Forum Inovasi Teknologi Akuakultur 2010

ABSTRAK PRESENTASI ORAL

Forum Inovasi Teknologi Akuakultur 2010

FF 01
PERFORMA IKAN NILA BEST DALAM MEDIA SALINITAS
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: =2,1±0,23; W = 7,0±0.29; = 139,8±6.72; 7,5ppt = 2,3±0.06; 0ppt 0ppt 0ppt L B L W7,5ppt = 8,2 ± 0,42;7,5ppt = 164.3 ± 8,46; 5ppt = 2.3 ± 0,21; 15ppt 7.8 ± 0,45; B = 155,6 ± 8,95. Pengamatan setelah W B L1 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-5 : 4,0±0,34; 3: 4,8±0,27; 5- : 7,4±0,35; 5: 9,2±0,98. 5 15ppt8 0ppt8 15pptPengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
0ppt 15ppt

KATA KUNCI:

nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
PENGUJIAN LANGSUNG EMPAT STRAIN IKAN NILA (Oreochromis niloticus) PADA SALINITAS 40‰
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen ) dengan 8 ulangan dari masing-masing strain. Analisa 50 (LT data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise

Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata 50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru LT (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT
50

Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. 1 2 3 Hasil penelitian menunjukkan penggunaan S. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD). ikan nila. Sebagai perlakuan 0 adalah A (tanpa penambagan S. dan lokal Bogor.5797.) DENGAN ANALISA SIDIK RAGAM RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD) Iskandariah. dan A (penambahan S. Pertumbuhan terbaik diperoleh pada penambahan S. genetik. nila merah FF 04 ANALISIS KERAGAMAN GENETIK LIMA POPULASI NILA HITAM (Oreochromis sp. Universitas Padjadjaran ABSTRAK Penelitian ditujukan untuk menentukan persentase terbaik dari S. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. Oreochromis . cereviceae 3%). OPA-04. dengan nilai heterozigositas 0. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13. cereviceae 2%).1765– 0. A (penambahan S.0351–0. Populasi yang diamati meliputi jenis nila BEST. Gesit.3333%–46. Otong Zenal Arifin. cereviceae sebesar 2% KATA KUNCI: Saccaromyces cereviceae. pakan buatan. OPC-14. lokal Kuningan. populasi. Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor.Forum Inovasi Teknologi Akuakultur 2010 FF 03 PENGGUNAAN Saccharomyces Cereviceae PADA FERMENTASI PAKAN BUATAN UNTUK MENINGKATKAN PERTUMBUHAN NILA MERAH (Oreochromis Niloticus) Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan. cereviceae 1%). cereviceae sebagai perlakuan dan lima kali ulangan. dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. fermentasi. Nirwana. A (penambahan S.1952 dan jarak genetik antar populasi 0.6667%. dan OPC-15. dengan menggunakan primer OPA-03. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. KATA KUNCI: RAPD. cereviceae). Bogor ABSTRAK Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi.

Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. limfosit perlakuan tidak berbeda nyata dengan kontrol. XY.81% dan 83. XY. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. Pada uji tantang setelah minggu keenam. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. 106. Pada perkembangannya. Untuk kontrol. tidak cukup untuk memberikan protektif terhadap S. Budidaya Perairan. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. yaitu genotype XX. Kata kunci : Ikan nila. Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. Tetapi setelah uji tantang.55% sedangkan genotipe XY dan YY masing-masing sebesar 79. SR). S. diferensiasi kelamin. titer antibodinya menurun. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. Perlakuan dengan injeksi sel utuh S. agalactiae. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. Data sintasan (Survival Rate. dan differensial leukosit dilakukan analisa sidik ragam (Anova). 106. 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga. Komar Sumantadinata**). ikan nila . Hasil yang diperoleh bahwa sel utuh (whole cell) S. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. agalactiae. genotipe. KATA KUNCI: vaksin sel utuh. DAN YY Didik Ariyanto*). agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. Fakultas Perikanan dan Ilmu Kelautan. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). Uni Purwaningsih*). agalactiae secara intra peritoneal pada ikan uji sebanyak 0. Oreochromis niloticus Angela Mariana Lusiastuti*). Sukamandi **) Dept. agalactiae pada tingkat kepadatan 108. ikan uji disuntik dengan PBS. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. titer antibodi. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. Selain ditentukan secara genotipe. dan YY melalui evaluasi nisbah kelamin yang dihasilkan. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. Pada akhir pendederan dilakukan identifikasi jenis kelamin.Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX.01%.1 mL/ekor. Genotipe XX mencirikan betina dan XY untuk jantan. pengukuran bobot individu rata-rata dan penghitungan sintasan.

melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. ortofosfat dan total fosfat. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. pH. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. C=104. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. DO. adalah septikemia dan meningoencephalitis. NH . Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. total nitrogen. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. KATA KUNCI: Streptococcus agalictiae. BOD. NO . karena pada kondisi perairan yang kurang . Selain itu. D=102 cfu/mL dan E=kontrol). dengan variasi perbedaan kepadatan bakteri vaksin (A=108. Anjang Bangun Prasetio. terutama dalam hal manajemen pemberian pakan. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar.5). Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. Angela Mariana Lusiastuti.5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. dan Joni Haryadi Pusat Riset Perikanan Budidaya. pemanasan. Selain itu. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. kecerahan. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. turbiditas. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. B=106. Pemberian pakan tidak boleh berlebihan. NO . dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. serta data status kegiatan 3 2 3 budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. TDS. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan.

baik akan menyebabkan stres pada ikan. KATA KUNCI: manajemen pakan. lingkungan perairan . keramba jaring apung (KJA). Danau Maninjau.

dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Parameter yang diamati meliputi keragaan pertumbuhan (panjang.05) bila dibandingkan dengan dua populasi lainya.20%. tebal (-1.22%).53 % bt/hari. oreochromis niloticus . Sukamandi **) Dept. lebar (0. Fakultas Perikanan dan Ilmu Kelautan. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (2.64% bobot badan (bt)/hari.82%).74%). tidak berbeda nyata (P<0.21%). SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2.87%) dan sintasan (0. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. Sukamandi selama lima bulan. sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2.06%). tinggi. bobot ( -2.94%). Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia). Nunuk Listiyowati. dan sintasan(1.Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*). Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.65%).80%. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4. tebal (0. persilangan. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat. bobot) dan sintasan. Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49.48% bt/hari dan 2. Budidaya Perairan. bobot (-2.44%). tinggi (3. KATA KUNCI: heterosis. Komar Sumantadinata**). tebal.48%). sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74. IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi.35% bt/hari.

2. Bogor. 72. NK1) dan 1 isolat S. 48.8090) dan benih ikan nila 5. SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA. dan 96 jam terhadap benih ikan mas adalah 4.9421 mg/L (1.9823–4. 72.5480). 3. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration ) 24.6578–2. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S.4227– 4. N4M. 50 LD iniae (N2O). Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp.81±0.7138 mg/L (0. Hasil penapisan menunjukkan bahwa bakteri S. agalactiae (N4M) memiliki nilai terkecil.6799–13.6904– 5.0678 (1. Konfirmasi taksonomis hingga level spesies isolat bakteri S. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak.9237(0. Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar.0839(2.08 g.13 dan 1. 0.8532). 48. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). agalactiae (N3M. benih ikan.7504). dan 96 jam. dan nilai terbesar dimiliki oleh bakteri S.1295). SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN. 1. Penelitian dilakukan di Instalasi 50 (LC Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung. dan 96 jam. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp.6297–0.8101–1. 48. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila. uji stabilitas dan LC50–24. Data diolah dengan analisis probit program LC50.55±0. iniae (N2O). Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis.0430 (4.7877–2. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin. 3. N17O.5805). Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan. dan sonikasi. 0.0930).3354 (3. 50 KATA KUNCI: toksisitas. pemanasan. . Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan.5094 (2. N14G.1100). agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar. Hasil penelitian menunjukan bahwa Nilai LC 24.

streptococciasis. vaksin.KATA KUNCI: penapisan. ikan nila .

00 pagi hari.5 kg. kadar air 13. kambing. sarung tangan. Pembenihan ikan ini mulai berkembang di sekitar Gondol. Nusa Tenggara Timur.76 kg/cm2. lemas. tas. sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. liat. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. dan 15% . dan corak permukaannya spesifik. dan 102. namun sintasannya masih rendah yaitu sekitar 1%–3%. Ikan ini relatif sensitif dengan perubahan lingkungan. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya.62%.2 g. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. kekuatan jahit 1. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek.184. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi).97% sehingga sangat prospektif untuk 2 3 dijadikan barang-barang kerajinan kulit. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih. kadar lemak 6. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi.94%.00 sampai jam 03.93% dan kadar Cr O 1.00. kekuatan regang (kemuluran) 66.12 kg/cm. dan 80 ekor/m3 selama 5 bulan masing.0–3. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g. garmen. dompet. Waktu pemijahannya sekitar jam 24. Telur yang ada dalam kolektor dapat diambil jam 07. karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa .5 g.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. Sulawesi. Dalam pembesaran. Ikan ini mudah terserang parasit seperti cryptocarion.53 N/cm atau 138. yang merupakan limbah perikanan dari perusahaan filet ikan. suhu kerut 88°C. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih. kakap putih.354. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat. kambing dan ikan pari yaitu berisi. benedinia.46 N/ cm2 atau 222. dan Sumatera. dan cacing. KATA KUNCI: bahan penyamak kron. untuk dijadikan kulit tersamak.00–08. 40. dan sebagainya. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu. kadar abu 2.66%. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. Selain itu. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. 10%. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia. 103. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20.masing mencapai ukuran 127. kekuatan tarik 2.0 g. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan. simetris. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1.

kerapu sunu .Tenggara Barat. KATA KUNCI: pembenihan. pembesaran.

Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. ikan kerapu tikus . namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. transfer gen. Situbondo **) Fakultas Perikanan dan Kelautan. lama kejut 30 ms. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. di antaranya Indonesia. Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. mikroinjeksi. dan Gemi Triastutik*) *) Balai Budidaya Air Payau. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. hormon pertumbuhan. 2. 10 µg/mL. M. KATA KUNCI: transfeksi. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. mikroinjeksi. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. jarak waktu antar kejutan 0. sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. Metode elektroporasi dilakukan dengan voltase 50 V. Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. elektroporasi. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. Namun demikian. Irvan Faizal*****). Alimuddin***). dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. dan 3 detik. Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH).Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. Sasmito Jati****).1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. Cromileptes altivelis Slamet Subyakto*). mikroinjeksi. dan 20 µg/ mL. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. jumlah kejutan 5. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. Ratu Siti Aliah*****). Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. Komar Sumantadinata***). Rustidja**).

Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan.000 ekor/bak.69 mm). Sampling dilakukan setiap minggu.02%) serta nisbah konversi pakan (1. dan 15% dari total biomassa benih.20-4. optimasi pakan. nisbah konversi pakan.35 cm). B (oksigen).90±0.19%) harian serta laju pertumbuhan bobot badan spesifik (6. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal. dan efisiensi pakan pada benih kerapu sunu. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0. Peubah yang diamati adalah sintasan.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu.00%) yang baik bagi benih kerapu sunu. Materi yang digunakan adalah larva kerapu sunu sebanyak 4.42±0.31±0.39±0.35 mm). KATA KUNCI: benih kerapu sunu.25) dan efisiensi pakan (80. Namun. 10%. C (probiotik). dan perlakuan B (63. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen). Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus).69 g dan panjang total awal 3. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan. KATA KUNCI: larva kerapu sunu. yaitu 5%. pertumbuhan. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU. serta terakhir perlakuan D (47. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan. D (kontrol).20 cm. laju pertumbuhan bobot badan harian (10.68 g) dan panjang total (6. efisiensi pakan.73%) dan panjang total (9. Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva. laju pertumbuhan spesifik. oksigen .19%) dan panjang total spesifik (1. Pemberian pakan dilakukan tiga kali sehari. Pakan yang digunakan adalah pakan pelet komersial.52±0.50-0. Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan. probiotik. Salah satu faktor yang berperan adalah lingkungan pemeliharaan. Kendala yang dihadapi terutama terjadi pada stadia awal.86 mm). Nilai pertambahan panjang tertinggi A (72. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3.95 mm). pertumbuhan panjang larva. dan kualitas air. laju pertumbuhan harian. selanjutnya perlakuan C (64.19±0. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut.

imunstimulan. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. mencapai ukuran panjang total pada perlakuan A: 24.87. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular.08 ± 2. Bejo Slamet.08 ± 1. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. B: 24. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari. Perlakuan B: 4 kali/hari pada umur 7-20 hari. infeksi.5 ± 4. terutama infeksi virus.65%.96 mg. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny.04 ± 0.0x105 sell/mL. Perlakuan C: 5 kali/hari pada umur 7-20 hari. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido. KATA KUNCI: pakan buatan.62 ± 2.57 mm. serta bobot badan pada perlakuan A: 192. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C. Perlakuan A dan B tidak berbeda nyata. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind. Des Roza. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1.55 mm dan C: 26.81 ± 0.87 cm dan sintasan setelah diuji tantang sebesar 72. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun non.1 ± 2./mL dan mulai umur 17 hari diberikan nauplii Artemia. Epinephelus fuscoguttatus Irwan Setyadi. KATA KUNCI: Epinephelus fuscoguttatus. perlakuan B adalah 6.50%. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L. larva kerapu macan. dengan kepadatan 1. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut.12 mg dan C: 211. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian.95 mg.5 ± 2. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang. sedangkan kontrol hanya disuntik dengan PBS.spesifik ikan kerapu macan.62%. Gondol ABSTRAK Ikan kerapu macan.68 mm. indeks fagositik sebesar 1. Mulai larva umur 2 hari diberikan Nannochloropsis sp.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN.03% dan perlakuan C adalah 8. Masing-masing perlakuan diulang 3 kali. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0.00%. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting. kerapu macan . B: 196. aktivitas lisosim sebesar 1. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari. Anak Agung Ketut Alit. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan.20 ± 0. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19.

Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen. Setiap bulan dilakukan pengamatan pertumbuhan bobot. Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. generasi kedua (F-2). Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir. pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari. panjang. dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp. konsentrat mempunyai sintasan 19. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor. perkembangan oosit . Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah. dan dilihat perkembangan oositnya. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp. KATA KUNCI: efisiensi. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. Sampai dengan bulan Oktober telah berhasil memijah. pembenihan. sedangkan pada bak B : pakan pelet kering. KATA KUNCI: kerapu bebek (Humpback grouper). kerapu bebek (Cromileptes altivelis). Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi.86 mm.72% dan panjang total 18. yang kurang baik. pada bak A : ikan rucah + cumi-cumi + vitamin.10% dan panjang total 21. Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. konsentrat yang bisa dibeli di pasaran. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk. dengan sintasan 6. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu.

histologi. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). Tangki pemeliharaan yang digunakan ukuran 8-10 m3. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. 4. produksi massal . 15. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin.8%-41.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. Cromileptes altivelis Yasmina Nirmala Asih. 13. 20. dan 32 hari setelah menetas masing. 2. Selain itu. KATA KUNCI: pemeliharaan larva. Ketut Mahardika. KATA KUNCI: kerapu bebek. mutu benih kerapu.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. 7. Sampel larva diambil pada umur 1. Indah Mastuti. 17. Tetapi tingkat sintasan yang didapatkan masih rendah. 3. 5. manajemen air media pemeliharaan dan manajemen pakan. Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. 10. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor. Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri.masing sebanyak 10-20 ekor. pemeliharaan dilakukan hingga yuwana (2 bulan). 25. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D15).

4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. 5%. survival rate. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. (pakan kontrol). dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). siklus pertama. pertambahan bobot. dan ketiga menggunakan larva tanpa kekebalan bawaan. Sumber protein utama pada pakan adalah tepung ikan. perlu alternatif lain sebagai substitusi tepung ikan. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. KATA KUNCI: innate immunity. dan siklus kedua menggunakan larva dengan kekebalan bawaan.Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. 15% (P>0. Pakan penelitian berupa pelet kering dengan kandungan PST 0%. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. I Nyoman Adiasmara Giri. Hasil penelitian menunjukkan bahwa nilai bobot akhir. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. Oleh karena itu. Salah satu sumber protein alternatif adalah protein sel tunggal (PST). Oleh karena itu. laju pertumbuhan spesifik. Pangasius hypophthalmus . kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. 10%. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. di lain pihak hasil tangkapan cenderung menurun. dan 20% dalam pakan. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR).05).651 ekor benih untuk setiap induknya. tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. Ketut Suwirya. Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. akibat serangan penyakit dan kondisi media. catfish seed. Tingkat kematian larva dapat mencapai 40%–80%. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. Pakan diberikan 2 kali secara “adlibitum”. 10%. 15%.797–457. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. KATA KUNCI: protein sel tunggal. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. Lies Emmawati*). Kematian larva umumnya terjadi pada hari keempat.

