Forum Inovasi Teknologi Akuakultur 2010

ABSTRAK PRESENTASI ORAL

Forum Inovasi Teknologi Akuakultur 2010

FF 01
PERFORMA IKAN NILA BEST DALAM MEDIA SALINITAS
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: =2,1±0,23; W = 7,0±0.29; = 139,8±6.72; 7,5ppt = 2,3±0.06; 0ppt 0ppt 0ppt L B L W7,5ppt = 8,2 ± 0,42;7,5ppt = 164.3 ± 8,46; 5ppt = 2.3 ± 0,21; 15ppt 7.8 ± 0,45; B = 155,6 ± 8,95. Pengamatan setelah W B L1 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-5 : 4,0±0,34; 3: 4,8±0,27; 5- : 7,4±0,35; 5: 9,2±0,98. 5 15ppt8 0ppt8 15pptPengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
0ppt 15ppt

KATA KUNCI:

nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
PENGUJIAN LANGSUNG EMPAT STRAIN IKAN NILA (Oreochromis niloticus) PADA SALINITAS 40‰
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen ) dengan 8 ulangan dari masing-masing strain. Analisa 50 (LT data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise

Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata 50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru LT (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT
50

Forum Inovasi Teknologi Akuakultur 2010 FF 03 PENGGUNAAN Saccharomyces Cereviceae PADA FERMENTASI PAKAN BUATAN UNTUK MENINGKATKAN PERTUMBUHAN NILA MERAH (Oreochromis Niloticus) Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah.3333%–46.5797.1765– 0. Universitas Padjadjaran ABSTRAK Penelitian ditujukan untuk menentukan persentase terbaik dari S. OPA-04. dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. dengan nilai heterozigositas 0. dan OPC-15. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. dan lokal Bogor. A (penambahan S.) DENGAN ANALISA SIDIK RAGAM RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD) Iskandariah. Sebagai perlakuan 0 adalah A (tanpa penambagan S. cereviceae sebagai perlakuan dan lima kali ulangan. OPC-14. cereviceae 1%).0351–0. lokal Kuningan. Gesit. Populasi yang diamati meliputi jenis nila BEST. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD). dan A (penambahan S. Otong Zenal Arifin. Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. genetik. 1 2 3 Hasil penelitian menunjukkan penggunaan S.6667%. Oreochromis . KATA KUNCI: RAPD. nila merah FF 04 ANALISIS KERAGAMAN GENETIK LIMA POPULASI NILA HITAM (Oreochromis sp. cereviceae 3%). populasi. cereviceae 2%). cereviceae). Bogor ABSTRAK Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi. fermentasi. ikan nila. cereviceae sebesar 2% KATA KUNCI: Saccaromyces cereviceae. Nirwana. pakan buatan. A (penambahan S. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. dengan menggunakan primer OPA-03.1952 dan jarak genetik antar populasi 0. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. Pertumbuhan terbaik diperoleh pada penambahan S. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13.

agalactiae. SR). Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. Uni Purwaningsih*). Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. 106. 106. S. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. yaitu genotype XX. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. Fakultas Perikanan dan Ilmu Kelautan.01%. Oreochromis niloticus Angela Mariana Lusiastuti*). agalactiae pada tingkat kepadatan 108.81% dan 83. Komar Sumantadinata**). agalactiae secara intra peritoneal pada ikan uji sebanyak 0. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. ikan uji disuntik dengan PBS. ikan nila . seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. Selain ditentukan secara genotipe. titer antibodinya menurun. titer antibodi. Kata kunci : Ikan nila. pengukuran bobot individu rata-rata dan penghitungan sintasan. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. genotipe. DAN YY Didik Ariyanto*). dan YY melalui evaluasi nisbah kelamin yang dihasilkan.55% sedangkan genotipe XY dan YY masing-masing sebesar 79. Untuk kontrol. Budidaya Perairan. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. Genotipe XX mencirikan betina dan XY untuk jantan. 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. dan differensial leukosit dilakukan analisa sidik ragam (Anova). Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. Tetapi setelah uji tantang. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. Pada perkembangannya. XY. agalactiae. KATA KUNCI: vaksin sel utuh. Perlakuan dengan injeksi sel utuh S. Sukamandi **) Dept.1 mL/ekor. XY. limfosit perlakuan tidak berbeda nyata dengan kontrol. Pada uji tantang setelah minggu keenam.Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. diferensiasi kelamin. Data sintasan (Survival Rate. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. Pada akhir pendederan dilakukan identifikasi jenis kelamin. tidak cukup untuk memberikan protektif terhadap S. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. Hasil yang diperoleh bahwa sel utuh (whole cell) S.

dengan variasi perbedaan kepadatan bakteri vaksin (A=108. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. B=106. Selain itu. ortofosfat dan total fosfat. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. D=102 cfu/mL dan E=kontrol). NO . kecerahan. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. TDS. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. pH. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. NH .5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. KATA KUNCI: Streptococcus agalictiae. karena pada kondisi perairan yang kurang . dan Joni Haryadi Pusat Riset Perikanan Budidaya. Angela Mariana Lusiastuti. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). turbiditas. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. Pemberian pakan tidak boleh berlebihan. NO . melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). terutama dalam hal manajemen pemberian pakan. Anjang Bangun Prasetio. pemanasan. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. C=104. BOD. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. adalah septikemia dan meningoencephalitis. DO. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. Selain itu.5). Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. total nitrogen. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. serta data status kegiatan 3 2 3 budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau.

Danau Maninjau.baik akan menyebabkan stres pada ikan. lingkungan perairan . KATA KUNCI: manajemen pakan. keramba jaring apung (KJA).

tinggi.20%.48% bt/hari dan 2.44%). tinggi (3.53 % bt/hari.74%).06%). bobot ( -2. Sukamandi **) Dept. oreochromis niloticus .64% bobot badan (bt)/hari. Sukamandi selama lima bulan. sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2. Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia). SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2. Fakultas Perikanan dan Ilmu Kelautan.94%).87%) dan sintasan (0. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat. persilangan.Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*).22%).80%. bobot) dan sintasan. Komar Sumantadinata**). bobot (-2.82%).35% bt/hari. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4. Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (2. tebal.05) bila dibandingkan dengan dua populasi lainya. IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi. Parameter yang diamati meliputi keragaan pertumbuhan (panjang. dan sintasan(1.65%). tidak berbeda nyata (P<0.48%). lebar (0. Budidaya Perairan. Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49. Nunuk Listiyowati.21%). Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. tebal (-1. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. tebal (0. KATA KUNCI: heterosis. sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.

48.1100).0839(2. 0. 3.6578–2. dan 96 jam. 72.08 g. N17O.0930).13 dan 1. . 2.1295). N14G. Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1.3354 (3. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis.0430 (4. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S. 50 LD iniae (N2O).9237(0. Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan.8090) dan benih ikan nila 5. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin. 72. dan 96 jam terhadap benih ikan mas adalah 4.7138 mg/L (0. dan nilai terbesar dimiliki oleh bakteri S.6904– 5. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran. agalactiae (N4M) memiliki nilai terkecil.8532). dan sonikasi. Konfirmasi taksonomis hingga level spesies isolat bakteri S. Hasil penelitian menunjukan bahwa Nilai LC 24. 3.7877–2. Data diolah dengan analisis probit program LC50. N4M. 0.9421 mg/L (1. 1. Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar. 48.7504). Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah.4227– 4. Penelitian dilakukan di Instalasi 50 (LC Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak.9823–4.6799–13.5805). NK1) dan 1 isolat S. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). agalactiae (N3M.81±0.5094 (2. Hasil penapisan menunjukkan bahwa bakteri S. dan 96 jam.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration ) 24.5480). Bogor.6297–0. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN. pemanasan. benih ikan. agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik.0678 (1. iniae (N2O). Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila.55±0. 48. 50 KATA KUNCI: toksisitas.8101–1. uji stabilitas dan LC50–24. SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA.

streptococciasis. vaksin.KATA KUNCI: penapisan. ikan nila .

Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Sulawesi.2 g. dan sebagainya. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya.00 pagi hari. dan 80 ekor/m3 selama 5 bulan masing. Waktu pemijahannya sekitar jam 24.12 kg/cm. kambing dan ikan pari yaitu berisi. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek.0–3. kadar air 13. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20.76 kg/cm2. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. suhu kerut 88°C.00.62%. Nusa Tenggara Timur.97% sehingga sangat prospektif untuk 2 3 dijadikan barang-barang kerajinan kulit. benedinia.46 N/ cm2 atau 222.masing mencapai ukuran 127. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi. kekuatan regang (kemuluran) 66.184. liat.53 N/cm atau 138. simetris. 103. kekuatan tarik 2. kadar abu 2. garmen. kakap putih. 40. tas.00–08.66%.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat.94%. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%.0 g. dan 102. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. dan Sumatera. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia. Telur yang ada dalam kolektor dapat diambil jam 07. sarung tangan.354. namun sintasannya masih rendah yaitu sekitar 1%–3%. Ikan ini relatif sensitif dengan perubahan lingkungan. dan corak permukaannya spesifik.5 g.5 kg. lemas.93% dan kadar Cr O 1. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan. kadar lemak 6. dan cacing. dan 15% . karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu.00 sampai jam 03. Ikan ini mudah terserang parasit seperti cryptocarion. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. Pembenihan ikan ini mulai berkembang di sekitar Gondol. KATA KUNCI: bahan penyamak kron. kekuatan jahit 1. dompet. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa . sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. Dalam pembesaran. untuk dijadikan kulit tersamak. 10%. Selain itu. kambing. yang merupakan limbah perikanan dari perusahaan filet ikan. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi).Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.

kerapu sunu . KATA KUNCI: pembenihan. pembesaran.Tenggara Barat.

Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. Alimuddin***). Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). dan Gemi Triastutik*) *) Balai Budidaya Air Payau. Cromileptes altivelis Slamet Subyakto*). 2. KATA KUNCI: transfeksi. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. Ratu Siti Aliah*****). mikroinjeksi. dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. jarak waktu antar kejutan 0. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. mikroinjeksi. Sasmito Jati****). transfer gen. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. Metode elektroporasi dilakukan dengan voltase 50 V. Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. dan 20 µg/ mL. dan 3 detik. Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. lama kejut 30 ms. Komar Sumantadinata***). 10 µg/mL. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. hormon pertumbuhan. M. Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. ikan kerapu tikus . Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. di antaranya Indonesia. Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. jumlah kejutan 5.1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. Namun demikian. elektroporasi. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. Situbondo **) Fakultas Perikanan dan Kelautan. Irvan Faizal*****). Rustidja**). mikroinjeksi.

oksigen . laju pertumbuhan harian. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan. Pakan yang digunakan adalah pakan pelet komersial. Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva. B (oksigen). dan 15% dari total biomassa benih. Kendala yang dihadapi terutama terjadi pada stadia awal. dan kualitas air.25) dan efisiensi pakan (80.52±0.42±0. 10%.31±0.20-4. serta terakhir perlakuan D (47. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan.20 cm. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut. Pemberian pakan dilakukan tiga kali sehari. KATA KUNCI: benih kerapu sunu. dan perlakuan B (63.19%) dan panjang total spesifik (1.19±0.35 cm). Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus).000 ekor/bak. dan efisiensi pakan pada benih kerapu sunu. probiotik. Peubah yang diamati adalah sintasan.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut.02%) serta nisbah konversi pakan (1. selanjutnya perlakuan C (64. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu. D (kontrol).19%) harian serta laju pertumbuhan bobot badan spesifik (6.90±0. Nilai pertambahan panjang tertinggi A (72.00%) yang baik bagi benih kerapu sunu. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen). Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU. pertumbuhan.95 mm). pertumbuhan panjang larva.50-0. Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan. efisiensi pakan.68 g) dan panjang total (6.39±0.73%) dan panjang total (9. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal. yaitu 5%. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan.35 mm).69 g dan panjang total awal 3. Salah satu faktor yang berperan adalah lingkungan pemeliharaan. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3. Namun. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan. optimasi pakan. KATA KUNCI: larva kerapu sunu. nisbah konversi pakan. C (probiotik).69 mm). laju pertumbuhan spesifik. laju pertumbuhan bobot badan harian (10. Sampling dilakukan setiap minggu. Materi yang digunakan adalah larva kerapu sunu sebanyak 4.86 mm).

infeksi. imunstimulan. B: 24.12 mg dan C: 211. aktivitas lisosim sebesar 1. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C.50%. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan. mencapai ukuran panjang total pada perlakuan A: 24.spesifik ikan kerapu macan. terutama infeksi virus. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido.08 ± 2.55 mm dan C: 26.5 ± 2.08 ± 1. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6.68 mm.81 ± 0. kerapu macan . Perlakuan A dan B tidak berbeda nyata. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L.1 ± 2. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun non. dengan kepadatan 1. perlakuan B adalah 6. sedangkan kontrol hanya disuntik dengan PBS. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. Perlakuan B: 4 kali/hari pada umur 7-20 hari. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. KATA KUNCI: pakan buatan. Perlakuan C: 5 kali/hari pada umur 7-20 hari.04 ± 0. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind.62 ± 2. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN. Masing-masing perlakuan diulang 3 kali. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng.20 ± 0.87. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0.0x105 sell/mL. larva kerapu macan. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. Mulai larva umur 2 hari diberikan Nannochloropsis sp.95 mg. KATA KUNCI: Epinephelus fuscoguttatus. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular. Epinephelus fuscoguttatus Irwan Setyadi. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting.03% dan perlakuan C adalah 8.00%.62%.5 ± 4. Gondol ABSTRAK Ikan kerapu macan. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari. B: 196. Anak Agung Ketut Alit. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol.65%. Des Roza. serta bobot badan pada perlakuan A: 192. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari./mL dan mulai umur 17 hari diberikan nauplii Artemia. Bejo Slamet.96 mg. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan. indeks fagositik sebesar 1. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1.87 cm dan sintasan setelah diuji tantang sebesar 72. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari.57 mm.

yang kurang baik. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal.86 mm. panjang. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. dan dilihat perkembangan oositnya. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. generasi kedua (F-2).72% dan panjang total 18.10% dan panjang total 21. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari. Setiap bulan dilakukan pengamatan pertumbuhan bobot. sedangkan pada bak B : pakan pelet kering. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor. KATA KUNCI: kerapu bebek (Humpback grouper). Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. kerapu bebek (Cromileptes altivelis). Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah. pada bak A : ikan rucah + cumi-cumi + vitamin. perkembangan oosit . Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. pembenihan.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp. Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: efisiensi. Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. konsentrat mempunyai sintasan 19. konsentrat yang bisa dibeli di pasaran. Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. Sampai dengan bulan Oktober telah berhasil memijah. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya. dengan sintasan 6. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk. dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp.

organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. 15. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D15). Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). mutu benih kerapu. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. Sampel larva diambil pada umur 1. 25. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. KATA KUNCI: kerapu bebek. Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). Tangki pemeliharaan yang digunakan ukuran 8-10 m3. dan 32 hari setelah menetas masing. manajemen air media pemeliharaan dan manajemen pakan. Tetapi tingkat sintasan yang didapatkan masih rendah. 7. Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan.8%-41. produksi massal . histologi. 4. Indah Mastuti. 17. 10. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. 2. 5. Selain itu. Ketut Mahardika. 20. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin.masing sebanyak 10-20 ekor. Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. KATA KUNCI: pemeliharaan larva. pemeliharaan dilakukan hingga yuwana (2 bulan). 13. 3. Cromileptes altivelis Yasmina Nirmala Asih.

Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. laju pertumbuhan spesifik. survival rate. akibat serangan penyakit dan kondisi media. KATA KUNCI: protein sel tunggal. Pakan penelitian berupa pelet kering dengan kandungan PST 0%. 10%. Pangasius hypophthalmus . Oleh karena itu. Pakan diberikan 2 kali secara “adlibitum”. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. Ketut Suwirya. di lain pihak hasil tangkapan cenderung menurun. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. I Nyoman Adiasmara Giri. Oleh karena itu. dan siklus kedua menggunakan larva dengan kekebalan bawaan. Sumber protein utama pada pakan adalah tepung ikan. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. Tingkat kematian larva dapat mencapai 40%–80%. Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR). (pakan kontrol). tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. pertambahan bobot. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. catfish seed. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. Lies Emmawati*). KATA KUNCI: innate immunity. Salah satu sumber protein alternatif adalah protein sel tunggal (PST).797–457. 15%. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. dan 20% dalam pakan.05).Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi.651 ekor benih untuk setiap induknya. 15% (P>0. Hasil penelitian menunjukkan bahwa nilai bobot akhir. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. perlu alternatif lain sebagai substitusi tepung ikan. siklus pertama. Kematian larva umumnya terjadi pada hari keempat. 5%. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. dan ketiga menggunakan larva tanpa kekebalan bawaan.4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. 10%.

