P. 1
Abstrak-FITA-20102

Abstrak-FITA-20102

|Views: 1,531|Likes:
Published by QfLy Andis

More info:

Published by: QfLy Andis on Nov 03, 2011
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as DOC, PDF, TXT or read online from Scribd
See more
See less

01/14/2013

pdf

text

original

Forum Inovasi Teknologi Akuakultur 2010

ABSTRAK PRESENTASI ORAL

Forum Inovasi Teknologi Akuakultur 2010

FF 01
PERFORMA IKAN NILA BEST DALAM MEDIA SALINITAS
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: =2,1±0,23; W = 7,0±0.29; = 139,8±6.72; 7,5ppt = 2,3±0.06; 0ppt 0ppt 0ppt L B L W7,5ppt = 8,2 ± 0,42;7,5ppt = 164.3 ± 8,46; 5ppt = 2.3 ± 0,21; 15ppt 7.8 ± 0,45; B = 155,6 ± 8,95. Pengamatan setelah W B L1 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-5 : 4,0±0,34; 3: 4,8±0,27; 5- : 7,4±0,35; 5: 9,2±0,98. 5 15ppt8 0ppt8 15pptPengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
0ppt 15ppt

KATA KUNCI:

nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
PENGUJIAN LANGSUNG EMPAT STRAIN IKAN NILA (Oreochromis niloticus) PADA SALINITAS 40‰
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen ) dengan 8 ulangan dari masing-masing strain. Analisa 50 (LT data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise

Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata 50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru LT (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT
50

Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD). OPC-14. Gesit. nila merah FF 04 ANALISIS KERAGAMAN GENETIK LIMA POPULASI NILA HITAM (Oreochromis sp. dan A (penambahan S. Nirwana. dan OPC-15. cereviceae 2%). Populasi yang diamati meliputi jenis nila BEST.1952 dan jarak genetik antar populasi 0.3333%–46. Sebagai perlakuan 0 adalah A (tanpa penambagan S. fermentasi. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. A (penambahan S. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. 1 2 3 Hasil penelitian menunjukkan penggunaan S. dengan nilai heterozigositas 0. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah.6667%. cereviceae 1%).0351–0. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. A (penambahan S. lokal Kuningan. cereviceae). genetik. ikan nila. Otong Zenal Arifin. Oreochromis . KATA KUNCI: RAPD. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13.5797. dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. Bogor ABSTRAK Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi. dengan menggunakan primer OPA-03. cereviceae sebagai perlakuan dan lima kali ulangan.Forum Inovasi Teknologi Akuakultur 2010 FF 03 PENGGUNAAN Saccharomyces Cereviceae PADA FERMENTASI PAKAN BUATAN UNTUK MENINGKATKAN PERTUMBUHAN NILA MERAH (Oreochromis Niloticus) Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan. cereviceae sebesar 2% KATA KUNCI: Saccaromyces cereviceae. pakan buatan. dan lokal Bogor. cereviceae 3%).1765– 0. OPA-04. Universitas Padjadjaran ABSTRAK Penelitian ditujukan untuk menentukan persentase terbaik dari S. populasi. Pertumbuhan terbaik diperoleh pada penambahan S.) DENGAN ANALISA SIDIK RAGAM RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD) Iskandariah.

ikan nila . tidak cukup untuk memberikan protektif terhadap S. Perlakuan dengan injeksi sel utuh S.Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. agalactiae pada tingkat kepadatan 108. Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. Uni Purwaningsih*). Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). genotipe. Tetapi setelah uji tantang. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. DAN YY Didik Ariyanto*). 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. titer antibodinya menurun. limfosit perlakuan tidak berbeda nyata dengan kontrol. S. 106. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. XY. Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. dan YY melalui evaluasi nisbah kelamin yang dihasilkan. KATA KUNCI: vaksin sel utuh. agalactiae. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. 106. Sukamandi **) Dept.81% dan 83. diferensiasi kelamin. Oreochromis niloticus Angela Mariana Lusiastuti*). Pada akhir pendederan dilakukan identifikasi jenis kelamin. Selain ditentukan secara genotipe. Pada perkembangannya. Fakultas Perikanan dan Ilmu Kelautan. Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. dan differensial leukosit dilakukan analisa sidik ragam (Anova). Kata kunci : Ikan nila. Genotipe XX mencirikan betina dan XY untuk jantan. Pada uji tantang setelah minggu keenam. seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. Untuk kontrol.55% sedangkan genotipe XY dan YY masing-masing sebesar 79.1 mL/ekor. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. titer antibodi. yaitu genotype XX. ikan uji disuntik dengan PBS. Budidaya Perairan. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. SR). Hasil yang diperoleh bahwa sel utuh (whole cell) S. pengukuran bobot individu rata-rata dan penghitungan sintasan. agalactiae. Komar Sumantadinata**). IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. Data sintasan (Survival Rate. agalactiae secara intra peritoneal pada ikan uji sebanyak 0. XY.01%. 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga.

Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. D=102 cfu/mL dan E=kontrol). C=104. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. kecerahan. KATA KUNCI: Streptococcus agalictiae. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. Selain itu. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. TDS. BOD. pH. dan Joni Haryadi Pusat Riset Perikanan Budidaya. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. DO. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. NO . ortofosfat dan total fosfat. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). karena pada kondisi perairan yang kurang . Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. Pemberian pakan tidak boleh berlebihan. melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). B=106. turbiditas. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. NH .5). Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. Angela Mariana Lusiastuti. Selain itu.5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. adalah septikemia dan meningoencephalitis. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. Anjang Bangun Prasetio. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. total nitrogen. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. serta data status kegiatan 3 2 3 budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. dengan variasi perbedaan kepadatan bakteri vaksin (A=108. terutama dalam hal manajemen pemberian pakan.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. pemanasan. Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. NO . Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan.

baik akan menyebabkan stres pada ikan. Danau Maninjau. keramba jaring apung (KJA). lingkungan perairan . KATA KUNCI: manajemen pakan.

Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. KATA KUNCI: heterosis.06%).20%.87%) dan sintasan (0. tidak berbeda nyata (P<0. oreochromis niloticus . Sukamandi **) Dept. Parameter yang diamati meliputi keragaan pertumbuhan (panjang. IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi.64% bobot badan (bt)/hari. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4. Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia). Nunuk Listiyowati. bobot (-2.48% bt/hari dan 2. Budidaya Perairan.35% bt/hari.74%). Komar Sumantadinata**).44%).82%).Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*). sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat. bobot) dan sintasan. tebal (-1.05) bila dibandingkan dengan dua populasi lainya. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2.80%. bobot ( -2. Sukamandi selama lima bulan. tinggi. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2.65%). Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49.53 % bt/hari. dan sintasan(1.22%). lebar (0. tebal. tebal (0. Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (2. tinggi (3.48%). sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2. Fakultas Perikanan dan Ilmu Kelautan.21%).94%). persilangan.

5805).3354 (3. N17O.7504).1100). benih ikan. dan 96 jam. N4M. . Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar.0678 (1. 50 LD iniae (N2O). 0.8090) dan benih ikan nila 5. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration ) 24. NK1) dan 1 isolat S. iniae (N2O).08 g. Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan.55±0. dan 96 jam. 48. dan sonikasi. SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA.9823–4. Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan.8101–1. 2. 72. 48.13 dan 1.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar. Bogor. dan nilai terbesar dimiliki oleh bakteri S. 3.4227– 4. 48.7877–2. Hasil penelitian menunjukan bahwa Nilai LC 24. N14G.5094 (2.6578–2.9237(0. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak.81±0. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran. Data diolah dengan analisis probit program LC50. 3. agalactiae (N3M. Hasil penapisan menunjukkan bahwa bakteri S.1295).6297–0. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1. pemanasan.0930). agalactiae (N4M) memiliki nilai terkecil. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin. 50 KATA KUNCI: toksisitas.0430 (4. dan 96 jam terhadap benih ikan mas adalah 4. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah.7138 mg/L (0. 1.0839(2.8532).6799–13. agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik.6904– 5. 0. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis.9421 mg/L (1. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S. Konfirmasi taksonomis hingga level spesies isolat bakteri S. 72.5480). Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp. Penelitian dilakukan di Instalasi 50 (LC Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung. uji stabilitas dan LC50–24.

streptococciasis. ikan nila .KATA KUNCI: penapisan. vaksin.