Pangasius djambal. Kecernaan protein tertinggi berturut-turut pakan C (82.13% per hari. Pangasius hypopthalmus Mohamad Amin.14%). Dade Jubaedah. Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan.674±2. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya. Pakan diberikan 3 kali sehari secara at satiation. kemudian salinitas 3‰ (4. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik).07 cm).49 cm).75±0.4%).17% per hari menjadi 1. benih. Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter. D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase). Ade Dwi Sasanti. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰. Kecernaan P pakan B (98.32% per hari menjadi 4. pakan A (82. (B) 2‰.910±0.3%) dan pakan D (80. selama 30 hari.25±0.93%) dan terendah salinitas 3‰ (25. yang dilanjutkan dengan uji Tukey. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32.92 cm). Data diperoleh dianalisis sidik ragam.1%) berbeda nyata lebih tinggi dibanding pakan D (97.5 g/ekor.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN.1%).223±0. dan salinitas 1‰ (3. dan A (98. pakan B (82.1%) dan pakan E (95.010±0.46% per hari. ikan patin.204±0. sintasan serta beberapa parameter kualitas air.2%).00%). KATA KUNCI: salinitas. dan sintasan .4%) berbeda nyata lebih tinggi dibanding pakan E (68. Analisis data dilakukan secara deskriptif.114±0. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak). Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3. KATA KUNCI: fitase . sedangkan laju pertumbuhan panjang harian meningkat dari 1.0%). dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan. Kecernaan protein juga meningkat akibat penambahan enzim fitase. dan (C) 3‰ dengan tiga kali ulangan.763±0. dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan.884±2.140±0. pakan C (98.35±0.3%). diikuti salinitas 2‰ (28.764±3. Ikan patin sebayak 15 ekor. Ikan uji yang digunakan berukuran 2 ± 0. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm.8%). C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati. Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4. Parameter yang diamati adalah laju pertumbuhan panjang badan.

nila. B (95. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan. Padat tebar larva yang digunakan adalah 100 ekor/m2. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. Pupuk anorganik + organik. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan. penetasan telur dan pemeliharaan larva di kolam. Larva yang ditebar berumur 20 jam setelah menetas.526. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan ikan.19±0. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam. belut.60±10. udang liar) serta jenis serangga air. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia.7% rendahnya sintasan ini diduga karena adanya faktor hama. 0.31 cm B. pengecekan induk.5). Pemberian pakan dengan pelet apung sebanyak 5% per hari. dan C (613.74±0. Jika luas gambut Indonesia adalah 20 juta ha. Akmal.12 g dan 3.08 g dan 3. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam.42±0.3 g) dan SR perlakuan A (91. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut.5%-9. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia. Pemupukan. komposisi pakan alami kolam. B (7 ekor/m2).Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari. sepat. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4.27±0. B (660 g).7. Sularto.5 juta ha (rata-rata 20 juta ha).2%). Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2). yaitu antara 13. Patin Siam. Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masingmasing perlakuan: A. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g).37 cm C 16. betok. predator yaitu antara lain: Ikan liar (gabus. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.49±1. dan Syafrudin Balai Budidaya Air Tawar. Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah. 0. sintasan ikan. namun perlakuan B (7 ekor/m2) . dan C (95. dan C (10 ekor/m2) dengan 3 kali ulangan.9%). Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. Pupuk anorganik + organik yang difermentasi + Probiotik. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. Pupuk anorganik + organik + probiotik dan C.51 g dan 11. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. B. dan sintasan Kata kunci: Intensifikasi.26 cm. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam. pemijahan.

memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95. lahan marjinal . ikan patin. KATA KUNCI: budidaya.2%.

dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. nasutus . Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99.10%/hari. 15 dan 20 ekor/m2 dengan bobot awal antara 15. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin. pertumbuhan. Percobaan dilakukan selama 100 hari pemeliharaan. diikuti dengan kepadatan 10 ekor/m2 (92. Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda.76 cm dan 2. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan.000 ekor atau kepadatan 5 ekor/m2.71).52%) dan terendah pada 20 ekor/m2 (91.80%.54 g dan panjang awal antara 10.36 cm. Evi Tahapari***). Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3.76%).17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3. pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2.5 m. Evi Tahapari. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya.000 ekor atau kepadatan 10 ekor/m2.06%) dan terendah pada kepadatan 20 ekor/m2 (7.70–20.43–11. Jakarta **) Balai Riset Perikanan Bididaya Air Tawar.45 g).47 g).60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97.30%). di samping itu. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8. Padat tebar yang digunakan adalah 5. Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98.46 g). Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih. Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 15 ekor/m2 (70. dan Sularto***) *) Pusat Riset Perikanan Budidaya. Kata kunci: padat tebar. 10.18) dan terendah pada 10 ekor/m2 (1. KATA KUNCI: patin pasupati. salinitas.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES. Zafril Imran Azwar**). Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah. dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3.09 cm dan 1.74 g) dan 20 ekor/m2 (61. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95. Sifat biologi pertumbuhannya belum banyak diketahui. JAWA TENGAH Ongko Praseno*). Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. sedangkan petakan kedua ditebar sebanyak 2. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%. pertumbuhan.

Nurbakti Listyanto*). Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar. Evi Tahapari*). Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0.67%). dan (C) 0. kemudian dosis 0. Ikan uji yang digunakan berukuran 3–4 inci. Sukamandi. Perlakuan kedua adalah padat tebar: 5 ekor/L. 108. Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109.003 mg/L dengan tiga kali ulangan. 106.002 mg/L (83. diikuti dosis 0. Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. Analisis data dilakukan secara deskriptif.001 mg/L. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*).003 mg/L (4. Parameter yang diamati adalah insidensi dan sintasannya. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. yaitu: cara perendaman dan cara penyuntikan intraperitonial. 109. Uji tantang dilakukan dengan dua cara. sebagai perlakuan yaitu: (A) 0. dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. dosis. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan. (B) 0.001 mg/L (86. dan kontrol (placebo). Ikan uji yang digunakan berukuran 1–2 inci. dan kontrol.49 cm).Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*). dan 15 ekor/L. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo. benih.003 mg/L (81. Pengamatan dilakukan selama 15 hari setelah perlakuan.35 ± 0. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air.002 mg/L (4. 107. Jakarta **) Balai Besar Riset Perikanan Budidaya Laut. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. intraperitonial. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. perendaman. dan pertumbuhan . Kata kunci: uji tantang Aeromonas hydrophila. KATA KUNCI: probiotik. sintasan.14 cm). Bogor ***) Pusat Riset Perikanan Budidaya.001 mg/L (4. Angela Mariana Lusiana**). Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal.002 mg/ L. kemudian perlakuan dosis 0.67%).55 ± 0.35 cm). Probiotik diberikan dengan dosis yang berbeda.33%) dan terendah perlakuan dosis 0.60 ± 0. 10 ekor/L. 108. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.

Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu.130–22.900 µm. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. larva. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11. Pangasius nasutus . yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm. tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus. 75% ampas tahu:25% tapioka. KATA KUNCI oosit. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. Derajat penetasan patin nasutus berkisar 44.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium.03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai.000 µm. Zafril Imran Azwar. substitusi protein 4.05% dengan lama inkubasi 22–25 jam. Aspergillus niger. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. Penelitin ini terdiri atas dua tahap.03% (pakan C). Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Ukuran panjang total larva yang baru menetas berkisar 3. ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad.250–1.41±0. hatching. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu. ampas tahu. substitusi protein 0% (kontrol) (pakan A).52% (pakan B). dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar. yakni pengamatan perkembangan gonad dan fertilisasi. artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai. substitusi protein 2. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. rearing.58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4. tahap 3 (granula kuning telur) dengan diameter oosit 700–1. KATA KUNCI: fermentasi. Perkembangan oosit patin nasutus bersifat sinkronis grup. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologireproduksi berkaitan dengan kapasitas produksinya. dan 25% ampas tahu:75% tapioka. 50% ampas tahu:50% tapioka. Ke dalam wadah ditebar ikan patin ukuran 11.850 µm. Bambang Iswanto.16%–79.700– 4. dan tahap 5 (atresis) dengan diameter oosit 300–1.700 µm.04% (pakan D). dan substitusi protein 6.

sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE.58%.42±0. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A.67%.14 mm. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa.08 mm3 yang terserap 50% pada umur 30 jam . 88. 92.33%. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat. dengan kantung kuning telur berukuran 0. B. 1. 4. 25% zeolit + 75% bioball. B. dan D. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0.20. berukuran panjang total 3. 4.24) x 103.64±0.75% dan terendah perlakuan A.62 g) dan panjang (2. B.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin. 79. 89. C. diikuti perlakuan C.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR.1±0. C.35 cm/ekor dan A. 1. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1.30ab. berukuran panjang total 3.25 g/ekor. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D. biofilter.45 g/ekor. 50% zeolit + 50% bioball dan D. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D. 2. 0. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER.20 mm. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi.6±0. 0.89±0. masing-masing perlakuan diulang sebanyak empat kali.54 cm).27a. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A.13 mm. pertumbuhan. dengan kantung kuning telur berukuran 0. 91.02 g/ekor.42.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias. 88. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D. C.98±0. dan D. KATA KUNCI: patin albino. 75% zeolit + 25% bioball. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi. C.30a.34±0. diikuti perlakuan B.03±0. 1. 100% zeolit B.10–1. C.56 cm/ekor. 2. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi.69 cm/ekor diikuti B. 1.01±0. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER.71±0.1. 0.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam.84 g/ekor dan terendah A.60 cm/ekor.43b.47±0. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian.31ab.01±0. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya. 95. 75.

hibrida.23%. tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus. siam. nasutus . larva. sedangkan patin hibrida siam-jambal sebesar -4.28%. Kata kunci: embriogenesis. jambal. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20.dan habis terserap pada umur 60 jam.

Hasil penelitian menunjukkan bahwa. dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. Untuk menentukan 2 3 total limbah N termasuk eksresi amonia. dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. lalu ditambahkan kromium oksida (Cr O ) sebagai indikator kecernaan. tambak. Dedi Jusadi**). Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%.0% untuk protein dan 81.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. padat penebaran udang windu. Enang Harris**).2% untuk bahan kering. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. Eddy Supriyono**). dan Anugriati Balai Riset Perikanan Budidaya Air Payau. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone. Oleh karena itu. Maros **) Fakultas Perikanan dan Ilmu Kelautan. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. Pakan tersebut digiling ulang. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak. Neltje Nobertine Palinggi*). ikan bandeng. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah.2 kg/ha/musim.6%–90. 88. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. lama ikan bandeng digelondongkan. 21% dan 26%. Oleh karena itu.2%–78. Akhmad Mustafa. produksi. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein .6%–83. Jika bioflok terbentuk. Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2.1% untuk Corganik. lama pemeliharaan ikan bandeng.990 kg/ha/musim dengan rata-rata 292. KATA KUNCI: pengelolaan. dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng.

diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%.pakan yaitu 2. N waste. dan 3. KATA KUNCI: feed digestibility.28% untuk pakan berprotein 26%. 2. heterotrof bakteria .27 g N untuk pakan berprotein 17%. Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok). milk fish.76 g N untuk pakan berprotein 21%.

PATI. Penyusun utama bioflok ini adalah bakteri heterotrof. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. KATA KUNCI: Heterotrofic bakteria. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri.975 ha. DAN PEKALONGAN ) Anjang Bangun Prasetio. Pati. Khususnya di wilayah Pantai Utara yaitu Kendal. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12.66% dari tahun-tahun sebelumnya. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya. KATA KUNCI: budidaya.726 ha dan yang layak untuk budidaya sekitar 6. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng.54% per tahun kurun waktu tahun 2005–2009. Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. Pada tahun yang sama. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia.000 ton dan mengalami kenaikan rata-rata 13. Oleh karena itu. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan. Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. Penambahan inokulasi bakteri komersial (Bacillus sp. Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari.000 ton dan mengalami kenaikan sebesar 14. Enang Harris**).250 ton. (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL. opsi kebijakan . (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. dan Rasidi Pusat Riset Perikanan Budidaya. Eddy Supriyono**). milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. kendala. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. growing. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%.) cenderung meningkatkan kandungan asam amino bioflok. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. Dedi Jusadi**). Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475. bandeng. dan Pekalongan. Hatim Albasri.organik. Molase digunakan sebagai sumber C.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol.

Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji.0%) dan yang terendah â-aktin-GFP (3. Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik.00±3. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp. ikan lele . Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. keratin. dan Utut Widyastuti***). mikroinjeksi.67%).0%).****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan.34±1. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi. GFP. Gusrina*). Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein.0±0. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. FMIPA. Fakultas Perikanan dan Ilmu Kelautan.0±10.03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA).) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0.66±1.33±1.66%) relatif sama. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi.65%. Hasil penelitian menunjukkan bahwa DKH-e (63.00±1.67%.33%.33±3. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. menyusul heat shock-GFP (10. KATA KUNCI: promoter.34%) dan DP (63. Konstruksi gen dalam bentuk plasmid mBA-gfp. Clarias sp. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi.3±0. dan heat shock-GFP berturutturut adalah 20. Data dianalisis secara deskriptif. Alimuddin**). DKH-e yang diinjeksi dengan â-aktin-GFP (25. keratin-GFP (21.GFP. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel. dan 15. DP untuk â-aktin-GFP.00±1. 18. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20. DKHe dihitung sebelum telur menetas.Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN.65%) dan heat shock-GFP (18. Ekspresi gen gfp tidak tampak lagi pada saat telur menetas. HEAT SHOCK DAN KERATIN PADA IKAN LELE.0%). Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10.63±10. Komar Sumantadinata**). sedangkan DP dihitung ketika semua telur telah menetas.

. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang. Ikan lele dumbo berukuran 41. pagi dan sore. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan. pakan terapung . Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5. Pemberian pakan sebesar 5% dari biomassa per harinya.33% kadar sari dalam air.30±2.37% kadar abu. 24. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0.53%) (P<0. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo.83% kadar sari dalam alkohol.74±1.25% sehingga tidak berbeda nyata dengan pakan terapung.05). Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif).47±4. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak.23% kadar abu tak larut asam. Kandungan bahan aktif hasil pengekstrasian pegagan segar.05) dari 79. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A.47±4. Taukhid. hydrophila menjadi penyakit endemis di Indonesia. Angela Mariana Lusiastuti. pegagan Centella asiatical [L] Urb. 1. pakan tenggelam. Melalui penambahan aerasi. Bak diisi air sebanyak 100 liter. 39. 6. aerasi. Rita Febrianti.41 mg/L) dengan dosis efektif 250 mg/L.623.34% kadar air. Feces yang dihasilkan diambil setiap hari. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani.15%) dibandingkan dengan pakan tenggelam (yakni 79. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi. 5.53% menjadi 92. pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. KATA KUNCi: A. 0. hydrophila. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus).Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB. Pada perlakuan tanpa aerasi.39% kadar asiaticosid. KATA KUNCI: kecernaan pakan. bahan aktif. ikan lele dumbo (Clarias gariepinus). dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus).71±2.

Forum Inovasi Teknologi Akuakultur 2010

FF 45
PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus)
Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar

ABSTRAK
Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. Wadah percobaan yang digunakan adalah bak beton ukuran 1,0 m x 1,0 m x 0,8 m, dan dirancang sistem resirkulasi. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9,33±0,10 g sebanyak 40 ekor. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol); 7,92%; 13,28%; 19,56%; dan 25,81% dalam formulasi pakan. Setiap perlakuan dengan 3 ulangan. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar, tapioka, dan molase. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11,96%, dan penurunan lemak 61,85%, dari perlakuan kontrol. Laju pertumbuhan spesifik, penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7,90%, namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25,83% tidak memperlihat perbedaan dengan perlakuan kontrol.
KATA KUNCI: maggot, fermentasi, formulasi, lele dumbo

FF 46
ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA
Tutik Kadarini, Siti Subandiyah, Sulasy Rohmi, dan Darti Satyani Balai Riset Budidaya Ikan Hias

ABSTRAK
Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2,3–3,1 cm. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0, 10, 20, dan 30 g/40 liter masing- masing diulang 3 kali. Jenis pakan berupa cacing tubifex, bloodworm, dan cuk yang diberikan diselang-seling secara adlibitum. Parameter yang diamati sintasan dan pertumbuhan (bobot, panjang, dan perkembangan gonad), kualitas air (suhu, pH, amonia, alkalinitas, oksigen, dan karbondioksida). Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3,8–4,7 cm mencapai TKG III.
KATA KUNCI: gurame coklat, reproduksi, ikan, dan gonad

Forum Inovasi Teknologi Akuakultur 2010

FF 47
APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC.) DI JAWA
Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi, Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman, yaitu seperti daun talas. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa, yaitu di Jawa timur (Blitar dan Tukung Agung), Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Dari hasil penelitian menunjukkan bahwa di daerah Blitar, Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan, penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat, sehingga petani tidak mengalami banyak kerugian.
KATA KUNCI: fish TB, Mycobacteriosis, Mycobacterium fortuitum, biokimia, PCR

FF 48
PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI
Bambang Gunadi, Lamanto, dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Ikan gurame termasuk ikan dengan fekunditas rendah. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang, produksi telur per sarang, dan tingkat fertilitas telur yang dihasilkan. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang), dan injuk sebagai bahan pembuat sarang. Induk gurami yang digunakan berbobot 2-3 kg/ekor, dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. Pakan yang diberikan berupa daun sente sebanyak 3,5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. Perlakuan yang diterapkan adalah kadar protein 38%, 33%, dan 14% sesuai dengan label pada kemasan masing-masing. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. Masing-masing perlakuan mempunyai 2 ulangan. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0,09). Pemberian pakan tambahan dengan kadar protein 38%, 33%, dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10.351 butir, 4.546 butir dan 2.730 butir. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2.774 butir per sarang. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92,23% dibandingkan dengan pemberian pakan dengan kadar protein 33%, 14% dan kontrol yakni masing-masing 79,05%, 28,86%, dan 71,94% (P=0,26). Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0,75 buah, lebih rendah dibandingkan dengan yang

diberikan pakan tambahan berkadar protein 33%, yakni 0,88 buah, namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0,13 buah) dan hanya daun sente (0,5 buah).
KATA KUNCI: ikan gurame, pakan buatan, daun sente, keragaan reproduksi

Kandungan protein dedak padi naik 19. oligosporus yaitu 2. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5. Kadar protein polar naik 38. mud carp sebesar 1127 bp.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas. Parameter yang diuji meliputi bobot akhir rata-rata. polar. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar.14% dan kadar lemaknya turun sebesar 19. Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. Reza Samsudin.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan . protein efisiensi rasio. dan selanjutnya polar dan dedak padi. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ – GATGAAACTCGAGTAGCCCTTGCTCTTC. dedak padi fermentasi. dengan ditandai tumbuhnya koloni transforman berwarna putih. dan polar fermentasi. retensi lemak. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen.05) dengan dedak padi tanpa fermentasi.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG. retensi protein. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar. Retensi protein dedak padi fermentasi. dan koloni berwarna biru tidak mengandung DNA sisipan.02% sedangkan kandungan lemaknya turun 13.33%. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. Bogor dan terdiri atas dua tahap. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. pertambahan bobot relatif. polar. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). dan pada Silver carp sebesar 1123 bp. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp.28%. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. Wadah percobaan yang digunakan yaitu akuarium volume 100 L. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. dengan padat penebaran ikan uji 30 ekor per akuarium. dan polar fermentasi berbeda nyata (P<0. 4. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi. yang menunjukkan terbentuknya plasmid rekombinan.47 g/ekor. dan sintasan. Retensi lemak tertinggi (35.3’). dan 6 hari.

berbeda nyata (P<0. dedak padi. ikan mas . oligosphorus. KATA KUNCI: R.67%–100%. dedak polar. fermentasi. Sintasan ikan uji berkisar antara 96.05) dengan perlakuan lainnya.

