD.13 cm dan 1. 20 ppt. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. 25 ppt. konsentrasi. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. diantaranya karakteristik templat DNA genom yang meliputi kemurnian. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3). Guna mendukung prgoram revitalisasi tambak. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. 15 ppt. dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. PCR. KATA KUNCI: Macrobrachium rosenbergii. dan 20 ppt sintasan dari post larva udang galah mencapai 100%. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional.

Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. panjang. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. Pakan diberikan dua kali sehari selama penelitian. dan gabungan keduanya (C). Oleh karena itu. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL).66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan. maupun lebar karapas (P>0. ikan rucah (B). Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. manipulasi lingkungan. KATA KUNCI: pergantian kulit. Dari pencapaian bobot ini.05). kepiting lunak .Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. KATA KUNCI: kepiting bakau. perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet. pemberian pakan. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen.5%. kepiting bakau. baik pertumbuhan bobot. Sintasan yang diperoleh pada penelitian ini yakni 52%–54. Sulaeman. Berdasarkan persentase. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau.

dan produksi serta parameter kualitas air. Dibalik manfaat mangrove yang demikian banyaknya.04 ha.2 mm dan 0.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya. sehingga perlu riset budidaya rajungan pada musim kemarau.2 ± 2. Peubah yang diamati adalah pertumbuhan lebar karapas. Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan. sintasan. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa.300 pohon/ha dengan rata-rata 1. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.2 g. data yang diperoleh dibahas secara deskriptif.100 pohon/ha. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi.02 g dengan kepadatan 1 ind. Tambak yang digunakan berukuran 10. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan.5 bulan dengan panjang dan bobot masing-masing adalah 8. KATA KUNCI: kerapatan hutan mangrove. Hasnawi.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Ikan bandeng yang digunakan adalah gelondongan umur 1. tambak bersalinitas tinggi.0 ± 2.000–1. rumput laut dengan kepadatan 1. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰— 4 9‰) mengakibatkan sintasan dan produksi rendah./m2. bobot. pertumbuhan. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi.000 m2. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau.7 cm dan 4. perlindungan. sintasan. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau.1±0. Tambak ditebari benih rajungan. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari). dan pelestarian alam. KATA KUNCI: rajungan. produksi . restoking kepiting bakau.05±0.573. jumlah permudaan 450–500 pohon/ ha.000 ekor/ha ukuran crablet-30. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009.

Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. Untuk memfokuskan kegiatan budidaya rumput laut. SIG. Secara umum. Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. bioakumulasi. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. kondisi perairan sangat mendukung pengembangan budidaya rumput laut.03 mg/L. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. Kappaphycus alvarezii. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Anjang Bangun Prasetio. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. I Nyoman Radiarta. Adang Saputra. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0. rumput laut. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. cukup layak dan tidak layak. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. Provinsi Gorontalo. KATA KUNCI: Danau Maninjau. KATA KUNCI: minapolitan. Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). logam berat . Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. layak. Secara umum.

kimia. alga hijau biru dan alga hijau). dan Sudewi Balai Besar Riset Perikanan Budidaya Laut. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. Supii. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. dan Erlania*) *) Pusat Riset Perikanan Budidaya. outlet. Nitzschia sigma. Dara Kasih**). Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air. KATA KUNCI: kualitas air. Indeks keanekaragaman berkisar antara H’=2.853. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. BBRPBL Gondol .814-0. indeks keseragaman berkisar antara E=0. Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan. N. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. tambak.0760. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. nitrit. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. Sampling air secara regular untuk pengamatan fisika. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT.085.7112.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. TSS.962. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet. 20 dan 30. Perifiton yang terdapat di Tambak Blanakan. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. sedangkan indeks dominansi berkisar antara D=0. Adi Hanafi. Subang. KATA KUNCI: alga perifiton. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. Kualitas kimia air untuk pH. DO. inlet. dan plankton dilakukan seminggu sekali. SUBANG Joni Haryadi*). Subang. GONDOL-BALI Apri I. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan.

23%–6. P. dan 1. limbah hara N dan P . kelimpahan.90.78%).53%–15. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal. serta produksi Moina sp.83– 1. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP.16 g. 1. Data dianalisis secara deskriptif.89%–17. ikan nila. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP .73–1. Bogor.dengan produksi Moina sp. dan 3). Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin. Kusdiarti. yang terdiri atas: 9 jenis pakan untuk ikan mas.87. dilakukan pada hari ke-8 sejak dilakukannya penebaran. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp.96 ±1. Perlakuan adalah pemupukan dengan perbandingan N. 9. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp. 1. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan. Ani Widiyati. Panen Moina sp. ikan nila (3. volume air 500 L.63% dan 10. 2). Pengukuran N dan P dilakukan pada ikan dan pakan. akuaponik..17% dan 8. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas.89. dan bawal adalah 1. indek dominasi. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP.89% dan 11. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio).88–1.53%) dan ikan bawal (8.48%–9.21%). KATA KUNCI: limbah.) di laboratorium.58%–13.71%– 10. K = 16:20:0. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi. yaitu: ikan mas (5. KATA KUNCI: konversi pakan. nila (Oreochromis niloticus) dan bawal (Colossoma sp. Parameter yang diamati adalah jenis. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan.900 g sedimen + 20 g TSP. dan keanekaragaman plankton. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan.