97% sehingga sangat prospektif untuk 2 3 dijadikan barang-barang kerajinan kulit. namun sintasannya masih rendah yaitu sekitar 1%–3%. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih. Telur yang ada dalam kolektor dapat diambil jam 07. Selain itu.0–3. yang merupakan limbah perikanan dari perusahaan filet ikan. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g. suhu kerut 88°C. 103.93% dan kadar Cr O 1. Ikan ini relatif sensitif dengan perubahan lingkungan.66%. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU. KATA KUNCI: bahan penyamak kron. liat. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek. dan Sumatera. dan cacing. kadar lemak 6. kambing dan ikan pari yaitu berisi. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. kekuatan jahit 1. karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. dan corak permukaannya spesifik. benedinia. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. untuk dijadikan kulit tersamak. dan 102.5 g. kadar air 13. sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih.53 N/cm atau 138.94%.2 g. dan sebagainya. dan 15% . Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu. Sulawesi. lemas. Waktu pemijahannya sekitar jam 24. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa .12 kg/cm. Pembenihan ikan ini mulai berkembang di sekitar Gondol. tas. sarung tangan. 10%.5 kg. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Ikan ini mudah terserang parasit seperti cryptocarion.00 sampai jam 03. Dalam pembesaran.00. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1.76 kg/cm2. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. garmen. kekuatan regang (kemuluran) 66. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.00–08.masing mencapai ukuran 127. Nusa Tenggara Timur.00 pagi hari.46 N/ cm2 atau 222.0 g.62%. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi. kekuatan tarik 2. kambing. simetris. dan 80 ekor/m3 selama 5 bulan masing.184. kakap putih. kadar abu 2. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi). 40. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia. dompet. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek.354. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak.

Tenggara Barat. KATA KUNCI: pembenihan. kerapu sunu . pembesaran.

hormon pertumbuhan. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. mikroinjeksi. elektroporasi. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. jumlah kejutan 5. transfer gen. lama kejut 30 ms. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. ikan kerapu tikus . Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. Sasmito Jati****). Irvan Faizal*****). mikroinjeksi. Rustidja**).1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. Situbondo **) Fakultas Perikanan dan Kelautan. Alimuddin***). Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. Cromileptes altivelis Slamet Subyakto*). M. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. Ratu Siti Aliah*****). dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). 2. Namun demikian. dan 3 detik. 10 µg/mL. di antaranya Indonesia. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. dan Gemi Triastutik*) *) Balai Budidaya Air Payau. mikroinjeksi. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. dan 20 µg/ mL. jarak waktu antar kejutan 0. Metode elektroporasi dilakukan dengan voltase 50 V. Komar Sumantadinata***). KATA KUNCI: transfeksi.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS.

42±0.69 mm). pertumbuhan.00%) yang baik bagi benih kerapu sunu. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen). dan kualitas air. serta terakhir perlakuan D (47.19%) harian serta laju pertumbuhan bobot badan spesifik (6. KATA KUNCI: larva kerapu sunu. probiotik.19±0. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan. laju pertumbuhan spesifik. nisbah konversi pakan.25) dan efisiensi pakan (80. Namun. Nilai pertambahan panjang tertinggi A (72.90±0. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan.69 g dan panjang total awal 3. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan. Peubah yang diamati adalah sintasan. Salah satu faktor yang berperan adalah lingkungan pemeliharaan.86 mm).68 g) dan panjang total (6.20 cm. laju pertumbuhan harian. selanjutnya perlakuan C (64.20-4. Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus). Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan. Pakan yang digunakan adalah pakan pelet komersial. Sampling dilakukan setiap minggu. C (probiotik).73%) dan panjang total (9.000 ekor/bak. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu. D (kontrol). dan efisiensi pakan pada benih kerapu sunu. Pemberian pakan dilakukan tiga kali sehari.35 cm). dan 15% dari total biomassa benih. B (oksigen). laju pertumbuhan bobot badan harian (10.39±0.52±0. yaitu 5%. KATA KUNCI: benih kerapu sunu.19%) dan panjang total spesifik (1.02%) serta nisbah konversi pakan (1. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. efisiensi pakan.50-0. 10%. Materi yang digunakan adalah larva kerapu sunu sebanyak 4. oksigen . Kendala yang dihadapi terutama terjadi pada stadia awal.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut. dan perlakuan B (63. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU. optimasi pakan. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0.31±0.95 mm). pertumbuhan panjang larva.35 mm). Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3.

B: 196./mL dan mulai umur 17 hari diberikan nauplii Artemia.57 mm. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan.08 ± 1. aktivitas lisosim sebesar 1. Perlakuan A dan B tidak berbeda nyata.20 ± 0. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster.00%. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng.55 mm dan C: 26. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN.95 mg.spesifik ikan kerapu macan.1 ± 2. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari. Gondol ABSTRAK Ikan kerapu macan.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind.50%.81 ± 0.65%. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. Masing-masing perlakuan diulang 3 kali. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut. sedangkan kontrol hanya disuntik dengan PBS. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari.87 cm dan sintasan setelah diuji tantang sebesar 72.96 mg.03% dan perlakuan C adalah 8.87. indeks fagositik sebesar 1. dengan kepadatan 1. B: 24.12 mg dan C: 211. Perlakuan B: 4 kali/hari pada umur 7-20 hari. Des Roza.0x105 sell/mL.68 mm. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian. mencapai ukuran panjang total pada perlakuan A: 24.5 ± 2. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. KATA KUNCI: Epinephelus fuscoguttatus. perlakuan B adalah 6. Bejo Slamet.62%. serta bobot badan pada perlakuan A: 192. larva kerapu macan. KATA KUNCI: pakan buatan. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0.62 ± 2.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C. imunstimulan. Anak Agung Ketut Alit.5 ± 4. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun non. Mulai larva umur 2 hari diberikan Nannochloropsis sp. Perlakuan C: 5 kali/hari pada umur 7-20 hari.04 ± 0. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari. infeksi. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang. terutama infeksi virus. kerapu macan . Epinephelus fuscoguttatus Irwan Setyadi.08 ± 2. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19.

Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp. generasi kedua (F-2). pembenihan. pada bak A : ikan rucah + cumi-cumi + vitamin. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor. sedangkan pada bak B : pakan pelet kering.86 mm. KATA KUNCI: efisiensi. konsentrat yang bisa dibeli di pasaran. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya. dengan sintasan 6. Sampai dengan bulan Oktober telah berhasil memijah. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. Setiap bulan dilakukan pengamatan pertumbuhan bobot.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. kerapu bebek (Cromileptes altivelis).10% dan panjang total 21. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen. yang kurang baik. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk. dan dilihat perkembangan oositnya.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari. perkembangan oosit . Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah. KATA KUNCI: kerapu bebek (Humpback grouper).72% dan panjang total 18. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. panjang. Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. konsentrat mempunyai sintasan 19.

pemeliharaan dilakukan hingga yuwana (2 bulan). Cromileptes altivelis Yasmina Nirmala Asih. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. Tangki pemeliharaan yang digunakan ukuran 8-10 m3. Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor. 5. 2. KATA KUNCI: kerapu bebek. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D15). Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. histologi. 4.masing sebanyak 10-20 ekor. Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. manajemen air media pemeliharaan dan manajemen pakan. Selain itu. 3. 20.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. 10. dan 32 hari setelah menetas masing. KATA KUNCI: pemeliharaan larva. 25. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. 17. 7. Sampel larva diambil pada umur 1. 13. Ketut Mahardika.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan.8%-41. produksi massal . Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. Indah Mastuti. Tetapi tingkat sintasan yang didapatkan masih rendah. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). mutu benih kerapu. 15.

Kematian larva umumnya terjadi pada hari keempat. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. akibat serangan penyakit dan kondisi media. (pakan kontrol). Pakan penelitian berupa pelet kering dengan kandungan PST 0%. Salah satu sumber protein alternatif adalah protein sel tunggal (PST).4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak.651 ekor benih untuk setiap induknya.797–457. survival rate. Lies Emmawati*). perlu alternatif lain sebagai substitusi tepung ikan. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. Sumber protein utama pada pakan adalah tepung ikan. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. dan ketiga menggunakan larva tanpa kekebalan bawaan. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). siklus pertama. dan 20% dalam pakan. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. 10%. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. Tingkat kematian larva dapat mencapai 40%–80%. KATA KUNCI: protein sel tunggal. Pakan diberikan 2 kali secara “adlibitum”. 15% (P>0. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. Oleh karena itu.Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. Ketut Suwirya. KATA KUNCI: innate immunity. dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. I Nyoman Adiasmara Giri. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR). di lain pihak hasil tangkapan cenderung menurun. 15%. tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%.05). Oleh karena itu. laju pertumbuhan spesifik. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. Hasil penelitian menunjukkan bahwa nilai bobot akhir. Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. dan siklus kedua menggunakan larva dengan kekebalan bawaan. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). pertambahan bobot. Pangasius hypophthalmus . dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. catfish seed. 10%. 5%. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II.

Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.1%) berbeda nyata lebih tinggi dibanding pakan D (97.763±0. ikan patin.25±0. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan.00%).17% per hari menjadi 1.93%) dan terendah salinitas 3‰ (25.4%). pakan B (82. dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan.07 cm).204±0. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak). kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya.4%) berbeda nyata lebih tinggi dibanding pakan E (68. yang dilanjutkan dengan uji Tukey.3%) dan pakan D (80.114±0.764±3.92 cm). Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4.75±0. Parameter yang diamati adalah laju pertumbuhan panjang badan. KATA KUNCI: salinitas. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm. Ikan patin sebayak 15 ekor. Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan. benih. dan (C) 3‰ dengan tiga kali ulangan. Pangasius djambal. Kecernaan protein juga meningkat akibat penambahan enzim fitase. dan A (98.35±0. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan.010±0. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰. Analisis data dilakukan secara deskriptif. selama 30 hari.46% per hari. Data diperoleh dianalisis sidik ragam. Dade Jubaedah.3%).884±2.910±0. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase).1%). dan salinitas 1‰ (3.140±0.2%). Pakan diberikan 3 kali sehari secara at satiation. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal. pakan A (82. (B) 2‰.8%). kemudian salinitas 3‰ (4.1%) dan pakan E (95. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin.13% per hari. Ikan uji yang digunakan berukuran 2 ± 0.674±2. C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati.14%).0%).223±0. Pangasius hypopthalmus Mohamad Amin. Kecernaan P pakan B (98.49 cm). sedangkan laju pertumbuhan panjang harian meningkat dari 1. pakan C (98. dan sintasan . Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter. KATA KUNCI: fitase . Kecernaan protein tertinggi berturut-turut pakan C (82.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN. diikuti salinitas 2‰ (28.5 g/ekor. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32.32% per hari menjadi 4. Ade Dwi Sasanti. dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor. Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3. sintasan serta beberapa parameter kualitas air.

B (7 ekor/m2). komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam. betok. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g). B.5%-9. dan C (613. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. predator yaitu antara lain: Ikan liar (gabus. dan sintasan Kata kunci: Intensifikasi. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia. pemijahan. Pemberian pakan dengan pelet apung sebanyak 5% per hari. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan. Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. Larva yang ditebar berumur 20 jam setelah menetas.7% rendahnya sintasan ini diduga karena adanya faktor hama.74±0. sintasan ikan. Padat tebar larva yang digunakan adalah 100 ekor/m2. udang liar) serta jenis serangga air. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan.31 cm B. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4. Pemupukan. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan ikan.3 g) dan SR perlakuan A (91. dan C (10 ekor/m2) dengan 3 kali ulangan. B (660 g). komposisi pakan alami kolam. sepat. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia. nila. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam.60±10.26 cm. Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah.51 g dan 11.37 cm C 16. Pupuk anorganik + organik + probiotik dan C. yaitu antara 13. Patin Siam. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2). penetasan telur dan pemeliharaan larva di kolam. dan Syafrudin Balai Budidaya Air Tawar.27±0. B (95.49±1.5). Akmal. dan C (95. belut.12 g dan 3.08 g dan 3.5 juta ha (rata-rata 20 juta ha).19±0. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masingmasing perlakuan: A.9%). 0.42±0. Sularto. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk.526. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. namun perlakuan B (7 ekor/m2) . Pupuk anorganik + organik.7.2%). Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. Jika luas gambut Indonesia adalah 20 juta ha. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. 0. pengecekan induk. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan. Pupuk anorganik + organik yang difermentasi + Probiotik.

lahan marjinal .2%.memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95. KATA KUNCI: budidaya. ikan patin.

salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin. Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1.45 g).18) dan terendah pada 10 ekor/m2 (1. KATA KUNCI: patin pasupati. Evi Tahapari. sedangkan petakan kedua ditebar sebanyak 2.47 g).46 g). Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98.60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97. Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih.43–11. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt.54 g dan panjang awal antara 10. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari.10%/hari. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2. 10.30%).76%).5 m. Percobaan dilakukan selama 100 hari pemeliharaan. Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3.000 ekor atau kepadatan 10 ekor/m2.52%) dan terendah pada 20 ekor/m2 (91. pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela. 15 ekor/m2 (70. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda. 15 dan 20 ekor/m2 dengan bobot awal antara 15.000 ekor atau kepadatan 5 ekor/m2. dan Sularto***) *) Pusat Riset Perikanan Budidaya. Jakarta **) Balai Riset Perikanan Bididaya Air Tawar. Zafril Imran Azwar**). pertumbuhan.09 cm dan 1. Padat tebar yang digunakan adalah 5.36 cm. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.06%) dan terendah pada kepadatan 20 ekor/m2 (7. pertumbuhan. Evi Tahapari***). salinitas. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99. Sifat biologi pertumbuhannya belum banyak diketahui.71). Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. Kata kunci: padat tebar. nasutus .17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3.70–20. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8.76 cm dan 2. dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3. di samping itu.80%. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95. JAWA TENGAH Ongko Praseno*). Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES. diikuti dengan kepadatan 10 ekor/m2 (92.74 g) dan 20 ekor/m2 (61.

dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sukamandi. intraperitonial. dan kontrol (placebo).33%) dan terendah perlakuan dosis 0. Perlakuan kedua adalah padat tebar: 5 ekor/L. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air. Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal. 108. kemudian dosis 0. dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*). Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. kemudian perlakuan dosis 0. Bogor ***) Pusat Riset Perikanan Budidaya. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif. diikuti dosis 0. Probiotik diberikan dengan dosis yang berbeda. dan 15 ekor/L. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0. yaitu: cara perendaman dan cara penyuntikan intraperitonial.14 cm).003 mg/L dengan tiga kali ulangan. dosis.60 ± 0.003 mg/L (4.35 ± 0. Angela Mariana Lusiana**).002 mg/L (83. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Jakarta **) Balai Besar Riset Perikanan Budidaya Laut. Kata kunci: uji tantang Aeromonas hydrophila. Ikan uji yang digunakan berukuran 3–4 inci. 106. benih. Evi Tahapari*). Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109. Analisis data dilakukan secara deskriptif. sintasan. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.67%).003 mg/L (81.001 mg/L (4. KATA KUNCI: probiotik. (B) 0. Nurbakti Listyanto*). Ikan uji yang digunakan berukuran 1–2 inci. sebagai perlakuan yaitu: (A) 0.001 mg/L. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan. dan (C) 0. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo.49 cm). 108. Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0.67%). Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut.55 ± 0.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*).002 mg/ L. perendaman. 109. dan kontrol. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar. dan pertumbuhan . Uji tantang dilakukan dengan dua cara. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. Pengamatan dilakukan selama 15 hari setelah perlakuan.002 mg/L (4. 107. 10 ekor/L. Parameter yang diamati adalah insidensi dan sintasannya.001 mg/L (86. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan.35 cm).

03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar. 75% ampas tahu:25% tapioka. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger. Bambang Iswanto. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Pangasius nasutus . Penelitin ini terdiri atas dua tahap. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1.04% (pakan D).900 µm. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. substitusi protein 4.16%–79. dan substitusi protein 6.58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4.250–1. Derajat penetasan patin nasutus berkisar 44. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologireproduksi berkaitan dengan kapasitas produksinya. Ukuran panjang total larva yang baru menetas berkisar 3.700 µm. substitusi protein 0% (kontrol) (pakan A).05% dengan lama inkubasi 22–25 jam. 50% ampas tahu:50% tapioka. Aspergillus niger. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus. rearing. ampas tahu. KATA KUNCI: fermentasi. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu. artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai. larva.700– 4.52% (pakan B). tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya.000 µm. Ke dalam wadah ditebar ikan patin ukuran 11.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati.130–22.850 µm. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar. yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm. substitusi protein 2. yakni pengamatan perkembangan gonad dan fertilisasi.03% (pakan C). Zafril Imran Azwar.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. dan tahap 5 (atresis) dengan diameter oosit 300–1. dan 25% ampas tahu:75% tapioka. hatching.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium.41±0. Perkembangan oosit patin nasutus bersifat sinkronis grup. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. KATA KUNCI oosit. tahap 3 (granula kuning telur) dengan diameter oosit 700–1. ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad.

33%. berukuran panjang total 3. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D.20 mm. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D. masing-masing perlakuan diulang sebanyak empat kali. 75. biofilter. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi.6±0.01±0.10–1.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin. 4. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER.84 g/ekor dan terendah A.13 mm. C.42.08 mm3 yang terserap 50% pada umur 30 jam . yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus. 0. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A. 50% zeolit + 50% bioball dan D. 1.98±0. dan D. 95. 89.24) x 103. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan.43b.31ab.35 cm/ekor dan A.25 g/ekor.47±0. 1. C. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A.75% dan terendah perlakuan A.60 cm/ekor. 88.64±0.69 cm/ekor diikuti B.34±0.27a. 0. dengan kantung kuning telur berukuran 0. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian.02 g/ekor. pertumbuhan. 0.89±0.54 cm). KATA KUNCI: patin albino. B. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut. dengan kantung kuning telur berukuran 0. 2. 100% zeolit B.45 g/ekor. 79. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var.42±0.1±0.30a.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias. 91. 75% zeolit + 25% bioball. dan D. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE. diikuti perlakuan C. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A.56 cm/ekor.58%.67%. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D.14 mm.62 g) dan panjang (2. 88.03±0. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih.20. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi. 25% zeolit + 75% bioball. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1.1.71±0. C. berukuran panjang total 3. 2. 92.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam. 1. 4. B.30ab. 1. C.01±0. B. diikuti perlakuan B. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0. C.

tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus. hibrida. nasutus . Kata kunci: embriogenesis. larva. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20.28%. siam. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa. jambal. sedangkan patin hibrida siam-jambal sebesar -4.dan habis terserap pada umur 60 jam.23%.

dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya. lama pemeliharaan ikan bandeng. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). Untuk menentukan 2 3 total limbah N termasuk eksresi amonia. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone.0% untuk protein dan 81. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak. lalu ditambahkan kromium oksida (Cr O ) sebagai indikator kecernaan. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. Eddy Supriyono**). Maros **) Fakultas Perikanan dan Ilmu Kelautan. dan Anugriati Balai Riset Perikanan Budidaya Air Payau.6%–90.2 kg/ha/musim.1% untuk Corganik. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. 88.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur. ikan bandeng. Oleh karena itu. dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng.2%–78. Jika bioflok terbentuk. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. Oleh karena itu. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. Akhmad Mustafa. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein .6%–83. Pakan tersebut digiling ulang. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. Hasil penelitian menunjukkan bahwa. Neltje Nobertine Palinggi*). produksi. dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). Dedi Jusadi**). Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar. lama ikan bandeng digelondongkan. padat penebaran udang windu.2% untuk bahan kering.990 kg/ha/musim dengan rata-rata 292. KATA KUNCI: pengelolaan. 21% dan 26%. tambak. Enang Harris**).

Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok).pakan yaitu 2. milk fish. dan 3. N waste. 2.27 g N untuk pakan berprotein 17%. diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%. heterotrof bakteria .76 g N untuk pakan berprotein 21%. KATA KUNCI: feed digestibility.28% untuk pakan berprotein 26%.

Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L. Oleh karena itu. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86. Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12. kendala. Penambahan inokulasi bakteri komersial (Bacillus sp. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). Enang Harris**). (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL. Pada tahun yang sama.250 ton. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol.54% per tahun kurun waktu tahun 2005–2009. Penyusun utama bioflok ini adalah bakteri heterotrof. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. Hatim Albasri. opsi kebijakan . KATA KUNCI: budidaya. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan.66% dari tahun-tahun sebelumnya. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475.) cenderung meningkatkan kandungan asam amino bioflok. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. Khususnya di wilayah Pantai Utara yaitu Kendal. Eddy Supriyono**).organik. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. dan Rasidi Pusat Riset Perikanan Budidaya. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. Molase digunakan sebagai sumber C.726 ha dan yang layak untuk budidaya sekitar 6. Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. KATA KUNCI: Heterotrofic bakteria. DAN PEKALONGAN ) Anjang Bangun Prasetio. dan Pekalongan. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. bandeng. PATI. growing.000 ton dan mengalami kenaikan sebesar 14. Pati. Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya. Dedi Jusadi**).975 ha.000 ton dan mengalami kenaikan rata-rata 13.

63±10. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp. Data dianalisis secara deskriptif.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel.67%). Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10. Hasil penelitian menunjukkan bahwa DKH-e (63. KATA KUNCI: promoter.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur. DKH-e yang diinjeksi dengan â-aktin-GFP (25. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi.33±3. Gusrina*). menyusul heat shock-GFP (10.0%).33±1. sedangkan DP dihitung ketika semua telur telah menetas. DKHe dihitung sebelum telur menetas. FMIPA. sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik.65%) dan heat shock-GFP (18. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi. Komar Sumantadinata**). dan heat shock-GFP berturutturut adalah 20. Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji.GFP.00±1.66±1. DP untuk â-aktin-GFP. dan 15. Fakultas Perikanan dan Ilmu Kelautan.00±1. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20.65%.****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan.33%. GFP. Ekspresi gen gfp tidak tampak lagi pada saat telur menetas. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA). Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein.67%.0%) dan yang terendah â-aktin-GFP (3.00±3. Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi.66%) relatif sama. keratin. keratin-GFP (21.0±0. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan. mikroinjeksi.Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN. Alimuddin**). Clarias sp. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi.34%) dan DP (63.03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi.0±10. HEAT SHOCK DAN KERATIN PADA IKAN LELE. dan Utut Widyastuti***). ikan lele .3±0. Konstruksi gen dalam bentuk plasmid mBA-gfp.34±1. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. 18.0%).

24. 1. Pemberian pakan sebesar 5% dari biomassa per harinya. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif). pakan terapung . Angela Mariana Lusiastuti.74±1. Bak diisi air sebanyak 100 liter. pegagan Centella asiatical [L] Urb.33% kadar sari dalam air. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang. aerasi. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus). nilai kecernaan pakan tenggelam meningkat secara nyata (P<0. KATA KUNCI: kecernaan pakan. bahan aktif. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus).15%) dibandingkan dengan pakan tenggelam (yakni 79. Feces yang dihasilkan diambil setiap hari.47±4.39% kadar asiaticosid. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%.53% menjadi 92.34% kadar air.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak. Melalui penambahan aerasi.30±2.47±4.25% sehingga tidak berbeda nyata dengan pakan terapung. ikan lele dumbo (Clarias gariepinus). 39.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB. pakan tenggelam. Taukhid. 5.41 mg/L) dengan dosis efektif 250 mg/L. 6. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan.53%) (P<0. hydrophila.37% kadar abu.71±2. pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi.23% kadar abu tak larut asam.623. hydrophila menjadi penyakit endemis di Indonesia.83% kadar sari dalam alkohol.05) dari 79. KATA KUNCi: A. Kandungan bahan aktif hasil pengekstrasian pegagan segar. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani.. Ikan lele dumbo berukuran 41. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5.05). pagi dan sore. Rita Febrianti. 0. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A. Pada perlakuan tanpa aerasi.

Forum Inovasi Teknologi Akuakultur 2010

FF 45
PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus)
Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar

ABSTRAK
Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. Wadah percobaan yang digunakan adalah bak beton ukuran 1,0 m x 1,0 m x 0,8 m, dan dirancang sistem resirkulasi. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9,33±0,10 g sebanyak 40 ekor. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol); 7,92%; 13,28%; 19,56%; dan 25,81% dalam formulasi pakan. Setiap perlakuan dengan 3 ulangan. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar, tapioka, dan molase. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11,96%, dan penurunan lemak 61,85%, dari perlakuan kontrol. Laju pertumbuhan spesifik, penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7,90%, namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25,83% tidak memperlihat perbedaan dengan perlakuan kontrol.
KATA KUNCI: maggot, fermentasi, formulasi, lele dumbo

FF 46
ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA
Tutik Kadarini, Siti Subandiyah, Sulasy Rohmi, dan Darti Satyani Balai Riset Budidaya Ikan Hias

ABSTRAK
Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2,3–3,1 cm. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0, 10, 20, dan 30 g/40 liter masing- masing diulang 3 kali. Jenis pakan berupa cacing tubifex, bloodworm, dan cuk yang diberikan diselang-seling secara adlibitum. Parameter yang diamati sintasan dan pertumbuhan (bobot, panjang, dan perkembangan gonad), kualitas air (suhu, pH, amonia, alkalinitas, oksigen, dan karbondioksida). Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3,8–4,7 cm mencapai TKG III.
KATA KUNCI: gurame coklat, reproduksi, ikan, dan gonad

Forum Inovasi Teknologi Akuakultur 2010

FF 47
APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC.) DI JAWA
Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi, Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman, yaitu seperti daun talas. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa, yaitu di Jawa timur (Blitar dan Tukung Agung), Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Dari hasil penelitian menunjukkan bahwa di daerah Blitar, Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan, penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat, sehingga petani tidak mengalami banyak kerugian.
KATA KUNCI: fish TB, Mycobacteriosis, Mycobacterium fortuitum, biokimia, PCR

FF 48
PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI
Bambang Gunadi, Lamanto, dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Ikan gurame termasuk ikan dengan fekunditas rendah. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang, produksi telur per sarang, dan tingkat fertilitas telur yang dihasilkan. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang), dan injuk sebagai bahan pembuat sarang. Induk gurami yang digunakan berbobot 2-3 kg/ekor, dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. Pakan yang diberikan berupa daun sente sebanyak 3,5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. Perlakuan yang diterapkan adalah kadar protein 38%, 33%, dan 14% sesuai dengan label pada kemasan masing-masing. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. Masing-masing perlakuan mempunyai 2 ulangan. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0,09). Pemberian pakan tambahan dengan kadar protein 38%, 33%, dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10.351 butir, 4.546 butir dan 2.730 butir. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2.774 butir per sarang. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92,23% dibandingkan dengan pemberian pakan dengan kadar protein 33%, 14% dan kontrol yakni masing-masing 79,05%, 28,86%, dan 71,94% (P=0,26). Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0,75 buah, lebih rendah dibandingkan dengan yang

diberikan pakan tambahan berkadar protein 33%, yakni 0,88 buah, namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0,13 buah) dan hanya daun sente (0,5 buah).
KATA KUNCI: ikan gurame, pakan buatan, daun sente, keragaan reproduksi

dan selanjutnya polar dan dedak padi. dan polar fermentasi. dan polar fermentasi berbeda nyata (P<0. polar. 4. Retensi lemak tertinggi (35.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. Kandungan protein dedak padi naik 19. mud carp sebesar 1127 bp. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat.3’). dan koloni berwarna biru tidak mengandung DNA sisipan.33%.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan . Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T.14% dan kadar lemaknya turun sebesar 19. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. protein efisiensi rasio. yang menunjukkan terbentuknya plasmid rekombinan. dengan ditandai tumbuhnya koloni transforman berwarna putih. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. oligosporus yaitu 2.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5. dan sintasan. polar.02% sedangkan kandungan lemaknya turun 13. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari. retensi lemak. Retensi protein dedak padi fermentasi. dedak padi fermentasi. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp. Reza Samsudin.47 g/ekor. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas. pertambahan bobot relatif. Wadah percobaan yang digunakan yaitu akuarium volume 100 L.28%. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. retensi protein. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ – GATGAAACTCGAGTAGCCCTTGCTCTTC.05) dengan dedak padi tanpa fermentasi. Parameter yang diuji meliputi bobot akhir rata-rata. dengan padat penebaran ikan uji 30 ekor per akuarium. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. dan pada Silver carp sebesar 1123 bp. Kadar protein polar naik 38. Bogor dan terdiri atas dua tahap. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. dan 6 hari.

KATA KUNCI: R.05) dengan perlakuan lainnya.67%–100%. ikan mas . fermentasi. dedak polar. Sintasan ikan uji berkisar antara 96. oligosphorus. dedak padi.berbeda nyata (P<0.

dan ikan mas galur majalaya sebesar 0. KATA KUNCI: ikan mas. Data setiap sampling dijadikan ulangan. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan.25 kali lebih besar dibanding pada kolam konvensional. Penelitian telah dilaksanakan dari bulan Nopember 2009 —Pebruari 2010.15 g/hari.28 g/ ekor yang digunakan sebagai hewan uji. kemudian ikan mas galur kuningan sebesar 1. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1. akuaponik. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. Di mana satu di antaranya di desain sebagai kolam akuaponik. serta keramba jaring apung di danau maupun waduk. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. Sedangkan sintasan. Parameter yang diuji adalah kualitas air terutama kandungan ammonia. salinitas rendah.akhir ini banyak lahan yang tidak digunakan (marginal). Lilis Sofiarsih*). Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. Achmad Sudradjat. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. sawah. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan.64 kali lebih banyak dengan ukuran panen 1. sedangkan yang lainnya sebagai kolam konvensional. ukuran panen. Benih ikan mas ukuran 18. KATA KUNCI: ammonia. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. wildan.86 g/hari.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. Provinsi Banten. Kabupaten Tangerang. tambak . Ongko Praseno. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas.41 g/hari. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. Sutrisno*). dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. pertumbuhan. dengan lokasi penelitian di Desa Kronjo. sintasan. karena akhir. ukuran panen. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. dengan padat tebar 20 ekor/m3. dan parameter kualitas air yang lain dianalisis secara deskriptif. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman.

Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam. Siti Zuhriyyah Musthofa. KATA KUNCI: artemia nauplii. cobia larvae. Masing-masing perlakuan diulang 3 kali. Hasil penelitian menunjukkan bahwa pertumbuhan panjang. Afifah. dan Afifah Balai Besar Riset Perikanan Budidaya Laut.067mg) serta kelangsungan hidup (12. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. lasted time feeding . Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. (B) umur 10 hari dan (C) umur 15 hari. Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti.07%) relatif lebih tinggi dari pada perlakuan B dan C. fry performance. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). serta mempunyai respons yang baik terhadap pakan buatan. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2.42%. kemudian diberikan sebagai pakan larva. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata. dapat dikembangkan di bak terkontrol maupun di KJA.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. KATA KUNCI: survival rate.58 cm dan 17. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian. Siti Zuhriyyah. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya.

Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. KATA KUNCI: ikan hias. Stakeholder. Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. plasma nutfah .Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). Lebih dari 100 spesies. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. Lucky Marzuki Nasution*). Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam. termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. KATA KUNCI: cobia. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. Herno Minjoyo*). budidaya.

Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias. multifocal granuloma . Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. KATA KUNCI: deformity. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias. dan yang terendah Moina. bakteri. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. Tubifex sp.Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*). Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian.. granuloma. dan selalu berusaha mendekati sumber oksigen (aerator). Peacock bass ini akhirnya berenangnya jadi terbalik. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. KATA KUNCI: Synodontis nigriventris. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. karena belum banyak yang membudidayakannya. pertumbuhan. Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata.778 cm. dan Tubifex sp. Afrika. infeksi penyakit (cacing.226 g. virus).. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. Artemia sp.586%. atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh. dengan 6 kali ulangan. laju pertumbuhan harian sebesar 32. dan pertambahan panjang total sebesar 1. diikuti Artemia. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. peacock bass. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. Depok ABSTRAK Deformity (dysmorphism. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. kondisi daya dukung lingkungan yang terus menurun. pakan alami. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. Eni Kusrini*). diam dan kepalanya menyembul tepat di bawah permukaan badan air. Deformity dapat disebabkan oleh : mutasi genetic. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia.

3 cm dan bobot 2. KATA KUNCI: banggai cardinal fish. Hasil penelitian menunjukkan. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai . Rainbow Papua . Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. Hewan uji yang digunakan berukuran panjang total 5. 20 ekor/bak. T3. dan Ahmad Musa Balai Riset Budidaya Ikan Hias.9 ± 0. Variabel yang diamati meliputi. Jhon Harianto Hutapea. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. wortel dan tepung kepala udang.50 g. Bastiar Nur.87 ± 0. density.Sulawesi Tengah. yaitu : astaxanthin. 60 ekor/bak. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF). Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. KATA KUNCI: maggot. Selama penelitian. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. zat pemicu warna. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. 40 ekor/bak. udang jembret (mysids) dan larva nyamuk. T2.Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. induk diberi pakan berupa naupli artemia/artemia pra dewasa. Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia.

Nina Meilisza. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. KATA KUNCI: benih botia. Masing-masing perlakuan dilakukan dengan 3 ulangan. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Pada akhir penelitian (hari ke 105). AB (aqua+blitz ich). ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2.5 x 0. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia.67%). Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. 55. I Wayan Subamia.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. AO (aqua+oksitetrasiklin). KF (air kontrol+formalin). KO (air kontrol+oksitetrasiklin).5 m dan tinggi air 40 cm. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0.67%). Selama pemeliharaan. Sintasan terendah dihasilkan oleh perlakuan KB . namun tidak berbeda nyata dengan perlakuan AO (81.05).6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.0 cm dan bobot rata-rata 0. Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. oksitetrasiklin. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. 70. KF (71.33%. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2.009 gram. ukuran ekspor 1 inci (2. dan blitz ich) akan dilakukan melalui rancangan faktorial. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. dan 105 dan dianalisis secara deskriptif.5 cm (ukuran ekspor). AF (aqua+formalin). Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis).5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza.5 cm dan panjang tertinggi sebesar 3. pertumbuhan panjang.67%). 35. namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis. Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari. sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. KO (76. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium.05). dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar.0 cm. 20. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich).5 x 0.

sebesar 51. media air. KATA KUNCI: prophylaksis. sintasan.67% namun tidak berbeda nyata dengan perlakuan AB (55%). larva Tetraodon palembangensis .

Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27. platidoras (Platydoras sp). Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol. Pemijahan tersebut terdiri atas seleksi induk. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina.91%. polypterus senegalus albino. Ikan palmas jenis albino (Polypterus senegalus var. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin.31% dan menghasilkan larva normal sebanyak 218 ekor. masa inkubasi . memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan.6°C–29. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. sehingga produksinya masih mengandalkan impor dari luar negeri. Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias. inkubasi telur dan perawatan larva. KATA KUNCI: Neocaridina heteropoda.15%. dan redfin shark (Ephalzeorhynchos sp.75 mL/kg untuk induk betina di bagian intraperitoneal. perkembangan embrio.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar. pembuahan. Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. Asep Permana. tiger catfish (Platysoma sp. dan Bastiar Nur Balai Riset Budidaya Ikan Hias. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias.). KATA KUNCI: palmas albino. namun belum banyak diketahui data embriologinya. SR (0-10 hari) 83.5 ml/kg untuk induk jantan dan 0. Asep Permana. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy.).). penyuntikan hormon. albino) masih sulit untuk memijah dalam wadah terkontrol. antara lain sinodontis (Synodontys sp.4°C. aligator (Lepisosteus oculatus). daya tetas telur 80. Depok ABSTRAK Ikan palmas (Polypterus sp. hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina.

0488–0. LHRH 100 mg dan testosteron 50 mg (B).0518 g. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. KATA KUNCI: induk. implantasi. KATA KUNCI: Neocaridina heteropoda. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. hormon. Asep Permana. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air. Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm.042 pg/mL. dipelihara selama 6 bulan. Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks. Kepadatan 10 ekor induk dengan bobot 65–600 g. matang gonad. Pada ikan yang baru di domestikasi. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungai.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20.sungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana. budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah. Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi.3–2. Udang diberi pakan berupa moina beku sekali dalam setiap hari. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A). oocyt .9 cm dengan bobot 0. dan Darti Satyani Balai Riset Budidaya Ikan Hias. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah. Tutik Kadarini. panjang 40– 60 cm. dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32. LHRH 50 mg dan testosteron 50 mg (C). Rendy Ginanjar.725 pg/mL. sedang induk jantan belum ada yang mengandung sperma.7–1. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96. Rina Hirnawati. murah dan aplikatif.1630 g dan dua ekor induk jantan yang berukuran panjang 1. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya).5 cm dengan bobot 0. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka.1272–0. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor.

and 75 mL/L. but between treatments not significant different. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian.000 mg/kg). suhu. the treatments gave significant different with control. The research was conducted experimental with completely randomized design. KEYWORDS: honey. chrysin. The proportions test showed dose 50 mL/L have significant different to control. because of residual effects to human caused cancer. Honey is a natural substance which have crysin. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. The concluded that the optimum dose to produce male guppy is 50 mL/L. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan.000-4.6%). yeast (30–800 mg/kg) dan sumber lainnya. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control).) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit.05 significant level. kemudian dipisahkan antara tangkai dan kelopaknya. the alternative masculinization application of natural substance like honey. male.07 ± 9. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. The observation to sexual secondary characteristic guppy can be observed at least two months old. 50 mL/L. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2.71%. KATA KUNCI: bunga tai kotok. Based on LSD test. The result showed that the percentage of male guppy at 50 mL/ L is 64. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. Therefore. carotenoid. as the curative effort is not applicable. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam. 25 mL/L. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method. guppy fish .