28 g/ ekor yang digunakan sebagai hewan uji. Provinsi Banten. wildan.akhir ini banyak lahan yang tidak digunakan (marginal). sawah. dengan lokasi penelitian di Desa Kronjo. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. Parameter yang diuji adalah kualitas air terutama kandungan ammonia. dengan padat tebar 20 ekor/m3. Benih ikan mas ukuran 18. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1. pertumbuhan. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. sedangkan yang lainnya sebagai kolam konvensional. serta keramba jaring apung di danau maupun waduk. Kabupaten Tangerang. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra.15 g/hari. ukuran panen. dan parameter kualitas air yang lain dianalisis secara deskriptif. KATA KUNCI: ikan mas. Penelitian telah dilaksanakan dari bulan Nopember 2009 —Pebruari 2010.41 g/hari. Data setiap sampling dijadikan ulangan. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. Ongko Praseno. Lilis Sofiarsih*). Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan.64 kali lebih banyak dengan ukuran panen 1. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). kemudian ikan mas galur kuningan sebesar 1. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. karena akhir. ukuran panen. sintasan. salinitas rendah.86 g/hari. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. Sedangkan sintasan. dan ikan mas galur majalaya sebesar 0. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. tambak . KATA KUNCI: ammonia. Sutrisno*). akuaponik. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan.25 kali lebih besar dibanding pada kolam konvensional. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. Achmad Sudradjat. Di mana satu di antaranya di desain sebagai kolam akuaponik.

Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. (B) umur 10 hari dan (C) umur 15 hari. kemudian diberikan sebagai pakan larva. Siti Zuhriyyah. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata. dan Afifah Balai Besar Riset Perikanan Budidaya Laut.42%. serta mempunyai respons yang baik terhadap pakan buatan. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2. KATA KUNCI: survival rate. fry performance. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3.58 cm dan 17. lasted time feeding . Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal. Afifah. Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. Masing-masing perlakuan diulang 3 kali. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Siti Zuhriyyah Musthofa. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. dapat dikembangkan di bak terkontrol maupun di KJA. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam.067mg) serta kelangsungan hidup (12.07%) relatif lebih tinggi dari pada perlakuan B dan C. cobia larvae. KATA KUNCI: artemia nauplii. Hasil penelitian menunjukkan bahwa pertumbuhan panjang.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari).

termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Lucky Marzuki Nasution*). dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam. KATA KUNCI: ikan hias. budidaya. Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera.Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). Herno Minjoyo*). Stakeholder. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. plasma nutfah . KATA KUNCI: cobia. sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. Lebih dari 100 spesies. Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan.

Artemia sp. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. Tubifex sp. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan. Eni Kusrini*). Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. pakan alami. laju pertumbuhan harian sebesar 32. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. virus). Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. KATA KUNCI: deformity. diikuti Artemia.226 g. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. dan Tubifex sp. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. karena belum banyak yang membudidayakannya. infeksi penyakit (cacing. dan pertambahan panjang total sebesar 1. dan yang terendah Moina. granuloma. multifocal granuloma . Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias.. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish.586%. kondisi daya dukung lingkungan yang terus menurun. Peacock bass ini akhirnya berenangnya jadi terbalik. diam dan kepalanya menyembul tepat di bawah permukaan badan air. KATA KUNCI: Synodontis nigriventris. bakteri. dan selalu berusaha mendekati sumber oksigen (aerator). Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias. atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh. Depok ABSTRAK Deformity (dysmorphism. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. peacock bass. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. pertumbuhan. Deformity dapat disebabkan oleh : mutasi genetic. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia.778 cm. Afrika.. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. dengan 6 kali ulangan. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata.Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*).

KATA KUNCI: banggai cardinal fish. Hasil penelitian menunjukkan. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. zat pemicu warna. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. 60 ekor/bak. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati.9 ± 0. T2. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. T3. KATA KUNCI: maggot. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. wortel dan tepung kepala udang. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. Selama penelitian. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. Hewan uji yang digunakan berukuran panjang total 5. Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai . 40 ekor/bak. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. udang jembret (mysids) dan larva nyamuk. Rainbow Papua .87 ± 0. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF).Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan.3 cm dan bobot 2. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. yaitu : astaxanthin. 20 ekor/bak. Jhon Harianto Hutapea. induk diberi pakan berupa naupli artemia/artemia pra dewasa. density.Sulawesi Tengah. Variabel yang diamati meliputi. dan Ahmad Musa Balai Riset Budidaya Ikan Hias.50 g. Bastiar Nur.

Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis.5 x 0. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. KF (air kontrol+formalin). Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air.0 cm dan bobot rata-rata 0. dan 105 dan dianalisis secara deskriptif. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich). I Wayan Subamia. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).67%).05).5 cm dan panjang tertinggi sebesar 3.0 cm. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2.67%). Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. ukuran ekspor 1 inci (2.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.5 cm (ukuran ekspor). AF (aqua+formalin). pertumbuhan panjang. Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari. KO (air kontrol+oksitetrasiklin). 35.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.5 m dan tinggi air 40 cm. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. 70.33%. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. KO (76. 20.05).67%). Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza. Sintasan terendah dihasilkan oleh perlakuan KB . Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium. KF (71. sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. Selama pemeliharaan.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis). lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. 55. KATA KUNCI: benih botia. Pada akhir penelitian (hari ke 105). Panjang rata-rata benih ikan botia di awal penelitian berukuran 1.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari.009 gram. Masing-masing perlakuan dilakukan dengan 3 ulangan. AO (aqua+oksitetrasiklin). Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin. AB (aqua+blitz ich). Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian. dan blitz ich) akan dilakukan melalui rancangan faktorial. Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0. Nina Meilisza. dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar. namun tidak berbeda nyata dengan perlakuan AO (81. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. oksitetrasiklin.5 x 0. dan Lili Sholichah Balai Riset Budidaya Ikan Hias.

67% namun tidak berbeda nyata dengan perlakuan AB (55%). larva Tetraodon palembangensis . sintasan. media air. KATA KUNCI: prophylaksis.sebesar 51.

penyuntikan hormon.15%.5 ml/kg untuk induk jantan dan 0. aligator (Lepisosteus oculatus). Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar. dan Bastiar Nur Balai Riset Budidaya Ikan Hias.4°C. inkubasi telur dan perawatan larva.). Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. KATA KUNCI: palmas albino. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. polypterus senegalus albino. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. Pemijahan tersebut terdiri atas seleksi induk.31% dan menghasilkan larva normal sebanyak 218 ekor.6°C–29.91%.). perkembangan embrio. dan redfin shark (Ephalzeorhynchos sp. KATA KUNCI: Neocaridina heteropoda. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73. Depok ABSTRAK Ikan palmas (Polypterus sp. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina. daya tetas telur 80. antara lain sinodontis (Synodontys sp. sehingga produksinya masih mengandalkan impor dari luar negeri. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27.). Asep Permana. namun belum banyak diketahui data embriologinya. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina. pembuahan. platidoras (Platydoras sp). Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias.75 mL/kg untuk induk betina di bagian intraperitoneal. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy. memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan. albino) masih sulit untuk memijah dalam wadah terkontrol. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0. hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur. Asep Permana. tiger catfish (Platysoma sp. SR (0-10 hari) 83. masa inkubasi . telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan. Ikan palmas jenis albino (Polypterus senegalus var.

budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah. sedang induk jantan belum ada yang mengandung sperma.7–1.9 cm dengan bobot 0. Rendy Ginanjar. Udang diberi pakan berupa moina beku sekali dalam setiap hari. Kepadatan 10 ekor induk dengan bobot 65–600 g. dan Darti Satyani Balai Riset Budidaya Ikan Hias. LHRH 100 mg dan testosteron 50 mg (B). dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. dipelihara selama 6 bulan.3–2. implantasi. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32.1630 g dan dua ekor induk jantan yang berukuran panjang 1. Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi. Pada ikan yang baru di domestikasi. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor.0518 g. KATA KUNCI: induk. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20.0488–0. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2. hormon. KATA KUNCI: Neocaridina heteropoda. matang gonad. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungai. Tutik Kadarini.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana.5 cm dengan bobot 0. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya).sungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah. LHRH 50 mg dan testosteron 50 mg (C). Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm. panjang 40– 60 cm. oocyt . murah dan aplikatif.725 pg/mL.1272–0.042 pg/mL. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai. Asep Permana. dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A). Rina Hirnawati.

kemudian dipisahkan antara tangkai dan kelopaknya. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. Honey is a natural substance which have crysin. The result showed that the percentage of male guppy at 50 mL/ L is 64. as the curative effort is not applicable. Therefore.6%). Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias. Based on LSD test.07 ± 9. yeast (30–800 mg/kg) dan sumber lainnya. The proportions test showed dose 50 mL/L have significant different to control.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. because of residual effects to human caused cancer. The research was conducted experimental with completely randomized design. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2. KATA KUNCI: bunga tai kotok. guppy fish . suhu. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit. 25 mL/L. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control). kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan. chrysin. the alternative masculinization application of natural substance like honey.000 mg/kg).71%.000-4. The concluded that the optimum dose to produce male guppy is 50 mL/L. male.05 significant level. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. the treatments gave significant different with control. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam. but between treatments not significant different. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. 50 mL/L. The observation to sexual secondary characteristic guppy can be observed at least two months old. and 75 mL/L.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias. carotenoid. KEYWORDS: honey.

Forum Inovasi Teknologi Akuakultur 2010

FF 69
PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA
Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. Induk dipelihara dalam 8 buah bak berukuran 1,5 m x 1,5 m x 1,0 m dengan kepadatan 24 ekor/bak. Lama penelitian berlangsung selama 6 bulan. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&), 1:2 (B&:@&), 1:3 (B&:@&), dan 2:1(B&:@&). Pada awal percobaan, semua induk secara individu dalam keadaan TKG=O. Peubah biologis yang diamati meliputi: jumlah induk memijah, jumlah telur, diameter telur, dan daya tetas telur. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor, jumlah telur 237.865–335.837 butir/ekor, diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%, rasio (1:2) jumlah induk memijah 30 ekor, jumlah telur 129.534–393.333 butir/ekor, diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%, rasio (1:3) jumlah induk memijah 35 ekor, jumlah telur 272.837–344.975 butir/ekor, diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor, jumlah telur 227.945– 350.140 butir/ekor. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama.pada induk beronang.
KATA KUNCI: Siganus guttatus, pemijahan, jumlah telur, diameter telur, daya tetas telur

FF 70
SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG, Siganus guttatus
Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22,05±6,4 g dengan padat tebar 15 ekor/keramba. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut, B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan, masing- masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0,05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0,05) dengan rasio efisiensi proteinnya.
KATA KUNCI: tepung ikan, tepung rumput laut, substitusi, pakan ikan beronang, S. guttatus

Forum Inovasi Teknologi Akuakultur 2010

FF 71
PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH
Rusmaedi, Idil Ardi, dan Wartono Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan, yaitu menggunakan tingkat teknologi tradisional plus, memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Dengan teknologi yang diterapkan, diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Penelitian ini dilakukan pada tambak di daerah Betok Mati, Kecamatan Cilebar, Karawang, Empat petak tambak masing-masing berukuran 3.500 m2 digunakan untuk percobaan. Sebelum penebaran, dilakukan pengolahan tanah tambak,n pengapuran sebanyak 175 kg/petak, kemudian dikeringkan sekitar satu minggu. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. Setelah dua hari, pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Pemeliharaan dilakukan selama tiga bulan, pada bulan pertama udang tidak diberi pakan, sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak, penebaran dilakukan setelah satu bulan dari penebaran tokolan. Dari pemeliharaan udang selama tiga bulan, diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34,5 g, produksi 81,1 kg dan sintasan 11,2%. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3, yaitu pertambahan berat rata-rata 230 g, produksi 78,8 kg dan kelangsungan hidup 100%.
KATA KUNCI: Karawang udang windu, salinitas rendah, tokolan,

FF 72
PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT
Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1,5–50 m3 dengan rata-rata kepadatan akhir N. oculata 13,1±0,04 juta sel/mL dan rotifer 186±5.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. Pemadatan (flokulasi) N. oculata dengan NaOH dosis 75, 100, dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368, 427, dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. Tingkat total ammonium terlarut dalam air laut produksi masal N. oculata relatif tinggi (4,3–8,2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. oculata relatif rendah (3,6%) dengan rasio DHA/EPA hanya 0,2.
KATA KUNCI: pakan alami, marine chlorella, Nannochloropsis oculata, rotifer Brachionus rotundiformis, semi-continuous system

Forum Inovasi Teknologi Akuakultur 2010

FF 73
PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus)
Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi, juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). Wadah penelitian yang digunakan adalah jaring berukuran 1,0 m x 1,0 m x 2,0 m, yang ditempatkan pada keramba jaring apung di laut. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19,2 ± 0,67 cm/ ekor dan bobot 155,3 ± 10,79 g/ekor, ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%, (B) 9%, dan (C) 13%, masing- masing terdiri atas 3 ulangan. Pemberian pakan dilakukan 3 kali/hari (pukul 08.00, 11.00, dan 17.00). Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. Hasil penelitian menunjukkan bahwa kadar lemak 5%, 9%, dan 13% dalam pakan berpengaruh tidak nyata (P<0,05) terhadap pertumbuhan dan sintasan ikan beronang.
KATA KUNCI: kadar lemak, pertumbuhan, sintasan, Siganus guttatus

FF 74
ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA
Lies Emmawati Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. Jika tidak ada efek rumah kaca, suhu dipermukaan bumi akan turun secara drastis. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia. Permasalahan ini perlu dipikirkan solusinya, karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Padahal dalam upaya peningkatan produktivitas perikanan budidaya, plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global.
KATA KUNCI: pemuliaan, ikan langka, budidaya, konservasi

mas koki. sympilum dan Characidae. parasit . KATA KUNCI: ikan hias air tawar. cukup sesuai 512. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. perairan Papalan.Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. Argulus sp. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. dan platydoras. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. neon tetra. perairan Kalukku. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. Akhmad Mustafa. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. Oleh karena itu. dan Dactylogyrus spp. Trichodina sp. kecepatan arus. Chiclidae. (Dinoflagelata). penyakit. Sampel ikan hias antara lain dari golongan cyprinidae. dan Ichthyophthirius multifiliis (Ciliata). Kualitas air perairan yang diukur adalah: pH. budidaya laut.59 ha. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. KATA KUNCI: kesesuaian lahan. fosfat. dan besi. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. 98% terinfeksi parasit. kecerahan. kedalaman. Trematoda). dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. Red Fin Albino. sirip. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. keramba jaring apung. cat fish. 2009. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. Ektoparasit yang teridentifikasi antara lain: Oodinium spp.18 ha. Dari Sampel yang diperiksa 33. dan insang. (metacercaria. Pulau Kambunong.18 ha yang terdiri dari sangat sesuai seluas 133. (Monogenea). kapiat albino. dan Tanjung Dapuran. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. Synodontis. (Copepoda) dan Centrocestus sp. salinitas. Gyrodatylus spp. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. Pulau Bekengkeng.41 ha dan kurang sesuai 52. arah arus. nitrat.

badan air Sungai Citarum dan Sungai Cimeta. sedimen (lumpur/tanah). zona 2 Purwakarta. dan Karbamat. pestisida.98 ton/bulan. muara Sungai Cisokan. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar.88 mg/L/kg daging ikan. Tahapan penelitian meliputi: penentuan lokasi. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. pencemaran.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. Variabel yang diamati adalah konsentrasi kandungan Pb. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. KATA KUNCI: lahan perikanan budidaya. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS. batas daerah bahaya. Cd. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet. muara Sungai Citarum.86 ton/bulan. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. Cd. inlet. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. Perairan Waduk Cirata sudah tercemar oleh parameter Zn. dan Zn dalam air dan daging ikan. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. Piretroid. KATA KUNCI: logam berat. Organofosfat. Cd. preparasi. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. identifikasi dan analisis data serta pelaporan. CD. residu . Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan. Contoh yang diambil berupa air. pengambilan contoh. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. serta debit air dari muara sungai yang masuk ke perairan waduk.8214 ton/bulan dan 1.