N17O (4). pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani PongMasak Balai Riset Perikanan Budidaya Air Payau.6 juta ton per tahun sekarang ini menjadi 7. dan NK1 (5) yang berasal dari organ otak. Bogor **) Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. Isolat 1. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S. Produksi rumput laut ditargetkan meningkat dari 2. Esti Handayani Hardi**). agalactiae. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S. Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. sehingga dapat meminimasi kegagalan panen. khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. Postulat Koch. Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur.6 juta ton per tahun pada 2014. Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. N14G (3). Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. Sukenda***). Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. . Budidaya rumput laut khususnya Kappaphycus sp. Oreochromis niloticus. di laut dan Gracillaria sp. KATA KUNCI: Streptococcus agalactiae. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. mata. namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. Hasil yang diperoleh. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*).1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. 4. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). agalactiae setelah dilakukan uji Postulat Koch. N4M (2). sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. Oleh karena itu.

penyakit.KATA KUNCI: rumput laut. hama. pencegahan .

Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir. dan Makmur Balai Riset Perikanan Buddidaya Air Payau. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden.32 ha. Kabupaten Kepulauan Selayar.685 mg/L. Syarifuddin Tonnek.01169 mg/L. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis. salinitas 36.3 meter. demikian pula dengan karakteristik físika dan kimia oseanografinya. oksigen terlarut 5.30 ha dan tidak sesuai 3.90 ppt. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. suhu 29. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar.1113 mg/L. kurang sesuai 2. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau.039–0.57°C–30.0008–0. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya. karakteristik. .695.610. KATA KUNCI: potensi. kesesuaian rumput laut. analisis hierarki proses.09 mg/L. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27.95 ha.0032–0. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka. Kata kunci : Opsi pemanfaatan wilayah pesisir. pH antara 6. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009. Rachman Syah.095. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian.37. besi 0. Penelitian ini bertujuan untuk mengetahui potensi. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang.820. Pengumpulan data primer dilakukan dengan cara wawancara mendalam. kedalaman 1–40 meter. dengan tingkat kesesuaian lahan sesuai 21. nitrit <0. KARAKTERISTIK. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1.33 ha.1–8. Mudian Paena. bahan organik total 37. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka.10– 36.66°C.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder.85 mg/L. dan total suspensi <25–80 mg/L.81–6.0037 mg/L.0267–0. Petrus Rani Pong-Masak. fosfat 0. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir.02–9.38–44.Indra Jaya Asaad. nitrat 0. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari.

KATA KUNCI: keramba jaring apung. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. analisis faktor. faktor teknologi budidaya. Rachman Syah. konduktivitas. pH.Indra Jaya Asaad. Parameter kualitas perairan yang diamati adalah suhu. salinitas. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. yaitu : faktor infrastruktur dan kondisi perairan. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. NO3. NO2. Utoyo. tambak. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. Kata kunci : kualitas perairan. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. PO4 dan Fe. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan.Indra Jaya Asaad. Makmur. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. NH3. Cakupan wilayah penelitian meliputi Teluk Hurun. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. kandungan oksigen telarut. dan faktor pasar. A. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. Muhammad Chaidir Undu.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. Kabupaten Pontianak . Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor.

Jakarta **) Pusat Riset Perikanan Budidaya. bau.44%. mikrobiologi (Angka Lempeng Total/ALT. analisis fisika-kimia .0%. Kelompok kedua ditebar di atas lantai dengan beralaskan waring. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempahrempah kasar dan halus (ekstrak). abu. abu. Rumput laut coklat setelah dipanen. kadar abu. Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. viskositas 8. dan dijemur di bawah sinar matahari selama 18 jam. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. dan protein masing-masing sebesar 14.04 mgN% dan 6. KATA KUNCI: pengeringan. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15.1%. rendemen. kimiawi (kadar air.4%. Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik. TVB. rumput laut coklat. dan viskositas natrium alginat).663 cps. Rumput laut coklat dibagi menjadi dua kelompok. dan tekstur) menggunakan skala hedonik. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai.41%.0%. natrium alginat. dan 28. dan pH). dan dijemur di bawah sinar matahari selama 18 jam.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk. terbuka di atas lantai pada suhu ruang (sekitar 30°C).32%. kapang) dan rendemen. 28. Selanjutnya. kemudian direndam dalam larutan KOH 0. KATA KUNCI: ikan sidat. lemak.1% selama 60 menit. 7. dicuci dengan air bersih. Sedangkan nilai TVB dan pH masing-masing sebesar 21. protein lemak. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat.26%. dendeng. rasa. dan mutu natrium alginatnya mempunyai kadar air 19. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Rendemen dendeng sidat dengan bumbu kasar sebesar 57.46%. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air. kadar abu 19. Kadar air. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla).97%. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna.25% dan dendeng dengan bumbu ekstrak sebesar 59. dan rendemennya 37. setiap kelompok dikumpulkan dan dibagi menjadi dua bagian.

Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. Faktor pendorong yaitu ketersediaan air yang melimpah. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. polusi air. KATA KUNCI: potensi desa. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi. Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. kelembagaan yang menunjang. agribisnis perikanan . prasarana fisik yang kurang mendukung. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. serta ketersediannya dalam skala kecil. harga ikan yang tergantung pembeli dan cuaca. kekurangan modal. Metode yang digunakan adalah studi kasus. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). pengalaman petani ikan dan Kebijakan Pemerintah. Identifikasi faktor-faktor pendorong maupun faktorfaktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya.