Forum Inovasi Teknologi Akuakultur 2010

ABSTRAK PRESENTASI ORAL

Forum Inovasi Teknologi Akuakultur 2010

FF 01
PERFORMA IKAN NILA BEST DALAM MEDIA SALINITAS
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: =2,1±0,23; W = 7,0±0.29; = 139,8±6.72; 7,5ppt = 2,3±0.06; 0ppt 0ppt 0ppt L B L W7,5ppt = 8,2 ± 0,42;7,5ppt = 164.3 ± 8,46; 5ppt = 2.3 ± 0,21; 15ppt 7.8 ± 0,45; B = 155,6 ± 8,95. Pengamatan setelah W B L1 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-5 : 4,0±0,34; 3: 4,8±0,27; 5- : 7,4±0,35; 5: 9,2±0,98. 5 15ppt8 0ppt8 15pptPengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
0ppt 15ppt

KATA KUNCI:

nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
PENGUJIAN LANGSUNG EMPAT STRAIN IKAN NILA (Oreochromis niloticus) PADA SALINITAS 40‰
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen ) dengan 8 ulangan dari masing-masing strain. Analisa 50 (LT data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise

Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata 50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru LT (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT
50

dan OPC-15. cereviceae sebesar 2% KATA KUNCI: Saccaromyces cereviceae. dengan menggunakan primer OPA-03. ikan nila. lokal Kuningan. A (penambahan S. Sebagai perlakuan 0 adalah A (tanpa penambagan S. Bogor ABSTRAK Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD). KATA KUNCI: RAPD. Gesit. cereviceae sebagai perlakuan dan lima kali ulangan.1952 dan jarak genetik antar populasi 0. cereviceae 3%).3333%–46.0351–0. genetik. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13.6667%. dan A (penambahan S. Nirwana. fermentasi.1765– 0. cereviceae 2%).) DENGAN ANALISA SIDIK RAGAM RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD) Iskandariah. nila merah FF 04 ANALISIS KERAGAMAN GENETIK LIMA POPULASI NILA HITAM (Oreochromis sp. OPC-14. Oreochromis . OPA-04. pakan buatan. cereviceae). Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. Pertumbuhan terbaik diperoleh pada penambahan S. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai.5797. populasi. Populasi yang diamati meliputi jenis nila BEST. cereviceae 1%). dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. Universitas Padjadjaran ABSTRAK Penelitian ditujukan untuk menentukan persentase terbaik dari S. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. dengan nilai heterozigositas 0.Forum Inovasi Teknologi Akuakultur 2010 FF 03 PENGGUNAAN Saccharomyces Cereviceae PADA FERMENTASI PAKAN BUATAN UNTUK MENINGKATKAN PERTUMBUHAN NILA MERAH (Oreochromis Niloticus) Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. 1 2 3 Hasil penelitian menunjukkan penggunaan S. A (penambahan S. Otong Zenal Arifin. dan lokal Bogor.

Sukamandi **) Dept. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. genotipe. Pada uji tantang setelah minggu keenam. pengukuran bobot individu rata-rata dan penghitungan sintasan. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7.81% dan 83. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. Pada akhir pendederan dilakukan identifikasi jenis kelamin. Kata kunci : Ikan nila. ikan uji disuntik dengan PBS. diferensiasi kelamin. Data sintasan (Survival Rate. agalactiae. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). Budidaya Perairan.1 mL/ekor. Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. DAN YY Didik Ariyanto*). Untuk kontrol. titer antibodi. agalactiae secara intra peritoneal pada ikan uji sebanyak 0. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. Tetapi setelah uji tantang.01%. XY. Pada perkembangannya. 106. dan differensial leukosit dilakukan analisa sidik ragam (Anova). ikan nila . Fakultas Perikanan dan Ilmu Kelautan. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Oreochromis niloticus Angela Mariana Lusiastuti*). genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. titer antibodinya menurun. agalactiae. XY. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. tidak cukup untuk memberikan protektif terhadap S. S. 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. agalactiae pada tingkat kepadatan 108. 106. Uni Purwaningsih*). Selain ditentukan secara genotipe. dan YY melalui evaluasi nisbah kelamin yang dihasilkan. Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. Hasil yang diperoleh bahwa sel utuh (whole cell) S. limfosit perlakuan tidak berbeda nyata dengan kontrol. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. SR). Genotipe XX mencirikan betina dan XY untuk jantan. Komar Sumantadinata**). Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan.Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. Perlakuan dengan injeksi sel utuh S. yaitu genotype XX. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: vaksin sel utuh.55% sedangkan genotipe XY dan YY masing-masing sebesar 79.

Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. serta data status kegiatan 3 2 3 budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. TDS. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. pemanasan. NO .5). di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. pH. D=102 cfu/mL dan E=kontrol). NO . Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. BOD. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. kecerahan. C=104. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. Selain itu. Pemberian pakan tidak boleh berlebihan. DO. NH . melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. KATA KUNCI: Streptococcus agalictiae. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. adalah septikemia dan meningoencephalitis. turbiditas. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). dan Joni Haryadi Pusat Riset Perikanan Budidaya. total nitrogen. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. Selain itu. Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini.5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. B=106. terutama dalam hal manajemen pemberian pakan. Anjang Bangun Prasetio. karena pada kondisi perairan yang kurang . dengan variasi perbedaan kepadatan bakteri vaksin (A=108. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. Angela Mariana Lusiastuti. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. ortofosfat dan total fosfat. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan.

baik akan menyebabkan stres pada ikan. Danau Maninjau. lingkungan perairan . KATA KUNCI: manajemen pakan. keramba jaring apung (KJA).

sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2. lebar (0.80%.44%).94%).06%). Sukamandi **) Dept.87%) dan sintasan (0. SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2.20%.65%). tebal (0. dan sintasan(1. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.21%).Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*). bobot ( -2. KATA KUNCI: heterosis. Komar Sumantadinata**). tebal (-1. persilangan. oreochromis niloticus .05) bila dibandingkan dengan dua populasi lainya. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia).82%). Nunuk Listiyowati.74%).22%). IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi. Budidaya Perairan. tinggi. Sukamandi selama lima bulan. sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74. tinggi (3.48%). Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.53 % bt/hari. tebal. Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4.35% bt/hari. Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (2.64% bobot badan (bt)/hari. Parameter yang diamati meliputi keragaan pertumbuhan (panjang. bobot (-2. tidak berbeda nyata (P<0.48% bt/hari dan 2. bobot) dan sintasan. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat. Fakultas Perikanan dan Ilmu Kelautan.

agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar.1295).81±0. agalactiae (N4M) memiliki nilai terkecil. dan 96 jam.8090) dan benih ikan nila 5. dan 96 jam terhadap benih ikan mas adalah 4.5805).13 dan 1. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1. dan nilai terbesar dimiliki oleh bakteri S. 48. 0. 50 LD iniae (N2O). N17O.55±0.9823–4. 48. dan 96 jam.0430 (4.1100). dan sonikasi.0930).9421 mg/L (1.08 g. Konfirmasi taksonomis hingga level spesies isolat bakteri S. 50 KATA KUNCI: toksisitas. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran. Data diolah dengan analisis probit program LC50. Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration ) 24. pemanasan. 48. 72. benih ikan. . 1.5094 (2. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN. 2.6904– 5.7504). agalactiae (N3M. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila. Bogor. Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan. 72. SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin. Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan.8532).0678 (1. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S.4227– 4.7877–2.8101–1. Hasil penelitian menunjukan bahwa Nilai LC 24. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak.7138 mg/L (0.6799–13. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. 0. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah. N4M. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). 3. Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp. Penelitian dilakukan di Instalasi 50 (LC Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung.6297–0. Hasil penapisan menunjukkan bahwa bakteri S. N14G.3354 (3. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis.6578–2. 3.0839(2.5480). iniae (N2O).9237(0. uji stabilitas dan LC50–24. NK1) dan 1 isolat S.

vaksin. ikan nila .KATA KUNCI: penapisan. streptococciasis.

Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan. sarung tangan. kambing dan ikan pari yaitu berisi. kadar air 13. Telur yang ada dalam kolektor dapat diambil jam 07. kadar lemak 6. kadar abu 2.184. simetris.0 g. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa . Nusa Tenggara Timur. dompet.53 N/cm atau 138. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi. garmen. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. untuk dijadikan kulit tersamak. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya. kekuatan regang (kemuluran) 66. tas. kekuatan jahit 1. kambing. Dalam pembesaran. yang merupakan limbah perikanan dari perusahaan filet ikan. dan cacing.66%. kakap putih. dan 15% .5 g. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g.62%.354. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20. Ikan ini mudah terserang parasit seperti cryptocarion. dan corak permukaannya spesifik.00 pagi hari. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih.94%. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia. suhu kerut 88°C. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak.masing mencapai ukuran 127. dan 80 ekor/m3 selama 5 bulan masing. liat.0–3. dan sebagainya. namun sintasannya masih rendah yaitu sekitar 1%–3%.00 sampai jam 03. Ikan ini relatif sensitif dengan perubahan lingkungan.93% dan kadar Cr O 1. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu. Sulawesi. karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih.46 N/ cm2 atau 222. Waktu pemijahannya sekitar jam 24. 10%. dan Sumatera. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. dan 102. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi).76 kg/cm2.12 kg/cm. benedinia. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. lemas.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi. kekuatan tarik 2. Selain itu.2 g. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. 40. Pembenihan ikan ini mulai berkembang di sekitar Gondol.00. KATA KUNCI: bahan penyamak kron.00–08.5 kg. 103.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan.97% sehingga sangat prospektif untuk 2 3 dijadikan barang-barang kerajinan kulit. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek.

KATA KUNCI: pembenihan.Tenggara Barat. pembesaran. kerapu sunu .

Situbondo **) Fakultas Perikanan dan Kelautan. M. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. Sasmito Jati****). Komar Sumantadinata***). KATA KUNCI: transfeksi. Namun demikian. jumlah kejutan 5.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. Metode elektroporasi dilakukan dengan voltase 50 V. jarak waktu antar kejutan 0. Alimuddin***). dan Gemi Triastutik*) *) Balai Budidaya Air Payau. dan 3 detik. mikroinjeksi. 2. ikan kerapu tikus . dan 20 µg/ mL. Rustidja**). elektroporasi. Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. transfer gen. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. di antaranya Indonesia. 10 µg/mL. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. Ratu Siti Aliah*****). Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL.1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. mikroinjeksi. hormon pertumbuhan. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. mikroinjeksi. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. Cromileptes altivelis Slamet Subyakto*). lama kejut 30 ms. Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. Irvan Faizal*****).

39±0. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus). Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva. KATA KUNCI: benih kerapu sunu. B (oksigen). pertumbuhan panjang larva. Pemberian pakan dilakukan tiga kali sehari. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal.02%) serta nisbah konversi pakan (1.95 mm). efisiensi pakan. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3. laju pertumbuhan spesifik.68 g) dan panjang total (6.000 ekor/bak. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0. serta terakhir perlakuan D (47.35 mm). laju pertumbuhan harian.35 cm). rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU. dan efisiensi pakan pada benih kerapu sunu. Sampling dilakukan setiap minggu. C (probiotik). D (kontrol). Kendala yang dihadapi terutama terjadi pada stadia awal. dan perlakuan B (63. Salah satu faktor yang berperan adalah lingkungan pemeliharaan.20-4. Nilai pertambahan panjang tertinggi A (72. yaitu 5%.20 cm. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan.69 mm). 10%. optimasi pakan. Namun. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. oksigen .31±0. selanjutnya perlakuan C (64. KATA KUNCI: larva kerapu sunu.19%) dan panjang total spesifik (1.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut.90±0. Peubah yang diamati adalah sintasan. Pakan yang digunakan adalah pakan pelet komersial. Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan.50-0.42±0.19±0. nisbah konversi pakan. probiotik.69 g dan panjang total awal 3.25) dan efisiensi pakan (80. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan. dan 15% dari total biomassa benih. dan kualitas air.73%) dan panjang total (9. laju pertumbuhan bobot badan harian (10.86 mm).19%) harian serta laju pertumbuhan bobot badan spesifik (6. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen).00%) yang baik bagi benih kerapu sunu. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut. pertumbuhan.52±0. Materi yang digunakan adalah larva kerapu sunu sebanyak 4. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan.

namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian. imunstimulan.57 mm.62%.08 ± 2. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster.55 mm dan C: 26. indeks fagositik sebesar 1.87 cm dan sintasan setelah diuji tantang sebesar 72.96 mg./mL dan mulai umur 17 hari diberikan nauplii Artemia. aktivitas lisosim sebesar 1. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6. KATA KUNCI: Epinephelus fuscoguttatus. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut. Anak Agung Ketut Alit. perlakuan B adalah 6. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0. B: 24.50%. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari.68 mm.1 ± 2. Perlakuan B: 4 kali/hari pada umur 7-20 hari. Bejo Slamet.00%. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari.12 mg dan C: 211. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting.5 ± 2.08 ± 1.62 ± 2.87.95 mg.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN.0x105 sell/mL. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan.spesifik ikan kerapu macan. B: 196. Des Roza.04 ± 0. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari. serta bobot badan pada perlakuan A: 192.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19. Mulai larva umur 2 hari diberikan Nannochloropsis sp. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang. dengan kepadatan 1. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari. Epinephelus fuscoguttatus Irwan Setyadi. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN. infeksi.5 ± 4.81 ± 0. kerapu macan . Perlakuan A dan B tidak berbeda nyata. Masing-masing perlakuan diulang 3 kali. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny.65%. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. KATA KUNCI: pakan buatan. sedangkan kontrol hanya disuntik dengan PBS.20 ± 0. mencapai ukuran panjang total pada perlakuan A: 24. larva kerapu macan. Perlakuan C: 5 kali/hari pada umur 7-20 hari. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun non. Gondol ABSTRAK Ikan kerapu macan. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind. terutama infeksi virus.03% dan perlakuan C adalah 8.

dengan sintasan 6. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir. yang kurang baik. konsentrat yang bisa dibeli di pasaran. konsentrat mempunyai sintasan 19. pada bak A : ikan rucah + cumi-cumi + vitamin. kerapu bebek (Cromileptes altivelis). plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. perkembangan oosit . Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. Setiap bulan dilakukan pengamatan pertumbuhan bobot. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya.10% dan panjang total 21. dan dilihat perkembangan oositnya. Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. pembenihan. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk.72% dan panjang total 18. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. KATA KUNCI: kerapu bebek (Humpback grouper). masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu. Sampai dengan bulan Oktober telah berhasil memijah. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah. panjang.86 mm. dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. generasi kedua (F-2). pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari. Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: efisiensi. sedangkan pada bak B : pakan pelet kering.

Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D15). pemeliharaan dilakukan hingga yuwana (2 bulan). 5. 7. 15.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. mutu benih kerapu. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin. Sampel larva diambil pada umur 1. Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. Cromileptes altivelis Yasmina Nirmala Asih. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. Tetapi tingkat sintasan yang didapatkan masih rendah.8%-41. 13.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. 10. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. 25. KATA KUNCI: pemeliharaan larva. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. produksi massal . Ketut Mahardika. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. 4. Selain itu. manajemen air media pemeliharaan dan manajemen pakan. histologi. 2. Tangki pemeliharaan yang digunakan ukuran 8-10 m3. 3. KATA KUNCI: kerapu bebek.masing sebanyak 10-20 ekor. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor. 17. Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. 20. Indah Mastuti. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). dan 32 hari setelah menetas masing. organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut.

Tingkat kematian larva dapat mencapai 40%–80%. Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. 5%. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. Oleh karena itu. pertambahan bobot. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). Pakan diberikan 2 kali secara “adlibitum”. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih.651 ekor benih untuk setiap induknya. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. catfish seed. survival rate. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17.Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. dan siklus kedua menggunakan larva dengan kekebalan bawaan. di lain pihak hasil tangkapan cenderung menurun. Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. dan 20% dalam pakan. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. perlu alternatif lain sebagai substitusi tepung ikan.797–457. dan ketiga menggunakan larva tanpa kekebalan bawaan. KATA KUNCI: innate immunity. Pangasius hypophthalmus . laju pertumbuhan spesifik. 15%. Sumber protein utama pada pakan adalah tepung ikan. tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. Salah satu sumber protein alternatif adalah protein sel tunggal (PST). dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. 15% (P>0. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. Lies Emmawati*). Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. Ketut Suwirya. Kematian larva umumnya terjadi pada hari keempat. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). Oleh karena itu. KATA KUNCI: protein sel tunggal. 10%. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR). Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. I Nyoman Adiasmara Giri.05). Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. 10%. (pakan kontrol). siklus pertama. Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia.4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. Hasil penelitian menunjukkan bahwa nilai bobot akhir. Pakan penelitian berupa pelet kering dengan kandungan PST 0%. akibat serangan penyakit dan kondisi media.

ikan patin. Kecernaan protein juga meningkat akibat penambahan enzim fitase.764±3.763±0.07 cm).75±0. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm. C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati.0%).49 cm). Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3.25±0. dan A (98.223±0. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰.3%).00%). D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase). Kecernaan P pakan B (98.93%) dan terendah salinitas 3‰ (25. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan. Ade Dwi Sasanti. diikuti salinitas 2‰ (28.1%) berbeda nyata lebih tinggi dibanding pakan D (97. dan salinitas 1‰ (3. kemudian salinitas 3‰ (4.140±0. benih.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN.46% per hari.010±0. dan sintasan .5 g/ekor. Pangasius hypopthalmus Mohamad Amin.92 cm).1%). pakan A (82. yang dilanjutkan dengan uji Tukey. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. Pangasius djambal. Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan.32% per hari menjadi 4. Data diperoleh dianalisis sidik ragam.884±2. KATA KUNCI: fitase . Kecernaan protein tertinggi berturut-turut pakan C (82.204±0.674±2. Ikan patin sebayak 15 ekor.114±0. Analisis data dilakukan secara deskriptif. Dade Jubaedah.14%). pakan B (82. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal. Ikan uji yang digunakan berukuran 2 ± 0.1%) dan pakan E (95.3%) dan pakan D (80. pakan C (98. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan. sedangkan laju pertumbuhan panjang harian meningkat dari 1.4%) berbeda nyata lebih tinggi dibanding pakan E (68.13% per hari. Parameter yang diamati adalah laju pertumbuhan panjang badan. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin. dan (C) 3‰ dengan tiga kali ulangan. Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter. selama 30 hari. KATA KUNCI: salinitas.4%). kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak). sintasan serta beberapa parameter kualitas air. Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4. (B) 2‰.35±0.910±0.8%). dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor.2%). Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32.17% per hari menjadi 1. Pakan diberikan 3 kali sehari secara at satiation.

Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masingmasing perlakuan: A. namun perlakuan B (7 ekor/m2) . dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g).60±10.42±0. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan. Pemupukan.7% rendahnya sintasan ini diduga karena adanya faktor hama. Sularto. B (660 g). Padat tebar larva yang digunakan adalah 100 ekor/m2. Pupuk anorganik + organik. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk. Larva yang ditebar berumur 20 jam setelah menetas. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2).7. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. Patin Siam.19±0. dan sintasan Kata kunci: Intensifikasi.5). Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. 0. yaitu antara 13. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan ikan.08 g dan 3. sepat. udang liar) serta jenis serangga air. dan C (613.49±1.12 g dan 3. sintasan ikan. predator yaitu antara lain: Ikan liar (gabus. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam.37 cm C 16. Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11. nila. Pemberian pakan dengan pelet apung sebanyak 5% per hari.5%-9. pemijahan. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. Jika luas gambut Indonesia adalah 20 juta ha. B. B (7 ekor/m2).31 cm B. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia.526. belut. Pupuk anorganik + organik yang difermentasi + Probiotik. Akmal. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. betok. dan Syafrudin Balai Budidaya Air Tawar. penetasan telur dan pemeliharaan larva di kolam. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam.74±0.9%). dan C (95. 0.5 juta ha (rata-rata 20 juta ha). pengecekan induk. Pupuk anorganik + organik + probiotik dan C. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. komposisi pakan alami kolam.27±0.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari.51 g dan 11.3 g) dan SR perlakuan A (91. dan C (10 ekor/m2) dengan 3 kali ulangan. B (95.26 cm.2%). Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut.

2%. ikan patin. KATA KUNCI: budidaya. lahan marjinal .memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95.

salinitas.46 g).09 cm dan 1. KATA KUNCI: patin pasupati. di samping itu.54 g dan panjang awal antara 10. JAWA TENGAH Ongko Praseno*). Jakarta **) Balai Riset Perikanan Bididaya Air Tawar. Evi Tahapari***). Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8.43–11. Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.52%) dan terendah pada 20 ekor/m2 (91. sedangkan petakan kedua ditebar sebanyak 2. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt.36 cm. dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3.06%) dan terendah pada kepadatan 20 ekor/m2 (7. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%.76%).17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3.70–20.000 ekor atau kepadatan 10 ekor/m2.000 ekor atau kepadatan 5 ekor/m2.60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97.30%). Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1.76 cm dan 2. diikuti dengan kepadatan 10 ekor/m2 (92. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.45 g).74 g) dan 20 ekor/m2 (61. 15 ekor/m2 (70. pertumbuhan. Kata kunci: padat tebar.18) dan terendah pada 10 ekor/m2 (1. Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3. Percobaan dilakukan selama 100 hari pemeliharaan. Padat tebar yang digunakan adalah 5. pertumbuhan.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES. Zafril Imran Azwar**). FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2.47 g). Evi Tahapari.5 m.10%/hari. Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. nasutus . Sifat biologi pertumbuhannya belum banyak diketahui. Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. dan Sularto***) *) Pusat Riset Perikanan Budidaya.71). Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih. 10. pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari. 15 dan 20 ekor/m2 dengan bobot awal antara 15. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99.80%. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda.

55 ± 0. benih. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan. Perlakuan kedua adalah padat tebar: 5 ekor/L.002 mg/L (4. (B) 0. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. dan 15 ekor/L. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*). 108. 107. 109. dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya. dan pertumbuhan .003 mg/L dengan tiga kali ulangan.14 cm).003 mg/L (4.67%). Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. sebagai perlakuan yaitu: (A) 0. dan kontrol (placebo). Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air. Kata kunci: uji tantang Aeromonas hydrophila. Evi Tahapari*). Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. Probiotik diberikan dengan dosis yang berbeda. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal. Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0. Angela Mariana Lusiana**). Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. Uji tantang dilakukan dengan dua cara.67%). Pengamatan dilakukan selama 15 hari setelah perlakuan. kemudian perlakuan dosis 0.60 ± 0.35 cm). Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109. Jakarta **) Balai Besar Riset Perikanan Budidaya Laut. 108. dan kontrol. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.35 ± 0. Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air. Ikan uji yang digunakan berukuran 1–2 inci.003 mg/L (81.49 cm). 106. kemudian dosis 0.002 mg/ L. 10 ekor/L. Nurbakti Listyanto*). Parameter yang diamati adalah insidensi dan sintasannya. Bogor ***) Pusat Riset Perikanan Budidaya. sintasan.001 mg/L (86.001 mg/L (4. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sukamandi. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*). Ikan uji yang digunakan berukuran 3–4 inci. intraperitonial. dan (C) 0.002 mg/L (83.001 mg/L. perendaman. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar. diikuti dosis 0. KATA KUNCI: probiotik. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0. Analisis data dilakukan secara deskriptif. yaitu: cara perendaman dan cara penyuntikan intraperitonial. dosis.33%) dan terendah perlakuan dosis 0.

larva. ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu. rearing. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. substitusi protein 4. Zafril Imran Azwar. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. Perkembangan oosit patin nasutus bersifat sinkronis grup. Bambang Iswanto. yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm. 75% ampas tahu:25% tapioka. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar.000 µm.16%–79.04% (pakan D). Derajat penetasan patin nasutus berkisar 44. dan 25% ampas tahu:75% tapioka. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. yakni pengamatan perkembangan gonad dan fertilisasi.700 µm. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologireproduksi berkaitan dengan kapasitas produksinya. KATA KUNCI oosit.850 µm.700– 4. hatching. substitusi protein 0% (kontrol) (pakan A). Ukuran panjang total larva yang baru menetas berkisar 3. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus.250–1. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger. dan tahap 5 (atresis) dengan diameter oosit 300–1.52% (pakan B). Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. Aspergillus niger. artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai. tahap 3 (granula kuning telur) dengan diameter oosit 700–1.900 µm.05% dengan lama inkubasi 22–25 jam. dan substitusi protein 6. substitusi protein 2. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium.41±0. tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu.03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar. ampas tahu. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. Penelitin ini terdiri atas dua tahap.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11.130–22.58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4. Ke dalam wadah ditebar ikan patin ukuran 11. 50% ampas tahu:50% tapioka. Pangasius nasutus .03% (pakan C). Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. KATA KUNCI: fermentasi.

24) x 103.45 g/ekor.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER.43b. 88. 2. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.42.20. B. 0. dengan kantung kuning telur berukuran 0.67%. 75. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa. 91.71±0. C. berukuran panjang total 3.69 cm/ekor diikuti B.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin. diikuti perlakuan C. B. 75% zeolit + 25% bioball.35 cm/ekor dan A. 2. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi. 100% zeolit B.01±0. 50% zeolit + 50% bioball dan D. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER.25 g/ekor. C.98±0.02 g/ekor. berukuran panjang total 3.56 cm/ekor. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi. 25% zeolit + 75% bioball. KATA KUNCI: patin albino. masing-masing perlakuan diulang sebanyak empat kali. 95.42±0. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih. 88. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi.20 mm.60 cm/ekor. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus. 79. C. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D.27a.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias. biofilter. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian.10–1. dengan kantung kuning telur berukuran 0. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D. diikuti perlakuan B. 1. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var. 4. C. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1.1±0.33%.14 mm. 1. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat. dan D.62 g) dan panjang (2. 89. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi.1. 1. dan D. 0.31ab.30ab.08 mm3 yang terserap 50% pada umur 30 jam . Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A. 0.13 mm.58%.34±0. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE. 4.54 cm). C. pertumbuhan.64±0. B.47±0.84 g/ekor dan terendah A. 92.75% dan terendah perlakuan A. 1.6±0.89±0.03±0. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya.01±0.30a.

sedangkan patin hibrida siam-jambal sebesar -4.23%. Kata kunci: embriogenesis. tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus.28%. hibrida. jambal. larva. siam. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa.dan habis terserap pada umur 60 jam. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20. nasutus .

dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. lama pemeliharaan ikan bandeng. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein . Jika bioflok terbentuk. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. padat penebaran udang windu. Akhmad Mustafa. ikan bandeng. Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2.0% untuk protein dan 81. Eddy Supriyono**).2% untuk bahan kering. dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. 88.990 kg/ha/musim dengan rata-rata 292. KATA KUNCI: pengelolaan. Hasil penelitian menunjukkan bahwa. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak. lama ikan bandeng digelondongkan. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. Neltje Nobertine Palinggi*). Oleh karena itu. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. Dedi Jusadi**). penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. Oleh karena itu.2%–78.2 kg/ha/musim. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur. Maros **) Fakultas Perikanan dan Ilmu Kelautan. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok).6%–90.6%–83.1% untuk Corganik. tambak. Pakan tersebut digiling ulang. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. Enang Harris**). Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar. lalu ditambahkan kromium oksida (Cr O ) sebagai indikator kecernaan. produksi. Untuk menentukan 2 3 total limbah N termasuk eksresi amonia. 21% dan 26%.

76 g N untuk pakan berprotein 21%. KATA KUNCI: feed digestibility. diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%. Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok).pakan yaitu 2. 2.28% untuk pakan berprotein 26%.27 g N untuk pakan berprotein 17%. milk fish. dan 3. N waste. heterotrof bakteria .

(B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL. kendala. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. Penambahan inokulasi bakteri komersial (Bacillus sp. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). Penyusun utama bioflok ini adalah bakteri heterotrof. bandeng.250 ton. Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475. Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. Dedi Jusadi**). Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri.54% per tahun kurun waktu tahun 2005–2009.organik. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470.726 ha dan yang layak untuk budidaya sekitar 6. dan Pekalongan. Khususnya di wilayah Pantai Utara yaitu Kendal. KATA KUNCI: Heterotrofic bakteria. Oleh karena itu. PATI. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: budidaya. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L. opsi kebijakan . Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%.66% dari tahun-tahun sebelumnya.975 ha. DAN PEKALONGAN ) Anjang Bangun Prasetio. growing. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol. Enang Harris**). penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. Hatim Albasri. Pati.000 ton dan mengalami kenaikan sebesar 14. (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). Eddy Supriyono**). Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya.000 ton dan mengalami kenaikan rata-rata 13. Molase digunakan sebagai sumber C. Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari.) cenderung meningkatkan kandungan asam amino bioflok. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia. dan Rasidi Pusat Riset Perikanan Budidaya. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng. Pada tahun yang sama.

sedangkan DP dihitung ketika semua telur telah menetas.34%) dan DP (63. Alimuddin**). Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi.66±1.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel. DKHe dihitung sebelum telur menetas. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi. FMIPA. Konstruksi gen dalam bentuk plasmid mBA-gfp.67%). Fakultas Perikanan dan Ilmu Kelautan.0%). Gusrina*). Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20.GFP.3±0.0±10. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. ikan lele .65%) dan heat shock-GFP (18. keratin. HEAT SHOCK DAN KERATIN PADA IKAN LELE. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi. mikroinjeksi. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi.00±3. Hasil penelitian menunjukkan bahwa DKH-e (63. dan heat shock-GFP berturutturut adalah 20.33±3. menyusul heat shock-GFP (10. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0. Data dianalisis secara deskriptif. Clarias sp.33%. Komar Sumantadinata**).Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN.34±1.63±10. dan 15. KATA KUNCI: promoter.03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi. dan Utut Widyastuti***). Ekspresi gen gfp tidak tampak lagi pada saat telur menetas. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp.0±0. keratin-GFP (21.****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan. 18. DKH-e yang diinjeksi dengan â-aktin-GFP (25. sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik.00±1.0%) dan yang terendah â-aktin-GFP (3.65%.33±1. Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji.0%). GFP. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA). Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur.67%.66%) relatif sama.00±1. DP untuk â-aktin-GFP. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan.

Kandungan bahan aktif hasil pengekstrasian pegagan segar. 1. hydrophila menjadi penyakit endemis di Indonesia. Taukhid. pakan tenggelam. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo.23% kadar abu tak larut asam. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5.623. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%. 0.47±4.33% kadar sari dalam air. 39. Ikan lele dumbo berukuran 41.25% sehingga tidak berbeda nyata dengan pakan terapung.74±1. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif). 6. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani. Bak diisi air sebanyak 100 liter. KATA KUNCi: A. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus). nilai kecernaan pakan tenggelam meningkat secara nyata (P<0.34% kadar air. 5.. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi.37% kadar abu. KATA KUNCI: kecernaan pakan. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam.05) dari 79. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus). Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. Pemberian pakan sebesar 5% dari biomassa per harinya. Feces yang dihasilkan diambil setiap hari. pakan terapung . Rita Febrianti.53%) (P<0. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A. pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. hydrophila. Melalui penambahan aerasi. ikan lele dumbo (Clarias gariepinus). Pada perlakuan tanpa aerasi.39% kadar asiaticosid.05). aerasi. Angela Mariana Lusiastuti. bahan aktif.47±4.53% menjadi 92.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB. pagi dan sore.83% kadar sari dalam alkohol. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan.41 mg/L) dengan dosis efektif 250 mg/L.30±2. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna. 24. pegagan Centella asiatical [L] Urb.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak.15%) dibandingkan dengan pakan tenggelam (yakni 79.71±2.

Forum Inovasi Teknologi Akuakultur 2010

FF 45
PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus)
Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar

ABSTRAK
Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. Wadah percobaan yang digunakan adalah bak beton ukuran 1,0 m x 1,0 m x 0,8 m, dan dirancang sistem resirkulasi. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9,33±0,10 g sebanyak 40 ekor. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol); 7,92%; 13,28%; 19,56%; dan 25,81% dalam formulasi pakan. Setiap perlakuan dengan 3 ulangan. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar, tapioka, dan molase. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11,96%, dan penurunan lemak 61,85%, dari perlakuan kontrol. Laju pertumbuhan spesifik, penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7,90%, namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25,83% tidak memperlihat perbedaan dengan perlakuan kontrol.
KATA KUNCI: maggot, fermentasi, formulasi, lele dumbo

FF 46
ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA
Tutik Kadarini, Siti Subandiyah, Sulasy Rohmi, dan Darti Satyani Balai Riset Budidaya Ikan Hias

ABSTRAK
Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2,3–3,1 cm. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0, 10, 20, dan 30 g/40 liter masing- masing diulang 3 kali. Jenis pakan berupa cacing tubifex, bloodworm, dan cuk yang diberikan diselang-seling secara adlibitum. Parameter yang diamati sintasan dan pertumbuhan (bobot, panjang, dan perkembangan gonad), kualitas air (suhu, pH, amonia, alkalinitas, oksigen, dan karbondioksida). Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3,8–4,7 cm mencapai TKG III.
KATA KUNCI: gurame coklat, reproduksi, ikan, dan gonad

Forum Inovasi Teknologi Akuakultur 2010

FF 47
APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC.) DI JAWA
Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi, Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman, yaitu seperti daun talas. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa, yaitu di Jawa timur (Blitar dan Tukung Agung), Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Dari hasil penelitian menunjukkan bahwa di daerah Blitar, Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan, penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat, sehingga petani tidak mengalami banyak kerugian.
KATA KUNCI: fish TB, Mycobacteriosis, Mycobacterium fortuitum, biokimia, PCR

FF 48
PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI
Bambang Gunadi, Lamanto, dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Ikan gurame termasuk ikan dengan fekunditas rendah. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang, produksi telur per sarang, dan tingkat fertilitas telur yang dihasilkan. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang), dan injuk sebagai bahan pembuat sarang. Induk gurami yang digunakan berbobot 2-3 kg/ekor, dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. Pakan yang diberikan berupa daun sente sebanyak 3,5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. Perlakuan yang diterapkan adalah kadar protein 38%, 33%, dan 14% sesuai dengan label pada kemasan masing-masing. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. Masing-masing perlakuan mempunyai 2 ulangan. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0,09). Pemberian pakan tambahan dengan kadar protein 38%, 33%, dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10.351 butir, 4.546 butir dan 2.730 butir. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2.774 butir per sarang. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92,23% dibandingkan dengan pemberian pakan dengan kadar protein 33%, 14% dan kontrol yakni masing-masing 79,05%, 28,86%, dan 71,94% (P=0,26). Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0,75 buah, lebih rendah dibandingkan dengan yang

diberikan pakan tambahan berkadar protein 33%, yakni 0,88 buah, namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0,13 buah) dan hanya daun sente (0,5 buah).
KATA KUNCI: ikan gurame, pakan buatan, daun sente, keragaan reproduksi

retensi lemak. dan selanjutnya polar dan dedak padi. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. retensi protein. yang menunjukkan terbentuknya plasmid rekombinan. dan pada Silver carp sebesar 1123 bp. Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar. dengan padat penebaran ikan uji 30 ekor per akuarium. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. Kandungan protein dedak padi naik 19. Kadar protein polar naik 38. oligosporus yaitu 2. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp. polar. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Retensi protein dedak padi fermentasi. Wadah percobaan yang digunakan yaitu akuarium volume 100 L. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. dengan ditandai tumbuhnya koloni transforman berwarna putih. 4. Reza Samsudin.05) dengan dedak padi tanpa fermentasi. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ – GATGAAACTCGAGTAGCCCTTGCTCTTC. dedak padi fermentasi. Parameter yang diuji meliputi bobot akhir rata-rata.33%. dan polar fermentasi berbeda nyata (P<0. mud carp sebesar 1127 bp.3’).3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan . Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. pertambahan bobot relatif. Bogor dan terdiri atas dua tahap. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi.47 g/ekor. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar. dan polar fermentasi. dan 6 hari. Retensi lemak tertinggi (35. dan koloni berwarna biru tidak mengandung DNA sisipan. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama.02% sedangkan kandungan lemaknya turun 13. polar.14% dan kadar lemaknya turun sebesar 19. dan sintasan. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan.28%. protein efisiensi rasio. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5.

fermentasi.berbeda nyata (P<0. dedak padi. ikan mas . Sintasan ikan uji berkisar antara 96. oligosphorus.67%–100%. dedak polar.05) dengan perlakuan lainnya. KATA KUNCI: R.

Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. wildan. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. dan ikan mas galur majalaya sebesar 0. sintasan. Penelitian telah dilaksanakan dari bulan Nopember 2009 —Pebruari 2010. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. sawah. Achmad Sudradjat.41 g/hari. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. karena akhir.64 kali lebih banyak dengan ukuran panen 1. serta keramba jaring apung di danau maupun waduk. dan parameter kualitas air yang lain dianalisis secara deskriptif. kemudian ikan mas galur kuningan sebesar 1. Provinsi Banten. ukuran panen. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan. Di mana satu di antaranya di desain sebagai kolam akuaponik. Kabupaten Tangerang.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan. akuaponik. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. tambak . Ongko Praseno. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. Sedangkan sintasan. Sutrisno*). Pertambahan berat rata-rata ikan mas strain wildan mencapai 1. pertumbuhan.akhir ini banyak lahan yang tidak digunakan (marginal). Lilis Sofiarsih*). Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. Benih ikan mas ukuran 18.25 kali lebih besar dibanding pada kolam konvensional. dengan lokasi penelitian di Desa Kronjo. Data setiap sampling dijadikan ulangan.28 g/ ekor yang digunakan sebagai hewan uji. ukuran panen. dengan padat tebar 20 ekor/m3. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. KATA KUNCI: ikan mas. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. Parameter yang diuji adalah kualitas air terutama kandungan ammonia. sedangkan yang lainnya sebagai kolam konvensional.15 g/hari. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. salinitas rendah.86 g/hari. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. KATA KUNCI: ammonia.

serta mempunyai respons yang baik terhadap pakan buatan. Siti Zuhriyyah Musthofa. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. lasted time feeding . Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal. Siti Zuhriyyah. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Masing-masing perlakuan diulang 3 kali.58 cm dan 17. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat.067mg) serta kelangsungan hidup (12. cobia larvae. Hasil penelitian menunjukkan bahwa pertumbuhan panjang. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari.42%. dapat dikembangkan di bak terkontrol maupun di KJA. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. Afifah. KATA KUNCI: survival rate. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian.07%) relatif lebih tinggi dari pada perlakuan B dan C. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik. (B) umur 10 hari dan (C) umur 15 hari. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. fry performance. KATA KUNCI: artemia nauplii. kemudian diberikan sebagai pakan larva. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi.

komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera. budidaya. Herno Minjoyo*). Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. Lucky Marzuki Nasution*). Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam. Lebih dari 100 spesies. KATA KUNCI: cobia. KATA KUNCI: ikan hias. sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. plasma nutfah . Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. Stakeholder. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan.Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*).

Depok ABSTRAK Deformity (dysmorphism. dan yang terendah Moina. Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias. virus). diam dan kepalanya menyembul tepat di bawah permukaan badan air. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. kondisi daya dukung lingkungan yang terus menurun. infeksi penyakit (cacing. karena belum banyak yang membudidayakannya. Tubifex sp.778 cm..586%. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias.Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*). Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. dengan 6 kali ulangan. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. pakan alami. KATA KUNCI: Synodontis nigriventris. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. granuloma. dan Tubifex sp. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. peacock bass. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. Afrika. diikuti Artemia. pertumbuhan.. KATA KUNCI: deformity. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. Deformity dapat disebabkan oleh : mutasi genetic. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. Artemia sp. dan selalu berusaha mendekati sumber oksigen (aerator). Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. Peacock bass ini akhirnya berenangnya jadi terbalik. laju pertumbuhan harian sebesar 32.226 g. Eni Kusrini*). atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. bakteri. multifocal granuloma . dan pertambahan panjang total sebesar 1.

Hasil penelitian menunjukkan. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. yaitu : astaxanthin.3 cm dan bobot 2. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai . Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. Bastiar Nur. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias.Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. KATA KUNCI: maggot. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. density. Jhon Harianto Hutapea. T2. 60 ekor/bak. zat pemicu warna. udang jembret (mysids) dan larva nyamuk. KATA KUNCI: banggai cardinal fish.Sulawesi Tengah. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. dan Ahmad Musa Balai Riset Budidaya Ikan Hias. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. 20 ekor/bak. T3. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF).50 g. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. Rainbow Papua . Hewan uji yang digunakan berukuran panjang total 5. Selama penelitian. wortel dan tepung kepala udang. induk diberi pakan berupa naupli artemia/artemia pra dewasa.87 ± 0. Variabel yang diamati meliputi.9 ± 0. 40 ekor/bak.

67%). 70. AO (aqua+oksitetrasiklin). Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium. ukuran ekspor 1 inci (2. oksitetrasiklin. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0.5 cm dan panjang tertinggi sebesar 3.33%.0 cm. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. Selama pemeliharaan. dan blitz ich) akan dilakukan melalui rancangan faktorial. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian. Pada akhir penelitian (hari ke 105). Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. I Wayan Subamia.5 m dan tinggi air 40 cm. AF (aqua+formalin). dan 105 dan dianalisis secara deskriptif. Nina Meilisza. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. Masing-masing perlakuan dilakukan dengan 3 ulangan. AB (aqua+blitz ich).5 cm (ukuran ekspor).5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza. KATA KUNCI: benih botia. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Sintasan terendah dihasilkan oleh perlakuan KB .05).67%). Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin.0 cm dan bobot rata-rata 0.009 gram. 35. namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis. Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air. KF (air kontrol+formalin). 20.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).5 x 0. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. pertumbuhan panjang. KO (air kontrol+oksitetrasiklin). Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis).05). Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari. 55.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. KO (76. sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. KF (71. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich). dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.5 x 0. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. namun tidak berbeda nyata dengan perlakuan AO (81.67%).

larva Tetraodon palembangensis . KATA KUNCI: prophylaksis. media air.sebesar 51.67% namun tidak berbeda nyata dengan perlakuan AB (55%). sintasan.

memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan. dan Bastiar Nur Balai Riset Budidaya Ikan Hias. perkembangan embrio. Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias. inkubasi telur dan perawatan larva.5 ml/kg untuk induk jantan dan 0.15%.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. sehingga produksinya masih mengandalkan impor dari luar negeri. hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur. SR (0-10 hari) 83.6°C–29. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina. antara lain sinodontis (Synodontys sp.). aligator (Lepisosteus oculatus). Asep Permana. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. pembuahan. Depok ABSTRAK Ikan palmas (Polypterus sp. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina.91%.).75 mL/kg untuk induk betina di bagian intraperitoneal. platidoras (Platydoras sp). Pemijahan tersebut terdiri atas seleksi induk.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar. namun belum banyak diketahui data embriologinya. penyuntikan hormon. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan.31% dan menghasilkan larva normal sebanyak 218 ekor. Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. tiger catfish (Platysoma sp.4°C. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. albino) masih sulit untuk memijah dalam wadah terkontrol. masa inkubasi . Asep Permana. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy. KATA KUNCI: palmas albino. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27. daya tetas telur 80.). KATA KUNCI: Neocaridina heteropoda. dan redfin shark (Ephalzeorhynchos sp. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. Ikan palmas jenis albino (Polypterus senegalus var. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol. polypterus senegalus albino.

Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka.042 pg/mL. panjang 40– 60 cm. sedang induk jantan belum ada yang mengandung sperma. matang gonad. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. Udang diberi pakan berupa moina beku sekali dalam setiap hari. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2. KATA KUNCI: induk. Pada ikan yang baru di domestikasi. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32. LHRH 100 mg dan testosteron 50 mg (B). Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm. hormon. LHRH 50 mg dan testosteron 50 mg (C). dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. KATA KUNCI: Neocaridina heteropoda. oocyt . Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi.0488–0. budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah.3–2. Kepadatan 10 ekor induk dengan bobot 65–600 g. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya). Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks.1630 g dan dua ekor induk jantan yang berukuran panjang 1. Tutik Kadarini. Rina Hirnawati. Rendy Ginanjar.9 cm dengan bobot 0.sungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana. murah dan aplikatif.7–1. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A). Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungai.1272–0. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20.0518 g. Asep Permana. dan Darti Satyani Balai Riset Budidaya Ikan Hias.5 cm dengan bobot 0. dipelihara selama 6 bulan. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor.725 pg/mL. implantasi. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata.

The concluded that the optimum dose to produce male guppy is 50 mL/L. carotenoid. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan. as the curative effort is not applicable. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. The result showed that the percentage of male guppy at 50 mL/ L is 64. guppy fish . male. The proportions test showed dose 50 mL/L have significant different to control.71%.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias. yeast (30–800 mg/kg) dan sumber lainnya. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16.07 ± 9.05 significant level. Therefore. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2.6%). chrysin. and 75 mL/L. The observation to sexual secondary characteristic guppy can be observed at least two months old. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. 50 mL/L. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias. the alternative masculinization application of natural substance like honey. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. but between treatments not significant different.000-4. KATA KUNCI: bunga tai kotok. The research was conducted experimental with completely randomized design. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control). suhu. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method. Based on LSD test. kemudian dipisahkan antara tangkai dan kelopaknya. KEYWORDS: honey. Honey is a natural substance which have crysin. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit. the treatments gave significant different with control.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. because of residual effects to human caused cancer. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp. 25 mL/L.000 mg/kg).

Forum Inovasi Teknologi Akuakultur 2010

FF 69
PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA
Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. Induk dipelihara dalam 8 buah bak berukuran 1,5 m x 1,5 m x 1,0 m dengan kepadatan 24 ekor/bak. Lama penelitian berlangsung selama 6 bulan. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&), 1:2 (B&:@&), 1:3 (B&:@&), dan 2:1(B&:@&). Pada awal percobaan, semua induk secara individu dalam keadaan TKG=O. Peubah biologis yang diamati meliputi: jumlah induk memijah, jumlah telur, diameter telur, dan daya tetas telur. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor, jumlah telur 237.865–335.837 butir/ekor, diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%, rasio (1:2) jumlah induk memijah 30 ekor, jumlah telur 129.534–393.333 butir/ekor, diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%, rasio (1:3) jumlah induk memijah 35 ekor, jumlah telur 272.837–344.975 butir/ekor, diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor, jumlah telur 227.945– 350.140 butir/ekor. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama.pada induk beronang.
KATA KUNCI: Siganus guttatus, pemijahan, jumlah telur, diameter telur, daya tetas telur

FF 70
SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG, Siganus guttatus
Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22,05±6,4 g dengan padat tebar 15 ekor/keramba. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut, B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan, masing- masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0,05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0,05) dengan rasio efisiensi proteinnya.
KATA KUNCI: tepung ikan, tepung rumput laut, substitusi, pakan ikan beronang, S. guttatus

Forum Inovasi Teknologi Akuakultur 2010

FF 71
PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH
Rusmaedi, Idil Ardi, dan Wartono Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan, yaitu menggunakan tingkat teknologi tradisional plus, memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Dengan teknologi yang diterapkan, diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Penelitian ini dilakukan pada tambak di daerah Betok Mati, Kecamatan Cilebar, Karawang, Empat petak tambak masing-masing berukuran 3.500 m2 digunakan untuk percobaan. Sebelum penebaran, dilakukan pengolahan tanah tambak,n pengapuran sebanyak 175 kg/petak, kemudian dikeringkan sekitar satu minggu. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. Setelah dua hari, pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Pemeliharaan dilakukan selama tiga bulan, pada bulan pertama udang tidak diberi pakan, sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak, penebaran dilakukan setelah satu bulan dari penebaran tokolan. Dari pemeliharaan udang selama tiga bulan, diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34,5 g, produksi 81,1 kg dan sintasan 11,2%. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3, yaitu pertambahan berat rata-rata 230 g, produksi 78,8 kg dan kelangsungan hidup 100%.
KATA KUNCI: Karawang udang windu, salinitas rendah, tokolan,

FF 72
PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT
Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1,5–50 m3 dengan rata-rata kepadatan akhir N. oculata 13,1±0,04 juta sel/mL dan rotifer 186±5.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. Pemadatan (flokulasi) N. oculata dengan NaOH dosis 75, 100, dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368, 427, dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. Tingkat total ammonium terlarut dalam air laut produksi masal N. oculata relatif tinggi (4,3–8,2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. oculata relatif rendah (3,6%) dengan rasio DHA/EPA hanya 0,2.
KATA KUNCI: pakan alami, marine chlorella, Nannochloropsis oculata, rotifer Brachionus rotundiformis, semi-continuous system

Forum Inovasi Teknologi Akuakultur 2010

FF 73
PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus)
Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi, juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). Wadah penelitian yang digunakan adalah jaring berukuran 1,0 m x 1,0 m x 2,0 m, yang ditempatkan pada keramba jaring apung di laut. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19,2 ± 0,67 cm/ ekor dan bobot 155,3 ± 10,79 g/ekor, ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%, (B) 9%, dan (C) 13%, masing- masing terdiri atas 3 ulangan. Pemberian pakan dilakukan 3 kali/hari (pukul 08.00, 11.00, dan 17.00). Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. Hasil penelitian menunjukkan bahwa kadar lemak 5%, 9%, dan 13% dalam pakan berpengaruh tidak nyata (P<0,05) terhadap pertumbuhan dan sintasan ikan beronang.
KATA KUNCI: kadar lemak, pertumbuhan, sintasan, Siganus guttatus

FF 74
ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA
Lies Emmawati Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. Jika tidak ada efek rumah kaca, suhu dipermukaan bumi akan turun secara drastis. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia. Permasalahan ini perlu dipikirkan solusinya, karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Padahal dalam upaya peningkatan produktivitas perikanan budidaya, plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global.
KATA KUNCI: pemuliaan, ikan langka, budidaya, konservasi

Kualitas air perairan yang diukur adalah: pH. (Copepoda) dan Centrocestus sp. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. mas koki. penyakit.59 ha. Akhmad Mustafa. parasit . Chiclidae. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. dan Tanjung Dapuran. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. arah arus.41 ha dan kurang sesuai 52. Sampel ikan hias antara lain dari golongan cyprinidae. Synodontis. fosfat. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. (Dinoflagelata). Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. Dari Sampel yang diperiksa 33. 98% terinfeksi parasit. dan besi.Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. kedalaman. Oleh karena itu. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. (metacercaria. cat fish. sympilum dan Characidae. nitrat. cukup sesuai 512. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. neon tetra. kapiat albino. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. dan Dactylogyrus spp. salinitas. Argulus sp. kecerahan. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. perairan Papalan. Trematoda). perairan Kalukku. Trichodina sp. KATA KUNCI: kesesuaian lahan. Red Fin Albino. dan insang. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. Pulau Kambunong.18 ha. dan Ichthyophthirius multifiliis (Ciliata). Ektoparasit yang menginfeksi ikan diamati dari organ kulit. sirip. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. keramba jaring apung. (Monogenea).18 ha yang terdiri dari sangat sesuai seluas 133. kecepatan arus. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. budidaya laut. KATA KUNCI: ikan hias air tawar. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. 2009. Pulau Bekengkeng. dan platydoras. Gyrodatylus spp.

Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. Tahapan penelitian meliputi: penentuan lokasi.8214 ton/bulan dan 1. Piretroid. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. Perairan Waduk Cirata sudah tercemar oleh parameter Zn. muara Sungai Cisokan. batas daerah bahaya. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur.88 mg/L/kg daging ikan. pencemaran. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS. sedimen (lumpur/tanah). Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. CD. pengambilan contoh. residu . Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. zona 2 Purwakarta. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. Contoh yang diambil berupa air. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. KATA KUNCI: logam berat. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. preparasi. serta debit air dari muara sungai yang masuk ke perairan waduk. badan air Sungai Citarum dan Sungai Cimeta. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. Variabel yang diamati adalah konsentrasi kandungan Pb.86 ton/bulan. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. dan Zn dalam air dan daging ikan.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. identifikasi dan analisis data serta pelaporan. Cd. Cd. pestisida. muara Sungai Citarum. KATA KUNCI: lahan perikanan budidaya. dan Karbamat.98 ton/bulan. Organofosfat. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. Cd. inlet.

dan Protozoa.71–19. (13. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik. dan 4–6 m. dikelompokan pada jenis A. dan nilai kemerataan (E) = 0.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar. Palumbon.7) dikelompokan jenis A. A.12–3.33. dan Cadas Bodas. bicolor bicolor. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias. fitoplankton. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. Copepoda. 2–4. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat. PELABUHAN RATU.marmorata dan (4. Cyanophyceae.marmorata. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. KATA KUNCI: komunitas. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa.072–0. nebulosa.31. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393. Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae.52) dikelompokan pada jenis A. Sungai Cimandiri. Ciputri.83. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton./L.35). Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi. A. KATA KUNCI: Glass eel.5 ind. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur. dan sebanyak 150 ekor disimpan dalam alkohol absolut.) DI PERAIRAN SUNGAI CIMANDIRI. Dinophyceae. selanjutnya digunakan untuk analisa genetik. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu. Bacillariophyceae.17-9. pada region mitokondria 16SRNA. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri. Sukabumi. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies. Pelabuhan Ratu. Patok Batas.75– 993.75–4887. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR.75 ind. dan Desmiceae dari zooplankton ditemukan jenis Rotifer. indeks dominansi (C) = 0. Maleber.65– 0. A. bicolor.n./L dan zooplankton berkisar antara 93.nebulosa .

Forum Inovasi Teknologi Akuakultur 2010

FF 81
POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN
Afifah*), Titiek Aslianti*), dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut, Gondol **) Mahasiswa Universitas Gadjah Mada, Jogjakarta

ABSTRAK
Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL), terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. rotifer, B. gonad kerang, dan C. kuning telur) dan 3 ulangan. Pemberian pakan awal di mulai saat larva berumur D-2—D-10, selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan, selanjutnya secara periodik 5 hari sampai dengan D-30. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan,. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10,99 mm; 27,10 g; dan 21,97%) dibanding perlakuan A (10,27 mm; 21,94 g; dan 1790%) dan C (11,01 mm; 25,20 g; dan 17,17%). Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan, namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.
KATA KUNCI: larva ikan kuwe, pakan awal, pola pemangsaan

FF 82
KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT
Mulyasari*), Dinar Tri Soelistyowati**), Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya

ABSTRAK
Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan, adalah dengan program pemuliaan. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra- dan inter-populasi ikan nilem di Jawa Barat. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin), sirip dada (pectoral fin), sirip perut (ventral fin), dan sirip anal (anal fin). Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata.
KATA KUNCI: ikan nilem, Osteochilus hasselti, meristik

Forum Inovasi Teknologi Akuakultur 2010

FF 83
EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti)
Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Pakan memegang peranan penting dalam budidaya ikan nilem. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan, Balai Riset Perikanan Budidaya Air Tawar, Bogor. Ikan uji yang digunakan adalah ikan nilem dengan bobot rata- rata 5,0±0,3 g/ekor. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%, 19%, dan 20%. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Ikan dipelihara selama 40 hari. Parameter yang diamati yaitu pertumbuhan spesifik, konversi pakan, serta sintasan ikan. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0,05) yaitu sebesar 1,56%. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0,05).
KATA KUNCI: nilem, protein, pertumbuhan, pakan

FF 84
EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI, KABUPATEN BATANG)
Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan, Jakarta

ABSTRAK
Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. Penelitian dilakukan di Kabupaten Brebes dan Batang. Metode penelitian dilakukan secara studi kasus. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Harga pakan hanya Rp 2.800,-–Rp 3.000,-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6.500,-–Rp 7.000,-/kg. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya.
KATA KUNCI: efisiensi usaha, pakan buatan, bahan baku lokal, ikan patin

Forum Inovasi Teknologi Akuakultur 2010

FF 85
PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN
Jhon Harianto Hutapea, Irwan Setiadi, Gunawan, dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg). Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2,5 m3 (diameter 2 m dan tinggi 0,8 m) dan bak fiberglass berbentuk oval volume 2,1 m3 (lebar 1,4 m dengan panjang 2,1 m dan tinggi 0,7 m. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari.
KATA KUNCI: penanganan calon induk, ikan tuna sirip kuning, sintasan

FF 86
KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON
Gleni Hasan Huwoyon, Irin Iriana Kusmini, dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. Pada beberapa jenis ikan, warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2,1±0,19; hitam: 1,7±0,20), pertumbuhan mutlak (merah: 6,8±1,02; hitam: 5,6±0,30) dan laju pertumbuhan spesifik (merah: 0,65±0,06; hitam: 0,57±0,02).
KATA KUNCI: warna, tengadak, Barbonymus schwanenfeldii, genetika

5% molasses + 0.02% khamir laut.01). Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu. Setelah kering.5% molasses + 0. E = Daun mengkudu + 2. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu.05). Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau.5% molasses + 0. pupuk . protein kasar. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2. R = Daun 3 mengkudu + 2. Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator. daun mengkudu. lemak kasar.00% khamir laut.04% khamir laut.5% molasses + 0. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan. urea.08% khamir laut. dan energi di antara perlakuan berbeda nyata (P<0.06% khamir laut. BETN. dan TSP.5% molasses + 0. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. dan abu di antara perlakuan tidak berbeda nyata (P>0. B = Daun mengkudu + 2. R4 = Daun mengkudu + 2. Setelah 5 hari dipanen. Jepara. serat kasar. KATA KUNCI: khamir laut. bahan kering.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan. gula. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia).05). Hasil penelitian menunjukkan bahwa: pH. silase. Berdasarkan hasil penelitian.

28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59. MY1112 bulan II.977. Pada akhir penelitian diperoleh sintasan 63.000.000 ekor/ha. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu. Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I. udang windu. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. KATA KUNCI: udang windu. Erfan Andi Hendradjat.-/musim tanam dengan B/C rasio 2. petak I ditebari bandeng (10.000 ind/ha) dan petak II. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal. KABUPATEN TAKALAR Muharijadi Atmomarsono./ha) dan petak II : bandeng (3. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen.48 kg/ha. tambak marjinal .5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar.000 ekor/ha) dan rumput laut (1 ton/ha). Sulawesi Selatan.000 ekor/ha).46% dengan produksi udang windu sebesar 249. serta manajemen pakan dan air secara benar. ditebari bandeng (10. bandeng (3. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I.1 ton/ha/16 mg menjadi 1. BL542 bulan III.07.000 ekor/ha) dan rumput laut (1 ton/ha). dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.73% dengan produksi sebesar 217. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara. CBIB. Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram. rumput laut. Perlakuan B. di mana termasuk cara budidaya udang. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram.000 ekor/ha). rumput laut (2 ton/ha) dan tiram (40.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA. Brata Pantjara.000 ind. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10. penggunaan sarana produksi yang ramah lingkungan. KATA KUNCI: biofilter. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik. rumput laut (2 ton/ha) dan tiram (20.

(tanpa probiotik dengan dosis pakan 50%) dengan ulangan masingmasing 3 kali dan lama pemeliharaan 10 minggu. Penelitian dilaksanakan selama 90 hari. menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%.05% dan 298. NO2. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. Hasil penelitian menunjukkan. kandungan BOT di atas 30 mg/L.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. Pengamatan sintasan udang windu dilakukan pada akhir penelitian. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. Sintasan udang windu tertinggi didapatkan pada . Balai Riset Perikanan Budidaya Air Payau. (C1) probiotik komersial dengan dosis pakan 100%. total bakteri. NH 3. Muliani. (D2) kontrol 2.7 kg/ha/90 hari). dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. dan C) Kontrol (tanpa probiotik). tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak. Oleh karena itu.8% dan 228. MY1112 bulan II. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%. BL542 bulan III. Penelitian dilakukan di laboratorium basah. KATA KUNCI: probiotic bacteria. terutama salinitas yang mencapai 56 ppt. dan total Vibrio. (C2) probiotik komersial dengan dosis pakan 50%. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan 3 selama penelitian relatif lebih tinggi pada perlakuan yang NH tidak menggunakan probiotik dengan dosis pakan 100%. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan.35% dan 448. Nurbaya. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. B) Pergiliran probiotik BT951 bulan I. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. Maros. PO4. NO3.7 kg/ha/90 hari). survival rate. Nurbaya.7 kg/ha/90 hari). Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. diikuti perlakuan kombinasi probiotik A (50. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah. production. Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. air laut salinitas 28 ppt sebanyak 15 L. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau.

sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0. dosis pakan.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11.05) pada akhir penelitian. udang windu .11%. KATA KUNCI: probiotik. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial. sintasan.perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60.

8% dan 63.masing-masing dengan dua kali ulangan. Tokolan udang windu (PL. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. 31) yang ditebar pada masing-masing tambak adalah 10.000 ek/ha bandeng) menunjukkan hasil yang terbaik. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. rumput laut dan ikan bandeng adalah perlakuan B (10.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya. serta 99. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu. kesehatan. Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha). produksi.masing adalah 66. Sampling dilakukan 30 hari sekali selama 90 hari.0%. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81.000 ekor/ha). Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu.4 ha. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak. Oleh karena itu. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha).000 ekor/ha (1 ekor/m2). Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya.7 kg.500 m2 dengan kedalaman 80 cm. Sintasan dan produksi udang windu dan ikan bandeng masing.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1. baik pada air maupun pada dasar tanah tambak. masing-masing terdiri atas 2 ulangan. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp.5% dengan produksi 19. KATA KUNCI: probiotik. Tjaronge. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1. Maros selama 90 Hari. yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0.9 kg dan secara finansial memberikan . C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). namun belum mampu menurunkan kandungan amoniak dalam media budidaya.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto.9% dan 33. dan pertumbuhan udang serta aman bagi konsumen. dan kontrol (tanpa aplikasi probiotik). Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak. Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an. Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. Selama pemeliharan tidak diberi pakan. M.

rumput laut.572.-/ha /90 hari.keuntungan sebesar Rp 11. sintasan. produksi . KATA KUNCI: multitropik.000. ikan bandeng. udang windu.

Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu.1%) serta tanpa transfeksi (49. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. 12 jam. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. danAndi Tenriulo*) **) Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia.Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. 3 hari.3% dan tidak berbeda nyata (P>0. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). gen PmAV menunjukkan respons meningkat (up-regulation). KATA KUNCI: ekspresi. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. KATA KUNCI: promoter. Fakultas Perikanan dan Ilmu Kelautan. Maros **) Departemen Budidaya Perairan. transfeksi. Bunga Rante Tampangallo.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. IPB. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. Aan Fibro Widodo. yang sampai saat ini belum bisa diatasi secara secara tuntas. 4 hari. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. gen anti virus. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva.05) dibandingkan dengan kontrol. Ketika ditantang dengan WSSV. udang windu . uji tantang. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. Sukenda**). Komar Sumantadinata**). Alimuddin**). Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. ekspresi gen. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Promoter dikatakan aktif apabila gen penanda dapat terekspresi. 2 hari. Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Selain itu. Syarifuddin Tonnek. 1 hari.0%). EGFP.

Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. serta epidemi penyakit di lapangan. dan disertai ulserasi lapisan mukosa epitel. Nurhidayah. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. Setelah pengujian. Teknik serologi. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. Antibodi monoklonal memiliki kespesifikan yang tinggi. sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. White Spot Syndrome Virus (WSSV). monodon dengan melihat gejala klinis dan studi histopatologi. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. karena relatif mudah dan murah. serta berpeluang untuk digunakan secara langsung di lapangan. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. menyeleksi. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. antibodi monoklonal . KATA KUNCI: ELISA. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. Penelitian dilakukan untuk membuat. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. khususnya ELISA. cepat dan akurat. Pewarnaan jaringan menggunakan Hematoxilin eosin. KATA KUNCI: White Spot Syndrom Virus (WSSV). dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan.

31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya. dan efisiensi biaya produksi. Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12).0328 mg/L) pada akhir penelitian.18235 mg/L) dibandingkan dengan perlakuan A (0.5±88. . sintasan. Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0.085±0. Budidaya ini berkembang dengan teknologi intensif.048). kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0.masing-masing perlakuan diulang tiga kali.000 m2/petak. Riset ini dilaksanakan di tambak Punaga.7 m sebanyak 9 buah.0±149.51). tokolan. benur. produksi (1831. Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.Setiap perlakuan dengan 2 ulangan. namun terbatas pada golongan masyarakat menengah keatas (padat modal). dan kepadatan benur dan tokolan adalah 50 ekor/m2. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari. dan (B) pembesaran dengan tebar tokolan (PL 27). menggunakan 4 petak masing masing berukuran 4. Selama pemeliharan 85 hari. karena berpengaruh terhadap pertumbuhan. Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi. sintasan (90. Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan. Instalasi BRPBAP.114±0. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun. produksi (2087. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei).Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.9). Takalar. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1.83±8. Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%.234). rasio konversi pakan dan produksi udang vaname.102 CFU/mL.034) berbeda nyata (P<0. Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei).549±0. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0. budidaya udang intensif.05) terhadap pertumbuhan.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10.05) dengan perlakuan A (1. namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6. KATA KUNCI: udang vaname.257±0. sintasan ( 92. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11.096±0. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%..45 g/ekor dan ditebar kepadatan 100 ekor/bak. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak.120). 829. RKP pada pembesaran udang vaname teknologi intensif. dan pemeliharaan berlangsung 80 hari di tambak. sintasan.258).

survival rate. and L vannamei . feed.KATA KUNCI: growth.

3%–86. Bobot yuwana yang ditebar rata-rata 0.05). K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH.6 kkal GE/g).0– 8.000 m2.1 kkal GE/g). Kemudian dilanjutkan uji kecernaan. Jakarta Utara. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7.00. C/P rasio 14. M. Selama pemeliharaan. dan E atau komersial (protein 40. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon). Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB). 15. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0. Agus Suprayudi**). B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). dan pH 8. Bogor **) Departemen Budidaya Perairan. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih.464 mg/kg tubuh/jam. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4. Litopenaeus vannamei Deisi Heptarina*). B (protein 31%. produksi.69%.05) terhadap pertambahan berat mutlak. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI .71%–22. suhu 28°C–30°C. sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya. fotoperiod dibuat 12 jam terang–gelap. . Hidayat Suryanto Suwoyo.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2. Penelitian dilakukan di tambak percobaan Punaga Takalar. sintasan.39%. 5 kali sehari pada pukul 07. C (protein 33%. C/P rasio 11.00. D (protein 35%. Fakultas Perikanan dan Ilmu Kelautan.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN.8 kkal GE/g). Pakan diberikan at satiation. Perlakuan terdiri atas pakan A (protein 29%. dan 23. Ing Mokoginta**) dan Dedy Yaniharto***) *) Balai Riset Perikanan Tawar. C/P rasio 15. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0. sintasan. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu.00. Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an. rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi . laju pertumbuhan harian. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0. C/ P rasio 16. namun kurang diimbangi dengan penyediaan pakan yang sesuai. 19.5. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum. C/P rasio 13. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan. Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%.00. Sintasan antara 73. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname.2 kkal GE/g).intensif. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. salinitas 24–25 ppt. 11.00. ekskresi amonia dan stabilitas pakan.029–2.5 kkal GE/g).7%. sedangkan ekskresi amonia antara 1.INTENSIF DI TAMBAK Abdul Mansyur.5 g/ekor dengan kepadatan 10 ekor per akuarium.

5%.masing 26.05).2%.5%–62.8% dan 11. FCR 1. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0. pertumbuhan.4%–94.5%–36.2% serta WS berkisar antara 49.4. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13. yuwana.Namun.4–2. retensi protein (RP).1 g. PR 532. RL dan RP masing-masing 26.9%–79.7%–1130.4%.9%–68. pertumbuhan relatif (PR).6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik. Kisaran nilai masing-masing parameter tersebut adalah. kecernaan total dan kecernaan protein masing. K ATA KUNCI: protein vannamei optimal. konversi pakan (FCR). kecernaan total. jumlah konsumsi pakan (JKP).2–78. JKP 59. retensi lemak (RL).1% dan 65. Litopenaeus . kecernaan protein.

Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. belum dapat diyakinkan secara pasti bahwa ekspresi EST. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. toleran. dan SP mampu berdiri sendiri. Haryanti*). PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. SOD. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). PGM. Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. and SP) pada udang yang sehat. SOD. L. Namun demikian. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. toleran dan terinfeksi TSV. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. EST. Taura Syndrome Virus. PGM. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terusmenerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. toleran. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. protein haemolimph dan ekspresi enzim (GPI. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . SOD. . SOD. KATA KUNCI: enzim. Semua gejala tersebut diduga akibat adanya serangan virus.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). dan moribund. EST. Untuk mengetahui jenis virus yang menyerang udang tersebut maka. SPF. dan Rustidja**) *) Balai Besar Riset Perikanan Budiaya Laut. Gondol **) Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. Lila Gardenia. dan SP. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis).Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI.

WSSV. IMNV dan PvNV .KATA KUNCI: Litopenaeus vannamei. MBV. TSV. IHHNV.

5% berturut-turut untuk perlakuan A. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%.20 g. reproduksi. 25%. Imron. dan pembesaran. Pada sistem tersebut kematian induk relatif rendah. C. 0. yaitu 0%. B) 1 J : 2 B. 6. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. Sebagai perlakuan adalah rasio jantan-betina.25 g. Penelitian dilakukan dengan rancangan acak lengkap. berturutturut 0. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. berturut-turut 27%. yang meliputi pertambahan panjang dan bobot. dan D) 2 J : 4 B. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. berdasarkan nilai heterosis yang didapat. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal.25 m2/ekor induk.5%. dengan lama pengujian 8 minggu. rasio kelamin. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. KATA KUNCI: genetik. Penelitian meliputi pembenihan. Asahan. Barito. beserta persilangannya.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. dan D. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. dan 13%. diikuti perlakuan D. khususnya rasio jantan-betina. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. dengan sistem resirkulasi. diberikan pada pagi dan sore. pendederan I.42 mm. C) 2J : 2 B.31 mm. 0. Romy Suprapto. pemijahan. 2%. Musi. yang dilakukan selama 5 bulan. 0. A dan B. 0. pendederan II. pertumbuhan. Ciasem. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan. B. dan tidak berbeda nyata antar perlakuan. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.21 g. Namun demikian. dan 9.27 mm. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. udang galah . KATA KUNCI: mortalitas. persilangan. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji. dan 0.

Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan dioptimalkan. 45. Hewan uji yang digunakan adalah larva udang galah umur dua hari. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan.93.00% dan 3.8±7. C. Perlakuan yang diberikan yaitu A (kontrol.83% dan 3. dan D. (0 cfu/mL). dan D. Harry Wuwungan**).4%) diikuti oleh populasi hasil crossbreeding (57.05) terhadap kelimpahan bakteri.5 x 103). Dinar Soelistyawati**). Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan.5±28. dan D (perendaman dalam larutan ekstrak bawang putih). Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan.4 mm).6±21.4 x 103 cfu/mL) . . B. C. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C.5%. Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah. yaitu inbreeding.4 mm) dan populasi inbreeding (21. sintasan (SR) dan perkembangan larva (LSI). Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya. Fakultas Perikanan dan Ilmu Kelautan. KATA KUNCI: budidaya dapat inbreeding.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. KATA KUNCI: bawang putih. dengan nilai sebagai berikut: A. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. namun tidak berbeda nyata (P>0. yaitu A. crossbreeding. Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0. 37. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah. B (perendaman dalam larutan formalin 250 mg/L).93. C (perendaman dalam larutan ekstrak daun sirih). formalin. desinfektan. 47.5% dan 3. keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24. (8.0%) dan populasi inbreeding (25. Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan.0±1. Sukamandi. 52.92. sirih. merupakan langkah bio-security.7 mm) diikuti oleh populasi hasil outbreeding (21. B. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74.8±1.8±1. outbreeding. keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. (4. Pada karakter pertumbuhan. (0 cfu/mL).Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*). **) Jurusan Budidaya.0%).0. Hasil penelitian menunjukkan bahwa pada karakter sintasan. Tiga tipe persilangan. 4. tanpa penambahan desinfektan). larva udang galah.

Kepadatan larva 75 ekor/L. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap. (B) 32%. Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0.Karawang dengan Pelabuhan Ratu lebih dekat. KATA KUNCI: udang galah. C. jarak genetik K 22 PEMELIHARAAN LARVA UDANG PAMA (Penaeus semisulcatus) DENGAN KEPADATAN BERBEDA Muslimin. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu.Forum Inovasi Teknologi Akuakultur 2010 K 21 VARIASI FENOTIP UDANG GALAH (Macrobrachium rosenbergii) DARI POPULASI PERAIRAN KARAWANG. dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. Jenis pakan yang diberikan berupa pakan alami chetoceros. Andi Tenriulo. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau. Kepadatan larva 25 ekor/L. dan F. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm. dan (F) 10%. populasi. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm. dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau. Kepadatan larva 50 ekor/L. dan Wartono Hadie**) *) Balai Riset Budidaya Perikanan Ikan Hias. di mana masing-masing perlakuan di ulang tiga kali. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang). dan Bone. sintasan dan pertumbuhan .05) terhadap laju sintasan dan pertumbuhan larva udang pama. Perlakuan yang diujicobakan adalah: A. Kepadatan larva 150 ekor/L. B. larva udang pama. (C) 31%. Kepadatan larva 125 ekor/L. Sulaeman. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. maka ditambahkan pemanas/heater suhu 30°C. DAN BONE Eni Kusrini*). Lies Emmawati**). E. Pelabuhan Ratu. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%. (D) 16%. semisucatus) dengan kepadatan berbeda. Hewan uji ini ditebar dengan kepadatan berbeda. dan pakan buatan. artemia. (E) 24%. Pemberian pakan dilakukan setiap pagi dan sore (08. Depok *) Pusat Riset Perikanan Budidaya. diameter 15 cm dan Volume 3 L. Maros dengan panjang awal mysis adalah 100-190 milimikron. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air. Kepadatan larva 100 ekor/L. KATA KUNCI: kepadatan.00 dan 16. PELABUHAN RATU. D. lebar 40 cm. Jakarta ABSTRAK Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua.00 wita).

panjang karapas 4. akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut.1 mm dan lebar karapas 5. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan.27 mg/g/jam. BRPBAP.1 mm.1. dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau.65 g/m3. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1. Data laju respirasi selama 2 O proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit.52 kg/250 m2.05) terhadap pertumbuhan bobot mutlak. Aan Fibro Widodo. KATA KUNCI: udang pama. Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0. Maros. 44.05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4.58%.Forum Inovasi Teknologi Akuakultur 2010 K 23 ESTIMASI PADAT TEBAR UDANG PAMA Penaeus semisulcatus BERDASARKAN TINGKAT KONSUMSI OKSIGEN Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. estimasi K 24 POLIKULTUR KEPITING BAKAU (Scylla serrata) DAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN METODE TEBAR YANG BERBEDA Sulaeman.446–6. Ver. Maros ABSTRAK Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan. bobot harian.18±0.9±0. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. Oksigen terlarut diukur dengan alat pengukur (TPSTM Model WP-82 DO meters).03–0. 58.14–7.6±0. Maros ABSTRAK Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. disusul perlakuan C: 64. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP).9 mg/L dan setelah 1 jam pengukuran 0.17 kg/250 m2.96 %.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan. Kisaran kelarutan oksigen pada awal penelitian adalah 3. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66. tetapi berpengaruh nyata (P<0. padat tebar. B (metode gantung).48 mg/L dan kontrol tetap berkisar 4 mg/L. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar). Wadah percobaan yang digunakan adalah bentik jar (chamber).06.26–7.95 kg/250 m2 dan terendah pada perlakuan B: 60. 40. .0235 g adalah 15. pertumbuhan panjang dan lebar karapas mutlak dan harian. dengan kisaran tingkat konsumsi oksigen 0.03 g. dan C (gabungan antara keduanya). Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2.2. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha.

KATA KUNCI: kepiting bakau. polikultur. rumput laut . metode sebar.

Peubah yang diamati adalah laju pemangsaan. sintasan. TOM (rs = 0./mL). data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak./mL dengan laju pemangsaan sebesar 259. KATA KUNCI: kepadatan. dan peubah kualitas air. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Maros ABSTRAK Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. dan kandungan bahan organik (rs = 0.) Aan Fibro Widodo. sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0./mL).05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. C (375 ind. kepiting bakau. jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. kandungan liat (rs = 0.75). Karena hidup di dasar tambak.). Sulawesi Selatan.72).1667 ind. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton./mL). rotifera. Sulaeman. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang./mL).62). Selain diatom epipelic. dan E (125 ind. Hasil terbaik diperoleh pada perlakuan A. dan nitrat (rs = 0. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0. . Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau. laju pemangsaan. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma. yaitu: A (625 ind. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp. yaitu kepadatan rotifera 625 ind. yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang.71).0%. D (250 ind.65).66)./mL). zoea K 26 ANALISIS DIATOM EPIPELIC SEBAGAI INDIKATOR KUALITAS AIR DAN TANAHUNTUK BUDIDAYA UDANG Supono Budidaya Perairan Universitas Lampung ABSTRAK Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. B (500 ind. Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros. dan Muslimin Balai Riset Perikanan Budidaya Air Payau. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros./larva/jam dan sintasan 86. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen.Forum Inovasi Teknologi Akuakultur 2010 K 25 LAJU PEMANGSAAN LARVA KEPITING BAKAU (Scylla serrata) TERHADAP PAKAN ALAMI ROTIFERA (Brachionus SP.

KATA KUNCI: diatom epipelic. tambak udang. kualitas sedimen . kualitas air.

dan panjang total). Pertambahan bobot (71. Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci.6-7. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan. panjang standar.72). Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci.0 cm dan adanya pertambahan bobot sebesar 58. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2. benih. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot.6-71.9±9. panjang standar. Dianalisis dengan Rancangan Acak Lengkap (RAL).47) terbaik adalah benih lobster air tawar asal Tangerang. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. dan Tulung Agung). ragam. dan panjang total tiap individu.0±0. Bogor. simpangan baku. Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang. Gleni Hasan Huwoyon.9 g. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. KATA KUNCI: Cherax quadricarinatus.6±10.Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini. pertumbuhan.74) dan panjang (7. lokasi . namun kemampuan produksi para pembudidaya hanya sampai 4 inci. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda.

perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto. Gracilaria.0 ± 0. (P<0. dan kombinasi keduanya.50 g dan 217.18 mm dan 7. Riani Rahmawati.73 g. serta pakan (C)= kombinasi Gracilaria + E. (5.59±2. 73.68 µg/hari). (13.44 µg serta 92.. yaitu pada perlakuan pemberian pakan Gracilaria sp. kombinasi Gracilaria sp. pakan (B) dengan R² = 0. dan Sargassum sp. B.52 µg/hari) dan terendah pemberian pakan Sargassum sp.23 g dan 121.58 m x 0. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi. + Ulva sp. pakan (B)= E.44 µm .39 mm dan 10. + Ulva sp.06 g. (13. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir. cottonii : 40. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30.854. squamata.17 ± 25. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0.73±2. Sargassum. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata.80 sampai 31. + Sargassum sp.891.37 mm.06 µg/hari). (D) Kombinasi Gracilaria sp.02 g.1 ± 4. Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp. I Nyoman Adiasmara Giri. (rasio 1:1:1).9 ± 1.00 µm dan 38.05 mm dan 10.82 µg/hari).56 ± 48. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali. dilakukan dengan menerapkan 4 perlakuan pemberian pakan. Ulva.31 m.99 mm dan 36.613. cottonii 37. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: Haliotis squamata. Bambang Susanto. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon.44 µg. dan C berturut-turut adalah 120. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41. + Sargassum sp.03 ± 1. E. cottoni..39 g. (7. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m.17 ± 2. (C) Sargassum sp.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON. 38. + Ulva sp. + Sargassum sp.05) antar perlakuan.92 g dan 219. lebar dan bobot cangkang. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang. yaitu: (A) Gracilaria sp. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0. (B) Ulva sp. masing-masing 58. dan pakan (C) dengan R² = 0. Ibnu Rusdi.89 µm dan 38. sangat sesuai dalam memacu pematangan gonad induk abalon H.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria.26 ± 10. Ulva sp..16 g dan -86. Riani Rahmawati.06 ± 170. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A.05). Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp.44 ± 102. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0.39 m x 0. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga.19 ± 6.

KATA KUNCI: abalon Haliotis squamata. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir.44 µg.dan 65. aplikasi teknologi pembesaran .

proporsi pakan. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. pembesaran. Gondol. Ibnu Rusdi. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. Nilai variasi genetik induk abalone asal Banten (0.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin.13) lebih tinggi dibandingkan dengan induk asal Bali (0. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. genetic monitoring. mengingat permintaannya yang cukup tinggi. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. Kepadatan awal benih abalon adalah 450 ekor per wadah. Untuk itu. tinggi 22 cm. wild. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. Setiap perlakuan terdiri atas 2 ulangan. dan Ulva sp. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. dan Ulva sp. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. Tatam Sutarmat.06). Gpi*. Est-1*. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. Est-3*. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. Sampel yang digunakan berasal dari Bali dan Banten. dengan proporsi yang berbeda Gracilaria sp. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp./Ulva sp./Ulva sp. Est-2*. Abalon diberi pakan rumput laut Gracilaria sp.52. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*.7 cm. KATA KUNCI: abalon Haliotis squamata. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut.6-3. peluang pasar serta teknik budidayanya yang sederhana. Hirmawan Tirta Yudha. KATA KUNCI: allozyme. 100/0% (A). Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. penjarangan . dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air. 80/20% (B). Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. dan 60/40% (C) sebagai perlakuan. 60/40% memberikan pertumbuhan abalon terbaik. dengan bobot awal 2. Est-4* dan Cah-3*.2 g dan panjang cangkang 2. Pakan dengan proporsi Gracilaria sp.

B.44±0. Bali. DAN UJI PATOGENISITAS BAKTERI VIBRIO YANG DIISOLASI DARI LARVA ABALON SAKIT DI HATCHERI Zafran. dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13. Oleh karena itu.33% . Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan.55 mm (perlakuan C). 71. Apri I.85±0.33%.27±0. KATA KUNCI: Pinctada maxima. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan.67%. sedangkan mortalitas pada kelompok kontrol hanya 3.05 µm). vibriosis. sintasan. untuk memperoleh pertumbuhan dan sintasan yang baik. 10.37±0.42%.01 mm/hari (perlakuan C). Laju pertumbuhan lebar cangkang 0.69%. Indah Mastuti. Supii. tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut. pertumbuhan. dan C berturut-turut 37. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0. KARAKTERISASI. Namun.05) dibandingkan dengan perlakuan C.46±0. dan 46. Gondol. ukuran awal spat . Karena itu. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar.44±0. yaitu media spesifik untuk bakteri Vibrio. dan 21.Forum Inovasi Teknologi Akuakultur 2010 M 05 ISOLASI. Vibrio cincinnatiensis. dan 20. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan.33%. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1. masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. uji patogenisitas M 06 PENDEDERAN TIRAM MUTIARA (Pinctada maxima) DENGAN PERBEDAAN UKURAN TEBAR AWAL Sudewi.16%. Gondol ABSTRAK Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini.03 mm/hari (perlakuan B) dan 0. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia. dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon.36±0.1 mm (perlakuan B). penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm. dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0. Setiap perlakuan diulang 3 kali. Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0. Sintasan yang diperoleh untuk perlakuan A. isolat-2. 0. Gondol ABSTRAK Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan. Perlakuan yang diberikan adalah ukuran tebar 3. 18.01 mm/hari (perlakuan A).01 mm/hari (perlakuan A). 0. Parameter yang diamati adalah laju pertumbuhan harian dan sintasan.00 mm/hari (perlakuan C). KATA KUNCI: abalon.03 mm/hari (perlakuan B) dan 0. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H.44 mm (perlakuan A). Haliotis squamata.4±0.30±0.

Gondol **) Fakultas MIPA Universitas Udayana ABSTRAK Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan. Teluk Awen. akan tetapi jika diinginkan. Pinctada maxima. Pantai Pengambengan khususnya. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Sumber Sari. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari. regional maupun lokal. tiram mutiara. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara.Forum Inovasi Teknologi Akuakultur 2010 M 07 KAJIAN POTENSI KELAUTAN UNTUK BUDIDAYA TIRAM MUTIARA (Pinctada maxima) DI WILAYAH PESISIR KABUPATEN JEMBRANA-BALI Apri I. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai. dan Sudewi*) *) Balai Besar Riset Perikanan Budidaya Laut. Berdasarkan hasil pengkajian. Ida Ayu Astarini**). budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. KATA KUNCI: potensi kelautan. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara. dan Teluk Rabu. pada tingkat nasional. Jembrana . Supii*). tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan.

jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0. dan 5 m. verrucosa. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G.3 m. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver. Sedangkan jumlah tunas dalam stoples (7. 4 m. Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). dan 5 m dari permukaan perairan. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Rumput laut dikumpulkan dari Kabupaten Brebes. 1 m. kepadatan eksplan. stoples . Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26. 2 m. 1 m. pertumbuhan. Maros ABSTRAK Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan. Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2. metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker.1%. Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut.70 dibandingkan dalam botol yang hanya 6. dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau. Oleh karena itu. sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi. kandungan keraginan. K. Rosmiati.6 juta ton per tahun sekarang ini menjadi 7. 3. 3 m.3 m. sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya.20. KATA KUNCI: botol. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut.50) lebih banyak dibandingkan dalam botol (7. 2 m. KATA KUNCI: Kappaphycus alvarezii. yakni 0. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu.75%).1. vertikultur LL 2 PERBANYAKAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN KULTUR JARINGAN MENGGUNAKAN WADAH YANG BERBEDA Siti Fadilah. Jawa Tengah. Maros ABSTRAK Produksi rumput laut ditargetkan meningkat dari 2.03). di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. 3 m. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut.70%) daripada botol (90.40 mm pada stoples dan 2.42 mm pada botol. Umumnya pembudidaya rumput laut. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masingmasing dengan 3 kali ulangan.6 juta ton per tahun pada 2014. Eksplan diinokulasi ke dalam media cair yang diperkaya PES. Kappaphycus sp. 4 m. mengaplikasikan metode long line. Pengamatan panjang tunas.75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan.Forum Inovasi Teknologi Akuakultur 2010 LL 1 PERFORMANSI PERTUMBUHAN DAN KANDUNGAN KERAGINAN RUMPUT LAUT (Kappaphycus alvarezii) DENGAN APLIKASI METODE BUDIDAYA VERTIKULTUR Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau.

panjang kejutan: 0. Rajamuddin*). Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) .Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT. daya tahan penyakit. puncak jam ketiga – keenam s. . Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. promoter. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV.e). Sebagai tahap awal dalam rangka produksi rumput laut transgenik. transgenesis.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12.BPPT. Fadilah. ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. dan sumber karbon yang berbeda.Irvan Faizal****). Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0. Pola ekspresi keempat promoter relatif sama.1 second. Rosmiati. Utut Widyastuti***). mulai berpendar jam pertama – kedua setelah elektroporasi (s. persentase sel berpendar rata-rata 10%. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium.e. Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA.5 mili/second. dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. Alias L. ZPT. b-actin. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. Alimuddin**). Balai Riset Perikanan Budidaya Air Payau. dan St. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%– 10%. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. jumlah kejutan: 4 kali dan interval kejutan: 0. Keratin dan b-actin. Makassar **) Departemen Budidaya Perairan-FPIK.e dan stabil setelah jam ke9 sampai ke-12 s. Kappaphycus alvarezii Muh. cytomegalovirus/ CMV. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. KATA KUNCI: Kappaphycus alvarezii.