010±0. Kecernaan protein juga meningkat akibat penambahan enzim fitase.8%). Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan. diikuti salinitas 2‰ (28. (B) 2‰.4%) berbeda nyata lebih tinggi dibanding pakan E (68.13% per hari.07 cm).114±0. sedangkan laju pertumbuhan panjang harian meningkat dari 1. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰. Pangasius hypopthalmus Mohamad Amin. KATA KUNCI: fitase . dan salinitas 1‰ (3. Kecernaan protein tertinggi berturut-turut pakan C (82. KATA KUNCI: salinitas.140±0.00%). yang dilanjutkan dengan uji Tukey.4%). Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3. kemudian salinitas 3‰ (4. dan sintasan . Kecernaan P pakan B (98. dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor. benih. dan A (98.2%). Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter.46% per hari.764±3. Dade Jubaedah. Data diperoleh dianalisis sidik ragam. Ade Dwi Sasanti.35±0.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN.1%) berbeda nyata lebih tinggi dibanding pakan D (97.1%) dan pakan E (95. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan.32% per hari menjadi 4. Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). selama 30 hari. sintasan serta beberapa parameter kualitas air. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32. ikan patin.674±2. dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin.75±0. Parameter yang diamati adalah laju pertumbuhan panjang badan.3%).17% per hari menjadi 1. Analisis data dilakukan secara deskriptif.884±2.0%). pakan A (82. Ikan patin sebayak 15 ekor. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.5 g/ekor.1%).204±0. Ikan uji yang digunakan berukuran 2 ± 0.223±0. pakan C (98.3%) dan pakan D (80.92 cm).49 cm). Pakan diberikan 3 kali sehari secara at satiation. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak). C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati.763±0.25±0. pakan B (82.93%) dan terendah salinitas 3‰ (25. Pangasius djambal.910±0. D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase).14%). dan (C) 3‰ dengan tiga kali ulangan.

Pupuk anorganik + organik yang difermentasi + Probiotik. Pemberian pakan dengan pelet apung sebanyak 5% per hari. komposisi pakan alami kolam. Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. Patin Siam. pemijahan. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan ikan. pengecekan induk. betok. dan C (613. predator yaitu antara lain: Ikan liar (gabus. dan sintasan Kata kunci: Intensifikasi.60±10.9%). Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11. Pupuk anorganik + organik. B. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia.7. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut.526. nila. B (7 ekor/m2). komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan. Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah. B (660 g). yaitu antara 13. dan Syafrudin Balai Budidaya Air Tawar.7% rendahnya sintasan ini diduga karena adanya faktor hama. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut.19±0.49±1.5).12 g dan 3. dan C (95. belut. dan C (10 ekor/m2) dengan 3 kali ulangan. Akmal. B (95. Pupuk anorganik + organik + probiotik dan C.5 juta ha (rata-rata 20 juta ha). 0. Larva yang ditebar berumur 20 jam setelah menetas. Sularto.74±0. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g). penetasan telur dan pemeliharaan larva di kolam. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. sepat. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut.08 g dan 3. Padat tebar larva yang digunakan adalah 100 ekor/m2.31 cm B. 0. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2). Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A.42±0. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam.51 g dan 11. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masingmasing perlakuan: A.3 g) dan SR perlakuan A (91.5%-9. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk.26 cm. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. Pemupukan. namun perlakuan B (7 ekor/m2) . Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia.2%). udang liar) serta jenis serangga air. Jika luas gambut Indonesia adalah 20 juta ha.37 cm C 16.27±0. sintasan ikan.

ikan patin. lahan marjinal .2%.memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95. KATA KUNCI: budidaya.

18) dan terendah pada 10 ekor/m2 (1. Sifat biologi pertumbuhannya belum banyak diketahui.06%) dan terendah pada kepadatan 20 ekor/m2 (7. KATA KUNCI: patin pasupati. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan.09 cm dan 1.47 g). Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari. di samping itu.54 g dan panjang awal antara 10.70–20. Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES. diikuti dengan kepadatan 10 ekor/m2 (92. Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1. Evi Tahapari***).30%).000 ekor atau kepadatan 5 ekor/m2.46 g). 10.000 ekor atau kepadatan 10 ekor/m2. dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3.17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3.76%). Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih.5 m. Zafril Imran Azwar**). pertumbuhan. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8.45 g). sedangkan petakan kedua ditebar sebanyak 2. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda. Evi Tahapari.52%) dan terendah pada 20 ekor/m2 (91.74 g) dan 20 ekor/m2 (61. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2.36 cm. salinitas.71).43–11. 15 ekor/m2 (70. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah. Padat tebar yang digunakan adalah 5. 15 dan 20 ekor/m2 dengan bobot awal antara 15. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin. nasutus . Jakarta **) Balai Riset Perikanan Bididaya Air Tawar.10%/hari.60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97. pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela. JAWA TENGAH Ongko Praseno*). dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%. dan Sularto***) *) Pusat Riset Perikanan Budidaya. Kata kunci: padat tebar.76 cm dan 2.80%. Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. pertumbuhan. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt. Percobaan dilakukan selama 100 hari pemeliharaan. Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3.

Parameter yang diamati adalah insidensi dan sintasannya.002 mg/ L. sebagai perlakuan yaitu: (A) 0. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar. dosis.001 mg/L (4. Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya.49 cm). Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109. 108.55 ± 0. dan kontrol (placebo).002 mg/L (83.67%). Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*). perendaman. Probiotik diberikan dengan dosis yang berbeda. Evi Tahapari*). Kata kunci: uji tantang Aeromonas hydrophila. Bogor ***) Pusat Riset Perikanan Budidaya. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. diikuti dosis 0. kemudian perlakuan dosis 0. 10 ekor/L.60 ± 0. (B) 0. Uji tantang dilakukan dengan dua cara. Nurbakti Listyanto*).Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*). Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan.35 cm). sintasan. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.33%) dan terendah perlakuan dosis 0.003 mg/L (81. Angela Mariana Lusiana**).67%). yaitu: cara perendaman dan cara penyuntikan intraperitonial.001 mg/L (86. intraperitonial. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sukamandi. 109. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo. Analisis data dilakukan secara deskriptif. Ikan uji yang digunakan berukuran 3–4 inci. 108.003 mg/L dengan tiga kali ulangan.35 ± 0. Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. Jakarta **) Balai Besar Riset Perikanan Budidaya Laut.002 mg/L (4. Pengamatan dilakukan selama 15 hari setelah perlakuan. Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0. 106.001 mg/L. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif. benih. dan pertumbuhan . dan (C) 0.14 cm). 107. Perlakuan kedua adalah padat tebar: 5 ekor/L. dan 15 ekor/L. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air. dan kontrol. kemudian dosis 0.003 mg/L (4. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal. Ikan uji yang digunakan berukuran 1–2 inci. KATA KUNCI: probiotik.

Penelitin ini terdiri atas dua tahap. rearing. Derajat penetasan patin nasutus berkisar 44. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. Ukuran panjang total larva yang baru menetas berkisar 3. Bambang Iswanto. KATA KUNCI oosit. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium. yakni pengamatan perkembangan gonad dan fertilisasi.52% (pakan B). Aspergillus niger. KATA KUNCI: fermentasi. dan 25% ampas tahu:75% tapioka. substitusi protein 4. larva.850 µm. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu.58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11. ampas tahu.03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai. ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad.05% dengan lama inkubasi 22–25 jam.250–1. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu.16%–79. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129.900 µm. Pangasius nasutus . tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm.130–22.700 µm. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologireproduksi berkaitan dengan kapasitas produksinya. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Ke dalam wadah ditebar ikan patin ukuran 11. Perkembangan oosit patin nasutus bersifat sinkronis grup. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus.700– 4. 75% ampas tahu:25% tapioka. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm.41±0. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar. hatching. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati. dan tahap 5 (atresis) dengan diameter oosit 300–1. substitusi protein 2. 50% ampas tahu:50% tapioka.000 µm.04% (pakan D). substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. substitusi protein 0% (kontrol) (pakan A). tahap 3 (granula kuning telur) dengan diameter oosit 700–1. dan substitusi protein 6. Zafril Imran Azwar. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar.03% (pakan C). artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai.

89±0. C. 0. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut.45 g/ekor. biofilter. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D. 25% zeolit + 75% bioball. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam. 0. 0. 2.84 g/ekor dan terendah A.20.02 g/ekor. C. C. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian.42±0.14 mm. 4. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D.47±0. C. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1. 79.33%.30ab.75% dan terendah perlakuan A.35 cm/ekor dan A. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A.30a.27a.58%. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi.10–1. C. 1. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa.08 mm3 yang terserap 50% pada umur 30 jam . diikuti perlakuan B. dan D. 88. B.1. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER. 92.13 mm. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya. 95. dan D. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D. 2.20 mm.98±0.42. masing-masing perlakuan diulang sebanyak empat kali. 1.71±0. dengan kantung kuning telur berukuran 0.69 cm/ekor diikuti B. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A.6±0.01±0. 50% zeolit + 50% bioball dan D.54 cm).) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias.01±0. 1.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. 1.24) x 103.62 g) dan panjang (2.1±0. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.60 cm/ekor. 75. 89.03±0. B. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER.31ab.43b. 88.25 g/ekor. KATA KUNCI: patin albino. 4. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var.56 cm/ekor. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat. berukuran panjang total 3.64±0. berukuran panjang total 3. 100% zeolit B. diikuti perlakuan C. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih. pertumbuhan.34±0. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi. 91. 75% zeolit + 25% bioball.67%. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi. dengan kantung kuning telur berukuran 0. B.

28%. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa. larva. hibrida. tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus. siam. sedangkan patin hibrida siam-jambal sebesar -4.dan habis terserap pada umur 60 jam. nasutus . Kata kunci: embriogenesis.23%. jambal. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20.

tambak. Hasil penelitian menunjukkan bahwa. 88. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. 21% dan 26%. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. Dedi Jusadi**).6%–90. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. Oleh karena itu. Pakan tersebut digiling ulang.1% untuk Corganik. ikan bandeng. lama ikan bandeng digelondongkan. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. Oleh karena itu. padat penebaran udang windu.990 kg/ha/musim dengan rata-rata 292.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. Maros **) Fakultas Perikanan dan Ilmu Kelautan. Akhmad Mustafa. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. Jika bioflok terbentuk. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. lalu ditambahkan kromium oksida (Cr O ) sebagai indikator kecernaan. Neltje Nobertine Palinggi*). Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak.2 kg/ha/musim. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. Untuk menentukan 2 3 total limbah N termasuk eksresi amonia.6%–83. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone. KATA KUNCI: pengelolaan. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). lama pemeliharaan ikan bandeng. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar.2% untuk bahan kering. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein . dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur. produksi. Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2.0% untuk protein dan 81.2%–78. dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. Enang Harris**). Eddy Supriyono**).

diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%. milk fish. KATA KUNCI: feed digestibility.76 g N untuk pakan berprotein 21%.27 g N untuk pakan berprotein 17%. dan 3. 2.pakan yaitu 2.28% untuk pakan berprotein 26%. Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok). N waste. heterotrof bakteria .

Enang Harris**). Eddy Supriyono**). Pada tahun yang sama. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). Hatim Albasri. Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif.000 ton dan mengalami kenaikan sebesar 14. DAN PEKALONGAN ) Anjang Bangun Prasetio. Khususnya di wilayah Pantai Utara yaitu Kendal. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Penambahan inokulasi bakteri komersial (Bacillus sp. growing. Molase digunakan sebagai sumber C. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan.organik. Penyusun utama bioflok ini adalah bakteri heterotrof. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. opsi kebijakan . Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). Oleh karena itu. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. dan Pekalongan. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia. (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. PATI. kendala. Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng.66% dari tahun-tahun sebelumnya. bandeng. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12.975 ha. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. dan Rasidi Pusat Riset Perikanan Budidaya. KATA KUNCI: budidaya. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL. KATA KUNCI: Heterotrofic bakteria. Dedi Jusadi**). Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya.726 ha dan yang layak untuk budidaya sekitar 6. Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL.250 ton.54% per tahun kurun waktu tahun 2005–2009.000 ton dan mengalami kenaikan rata-rata 13. Pati.) cenderung meningkatkan kandungan asam amino bioflok.

0%) dan yang terendah â-aktin-GFP (3. HEAT SHOCK DAN KERATIN PADA IKAN LELE.GFP. DKH-e yang diinjeksi dengan â-aktin-GFP (25.00±1.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur.34%) dan DP (63. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10.3±0.33±1.00±1. keratin-GFP (21. dan heat shock-GFP berturutturut adalah 20. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan. dan Utut Widyastuti***). Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20.67%). menyusul heat shock-GFP (10. Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi.33%. mikroinjeksi.03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi.65%) dan heat shock-GFP (18.Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN. Clarias sp. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi. Komar Sumantadinata**). Gusrina*). Konstruksi gen dalam bentuk plasmid mBA-gfp.0%).66±1. KATA KUNCI: promoter.00±3. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. keratin. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi. FMIPA.0±10. sedangkan DP dihitung ketika semua telur telah menetas. DP untuk â-aktin-GFP.0%). Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein. DKHe dihitung sebelum telur menetas.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel. Data dianalisis secara deskriptif. Alimuddin**).65%. GFP. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi.67%. ikan lele .34±1. Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji.****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan. sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik.0±0.66%) relatif sama. Hasil penelitian menunjukkan bahwa DKH-e (63.63±10. dan 15. Ekspresi gen gfp tidak tampak lagi pada saat telur menetas. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA).33±3. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp. 18. Fakultas Perikanan dan Ilmu Kelautan.

53%) (P<0.53% menjadi 92. 6. Angela Mariana Lusiastuti.41 mg/L) dengan dosis efektif 250 mg/L. hydrophila menjadi penyakit endemis di Indonesia. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi. Bak diisi air sebanyak 100 liter. 39. pakan tenggelam.30±2.15%) dibandingkan dengan pakan tenggelam (yakni 79. KATA KUNCi: A.25% sehingga tidak berbeda nyata dengan pakan terapung.33% kadar sari dalam air. Ikan lele dumbo berukuran 41. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak. hydrophila. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif). ikan lele dumbo (Clarias gariepinus). Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan.47±4.. Pemberian pakan sebesar 5% dari biomassa per harinya. Rita Febrianti. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A. Kandungan bahan aktif hasil pengekstrasian pegagan segar.05). bahan aktif. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani. Melalui penambahan aerasi. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara.39% kadar asiaticosid.47±4.83% kadar sari dalam alkohol. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang. 24.23% kadar abu tak larut asam.37% kadar abu. pakan terapung .34% kadar air.71±2. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus). pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. 0. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0. pegagan Centella asiatical [L] Urb. Pada perlakuan tanpa aerasi. KATA KUNCI: kecernaan pakan. Taukhid.74±1.623.05) dari 79. pagi dan sore. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus). 1. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB. 5. Feces yang dihasilkan diambil setiap hari. aerasi.

Forum Inovasi Teknologi Akuakultur 2010

FF 45
PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus)
Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar

ABSTRAK
Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. Wadah percobaan yang digunakan adalah bak beton ukuran 1,0 m x 1,0 m x 0,8 m, dan dirancang sistem resirkulasi. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9,33±0,10 g sebanyak 40 ekor. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol); 7,92%; 13,28%; 19,56%; dan 25,81% dalam formulasi pakan. Setiap perlakuan dengan 3 ulangan. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar, tapioka, dan molase. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11,96%, dan penurunan lemak 61,85%, dari perlakuan kontrol. Laju pertumbuhan spesifik, penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7,90%, namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25,83% tidak memperlihat perbedaan dengan perlakuan kontrol.
KATA KUNCI: maggot, fermentasi, formulasi, lele dumbo

FF 46
ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA
Tutik Kadarini, Siti Subandiyah, Sulasy Rohmi, dan Darti Satyani Balai Riset Budidaya Ikan Hias

ABSTRAK
Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2,3–3,1 cm. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0, 10, 20, dan 30 g/40 liter masing- masing diulang 3 kali. Jenis pakan berupa cacing tubifex, bloodworm, dan cuk yang diberikan diselang-seling secara adlibitum. Parameter yang diamati sintasan dan pertumbuhan (bobot, panjang, dan perkembangan gonad), kualitas air (suhu, pH, amonia, alkalinitas, oksigen, dan karbondioksida). Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3,8–4,7 cm mencapai TKG III.
KATA KUNCI: gurame coklat, reproduksi, ikan, dan gonad

Forum Inovasi Teknologi Akuakultur 2010

FF 47
APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC.) DI JAWA
Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi, Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman, yaitu seperti daun talas. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa, yaitu di Jawa timur (Blitar dan Tukung Agung), Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Dari hasil penelitian menunjukkan bahwa di daerah Blitar, Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan, penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat, sehingga petani tidak mengalami banyak kerugian.
KATA KUNCI: fish TB, Mycobacteriosis, Mycobacterium fortuitum, biokimia, PCR

FF 48
PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI
Bambang Gunadi, Lamanto, dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Ikan gurame termasuk ikan dengan fekunditas rendah. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang, produksi telur per sarang, dan tingkat fertilitas telur yang dihasilkan. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang), dan injuk sebagai bahan pembuat sarang. Induk gurami yang digunakan berbobot 2-3 kg/ekor, dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. Pakan yang diberikan berupa daun sente sebanyak 3,5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. Perlakuan yang diterapkan adalah kadar protein 38%, 33%, dan 14% sesuai dengan label pada kemasan masing-masing. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. Masing-masing perlakuan mempunyai 2 ulangan. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0,09). Pemberian pakan tambahan dengan kadar protein 38%, 33%, dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10.351 butir, 4.546 butir dan 2.730 butir. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2.774 butir per sarang. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92,23% dibandingkan dengan pemberian pakan dengan kadar protein 33%, 14% dan kontrol yakni masing-masing 79,05%, 28,86%, dan 71,94% (P=0,26). Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0,75 buah, lebih rendah dibandingkan dengan yang

diberikan pakan tambahan berkadar protein 33%, yakni 0,88 buah, namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0,13 buah) dan hanya daun sente (0,5 buah).
KATA KUNCI: ikan gurame, pakan buatan, daun sente, keragaan reproduksi

Retensi protein dedak padi fermentasi. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar.28%. pertambahan bobot relatif. Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar.3’). Kandungan protein dedak padi naik 19.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan . Reza Samsudin. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. oligosporus yaitu 2. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. dan polar fermentasi berbeda nyata (P<0. retensi protein. Parameter yang diuji meliputi bobot akhir rata-rata. dan polar fermentasi. dan 6 hari.33%. protein efisiensi rasio. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5. yang menunjukkan terbentuknya plasmid rekombinan. dan pada Silver carp sebesar 1123 bp. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. 4. dan koloni berwarna biru tidak mengandung DNA sisipan.47 g/ekor. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar.14% dan kadar lemaknya turun sebesar 19. retensi lemak. mud carp sebesar 1127 bp. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ – GATGAAACTCGAGTAGCCCTTGCTCTTC. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). dan selanjutnya polar dan dedak padi. Wadah percobaan yang digunakan yaitu akuarium volume 100 L.05) dengan dedak padi tanpa fermentasi. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari.02% sedangkan kandungan lemaknya turun 13. polar. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. dan sintasan. dengan ditandai tumbuhnya koloni transforman berwarna putih. Kadar protein polar naik 38. dengan padat penebaran ikan uji 30 ekor per akuarium. dedak padi fermentasi. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. polar. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp. Retensi lemak tertinggi (35. Bogor dan terdiri atas dua tahap.

dedak padi.67%–100%. dedak polar. Sintasan ikan uji berkisar antara 96. fermentasi.05) dengan perlakuan lainnya. ikan mas . oligosphorus. KATA KUNCI: R.berbeda nyata (P<0.

Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. Sedangkan sintasan.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). Achmad Sudradjat. Di mana satu di antaranya di desain sebagai kolam akuaponik. Lilis Sofiarsih*). dengan lokasi penelitian di Desa Kronjo. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1.25 kali lebih besar dibanding pada kolam konvensional. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. Benih ikan mas ukuran 18. Penelitian telah dilaksanakan dari bulan Nopember 2009 —Pebruari 2010. dan parameter kualitas air yang lain dianalisis secara deskriptif. Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas.akhir ini banyak lahan yang tidak digunakan (marginal). Kabupaten Tangerang. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. tambak . serta keramba jaring apung di danau maupun waduk. kemudian ikan mas galur kuningan sebesar 1. ukuran panen. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. Parameter yang diuji adalah kualitas air terutama kandungan ammonia. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1. wildan. Ongko Praseno. KATA KUNCI: ammonia.15 g/hari. pertumbuhan. ukuran panen. Data setiap sampling dijadikan ulangan. salinitas rendah. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. dan ikan mas galur majalaya sebesar 0. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan.41 g/hari. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. sintasan. Sutrisno*). Provinsi Banten. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan. karena akhir.86 g/hari.64 kali lebih banyak dengan ukuran panen 1. dengan padat tebar 20 ekor/m3. KATA KUNCI: ikan mas. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. akuaponik.28 g/ ekor yang digunakan sebagai hewan uji. sedangkan yang lainnya sebagai kolam konvensional. sawah.

memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi. Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. Siti Zuhriyyah. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. serta mempunyai respons yang baik terhadap pakan buatan. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. Afifah. (B) umur 10 hari dan (C) umur 15 hari. lasted time feeding . Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. Siti Zuhriyyah Musthofa. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya. fry performance.42%. dapat dikembangkan di bak terkontrol maupun di KJA. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat.58 cm dan 17. cobia larvae. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: artemia nauplii. KATA KUNCI: survival rate.067mg) serta kelangsungan hidup (12. Hasil penelitian menunjukkan bahwa pertumbuhan panjang. kemudian diberikan sebagai pakan larva.07%) relatif lebih tinggi dari pada perlakuan B dan C. Masing-masing perlakuan diulang 3 kali. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2.

Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera. Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. budidaya. Lebih dari 100 spesies. sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. Stakeholder. KATA KUNCI: cobia. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. Lucky Marzuki Nasution*). KATA KUNCI: ikan hias. Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. Herno Minjoyo*). plasma nutfah . komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam.Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias.

226 g. bakteri. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh. Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata. multifocal granuloma . Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias. Tubifex sp. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. infeksi penyakit (cacing.. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. peacock bass. kondisi daya dukung lingkungan yang terus menurun. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. Peacock bass ini akhirnya berenangnya jadi terbalik. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. KATA KUNCI: Synodontis nigriventris. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. laju pertumbuhan harian sebesar 32. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. Afrika. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati.778 cm. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias. KATA KUNCI: deformity. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. dan selalu berusaha mendekati sumber oksigen (aerator). dengan 6 kali ulangan. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. Eni Kusrini*). dan yang terendah Moina. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. karena belum banyak yang membudidayakannya. dan pertambahan panjang total sebesar 1. pertumbuhan. virus). Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. Deformity dapat disebabkan oleh : mutasi genetic. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. pakan alami. granuloma.586%. Depok ABSTRAK Deformity (dysmorphism. Artemia sp. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. diikuti Artemia. dan Tubifex sp. diam dan kepalanya menyembul tepat di bawah permukaan badan air. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia..Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*).

zat pemicu warna. dan Ahmad Musa Balai Riset Budidaya Ikan Hias. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. 20 ekor/bak. yaitu : astaxanthin. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. 60 ekor/bak. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF). T3. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana.50 g. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. KATA KUNCI: maggot. Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3.Sulawesi Tengah. wortel dan tepung kepala udang. Rainbow Papua . induk diberi pakan berupa naupli artemia/artemia pra dewasa. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai . density. KATA KUNCI: banggai cardinal fish. 40 ekor/bak. udang jembret (mysids) dan larva nyamuk.87 ± 0. Selama penelitian. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. Bastiar Nur. Hasil penelitian menunjukkan. Variabel yang diamati meliputi.Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. T2. Hewan uji yang digunakan berukuran panjang total 5.9 ± 0.3 cm dan bobot 2. Jhon Harianto Hutapea. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati.

Nina Meilisza. dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar. AO (aqua+oksitetrasiklin).33%. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza. 55. KF (air kontrol+formalin). dan Lili Sholichah Balai Riset Budidaya Ikan Hias. KF (71. pertumbuhan panjang. Pada akhir penelitian (hari ke 105).5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. KO (air kontrol+oksitetrasiklin).5 m dan tinggi air 40 cm.0 cm. ukuran ekspor 1 inci (2.05).5 cm (ukuran ekspor). Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. AB (aqua+blitz ich). 70. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2.5 x 0. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin. Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis. KO (76. Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. 35.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. namun tidak berbeda nyata dengan perlakuan AO (81.05).009 gram. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. dan 105 dan dianalisis secara deskriptif.0 cm dan bobot rata-rata 0. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis). sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian. Sintasan terendah dihasilkan oleh perlakuan KB .67%). AF (aqua+formalin).5 x 0. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. 20. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich).5 cm dan panjang tertinggi sebesar 3. Selama pemeliharaan. I Wayan Subamia.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari.67%). Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari. dan blitz ich) akan dilakukan melalui rancangan faktorial. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. oksitetrasiklin.67%). Masing-masing perlakuan dilakukan dengan 3 ulangan. Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. KATA KUNCI: benih botia. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.

larva Tetraodon palembangensis .67% namun tidak berbeda nyata dengan perlakuan AB (55%). sintasan.sebesar 51. media air. KATA KUNCI: prophylaksis.

inkubasi telur dan perawatan larva.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. Ikan palmas jenis albino (Polypterus senegalus var. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina.6°C–29. tiger catfish (Platysoma sp. Pemijahan tersebut terdiri atas seleksi induk. Asep Permana. KATA KUNCI: palmas albino. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina.).).31% dan menghasilkan larva normal sebanyak 218 ekor. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol. Depok ABSTRAK Ikan palmas (Polypterus sp.).15%.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27. daya tetas telur 80. penyuntikan hormon. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan. polypterus senegalus albino. aligator (Lepisosteus oculatus). dan redfin shark (Ephalzeorhynchos sp. memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan. perkembangan embrio.91%. albino) masih sulit untuk memijah dalam wadah terkontrol. masa inkubasi . hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur. Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias. antara lain sinodontis (Synodontys sp.75 mL/kg untuk induk betina di bagian intraperitoneal. Asep Permana. namun belum banyak diketahui data embriologinya. SR (0-10 hari) 83. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy.4°C. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0. dan Bastiar Nur Balai Riset Budidaya Ikan Hias. Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. sehingga produksinya masih mengandalkan impor dari luar negeri. pembuahan. platidoras (Platydoras sp). dan I Wayan Subamia Balai Riset Budidaya Ikan Hias.5 ml/kg untuk induk jantan dan 0. KATA KUNCI: Neocaridina heteropoda. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi.

dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks.3–2. Asep Permana. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor. Rendy Ginanjar. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungai.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20.0518 g. oocyt . Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A).042 pg/mL. dan Darti Satyani Balai Riset Budidaya Ikan Hias. Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. LHRH 50 mg dan testosteron 50 mg (C). Rina Hirnawati. sedang induk jantan belum ada yang mengandung sperma. budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah.7–1. panjang 40– 60 cm.1272–0.sungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya. KATA KUNCI: induk. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai. Pada ikan yang baru di domestikasi. dipelihara selama 6 bulan. Udang diberi pakan berupa moina beku sekali dalam setiap hari. implantasi. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka. LHRH 100 mg dan testosteron 50 mg (B). Tutik Kadarini. murah dan aplikatif.725 pg/mL. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32. KATA KUNCI: Neocaridina heteropoda.1630 g dan dua ekor induk jantan yang berukuran panjang 1. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya).5 cm dengan bobot 0. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah.0488–0. matang gonad. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. Kepadatan 10 ekor induk dengan bobot 65–600 g.9 cm dengan bobot 0.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana. hormon.

KEYWORDS: honey. Based on LSD test. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2. guppy fish . Depok ABSTRAK Bunga Tai Kotok (Tagetes sp.6%). The concluded that the optimum dose to produce male guppy is 50 mL/L. Honey is a natural substance which have crysin. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method.71%. 50 mL/L. yeast (30–800 mg/kg) dan sumber lainnya. the alternative masculinization application of natural substance like honey. as the curative effort is not applicable.05 significant level. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias. kemudian dipisahkan antara tangkai dan kelopaknya.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization.000-4. and 75 mL/L. The result showed that the percentage of male guppy at 50 mL/ L is 64. KATA KUNCI: bunga tai kotok. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control). The research was conducted experimental with completely randomized design. because of residual effects to human caused cancer. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias.07 ± 9. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. male. 25 mL/L.000 mg/kg). suhu. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. The proportions test showed dose 50 mL/L have significant different to control. Therefore. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan. the treatments gave significant different with control. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. The observation to sexual secondary characteristic guppy can be observed at least two months old. chrysin. carotenoid. but between treatments not significant different.

Forum Inovasi Teknologi Akuakultur 2010

FF 69
PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA
Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. Induk dipelihara dalam 8 buah bak berukuran 1,5 m x 1,5 m x 1,0 m dengan kepadatan 24 ekor/bak. Lama penelitian berlangsung selama 6 bulan. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&), 1:2 (B&:@&), 1:3 (B&:@&), dan 2:1(B&:@&). Pada awal percobaan, semua induk secara individu dalam keadaan TKG=O. Peubah biologis yang diamati meliputi: jumlah induk memijah, jumlah telur, diameter telur, dan daya tetas telur. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor, jumlah telur 237.865–335.837 butir/ekor, diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%, rasio (1:2) jumlah induk memijah 30 ekor, jumlah telur 129.534–393.333 butir/ekor, diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%, rasio (1:3) jumlah induk memijah 35 ekor, jumlah telur 272.837–344.975 butir/ekor, diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor, jumlah telur 227.945– 350.140 butir/ekor. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama.pada induk beronang.
KATA KUNCI: Siganus guttatus, pemijahan, jumlah telur, diameter telur, daya tetas telur

FF 70
SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG, Siganus guttatus
Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22,05±6,4 g dengan padat tebar 15 ekor/keramba. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut, B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan, masing- masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0,05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0,05) dengan rasio efisiensi proteinnya.
KATA KUNCI: tepung ikan, tepung rumput laut, substitusi, pakan ikan beronang, S. guttatus

Forum Inovasi Teknologi Akuakultur 2010

FF 71
PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH
Rusmaedi, Idil Ardi, dan Wartono Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan, yaitu menggunakan tingkat teknologi tradisional plus, memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Dengan teknologi yang diterapkan, diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Penelitian ini dilakukan pada tambak di daerah Betok Mati, Kecamatan Cilebar, Karawang, Empat petak tambak masing-masing berukuran 3.500 m2 digunakan untuk percobaan. Sebelum penebaran, dilakukan pengolahan tanah tambak,n pengapuran sebanyak 175 kg/petak, kemudian dikeringkan sekitar satu minggu. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. Setelah dua hari, pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Pemeliharaan dilakukan selama tiga bulan, pada bulan pertama udang tidak diberi pakan, sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak, penebaran dilakukan setelah satu bulan dari penebaran tokolan. Dari pemeliharaan udang selama tiga bulan, diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34,5 g, produksi 81,1 kg dan sintasan 11,2%. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3, yaitu pertambahan berat rata-rata 230 g, produksi 78,8 kg dan kelangsungan hidup 100%.
KATA KUNCI: Karawang udang windu, salinitas rendah, tokolan,

FF 72
PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT
Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1,5–50 m3 dengan rata-rata kepadatan akhir N. oculata 13,1±0,04 juta sel/mL dan rotifer 186±5.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. Pemadatan (flokulasi) N. oculata dengan NaOH dosis 75, 100, dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368, 427, dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. Tingkat total ammonium terlarut dalam air laut produksi masal N. oculata relatif tinggi (4,3–8,2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. oculata relatif rendah (3,6%) dengan rasio DHA/EPA hanya 0,2.
KATA KUNCI: pakan alami, marine chlorella, Nannochloropsis oculata, rotifer Brachionus rotundiformis, semi-continuous system

Forum Inovasi Teknologi Akuakultur 2010

FF 73
PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus)
Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi, juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). Wadah penelitian yang digunakan adalah jaring berukuran 1,0 m x 1,0 m x 2,0 m, yang ditempatkan pada keramba jaring apung di laut. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19,2 ± 0,67 cm/ ekor dan bobot 155,3 ± 10,79 g/ekor, ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%, (B) 9%, dan (C) 13%, masing- masing terdiri atas 3 ulangan. Pemberian pakan dilakukan 3 kali/hari (pukul 08.00, 11.00, dan 17.00). Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. Hasil penelitian menunjukkan bahwa kadar lemak 5%, 9%, dan 13% dalam pakan berpengaruh tidak nyata (P<0,05) terhadap pertumbuhan dan sintasan ikan beronang.
KATA KUNCI: kadar lemak, pertumbuhan, sintasan, Siganus guttatus

FF 74
ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA
Lies Emmawati Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. Jika tidak ada efek rumah kaca, suhu dipermukaan bumi akan turun secara drastis. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia. Permasalahan ini perlu dipikirkan solusinya, karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Padahal dalam upaya peningkatan produktivitas perikanan budidaya, plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global.
KATA KUNCI: pemuliaan, ikan langka, budidaya, konservasi

dan besi. neon tetra. kapiat albino. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. Akhmad Mustafa.59 ha. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. 98% terinfeksi parasit. dan Dactylogyrus spp. dan Ichthyophthirius multifiliis (Ciliata). mas koki. Trichodina sp. Trematoda). (Dinoflagelata). kecepatan arus. Argulus sp. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. Gyrodatylus spp. Oleh karena itu. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. keramba jaring apung. Kualitas air perairan yang diukur adalah: pH. salinitas. perairan Kalukku. 2009.41 ha dan kurang sesuai 52. kedalaman. Pulau Kambunong. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. cat fish. nitrat. dan insang. parasit . perairan Papalan. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. kecerahan. Pulau Bekengkeng. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. dan Tanjung Dapuran. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. budidaya laut. (Monogenea).18 ha. sympilum dan Characidae. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. Sampel ikan hias antara lain dari golongan cyprinidae.Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar.18 ha yang terdiri dari sangat sesuai seluas 133. (Copepoda) dan Centrocestus sp. Synodontis. Chiclidae. sirip. cukup sesuai 512. Dari Sampel yang diperiksa 33. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. Red Fin Albino. KATA KUNCI: ikan hias air tawar. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. dan platydoras. KATA KUNCI: kesesuaian lahan. (metacercaria. arah arus. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. penyakit. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. fosfat.

CD. pencemaran. Contoh yang diambil berupa air. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS. Cd. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. KATA KUNCI: lahan perikanan budidaya.88 mg/L/kg daging ikan. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. serta debit air dari muara sungai yang masuk ke perairan waduk.98 ton/bulan. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. muara Sungai Citarum. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. Cd. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. KATA KUNCI: logam berat. badan air Sungai Citarum dan Sungai Cimeta. muara Sungai Cisokan. pengambilan contoh. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. sedimen (lumpur/tanah). Perairan Waduk Cirata sudah tercemar oleh parameter Zn. dan Zn dalam air dan daging ikan. identifikasi dan analisis data serta pelaporan. batas daerah bahaya.8214 ton/bulan dan 1. Tahapan penelitian meliputi: penentuan lokasi. pestisida. Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. Cd. Organofosfat. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. residu . serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. Variabel yang diamati adalah konsentrasi kandungan Pb. Piretroid. zona 2 Purwakarta. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan.86 ton/bulan. inlet. preparasi. dan Karbamat.

marmorata. dan Cadas Bodas. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton. fitoplankton. dan 4–6 m. nebulosa./L dan zooplankton berkisar antara 93.35). Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). (13. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae.5 ind.n. Bacillariophyceae.7) dikelompokan jenis A. pada region mitokondria 16SRNA.75 ind.71–19. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi. dan sebanyak 150 ekor disimpan dalam alkohol absolut. KATA KUNCI: komunitas. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies.marmorata dan (4. Sukabumi. Dinophyceae.52) dikelompokan pada jenis A. Cyanophyceae. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393.65– 0. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. Maleber. A.) DI PERAIRAN SUNGAI CIMANDIRI.33. Sungai Cimandiri. 2–4. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar.75–4887. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias. Copepoda. Pelabuhan Ratu. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. selanjutnya digunakan untuk analisa genetik. indeks dominansi (C) = 0. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor.31.17-9. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari. dan Desmiceae dari zooplankton ditemukan jenis Rotifer. A. Ciputri. dan nilai kemerataan (E) = 0. dan Protozoa. Patok Batas.nebulosa . KATA KUNCI: Glass eel. dikelompokan pada jenis A. bicolor bicolor. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri. A. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR.83. bicolor. Palumbon.072–0.75– 993.12–3. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. PELABUHAN RATU./L.

Forum Inovasi Teknologi Akuakultur 2010

FF 81
POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN
Afifah*), Titiek Aslianti*), dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut, Gondol **) Mahasiswa Universitas Gadjah Mada, Jogjakarta

ABSTRAK
Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL), terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. rotifer, B. gonad kerang, dan C. kuning telur) dan 3 ulangan. Pemberian pakan awal di mulai saat larva berumur D-2—D-10, selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan, selanjutnya secara periodik 5 hari sampai dengan D-30. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan,. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10,99 mm; 27,10 g; dan 21,97%) dibanding perlakuan A (10,27 mm; 21,94 g; dan 1790%) dan C (11,01 mm; 25,20 g; dan 17,17%). Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan, namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.
KATA KUNCI: larva ikan kuwe, pakan awal, pola pemangsaan

FF 82
KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT
Mulyasari*), Dinar Tri Soelistyowati**), Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya

ABSTRAK
Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan, adalah dengan program pemuliaan. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra- dan inter-populasi ikan nilem di Jawa Barat. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin), sirip dada (pectoral fin), sirip perut (ventral fin), dan sirip anal (anal fin). Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata.
KATA KUNCI: ikan nilem, Osteochilus hasselti, meristik

Forum Inovasi Teknologi Akuakultur 2010

FF 83
EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti)
Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Pakan memegang peranan penting dalam budidaya ikan nilem. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan, Balai Riset Perikanan Budidaya Air Tawar, Bogor. Ikan uji yang digunakan adalah ikan nilem dengan bobot rata- rata 5,0±0,3 g/ekor. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%, 19%, dan 20%. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Ikan dipelihara selama 40 hari. Parameter yang diamati yaitu pertumbuhan spesifik, konversi pakan, serta sintasan ikan. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0,05) yaitu sebesar 1,56%. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0,05).
KATA KUNCI: nilem, protein, pertumbuhan, pakan

FF 84
EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI, KABUPATEN BATANG)
Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan, Jakarta

ABSTRAK
Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. Penelitian dilakukan di Kabupaten Brebes dan Batang. Metode penelitian dilakukan secara studi kasus. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Harga pakan hanya Rp 2.800,-–Rp 3.000,-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6.500,-–Rp 7.000,-/kg. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya.
KATA KUNCI: efisiensi usaha, pakan buatan, bahan baku lokal, ikan patin

Forum Inovasi Teknologi Akuakultur 2010

FF 85
PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN
Jhon Harianto Hutapea, Irwan Setiadi, Gunawan, dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg). Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2,5 m3 (diameter 2 m dan tinggi 0,8 m) dan bak fiberglass berbentuk oval volume 2,1 m3 (lebar 1,4 m dengan panjang 2,1 m dan tinggi 0,7 m. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari.
KATA KUNCI: penanganan calon induk, ikan tuna sirip kuning, sintasan

FF 86
KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON
Gleni Hasan Huwoyon, Irin Iriana Kusmini, dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. Pada beberapa jenis ikan, warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2,1±0,19; hitam: 1,7±0,20), pertumbuhan mutlak (merah: 6,8±1,02; hitam: 5,6±0,30) dan laju pertumbuhan spesifik (merah: 0,65±0,06; hitam: 0,57±0,02).
KATA KUNCI: warna, tengadak, Barbonymus schwanenfeldii, genetika

Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau. B = Daun mengkudu + 2. pupuk . serat kasar. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan.05). Berdasarkan hasil penelitian. silase. E = Daun mengkudu + 2. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu. dan energi di antara perlakuan berbeda nyata (P<0. Setelah 5 hari dipanen. R4 = Daun mengkudu + 2. lemak kasar. urea. protein kasar.02% khamir laut. dan TSP. daun mengkudu. KATA KUNCI: khamir laut.5% molasses + 0. gula.06% khamir laut. BETN. Hasil penelitian menunjukkan bahwa: pH.05).5% molasses + 0. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu.01). Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator. Setelah kering.04% khamir laut. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. dan abu di antara perlakuan tidak berbeda nyata (P>0.00% khamir laut.08% khamir laut. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan.5% molasses + 0. Jepara. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia).5% molasses + 0. R = Daun 3 mengkudu + 2. bahan kering.5% molasses + 0.

Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I. ditebari bandeng (10. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik.000 ekor/ha) dan rumput laut (1 ton/ha).5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar.000 ekor/ha).-/musim tanam dengan B/C rasio 2. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10.000 ekor/ha) dan rumput laut (1 ton/ha). Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram. KATA KUNCI: biofilter. CBIB. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1. KATA KUNCI: udang windu. di mana termasuk cara budidaya udang.000 ind. penggunaan sarana produksi yang ramah lingkungan. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu.48 kg/ha.73% dengan produksi sebesar 217. udang windu. serta manajemen pakan dan air secara benar. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.000 ekor/ha). rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. rumput laut. Brata Pantjara. Pada akhir penelitian diperoleh sintasan 63. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara. Sulawesi Selatan.1 ton/ha/16 mg menjadi 1. Perlakuan B. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I.977.07. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal. rumput laut (2 ton/ha) dan tiram (20.000.000 ekor/ha.000 ind/ha) dan petak II. KABUPATEN TAKALAR Muharijadi Atmomarsono. Erfan Andi Hendradjat./ha) dan petak II : bandeng (3. Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau. tambak marjinal .46% dengan produksi udang windu sebesar 249. petak I ditebari bandeng (10. BL542 bulan III. MY1112 bulan II. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram. rumput laut (2 ton/ha) dan tiram (40. bandeng (3.

(C2) probiotik komersial dengan dosis pakan 50%. Nurbaya.05% dan 298. NH 3. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah.8% dan 228. kandungan BOT di atas 30 mg/L. tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani. NO2.7 kg/ha/90 hari). menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. (D2) kontrol 2. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. dan C) Kontrol (tanpa probiotik). Pengamatan sintasan udang windu dilakukan pada akhir penelitian. Hasil penelitian menunjukkan. KATA KUNCI: probiotic bacteria. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. Oleh karena itu. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. diikuti perlakuan kombinasi probiotik A (50. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. MY1112 bulan II. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. air laut salinitas 28 ppt sebanyak 15 L.7 kg/ha/90 hari). Muliani. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan 3 selama penelitian relatif lebih tinggi pada perlakuan yang NH tidak menggunakan probiotik dengan dosis pakan 100%. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. Penelitian dilaksanakan selama 90 hari. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak. production. terutama salinitas yang mencapai 56 ppt. NO3.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masingmasing 3 kali dan lama pemeliharaan 10 minggu. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). BL542 bulan III. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. Balai Riset Perikanan Budidaya Air Payau.7 kg/ha/90 hari). namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. Penelitian dilakukan di laboratorium basah. dan total Vibrio. (C1) probiotik komersial dengan dosis pakan 100%. PO4. Nurbaya. Sintasan udang windu tertinggi didapatkan pada . survival rate. Maros. B) Pergiliran probiotik BT951 bulan I. total bakteri.35% dan 448.

11%. sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0.perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60. sintasan. udang windu . Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11. dosis pakan. KATA KUNCI: probiotik.05) pada akhir penelitian.

baik pada air maupun pada dasar tanah tambak. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp. Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari.5% dengan produksi 19. produksi.4 ha. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. dan pertumbuhan udang serta aman bagi konsumen.000 ekor/ha). KATA KUNCI: probiotik.9% dan 33.masing-masing dengan dua kali ulangan. namun belum mampu menurunkan kandungan amoniak dalam media budidaya. M. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya.500 m2 dengan kedalaman 80 cm.9 kg dan secara finansial memberikan . Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari. Tjaronge. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha).masing adalah 66. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. 31) yang ditebar pada masing-masing tambak adalah 10.0%.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak.000 ekor/ha (1 ekor/m2). kesehatan. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1. Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu. masing-masing terdiri atas 2 ulangan.000 ek/ha bandeng) menunjukkan hasil yang terbaik. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya. Sintasan dan produksi udang windu dan ikan bandeng masing.8% dan 63. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). Maros selama 90 Hari.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto. Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an.7 kg. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok. Sampling dilakukan 30 hari sekali selama 90 hari. serta 99. Oleh karena itu. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. Tokolan udang windu (PL. dan kontrol (tanpa aplikasi probiotik). yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13. Selama pemeliharan tidak diberi pakan. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha). Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau. rumput laut dan ikan bandeng adalah perlakuan B (10.

udang windu.572.000.-/ha /90 hari. rumput laut. KATA KUNCI: multitropik. sintasan.keuntungan sebesar Rp 11. ikan bandeng. produksi .

ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA.3% dan tidak berbeda nyata (P>0. 1 hari. termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). Alimuddin**). Fakultas Perikanan dan Ilmu Kelautan. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. Selain itu. 4 hari. EGFP. Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. 2 hari. uji tantang. Aan Fibro Widodo. Komar Sumantadinata**). Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. Bunga Rante Tampangallo. IPB.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. yang sampai saat ini belum bisa diatasi secara secara tuntas. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. ekspresi gen. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. Promoter dikatakan aktif apabila gen penanda dapat terekspresi. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut.Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU.0%). Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi. Ketika ditantang dengan WSSV. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. Sukenda**). Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. udang windu .1%) serta tanpa transfeksi (49. danAndi Tenriulo*) **) Balai Riset Perikanan Budidaya Air Payau.05) dibandingkan dengan kontrol. Maros **) Departemen Budidaya Perairan. transfeksi. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR. KATA KUNCI: promoter. Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. 12 jam. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. gen PmAV menunjukkan respons meningkat (up-regulation). udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. 3 hari. KATA KUNCI: ekspresi. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia. Syarifuddin Tonnek. gen anti virus.

sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. Nurhidayah. Antibodi monoklonal memiliki kespesifikan yang tinggi. khususnya ELISA. dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. Setelah pengujian. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. KATA KUNCI: White Spot Syndrom Virus (WSSV). Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. KATA KUNCI: ELISA. White Spot Syndrome Virus (WSSV). sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. karena relatif mudah dan murah. monodon dengan melihat gejala klinis dan studi histopatologi. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. antibodi monoklonal . Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. serta berpeluang untuk digunakan secara langsung di lapangan. menyeleksi. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. Pewarnaan jaringan menggunakan Hematoxilin eosin. dan disertai ulserasi lapisan mukosa epitel. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. serta epidemi penyakit di lapangan. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. cepat dan akurat. Penelitian dilakukan untuk membuat. Teknik serologi. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson.

Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah.05) dengan perlakuan A (1. 829. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12).257±0.45 g/ekor dan ditebar kepadatan 100 ekor/bak. Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei). namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan. dan (B) pembesaran dengan tebar tokolan (PL 27).51).0328 mg/L) pada akhir penelitian.102 CFU/mL.18235 mg/L) dibandingkan dengan perlakuan A (0. Takalar.120).549±0.Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.0±149. Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau.83±8. dan kepadatan benur dan tokolan adalah 50 ekor/m2.234).9). menggunakan 4 petak masing masing berukuran 4.05) terhadap pertumbuhan. sintasan. dan efisiensi biaya produksi. Instalasi BRPBAP. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: udang vaname. Budidaya ini berkembang dengan teknologi intensif. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun. benur. . RKP pada pembesaran udang vaname teknologi intensif.. rasio konversi pakan dan produksi udang vaname.5±88.114±0. produksi (1831. Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0. budidaya udang intensif. sintasan.Setiap perlakuan dengan 2 ulangan. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei). namun terbatas pada golongan masyarakat menengah keatas (padat modal). sintasan (90.096±0.048). Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%. kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0.masing-masing perlakuan diulang tiga kali. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari.085±0. Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0.000 m2/petak. Selama pemeliharan 85 hari. tokolan. sintasan ( 92. dan pemeliharaan berlangsung 80 hari di tambak. produksi (2087. karena berpengaruh terhadap pertumbuhan. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0. Riset ini dilaksanakan di tambak Punaga. Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6.7 m sebanyak 9 buah.258). Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi.034) berbeda nyata (P<0.31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10.

and L vannamei .KATA KUNCI: growth. survival rate. feed.

Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%. Sintasan antara 73.00. B (protein 31%. C/P rasio 11.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2.05). menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4. M. dan 23. 19. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon). Penelitian dilakukan di tambak percobaan Punaga Takalar.8 kkal GE/g).intensif.464 mg/kg tubuh/jam.7%. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan. Agus Suprayudi**).2 kkal GE/g). sedangkan ekskresi amonia antara 1.39%. Fakultas Perikanan dan Ilmu Kelautan. Perlakuan terdiri atas pakan A (protein 29%.00. sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya. 11. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname. 5 kali sehari pada pukul 07.029–2.05) terhadap pertambahan berat mutlak.00.0– 8.00. Hidayat Suryanto Suwoyo. produksi. ekskresi amonia dan stabilitas pakan. . C/P rasio 15. salinitas 24–25 ppt. Bogor **) Departemen Budidaya Perairan. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum. dan E atau komersial (protein 40.000 m2. Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media.69%. D (protein 35%. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan.71%–22. Pakan diberikan at satiation. C/ P rasio 16. rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi .6 kkal GE/g). laju pertumbuhan harian. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0. namun kurang diimbangi dengan penyediaan pakan yang sesuai.INTENSIF DI TAMBAK Abdul Mansyur. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu.5 kkal GE/g). Selama pemeliharaan. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0. 15. Litopenaeus vannamei Deisi Heptarina*).00. sintasan. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI . dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7. Jakarta Utara. C (protein 33%. C/P rasio 13. C/P rasio 14. dan pH 8. fotoperiod dibuat 12 jam terang–gelap. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB).5 g/ekor dengan kepadatan 10 ekor per akuarium. sintasan. Kemudian dilanjutkan uji kecernaan. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0. Ing Mokoginta**) dan Dedy Yaniharto***) *) Balai Riset Perikanan Tawar. suhu 28°C–30°C.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan.3%–86. Bobot yuwana yang ditebar rata-rata 0.5. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH.1 kkal GE/g).

K ATA KUNCI: protein vannamei optimal. retensi lemak (RL). FCR 1. PR 532.9%–68. kecernaan protein.4%. RL dan RP masing-masing 26.9%–79.2%.2–78. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0.5%–36. Kisaran nilai masing-masing parameter tersebut adalah.Namun.5%–62. pertumbuhan relatif (PR).1 g.1% dan 65.05). retensi protein (RP). JKP 59. yuwana.4–2.5%.8% dan 11. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13.7%–1130. kecernaan total. kecernaan total dan kecernaan protein masing.4%–94. pertumbuhan.4.masing 26.6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik. jumlah konsumsi pakan (JKP). konversi pakan (FCR). Litopenaeus .2% serta WS berkisar antara 49.

SOD. hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun).Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. protein haemolimph dan ekspresi enzim (GPI. Semua gejala tersebut diduga akibat adanya serangan virus. Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. Gondol **) Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. Lila Gardenia. Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terusmenerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). dan Rustidja**) *) Balai Besar Riset Perikanan Budiaya Laut. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. SOD. Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. Untuk mengetahui jenis virus yang menyerang udang tersebut maka. PGM. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). Haryanti*). vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. and SP) pada udang yang sehat. Namun demikian. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). PGM.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). SOD. EST. dan moribund. toleran. Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. Taura Syndrome Virus. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. KATA KUNCI: enzim. L. . SPF. dan SP. toleran dan terinfeksi TSV. toleran. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. SOD. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. belum dapat diyakinkan secara pasti bahwa ekspresi EST. EST. dan SP mampu berdiri sendiri. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal.

IMNV dan PvNV . WSSV.KATA KUNCI: Litopenaeus vannamei. MBV. IHHNV. TSV.

Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. 25%. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. B. dan pembesaran. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%. yang dilakukan selama 5 bulan. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. C) 2J : 2 B. 0. berturutturut 0. Penelitian dilakukan dengan rancangan acak lengkap. KATA KUNCI: genetik. KATA KUNCI: mortalitas. pemijahan.20 g. 2%. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). diberikan pada pagi dan sore. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal. dan D.31 mm. 0. Musi. C.25 m2/ekor induk. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. rasio kelamin. Namun demikian. dengan lama pengujian 8 minggu. diikuti perlakuan D. yaitu 0%. berturut-turut 27%. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. pertumbuhan. khususnya rasio jantan-betina. Romy Suprapto. beserta persilangannya.5% berturut-turut untuk perlakuan A. 6. berdasarkan nilai heterosis yang didapat. dan 9. Penelitian meliputi pembenihan. Pada sistem tersebut kematian induk relatif rendah. pendederan II. pendederan I. dan D) 2 J : 4 B. Sebagai perlakuan adalah rasio jantan-betina.42 mm. 0. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu.21 g. dan 0. udang galah . persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. persilangan.27 mm. B) 1 J : 2 B. dengan sistem resirkulasi.25 g. Imron. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. reproduksi. dan 13%. Ciasem. A dan B. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 0. yang meliputi pertambahan panjang dan bobot. Barito.5%. dan tidak berbeda nyata antar perlakuan. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan. Asahan.

93. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0. sirih.5 x 103). B (perendaman dalam larutan formalin 250 mg/L).8±1.8±7. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah.5% dan 3. B. Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan.83% dan 3. Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan. 37. 47. (0 cfu/mL). KATA KUNCI: bawang putih.00% dan 3. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C.0±1. C.92. Sukamandi.5±28. dengan nilai sebagai berikut: A. sintasan (SR) dan perkembangan larva (LSI). Pada karakter pertumbuhan. namun tidak berbeda nyata (P>0.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. . Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya.93. Perlakuan yang diberikan yaitu A (kontrol.4 x 103 cfu/mL) . Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰.6±21. desinfektan. Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi. keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24. formalin.0%) dan populasi inbreeding (25. B.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan. 45.7 mm) diikuti oleh populasi hasil outbreeding (21. Harry Wuwungan**).4%) diikuti oleh populasi hasil crossbreeding (57. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan. Hewan uji yang digunakan adalah larva udang galah umur dua hari. **) Jurusan Budidaya.4 mm) dan populasi inbreeding (21. yaitu A. dan D (perendaman dalam larutan ekstrak bawang putih). C (perendaman dalam larutan ekstrak daun sirih). keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.8±1. Dinar Soelistyawati**).0.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*). outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan. KATA KUNCI: budidaya dapat inbreeding. Fakultas Perikanan dan Ilmu Kelautan.0%). dan D. dan D.4 mm). Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74. 4. outbreeding. tanpa penambahan desinfektan). C. yaitu inbreeding. Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah. Hasil penelitian menunjukkan bahwa pada karakter sintasan.05) terhadap kelimpahan bakteri. crossbreeding. (4. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan dioptimalkan. (8. larva udang galah. (0 cfu/mL). 52. Tiga tipe persilangan. merupakan langkah bio-security.5%.

Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. E. KATA KUNCI: kepadatan. Maros dengan panjang awal mysis adalah 100-190 milimikron. dan (F) 10%. Jakarta ABSTRAK Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. dan pakan buatan. sintasan dan pertumbuhan . dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau. Kepadatan larva 25 ekor/L. Pemberian pakan dilakukan setiap pagi dan sore (08.00 dan 16. larva udang pama. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. B. (C) 31%. dan Wartono Hadie**) *) Balai Riset Budidaya Perikanan Ikan Hias. C. Perlakuan yang diujicobakan adalah: A.Forum Inovasi Teknologi Akuakultur 2010 K 21 VARIASI FENOTIP UDANG GALAH (Macrobrachium rosenbergii) DARI POPULASI PERAIRAN KARAWANG. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap. PELABUHAN RATU. Sulaeman. semisucatus) dengan kepadatan berbeda. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm. maka ditambahkan pemanas/heater suhu 30°C. di mana masing-masing perlakuan di ulang tiga kali. D. Kepadatan larva 150 ekor/L.00 wita). Depok *) Pusat Riset Perikanan Budidaya.Karawang dengan Pelabuhan Ratu lebih dekat. Jenis pakan yang diberikan berupa pakan alami chetoceros. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%. Lies Emmawati**). Pelabuhan Ratu. Andi Tenriulo. (D) 16%. Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang). Hewan uji ini ditebar dengan kepadatan berbeda. Kepadatan larva 125 ekor/L. KATA KUNCI: udang galah. dan F. (B) 32%. dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. artemia. diameter 15 cm dan Volume 3 L. Kepadatan larva 100 ekor/L. Kepadatan larva 75 ekor/L. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air. (E) 24%. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu. dan Bone. populasi. lebar 40 cm. DAN BONE Eni Kusrini*). Kepadatan larva 50 ekor/L. jarak genetik K 22 PEMELIHARAAN LARVA UDANG PAMA (Penaeus semisulcatus) DENGAN KEPADATAN BERBEDA Muslimin.05) terhadap laju sintasan dan pertumbuhan larva udang pama.

27 mg/g/jam.9 mg/L dan setelah 1 jam pengukuran 0. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4.1 mm.03 g. panjang karapas 4. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66. 40.1 mm dan lebar karapas 5.1.17 kg/250 m2. yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit.06. KATA KUNCI: udang pama.9±0. disusul perlakuan C: 64. estimasi K 24 POLIKULTUR KEPITING BAKAU (Scylla serrata) DAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN METODE TEBAR YANG BERBEDA Sulaeman. dengan kisaran tingkat konsumsi oksigen 0. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. BRPBAP.Forum Inovasi Teknologi Akuakultur 2010 K 23 ESTIMASI PADAT TEBAR UDANG PAMA Penaeus semisulcatus BERDASARKAN TINGKAT KONSUMSI OKSIGEN Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Kisaran kelarutan oksigen pada awal penelitian adalah 3.58%. tetapi berpengaruh nyata (P<0.96 %. padat tebar. Oksigen terlarut diukur dengan alat pengukur (TPSTM Model WP-82 DO meters). Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1. dan C (gabungan antara keduanya).0235 g adalah 15.14–7.52 kg/250 m2. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP).05) terhadap pertumbuhan bobot mutlak. Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0.2. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. 44.6±0. akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. Ver.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan.446–6.05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. B (metode gantung). Data laju respirasi selama 2 O proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit.48 mg/L dan kontrol tetap berkisar 4 mg/L. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0.65 g/m3. Maros ABSTRAK Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. Wadah percobaan yang digunakan adalah bentik jar (chamber). Maros ABSTRAK Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan. . Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau. Maros. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. Aan Fibro Widodo.03–0.18±0. bobot harian. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar). 58.26–7. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan. pertumbuhan panjang dan lebar karapas mutlak dan harian.95 kg/250 m2 dan terendah pada perlakuan B: 60. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert.

rumput laut .KATA KUNCI: kepiting bakau. metode sebar. polikultur.

/mL)./larva/jam dan sintasan 86. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. dan peubah kualitas air.65). yaitu kepadatan rotifera 625 ind. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang. sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0./mL). KATA KUNCI: kepadatan. yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang. data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton.66). Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau. D (250 ind. rotifera. yaitu: A (625 ind. B (500 ind. Selain diatom epipelic. zoea K 26 ANALISIS DIATOM EPIPELIC SEBAGAI INDIKATOR KUALITAS AIR DAN TANAHUNTUK BUDIDAYA UDANG Supono Budidaya Perairan Universitas Lampung ABSTRAK Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. dan E (125 ind. Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0.). Hasil terbaik diperoleh pada perlakuan A.71). Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan.62). dan Muslimin Balai Riset Perikanan Budidaya Air Payau.Forum Inovasi Teknologi Akuakultur 2010 K 25 LAJU PEMANGSAAN LARVA KEPITING BAKAU (Scylla serrata) TERHADAP PAKAN ALAMI ROTIFERA (Brachionus SP./mL). dan kandungan bahan organik (rs = 0. kepiting bakau. sintasan. Peubah yang diamati adalah laju pemangsaan.72). Maros ABSTRAK Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. C (375 ind. Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air. kandungan liat (rs = 0.) Aan Fibro Widodo. laju pemangsaan. TOM (rs = 0./mL). Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma.0%. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan./mL).05) terhadap laju pemangsaan dan sintasan larva kepiting bakau.1667 ind. Karena hidup di dasar tambak. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0. Sulawesi Selatan. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. dan nitrat (rs = 0./mL dengan laju pemangsaan sebesar 259. jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan.75). . Sulaeman. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang.

KATA KUNCI: diatom epipelic. kualitas air. tambak udang. kualitas sedimen .

74) dan panjang (7. namun kemampuan produksi para pembudidaya hanya sampai 4 inci. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan.0 cm dan adanya pertambahan bobot sebesar 58. Pertambahan bobot (71.9±9. KATA KUNCI: Cherax quadricarinatus. ragam. panjang standar. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar.6±10. dan panjang total tiap individu.9 g.0±0. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot. panjang standar.72). Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang. benih. pertumbuhan. dan Tulung Agung).Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6. Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. simpangan baku. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci. Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda.6-7. Bogor. Gleni Hasan Huwoyon. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. dan panjang total). Dianalisis dengan Rancangan Acak Lengkap (RAL).47) terbaik adalah benih lobster air tawar asal Tangerang. lokasi .6-71.

73±2. dan kombinasi keduanya.44 µm . cottonii : 40. + Sargassum sp.80 sampai 31. I Nyoman Adiasmara Giri.891.19 ± 6.26 ± 10.23 g dan 121.1 ± 4.37 mm.52 µg/hari) dan terendah pemberian pakan Sargassum sp.06 ± 170. 38. Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp.44 ± 102.82 µg/hari).06 µg/hari).00 µm dan 38. lebar dan bobot cangkang. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi. 73. B. cottoni. Ibnu Rusdi. pakan (B)= E.92 g dan 219. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp. (P<0.06 g. dan Sargassum sp. Riani Rahmawati.31 m. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0.39 mm dan 10. + Ulva sp. yaitu pada perlakuan pemberian pakan Gracilaria sp. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga. masing-masing 58. dan C berturut-turut adalah 120. (13.17 ± 2. sangat sesuai dalam memacu pematangan gonad induk abalon H. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30.99 mm dan 36. (C) Sargassum sp. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan.18 mm dan 7. yaitu: (A) Gracilaria sp.. Sargassum.50 g dan 217. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut.16 g dan -86. Gracilaria. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria. E.39 g.68 µg/hari). kombinasi Gracilaria sp. cottonii 37.0 ± 0. Bambang Susanto. squamata.58 m x 0.02 g.44 µg. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut. (7. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0. Ulva sp. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali.39 m x 0.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon. + Ulva sp. (B) Ulva sp. serta pakan (C)= kombinasi Gracilaria + E. + Sargassum sp. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0. + Sargassum sp. dan pakan (C) dengan R² = 0. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41.854. (rasio 1:1:1).05). KATA KUNCI: Haliotis squamata. Riani Rahmawati.613. (13. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata. (5.05) antar perlakuan.03 ± 1. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir.44 µg serta 92. Ulva.73 g. pakan (B) dengan R² = 0. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang. (D) Kombinasi Gracilaria sp. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto.05 mm dan 10.89 µm dan 38..59±2.17 ± 25. dilakukan dengan menerapkan 4 perlakuan pemberian pakan.9 ± 1.56 ± 48. + Ulva sp.. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit.

KATA KUNCI: abalon Haliotis squamata.44 µg.dan 65. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir. aplikasi teknologi pembesaran .

Gpi*. wild.52. Gondol. Kepadatan awal benih abalon adalah 450 ekor per wadah. mengingat permintaannya yang cukup tinggi. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim.06). Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. penjarangan . Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. 80/20% (B). dan Ulva sp. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. 100/0% (A). Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut. Abalon diberi pakan rumput laut Gracilaria sp. tinggi 22 cm. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. Est-3*.7 cm./Ulva sp. Tatam Sutarmat. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. Pakan dengan proporsi Gracilaria sp./Ulva sp. Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. Est-4* dan Cah-3*.13) lebih tinggi dibandingkan dengan induk asal Bali (0. Nilai variasi genetik induk abalone asal Banten (0. KATA KUNCI: abalon Haliotis squamata. 60/40% memberikan pertumbuhan abalon terbaik. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. pembesaran. genetic monitoring. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. Est-1*. Est-2*. dan Ulva sp. KATA KUNCI: allozyme.6-3. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. Setiap perlakuan terdiri atas 2 ulangan. dengan bobot awal 2. Untuk itu. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. Ibnu Rusdi.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin. dengan proporsi yang berbeda Gracilaria sp. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. peluang pasar serta teknik budidayanya yang sederhana.2 g dan panjang cangkang 2. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. Sampel yang digunakan berasal dari Bali dan Banten. Hirmawan Tirta Yudha. proporsi pakan. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. dan 60/40% (C) sebagai perlakuan.

Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan.01 mm/hari (perlakuan A). Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia.33% . tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. sintasan.55 mm (perlakuan C).33%. 0. Parameter yang diamati adalah laju pertumbuhan harian dan sintasan.4±0. Oleh karena itu. yaitu media spesifik untuk bakteri Vibrio. Haliotis squamata. KATA KUNCI: Pinctada maxima. dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Supii. Gondol ABSTRAK Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan.Forum Inovasi Teknologi Akuakultur 2010 M 05 ISOLASI. DAN UJI PATOGENISITAS BAKTERI VIBRIO YANG DIISOLASI DARI LARVA ABALON SAKIT DI HATCHERI Zafran. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut.01 mm/hari (perlakuan A). Karena itu. masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. untuk memperoleh pertumbuhan dan sintasan yang baik.46±0. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut. Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0. Sintasan yang diperoleh untuk perlakuan A. Gondol.1 mm (perlakuan B).36±0. dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13. Bali. KATA KUNCI: abalon. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1.69%. Gondol ABSTRAK Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini.00 mm/hari (perlakuan C). sedangkan mortalitas pada kelompok kontrol hanya 3. Namun.44 mm (perlakuan A).16%. Setiap perlakuan diulang 3 kali. dan 21. 0. isolat-2. dan 20. Apri I. 18. Indah Mastuti. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan.27±0.33%. Vibrio cincinnatiensis. dan 46.42%.05) dibandingkan dengan perlakuan C.44±0. pertumbuhan. dan C berturut-turut 37. KARAKTERISASI.85±0. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar.05 µm).37±0.44±0.01 mm/hari (perlakuan C). Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis.03 mm/hari (perlakuan B) dan 0. vibriosis. ukuran awal spat . 71.67%. uji patogenisitas M 06 PENDEDERAN TIRAM MUTIARA (Pinctada maxima) DENGAN PERBEDAAN UKURAN TEBAR AWAL Sudewi.30±0. 10. B. penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm. Laju pertumbuhan lebar cangkang 0.03 mm/hari (perlakuan B) dan 0. Perlakuan yang diberikan adalah ukuran tebar 3. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0.

Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. KATA KUNCI: potensi kelautan. dan Sudewi*) *) Balai Besar Riset Perikanan Budidaya Laut. Sumber Sari. Pinctada maxima. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Berdasarkan hasil pengkajian. tiram mutiara. pada tingkat nasional. regional maupun lokal. Gondol **) Fakultas MIPA Universitas Udayana ABSTRAK Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. Ida Ayu Astarini**).Forum Inovasi Teknologi Akuakultur 2010 M 07 KAJIAN POTENSI KELAUTAN UNTUK BUDIDAYA TIRAM MUTIARA (Pinctada maxima) DI WILAYAH PESISIR KABUPATEN JEMBRANA-BALI Apri I. Supii*). akan tetapi jika diinginkan. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari. dan Teluk Rabu. tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Pantai Pengambengan khususnya. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai. Teluk Awen. Jembrana .