(13.31.marmorata dan (4. pada region mitokondria 16SRNA. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur. 2–4. KATA KUNCI: Glass eel. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies.5 ind.71–19. Copepoda. selanjutnya digunakan untuk analisa genetik. fitoplankton. A.65– 0.75–4887.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar.marmorata. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393. indeks dominansi (C) = 0.12–3. Palumbon. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa. dikelompokan pada jenis A. Bacillariophyceae. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae.83. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias. PELABUHAN RATU. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat. dan 4–6 m. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi./L. dan sebanyak 150 ekor disimpan dalam alkohol absolut. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. Dinophyceae. Patok Batas.n. Sungai Cimandiri. Maleber. Cyanophyceae.) DI PERAIRAN SUNGAI CIMANDIRI.nebulosa . A. bicolor. dan Desmiceae dari zooplankton ditemukan jenis Rotifer.35). Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009).75– 993. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2.17-9. Sukabumi.072–0. A.33.75 ind. Ciputri. dan Cadas Bodas. KATA KUNCI: komunitas.52) dikelompokan pada jenis A. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. Pelabuhan Ratu. bicolor bicolor. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri./L dan zooplankton berkisar antara 93. dan Protozoa. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik. dan nilai kemerataan (E) = 0. nebulosa.7) dikelompokan jenis A.

Forum Inovasi Teknologi Akuakultur 2010

FF 81
POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN
Afifah*), Titiek Aslianti*), dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut, Gondol **) Mahasiswa Universitas Gadjah Mada, Jogjakarta

ABSTRAK
Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL), terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. rotifer, B. gonad kerang, dan C. kuning telur) dan 3 ulangan. Pemberian pakan awal di mulai saat larva berumur D-2—D-10, selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan, selanjutnya secara periodik 5 hari sampai dengan D-30. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan,. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10,99 mm; 27,10 g; dan 21,97%) dibanding perlakuan A (10,27 mm; 21,94 g; dan 1790%) dan C (11,01 mm; 25,20 g; dan 17,17%). Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan, namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.
KATA KUNCI: larva ikan kuwe, pakan awal, pola pemangsaan

FF 82
KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT
Mulyasari*), Dinar Tri Soelistyowati**), Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya

ABSTRAK
Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan, adalah dengan program pemuliaan. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra- dan inter-populasi ikan nilem di Jawa Barat. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin), sirip dada (pectoral fin), sirip perut (ventral fin), dan sirip anal (anal fin). Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata.
KATA KUNCI: ikan nilem, Osteochilus hasselti, meristik

Forum Inovasi Teknologi Akuakultur 2010

FF 83
EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti)
Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Pakan memegang peranan penting dalam budidaya ikan nilem. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan, Balai Riset Perikanan Budidaya Air Tawar, Bogor. Ikan uji yang digunakan adalah ikan nilem dengan bobot rata- rata 5,0±0,3 g/ekor. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%, 19%, dan 20%. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Ikan dipelihara selama 40 hari. Parameter yang diamati yaitu pertumbuhan spesifik, konversi pakan, serta sintasan ikan. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0,05) yaitu sebesar 1,56%. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0,05).
KATA KUNCI: nilem, protein, pertumbuhan, pakan

FF 84
EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI, KABUPATEN BATANG)
Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan, Jakarta

ABSTRAK
Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. Penelitian dilakukan di Kabupaten Brebes dan Batang. Metode penelitian dilakukan secara studi kasus. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Harga pakan hanya Rp 2.800,-–Rp 3.000,-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6.500,-–Rp 7.000,-/kg. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya.
KATA KUNCI: efisiensi usaha, pakan buatan, bahan baku lokal, ikan patin

Forum Inovasi Teknologi Akuakultur 2010

FF 85
PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN
Jhon Harianto Hutapea, Irwan Setiadi, Gunawan, dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg). Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2,5 m3 (diameter 2 m dan tinggi 0,8 m) dan bak fiberglass berbentuk oval volume 2,1 m3 (lebar 1,4 m dengan panjang 2,1 m dan tinggi 0,7 m. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari.
KATA KUNCI: penanganan calon induk, ikan tuna sirip kuning, sintasan

FF 86
KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON
Gleni Hasan Huwoyon, Irin Iriana Kusmini, dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. Pada beberapa jenis ikan, warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2,1±0,19; hitam: 1,7±0,20), pertumbuhan mutlak (merah: 6,8±1,02; hitam: 5,6±0,30) dan laju pertumbuhan spesifik (merah: 0,65±0,06; hitam: 0,57±0,02).
KATA KUNCI: warna, tengadak, Barbonymus schwanenfeldii, genetika

Setelah 5 hari dipanen. Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau. gula. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu. bahan kering. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia). B = Daun mengkudu + 2. urea. E = Daun mengkudu + 2. Hasil penelitian menunjukkan bahwa: pH.00% khamir laut.04% khamir laut. daun mengkudu.5% molasses + 0. lemak kasar.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan. R = Daun 3 mengkudu + 2. silase. Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator.08% khamir laut.01).5% molasses + 0. R4 = Daun mengkudu + 2. dan TSP.05).5% molasses + 0.5% molasses + 0. BETN. KATA KUNCI: khamir laut. dan abu di antara perlakuan tidak berbeda nyata (P>0. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2.05). Berdasarkan hasil penelitian. protein kasar.5% molasses + 0. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0. pupuk . Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan. serat kasar. Setelah kering.02% khamir laut. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu. Jepara. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. dan energi di antara perlakuan berbeda nyata (P<0.06% khamir laut.

di mana termasuk cara budidaya udang.1 ton/ha/16 mg menjadi 1. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara.977. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40.000.000 ekor/ha. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu.46% dengan produksi udang windu sebesar 249. KATA KUNCI: biofilter. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.000 ekor/ha). CBIB. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I. udang windu. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. tambak marjinal . Brata Pantjara. Sulawesi Selatan.000 ind/ha) dan petak II. ditebari bandeng (10.000 ekor/ha) dan rumput laut (1 ton/ha). Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59. KATA KUNCI: udang windu. Erfan Andi Hendradjat. bandeng (3. MY1112 bulan II.07.000 ind.5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. KABUPATEN TAKALAR Muharijadi Atmomarsono. serta manajemen pakan dan air secara benar. rumput laut. penggunaan sarana produksi yang ramah lingkungan.73% dengan produksi sebesar 217. rumput laut (2 ton/ha) dan tiram (20.000 ekor/ha) dan rumput laut (1 ton/ha). rumput laut (2 ton/ha) dan tiram (40. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik.48 kg/ha. Perlakuan B.-/musim tanam dengan B/C rasio 2.000 ekor/ha)./ha) dan petak II : bandeng (3. petak I ditebari bandeng (10. BL542 bulan III. Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I. Pada akhir penelitian diperoleh sintasan 63. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA.

air laut salinitas 28 ppt sebanyak 15 L. Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. Nurbaya.8% dan 228. NO3. PO4.7 kg/ha/90 hari).7 kg/ha/90 hari). B) Pergiliran probiotik BT951 bulan I. NH 3. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah. diikuti perlakuan kombinasi probiotik A (50. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. MY1112 bulan II. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. Sintasan udang windu tertinggi didapatkan pada . (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. (C1) probiotik komersial dengan dosis pakan 100%. Penelitian dilaksanakan selama 90 hari. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masingmasing 3 kali dan lama pemeliharaan 10 minggu. dan C) Kontrol (tanpa probiotik). Pengamatan sintasan udang windu dilakukan pada akhir penelitian. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan 3 selama penelitian relatif lebih tinggi pada perlakuan yang NH tidak menggunakan probiotik dengan dosis pakan 100%.05% dan 298. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. kandungan BOT di atas 30 mg/L. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. Oleh karena itu. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak. Penelitian dilakukan di laboratorium basah. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. dan total Vibrio. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. KATA KUNCI: probiotic bacteria. menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. survival rate.7 kg/ha/90 hari). tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani.35% dan 448. production. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. (D2) kontrol 2. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. Hasil penelitian menunjukkan. Maros. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). (B1) BL542+BT951+ MR55 dengan dosis pakan 100%. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. NO2. Balai Riset Perikanan Budidaya Air Payau. (C2) probiotik komersial dengan dosis pakan 50%. Muliani. BL542 bulan III. Nurbaya. total bakteri. terutama salinitas yang mencapai 56 ppt. dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau.

11%. dosis pakan. sintasan. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial.05) pada akhir penelitian. sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0. KATA KUNCI: probiotik.perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11. udang windu .

Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. Tjaronge. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1. produksi. yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto.7 kg. Sampling dilakukan 30 hari sekali selama 90 hari. dan pertumbuhan udang serta aman bagi konsumen. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha). Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha). Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari.8% dan 63. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.000 ekor/ha (1 ekor/m2).000 ekor/ha). masing-masing terdiri atas 2 ulangan. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu.masing-masing dengan dua kali ulangan. Oleh karena itu.0%. Selama pemeliharan tidak diberi pakan. Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an. namun belum mampu menurunkan kandungan amoniak dalam media budidaya.5% dengan produksi 19.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13. Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari. Tokolan udang windu (PL. kesehatan. serta 99.9 kg dan secara finansial memberikan . M. dan kontrol (tanpa aplikasi probiotik). 31) yang ditebar pada masing-masing tambak adalah 10.4 ha. Maros selama 90 Hari. Sintasan dan produksi udang windu dan ikan bandeng masing.9% dan 33. Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok.000 ek/ha bandeng) menunjukkan hasil yang terbaik. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). KATA KUNCI: probiotik. baik pada air maupun pada dasar tanah tambak.masing adalah 66. rumput laut dan ikan bandeng adalah perlakuan B (10.500 m2 dengan kedalaman 80 cm.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya.

-/ha /90 hari. sintasan.keuntungan sebesar Rp 11.000. udang windu. ikan bandeng. KATA KUNCI: multitropik. rumput laut.572. produksi .

Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan.05) dibandingkan dengan kontrol. Maros **) Departemen Budidaya Perairan. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. Syarifuddin Tonnek.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. danAndi Tenriulo*) **) Balai Riset Perikanan Budidaya Air Payau. gen anti virus. 4 hari. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. 12 jam. udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. EGFP. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. uji tantang.3% dan tidak berbeda nyata (P>0. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). Promoter dikatakan aktif apabila gen penanda dapat terekspresi. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. Fakultas Perikanan dan Ilmu Kelautan. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. 1 hari. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. yang sampai saat ini belum bisa diatasi secara secara tuntas. Selain itu. Aan Fibro Widodo. Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV.Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. Alimuddin**). KATA KUNCI: promoter. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi. 3 hari. gen PmAV menunjukkan respons meningkat (up-regulation). Ketika ditantang dengan WSSV. 2 hari. KATA KUNCI: ekspresi. ekspresi gen. IPB. udang windu . Sukenda**). transfeksi.0%). Komar Sumantadinata**). termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR. Bunga Rante Tampangallo.1%) serta tanpa transfeksi (49.

Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. khususnya ELISA. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. White Spot Syndrome Virus (WSSV). karena relatif mudah dan murah. Setelah pengujian. Nurhidayah. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. Teknik serologi. antibodi monoklonal . sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: White Spot Syndrom Virus (WSSV). monodon dengan melihat gejala klinis dan studi histopatologi. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). dan disertai ulserasi lapisan mukosa epitel. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. serta berpeluang untuk digunakan secara langsung di lapangan. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. KATA KUNCI: ELISA. menyeleksi. Pewarnaan jaringan menggunakan Hematoxilin eosin. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. serta epidemi penyakit di lapangan. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. Penelitian dilakukan untuk membuat. cepat dan akurat. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. Antibodi monoklonal memiliki kespesifikan yang tinggi. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas.

KATA KUNCI: udang vaname. budidaya udang intensif.51). Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau.096±0. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%.234). benur. menggunakan 4 petak masing masing berukuran 4.000 m2/petak. kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0. namun terbatas pada golongan masyarakat menengah keatas (padat modal). udang diberi pakan dosis 50%-5% dari total berat biomassa/hari. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak. dan kepadatan benur dan tokolan adalah 50 ekor/m2.18235 mg/L) dibandingkan dengan perlakuan A (0. Budidaya ini berkembang dengan teknologi intensif. sintasan (90.5±88.0328 mg/L) pada akhir penelitian.05) terhadap pertumbuhan.549±0. rasio konversi pakan dan produksi udang vaname. dan pemeliharaan berlangsung 80 hari di tambak. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0. namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan.masing-masing perlakuan diulang tiga kali.120). Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun. RKP pada pembesaran udang vaname teknologi intensif. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0.048). karena berpengaruh terhadap pertumbuhan.257±0.Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi. Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6. Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah. Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12).246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10. 829.114±0. dan (B) pembesaran dengan tebar tokolan (PL 27). sintasan ( 92. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. Takalar.. sintasan.0±149. Instalasi BRPBAP. dan efisiensi biaya produksi. produksi (2087.7 m sebanyak 9 buah. sintasan.45 g/ekor dan ditebar kepadatan 100 ekor/bak. Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei). Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11. Selama pemeliharan 85 hari.83±8. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei). Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%.31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya. tokolan. Riset ini dilaksanakan di tambak Punaga. produksi (1831.102 CFU/mL.258). Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0. .085±0.9).034) berbeda nyata (P<0.05) dengan perlakuan A (1. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B).Setiap perlakuan dengan 2 ulangan.

feed. and L vannamei . survival rate.KATA KUNCI: growth.

M.2 kkal GE/g). rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi . dan pH 8. C (protein 33%. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon). Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN.00.0– 8. Selama pemeliharaan.00. 5 kali sehari pada pukul 07. C/P rasio 13. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname. laju pertumbuhan harian.8 kkal GE/g). C/ P rasio 16.029–2. Sintasan antara 73. 11.6 kkal GE/g).5 g/ekor dengan kepadatan 10 ekor per akuarium.intensif.1 kkal GE/g). Pakan diberikan at satiation. Kemudian dilanjutkan uji kecernaan. C/P rasio 14. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB).000 m2. dan 23. Ing Mokoginta**) dan Dedy Yaniharto***) *) Balai Riset Perikanan Tawar. fotoperiod dibuat 12 jam terang–gelap. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0.7%.5. Litopenaeus vannamei Deisi Heptarina*). suhu 28°C–30°C. C/P rasio 15. Jakarta Utara.71%–22.00. sintasan.05) terhadap pertambahan berat mutlak. sedangkan ekskresi amonia antara 1. .39%. D (protein 35%. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an. C/P rasio 11. Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7. Penelitian dilakukan di tambak percobaan Punaga Takalar. Hidayat Suryanto Suwoyo. 19.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2. Bogor **) Departemen Budidaya Perairan. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan.69%.05).464 mg/kg tubuh/jam. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH. B (protein 31%. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. salinitas 24–25 ppt. produksi. Perlakuan terdiri atas pakan A (protein 29%. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4. Agus Suprayudi**). B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). Bobot yuwana yang ditebar rata-rata 0. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0. dan E atau komersial (protein 40.3%–86.00. Fakultas Perikanan dan Ilmu Kelautan. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI . Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0.INTENSIF DI TAMBAK Abdul Mansyur. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum. Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%. ekskresi amonia dan stabilitas pakan. namun kurang diimbangi dengan penyediaan pakan yang sesuai. sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan. 15. sintasan.00.5 kkal GE/g).

4%–94.7%–1130.2% serta WS berkisar antara 49.2%.2–78.6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik. retensi protein (RP). konversi pakan (FCR).9%–79. JKP 59. RL dan RP masing-masing 26.5%.5%–36.5%–62. Kisaran nilai masing-masing parameter tersebut adalah. retensi lemak (RL). PR 532. FCR 1. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0. kecernaan protein.9%–68. K ATA KUNCI: protein vannamei optimal. yuwana.4–2. kecernaan total.4%. pertumbuhan relatif (PR).Namun.1% dan 65. pertumbuhan. kecernaan total dan kecernaan protein masing.4.05).1 g. jumlah konsumsi pakan (JKP). Litopenaeus .masing 26.8% dan 11.

PGM. belum dapat diyakinkan secara pasti bahwa ekspresi EST. L. EST. Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. PGM. toleran dan terinfeksi TSV.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. toleran. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. SOD. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. dan moribund. SOD. . Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). and SP) pada udang yang sehat. SOD. Semua gejala tersebut diduga akibat adanya serangan virus. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terusmenerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV).Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. Taura Syndrome Virus. Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . SPF. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. Untuk mengetahui jenis virus yang menyerang udang tersebut maka. hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. dan Rustidja**) *) Balai Besar Riset Perikanan Budiaya Laut. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. SOD. toleran. Namun demikian. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. KATA KUNCI: enzim. dan SP. EST. Lila Gardenia. Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. Haryanti*). Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). Gondol **) Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. dan SP mampu berdiri sendiri. protein haemolimph dan ekspresi enzim (GPI.

KATA KUNCI: Litopenaeus vannamei. WSSV. IMNV dan PvNV . MBV. TSV. IHHNV.

Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. pendederan II. B) 1 J : 2 B. yang dilakukan selama 5 bulan. B. 0. dan 9. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. Asahan.42 mm.21 g. Romy Suprapto. dan tidak berbeda nyata antar perlakuan. 0. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). Ciasem. 2%. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal. 0. pertumbuhan. Barito.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. berturutturut 0. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro. dan 13%. diberikan pada pagi dan sore. udang galah . yang meliputi pertambahan panjang dan bobot. dan D) 2 J : 4 B.5%. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. dan 0. yaitu 0%. pemijahan.25 g. persilangan. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. Penelitian dilakukan dengan rancangan acak lengkap. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0.27 mm. Imron. beserta persilangannya. KATA KUNCI: genetik. KATA KUNCI: mortalitas. Namun demikian. berdasarkan nilai heterosis yang didapat. A dan B. dan pembesaran. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji.31 mm. 25%. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). Musi. dengan sistem resirkulasi. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan. 0. Pada sistem tersebut kematian induk relatif rendah. pendederan I. khususnya rasio jantan-betina. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. dengan lama pengujian 8 minggu. Penelitian meliputi pembenihan. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 6. berturut-turut 27%. rasio kelamin. Sebagai perlakuan adalah rasio jantan-betina. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%.5% berturut-turut untuk perlakuan A. reproduksi. diikuti perlakuan D. C) 2J : 2 B.20 g. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. C.25 m2/ekor induk. dan D.

keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Hasil penelitian menunjukkan bahwa pada karakter sintasan. . desinfektan. 52. (0 cfu/mL). Sukamandi.5%. sirih.0%). crossbreeding. Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah. dan D. Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya. yaitu inbreeding. dan D (perendaman dalam larutan ekstrak bawang putih).00% dan 3.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah.4%) diikuti oleh populasi hasil crossbreeding (57.93. merupakan langkah bio-security. formalin. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74. (4. (0 cfu/mL). Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi. Fakultas Perikanan dan Ilmu Kelautan. 37. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan. namun tidak berbeda nyata (P>0.4 x 103 cfu/mL) .92.0±1. dan D. **) Jurusan Budidaya. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 4. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan. Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan. C (perendaman dalam larutan ekstrak daun sirih). keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24.6±21. Harry Wuwungan**). Tiga tipe persilangan. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan. B. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. Pada karakter pertumbuhan. Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰. dengan nilai sebagai berikut: A. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan dioptimalkan.8±7.0%) dan populasi inbreeding (25. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0.4 mm) dan populasi inbreeding (21. B. C. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C.93. Dinar Soelistyawati**). 45. larva udang galah.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*).4 mm). Hewan uji yang digunakan adalah larva udang galah umur dua hari. KATA KUNCI: bawang putih. tanpa penambahan desinfektan).5% dan 3.0.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan.8±1.5±28. C. Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan.8±1. Perlakuan yang diberikan yaitu A (kontrol. yaitu A.5 x 103). B (perendaman dalam larutan formalin 250 mg/L). outbreeding. KATA KUNCI: budidaya dapat inbreeding.83% dan 3. (8. 47.7 mm) diikuti oleh populasi hasil outbreeding (21. sintasan (SR) dan perkembangan larva (LSI).05) terhadap kelimpahan bakteri.

Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau.Forum Inovasi Teknologi Akuakultur 2010 K 21 VARIASI FENOTIP UDANG GALAH (Macrobrachium rosenbergii) DARI POPULASI PERAIRAN KARAWANG. Hewan uji ini ditebar dengan kepadatan berbeda. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu. larva udang pama. populasi. Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0. Kepadatan larva 100 ekor/L. D. artemia. Pemberian pakan dilakukan setiap pagi dan sore (08. KATA KUNCI: kepadatan. dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau.00 wita). Kepadatan larva 25 ekor/L. dan Wartono Hadie**) *) Balai Riset Budidaya Perikanan Ikan Hias. dan pakan buatan. maka ditambahkan pemanas/heater suhu 30°C. Andi Tenriulo. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm. Kepadatan larva 50 ekor/L.00 dan 16. Pelabuhan Ratu. E. di mana masing-masing perlakuan di ulang tiga kali. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm. B. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. C. dan (F) 10%. Jenis pakan yang diberikan berupa pakan alami chetoceros. DAN BONE Eni Kusrini*). Depok *) Pusat Riset Perikanan Budidaya. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut. Kepadatan larva 150 ekor/L. PELABUHAN RATU. Sulaeman. KATA KUNCI: udang galah. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. (C) 31%. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%. sintasan dan pertumbuhan . Maros dengan panjang awal mysis adalah 100-190 milimikron. semisucatus) dengan kepadatan berbeda. dan F.Karawang dengan Pelabuhan Ratu lebih dekat. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. Jakarta ABSTRAK Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. dan Bone. (E) 24%. jarak genetik K 22 PEMELIHARAAN LARVA UDANG PAMA (Penaeus semisulcatus) DENGAN KEPADATAN BERBEDA Muslimin. Kepadatan larva 125 ekor/L. Lies Emmawati**). Perlakuan yang diujicobakan adalah: A. Kepadatan larva 75 ekor/L.05) terhadap laju sintasan dan pertumbuhan larva udang pama. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap. (D) 16%. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang). (B) 32%. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air. diameter 15 cm dan Volume 3 L. lebar 40 cm.

05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. padat tebar. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP).9±0. .06. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan.2.27 mg/g/jam.1 mm.446–6. estimasi K 24 POLIKULTUR KEPITING BAKAU (Scylla serrata) DAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN METODE TEBAR YANG BERBEDA Sulaeman.05) terhadap pertumbuhan bobot mutlak. panjang karapas 4.Forum Inovasi Teknologi Akuakultur 2010 K 23 ESTIMASI PADAT TEBAR UDANG PAMA Penaeus semisulcatus BERDASARKAN TINGKAT KONSUMSI OKSIGEN Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. 44. Maros ABSTRAK Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan.1.1 mm dan lebar karapas 5.03 g. 40. bobot harian.17 kg/250 m2. Kisaran kelarutan oksigen pada awal penelitian adalah 3. yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. BRPBAP.9 mg/L dan setelah 1 jam pengukuran 0.6±0.03–0. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. dan C (gabungan antara keduanya). Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0.95 kg/250 m2 dan terendah pada perlakuan B: 60.52 kg/250 m2.96 %. tetapi berpengaruh nyata (P<0. dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau. disusul perlakuan C: 64. Data laju respirasi selama 2 O proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit. Maros ABSTRAK Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen.65 g/m3. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar). dengan kisaran tingkat konsumsi oksigen 0. Wadah percobaan yang digunakan adalah bentik jar (chamber). Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66. Aan Fibro Widodo. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. 58.26–7. B (metode gantung). Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak.0235 g adalah 15. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4. KATA KUNCI: udang pama. akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. pertumbuhan panjang dan lebar karapas mutlak dan harian.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Maros. Ver. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1.14–7.58%. Oksigen terlarut diukur dengan alat pengukur (TPSTM Model WP-82 DO meters).48 mg/L dan kontrol tetap berkisar 4 mg/L. Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0.18±0.

rumput laut .KATA KUNCI: kepiting bakau. metode sebar. polikultur.

Sulawesi Selatan. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping./mL dengan laju pemangsaan sebesar 259. KATA KUNCI: kepadatan. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang. dan E (125 ind. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0. sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0. rotifera. Peubah yang diamati adalah laju pemangsaan./mL). Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton. laju pemangsaan.0%. Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau.71). Maros ABSTRAK Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0. yaitu kepadatan rotifera 625 ind.72). Karena hidup di dasar tambak. Selain diatom epipelic. Sulaeman. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang./mL). yaitu: A (625 ind. C (375 ind.1667 ind. kandungan liat (rs = 0. sintasan. zoea K 26 ANALISIS DIATOM EPIPELIC SEBAGAI INDIKATOR KUALITAS AIR DAN TANAHUNTUK BUDIDAYA UDANG Supono Budidaya Perairan Universitas Lampung ABSTRAK Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang./mL). Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp. dan nitrat (rs = 0. . kepiting bakau.) Aan Fibro Widodo. D (250 ind. dan kandungan bahan organik (rs = 0./mL). Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang.75). B (500 ind.05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. dan Muslimin Balai Riset Perikanan Budidaya Air Payau./mL). Hasil terbaik diperoleh pada perlakuan A. jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. TOM (rs = 0.62).65)./larva/jam dan sintasan 86. data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak.Forum Inovasi Teknologi Akuakultur 2010 K 25 LAJU PEMANGSAAN LARVA KEPITING BAKAU (Scylla serrata) TERHADAP PAKAN ALAMI ROTIFERA (Brachionus SP.66). Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan. dan peubah kualitas air. Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros. yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang.). Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air.

kualitas sedimen . tambak udang.KATA KUNCI: diatom epipelic. kualitas air.

Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot. Pertambahan bobot (71.9 g.47) terbaik adalah benih lobster air tawar asal Tangerang. Gleni Hasan Huwoyon. Bogor. pertumbuhan. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. simpangan baku. namun kemampuan produksi para pembudidaya hanya sampai 4 inci. KATA KUNCI: Cherax quadricarinatus. Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda. lokasi .72).0±0.74) dan panjang (7.9±9. benih. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang.0 cm dan adanya pertambahan bobot sebesar 58. dan panjang total). panjang standar. ragam.6±10. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini.6-71. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. dan panjang total tiap individu. dan Tulung Agung). sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci. Dianalisis dengan Rancangan Acak Lengkap (RAL). Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci.6-7. panjang standar.

50 g dan 217. + Ulva sp.52 µg/hari) dan terendah pemberian pakan Sargassum sp. Ibnu Rusdi.39 mm dan 10.05) antar perlakuan.. (P<0. I Nyoman Adiasmara Giri. masing-masing 58. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A. (13. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30. KATA KUNCI: Haliotis squamata.. + Ulva sp. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON.44 µm .56 ± 48. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0. (7. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali. cottonii : 40.18 mm dan 7. kombinasi Gracilaria sp.891.58 m x 0. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0. (C) Sargassum sp.16 g dan -86. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0. dilakukan dengan menerapkan 4 perlakuan pemberian pakan. pakan (B) dengan R² = 0. lebar dan bobot cangkang.9 ± 1. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga. Bambang Susanto.06 ± 170. dan Sargassum sp.02 g. Gracilaria. (D) Kombinasi Gracilaria sp. (B) Ulva sp.0 ± 0. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi.44 ± 102.06 g. E. cottoni. squamata. 73. B.39 g.17 ± 25. Ulva.17 ± 2.26 ± 10.68 µg/hari).07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang. dan pakan (C) dengan R² = 0. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan. sangat sesuai dalam memacu pematangan gonad induk abalon H. yaitu pada perlakuan pemberian pakan Gracilaria sp. serta pakan (C)= kombinasi Gracilaria + E. + Sargassum sp. Riani Rahmawati.613. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp.73 g.854. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m. + Sargassum sp.44 µg serta 92.. Sargassum. dan C berturut-turut adalah 120.99 mm dan 36.80 sampai 31. (5.23 g dan 121.92 g dan 219. pakan (B)= E. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. dan kombinasi keduanya.82 µg/hari). Riani Rahmawati.05 mm dan 10.00 µm dan 38. (13.06 µg/hari). cottonii 37.19 ± 6. + Sargassum sp. 38.05). Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp. + Ulva sp. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir. Ulva sp. yaitu: (A) Gracilaria sp.73±2.1 ± 4. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit.89 µm dan 38. (rasio 1:1:1). Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata.44 µg. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon.31 m. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut.37 mm.59±2. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto.39 m x 0.03 ± 1.

dan 65. KATA KUNCI: abalon Haliotis squamata. aplikasi teknologi pembesaran .44 µg. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir.

hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. Kepadatan awal benih abalon adalah 450 ekor per wadah.6-3. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. pembesaran. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. Abalon diberi pakan rumput laut Gracilaria sp. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. Sampel yang digunakan berasal dari Bali dan Banten. 80/20% (B). tinggi 22 cm. proporsi pakan. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut./Ulva sp. Setiap perlakuan terdiri atas 2 ulangan. Est-3*. Est-1*. genetic monitoring. Gondol. 60/40% memberikan pertumbuhan abalon terbaik. KATA KUNCI: abalon Haliotis squamata. mengingat permintaannya yang cukup tinggi. dengan bobot awal 2. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. dan Ulva sp. Est-4* dan Cah-3*. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. wild. Gpi*. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. Tatam Sutarmat.52.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin.7 cm.2 g dan panjang cangkang 2. Est-2*. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya.13) lebih tinggi dibandingkan dengan induk asal Bali (0. Nilai variasi genetik induk abalone asal Banten (0. penjarangan . dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. Ibnu Rusdi. dengan proporsi yang berbeda Gracilaria sp. Pakan dengan proporsi Gracilaria sp. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm./Ulva sp. 100/0% (A). Hirmawan Tirta Yudha. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. KATA KUNCI: allozyme. dan 60/40% (C) sebagai perlakuan. peluang pasar serta teknik budidayanya yang sederhana. dan Ulva sp. Untuk itu. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga.06).

KATA KUNCI: Pinctada maxima.00 mm/hari (perlakuan C). Namun. Indah Mastuti. Supii.85±0. Apri I. masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. uji patogenisitas M 06 PENDEDERAN TIRAM MUTIARA (Pinctada maxima) DENGAN PERBEDAAN UKURAN TEBAR AWAL Sudewi. tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. dan C berturut-turut 37. Setiap perlakuan diulang 3 kali. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut. Haliotis squamata. dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13.42%. sintasan. Gondol ABSTRAK Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. sedangkan mortalitas pada kelompok kontrol hanya 3. dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut. isolat-2. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar. dan 21. Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0.67%.1 mm (perlakuan B). Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan.05 µm).Forum Inovasi Teknologi Akuakultur 2010 M 05 ISOLASI. Vibrio cincinnatiensis.03 mm/hari (perlakuan B) dan 0.33% .30±0. Karena itu. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon.27±0. Bali. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1.33%. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. KARAKTERISASI.44±0. B.05) dibandingkan dengan perlakuan C. Gondol. Parameter yang diamati adalah laju pertumbuhan harian dan sintasan. Laju pertumbuhan lebar cangkang 0. dan 20.37±0. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0.69%.01 mm/hari (perlakuan A). untuk memperoleh pertumbuhan dan sintasan yang baik. 18. 0.01 mm/hari (perlakuan C). DAN UJI PATOGENISITAS BAKTERI VIBRIO YANG DIISOLASI DARI LARVA ABALON SAKIT DI HATCHERI Zafran. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. Sintasan yang diperoleh untuk perlakuan A. 10. Oleh karena itu.36±0. yaitu media spesifik untuk bakteri Vibrio.44 mm (perlakuan A).44±0.01 mm/hari (perlakuan A). 0.55 mm (perlakuan C). dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. 71. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia. penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm.03 mm/hari (perlakuan B) dan 0. Gondol ABSTRAK Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan. Perlakuan yang diberikan adalah ukuran tebar 3. pertumbuhan.16%. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis. ukuran awal spat .33%. dan 46. vibriosis. KATA KUNCI: abalon.46±0.4±0.

Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara. dan Teluk Rabu. tiram mutiara.Forum Inovasi Teknologi Akuakultur 2010 M 07 KAJIAN POTENSI KELAUTAN UNTUK BUDIDAYA TIRAM MUTIARA (Pinctada maxima) DI WILAYAH PESISIR KABUPATEN JEMBRANA-BALI Apri I. budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. pada tingkat nasional. Jembrana . Ida Ayu Astarini**). dan Sudewi*) *) Balai Besar Riset Perikanan Budidaya Laut. Supii*). Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. Teluk Awen. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Sumber Sari. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari. Gondol **) Fakultas MIPA Universitas Udayana ABSTRAK Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan. Pantai Pengambengan khususnya. secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. KATA KUNCI: potensi kelautan. akan tetapi jika diinginkan. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. Berdasarkan hasil pengkajian. Pinctada maxima. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai. tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. regional maupun lokal.

kandungan keraginan. 1 m.20. K. Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81. jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut. stoples . Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver.70%) daripada botol (90. Maros ABSTRAK Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan.03).1. 1 m. 4 m. Oleh karena itu. metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468.50) lebih banyak dibandingkan dalam botol (7. 3 m. KATA KUNCI: Kappaphycus alvarezii. mengaplikasikan metode long line. Rumput laut dikumpulkan dari Kabupaten Brebes.3 m.70 dibandingkan dalam botol yang hanya 6.75%). Rosmiati. Maros ABSTRAK Produksi rumput laut ditargetkan meningkat dari 2. kepadatan eksplan. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0. dan 5 m. 3. sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masingmasing dengan 3 kali ulangan. Sedangkan jumlah tunas dalam stoples (7. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya.6 juta ton per tahun pada 2014.6 juta ton per tahun sekarang ini menjadi 7. 4 m. Jawa Tengah.1%. pertumbuhan. Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan. dan 5 m dari permukaan perairan. Pengamatan panjang tunas.75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan. KATA KUNCI: botol. Kappaphycus sp. sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker. Eksplan diinokulasi ke dalam media cair yang diperkaya PES.3 m. dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau.40 mm pada stoples dan 2. 2 m. verrucosa.42 mm pada botol. yakni 0. Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2. vertikultur LL 2 PERBANYAKAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN KULTUR JARINGAN MENGGUNAKAN WADAH YANG BERBEDA Siti Fadilah. 3 m. Umumnya pembudidaya rumput laut. Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26. 2 m.Forum Inovasi Teknologi Akuakultur 2010 LL 1 PERFORMANSI PERTUMBUHAN DAN KANDUNGAN KERAGINAN RUMPUT LAUT (Kappaphycus alvarezii) DENGAN APLIKASI METODE BUDIDAYA VERTIKULTUR Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau. di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali.

e dan stabil setelah jam ke9 sampai ke-12 s. transgenesis. KATA KUNCI: Kappaphycus alvarezii. Makassar **) Departemen Budidaya Perairan-FPIK. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. cytomegalovirus/ CMV. Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) . dan sumber karbon yang berbeda. Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. puncak jam ketiga – keenam s.Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT. Sebagai tahap awal dalam rangka produksi rumput laut transgenik. Alimuddin**). b-actin. Utut Widyastuti***). dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik.e.e).5 mili/second. Kappaphycus alvarezii Muh. Balai Riset Perikanan Budidaya Air Payau. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%– 10%. Rosmiati. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. mulai berpendar jam pertama – kedua setelah elektroporasi (s. Fadilah.1 second. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. Rajamuddin*). dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. daya tahan penyakit. Keratin dan b-actin. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. Alias L.BPPT. . Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV.Irvan Faizal****). jumlah kejutan: 4 kali dan interval kejutan: 0. ZPT. dan St. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. Pola ekspresi keempat promoter relatif sama. panjang kejutan: 0. Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. persentase sel berpendar rata-rata 10%. promoter. Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT.