KATA KUNCI: mutu genetik. kappaphycus alvarezii. hibridisasi. fusi protoplas .

Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. taman nasional ujung kulon. Erlania. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. kondisi sosek-ekonomi. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). KATA KUNCI: rumput laut. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. Kabupaten Pandeglang. Pandeglang . Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. pembudidaya rumput laut. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. Pada umumnya. khususnya di Kecamatan Sumur. Untuk itu. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. Rekomendasi pencegahan penyakit. dan status wilayah kawasan. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. SIG. I Nyoman Radiarta. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. konservasi dan wisata). Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang.

6%.1 mg/L) dengan konsentrasi agar (0. pada rasio IAA: kinetin (0.8%). adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus. dan 0. morfologi. 0.5:0. Tahap (2) adalah regenerasi massa sel embriogenik somatik.0:0. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0. Pada tahap induksi kalus.5%). pengggantian media dilakukan setiap minggu dengan komposisi media yang sama. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan.0:1. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%. 0. Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm).Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati. Perkembangan selsel embriogenik diamati pada kultur cair. dan 1. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan. Makassar **) Balai Riset Perikanan Budidaya Air Payau. Ridwan*). dan 2.0 mg/L.8%. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep.4%.0%.0 mg/L. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya.1:1. embrio somatik.6%. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis.0 mg/L. Rosmiati.2 mg/L) dengan konsentrasi agar media induksi (0. 1. KATA KUNCI : Kappaphycus alvarezii. Pada tahap regenerasi massa sel embriogenik. Andi Asdar Jaya*). Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid.0:0.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0. embriogenesis somatik . Alias L. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. 0. Pemeliharaan dilakukan selama 8 minggu. Rajamuddin*). Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii. KATA KUNCI: keragaman. 1.6% dan 0.5 mm dapat dicapai dalam satu bulan kultur.4 mg/L. Pada media cair. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0. kalus.0% menghasilkan persentase induksi kalus tertinggi (90%). Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0.8% dan 1.

rumput laut.143. Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. dan karbohidrat) dan uji organoleptik. 01-2973–1992 dan SII 0177–1990. Hasnawi. kadar abu. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No. abu. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. rasa.13 ha dan 3.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn . aroma. protein. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam pengembangan. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). produksi pada tahun 2008 sebesar 750 ton. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. KATA KUNCI: program-program pokok strategi pengembangan. A-1 (15% tepung rumput laut dan 85% tepung terigu). Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf.780. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. lemak. dan berpengaruh nyata terhadap rupa dan tekstur. Mery Sukmiwati. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. denga metode budidaya tali panjang (long line). Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut.24 ha. Parameter mutunya adalah kandungan zat gizi (air. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. A-2 (30% tepung rumput laut dan 70% tepung terigu). Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat.

KATA KUNCI: rumput laut.85%. crakers. gizi. uji organoleptik .

bahan organik dan berat volume tanah. tanah.60 dan 36. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei.884 g/cm3 tanah berkisar antara POS dan S 0.29 ton/ha 3 CaCO dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju.36 dan 3. Kebutuhan kapur didasarkan pada tanah dengan POS nilai S mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur. Oleh karena itu. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan.09 dan 90. namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. S . Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia. Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95.28% dengan rata-rata 7. . S .02. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI S POS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa.2 digunakan untuk pembuatan peta distribusi tanah. pH F . berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra POS S ALOS FOX AVNIR-2 akuisisi 28 Juli 2009.15 dan 19. Rachmansyah.02% serta 44.78% sehingga memiliki faktor konversi berturutturut sebesar 2. pirit. Maros ABSTRAK Kabupaten Mamuju. Penelitian ini bertujuan untuk melakukan analisis . dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. KATA KUNCI: kebutuhan kapur.71 g/cm3 dengan rata-rata 0. Adang Saputra. tambak. Program ArcView 3. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. Kapur S P KCl POSpertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur.32 dan 113. ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting.30 dan 1. Kebutuhan kapur untuk tambak di Kabupaten Mamuju berkisar antara 1. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat POS S dan berkelanjutan. Peubah kualitas tanah yang diukur adalah: pH .614%. S POS . dan Anugriati Balai Riset Perikanan Budidaya Air Payau. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta.

inderaja.spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG). klorofil-a dan suhu permukaan laut). Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan. Maluku . analisis spasial. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. KATA KUNCI: budidaya laut. Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut. infrastruktur (jalan) dan sebaran penduduk. SIG.

dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. peningkatan pendapatan. b a nd en g LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). dan analisis usaha perikanan. rumput laut.400 m2 selama 3 bulan pemeliharaan. Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. udang dan bandeng. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. ikan patin. Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. analisis komoditas unggulan dan andalan. Di samping itu. analisis location quotient. Jakarta **) Pusat Riset Perikanan Budidaya. Adang Saputra**). KATA KUNCI: produktivitas tambak. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. Hatim Albasri**).Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). Sukamandi ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. Introduksi kaji terap dilakukan dilahan seluas 2. Wartono Hadie**). Evi Tahapari***). Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). KATA KUNCI: minapolitan. Kabupaten Brebes . rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara. udang. tambak terbengkalai. konversi pakan serta pertumbuhan yang cukup baik. Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. dan Sularto***) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. analisis komoditas. Jakarta **) Pusat Riset Perikanan Budidaya.

50-0. bakau. sedangkan yang dianalisis di laboratorium adalah pH FOX . Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. Kualitas tanah yang diukur langsung di lapangan adalah pHF. pesisir. Kabupaten Mamuju . N-total. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). dan Kamariah Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan bahwa. Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. bakau. tanah.25 m dan 0. penutup/penggunaan lahan. A. KCl KATA KUNCI: keragaman. campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. Al dan tekstur. padi (Oryza sativa). kelapa (Cocos nucifera).75 m. sagu (Metroxylon sagu). Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah. Pada kedalaman 0. pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent. nipah (Nypa fruticans). TSA. 4PO . pH . rumput. Pada kedalaman 0-0.25 m tanah jenis penutup/penggunaan lahan api-api. rumput. nipah. pirit. TAA. paku laut (Acrostichum aureum). S . masingmasing pada kedalaman tanah 0-0. S . sagu. OXS P KCl POS karbon organik. . Marsambuana Pirzan. TPA. Fe. nipah. tanpa vegetasi. Oleh karena itu. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan.50-0. kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. pH dan potensial redoks.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. rumput. bakau (Rhizophora apiculata). kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu.75 m tanah vegetasi api-api.

walaupun dengan model regresi yang berbeda. sedangkan peubah bebas adalah suhu. dan data citra satelit digital. cukup sesuai (168. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. sedangkan yang kurang sesuai (213. Data sekunder yang diperoleh berupa data iklim.046 dan 22. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. terdapat di Kecamatan Segedong dan Siantan. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat.047 dengan rata-rata 6. tambak. tersebar di wilayah pesisir Kecamatan Sungai Pinyuh.077 ha.819 ha). Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil.000. dan bahan organik total. pH. salinitas. Sungai Kunyit. amonia. dan fosfat. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia. Sulawesi Barat . Oleh karena itu.398 µg/L. fosfat. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. KALIMANTAN BARAT Utojo. nitrat. data sekunder. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan.000. oksigen terlarut. Mempawah Hilir dan Mempawah Timur. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50. nitrit. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik. amonia. tambak. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. nitrit. nitrat.986 ha). dianalisis secara spasial dengan metode PATTERN menggunakan SIG. kualitas air. Data lapangan (fisiko-kimia air dan tanah). Akhmad Mustafa. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. Pada umumnya yang tergolong sangat sesuai (114.272 ha). pH. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil. KATA KUNCI: kesesuaian lahan.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497. KATA KUNCI: klorofil. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a.

Tidak terdapat perbedaan nyata (P>0.75). 2002 dan Dayananda et al. KATA KUNCI: mikroalga. DO. Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. kemudian 6. Kultur ini ditempatkan diluar ruangan. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4.bak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda. Spesies dominan adalah Limnaea sp. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda.60% menggunakan perlakuan pelarut hexana. dilakukan di dalam bak. 5:4.5 mg/L. kecerahan. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis. dan Nematoda. pH. dengan menggunakan cara modifikasi (Banerjee et al. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. Analisis data dilakukan secara deskriptif untuk komposisi jenis. Analisis kandungan minyak nabati Dunaliella sp. total bahan organik (TOM).. minyak nabati . Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0.. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. BRPBAT. ekstraksi. penghitungan kelimpahan. Chironomus sp. Dunaliella. Jakarta.02–8. 2006).. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6.0 sel/mL. indeks diversitas dan keseragaman spesies. kolam. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung.). Bogor. dan 6:3. Parameter kualitas air yang diamati adalah suhu. identifikasi. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya. Kultivasi Dunaliella sp. dan BOD5. pupuk. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9. KATA KUNCI: makrobentos.. Proses pengayakan termasuk penyeleksian. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. dan penghitungan dilakukan di laboratorium.

Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. KATA KUNCI: ketahanan pangan. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. Pengolahan data dilakukan secara deskriptif. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. KATA KUNCI: kepadatan. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. 02 sel/mL pada sistem outdoor.33 sel/mL pada sistem indoor dan 7. Botryococcus braunii .65/hari pada outdoor. Berdasarkan perhitungan statistik ANOVA. Departemen Pertanian. dan pH.37. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. salah satunya adalah Desa Merakan di daerah Jawa Timur.25/ hari pada indoor dan 3. salinitas. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. laju pertumbuhan. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. Metode penelitian menggunakan metode survei. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. rawan pangan. dengan skor 19. braunii. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat.

sehingga AH-26 merupakan isolat yang pathogen. Uji awal berupa pengecatan gram. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. KATA KUNCI: unit usaha. Sedangkan dengan menggunakan spesifik primer. penanganan aspek teknis. penanganan aspek teknis. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Isti Koesharyani. aerolysin dan primer spesifik . pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. Infeksi bakteri. tes katalase dan oksidase dilakukan sebelum uji PCR. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. kemungkinan merupakan strain yang tidak pathogen. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. pembudidayaan. KATA KUNCI: Aeromonas hydrophila. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. uji PCR. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. pengelolaan bisnis. Bakteri merupakan salah satu penyebab penyakit pada ikan. dan Balai Budidaya Laut (BBL) Ambon. profitabilitas. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut.

KATA KUNCI: kedalaman. Winarlin.Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat.Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti. Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar.81 (ind/cm2) dan 0. periphyton. namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae. kedalaman 3 meter(C) dan kedalaman 4 meter (D). Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. Ani Widiyati.860. Masing.91. kedalaman 2 meter (B).masing perlakuan 5 kali ulangan. yaitu 4423. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m). Waduk Cirata . Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A).

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. Sidi Asih***). Jakarta **) Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. KATA KUNCI: streptococcosis. dan Achmad Sudradjat*) Pusat Riset Perikanan Budidaya. 8 ppt (6–10 ppt). Majalaya. sintasan. dan tinggi 40 cm dengan ketinggian air 15 cm. Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. ikan mas. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. Cianjur Wildan. Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. ikan nila. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. Akuarium yang digunakan berukuran panjang 60 cm. Hary Krettiawan*). perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. pertumbuhan . Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. dan Sutisna Kuningan. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. Bogor *) ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. dan 12 ppt (11–15 ppt). Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. telah banyak menginfeksi ikan nila.masing perlakuan menggunakan 2 ulangan. KATA KUNCI: strain. Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. salinitas. Masing. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*).Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. lebar 40 cm. responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. sintasan terendah didapatkan pada salinitas 12 ppt. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas.

36. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan. Pemeliharaan ikan belida dilakukan di kolam. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. dengan jangka waktu pengembalian modal selama 3. KATA KUNCI: budidaya. anakan ikan nila . Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. Iwan Malhani Al’Wazan. termasuk jenis ikan karnivor. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. ekonomi. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september .20 siklus dan nilai RC ratio sebesar 1. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan. ikan belida yang banyak hidup di perairan umum Sumatera.64 sedangkan FCR total sebesar 1. Jakarta ABSTRAK Ikan karnivor. Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. yang diberi sekat jaring nilon hita. Jawa. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain. pakan. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4. dan kalimantan. KATA KUCI: ikan belida.53. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan September.November 2009. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. Dalam hal dukungan dana permodalan.

Induk yang matang dipilih dan dilakukan pemijahan secara buatan. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. Untuk menguasai teknologi domestikasinya. pelet maggot . jaring tancap dan keramba jaring apung. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. Jakarta **) Balai Riset Perikanan Budidaya Air Tawar. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) Pusat Riset Perikanan Budidaya. Selama proses adaptasi pada kolam pemeliharaan. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. kurang lebih 60% pengeluaran berasal dari pakan. yang dikenal dengan nama PKM (palm kernel meal). KATA KUNCI: ikan belida. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. KATA KUNCI: ikan nila. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. palm kernal meal. Dalam kegiatan budidaya ikan. Budidaya ikan nila dapat dilakukan di kolam. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva.

dan Zafran Balai Besar Riset Perikanan Budidaya Laut. Pendederan ikan kerapu macan. Masingmasing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0.bak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. KATA KUNCI: pertumbuhan. sedangkan kontrol hanya disuntik dengan PBS. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). Padat penebaran yang digunakan sebagai perlakuan adalah 100. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. penyakit infeksi . sintasan. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. 05. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. 05) tidak mempengaruhi sintasan. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. Rasio konversi pakan 1. Fris Johnny.150. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). baik disebabkan oleh infeksi virus. Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. dan 200 ekor/m³. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. 95 – 2.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. KATA KUNCI: vaksin bakteri. bakteri maupun berbagai jenis parasit. ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. 65 g/ ekor. Epinephelus fuscoguttatus. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bak. Masing-masing perlakuan diulang 3 kali. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. 25 – 1. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia.

Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 . Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut.240. Supii. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet. indeks somatik gonad dan diameter oocytnya. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. Agus Priyono. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. Ketut Suwirya. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3. Apri I. Plectropoma laevis.004. Tridjoko. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan. dan (B) Induk asal alam. Kualitas telur yang dihasilkan relatif masih fluktuatif. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. aspek biologi reproduksi .450.80.25-4. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia.520 µm.20.000 butir. KATA KUNCI: kerapu raja sunu. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. dengan jumlah 8% biomass/hari. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³. dan pada induk asal alam 20-92 % dengan SAI 2.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma.000 butir.

produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. (1988). Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. Kata kunci : Jaring apung. Peubah yang diamati adalah sintasan. ikan tengadak. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. pertambahan berat. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN.A. total biomass dan biaya pakan. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. tengadak albino. Hasil penelitian menunjukkan bahwa laju pertumbuhan. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. dibandingkan dengan perlakuan lainnya. pertambahan berat. KATA KUNCI: truss morfometrik. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. konversi pakan. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. tawes . pertumbuhan. Himawan Tirta Yudha. Rudy Gustiano. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. dan N. Giri Balai Besar Riset Perikanan Budidaya Laut. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. dengan periode pemeliharaan120 hari. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi.

4–0.33%). Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air. KATA KUNCI: substrat.8 mg/L). Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar.82%).05) dibandingkan kolam ikan kontrol (82. Untuk itu.5–14.36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0. Typha sp. juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut.849 mg/L) dan nitrat (0. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat). Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat.82%).5 mg/L).11%–44. Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi. akut.4%) pada kolam substrat 1 (pasir. Perlakuan pada penelitian ini terdiri atas dua perlakuan. Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya. kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur.5 mg/L).5%–90. Sintasan (93. amonia (0.). Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0. produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar.lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8.5%–66. karbofuran. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan. karena di samping harus efektif terhadap hama tanaman padi. amonia (0. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan. dan Scirpus sp.303–1. dan nitrat (11.081–0. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7. amonia (42. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan. nitrogen.32 %). tumbuhan air. KATA KUNCI: toksisitas.681mg/L) dan nitrat (0.05).67%). amonia (20.3 mg/L). khususnya ikan. Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi. pemakaian insektisida perlu dilakukan secara selektif. yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air).14%–92. yaitu TN (42.7–1.86%–85. Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen. kronis . Kisaran persentase efektivitas penyisihan TN (28%– 58. dan nitrat (37.Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar.58%).

000. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain– Jenssen.00 mg/L dan garam 4.000. yaitu (GCGAACGGGTGAGTAACACG) dan (TGCACACAGGCCACAAGGGA). Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. selanjutnya dibandingkan dengan teknik diagnosa melalui uji bio. Ketujuh perlakuan itu yaitu: (a) biji teh 10. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Gyrodactylus. sehingga upaya pengendaliannya sering terlambat. Oleh karena itu. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. 39 M1: T T dan primer M2: PreT (AATGGGCGCAAGCCTGATG) dan (ACCGCTACACCAGGAAT) digunakan pada penelitian 43 531 T ini.kimia dan histopatologis. yang telah dikembangkan oleh 13 beberapa peneliti.00 mg/L. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis.00–20. KATA KUNCI: ekstoparasit.00 mg/L (g) kontrol.00 mg/L efektif untuk memberantas Trichodina dan monogenea. sedangkan preparat histopatologi diambil dari organ hati. dan darah. Hasil penelitian .Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar.00 mg/L. Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. (c) biji teh 20. dan Quadriacanthus kobiensis serta menimbulkan kematian. Dua pasang primer. (f) garam 6. Dactylogyrus. (b) biji teh 15.00–6. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy). limpa. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. dan limpa. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya.000. Trichodina. serbuk biji teh dan garam. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10. Pada riset ini. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. Ada beberapa bahan nabati dan alami yang dapat digunakan. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp. (d) garam 4. ginjal.00 mg/L. (e) garam 5.00 mg/L. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. Mycobacterium fortuitum PADA IKAN GURAME. Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan.00 mg/ L. Sensitivitas teknik diagnosa terhadap bakteri target.

KATA KUNCI: mycobacteriosis. Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum.menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi. dan Polymerase Chain Reactio n . gurame. Mycobacterium fortuitum. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies.

60±0. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra. efisiensi pakan. pertumbuhan. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan.05). masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. guttatu s . dan tingkat sintasan. dan 2. 1.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan. nilem. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang.500. 1.05) terhadap pertumbuhan. B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau. C.000.73 g dengan padat tebar 15 ekor/keramba. substitusi.15±5. masing. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG. Balai Riset Perikanan Budidaya Air Tawar. rasio efisiensi protein. Bogor. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Parameter yang diamati yaitu laju pertumbuhan spesifik. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem. KATA KUNCI: fitase.500 dan 2. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0. dan sintasan ikan beronang. tepung bungkil kopra. efisiensi pakan. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. namun nilai ini tidak berbeda nyata dengan 1. pakan ikan beronang.45 g/ekor. S.masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0. KATA KUNCI: tepung bungkil kedelai. Hasil penelitian menunjukkan bahwa penggunaan fitase 1. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0.000 unit/kg pakan.V. Cijeruk dengan bobot rata-rata 8. 500.000 unit fitase/kg pakan.

sintasan . Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot. Maros selama 40 Hari. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. B.850.-/tahun/ha.Variabel yang diamati adalah pertumbuhan lebar karapas.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak.). rajungan. KATA KUNCI: pakan rucah. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur).526. Tjaronge Balai Riset Perikanan Budidaya Air Payau.2 ± 0.2 mm dan bobot 0. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. 100% ikan rucah jenis ikan tembang (Clupea sp. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. bobot dan sintasan serta kualitas air. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus). pelet. 50% ikan rucah + 50% pelet. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut. 100% pakan buatan/pelet dan C.02 g. tambak. KATA KUNCI: budidaya bandeng. pertumbuhan. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis.04 ± 0. Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan. lebar karapas dan sintasan (P>0. Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif.05) dengan perlakuan yang lain.

produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1.5 cm (ukuran ekspor). KATA KUNCI: pupuk organik.5 x 0. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B). Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional.43. dan 105 dan dianalisis secara deskriptif. 20.5 x 0.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. Pada akhir penelitian (hari ke 105). Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1. Oleh karena itu. Nina Meilisza.816%. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B). Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. B/C rasio 1. Padat penebaran bandeng pada masing.-.98 g/ekor menjadi 232. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.6 cm .009 gram. masing-masing mencapai 56. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. Produksi bandeng pada perlakuan A dan B. bandeng. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2.5 ton/ha. Erfan Andi Hendradjat. pupuk kandang dan dedak.625% dan 60. 70. masing-masing mencapai 986.masing perlakuan adalah 15. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Selama pemeliharaan. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).5 cm dan panjang tertinggi sebesar 3. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. Sintasan bandeng pada perlakuan A dan B.9 dan 1154 kg/ha. 35. ampas tahu.5 m dan tinggi air 40 cm.0 cm dan bobot rata-rata 0. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia.100.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. 55.0 cm. masing-masing dengan dosis 2.467.

ukuran ekspor 1 inchi (2. KATA KUNCI: benih botia. pertumbuhan panjang.5 cm) .dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.

98 ± 0.. (A) Chironomus sp. memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya. Hasil penelitian menunjukkan bahwa perlakuan pH 7.32 ± 0.00 dengan metode pemberian sekenyangnya (adlibitum). Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat.) Eni Kusrini*). Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian.85 ± 0. pH pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur.0 – 8. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp.9 dan pH 7. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp.. ikan diberi perlakuan pemberian pakan alami yang berbeda. namun tidak berbeda nyata (P>0.0-8.05) . (B) Culex sp.01 g dan panjang total rata-rata 3. KATA KUNCI: air Melanotaenia sp. dengan pertambahan bobot rata-rata sebesar 0. Agus Priyadi*). memberikan pengaruh yang berbeda nyata (P<0. Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5.05) terhadap pertambahan bobot rata-rata ikan.50 ± 0.8 (sebagai kontrol). Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali.5 – 5.00..0 – 6. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula. dan Culex sp. Rendy Ginanjar. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar. dan Irsyaphiani Insan**) Balai Riset Budidaya Ikan Hias. Selama 45 hari pemeliharaan. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. pH 6. Pakan diberikan tiga kali sehari yaitu pada pukul 8. dan (C) Tubifex sp.00 dan 16. gonad.24 cm. Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar. Jakarta *) ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua. Depok **) Pusat Riset Perikanan Budidaya.0.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. 12. Depok.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor.09 g dan pertambahan panjang total ratarata sebesar 0. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp.Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP. Gigih Setia Wibawa*).

pendederan. KATA KUNCI: Benih ikan pelangi. pakan alami. pertumbuhan. sintasan .terhadap rata-rata pertambahan panjang total dan sintasannya.

67%. Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia. Indonesia **) Institute Recherche Pour Le Developpement. B. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari.22±0. 97. resirkulasi. B (2 ekor/L). C.22% dan E. Pakan yang diberikan selama penelitian adalah nauplii artemia.02 cm dengan bobot 0.13±0. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi. 35 ekor/liter. B. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi. Prancis *) ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air.81%. ketersediaan pakan dan padat penebaran. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). Sintasan dari masing-masing perlakuan adalah sebagai berikut: A. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. Rendy Ginanjar*) Asep Permana*). 96. Lili Sholichah*). Marendra Gladiyakti**) *) Balai Riset Budidaya Ikan Hias. 96. 15 ekor/liter.67 mm. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). padat tebar. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan. Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. 95. 30 ekor/liter dan E. Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. pertumbuhan. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan. C. 20 ekor/liter. D.05) terhadap pertumbuhan. dan Jacques Slembrouck**) . Depok **) Universitas Diponegoro. 25 ekor/liter. .07%.45%. tetapi berpengaruh nyata (p<0. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap. KATA KUNCI: Metynnis hypsauchen.02 g. Balai Riset Budidaya Ikan Hias Depok. 96. Ikan uji yang digunakan adalah benih berukuran panjang 2.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*). D.

padat tebar .KATA KUNCI: ikan botia. sintasan.

Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. temperature. salinitas dan arus. dan homing atau reproduksi. KATA KUNCI: maggot.) . Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. memiliki bak untuk restokin. air tersedia dalam jumah yang cukup. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. propinsi Jambi. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). Migrasi terbagi menjadi migrasi vertical dan horizontal. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. memiliki mesin pelet. KATA KUNCI: Phenotipic plasticity. lunar. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). Ikan migrasi. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. makanan. ketersediaan pakan dan pemasaran. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. Kawasan Mina Pakan Mandiri. 2) unit pengolahan pakan dan 3) unit budidaya. Unit budidaya ikan memiliki prasyarat sebagai berikut. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. sedangkan factor eksternal yaitu. kolam budidaya dan manajement budidaya yang baik. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. Unit pengolah pakan memiliki prasyarat sebagai berikut. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. memiliki bak kultur. Ikan Sidat (Anguilla sp. biokonversi. Unit produksi maggot memiliki prasyaratan sebagai berikut. area penjemuran atau alat pengeringan pakan (drying). Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. bahan pakan seperti vitamin dan dedak. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. fisiologi dan tingkah laku dalam merespon perubahan lingkungan.

15%). NIRWANA (nila ras wanayasa). Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. Aktivitas reduksi nitrat terjadi dari awal inkubasi. Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi.h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST.mossambicus). Iman Rusmana**). Didik Ariyanto. untuk mengamati variasi genetik benih persilangan ikan nila. Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O.40 mM dan 0.17 mM. Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. Selain itu.26% – 63. mossambicus) Nunuk Listiyowati. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan . Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik.Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. Jarak genetik 15 populasi persilangan berkisar (0. Kata kunci: Randomly Amplified Polymorphic DNA (RAPD).236 – 0. Ikan yang di gunakan adalah hasil persilangan 4 strain. jarak genetik. dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. tetapi yang menghasilkan benih hanya 15 populasi. nila BEST (Bogor Enhancement Strain of Tilapia). Hasil dari persentase polimorfik (berkisar 5.mossambicus).h-1 dan 0. Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi. mujair (O. Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi.16 mM. Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik.28 mM. juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut. Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD). terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&). Oreochromis niloticus . nila merah (Red NIFI). pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*). dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Persilangan. Sukamandi. terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan.560).

Kata kunci: denitrifikasi.dengan Pseudomonas aeruginosa. reduksi nitrat . nitrogen anorganik.

Isdy Sulistyo2). distibusi. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma. KATA KUNCI: Bacillus sp. bungkil sawit. KATA KUNCI: PGC.37% setelah proses fermentasi. 6 hari (D3). Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC. Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm.09% menjadi 4.. Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. 4 hari (D2). kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi.74% menjadi 5. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. menurunkan lemak bungkil sawit dari 14. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral. sebagai bahan baku pakan ikan patin. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia. Osphronemus goramy. Pada tahap pembentukan mata. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. rasio inti sel:sitoplasma yang besar. Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. nutrisi dan serat kasar .Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC.37% dan meningkatkan kadar protein dari 13. Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. PGC terdistribusi secara berkelompok di bagian ventral.8%.) Priadi Setyawan1). dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. fermentasi.91% menjadi 15. migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. Sukamandi **) Universitas Jenderal Soedirman.

Subang. dan Labuan (Merak). Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. Perbedaan dari kedua sistem ini adalah sifat produksinya.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). dengan masing-masing hatchery terpisah lokasinya. pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. Depok ABSTRAK Ikan patin (Pangasius sp.Balai Riset Perikanan Budidaya Air Tawar. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran. setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. Angela M. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. integrasi. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster.. dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor. Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. Tipe integrasi bersifat soliter.1994). Wartono Hadie**). Eni Kusrini****). kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. patin. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. di antaranya daerah Bogor dan Subang. salah satunya melalui Catfish Club Indonesia. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal. Bogor ****) Balai Riset Budidaya Ikan Hias. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil . demikian juga ditinjau dari segi higienis dan kesehatan benih.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. dan kluster pemeliharaan larva dan benih. Jakarta ***) . Pengambilan data melalui responden dilakukan dengan cara purposive sampling. kluster penetasan telur. Jakarta **) Pusat Riset Perikanan Budidaya. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP. 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. dkk. Lusiastuti***). KATA KUNCI: UPR. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi.

sebagai materi kegiatan tahun mendatang. betina homogamet . jantan fungsional. kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. KATA KUNCI: ikan nilem.persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. sex reversal.

sintasan dan kualitas air (meliputi suhu. 15 butir/ liter perlakuan (I). Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). salinitas. Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva. dan nitrit). amonia. pH. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui. Agus Priyono. KATA KUNCI: sintasan.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa.27 pada ukuran konsumsi S D dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia. ikan mas strain rajadanu .57 % dalam satu generasi. KATA KUNCI: seleksi generasi. oksigen terlarut/DO.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. M H Fariddudin A. Diketahui estimasi nilai heritabilitas rata-rata h²( + ) = 0. 10 butir/liter (perlakuan H). dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar. Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431.2 gram. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. kepadatan. larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih. intensitas cahaya. Anang H K. pertumbuhan. dan Afifah Balai Besar Riset Perikanan Budidaya Laut.1. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva).

eksplorasi. Survei dilakukan di beberapa daerah yaitu Cianjur. Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). penyakit streptococcosis . penanggulangan.dan Tasikmalaya. Klaten. Hambali Supriyadi. bakteri probiotik. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus). Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. dan Lila Gardenia Pusat Riset Perikanan Budidaya. KATA KUNCI: antibakteri.Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati.

KATA KUNCI: kerang hijau. Pandeglang .Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. di perairan Panimbang Kabupaten Pandeglang. Erlania. budidaya laut. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. SIG. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. Teluk Lada. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. Provinsi Banten. Kabupaten Pandeglang. Kabupaten Pandeglang. Secara umum. Hatim Albasri. Untuk menjamin keberlangsungan usaha budidaya kerang hijau.

Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. . Bali.Wartono Hadie*). Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 pK 01 1. sedangkan dari kelompok protozoa adalah Epistylis sp. induk. dan Spiranura sp. dan diferensial hemosit. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). Parameter yang diamati meliputi pemeriksaan parasit.. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro. serta UPR yang mengembangkan usaha perbenihan udang galah. kelompok kedua adalah BBU Pamarican (Jabar). Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp..42%.. BBUG Klungkung. Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol..) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Ikhsan Khasani**). Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan. Vorticella sp. dan kelompok ketiga ialah pembudidaya. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76. Zoopthalmium sp. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas. dan Opercularia plikatilis. tingkat sintasan. STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*). dan Jatim. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro.UPU Probolinggo (Jatim). manajemen. Retna Utami**). BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar.). Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP SamasYogyakarta. Imron**). Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset. dan kelompok ketiga ialah pembudidaya. KATA KUNCI: udang. Jateng. padahal permintaan cukup besar. Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. kelompok kedua adalah penghasil benih. BBAP Samas-Yogya(Jateng). Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya.Bali. Bali. kelompok kedua adalah penghasil benih. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP. tingkat kesembuhan.. Carchecium sp.

).KATA KUNCI: huna (Cherax sp. tembakau (Tobacum nikotiana) .

8 kg dan kelangsungan hidup 100 %.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. Gracilaria verrucosa.1 kg dan kelangsungan hidup 11. tokolan. namun polikultur udang vaname dan rumput laut masih kurang informasinya. salinitas rendah. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2. Idil Ardi. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. produksi 78.5 g. pengapuran dan pemupukan. namun berbeda tidak nyata (P>0. dilakukan pengolahan tanah tambak. dan Wartono Hadie Pusat Riset Perikanan Budidaya. KATA KUNCI: udang windu. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Dengan teknologi yang diterapkan. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Setelah dua hari.2 %.500 m2 digunakan untuk percobaan. produksi 81. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan.22% dan 72. Sebelum penebaran. KATA KUNCI: vaname.84 kg/ha. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54. kemudian dikeringkan sekitar satu minggu.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35. yaitu menggunakan tingkat teknologi tradisional plus. sedangkan pada dua bulan berikutnya diberi pakan pellet udang. Pemeliharaan dilakukan selama tiga bulan. polikultur. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. pengeringan.6 kg/ha. Penelitian ini dilakukan pada tambak di daerah Betok Mati. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang.66% dan 108. masing-masing dengan dua ulangan. Empat petak tambak masing-masing berukuran 3. Kecamatan Cilebar. pada bulan pertama udang tidak diberi pakan. yaitu pertambahan berat rata-rata 230 g. Dari pemeliharaan udang selama tiga bulan. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. Karawang. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. Hewan uji yang digunakan adalah udang vaname PL-48. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. produksi . survival rate.n pengapuran sebanyak 175 kg/petak.000 kg/ha rumput laut. penebaran dilakukan setelah satu bulan dari penebaran tokolan. pemberantasan hama. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak.

penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. dan metabolit udang. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0. pelakuan B = sagu. 25. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. dan Rotatoria. pola intensif. Dinophyceae. indeks keseragaman menunjukkan komunitas plankton pada . udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Polychaeta. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari.05) terhadap kelimpahan dan jumlah jenis plankton. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. perlakuan C = tapioka.6 m sebanyak 12 buah. dan Cyanophyceae.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. pola tradisional. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil.3 g dengan padat tebar 50 ekor/bak. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. kotoran. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. Pada budidaya udang vaname pola tradisional plus. menggunakan bak kayu ukuran 1 m x 1 m x 0. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. Hal tersebut perlu mendapat dukungan dari penelitian. dan perlakuan D = tanpa sumber karbohidrat. Pada budidaya udang windu intensif. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. masing-masing dengan 3 ulangan. KATA KUNCI: tepung tapioka.

udang windu . KATA KUNCI: plankton.perlakuan D relatif lebih merata dibanding perlakuan lainnya. indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil. probiotik.

Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. dan produksi udang vaname. Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. indeks keseragaman. B = 2 mg/L. perlakuan B = kotoran sapi. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. pH. NO . indeks keragaman. dan indeks dominasi plankton selama pemeliharaan udang windu. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. pertumbuhan. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang.05) terhadap jmlah jenis dan kelimpahan plankton. sintasan. namun berpengaruh tidak nyata (P>0. Abdul Malik Tangko. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. C = 4 mg/L. BOT. serta Oscillatoria dari kelas Cyanophyceae. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas.05) terhadap pertumbuhan udang vaname. Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0. Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. Nitzschia.05) pada sintasan dan produksi udang vaname. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. dan Pleurosigma dari Kelas Bacillariophyceae. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. PO . Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing- . suhu. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0. dan perlakuan C = dedak padi halus. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea. oksigen terlarut. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname.000 ekor/petak). sintasan.5 m dengan volume air 400 L. Hasil penelitian menunjukkan perlakuan berpengaruh tidak 4 2 3 nyata (P>0. NO . KATA KUNCI: probiotik. setiap 15 hari. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air.

689–0. KATA KUNCI: dinamika plankton.199–1. udang windu.masing: indeks keragaman (1.324– 0.362). tambak . pupuk organik.427). indeks keseragaman (0.780) dan indeks dominansi (0.

5 dan 21. substrak tanah sawah. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka. Machluddin Amin. udang windu .. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru. Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak.8±0.24.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau. Penelitian dilaksanakan pada tambak ukuran luas 4.3±1. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1.05) antara perlakuan substrak tanah tambak.sedangkan pada perlakuan A dan B masing-masing 2. di mana masing-masing perlakuan diulang tiga kali. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau. Substrak tanah sawah. Substrak tanah lumpur.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A).01 g. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak.6. KATA KUNCI: substrak. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak. budidaya.dan Rp 19.14 dan 2. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0. umur pemeliharaan. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak. KATA KUNCI: efisiensi.984. B. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2.. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28. Perlakuan yang diujicobakan dalam penelitian ini adalah A.0±5. biaya pakan pada perlakuan A dan B masing-masing Rp 11. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak).650.875. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari. dan C. udang pama. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan.239..634.03±0. dan substak tanah lumpur. Substrak tanah tambak. biaya produksi. masing-masing dengan dua ulangan.2 cm dan bobot awal 0.

Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48.66 g/ekor. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar. masing.2 ± 13.6813.3 ± 7. Namun demikian. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. kisaran produksi 12. di mulai setelah satu minggu penebaran.28-13. lebih tinggi daripada perlakuan B = 41.235 kg/ha).86 g/ekor. dengan rata-rata berat 11. ukuran 84 sampai dengan 89 ekor/kg) dan C (16.64 kg/bak atau rata-rata 11. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah. pertumbuhan udang.998.15%. dengan rata-rata berat 12. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau. Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C). Pakan diberikan dengan dosis 100%–2% dari total biomassa udang.975 dan lebih .Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. Maros. KATA KUNCI: tepung tapioka. lebar dan kedalaman secara berurutan adalah 10 m.45 kg/bak atau rata-rata 12.7%.6 kg/500 m2 = 406 kg/ha. B). Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah.masing bak mempunyai ukuran panjang. ukuran 80 sampai dengan 96 ekor/kg).767.86 kg/bak (8.5 m dan 1 m. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan. fermentasi probiotik.66 kg/bak (7. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25.7%. 1. kisaran produksi 9. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2. Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B).0 ± 2.61%.2 kg/500 m2 = 506 kg/ha.7% dan perlakuan C = 36. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A.4 ± 0. Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan.7 kg/500 m2 = 320 kg/ha.1 ± 13.92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90.3 ± 5. namun tidak berakibat terjadi kematian massal.

325. salinitas rendah . udang vaname.rendah dibandingkan perlakuan B yang mencapai 1. KATA KUNCI: molase.

0 hari. sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. Pemberian probiotik B dengan konsentrasi 2. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F.5 mg/L. 1995). Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab.) dan probiotik B (mengandung bakteri Bacillus polimyxa. Tingkat sintasan yang diberi probiotik B berkisar antara 63. Pengaruh perlakuan terhadap sintasan. dan kontrol 66. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan. sedangkan juvenil dan udang dewasa hidup diperairan tawar. dan 0‰ sebesar 11. dan tiga ulangan.002 mL/L. dan pertumbuhan udang. Nitrobacter sp. sebelum diaplikasikan di tambak. Universitas Padjadjaran.. KATA KUNCI: salinitas. B.) berpengaruh nyata terhadap sintasan benih udang windu. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata.75%. Pemberian probiotik A dengan konsentrasi 0.6±0. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. Pemberian probiotik A dengan konsentrasi 0. 85%. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz. Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata. Kontrol (tanpa pemberian probiotik A).57 hari .5 mg/L. dan D.25%.) yang berukuran PL-20. Dengan meneliti dua jenis probiotik. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL).. Pemberian probiotik A dengan konsentrasi 0. 5 ‰. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol). Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter). Pemberian probiotik B dengan konsentrasi 7. diikuti perlakuan 5‰ sebesar 10±0. karena secara alamiah larva hidup di periran bersalinitas. dan R. sintasan. terdiri atas: A. Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang. Pemberian bakteri probiotik A (Bacillus sp. Nitrosomonas sp. waktu inkubasi.. C.. Aplikasi probiotik setiap tiga hari sekali.3±1. P. Kontrol (tanpa pemberian probiotik B). Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan. 88%.25%.50%. udang galah. Pemberian probiotik B dengan konsentrasi 5. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah. Pemberian bakteri dengan konsentrasi 0. Rhodococcus sp. yaitu probiotik A (mengandung bakteri Bacillus sp. Pemberian probiotik A memberikan pengaruh terhadap rata-rata . Penelitian II pengujian probiotik B. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6. terdiri atas: O.0 mg/L.Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.).001 mL/L. 10 ‰. Penelitian I adalah pengujian probiotik A. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji.75%–68. laterosporus. B. Q. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62.001 mL/L menghasilkan sintasan sebesar 81. sebagai dasar perbaikan sistem penyediaan larva udang galah.15. Parameter yang diukur adalah kualitas air. 85%.003 mL/L. Masing-masing perlakuan diulang sebanyak empat kali. dan Rhodobacter sp.

4255–0. KATA KUNCI: probiotik.001 mL/L menghasilkan pertumbuhan tertinggi (0. udang windu. kualitas air.3660 g. pertumbuhan .pertumbuhan mutlak benih udang windu. Ratarata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0. pemberian dengan konsentrasi 0. sintasan.8935 g). Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata.4440 g dan kontrol 0.

20 ppt. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor. Guna mendukung prgoram revitalisasi tambak.05). Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi.92±0.33±0. dan 20 ppt sintasan dari post larva udang galah mencapai 100%. KATA KUNCI: Macrobrachium rosenbergii. KATA KUNCI: pertumbuhan. 15 ppt. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.09 cm. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.67%.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH. Ditinjau dari keragaan pertumbuhan. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. 15 ppt. 10 ppt. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. Sukamandi. yaitu templat dengan berat molekul tinggi (1). diantaranya karakteristik templat DNA genom yang meliputi kemurnian. salinitas. dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. Selain itu. sedangkan sintasan pada perlakuan 25 ppt mencapai 61. dan ukuran templat. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. 25 ppt. udang galah .13 cm dan 1. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. PCR. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. 10 ppt (kontrol). Hasil yang diperoleh adalah pada salinitas 5 ppt. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3). konsentrasi.

Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. KATA KUNCI: kepiting bakau. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. dan gabungan keduanya (C). Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. maupun lebar karapas (P>0.05). Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. baik pertumbuhan bobot.5%. Oleh karena itu. panjang. KATA KUNCI: pergantian kulit. Sulaeman. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. ikan rucah (B). Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). Pakan diberikan dua kali sehari selama penelitian. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). pemberian pakan.Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan. Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. Sintasan yang diperoleh pada penelitian ini yakni 52%–54. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen. kepiting bakau. Dari pencapaian bobot ini. kepiting lunak . manipulasi lingkungan. Berdasarkan persentase. dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau.66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. Benih kepiting crablet-30 (C-30) dengan bobot rataan 0.

Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan.05±0.2 mm dan 0.000 m2. data yang diperoleh dibahas secara deskriptif.2 ± 2. pertumbuhan. produksi . merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan.5 bulan dengan panjang dan bobot masing-masing adalah 8. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. KATA KUNCI: kerapatan hutan mangrove.573. sintasan.1±0. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi. Tambak ditebari benih rajungan. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi. Ikan bandeng yang digunakan adalah gelondongan umur 1.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh. tambak bersalinitas tinggi.100 pohon/ha. Tambak yang digunakan berukuran 10. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰— 4 9‰) mengakibatkan sintasan dan produksi rendah.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena.04 ha. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009. jumlah permudaan 450–500 pohon/ ha.300 pohon/ha dengan rata-rata 1. sehingga perlu riset budidaya rajungan pada musim kemarau. Peubah yang diamati adalah pertumbuhan lebar karapas. Dibalik manfaat mangrove yang demikian banyaknya.000–1. dan produksi serta parameter kualitas air. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi. rumput laut dengan kepadatan 1. perlindungan.2 g. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau. sintasan.0 ± 2. dan pelestarian alam. Hasnawi. restoking kepiting bakau.000 ekor/ha ukuran crablet-30. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. bobot.7 cm dan 4. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: rajungan. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1.02 g dengan kepadatan 1 ind. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan./m2. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari).

Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. Secara umum. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. Kappaphycus alvarezii. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. KATA KUNCI: Danau Maninjau. KATA KUNCI: minapolitan. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. I Nyoman Radiarta. bioakumulasi. SIG.03 mg/L. Anjang Bangun Prasetio.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). Provinsi Gorontalo. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). logam berat . kondisi perairan sangat mendukung pengembangan budidaya rumput laut. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010. Secara umum. DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. Adang Saputra. Untuk memfokuskan kegiatan budidaya rumput laut. layak. Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. cukup layak dan tidak layak. rumput laut. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0.

kimia. GONDOL-BALI Apri I. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. N. dan plankton dilakukan seminggu sekali. Supii. TSS. DO.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. Adi Hanafi. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet. inlet. Indeks keanekaragaman berkisar antara H’=2. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. Nitzschia sigma. indeks keseragaman berkisar antara E=0. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. SUBANG Joni Haryadi*). Sampling air secara regular untuk pengamatan fisika. Kualitas kimia air untuk pH. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton.7112. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. KATA KUNCI: alga perifiton. Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah.962.853. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10. tambak. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air. sedangkan indeks dominansi berkisar antara D=0. KATA KUNCI: kualitas air.0760. nitrit.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. Subang. dan Erlania*) *) Pusat Riset Perikanan Budidaya. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2.814-0. alga hijau biru dan alga hijau). Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu.085. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut. Dara Kasih**). Perifiton yang terdapat di Tambak Blanakan. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom. 20 dan 30. BBRPBL Gondol . Subang. outlet.

Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung. ikan nila. Ani Widiyati. yang terdiri atas: 9 jenis pakan untuk ikan mas. Perlakuan adalah pemupukan dengan perbandingan N. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan. nila (Oreochromis niloticus) dan bawal (Colossoma sp. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp.88–1. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan. 1.17% dan 8. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. KATA KUNCI: limbah.48%–9.89. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm.23%–6. akuaponik. serta produksi Moina sp.89%–17. kelimpahan. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur. K = 16:20:0.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin. dan keanekaragaman plankton.96 ±1.16 g. 2). Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP. indek dominasi. yaitu: ikan mas (5. Pengukuran N dan P dilakukan pada ikan dan pakan. Data dianalisis secara deskriptif. volume air 500 L.71%– 10. Panen Moina sp. Bogor.63% dan 10. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP .21%). P.) di laboratorium. Kusdiarti. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio).87. 9. 1.. Parameter yang diamati adalah jenis.53%) dan ikan bawal (8.78%).58%–13.73–1. ikan nila (3. KATA KUNCI: konversi pakan. limbah hara N dan P .90. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g. dan 3). dan bawal adalah 1. dan 1. dilakukan pada hari ke-8 sejak dilakukannya penebaran. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP.dengan produksi Moina sp.53%–15.83– 1. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal.89% dan 11. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp.900 g sedimen + 20 g TSP.

Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. sehingga dapat meminimasi kegagalan panen. Hasil yang diperoleh.6 juta ton per tahun sekarang ini menjadi 7. pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. Budidaya rumput laut khususnya Kappaphycus sp. Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. agalactiae. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. mata. Sukenda***). Isolat 1. Postulat Koch.6 juta ton per tahun pada 2014. KATA KUNCI: Streptococcus agalactiae. N14G (3). khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. Produksi rumput laut ditargetkan meningkat dari 2. 4. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. Oleh karena itu. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani PongMasak Balai Riset Perikanan Budidaya Air Payau. Oreochromis niloticus. namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S.1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir. N4M (2). yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. Esti Handayani Hardi**). Bogor **) Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. . dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*). sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian. N17O (4). Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S. Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. di laut dan Gracillaria sp. dan NK1 (5) yang berasal dari organ otak. agalactiae setelah dilakukan uji Postulat Koch.

penyakit. hama.KATA KUNCI: rumput laut. pencegahan .

Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir. nitrat 0. dengan tingkat kesesuaian lahan sesuai 21. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau. besi 0. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari. bahan organik total 37.90 ppt.37. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar.85 mg/L.30 ha dan tidak sesuai 3. Kabupaten Kepulauan Selayar. Pengumpulan data primer dilakukan dengan cara wawancara mendalam. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden. .57°C–30.820.33 ha. analisis hierarki proses.95 ha.039–0. kesesuaian rumput laut. kedalaman 1–40 meter. fosfat 0. oksigen terlarut 5.0037 mg/L. dan total suspensi <25–80 mg/L. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian. Petrus Rani Pong-Masak. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka. karakteristik.Indra Jaya Asaad. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara.0008–0. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009.095.32 ha. pH antara 6. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir.10– 36. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan.0032–0. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang. salinitas 36.01169 mg/L.695.610. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder.81–6. KARAKTERISTIK. Mudian Paena.3 meter. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. Syarifuddin Tonnek. nitrit <0. demikian pula dengan karakteristik físika dan kimia oseanografinya. Kata kunci : Opsi pemanfaatan wilayah pesisir.02–9. dan Makmur Balai Riset Perikanan Buddidaya Air Payau. KATA KUNCI: potensi.66°C. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27.09 mg/L.1113 mg/L. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1.0267–0. kurang sesuai 2.1–8. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya. suhu 29. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis.685 mg/L. Rachman Syah.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka. Penelitian ini bertujuan untuk mengetahui potensi.38–44.

kandungan oksigen telarut. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. konduktivitas. Rachman Syah.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. yaitu : faktor infrastruktur dan kondisi perairan. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. dan faktor pasar. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. Parameter kualitas perairan yang diamati adalah suhu. pH. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. Makmur.Indra Jaya Asaad. Utoyo. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. Kabupaten Pontianak . KATA KUNCI: keramba jaring apung. NO3. PO4 dan Fe.Indra Jaya Asaad. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. analisis faktor. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor. salinitas. tambak. Cakupan wilayah penelitian meliputi Teluk Hurun. Muhammad Chaidir Undu. A. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. NH3. faktor teknologi budidaya. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. Kata kunci : kualitas perairan. NO2. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA.

04 mgN% dan 6.0%. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15. dendeng.26%. rumput laut coklat. KATA KUNCI: ikan sidat.0%. bau. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk. Sedangkan nilai TVB dan pH masing-masing sebesar 21.44%. lemak. dan dijemur di bawah sinar matahari selama 18 jam.1% selama 60 menit. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat. dan rendemennya 37. kapang) dan rendemen. mikrobiologi (Angka Lempeng Total/ALT. kemudian direndam dalam larutan KOH 0. dicuci dengan air bersih. setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. KATA KUNCI: pengeringan. Rumput laut coklat setelah dipanen. Rumput laut coklat dibagi menjadi dua kelompok. abu.41%. kadar abu. dan viskositas natrium alginat). Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. Selanjutnya. abu.25% dan dendeng dengan bumbu ekstrak sebesar 59. dan tekstur) menggunakan skala hedonik. dan mutu natrium alginatnya mempunyai kadar air 19. terbuka di atas lantai pada suhu ruang (sekitar 30°C). Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik. Kadar air.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air.1%. dan dijemur di bawah sinar matahari selama 18 jam. dan 28. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. rendemen.46%. analisis fisika-kimia . dan pH).97%.4%. dan protein masing-masing sebesar 14. Jakarta **) Pusat Riset Perikanan Budidaya. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). Rendemen dendeng sidat dengan bumbu kasar sebesar 57. rasa. kimiawi (kadar air.663 cps. 28. Kelompok kedua ditebar di atas lantai dengan beralaskan waring. natrium alginat. viskositas 8. TVB. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempahrempah kasar dan halus (ekstrak).32%. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna. protein lemak. 7. kadar abu 19.

Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. serta ketersediannya dalam skala kecil. kekurangan modal. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. pengalaman petani ikan dan Kebijakan Pemerintah. prasarana fisik yang kurang mendukung. agribisnis perikanan . Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. Faktor pendorong yaitu ketersediaan air yang melimpah. Identifikasi faktor-faktor pendorong maupun faktorfaktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya. harga ikan yang tergantung pembeli dan cuaca.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Metode yang digunakan adalah studi kasus. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. kelembagaan yang menunjang. KATA KUNCI: potensi desa. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. polusi air.

Sign up to vote on this title
UsefulNot useful