40 mm pada stoples dan 2. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker. 3 m. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masingmasing dengan 3 kali ulangan. 1 m. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0.3 m. Maros ABSTRAK Produksi rumput laut ditargetkan meningkat dari 2.6 juta ton per tahun sekarang ini menjadi 7. K. stoples . pertumbuhan. Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26.1%.70 dibandingkan dalam botol yang hanya 6. sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. dan 5 m dari permukaan perairan. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut.1.3 m. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81. Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). KATA KUNCI: botol. sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi.20.75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan. Eksplan diinokulasi ke dalam media cair yang diperkaya PES. di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. kepadatan eksplan. vertikultur LL 2 PERBANYAKAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN KULTUR JARINGAN MENGGUNAKAN WADAH YANG BERBEDA Siti Fadilah. Maros ABSTRAK Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan.42 mm pada botol. Kappaphycus sp. dan 5 m. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut. dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau.6 juta ton per tahun pada 2014. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu. Rosmiati.Forum Inovasi Teknologi Akuakultur 2010 LL 1 PERFORMANSI PERTUMBUHAN DAN KANDUNGAN KERAGINAN RUMPUT LAUT (Kappaphycus alvarezii) DENGAN APLIKASI METODE BUDIDAYA VERTIKULTUR Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau. mengaplikasikan metode long line. kandungan keraginan.50) lebih banyak dibandingkan dalam botol (7. Umumnya pembudidaya rumput laut. 2 m. Rumput laut dikumpulkan dari Kabupaten Brebes. Oleh karena itu. Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2. 1 m. 3 m. 2 m. Pengamatan panjang tunas.03). Jawa Tengah. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan. Sedangkan jumlah tunas dalam stoples (7. 4 m.70%) daripada botol (90. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut. yakni 0. verrucosa. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver.75%). 4 m. KATA KUNCI: Kappaphycus alvarezii. metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468. 3.

daya tahan penyakit. ZPT. Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. Fadilah. Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV. Alimuddin**). Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. Utut Widyastuti***). ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT.Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT.e). persentase sel berpendar rata-rata 10%. puncak jam ketiga – keenam s.e. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%– 10%. dan St. KATA KUNCI: Kappaphycus alvarezii. Keratin dan b-actin. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Balai Riset Perikanan Budidaya Air Payau.e dan stabil setelah jam ke9 sampai ke-12 s. panjang kejutan: 0. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. mulai berpendar jam pertama – kedua setelah elektroporasi (s. Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) . dan sumber karbon yang berbeda. b-actin. cytomegalovirus/ CMV.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen.Irvan Faizal****). Rajamuddin*). Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0.1 second. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. promoter. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. Rosmiati. Alias L. jumlah kejutan: 4 kali dan interval kejutan: 0. Pola ekspresi keempat promoter relatif sama. Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas. transgenesis. Sebagai tahap awal dalam rangka produksi rumput laut transgenik.5 mili/second. Kappaphycus alvarezii Muh. Makassar **) Departemen Budidaya Perairan-FPIK. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik.BPPT. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. . dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut.

hibridisasi.KATA KUNCI: mutu genetik. fusi protoplas . kappaphycus alvarezii.

klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. SIG. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). taman nasional ujung kulon. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. kondisi sosek-ekonomi. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). konservasi dan wisata). wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. KATA KUNCI: rumput laut. Pandeglang .Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. Untuk itu. khususnya di Kecamatan Sumur. Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. dan status wilayah kawasan. Pada umumnya. Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. Erlania. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. pembudidaya rumput laut. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. I Nyoman Radiarta. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. Kabupaten Pandeglang. Rekomendasi pencegahan penyakit.

1:1. embriogenesis somatik .4 mg/L. Tahap (2) adalah regenerasi massa sel embriogenik somatik. KATA KUNCI : Kappaphycus alvarezii. Perkembangan selsel embriogenik diamati pada kultur cair. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%.0%. Ridwan*). Rosmiati.0:0. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0. dan 2. embrio somatik. 0. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan.0:0.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0. 0. pada rasio IAA: kinetin (0.6%. dan 0. 0.0% menghasilkan persentase induksi kalus tertinggi (90%). Pada media cair. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. dan 1.4%.5 mm dapat dicapai dalam satu bulan kultur.2 mg/L) dengan konsentrasi agar media induksi (0.8%. adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio. 1. KATA KUNCI: keragaman. Andi Asdar Jaya*). Pemeliharaan dilakukan selama 8 minggu. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh.5:0.0 mg/L. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Pada tahap induksi kalus. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis.0:1. Alias L. pengggantian media dilakukan setiap minggu dengan komposisi media yang sama. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii.6%. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan.6% dan 0. Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen. Makassar **) Balai Riset Perikanan Budidaya Air Payau. 1. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid.8% dan 1.8%). Pada tahap regenerasi massa sel embriogenik.5%). dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau.0 mg/L. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm).1 mg/L) dengan konsentrasi agar (0. kalus.0 mg/L.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. Rajamuddin*). morfologi.

Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. Parameter mutunya adalah kandungan zat gizi (air. denga metode budidaya tali panjang (long line). Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. aroma. rasa. protein. produksi pada tahun 2008 sebesar 750 ton. abu. dan berpengaruh nyata terhadap rupa dan tekstur.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam pengembangan. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. dan karbohidrat) dan uji organoleptik. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. Hasnawi. Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. A-2 (30% tepung rumput laut dan 70% tepung terigu). A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. KATA KUNCI: program-program pokok strategi pengembangan. Mery Sukmiwati. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn . A-1 (15% tepung rumput laut dan 85% tepung terigu). Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. lemak. kadar abu. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju.24 ha. 01-2973–1992 dan SII 0177–1990.13 ha dan 3.780. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu).143. rumput laut. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers.

85%. gizi. uji organoleptik . crakers. KATA KUNCI: rumput laut.

Rachmansyah. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya.36 dan 3. bahan organik dan berat volume tanah.32 dan 113. Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat POS S dan berkelanjutan. Program ArcView 3.2 digunakan untuk pembuatan peta distribusi tanah.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI S POS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. Adang Saputra. Kapur S P KCl POSpertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur. Maros ABSTRAK Kabupaten Mamuju. pirit. Penelitian ini bertujuan untuk melakukan analisis .614%. S . Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting. Kebutuhan kapur didasarkan pada tanah dengan POS nilai S mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur. .60 dan 36. S .78% sehingga memiliki faktor konversi berturutturut sebesar 2. Kebutuhan kapur untuk tambak di Kabupaten Mamuju berkisar antara 1.28% dengan rata-rata 7. tambak. S POS . KATA KUNCI: kebutuhan kapur. Oleh karena itu. pH F .29 ton/ha 3 CaCO dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju. namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. tanah. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan.30 dan 1. Peubah kualitas tanah yang diukur adalah: pH .09 dan 90. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra POS S ALOS FOX AVNIR-2 akuisisi 28 Juli 2009.884 g/cm3 tanah berkisar antara POS dan S 0.02.15 dan 19. dan Anugriati Balai Riset Perikanan Budidaya Air Payau.71 g/cm3 dengan rata-rata 0. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei.02% serta 44. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0.

Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan. Maluku . budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan. infrastruktur (jalan) dan sebaran penduduk.spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG). analisis spasial. inderaja. SIG. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. KATA KUNCI: budidaya laut. Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet. klorofil-a dan suhu permukaan laut). Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut.

Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. analisis komoditas unggulan dan andalan. Jakarta **) Pusat Riset Perikanan Budidaya. udang. Kabupaten Brebes . Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis.400 m2 selama 3 bulan pemeliharaan. dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. dan analisis usaha perikanan. KATA KUNCI: produktivitas tambak. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. Adang Saputra**). rumput laut. KATA KUNCI: minapolitan. b a nd en g LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). tambak terbengkalai. Di samping itu.Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). Hatim Albasri**). konversi pakan serta pertumbuhan yang cukup baik. Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. analisis location quotient. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). analisis komoditas. Jakarta **) Pusat Riset Perikanan Budidaya. ikan patin. udang dan bandeng. Evi Tahapari***). dan Sularto***) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Sukamandi ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. Introduksi kaji terap dilakukan dilahan seluas 2. Wartono Hadie**). rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. peningkatan pendapatan. Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan.

Kabupaten Mamuju . Fe.50-0. dan Kamariah Balai Riset Perikanan Budidaya Air Payau. A. rumput. .75 m. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. paku laut (Acrostichum aureum). penutup/penggunaan lahan.25 m tanah jenis penutup/penggunaan lahan api-api. bakau (Rhizophora apiculata). padi (Oryza sativa). N-total. Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju.50-0. TPA. sagu (Metroxylon sagu). campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. 4PO . masingmasing pada kedalaman tanah 0-0. pesisir. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. kelapa (Cocos nucifera). tanpa vegetasi. Marsambuana Pirzan. KCl KATA KUNCI: keragaman. sagu. S . kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah. bakau. pH dan potensial redoks. TSA. nipah. nipah (Nypa fruticans). Pada kedalaman 0-0. Pada kedalaman 0. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). nipah. Oleh karena itu. sedangkan yang dianalisis di laboratorium adalah pH FOX .25 m dan 0. pH .75 m tanah vegetasi api-api. OXS P KCl POS karbon organik. TAA. Al dan tekstur. rumput. tanah. sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. Hasil penelitian menunjukkan bahwa. pirit. Kualitas tanah yang diukur langsung di lapangan adalah pHF. Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). rumput. S . bakau. pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent.

Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497. nitrat. nitrit. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). amonia. Akhmad Mustafa.077 ha. dan data citra satelit digital. pH. Data sekunder yang diperoleh berupa data iklim.000. kualitas air. KALIMANTAN BARAT Utojo. nitrat. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50. Oleh karena itu. Pada umumnya yang tergolong sangat sesuai (114. tersebar di wilayah pesisir Kecamatan Sungai Pinyuh. tambak. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. Data lapangan (fisiko-kimia air dan tanah). Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. cukup sesuai (168.398 µg/L. dan bahan organik total. fosfat. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. sedangkan peubah bebas adalah suhu.046 dan 22. dan fosfat. oksigen terlarut. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. Sulawesi Barat . walaupun dengan model regresi yang berbeda.000.272 ha). salinitas. pH. KATA KUNCI: klorofil. Sungai Kunyit. nitrit.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. tambak. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan.819 ha). Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik. data sekunder.047 dengan rata-rata 6.986 ha). terdapat di Kecamatan Segedong dan Siantan. amonia. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. KATA KUNCI: kesesuaian lahan. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. dianalisis secara spasial dengan metode PATTERN menggunakan SIG. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil. sedangkan yang kurang sesuai (213. Mempawah Hilir dan Mempawah Timur.

2006). diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis. Jakarta. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda.). Parameter kualitas air yang diamati adalah suhu. Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya.. Kultivasi Dunaliella sp. ekstraksi.. minyak nabati . indeks diversitas dan keseragaman spesies. Kultur ini ditempatkan diluar ruangan.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. Chironomus sp. kolam. dan Nematoda. dengan menggunakan cara modifikasi (Banerjee et al. total bahan organik (TOM). Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5. Analisis kandungan minyak nabati Dunaliella sp. pupuk..05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda. Dunaliella. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp. kecerahan.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6. dilakukan di dalam bak.02–8. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. dan 6:3. penghitungan kelimpahan. kemudian 6.. Spesies dominan adalah Limnaea sp. Proses pengayakan termasuk penyeleksian.5 mg/L. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0. dan BOD5. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. KATA KUNCI: makrobentos.60% menggunakan perlakuan pelarut hexana. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. 2002 dan Dayananda et al. KATA KUNCI: mikroalga. dan penghitungan dilakukan di laboratorium. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8.75). DO. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung. pH. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan.0 sel/mL. Analisis data dilakukan secara deskriptif untuk komposisi jenis. Bogor. 5:4. identifikasi. BRPBAT.bak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. Tidak terdapat perbedaan nyata (P>0.

Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. rawan pangan.25/ hari pada indoor dan 3. Pengolahan data dilakukan secara deskriptif. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. Departemen Pertanian. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. KATA KUNCI: ketahanan pangan. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Berdasarkan perhitungan statistik ANOVA. salinitas. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. KATA KUNCI: kepadatan. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. Metode penelitian menggunakan metode survei.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan. dan pH. 02 sel/mL pada sistem outdoor.33 sel/mL pada sistem indoor dan 7. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. dengan skor 19. Botryococcus braunii .65/hari pada outdoor. braunii. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. laju pertumbuhan. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor.37. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. salah satunya adalah Desa Merakan di daerah Jawa Timur. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan.

KATA KUNCI: Aeromonas hydrophila. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. sehingga AH-26 merupakan isolat yang pathogen. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. penanganan aspek teknis. aerolysin dan primer spesifik . tes katalase dan oksidase dilakukan sebelum uji PCR. KATA KUNCI: unit usaha. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Bakteri merupakan salah satu penyebab penyakit pada ikan. Infeksi bakteri. dan Balai Budidaya Laut (BBL) Ambon. profitabilitas. Sedangkan dengan menggunakan spesifik primer. uji PCR. pembudidayaan. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. Isti Koesharyani. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. Uji awal berupa pengecatan gram.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. kemungkinan merupakan strain yang tidak pathogen. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. pengelolaan bisnis. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. penanganan aspek teknis. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs.

Waduk Cirata .masing perlakuan 5 kali ulangan. Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A). dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: kedalaman. Winarlin.Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti.91.Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat. Ani Widiyati. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m).81 (ind/cm2) dan 0. kedalaman 2 meter (B). Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae. yaitu 4423.860. Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. periphyton. kedalaman 3 meter(C) dan kedalaman 4 meter (D). Masing.

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

salinitas. dan tinggi 40 cm dengan ketinggian air 15 cm. responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. 8 ppt (6–10 ppt). dan Sutisna Kuningan. Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. Sidi Asih***). dan Achmad Sudradjat*) Pusat Riset Perikanan Budidaya. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas.Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: streptococcosis. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. Cianjur Wildan. KATA KUNCI: strain. Masing. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. telah banyak menginfeksi ikan nila. sintasan terendah didapatkan pada salinitas 12 ppt. sintasan. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. ikan mas. Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. Hary Krettiawan*). pertumbuhan . Akuarium yang digunakan berukuran panjang 60 cm. Jakarta **) Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. dan 12 ppt (11–15 ppt). Bogor *) ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. Majalaya. ikan nila. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*). lebar 40 cm.masing perlakuan menggunakan 2 ulangan. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi.

termasuk jenis ikan karnivor. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. ekonomi. Pemeliharaan ikan belida dilakukan di kolam. Iwan Malhani Al’Wazan. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. Jawa. pakan. KATA KUNCI: budidaya.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. dan kalimantan. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan. Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya.64 sedangkan FCR total sebesar 1.36. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan September. anakan ikan nila . dengan jangka waktu pengembalian modal selama 3. yang diberi sekat jaring nilon hita. Dalam hal dukungan dana permodalan. KATA KUCI: ikan belida.53. Jakarta ABSTRAK Ikan karnivor. ikan belida yang banyak hidup di perairan umum Sumatera.November 2009.20 siklus dan nilai RC ratio sebesar 1. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september . Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal.

yang dikenal dengan nama PKM (palm kernel meal). pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. Untuk menguasai teknologi domestikasinya. palm kernal meal. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. Budidaya ikan nila dapat dilakukan di kolam.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) Pusat Riset Perikanan Budidaya. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva. KATA KUNCI: ikan belida. Jakarta **) Balai Riset Perikanan Budidaya Air Tawar. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. KATA KUNCI: ikan nila. pelet maggot . Dalam kegiatan budidaya ikan. kurang lebih 60% pengeluaran berasal dari pakan. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. jaring tancap dan keramba jaring apung. Selama proses adaptasi pada kolam pemeliharaan.

Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia. KATA KUNCI: pertumbuhan. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Masing-masing perlakuan diulang 3 kali. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bak. penyakit infeksi . dan Zafran Balai Besar Riset Perikanan Budidaya Laut. 05. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. 05) tidak mempengaruhi sintasan. Masingmasing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. sedangkan kontrol hanya disuntik dengan PBS. sintasan. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. KATA KUNCI: vaksin bakteri. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. Epinephelus fuscoguttatus. Rasio konversi pakan 1. baik disebabkan oleh infeksi virus.150.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%).Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. dan 200 ekor/m³. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). Padat penebaran yang digunakan sebagai perlakuan adalah 100. 25 – 1. Fris Johnny.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. Pendederan ikan kerapu macan. 95 – 2. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. bakteri maupun berbagai jenis parasit. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit.bak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan. 65 g/ ekor.

Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 .80. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. aspek biologi reproduksi . Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam. dengan jumlah 8% biomass/hari. Tridjoko. dan (B) Induk asal alam. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan. Plectropoma laevis.520 µm. Ketut Suwirya. Kualitas telur yang dihasilkan relatif masih fluktuatif. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya.450. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut.000 butir. Supii. KATA KUNCI: kerapu raja sunu. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. Agus Priyono.20.004. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. indeks somatik gonad dan diameter oocytnya.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma.25-4. Apri I.240.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya.000 butir. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. dan pada induk asal alam 20-92 % dengan SAI 2. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia.

Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. total biomass dan biaya pakan. dibandingkan dengan perlakuan lainnya. Kata kunci : Jaring apung. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. Rudy Gustiano. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. konversi pakan. dan N. KATA KUNCI: truss morfometrik. ikan tengadak. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal.A. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. Hasil penelitian menunjukkan bahwa laju pertumbuhan. pertumbuhan. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi. Peubah yang diamati adalah sintasan. pertambahan berat. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. Giri Balai Besar Riset Perikanan Budidaya Laut. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. dengan periode pemeliharaan120 hari. tengadak albino. pertambahan berat. (1988). Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. Himawan Tirta Yudha. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. tawes .

dan nitrat (11.). Sintasan (93. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar. Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi.4%) pada kolam substrat 1 (pasir. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan. Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat.5 mg/L). kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur. Typha sp.5%–66. yaitu TN (42. dan Scirpus sp. KATA KUNCI: toksisitas.05). karena di samping harus efektif terhadap hama tanaman padi. produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar.3 mg/L). Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi.5–14.4–0.33%). nitrogen.081–0. Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya. dan nitrat (37. Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat). pemakaian insektisida perlu dilakukan secara selektif.11%–44.86%–85.lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8.849 mg/L) dan nitrat (0. amonia (42. khususnya ikan. tumbuhan air.67%).7–1. Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air. KATA KUNCI: substrat. Kisaran persentase efektivitas penyisihan TN (28%– 58.5%–90.8 mg/L).82%). kronis . Untuk itu. Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0.5 mg/L). juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7. yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air). karbofuran.82%).58%). Perlakuan pada penelitian ini terdiri atas dua perlakuan.36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0.681mg/L) dan nitrat (0.32 %).303–1.05) dibandingkan kolam ikan kontrol (82. amonia (20. amonia (0. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan. akut. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan. amonia (0.14%–92.Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar.