KATA KUNCI: mutu genetik. fusi protoplas . kappaphycus alvarezii. hibridisasi.

rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). Pada umumnya. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. Kabupaten Pandeglang. khususnya di Kecamatan Sumur. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. kondisi sosek-ekonomi. Pandeglang . Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. SIG. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Rekomendasi pencegahan penyakit. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. pembudidaya rumput laut. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. KATA KUNCI: rumput laut. Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. Erlania. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. I Nyoman Radiarta. taman nasional ujung kulon. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. konservasi dan wisata). Untuk itu. Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. dan status wilayah kawasan. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata.

4 mg/L.6%.5:0. adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus.0:1.1 mg/L) dengan konsentrasi agar (0. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. Alias L. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii.5%). Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis. dan 0. pada rasio IAA: kinetin (0. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. Perkembangan selsel embriogenik diamati pada kultur cair. Pada tahap induksi kalus. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0.8% dan 1. 0.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm).0:0.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati.0%.0 mg/L. Rajamuddin*). 1. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%.0% menghasilkan persentase induksi kalus tertinggi (90%).8%). pengggantian media dilakukan setiap minggu dengan komposisi media yang sama. 1. 0. Pada tahap regenerasi massa sel embriogenik.5 mm dapat dicapai dalam satu bulan kultur.6% dan 0.8%. 0. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh. Tahap (2) adalah regenerasi massa sel embriogenik somatik.6%.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0. Pada media cair. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid. Pemeliharaan dilakukan selama 8 minggu. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0.2 mg/L) dengan konsentrasi agar media induksi (0. kalus. dan 1. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. embriogenesis somatik . Andi Asdar Jaya*). Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio.0 mg/L. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0. Rosmiati.0 mg/L. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. KATA KUNCI : Kappaphycus alvarezii.0:0.1:1. morfologi. Makassar **) Balai Riset Perikanan Budidaya Air Payau. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau. embrio somatik. dan 2.4%. Ridwan*). KATA KUNCI: keragaman.

Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. abu. dan berpengaruh nyata terhadap rupa dan tekstur.143. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn .13 ha dan 3. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. Mery Sukmiwati. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. kadar abu. Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya.24 ha. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. protein. aroma. rasa. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Hasnawi. dan karbohidrat) dan uji organoleptik.780. produksi pada tahun 2008 sebesar 750 ton.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. rumput laut. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. KATA KUNCI: program-program pokok strategi pengembangan. Parameter mutunya adalah kandungan zat gizi (air. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam pengembangan. lemak. 01-2973–1992 dan SII 0177–1990. Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. A-1 (15% tepung rumput laut dan 85% tepung terigu). denga metode budidaya tali panjang (long line). A-2 (30% tepung rumput laut dan 70% tepung terigu).

85%. uji organoleptik . gizi. KATA KUNCI: rumput laut. crakers.

60 dan 36. Kebutuhan kapur untuk tambak di Kabupaten Mamuju berkisar antara 1.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI S POS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa.15 dan 19. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat POS S dan berkelanjutan. Kebutuhan kapur didasarkan pada tanah dengan POS nilai S mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra POS S ALOS FOX AVNIR-2 akuisisi 28 Juli 2009. pirit.30 dan 1. Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95.71 g/cm3 dengan rata-rata 0.02% serta 44.09 dan 90. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan. S . Adang Saputra. . dan Achmad Sudradjat Pusat Riset Perikanan Budidaya.614%. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. bahan organik dan berat volume tanah. Program ArcView 3.28% dengan rata-rata 7. S POS . tambak.32 dan 113. Peubah kualitas tanah yang diukur adalah: pH . Maros ABSTRAK Kabupaten Mamuju. namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. Kapur S P KCl POSpertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur.36 dan 3. Rachmansyah. pH F .02.78% sehingga memiliki faktor konversi berturutturut sebesar 2.884 g/cm3 tanah berkisar antara POS dan S 0. tanah. Oleh karena itu. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta. KATA KUNCI: kebutuhan kapur. Penelitian ini bertujuan untuk melakukan analisis . ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting. S .2 digunakan untuk pembuatan peta distribusi tanah.29 ton/ha 3 CaCO dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju.

SIG. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. infrastruktur (jalan) dan sebaran penduduk. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan. Maluku . Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan. Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet.spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG). Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut. analisis spasial. KATA KUNCI: budidaya laut. inderaja. klorofil-a dan suhu permukaan laut).

dan Sularto***) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Hatim Albasri**). tambak terbengkalai. Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. Evi Tahapari***). udang. dan analisis usaha perikanan. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. Sukamandi ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. Jakarta **) Pusat Riset Perikanan Budidaya. Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut.400 m2 selama 3 bulan pemeliharaan. Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). KATA KUNCI: produktivitas tambak. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. Adang Saputra**). Jakarta **) Pusat Riset Perikanan Budidaya. peningkatan pendapatan. Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. Wartono Hadie**). Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. analisis komoditas.Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). analisis location quotient. ikan patin. rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara. Introduksi kaji terap dilakukan dilahan seluas 2. rumput laut. udang dan bandeng. dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Di samping itu. KATA KUNCI: minapolitan. analisis komoditas unggulan dan andalan. b a nd en g LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). Kabupaten Brebes . konversi pakan serta pertumbuhan yang cukup baik. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya.

pirit. tanah. Pada kedalaman 0. dan Kamariah Balai Riset Perikanan Budidaya Air Payau.75 m tanah vegetasi api-api. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). nipah.25 m tanah jenis penutup/penggunaan lahan api-api. nipah. rumput. tanpa vegetasi.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. Al dan tekstur. A. nipah (Nypa fruticans). Kualitas tanah yang diukur langsung di lapangan adalah pHF. 4PO . pH dan potensial redoks. Marsambuana Pirzan. . sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. KCl KATA KUNCI: keragaman. Hasil penelitian menunjukkan bahwa. masingmasing pada kedalaman tanah 0-0. S . kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent. pH . S . sedangkan yang dianalisis di laboratorium adalah pH FOX . TAA. TPA. padi (Oryza sativa). bakau. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak).50-0. N-total. Pada kedalaman 0-0. penutup/penggunaan lahan.25 m dan 0. pesisir. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. sagu. Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah.75 m. OXS P KCl POS karbon organik. Fe. Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. bakau. kelapa (Cocos nucifera). sagu (Metroxylon sagu). TSA.50-0. campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. bakau (Rhizophora apiculata). Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. paku laut (Acrostichum aureum). Kabupaten Mamuju . Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. rumput. Oleh karena itu. rumput.

046 dan 22. amonia. sedangkan yang kurang sesuai (213. walaupun dengan model regresi yang berbeda. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. oksigen terlarut. nitrit. sedangkan peubah bebas adalah suhu. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. pH.819 ha). Sulawesi Barat . Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil. cukup sesuai (168. KATA KUNCI: klorofil.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. dan data citra satelit digital. Data lapangan (fisiko-kimia air dan tanah). nitrat. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. tersebar di wilayah pesisir Kecamatan Sungai Pinyuh.986 ha). dan bahan organik total. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan. dianalisis secara spasial dengan metode PATTERN menggunakan SIG.000. nitrat. Akhmad Mustafa. Pada umumnya yang tergolong sangat sesuai (114. salinitas.047 dengan rata-rata 6.398 µg/L. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50. tambak. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil. dan fosfat. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. tambak. amonia. KATA KUNCI: kesesuaian lahan. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497. pH.077 ha.000. KALIMANTAN BARAT Utojo. fosfat. kualitas air. terdapat di Kecamatan Segedong dan Siantan. Oleh karena itu. data sekunder. nitrit.272 ha). Mempawah Hilir dan Mempawah Timur. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik. Data sekunder yang diperoleh berupa data iklim. Sungai Kunyit.

Bogor. total bahan organik (TOM). Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. Kultur ini ditempatkan diluar ruangan. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. ekstraksi. Proses pengayakan termasuk penyeleksian. penghitungan kelimpahan. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6.bak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan.). Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter.0 sel/mL. KATA KUNCI: mikroalga. DO. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp. dan 6:3. 2002 dan Dayananda et al. 2006). 5:4.75). Dunaliella. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar.. Analisis data dilakukan secara deskriptif untuk komposisi jenis. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9. kecerahan. Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. dan penghitungan dilakukan di laboratorium. dengan menggunakan cara modifikasi (Banerjee et al. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. dilakukan di dalam bak. dan Nematoda. Kultivasi Dunaliella sp. minyak nabati . pupuk. Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8. Chironomus sp... dan BOD5. Parameter kualitas air yang diamati adalah suhu. pH. Analisis kandungan minyak nabati Dunaliella sp. Jakarta.02–8. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP. BRPBAT.5 mg/L.60% menggunakan perlakuan pelarut hexana.. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung. kemudian 6. KATA KUNCI: makrobentos. identifikasi. indeks diversitas dan keseragaman spesies.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda. kolam. Tidak terdapat perbedaan nyata (P>0. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya. Spesies dominan adalah Limnaea sp.

salah satunya adalah Desa Merakan di daerah Jawa Timur. laju pertumbuhan. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. KATA KUNCI: kepadatan.25/ hari pada indoor dan 3. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat. Metode penelitian menggunakan metode survei. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. braunii. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. Botryococcus braunii .65/hari pada outdoor. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. Berdasarkan perhitungan statistik ANOVA. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan.37. Departemen Pertanian. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. Pengolahan data dilakukan secara deskriptif. salinitas. 02 sel/mL pada sistem outdoor. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12.33 sel/mL pada sistem indoor dan 7. dan pH. KATA KUNCI: ketahanan pangan. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. rawan pangan. dengan skor 19.

Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. Sedangkan dengan menggunakan spesifik primer. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. KATA KUNCI: unit usaha. pembudidayaan. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. pengelolaan bisnis. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. Uji awal berupa pengecatan gram. profitabilitas. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. uji PCR.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Bakteri merupakan salah satu penyebab penyakit pada ikan. Infeksi bakteri. penanganan aspek teknis. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. kemungkinan merupakan strain yang tidak pathogen. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. Isti Koesharyani. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. tes katalase dan oksidase dilakukan sebelum uji PCR. aerolysin dan primer spesifik . Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. dan Balai Budidaya Laut (BBL) Ambon. sehingga AH-26 merupakan isolat yang pathogen. KATA KUNCI: Aeromonas hydrophila. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. penanganan aspek teknis.

periphyton. Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. kedalaman 2 meter (B).91. kedalaman 3 meter(C) dan kedalaman 4 meter (D).masing perlakuan 5 kali ulangan. Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar.860. namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae.Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti.81 (ind/cm2) dan 0. Winarlin. Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A). Masing. yaitu 4423. Waduk Cirata . KATA KUNCI: kedalaman.Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m). Ani Widiyati.

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*). KATA KUNCI: streptococcosis. sintasan. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. pertumbuhan . Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. 8 ppt (6–10 ppt). Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. dan 12 ppt (11–15 ppt). lebar 40 cm. Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. dan Achmad Sudradjat*) Pusat Riset Perikanan Budidaya. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas.Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. Masing. Majalaya. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. Hary Krettiawan*). teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. dan Sutisna Kuningan. Sidi Asih***). Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. sintasan terendah didapatkan pada salinitas 12 ppt. Bogor *) ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. dan tinggi 40 cm dengan ketinggian air 15 cm. Akuarium yang digunakan berukuran panjang 60 cm. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas. Cianjur Wildan. KATA KUNCI: strain.masing perlakuan menggunakan 2 ulangan. ikan mas. salinitas. ikan nila. telah banyak menginfeksi ikan nila. Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. Jakarta **) Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt).

Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september . Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain. KATA KUCI: ikan belida. Dalam hal dukungan dana permodalan. pakan. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan September. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi.36. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan. ekonomi. dengan jangka waktu pengembalian modal selama 3. dan kalimantan.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal.53. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya. anakan ikan nila . Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya. ikan belida yang banyak hidup di perairan umum Sumatera.64 sedangkan FCR total sebesar 1. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4. KATA KUNCI: budidaya. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. termasuk jenis ikan karnivor. yang diberi sekat jaring nilon hita. Pemeliharaan ikan belida dilakukan di kolam. Jawa. Jakarta ABSTRAK Ikan karnivor. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan.November 2009.20 siklus dan nilai RC ratio sebesar 1. Iwan Malhani Al’Wazan.

palm kernal meal. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. KATA KUNCI: ikan belida. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. KATA KUNCI: ikan nila. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. yang dikenal dengan nama PKM (palm kernel meal). Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. Untuk menguasai teknologi domestikasinya. jaring tancap dan keramba jaring apung. Jakarta **) Balai Riset Perikanan Budidaya Air Tawar. Selama proses adaptasi pada kolam pemeliharaan. Budidaya ikan nila dapat dilakukan di kolam.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) Pusat Riset Perikanan Budidaya. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. kurang lebih 60% pengeluaran berasal dari pakan. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. pelet maggot . Dalam kegiatan budidaya ikan. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit.

sintasan.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. KATA KUNCI: vaksin bakteri. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. Fris Johnny. dan 200 ekor/m³. 65 g/ ekor. KATA KUNCI: pertumbuhan. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. Padat penebaran yang digunakan sebagai perlakuan adalah 100.bak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. 25 – 1. dan Zafran Balai Besar Riset Perikanan Budidaya Laut. ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. Pendederan ikan kerapu macan. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. penyakit infeksi . 95 – 2.150. Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Epinephelus fuscoguttatus. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. sedangkan kontrol hanya disuntik dengan PBS. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. Masingmasing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. baik disebabkan oleh infeksi virus. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bak. 05) tidak mempengaruhi sintasan. 05.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. Rasio konversi pakan 1. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. bakteri maupun berbagai jenis parasit. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Masing-masing perlakuan diulang 3 kali.

7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia. aspek biologi reproduksi .004. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan.450. dan (B) Induk asal alam. Apri I.240. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 . sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3. dan pada induk asal alam 20-92 % dengan SAI 2.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma. dengan jumlah 8% biomass/hari. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. Tridjoko. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya. Agus Priyono.000 butir.520 µm.000 butir. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. Supii. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya. Ketut Suwirya. Plectropoma laevis. Kualitas telur yang dihasilkan relatif masih fluktuatif. KATA KUNCI: kerapu raja sunu.80. indeks somatik gonad dan diameter oocytnya. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet.20. Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya.25-4. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2.

analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. Hasil penelitian menunjukkan bahwa laju pertumbuhan. Kata kunci : Jaring apung. dibandingkan dengan perlakuan lainnya. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). Peubah yang diamati adalah sintasan. pertambahan berat. pertumbuhan. KATA KUNCI: truss morfometrik. dengan periode pemeliharaan120 hari. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. tawes . Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat.A. Rudy Gustiano. (1988). Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. tengadak albino. dan N. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. pertambahan berat. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. Giri Balai Besar Riset Perikanan Budidaya Laut. konversi pakan. ikan tengadak. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. total biomass dan biaya pakan. Himawan Tirta Yudha.

82%). pemakaian insektisida perlu dilakukan secara selektif. Typha sp. juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut.11%–44. amonia (0.4–0. karbofuran.5 mg/L). dan nitrat (11. Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan. Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen.86%–85.303–1. kronis . Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi.58%).7–1. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7. khususnya ikan. tumbuhan air.33%). dan nitrat (37. Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat.849 mg/L) dan nitrat (0.lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8.Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar. karena di samping harus efektif terhadap hama tanaman padi.32 %). Kisaran persentase efektivitas penyisihan TN (28%– 58.82%). Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0.05) dibandingkan kolam ikan kontrol (82. Untuk itu. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan.5 mg/L).4%) pada kolam substrat 1 (pasir.5%–90.14%–92. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat).8 mg/L). KATA KUNCI: substrat. akut.681mg/L) dan nitrat (0. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar.67%). yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air). Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air.081–0. Perlakuan pada penelitian ini terdiri atas dua perlakuan.). amonia (20. KATA KUNCI: toksisitas.36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0. Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi.5–14. Sintasan (93. nitrogen.3 mg/L). produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar. kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur. amonia (0. amonia (42. dan Scirpus sp. yaitu TN (42.5%–66.05).

Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. KATA KUNCI: ekstoparasit. Gyrodactylus. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy).00 mg/L efektif untuk memberantas Trichodina dan monogenea. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis.kimia dan histopatologis.00–20. Ketujuh perlakuan itu yaitu: (a) biji teh 10.00 mg/L dan garam 4. Oleh karena itu. Ada beberapa bahan nabati dan alami yang dapat digunakan. Pada riset ini. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. 39 M1: T T dan primer M2: PreT (AATGGGCGCAAGCCTGATG) dan (ACCGCTACACCAGGAAT) digunakan pada penelitian 43 531 T ini. dan limpa. Dactylogyrus. Dua pasang primer. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. Mycobacterium fortuitum PADA IKAN GURAME.00 mg/L. (d) garam 4. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain– Jenssen. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya.000. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Trichodina. ginjal.000. (b) biji teh 15.00 mg/ L. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp.00 mg/L. limpa. dan Quadriacanthus kobiensis serta menimbulkan kematian. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. Hasil penelitian . Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. selanjutnya dibandingkan dengan teknik diagnosa melalui uji bio. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10. serbuk biji teh dan garam. Sensitivitas teknik diagnosa terhadap bakteri target.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar. (e) garam 5. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati. (f) garam 6.00 mg/L.00 mg/L (g) kontrol.000. yaitu (GCGAACGGGTGAGTAACACG) dan (TGCACACAGGCCACAAGGGA). sedangkan preparat histopatologi diambil dari organ hati. dan darah.00 mg/L. (c) biji teh 20. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. yang telah dikembangkan oleh 13 beberapa peneliti.00–6. sehingga upaya pengendaliannya sering terlambat.

gurame. KATA KUNCI: mycobacteriosis. Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies.menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi. Mycobacterium fortuitum. dan Polymerase Chain Reactio n .

000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0.05). Balai Riset Perikanan Budidaya Air Tawar. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. substitusi.45 g/ekor. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan.500 dan 2. Bogor. 1. masing.V.60±0. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang. 1. S. efisiensi pakan. Hasil penelitian menunjukkan bahwa penggunaan fitase 1. Cijeruk dengan bobot rata-rata 8.000 unit fitase/kg pakan. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. 500. namun nilai ini tidak berbeda nyata dengan 1.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti.05) terhadap pertumbuhan. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG. rasio efisiensi protein.masing diulang tiga kali dan di desain dengan rancangan acak lengkap. guttatu s . C. KATA KUNCI: fitase. nilem. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra. dan tingkat sintasan. tepung bungkil kopra. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. pertumbuhan. B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan.000.500. pakan ikan beronang.000 unit/kg pakan. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem. Parameter yang diamati yaitu laju pertumbuhan spesifik.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. dan 2. dan sintasan ikan beronang. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22.73 g dengan padat tebar 15 ekor/keramba. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0.15±5. KATA KUNCI: tepung bungkil kedelai. efisiensi pakan. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai.

Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan.2 mm dan bobot 0. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap. pelet. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut.02 g. KATA KUNCI: pakan rucah. sintasan .Variabel yang diamati adalah pertumbuhan lebar karapas. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana.2 ± 0. 50% ikan rucah + 50% pelet. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. rajungan. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm. Tjaronge Balai Riset Perikanan Budidaya Air Payau.-/tahun/ha. 100% pakan buatan/pelet dan C.). Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif. bobot dan sintasan serta kualitas air. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. B. tambak. Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak. pertumbuhan. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus). Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot.04 ± 0.526. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass.850. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur). Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. Maros selama 40 Hari. KATA KUNCI: budidaya bandeng.05) dengan perlakuan yang lain. lebar karapas dan sintasan (P>0.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. 100% ikan rucah jenis ikan tembang (Clupea sp. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis.

dan Lili Sholichah Balai Riset Budidaya Ikan Hias.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.816%.5 x 0. produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut. 70.masing perlakuan adalah 15.98 g/ekor menjadi 232.0 cm.5 x 0. pupuk kandang dan dedak. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1.5 m dan tinggi air 40 cm. bandeng. masing-masing mencapai 56. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1.9 dan 1154 kg/ha. Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran.6 cm . Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B). Pada akhir penelitian (hari ke 105).5 cm (ukuran ekspor).43. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh. Sintasan bandeng pada perlakuan A dan B.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. Oleh karena itu. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.5 cm dan panjang tertinggi sebesar 3. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara. ampas tahu.100. Nina Meilisza. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. 20.0 cm dan bobot rata-rata 0.009 gram.5 ton/ha. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. Erfan Andi Hendradjat.-. dan 105 dan dianalisis secara deskriptif. Padat penebaran bandeng pada masing. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2.625% dan 60. KATA KUNCI: pupuk organik. B/C rasio 1. 55. masing-masing dengan dosis 2. masing-masing mencapai 986.467. Produksi bandeng pada perlakuan A dan B.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B). Selama pemeliharaan. 35. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional.

ukuran ekspor 1 inchi (2.dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.5 cm) . KATA KUNCI: benih botia. pertumbuhan panjang.

Depok **) Pusat Riset Perikanan Budidaya.32 ± 0. pH pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur.. ikan diberi perlakuan pemberian pakan alami yang berbeda. (A) Chironomus sp. dan Irsyaphiani Insan**) Balai Riset Budidaya Ikan Hias.50 ± 0. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya.) Eni Kusrini*). Hasil penelitian menunjukkan bahwa perlakuan pH 7.00 dengan metode pemberian sekenyangnya (adlibitum). memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp. namun tidak berbeda nyata (P>0. Rendy Ginanjar.24 cm. Jakarta *) ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua.0. Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5. Gigih Setia Wibawa*). Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor.0 – 6.05) . dengan pertambahan bobot rata-rata sebesar 0. dan (C) Tubifex sp. gonad. (B) Culex sp. Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali..0-8. Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0.5 – 5.00 dan 16. pH 6. Pakan diberikan tiga kali sehari yaitu pada pukul 8. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula.09 g dan pertambahan panjang total ratarata sebesar 0.Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi. Agus Priyadi*).00. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp. 12.0 – 8.98 ± 0. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya.01 g dan panjang total rata-rata 3. Depok..8 (sebagai kontrol). Selama 45 hari pemeliharaan.85 ± 0.05) terhadap pertambahan bobot rata-rata ikan. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp. KATA KUNCI: air Melanotaenia sp. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar. memberikan pengaruh yang berbeda nyata (P<0.9 dan pH 7. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian. dan Culex sp.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat.

pertumbuhan. KATA KUNCI: Benih ikan pelangi. pakan alami. pendederan. sintasan .terhadap rata-rata pertambahan panjang total dan sintasannya.

Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. 20 ekor/liter. 96. 97. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. D. tetapi berpengaruh nyata (p<0. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia. B. . Pakan yang diberikan selama penelitian adalah nauplii artemia. dan Jacques Slembrouck**) . padat tebar. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi.13±0. 96. Depok **) Universitas Diponegoro. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*).81%.45%. 30 ekor/liter dan E. KATA KUNCI: Metynnis hypsauchen. 25 ekor/liter. resirkulasi.02 g. Rendy Ginanjar*) Asep Permana*). Balai Riset Budidaya Ikan Hias Depok. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). D. Lili Sholichah*).22% dan E. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. C.07%. 96.02 cm dengan bobot 0. 15 ekor/liter. Ikan uji yang digunakan adalah benih berukuran panjang 2. Prancis *) ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. B. Sintasan dari masing-masing perlakuan adalah sebagai berikut: A. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi.67 mm.67%.22±0. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari. Marendra Gladiyakti**) *) Balai Riset Budidaya Ikan Hias. C.05) terhadap pertumbuhan. Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. ketersediaan pakan dan padat penebaran. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap. 95. pertumbuhan. Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan. B (2 ekor/L). Indonesia **) Institute Recherche Pour Le Developpement. 35 ekor/liter.

sintasan. padat tebar .KATA KUNCI: ikan botia.

Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. biokonversi. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. dan homing atau reproduksi. memiliki bak kultur. kolam budidaya dan manajement budidaya yang baik. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. Unit pengolah pakan memiliki prasyarat sebagai berikut. memiliki bak untuk restokin. lunar. 2) unit pengolahan pakan dan 3) unit budidaya. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. Ikan Sidat (Anguilla sp. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). KATA KUNCI: maggot. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). makanan. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. KATA KUNCI: Phenotipic plasticity. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. bahan pakan seperti vitamin dan dedak. Unit budidaya ikan memiliki prasyarat sebagai berikut. temperature. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. Ikan migrasi. Migrasi terbagi menjadi migrasi vertical dan horizontal. ketersediaan pakan dan pemasaran. Kawasan Mina Pakan Mandiri. area penjemuran atau alat pengeringan pakan (drying). Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. fisiologi dan tingkah laku dalam merespon perubahan lingkungan.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. Unit produksi maggot memiliki prasyaratan sebagai berikut. air tersedia dalam jumah yang cukup. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. salinitas dan arus. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. memiliki mesin pelet. sedangkan factor eksternal yaitu. propinsi Jambi. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya.) . Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri.

dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. Selain itu.h-1 dan 0. terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&). Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi. Hasil dari persentase polimorfik (berkisar 5.560). Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan. Kata kunci: Randomly Amplified Polymorphic DNA (RAPD). Jarak genetik 15 populasi persilangan berkisar (0. Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O.mossambicus).h-1 dengan nilai konstanta Michaelis-Menten (Km) 0.236 – 0. dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Iman Rusmana**). Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD).26% – 63. mujair (O. Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. Sukamandi.mossambicus). Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik. Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Ikan yang di gunakan adalah hasil persilangan 4 strain.Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. nila merah (Red NIFI). juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. NIRWANA (nila ras wanayasa). Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan . Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. mossambicus) Nunuk Listiyowati.28 mM. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. tetapi yang menghasilkan benih hanya 15 populasi.17 mM. Oreochromis niloticus . jarak genetik.16 mM.40 mM dan 0.15%). untuk mengamati variasi genetik benih persilangan ikan nila. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*). Didik Ariyanto. Persilangan. Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi. nila BEST (Bogor Enhancement Strain of Tilapia). terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). Aktivitas reduksi nitrat terjadi dari awal inkubasi. sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST.

reduksi nitrat . nitrogen anorganik. Kata kunci: denitrifikasi.dengan Pseudomonas aeruginosa.

Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. Osphronemus goramy. ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma.09% menjadi 4. Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC. inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC.37% setelah proses fermentasi. fermentasi. Pada tahap pembentukan mata. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi. nutrisi dan serat kasar . Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia. distibusi. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. KATA KUNCI: PGC. bungkil sawit.37% dan meningkatkan kadar protein dari 13.) Priadi Setyawan1). UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. rasio inti sel:sitoplasma yang besar. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia. menurunkan lemak bungkil sawit dari 14. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp.. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. KATA KUNCI: Bacillus sp. Isdy Sulistyo2). 4 hari (D2). Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. Sukamandi **) Universitas Jenderal Soedirman. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. sebagai bahan baku pakan ikan patin.91% menjadi 15.8%. 6 hari (D3). Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). PGC terdistribusi secara berkelompok di bagian ventral.74% menjadi 5.

pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). Wartono Hadie**). Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. Angela M. dan Labuan (Merak). patin. setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. dan kluster pemeliharaan larva dan benih. integrasi. Tipe integrasi bersifat soliter. dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Pengambilan data melalui responden dilakukan dengan cara purposive sampling. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. salah satunya melalui Catfish Club Indonesia.1994). Eni Kusrini****). Jakarta ***) . Perbedaan dari kedua sistem ini adalah sifat produksinya. dkk. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. Lusiastuti***). Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil .Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: UPR. Bogor ****) Balai Riset Budidaya Ikan Hias. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran. di antaranya daerah Bogor dan Subang. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal.. kluster penetasan telur. Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. Depok ABSTRAK Ikan patin (Pangasius sp. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. demikian juga ditinjau dari segi higienis dan kesehatan benih. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. Subang. Jakarta **) Pusat Riset Perikanan Budidaya. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. dengan masing-masing hatchery terpisah lokasinya.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP.

sebagai materi kegiatan tahun mendatang. betina homogamet . KATA KUNCI: ikan nilem. kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. sex reversal. jantan fungsional.persilangan dengan jantan fungsional yang tidak dilakukan sex reversal.

Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva). dan Afifah Balai Besar Riset Perikanan Budidaya Laut. M H Fariddudin A. kepadatan. dan nitrit). larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih. oksigen terlarut/DO.57 % dalam satu generasi. sintasan dan kualitas air (meliputi suhu. KATA KUNCI: seleksi generasi. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. 15 butir/ liter perlakuan (I). Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan.2 gram. ikan mas strain rajadanu . Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva. 10 butir/liter (perlakuan H). Anang H K.27 pada ukuran konsumsi S D dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19. memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). KATA KUNCI: sintasan.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. pH. intensitas cahaya. Diketahui estimasi nilai heritabilitas rata-rata h²( + ) = 0. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. amonia. Agus Priyono. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar.1.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. salinitas. pertumbuhan. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui.

Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. bakteri probiotik. eksplorasi. Survei dilakukan di beberapa daerah yaitu Cianjur. KATA KUNCI: antibakteri. Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. dan Lila Gardenia Pusat Riset Perikanan Budidaya. penyakit streptococcosis . Klaten. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus). Hambali Supriyadi. penanggulangan.dan Tasikmalaya. Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik.

Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. Kabupaten Pandeglang. Untuk menjamin keberlangsungan usaha budidaya kerang hijau. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Provinsi Banten. budidaya laut. KATA KUNCI: kerang hijau. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). Pandeglang . di perairan Panimbang Kabupaten Pandeglang. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. Erlania. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. Hatim Albasri. Teluk Lada. Kabupaten Pandeglang. Secara umum. SIG.

Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro. Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. dan Opercularia plikatilis. Carchecium sp. padahal permintaan cukup besar. Jateng. STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*). Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro.Wartono Hadie*). sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP. tingkat sintasan. induk. BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. Retna Utami**). Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. dan diferensial hemosit.UPU Probolinggo (Jatim). Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Zoopthalmium sp..42%. Bali. Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan. Vorticella sp. Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. Ikhsan Khasani**). Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol. Parameter yang diamati meliputi pemeriksaan parasit.. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya.) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. kelompok kedua adalah penghasil benih. serta UPR yang mengembangkan usaha perbenihan udang galah. Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp. Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP SamasYogyakarta. dan kelompok ketiga ialah pembudidaya. kelompok kedua adalah BBU Pamarican (Jabar). BBAP Samas-Yogya(Jateng). KATA KUNCI: udang. manajemen.Forum Inovasi Teknologi Akuakultur 2010 pK 01 1.). Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas. . dan kelompok ketiga ialah pembudidaya.. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. dan Spiranura sp. Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. Imron**).. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp.Bali. dan Jatim. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset.Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. tingkat kesembuhan. BBUG Klungkung.. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya. Bali. kelompok kedua adalah penghasil benih. sedangkan dari kelompok protozoa adalah Epistylis sp.

tembakau (Tobacum nikotiana) .).KATA KUNCI: huna (Cherax sp.

masing-masing dengan dua ulangan.22% dan 72. dilakukan pengolahan tanah tambak. Penelitian ini dilakukan pada tambak di daerah Betok Mati. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang. survival rate.500 m2 digunakan untuk percobaan. KATA KUNCI: udang windu.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35.8 kg dan kelangsungan hidup 100 %. Setelah dua hari. Idil Ardi. tokolan. dan Wartono Hadie Pusat Riset Perikanan Budidaya. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. pada bulan pertama udang tidak diberi pakan. kemudian dikeringkan sekitar satu minggu. yaitu menggunakan tingkat teknologi tradisional plus. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54. pengapuran dan pemupukan. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. Sebelum penebaran. yaitu pertambahan berat rata-rata 230 g. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. penebaran dilakukan setelah satu bulan dari penebaran tokolan. pemberantasan hama. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak.n pengapuran sebanyak 175 kg/petak. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. namun polikultur udang vaname dan rumput laut masih kurang informasinya.66% dan 108. polikultur.5 g. produksi . salinitas rendah. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. Dari pemeliharaan udang selama tiga bulan. namun berbeda tidak nyata (P>0. Karawang. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan.1 kg dan kelangsungan hidup 11. sedangkan pada dua bulan berikutnya diberi pakan pellet udang. Hewan uji yang digunakan adalah udang vaname PL-48. Empat petak tambak masing-masing berukuran 3. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. Pemeliharaan dilakukan selama tiga bulan.2 %. produksi 81. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. KATA KUNCI: vaname. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. produksi 78. Dengan teknologi yang diterapkan. Gracilaria verrucosa.000 kg/ha rumput laut.6 kg/ha. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. Kecamatan Cilebar. pengeringan.84 kg/ha.

Dinophyceae.05) terhadap kelimpahan dan jumlah jenis plankton. dan Rotatoria. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari.3 g dengan padat tebar 50 ekor/bak. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Polychaeta. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. kotoran. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata.6 m sebanyak 12 buah. indeks keseragaman menunjukkan komunitas plankton pada . dan perlakuan D = tanpa sumber karbohidrat. menggunakan bak kayu ukuran 1 m x 1 m x 0. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. dan Cyanophyceae. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. pola tradisional. Pada budidaya udang vaname pola tradisional plus. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka. pelakuan B = sagu. Pada budidaya udang windu intensif. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. pola intensif. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. dan metabolit udang. KATA KUNCI: tepung tapioka. 25. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. masing-masing dengan 3 ulangan. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. Hal tersebut perlu mendapat dukungan dari penelitian. perlakuan C = tapioka. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea.

probiotik. udang windu . KATA KUNCI: plankton.perlakuan D relatif lebih merata dibanding perlakuan lainnya. indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil.

Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea. perlakuan B = kotoran sapi. pH. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton.05) terhadap pertumbuhan udang vaname. C = 4 mg/L. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. indeks keseragaman. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. dan produksi udang vaname. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. namun berpengaruh tidak nyata (P>0. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin. KATA KUNCI: probiotik. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. NO . indeks keragaman. sintasan. dan Pleurosigma dari Kelas Bacillariophyceae. pertumbuhan. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau.5 m dengan volume air 400 L. setiap 15 hari. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. serta Oscillatoria dari kelas Cyanophyceae. Nitzschia. BOT. Abdul Malik Tangko. PO . Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing- . Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. dan indeks dominasi plankton selama pemeliharaan udang windu. B = 2 mg/L. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. suhu. Hasil penelitian menunjukkan perlakuan berpengaruh tidak 4 2 3 nyata (P>0. oksigen terlarut. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L.05) pada sintasan dan produksi udang vaname. sintasan. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. NO . Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0.000 ekor/petak). dan perlakuan C = dedak padi halus. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang.05) terhadap jmlah jenis dan kelimpahan plankton. Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas.

tambak .427). KATA KUNCI: dinamika plankton. udang windu.362).199–1.masing: indeks keragaman (1. pupuk organik. indeks keseragaman (0.780) dan indeks dominansi (0.324– 0.689–0.

Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L.0±5. Substrak tanah tambak. masing-masing dengan dua ulangan. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71.984.5 dan 21. biaya produksi. Perlakuan yang diujicobakan dalam penelitian ini adalah A.2 cm dan bobot awal 0. KATA KUNCI: efisiensi. udang windu . udang pama. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0. Substrak tanah sawah. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak.03±0. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1.3±1. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A).650.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2.8±0.6. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak. budidaya. Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan. substrak tanah sawah. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak).239.dan Rp 19. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak.14 dan 2. B. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru. Penelitian dilaksanakan pada tambak ukuran luas 4. biaya pakan pada perlakuan A dan B masing-masing Rp 11. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak. dan C..24. di mana masing-masing perlakuan diulang tiga kali. Substrak tanah lumpur. dan substak tanah lumpur.01 g.. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari. Machluddin Amin. KATA KUNCI: substrak..05) antara perlakuan substrak tanah tambak.875. umur pemeliharaan.634. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka.sedangkan pada perlakuan A dan B masing-masing 2.

61%. Namun demikian.7%. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A.7 kg/500 m2 = 320 kg/ha. Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48.66 kg/bak (7. 1.masing bak mempunyai ukuran panjang. Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan. ukuran 80 sampai dengan 96 ekor/kg).3 ± 5. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan.4 ± 0. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91.3 ± 7. ukuran 84 sampai dengan 89 ekor/kg) dan C (16.1 ± 13.0 ± 2. KATA KUNCI: tepung tapioka.235 kg/ha).6813.15%.7%. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar. lebar dan kedalaman secara berurutan adalah 10 m.86 g/ekor.975 dan lebih . Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah. lebih tinggi daripada perlakuan B = 41. Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. pertumbuhan udang. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang. Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B). Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2.767.66 g/ekor.86 kg/bak (8.2 kg/500 m2 = 506 kg/ha. masing. namun tidak berakibat terjadi kematian massal. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali. kisaran produksi 12. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0.92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90.5 m dan 1 m. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau. Maros.998. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah.2 ± 13. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. dengan rata-rata berat 12. B).7% dan perlakuan C = 36. fermentasi probiotik.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau.28-13.64 kg/bak atau rata-rata 11. di mulai setelah satu minggu penebaran. kisaran produksi 9.6 kg/500 m2 = 406 kg/ha. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C).45 kg/bak atau rata-rata 12. dengan rata-rata berat 11. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20.

325. udang vaname. salinitas rendah .rendah dibandingkan perlakuan B yang mencapai 1. KATA KUNCI: molase.

75%. Pemberian bakteri probiotik A (Bacillus sp. dan kontrol 66.5 mg/L. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan.) yang berukuran PL-20. Pengaruh perlakuan terhadap sintasan. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol).5 mg/L. Pemberian probiotik A dengan konsentrasi 0. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah. Rhodococcus sp. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. Dengan meneliti dua jenis probiotik. Kontrol (tanpa pemberian probiotik A). karena secara alamiah larva hidup di periran bersalinitas. Aplikasi probiotik setiap tiga hari sekali. diikuti perlakuan 5‰ sebesar 10±0. dan pertumbuhan udang.25%.001 mL/L.50%. Pemberian probiotik B dengan konsentrasi 5. terdiri atas: O. sedangkan juvenil dan udang dewasa hidup diperairan tawar. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab. sintasan. B. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji. waktu inkubasi. Nitrosomonas sp. dan D..57 hari . sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. dan Rhodobacter sp.0 hari.75%–68. B. Penelitian I adalah pengujian probiotik A. dan tiga ulangan. Pemberian probiotik B dengan konsentrasi 2. yaitu probiotik A (mengandung bakteri Bacillus sp. C.). 10 ‰. Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang. Kontrol (tanpa pemberian probiotik B). Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62.6±0.. Parameter yang diukur adalah kualitas air.001 mL/L menghasilkan sintasan sebesar 81. laterosporus. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. 1995). Pemberian probiotik B dengan konsentrasi 7. Pemberian bakteri dengan konsentrasi 0. udang galah. dan R. Penelitian II pengujian probiotik B. Pemberian probiotik A dengan konsentrasi 0. 5 ‰. Q. Pemberian probiotik A memberikan pengaruh terhadap rata-rata . apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz.15. 88%.. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL).Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Nitrobacter sp. P. 85%. Universitas Padjadjaran. dan 0‰ sebesar 11.. 85%. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F. sebagai dasar perbaikan sistem penyediaan larva udang galah. terdiri atas: A. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan.) dan probiotik B (mengandung bakteri Bacillus polimyxa. Masing-masing perlakuan diulang sebanyak empat kali. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter). Pemberian probiotik A dengan konsentrasi 0.) berpengaruh nyata terhadap sintasan benih udang windu.003 mL/L.0 mg/L. KATA KUNCI: salinitas. Tingkat sintasan yang diberi probiotik B berkisar antara 63. sebelum diaplikasikan di tambak.002 mL/L.3±1.25%.

001 mL/L menghasilkan pertumbuhan tertinggi (0.pertumbuhan mutlak benih udang windu. udang windu. kualitas air.8935 g). sintasan. KATA KUNCI: probiotik. pemberian dengan konsentrasi 0. Ratarata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0. pertumbuhan .3660 g. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata.4255–0.4440 g dan kontrol 0.

67%. 20 ppt. KATA KUNCI: pertumbuhan. 25 ppt. KATA KUNCI: Macrobrachium rosenbergii. dan ukuran templat. Hasil yang diperoleh adalah pada salinitas 5 ppt. dan 20 ppt sintasan dari post larva udang galah mencapai 100%. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. 10 ppt. 10 ppt (kontrol).Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH. 15 ppt. diantaranya karakteristik templat DNA genom yang meliputi kemurnian. pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi.05). Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. sedangkan sintasan pada perlakuan 25 ppt mencapai 61. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. Selain itu. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau. Guna mendukung prgoram revitalisasi tambak. yaitu templat dengan berat molekul tinggi (1). dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. konsentrasi.33±0. PCR. Sukamandi. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 15 ppt. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3). Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. salinitas. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. udang galah .92±0. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. Ditinjau dari keragaan pertumbuhan.09 cm. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor.13 cm dan 1. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR.

panjang. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. Oleh karena itu. dan gabungan keduanya (C). baik pertumbuhan bobot. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). Berdasarkan persentase. Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. ikan rucah (B). dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. Sintasan yang diperoleh pada penelitian ini yakni 52%–54. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. kepiting lunak . perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. KATA KUNCI: kepiting bakau.66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. KATA KUNCI: pergantian kulit.05). Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen. Dari pencapaian bobot ini.5%. maupun lebar karapas (P>0. manipulasi lingkungan. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). kepiting bakau. Sulaeman. Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan.Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. Pakan diberikan dua kali sehari selama penelitian. pemberian pakan.

2 g. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh. Dibalik manfaat mangrove yang demikian banyaknya. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009.000 ekor/ha ukuran crablet-30.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan.1±0. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi. sintasan. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa.100 pohon/ha. data yang diperoleh dibahas secara deskriptif. perlindungan. Tambak yang digunakan berukuran 10./m2. sintasan. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.000 m2. dan pelestarian alam. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. dan produksi serta parameter kualitas air.0 ± 2. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi. Peubah yang diamati adalah pertumbuhan lebar karapas. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰— 4 9‰) mengakibatkan sintasan dan produksi rendah. jumlah permudaan 450–500 pohon/ ha. KATA KUNCI: kerapatan hutan mangrove. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya.5 bulan dengan panjang dan bobot masing-masing adalah 8. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1.2 mm dan 0. tambak bersalinitas tinggi. pertumbuhan. Ikan bandeng yang digunakan adalah gelondongan umur 1.300 pohon/ha dengan rata-rata 1. sehingga perlu riset budidaya rajungan pada musim kemarau.2 ± 2.7 cm dan 4.02 g dengan kepadatan 1 ind. restoking kepiting bakau. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari). rumput laut dengan kepadatan 1. KATA KUNCI: rajungan. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1. Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan. bobot.573.000–1. produksi . Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi. Hasnawi.05±0. Tambak ditebari benih rajungan.04 ha.

Secara umum. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan.03 mg/L. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). Kappaphycus alvarezii. cukup layak dan tidak layak. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. KATA KUNCI: minapolitan. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. KATA KUNCI: Danau Maninjau. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. layak. Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Adang Saputra. bioakumulasi. SIG. Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). logam berat . Provinsi Gorontalo. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya. DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. Secara umum. Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). Untuk memfokuskan kegiatan budidaya rumput laut. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. I Nyoman Radiarta.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. kondisi perairan sangat mendukung pengembangan budidaya rumput laut. Anjang Bangun Prasetio. rumput laut. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak.

Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. KATA KUNCI: kualitas air. tambak. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. DO. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut.962.085. 20 dan 30. Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. N. indeks keseragaman berkisar antara E=0. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom. dan plankton dilakukan seminggu sekali. SUBANG Joni Haryadi*). Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. dan Erlania*) *) Pusat Riset Perikanan Budidaya. kimia.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. Nitzschia sigma. TSS.0760. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. alga hijau biru dan alga hijau). Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan. Subang. nitrit. Supii. BBRPBL Gondol . KATA KUNCI: alga perifiton. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. Adi Hanafi. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali.7112. inlet.814-0. Kualitas kimia air untuk pH. Sampling air secara regular untuk pengamatan fisika. Indeks keanekaragaman berkisar antara H’=2. Subang. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. Dara Kasih**). Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah. sedangkan indeks dominansi berkisar antara D=0. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. Perifiton yang terdapat di Tambak Blanakan. GONDOL-BALI Apri I. outlet. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air.853.

2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal. yaitu: ikan mas (5. P. limbah hara N dan P . yang terdiri atas: 9 jenis pakan untuk ikan mas. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio). Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur.83– 1. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan.53%–15. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm.88–1. dan 3). 2). Ani Widiyati. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan. 1. Perlakuan adalah pemupukan dengan perbandingan N. dan keanekaragaman plankton. ikan nila (3. dan bawal adalah 1.48%–9. Kusdiarti. K = 16:20:0.58%–13. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan.17% dan 8. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas.dengan produksi Moina sp. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP.23%–6.53%) dan ikan bawal (8. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung.21%).89%–17.16 g. dan 1.71%– 10. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp. Parameter yang diamati adalah jenis.89.90. indek dominasi. Panen Moina sp.96 ±1. Data dianalisis secara deskriptif. KATA KUNCI: limbah.87. 9. ikan nila.. volume air 500 L. Pengukuran N dan P dilakukan pada ikan dan pakan.89% dan 11. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin. kelimpahan.) di laboratorium.78%).900 g sedimen + 20 g TSP. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP. Bogor. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp. KATA KUNCI: konversi pakan. serta produksi Moina sp.73–1. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP . dilakukan pada hari ke-8 sejak dilakukannya penebaran.63% dan 10. 1. akuaponik. nila (Oreochromis niloticus) dan bawal (Colossoma sp.

pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. N4M (2).1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. Oreochromis niloticus. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. sehingga dapat meminimasi kegagalan panen. Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir. Sukenda***). 4. dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah. Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. dan NK1 (5) yang berasal dari organ otak. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S. Hasil yang diperoleh. Oleh karena itu. N14G (3). di laut dan Gracillaria sp. agalactiae setelah dilakukan uji Postulat Koch. KATA KUNCI: Streptococcus agalactiae. Budidaya rumput laut khususnya Kappaphycus sp. Bogor **) Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. N17O (4). Esti Handayani Hardi**). Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM.6 juta ton per tahun sekarang ini menjadi 7. Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. Postulat Koch. Produksi rumput laut ditargetkan meningkat dari 2. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). .Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*). mata. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. Isolat 1. sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian. agalactiae. Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani PongMasak Balai Riset Perikanan Budidaya Air Payau. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur.6 juta ton per tahun pada 2014.

KATA KUNCI: rumput laut. penyakit. hama. pencegahan .

suhu 29. . Mudian Paena. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan.95 ha. dan total suspensi <25–80 mg/L. dan Makmur Balai Riset Perikanan Buddidaya Air Payau.33 ha.820. Kabupaten Kepulauan Selayar.38–44. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder.3 meter.57°C–30. pH antara 6.1113 mg/L.0032–0.095. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari. Syarifuddin Tonnek.0037 mg/L. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir. nitrit <0. kedalaman 1–40 meter. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara.09 mg/L.01169 mg/L.02–9.81–6.90 ppt. oksigen terlarut 5. kurang sesuai 2. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009.10– 36. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang. Rachman Syah. Pengumpulan data primer dilakukan dengan cara wawancara mendalam. fosfat 0. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27. karakteristik. kesesuaian rumput laut. KARAKTERISTIK. KATA KUNCI: potensi. demikian pula dengan karakteristik físika dan kimia oseanografinya.32 ha.0008–0.685 mg/L. Kata kunci : Opsi pemanfaatan wilayah pesisir.66°C.85 mg/L. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar.610. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya.Indra Jaya Asaad. salinitas 36. dengan tingkat kesesuaian lahan sesuai 21.30 ha dan tidak sesuai 3. analisis hierarki proses.695. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. besi 0.1–8. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis. bahan organik total 37. Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir. Penelitian ini bertujuan untuk mengetahui potensi.0267–0. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1.37.039–0. Petrus Rani Pong-Masak. nitrat 0.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI.

Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. PO4 dan Fe. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. A. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009.Indra Jaya Asaad. NO3. kandungan oksigen telarut. Utoyo. salinitas.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. faktor teknologi budidaya. KATA KUNCI: keramba jaring apung.Indra Jaya Asaad. Kata kunci : kualitas perairan. analisis faktor. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. Parameter kualitas perairan yang diamati adalah suhu. yaitu : faktor infrastruktur dan kondisi perairan. konduktivitas. NO2. Rachman Syah. lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor. Muhammad Chaidir Undu. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. Cakupan wilayah penelitian meliputi Teluk Hurun. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. Makmur. dan faktor pasar. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. NH3. pH. tambak. Kabupaten Pontianak . dan Muawanah Balai Riset Perikanan Buddidaya Air Payau.

4%. kemudian direndam dalam larutan KOH 0. setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. dan 28. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna.41%.663 cps. abu. kadar abu. rendemen. bau. kadar abu 19. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk. Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. kapang) dan rendemen.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.1% selama 60 menit.1%. lemak. viskositas 8. analisis fisika-kimia . Rumput laut coklat setelah dipanen. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempahrempah kasar dan halus (ekstrak). dan mutu natrium alginatnya mempunyai kadar air 19. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat. Selanjutnya. dan pH). 7. Kadar air. rasa. KATA KUNCI: ikan sidat.0%. abu. Rumput laut coklat dibagi menjadi dua kelompok. terbuka di atas lantai pada suhu ruang (sekitar 30°C). Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. kimiawi (kadar air. KATA KUNCI: pengeringan.44%. dicuci dengan air bersih. dan tekstur) menggunakan skala hedonik. Jakarta **) Pusat Riset Perikanan Budidaya. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. dan protein masing-masing sebesar 14.25% dan dendeng dengan bumbu ekstrak sebesar 59. 28.97%. Rendemen dendeng sidat dengan bumbu kasar sebesar 57.32%. dan viskositas natrium alginat).46%. Sedangkan nilai TVB dan pH masing-masing sebesar 21.0%.04 mgN% dan 6. dan rendemennya 37. dan dijemur di bawah sinar matahari selama 18 jam. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15.26%. dan dijemur di bawah sinar matahari selama 18 jam. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. Kelompok kedua ditebar di atas lantai dengan beralaskan waring. mikrobiologi (Angka Lempeng Total/ALT. dendeng. natrium alginat. rumput laut coklat. protein lemak. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). TVB.

Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. serta ketersediannya dalam skala kecil. pengalaman petani ikan dan Kebijakan Pemerintah. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. kelembagaan yang menunjang. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat. kekurangan modal. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). prasarana fisik yang kurang mendukung. harga ikan yang tergantung pembeli dan cuaca. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. KATA KUNCI: potensi desa. Faktor pendorong yaitu ketersediaan air yang melimpah. Identifikasi faktor-faktor pendorong maupun faktorfaktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya. Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. agribisnis perikanan . polusi air. Metode yang digunakan adalah studi kasus.

Sign up to vote on this title
UsefulNot useful