Mycobacterium fortuitum PADA IKAN GURAME.00 mg/L.kimia dan histopatologis. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. limpa.00–20. Dua pasang primer. Pada riset ini. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. KATA KUNCI: ekstoparasit.000. dan limpa.00 mg/L (g) kontrol. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut.000. Gyrodactylus. Sensitivitas teknik diagnosa terhadap bakteri target.00 mg/L dan garam 4. Ada beberapa bahan nabati dan alami yang dapat digunakan. serbuk biji teh dan garam. selanjutnya dibandingkan dengan teknik diagnosa melalui uji bio. yaitu (GCGAACGGGTGAGTAACACG) dan (TGCACACAGGCCACAAGGGA).00 mg/L. dan darah. ginjal. (c) biji teh 20. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. (d) garam 4. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati.00 mg/L. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10. (b) biji teh 15. Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan.00–6. Hasil penelitian .00 mg/L efektif untuk memberantas Trichodina dan monogenea. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. Trichodina. (f) garam 6. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain– Jenssen. sehingga upaya pengendaliannya sering terlambat. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. Dactylogyrus. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy). sedangkan preparat histopatologi diambil dari organ hati. Ketujuh perlakuan itu yaitu: (a) biji teh 10.00 mg/ L. dan Quadriacanthus kobiensis serta menimbulkan kematian. 39 M1: T T dan primer M2: PreT (AATGGGCGCAAGCCTGATG) dan (ACCGCTACACCAGGAAT) digunakan pada penelitian 43 531 T ini. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp.000.00 mg/L.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar. yang telah dikembangkan oleh 13 beberapa peneliti. Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. (e) garam 5. Oleh karena itu.

dan Polymerase Chain Reactio n . Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum. gurame. Mycobacterium fortuitum.menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies. KATA KUNCI: mycobacteriosis.

pertumbuhan. KATA KUNCI: fitase. dan sintasan ikan beronang. Cijeruk dengan bobot rata-rata 8. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0.45 g/ekor. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22.05). substitusi.masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0. Bogor. guttatu s . B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai. C. S. nilem.000 unit/kg pakan.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0.000 unit fitase/kg pakan. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG. 1. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: tepung bungkil kedelai.73 g dengan padat tebar 15 ekor/keramba.05) terhadap pertumbuhan. Parameter yang diamati yaitu laju pertumbuhan spesifik. dan 2.500 dan 2. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan. efisiensi pakan. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. tepung bungkil kopra.15±5. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem.000. masing. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. efisiensi pakan. Balai Riset Perikanan Budidaya Air Tawar. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. rasio efisiensi protein. 1. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap. dan tingkat sintasan.60±0.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra. Hasil penelitian menunjukkan bahwa penggunaan fitase 1. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. namun nilai ini tidak berbeda nyata dengan 1.500.V. 500. pakan ikan beronang. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang.

lebar karapas dan sintasan (P>0.04 ± 0.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. KATA KUNCI: pakan rucah. Tjaronge Balai Riset Perikanan Budidaya Air Payau. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan. KATA KUNCI: budidaya bandeng.2 ± 0.Variabel yang diamati adalah pertumbuhan lebar karapas. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass.02 g. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. tambak. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur). Maros selama 40 Hari.05) dengan perlakuan yang lain. 50% ikan rucah + 50% pelet. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif. sintasan . Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut. pelet. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M.-/tahun/ha. Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak. 100% pakan buatan/pelet dan C. Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak.2 mm dan bobot 0. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm.). Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus).526. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. 100% ikan rucah jenis ikan tembang (Clupea sp. bobot dan sintasan serta kualitas air. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot. B. pertumbuhan. rajungan.850.

lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh.5 cm dan panjang tertinggi sebesar 3.0 cm.467. Erfan Andi Hendradjat. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1.816%.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1. masing-masing mencapai 56. 35. Oleh karena itu. pupuk kandang dan dedak. Nina Meilisza. Selama pemeliharaan. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0.6 cm . 70.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari.5 x 0. masing-masing mencapai 986. Pada akhir penelitian (hari ke 105). Padat penebaran bandeng pada masing. Produksi bandeng pada perlakuan A dan B. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. masing-masing dengan dosis 2.5 cm (ukuran ekspor).9 dan 1154 kg/ha.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B). produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut.5 ton/ha.masing perlakuan adalah 15. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B).98 g/ekor menjadi 232. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. bandeng.625% dan 60. 20. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2.5 m dan tinggi air 40 cm. Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10.009 gram. Sintasan bandeng pada perlakuan A dan B.5 x 0.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara.0 cm dan bobot rata-rata 0. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran.-. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. 55.100. KATA KUNCI: pupuk organik. ampas tahu. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2.43. B/C rasio 1. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. dan 105 dan dianalisis secara deskriptif.

pertumbuhan panjang. KATA KUNCI: benih botia. ukuran ekspor 1 inchi (2.5 cm) .dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.

05) .8 (sebagai kontrol). (A) Chironomus sp.0. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi.0-8. namun tidak berbeda nyata (P>0. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar.01 g dan panjang total rata-rata 3. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp.00 dan 16.09 g dan pertambahan panjang total ratarata sebesar 0. memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp.9 dan pH 7. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat.24 cm. Rendy Ginanjar. ikan diberi perlakuan pemberian pakan alami yang berbeda. Agus Priyadi*).0 – 6. Gigih Setia Wibawa*). dan (C) Tubifex sp.5 – 5.50 ± 0. Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal. dengan pertambahan bobot rata-rata sebesar 0. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya. memberikan pengaruh yang berbeda nyata (P<0. pH pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur. Selama 45 hari pemeliharaan. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya. KATA KUNCI: air Melanotaenia sp. Depok.00 dengan metode pemberian sekenyangnya (adlibitum). Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5. dan Culex sp.32 ± 0. Hasil penelitian menunjukkan bahwa perlakuan pH 7. Depok **) Pusat Riset Perikanan Budidaya..Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp.98 ± 0. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor.0 – 8. dan Irsyaphiani Insan**) Balai Riset Budidaya Ikan Hias. pH 6. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. Pakan diberikan tiga kali sehari yaitu pada pukul 8.00. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula. 12.. gonad..85 ± 0.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi.) Eni Kusrini*). Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali. Jakarta *) ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua.05) terhadap pertambahan bobot rata-rata ikan. (B) Culex sp.

pertumbuhan. pendederan. sintasan . KATA KUNCI: Benih ikan pelangi. pakan alami.terhadap rata-rata pertambahan panjang total dan sintasannya.

padat tebar. 95.05) terhadap pertumbuhan. Indonesia **) Institute Recherche Pour Le Developpement. 20 ekor/liter. B. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari. Depok **) Universitas Diponegoro.02 cm dengan bobot 0. Prancis *) ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. 15 ekor/liter. . Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap.22% dan E. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara. 30 ekor/liter dan E. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. Ikan uji yang digunakan adalah benih berukuran panjang 2.22±0. Balai Riset Budidaya Ikan Hias Depok. Marendra Gladiyakti**) *) Balai Riset Budidaya Ikan Hias. 25 ekor/liter. C. B (2 ekor/L). Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. B. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. Pakan yang diberikan selama penelitian adalah nauplii artemia. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). 97. pertumbuhan. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). 96. Sintasan dari masing-masing perlakuan adalah sebagai berikut: A.45%. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi.02 g. D. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi. 35 ekor/liter. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia. 96.07%. tetapi berpengaruh nyata (p<0. resirkulasi. D. Rendy Ginanjar*) Asep Permana*). ketersediaan pakan dan padat penebaran. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan. C.67%.13±0. dan Jacques Slembrouck**) .67 mm. 96.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*).81%. Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). KATA KUNCI: Metynnis hypsauchen. Lili Sholichah*).

padat tebar .KATA KUNCI: ikan botia. sintasan.

Migrasi terbagi menjadi migrasi vertical dan horizontal. KATA KUNCI: Phenotipic plasticity. bahan pakan seperti vitamin dan dedak. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). dan homing atau reproduksi. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. biokonversi. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. 2) unit pengolahan pakan dan 3) unit budidaya. temperature.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. air tersedia dalam jumah yang cukup. Unit budidaya ikan memiliki prasyarat sebagai berikut.) . Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. lunar. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. memiliki mesin pelet. propinsi Jambi. ketersediaan pakan dan pemasaran. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. Ikan Sidat (Anguilla sp. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. salinitas dan arus. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. KATA KUNCI: maggot. Unit pengolah pakan memiliki prasyarat sebagai berikut. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. makanan. Ikan migrasi. area penjemuran atau alat pengeringan pakan (drying). Unit produksi maggot memiliki prasyaratan sebagai berikut. kolam budidaya dan manajement budidaya yang baik. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. Kawasan Mina Pakan Mandiri. memiliki bak kultur. Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. memiliki bak untuk restokin. Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). fisiologi dan tingkah laku dalam merespon perubahan lingkungan. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. sedangkan factor eksternal yaitu.

Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Oreochromis niloticus . Persilangan.40 mM dan 0. Sukamandi. terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair).16 mM.h-1 dan 0. dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST. Ikan yang di gunakan adalah hasil persilangan 4 strain. nila merah (Red NIFI). juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan. Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. Hasil dari persentase polimorfik (berkisar 5. mujair (O. Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik.26% – 63. Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. nila BEST (Bogor Enhancement Strain of Tilapia). Didik Ariyanto. terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&). mossambicus) Nunuk Listiyowati.560). Aktivitas reduksi nitrat terjadi dari awal inkubasi.15%). Kata kunci: Randomly Amplified Polymorphic DNA (RAPD). jarak genetik. Selain itu. Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi. Jarak genetik 15 populasi persilangan berkisar (0.236 – 0. Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O. Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*).mossambicus). NIRWANA (nila ras wanayasa). tetapi yang menghasilkan benih hanya 15 populasi. Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD).17 mM.28 mM.h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Iman Rusmana**).Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan . Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi. untuk mengamati variasi genetik benih persilangan ikan nila. Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik.mossambicus). dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.

nitrogen anorganik.dengan Pseudomonas aeruginosa. Kata kunci: denitrifikasi. reduksi nitrat .

37% setelah proses fermentasi.09% menjadi 4.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. menurunkan lemak bungkil sawit dari 14. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya.. fermentasi. Pada tahap pembentukan mata. KATA KUNCI: PGC. nutrisi dan serat kasar . Isdy Sulistyo2). Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. distibusi. sebagai bahan baku pakan ikan patin. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral. Sukamandi **) Universitas Jenderal Soedirman. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. rasio inti sel:sitoplasma yang besar. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma. Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia.74% menjadi 5.37% dan meningkatkan kadar protein dari 13. KATA KUNCI: Bacillus sp. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia.91% menjadi 15. inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. 6 hari (D3). 4 hari (D2). bungkil sawit.) Priadi Setyawan1). dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. PGC terdistribusi secara berkelompok di bagian ventral. Osphronemus goramy. Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC.8%. Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia.

benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. Lusiastuti***). anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). patin. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. Eni Kusrini****). Angela M. pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil . Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. Jakarta **) Pusat Riset Perikanan Budidaya.1994). salah satunya melalui Catfish Club Indonesia.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). integrasi. Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. Jakarta ***) . Tipe integrasi bersifat soliter. di antaranya daerah Bogor dan Subang. Depok ABSTRAK Ikan patin (Pangasius sp. kluster penetasan telur.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman.Balai Riset Perikanan Budidaya Air Tawar. dan kluster pemeliharaan larva dan benih. dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Subang. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. dan Labuan (Merak). Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. dengan masing-masing hatchery terpisah lokasinya. kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. dkk. Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik. Perbedaan dari kedua sistem ini adalah sifat produksinya.. Wartono Hadie**). Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran. Pengambilan data melalui responden dilakukan dengan cara purposive sampling. setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. KATA KUNCI: UPR. Bogor ****) Balai Riset Budidaya Ikan Hias. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal. demikian juga ditinjau dari segi higienis dan kesehatan benih. dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk.

kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. sex reversal. KATA KUNCI: ikan nilem.persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. jantan fungsional. betina homogamet . sebagai materi kegiatan tahun mendatang.

M H Fariddudin A. KATA KUNCI: sintasan. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. sintasan dan kualitas air (meliputi suhu. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva. salinitas. pertumbuhan. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut.27 pada ukuran konsumsi S D dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. KATA KUNCI: seleksi generasi.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. pH. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. oksigen terlarut/DO.2 gram. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva). larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih. intensitas cahaya. Anang H K. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. dan nitrit). ikan mas strain rajadanu . 10 butir/liter (perlakuan H). kepadatan. Diketahui estimasi nilai heritabilitas rata-rata h²( + ) = 0. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui. 15 butir/ liter perlakuan (I). Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia. Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. amonia. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar.1.57 % dalam satu generasi. Agus Priyono.

penyakit streptococcosis . bakteri probiotik. Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik. eksplorasi. penanggulangan. karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. Klaten. Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus).Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. Survei dilakukan di beberapa daerah yaitu Cianjur. dan Lila Gardenia Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus). Hambali Supriyadi.dan Tasikmalaya. KATA KUNCI: antibakteri.

Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. SIG. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. Teluk Lada. Hatim Albasri. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. Provinsi Banten. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). budidaya laut. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. Kabupaten Pandeglang. Erlania. KATA KUNCI: kerang hijau. Secara umum. di perairan Panimbang Kabupaten Pandeglang. Pandeglang . Untuk menjamin keberlangsungan usaha budidaya kerang hijau. Kabupaten Pandeglang.

manajemen. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro. dan Spiranura sp. kelompok kedua adalah penghasil benih. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya. Bali. Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro. Parameter yang diamati meliputi pemeriksaan parasit. Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP SamasYogyakarta.Forum Inovasi Teknologi Akuakultur 2010 pK 01 1. BBUG Klungkung. dan Opercularia plikatilis. kelompok kedua adalah penghasil benih. Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*).). Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset. tingkat kesembuhan. BBAP Samas-Yogya(Jateng).Bali. sedangkan dari kelompok protozoa adalah Epistylis sp. BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). Imron**). Retna Utami**). Bali. KATA KUNCI: udang.Wartono Hadie*). Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk.UPU Probolinggo (Jatim). Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol.42%. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76.. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp.) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. Zoopthalmium sp. Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan... dan kelompok ketiga ialah pembudidaya.. Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. padahal permintaan cukup besar. Ikhsan Khasani**). serta UPR yang mengembangkan usaha perbenihan udang galah. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP. .Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. dan Jatim. kelompok kedua adalah BBU Pamarican (Jabar). Vorticella sp. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. tingkat sintasan. induk. Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan. dan diferensial hemosit. Carchecium sp. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas.. dan kelompok ketiga ialah pembudidaya. Jateng.

). tembakau (Tobacum nikotiana) .KATA KUNCI: huna (Cherax sp.

Sebelum penebaran. Setelah dua hari. survival rate. Empat petak tambak masing-masing berukuran 3. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. Kecamatan Cilebar. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. pada bulan pertama udang tidak diberi pakan.5 g. Pemeliharaan dilakukan selama tiga bulan. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54. produksi 78.8 kg dan kelangsungan hidup 100 %. pemberantasan hama.n pengapuran sebanyak 175 kg/petak. pengeringan. salinitas rendah. Dengan teknologi yang diterapkan.66% dan 108. Penelitian ini dilakukan pada tambak di daerah Betok Mati. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35.2 %. masing-masing dengan dua ulangan. dan Wartono Hadie Pusat Riset Perikanan Budidaya. yaitu menggunakan tingkat teknologi tradisional plus. tokolan. Idil Ardi. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak. pengapuran dan pemupukan. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. produksi 81. Hewan uji yang digunakan adalah udang vaname PL-48. KATA KUNCI: udang windu.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2. KATA KUNCI: vaname. Dari pemeliharaan udang selama tiga bulan. namun berbeda tidak nyata (P>0. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan.500 m2 digunakan untuk percobaan. dilakukan pengolahan tanah tambak. namun polikultur udang vaname dan rumput laut masih kurang informasinya. kemudian dikeringkan sekitar satu minggu. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. penebaran dilakukan setelah satu bulan dari penebaran tokolan.84 kg/ha. polikultur. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. yaitu pertambahan berat rata-rata 230 g.1 kg dan kelangsungan hidup 11. sedangkan pada dua bulan berikutnya diberi pakan pellet udang.22% dan 72. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang. produksi . Karawang. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2.6 kg/ha. Gracilaria verrucosa.000 kg/ha rumput laut.

Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. pola tradisional. dan perlakuan D = tanpa sumber karbohidrat. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. Polychaeta. 25. menggunakan bak kayu ukuran 1 m x 1 m x 0. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. kotoran. dan metabolit udang.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. indeks keseragaman menunjukkan komunitas plankton pada . dan Rotatoria.05) terhadap kelimpahan dan jumlah jenis plankton. Hal tersebut perlu mendapat dukungan dari penelitian.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. perlakuan C = tapioka.3 g dengan padat tebar 50 ekor/bak. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. dan Cyanophyceae. Pada budidaya udang windu intensif. KATA KUNCI: tepung tapioka. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata.6 m sebanyak 12 buah. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. pola intensif. masing-masing dengan 3 ulangan. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus. Pada budidaya udang vaname pola tradisional plus. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. pelakuan B = sagu. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. Dinophyceae.

udang windu . KATA KUNCI: plankton. indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil. probiotik.perlakuan D relatif lebih merata dibanding perlakuan lainnya.

NO . serta Oscillatoria dari kelas Cyanophyceae. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. Nitzschia. dan perlakuan C = dedak padi halus. pertumbuhan. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. NO . Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. BOT. setiap 15 hari. oksigen terlarut.000 ekor/petak). Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang. KATA KUNCI: probiotik. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea. indeks keseragaman. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. suhu. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. Abdul Malik Tangko. perlakuan B = kotoran sapi. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. B = 2 mg/L. C = 4 mg/L. dan indeks dominasi plankton selama pemeliharaan udang windu. Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. sintasan. dan Pleurosigma dari Kelas Bacillariophyceae. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan.05) terhadap pertumbuhan udang vaname. sintasan. indeks keragaman. PO . Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas. Hasil penelitian menunjukkan perlakuan berpengaruh tidak 4 2 3 nyata (P>0. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname. Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0. dan produksi udang vaname. namun berpengaruh tidak nyata (P>0. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing- .05) pada sintasan dan produksi udang vaname.5 m dengan volume air 400 L. pH.05) terhadap jmlah jenis dan kelimpahan plankton.

KATA KUNCI: dinamika plankton. udang windu.masing: indeks keragaman (1.689–0. pupuk organik. tambak .324– 0.780) dan indeks dominansi (0.362).199–1.427). indeks keseragaman (0.

Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau.0±5. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru. biaya pakan pada perlakuan A dan B masing-masing Rp 11.14 dan 2.875. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak. Substrak tanah sawah. KATA KUNCI: efisiensi.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A).239. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71. dan substak tanah lumpur. budidaya.3±1..dan Rp 19.650. Machluddin Amin. B. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan.01 g. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak.05) antara perlakuan substrak tanah tambak. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak. Substrak tanah lumpur.8±0. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda. umur pemeliharaan. Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan. udang pama. di mana masing-masing perlakuan diulang tiga kali. udang windu .5 dan 21. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0..634.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2.03±0. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau. Substrak tanah tambak. biaya produksi.24. KATA KUNCI: substrak. Penelitian dilaksanakan pada tambak ukuran luas 4.984. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1. masing-masing dengan dua ulangan.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka.2 cm dan bobot awal 0. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L.. dan C. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28.sedangkan pada perlakuan A dan B masing-masing 2. substrak tanah sawah. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak. Perlakuan yang diujicobakan dalam penelitian ini adalah A.6. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak).

64 kg/bak atau rata-rata 11. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan. Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan. ukuran 84 sampai dengan 89 ekor/kg) dan C (16. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah.3 ± 7.7%. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau.7 kg/500 m2 = 320 kg/ha.66 g/ekor. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali.998. pertumbuhan udang.28-13.45 kg/bak atau rata-rata 12.3 ± 5. kisaran produksi 12. di mulai setelah satu minggu penebaran.7% dan perlakuan C = 36. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2. lebih tinggi daripada perlakuan B = 41. dengan rata-rata berat 11.235 kg/ha).0 ± 2. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah.975 dan lebih . kisaran produksi 9. ukuran 80 sampai dengan 96 ekor/kg).86 g/ekor. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan.2 ± 13.6 kg/500 m2 = 406 kg/ha.4 ± 0. masing. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C). Pakan diberikan dengan dosis 100%–2% dari total biomassa udang. Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48.2 kg/500 m2 = 506 kg/ha. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25. namun tidak berakibat terjadi kematian massal. 1. fermentasi probiotik. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2.masing bak mempunyai ukuran panjang. lebar dan kedalaman secara berurutan adalah 10 m.92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90. Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B). dengan rata-rata berat 12. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A.6813.767. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau. Maros.7%.66 kg/bak (7. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah.15%. B).1 ± 13. Namun demikian. KATA KUNCI: tepung tapioka.5 m dan 1 m.61%.86 kg/bak (8. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20.

salinitas rendah .rendah dibandingkan perlakuan B yang mencapai 1. KATA KUNCI: molase.325. udang vaname.

Masing-masing perlakuan diulang sebanyak empat kali. Pemberian bakteri probiotik A (Bacillus sp. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab. Pemberian bakteri dengan konsentrasi 0.3±1. Parameter yang diukur adalah kualitas air.75%–68. sintasan. 85%. sebelum diaplikasikan di tambak. Pemberian probiotik A dengan konsentrasi 0. P. 88%. Tingkat sintasan yang diberi probiotik B berkisar antara 63. C.15. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. sebagai dasar perbaikan sistem penyediaan larva udang galah.. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter).) yang berukuran PL-20. Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata. B. 85%.Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Pemberian probiotik B dengan konsentrasi 5. Q. Universitas Padjadjaran. 10 ‰. Dengan meneliti dua jenis probiotik.57 hari . daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. Nitrobacter sp. dan 0‰ sebesar 11. dan pertumbuhan udang.003 mL/L. 1995). Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan. terdiri atas: A.5 mg/L. dan D. diikuti perlakuan 5‰ sebesar 10±0. sedangkan juvenil dan udang dewasa hidup diperairan tawar.001 mL/L menghasilkan sintasan sebesar 81. dan tiga ulangan. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol). dan Rhodobacter sp. Nitrosomonas sp.5 mg/L. Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang. KATA KUNCI: salinitas.) dan probiotik B (mengandung bakteri Bacillus polimyxa. udang galah.001 mL/L.) berpengaruh nyata terhadap sintasan benih udang windu. Penelitian II pengujian probiotik B.0 hari. Pemberian probiotik A dengan konsentrasi 0.6±0. waktu inkubasi. sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi.. Pemberian probiotik B dengan konsentrasi 2. karena secara alamiah larva hidup di periran bersalinitas. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F. Aplikasi probiotik setiap tiga hari sekali.75%.25%. 5 ‰. Penelitian I adalah pengujian probiotik A. yaitu probiotik A (mengandung bakteri Bacillus sp. Kontrol (tanpa pemberian probiotik A). dan kontrol 66. Pemberian probiotik A memberikan pengaruh terhadap rata-rata .0 mg/L. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz. Pengaruh perlakuan terhadap sintasan. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62.25%.). terdiri atas: O. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL). B..002 mL/L.. Rhodococcus sp. Pemberian probiotik B dengan konsentrasi 7. dan R. Pemberian probiotik A dengan konsentrasi 0. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6.50%. laterosporus. Kontrol (tanpa pemberian probiotik B).

4255–0.001 mL/L menghasilkan pertumbuhan tertinggi (0. kualitas air. sintasan. pertumbuhan . pemberian dengan konsentrasi 0. Ratarata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0. KATA KUNCI: probiotik.4440 g dan kontrol 0. udang windu. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata.pertumbuhan mutlak benih udang windu.3660 g.8935 g).

Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. KATA KUNCI: Macrobrachium rosenbergii. 10 ppt. KATA KUNCI: pertumbuhan. Sukamandi. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. udang galah . sedangkan sintasan pada perlakuan 25 ppt mencapai 61. Hasil yang diperoleh adalah pada salinitas 5 ppt. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten. dan ukuran templat. konsentrasi.67%. 15 ppt. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. 20 ppt. diantaranya karakteristik templat DNA genom yang meliputi kemurnian.09 cm. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. Guna mendukung prgoram revitalisasi tambak. 15 ppt. 10 ppt (kontrol). Selain itu. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.05). dan 20 ppt sintasan dari post larva udang galah mencapai 100%. salinitas.33±0. 25 ppt. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor. Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3). PCR.13 cm dan 1. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt.92±0.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH. yaitu templat dengan berat molekul tinggi (1). Ditinjau dari keragaan pertumbuhan. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau. pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi. dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media.

ikan rucah (B).Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar.5%. baik pertumbuhan bobot. manipulasi lingkungan. KATA KUNCI: pergantian kulit. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). maupun lebar karapas (P>0. panjang.05). Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. Dari pencapaian bobot ini. Berdasarkan persentase. pemberian pakan. Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). kepiting lunak . Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet. Pakan diberikan dua kali sehari selama penelitian. dan gabungan keduanya (C). KATA KUNCI: kepiting bakau. Sulaeman.66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. Sintasan yang diperoleh pada penelitian ini yakni 52%–54. Oleh karena itu. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan. dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. kepiting bakau.

Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan.000 ekor/ha ukuran crablet-30. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau.1±0. perlindungan. dan produksi serta parameter kualitas air. produksi .Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari). merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan. rumput laut dengan kepadatan 1. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009.2 ± 2. KATA KUNCI: kerapatan hutan mangrove. Hasnawi.100 pohon/ha. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1. Ikan bandeng yang digunakan adalah gelondongan umur 1. jumlah permudaan 450–500 pohon/ ha. Peubah yang diamati adalah pertumbuhan lebar karapas./m2. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi. restoking kepiting bakau. Tambak yang digunakan berukuran 10. Tambak ditebari benih rajungan. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰— 4 9‰) mengakibatkan sintasan dan produksi rendah. sintasan. sintasan. sehingga perlu riset budidaya rajungan pada musim kemarau.04 ha. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan.05±0. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi.2 g. KATA KUNCI: rajungan. dan pelestarian alam.000 m2. pertumbuhan. Dibalik manfaat mangrove yang demikian banyaknya.573.5 bulan dengan panjang dan bobot masing-masing adalah 8. bobot. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1.2 mm dan 0. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi. tambak bersalinitas tinggi.0 ± 2.7 cm dan 4. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.000–1.02 g dengan kepadatan 1 ind. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau. data yang diperoleh dibahas secara deskriptif.300 pohon/ha dengan rata-rata 1. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa.

Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. Anjang Bangun Prasetio. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. KATA KUNCI: Danau Maninjau. logam berat . Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. Provinsi Gorontalo. kondisi perairan sangat mendukung pengembangan budidaya rumput laut. Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). Untuk memfokuskan kegiatan budidaya rumput laut. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA).136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. I Nyoman Radiarta. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009.03 mg/L. DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. layak. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010. SIG. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. KATA KUNCI: minapolitan. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. rumput laut. Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Secara umum. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. bioakumulasi. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. Kappaphycus alvarezii. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. Adang Saputra. Secara umum. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). cukup layak dan tidak layak. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya.

KATA KUNCI: kualitas air. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut. 20 dan 30.853. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. alga hijau biru dan alga hijau). GONDOL-BALI Apri I. Nitzschia sigma. Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan. kimia. Sampling air secara regular untuk pengamatan fisika. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10.085. outlet. Supii. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. BBRPBL Gondol . TSS. DO. SUBANG Joni Haryadi*). Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. Dara Kasih**). Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. sedangkan indeks dominansi berkisar antara D=0. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. indeks keseragaman berkisar antara E=0. Indeks keanekaragaman berkisar antara H’=2.962. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air. Perifiton yang terdapat di Tambak Blanakan. Kualitas kimia air untuk pH. nitrit. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. dan Erlania*) *) Pusat Riset Perikanan Budidaya. N. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. tambak.7112. KATA KUNCI: alga perifiton. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet.0760. Subang. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. Subang.814-0. dan plankton dilakukan seminggu sekali. Adi Hanafi. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah. inlet.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah.

Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP.78%). Data dianalisis secara deskriptif. yang terdiri atas: 9 jenis pakan untuk ikan mas. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp. volume air 500 L.58%–13. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g. Pengukuran N dan P dilakukan pada ikan dan pakan.48%–9. KATA KUNCI: limbah.53%) dan ikan bawal (8.73–1.88–1. dan 3).) di laboratorium. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm.63% dan 10. Ani Widiyati.87. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur. 2). dan keanekaragaman plankton.dengan produksi Moina sp. 1. dilakukan pada hari ke-8 sejak dilakukannya penebaran. 1.71%– 10. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio). Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp. kelimpahan. ikan nila (3. KATA KUNCI: konversi pakan.23%–6.53%–15. dan bawal adalah 1. indek dominasi. Parameter yang diamati adalah jenis. limbah hara N dan P . akuaponik.. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP. P. Bogor. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi. nila (Oreochromis niloticus) dan bawal (Colossoma sp. ikan nila. dan 1. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP . yaitu: ikan mas (5.96 ±1. 9. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. serta produksi Moina sp.89% dan 11.21%).89%–17. Kusdiarti. Panen Moina sp.83– 1. Perlakuan adalah pemupukan dengan perbandingan N.16 g.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin.17% dan 8. K = 16:20:0.89.900 g sedimen + 20 g TSP.90.

Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. agalactiae setelah dilakukan uji Postulat Koch. Oreochromis niloticus. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). dan NK1 (5) yang berasal dari organ otak.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*). N4M (2). Esti Handayani Hardi**). sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. Budidaya rumput laut khususnya Kappaphycus sp. Produksi rumput laut ditargetkan meningkat dari 2. mata. Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. KATA KUNCI: Streptococcus agalactiae. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani PongMasak Balai Riset Perikanan Budidaya Air Payau. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S. Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir.1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. sehingga dapat meminimasi kegagalan panen. . dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah.6 juta ton per tahun sekarang ini menjadi 7. 4.6 juta ton per tahun pada 2014. namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. Bogor **) Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. agalactiae. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S. Postulat Koch. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. Isolat 1. di laut dan Gracillaria sp. N17O (4). Oleh karena itu. Hasil yang diperoleh. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. N14G (3). khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian. Sukenda***).

penyakit. hama.KATA KUNCI: rumput laut. pencegahan .

fosfat 0.039–0.3 meter. kesesuaian rumput laut.09 mg/L. KATA KUNCI: potensi.90 ppt.Indra Jaya Asaad. kedalaman 1–40 meter.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI.695. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden. .820. kurang sesuai 2. demikian pula dengan karakteristik físika dan kimia oseanografinya. Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir.01169 mg/L. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka.30 ha dan tidak sesuai 3.57°C–30. suhu 29. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1. Penelitian ini bertujuan untuk mengetahui potensi. KARAKTERISTIK. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27. Syarifuddin Tonnek. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya.38–44.1–8. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau. karakteristik.66°C. dan total suspensi <25–80 mg/L.81–6. nitrit <0. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari. bahan organik total 37. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir. Rachman Syah. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis. dengan tingkat kesesuaian lahan sesuai 21. oksigen terlarut 5. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara.10– 36. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang. Kabupaten Kepulauan Selayar. besi 0.610.33 ha.37. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009. pH antara 6.32 ha.685 mg/L.0032–0. nitrat 0.0008–0.0267–0.1113 mg/L. analisis hierarki proses. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian. Petrus Rani Pong-Masak.02–9.0037 mg/L.95 ha.095. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder. Kata kunci : Opsi pemanfaatan wilayah pesisir. dan Makmur Balai Riset Perikanan Buddidaya Air Payau.85 mg/L. Mudian Paena. salinitas 36. Pengumpulan data primer dilakukan dengan cara wawancara mendalam.

Muhammad Chaidir Undu. kandungan oksigen telarut. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. konduktivitas. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. NH3. Kata kunci : kualitas perairan. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. Utoyo. pH. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. Parameter kualitas perairan yang diamati adalah suhu. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. PO4 dan Fe.Indra Jaya Asaad.Indra Jaya Asaad. dan faktor pasar. analisis faktor. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. A. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. Rachman Syah. Makmur. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. NO2. faktor teknologi budidaya. salinitas. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. Kabupaten Pontianak . KATA KUNCI: keramba jaring apung. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor. Cakupan wilayah penelitian meliputi Teluk Hurun. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. NO3. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. tambak. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. yaitu : faktor infrastruktur dan kondisi perairan.

Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla).Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.97%. dan protein masing-masing sebesar 14. dan pH). dendeng.46%. TVB.25% dan dendeng dengan bumbu ekstrak sebesar 59. bau.663 cps.41%.1% selama 60 menit. Sedangkan nilai TVB dan pH masing-masing sebesar 21. dan mutu natrium alginatnya mempunyai kadar air 19. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. dan dijemur di bawah sinar matahari selama 18 jam. 28. dan rendemennya 37. kapang) dan rendemen. KATA KUNCI: ikan sidat. rendemen. rasa.1%. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempahrempah kasar dan halus (ekstrak). Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik. analisis fisika-kimia . kimiawi (kadar air. Selanjutnya. abu.0%. protein lemak.4%.0%. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk. setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna. mikrobiologi (Angka Lempeng Total/ALT. natrium alginat.26%. Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. lemak.44%. Kadar air. Rumput laut coklat dibagi menjadi dua kelompok. Rendemen dendeng sidat dengan bumbu kasar sebesar 57. rumput laut coklat.04 mgN% dan 6. kadar abu 19. Kelompok kedua ditebar di atas lantai dengan beralaskan waring. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat. kemudian direndam dalam larutan KOH 0. KATA KUNCI: pengeringan. dan viskositas natrium alginat). Jakarta **) Pusat Riset Perikanan Budidaya. viskositas 8. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. terbuka di atas lantai pada suhu ruang (sekitar 30°C). abu. dan 28. kadar abu. Rumput laut coklat setelah dipanen. 7.32%. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. dan tekstur) menggunakan skala hedonik. dan dijemur di bawah sinar matahari selama 18 jam. dicuci dengan air bersih.

kelembagaan yang menunjang. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. pengalaman petani ikan dan Kebijakan Pemerintah. serta ketersediannya dalam skala kecil. Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. polusi air. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. Faktor pendorong yaitu ketersediaan air yang melimpah. prasarana fisik yang kurang mendukung. Metode yang digunakan adalah studi kasus. agribisnis perikanan . Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat. harga ikan yang tergantung pembeli dan cuaca. Identifikasi faktor-faktor pendorong maupun faktorfaktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya. kekurangan modal. KATA KUNCI: potensi desa.

Sign up to vote on this title
UsefulNot useful