Forum Inovasi Teknologi Akuakultur 2010

FF 69
PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA
Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. Induk dipelihara dalam 8 buah bak berukuran 1,5 m x 1,5 m x 1,0 m dengan kepadatan 24 ekor/bak. Lama penelitian berlangsung selama 6 bulan. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&), 1:2 (B&:@&), 1:3 (B&:@&), dan 2:1(B&:@&). Pada awal percobaan, semua induk secara individu dalam keadaan TKG=O. Peubah biologis yang diamati meliputi: jumlah induk memijah, jumlah telur, diameter telur, dan daya tetas telur. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor, jumlah telur 237.865–335.837 butir/ekor, diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%, rasio (1:2) jumlah induk memijah 30 ekor, jumlah telur 129.534–393.333 butir/ekor, diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%, rasio (1:3) jumlah induk memijah 35 ekor, jumlah telur 272.837–344.975 butir/ekor, diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor, jumlah telur 227.945– 350.140 butir/ekor. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama.pada induk beronang.
KATA KUNCI: Siganus guttatus, pemijahan, jumlah telur, diameter telur, daya tetas telur

FF 70
SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG, Siganus guttatus
Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22,05±6,4 g dengan padat tebar 15 ekor/keramba. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut, B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan, masing- masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0,05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0,05) dengan rasio efisiensi proteinnya.
KATA KUNCI: tepung ikan, tepung rumput laut, substitusi, pakan ikan beronang, S. guttatus

Forum Inovasi Teknologi Akuakultur 2010

FF 71
PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH
Rusmaedi, Idil Ardi, dan Wartono Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan, yaitu menggunakan tingkat teknologi tradisional plus, memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Dengan teknologi yang diterapkan, diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Penelitian ini dilakukan pada tambak di daerah Betok Mati, Kecamatan Cilebar, Karawang, Empat petak tambak masing-masing berukuran 3.500 m2 digunakan untuk percobaan. Sebelum penebaran, dilakukan pengolahan tanah tambak,n pengapuran sebanyak 175 kg/petak, kemudian dikeringkan sekitar satu minggu. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. Setelah dua hari, pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Pemeliharaan dilakukan selama tiga bulan, pada bulan pertama udang tidak diberi pakan, sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak, penebaran dilakukan setelah satu bulan dari penebaran tokolan. Dari pemeliharaan udang selama tiga bulan, diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34,5 g, produksi 81,1 kg dan sintasan 11,2%. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3, yaitu pertambahan berat rata-rata 230 g, produksi 78,8 kg dan kelangsungan hidup 100%.
KATA KUNCI: Karawang udang windu, salinitas rendah, tokolan,

FF 72
PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT
Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1,5–50 m3 dengan rata-rata kepadatan akhir N. oculata 13,1±0,04 juta sel/mL dan rotifer 186±5.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. Pemadatan (flokulasi) N. oculata dengan NaOH dosis 75, 100, dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368, 427, dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. Tingkat total ammonium terlarut dalam air laut produksi masal N. oculata relatif tinggi (4,3–8,2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. oculata relatif rendah (3,6%) dengan rasio DHA/EPA hanya 0,2.
KATA KUNCI: pakan alami, marine chlorella, Nannochloropsis oculata, rotifer Brachionus rotundiformis, semi-continuous system

Forum Inovasi Teknologi Akuakultur 2010

FF 73
PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus)
Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi, juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). Wadah penelitian yang digunakan adalah jaring berukuran 1,0 m x 1,0 m x 2,0 m, yang ditempatkan pada keramba jaring apung di laut. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19,2 ± 0,67 cm/ ekor dan bobot 155,3 ± 10,79 g/ekor, ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%, (B) 9%, dan (C) 13%, masing- masing terdiri atas 3 ulangan. Pemberian pakan dilakukan 3 kali/hari (pukul 08.00, 11.00, dan 17.00). Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. Hasil penelitian menunjukkan bahwa kadar lemak 5%, 9%, dan 13% dalam pakan berpengaruh tidak nyata (P<0,05) terhadap pertumbuhan dan sintasan ikan beronang.
KATA KUNCI: kadar lemak, pertumbuhan, sintasan, Siganus guttatus

FF 74
ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA
Lies Emmawati Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. Jika tidak ada efek rumah kaca, suhu dipermukaan bumi akan turun secara drastis. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia. Permasalahan ini perlu dipikirkan solusinya, karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Padahal dalam upaya peningkatan produktivitas perikanan budidaya, plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global.
KATA KUNCI: pemuliaan, ikan langka, budidaya, konservasi

Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. Trichodina sp. kecerahan. perairan Papalan. Pulau Bekengkeng. Akhmad Mustafa. Red Fin Albino. sirip. KATA KUNCI: kesesuaian lahan. dan Ichthyophthirius multifiliis (Ciliata). dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. dan Dactylogyrus spp. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. nitrat. salinitas. fosfat. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. Chiclidae. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. 98% terinfeksi parasit. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. kecepatan arus. budidaya laut. Trematoda). Oleh karena itu. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. (Copepoda) dan Centrocestus sp. Kualitas air perairan yang diukur adalah: pH.18 ha. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. dan besi. Dari Sampel yang diperiksa 33. parasit . sympilum dan Characidae.18 ha yang terdiri dari sangat sesuai seluas 133. keramba jaring apung. penyakit.59 ha. cukup sesuai 512. kedalaman. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar.41 ha dan kurang sesuai 52. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. perairan Kalukku. kapiat albino. 2009. (Dinoflagelata). mas koki. dan insang. Pulau Kambunong. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. neon tetra. dan platydoras. Argulus sp. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. (Monogenea).Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. dan Tanjung Dapuran. cat fish. Gyrodatylus spp. Sampel ikan hias antara lain dari golongan cyprinidae. (metacercaria. arah arus. KATA KUNCI: ikan hias air tawar. Synodontis.

Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. badan air Sungai Citarum dan Sungai Cimeta. inlet. zona 2 Purwakarta. pencemaran. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet. pestisida.86 ton/bulan. Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar.88 mg/L/kg daging ikan. muara Sungai Cisokan. Cd. residu . identifikasi dan analisis data serta pelaporan. Piretroid. batas daerah bahaya. Organofosfat. sedimen (lumpur/tanah). muara Sungai Citarum. Perairan Waduk Cirata sudah tercemar oleh parameter Zn. Variabel yang diamati adalah konsentrasi kandungan Pb. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. Cd. Cd. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. KATA KUNCI: lahan perikanan budidaya. preparasi. dan Karbamat. CD. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. serta debit air dari muara sungai yang masuk ke perairan waduk. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan.8214 ton/bulan dan 1. KATA KUNCI: logam berat. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS.98 ton/bulan. Tahapan penelitian meliputi: penentuan lokasi. dan Zn dalam air dan daging ikan. Contoh yang diambil berupa air. pengambilan contoh. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin.

bicolor.65– 0.072–0. Palumbon. Cyanophyceae. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. A.31. dan sebanyak 150 ekor disimpan dalam alkohol absolut. dan nilai kemerataan (E) = 0. Patok Batas. A. dan Desmiceae dari zooplankton ditemukan jenis Rotifer. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393. Sungai Cimandiri. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur. pada region mitokondria 16SRNA. dan 4–6 m.n. (13. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp.nebulosa . Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat.12–3. KATA KUNCI: komunitas. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias./L. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR.) DI PERAIRAN SUNGAI CIMANDIRI.7) dikelompokan jenis A. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik.17-9. Ciputri. nebulosa. bicolor bicolor. Copepoda. Sukabumi.75– 993. Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). A. Bacillariophyceae./L dan zooplankton berkisar antara 93. selanjutnya digunakan untuk analisa genetik.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar. Maleber. Pelabuhan Ratu. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu. fitoplankton.75 ind. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies. KATA KUNCI: Glass eel.marmorata. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor.5 ind. dan Protozoa.52) dikelompokan pada jenis A. PELABUHAN RATU. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton.71–19. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari.33. Dinophyceae. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. dan Cadas Bodas. dikelompokan pada jenis A. indeks dominansi (C) = 0.marmorata dan (4.83.75–4887. 2–4. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi.35). Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri.

Forum Inovasi Teknologi Akuakultur 2010

FF 81
POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN
Afifah*), Titiek Aslianti*), dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut, Gondol **) Mahasiswa Universitas Gadjah Mada, Jogjakarta

ABSTRAK
Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL), terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. rotifer, B. gonad kerang, dan C. kuning telur) dan 3 ulangan. Pemberian pakan awal di mulai saat larva berumur D-2—D-10, selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan, selanjutnya secara periodik 5 hari sampai dengan D-30. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan,. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10,99 mm; 27,10 g; dan 21,97%) dibanding perlakuan A (10,27 mm; 21,94 g; dan 1790%) dan C (11,01 mm; 25,20 g; dan 17,17%). Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan, namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.
KATA KUNCI: larva ikan kuwe, pakan awal, pola pemangsaan

FF 82
KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT
Mulyasari*), Dinar Tri Soelistyowati**), Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya

ABSTRAK
Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan, adalah dengan program pemuliaan. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra- dan inter-populasi ikan nilem di Jawa Barat. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin), sirip dada (pectoral fin), sirip perut (ventral fin), dan sirip anal (anal fin). Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata.
KATA KUNCI: ikan nilem, Osteochilus hasselti, meristik

Forum Inovasi Teknologi Akuakultur 2010

FF 83
EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti)
Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Pakan memegang peranan penting dalam budidaya ikan nilem. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan, Balai Riset Perikanan Budidaya Air Tawar, Bogor. Ikan uji yang digunakan adalah ikan nilem dengan bobot rata- rata 5,0±0,3 g/ekor. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%, 19%, dan 20%. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Ikan dipelihara selama 40 hari. Parameter yang diamati yaitu pertumbuhan spesifik, konversi pakan, serta sintasan ikan. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0,05) yaitu sebesar 1,56%. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0,05).
KATA KUNCI: nilem, protein, pertumbuhan, pakan

FF 84
EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI, KABUPATEN BATANG)
Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan, Jakarta

ABSTRAK
Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. Penelitian dilakukan di Kabupaten Brebes dan Batang. Metode penelitian dilakukan secara studi kasus. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Harga pakan hanya Rp 2.800,-–Rp 3.000,-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6.500,-–Rp 7.000,-/kg. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya.
KATA KUNCI: efisiensi usaha, pakan buatan, bahan baku lokal, ikan patin

Forum Inovasi Teknologi Akuakultur 2010

FF 85
PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN
Jhon Harianto Hutapea, Irwan Setiadi, Gunawan, dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg). Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2,5 m3 (diameter 2 m dan tinggi 0,8 m) dan bak fiberglass berbentuk oval volume 2,1 m3 (lebar 1,4 m dengan panjang 2,1 m dan tinggi 0,7 m. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari.
KATA KUNCI: penanganan calon induk, ikan tuna sirip kuning, sintasan

FF 86
KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON
Gleni Hasan Huwoyon, Irin Iriana Kusmini, dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. Pada beberapa jenis ikan, warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2,1±0,19; hitam: 1,7±0,20), pertumbuhan mutlak (merah: 6,8±1,02; hitam: 5,6±0,30) dan laju pertumbuhan spesifik (merah: 0,65±0,06; hitam: 0,57±0,02).
KATA KUNCI: warna, tengadak, Barbonymus schwanenfeldii, genetika

Setelah kering. E = Daun mengkudu + 2. dan energi di antara perlakuan berbeda nyata (P<0.5% molasses + 0. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0.04% khamir laut. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. R4 = Daun mengkudu + 2. B = Daun mengkudu + 2.5% molasses + 0. dan abu di antara perlakuan tidak berbeda nyata (P>0.01). Hasil penelitian menunjukkan bahwa: pH. R = Daun 3 mengkudu + 2.5% molasses + 0. serat kasar. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu. silase. KATA KUNCI: khamir laut.06% khamir laut. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan. Jepara. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau. lemak kasar. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2. urea. Setelah 5 hari dipanen. pupuk .08% khamir laut. bahan kering.5% molasses + 0. protein kasar. dan TSP. daun mengkudu. Berdasarkan hasil penelitian. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu.5% molasses + 0. gula.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan.05). BETN.02% khamir laut. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia). Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator.05).00% khamir laut.

rumput laut (2 ton/ha) dan tiram (40.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59. udang windu. KATA KUNCI: udang windu.73% dengan produksi sebesar 217. KATA KUNCI: biofilter. petak I ditebari bandeng (10.-/musim tanam dengan B/C rasio 2. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram.1 ton/ha/16 mg menjadi 1.000 ekor/ha). rumput laut. BL542 bulan III.977. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40. Brata Pantjara. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal.000 ekor/ha) dan rumput laut (1 ton/ha). Pada akhir penelitian diperoleh sintasan 63. MY1112 bulan II. serta manajemen pakan dan air secara benar.000 ind/ha) dan petak II. Erfan Andi Hendradjat. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik. Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I.000 ekor/ha) dan rumput laut (1 ton/ha). ditebari bandeng (10./ha) dan petak II : bandeng (3. rumput laut (2 ton/ha) dan tiram (20. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. KABUPATEN TAKALAR Muharijadi Atmomarsono. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen. Perlakuan B.000 ekor/ha). Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu. CBIB. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I.07.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA. Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau. Sulawesi Selatan.5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar. penggunaan sarana produksi yang ramah lingkungan. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.46% dengan produksi udang windu sebesar 249. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram.48 kg/ha.000. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara.000 ind.000 ekor/ha. di mana termasuk cara budidaya udang. tambak marjinal . Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10. bandeng (3.

Oleh karena itu. Penelitian dilaksanakan selama 90 hari.7 kg/ha/90 hari). kandungan BOT di atas 30 mg/L. tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani. NO3. air laut salinitas 28 ppt sebanyak 15 L. dan C) Kontrol (tanpa probiotik). Hasil penelitian menunjukkan bahwa konsentrasi BOT dan 3 selama penelitian relatif lebih tinggi pada perlakuan yang NH tidak menggunakan probiotik dengan dosis pakan 100%. Muliani. (C2) probiotik komersial dengan dosis pakan 50%. dan total Vibrio. (C1) probiotik komersial dengan dosis pakan 100%. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masingmasing 3 kali dan lama pemeliharaan 10 minggu. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. B) Pergiliran probiotik BT951 bulan I. MY1112 bulan II.35% dan 448. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. Pengamatan sintasan udang windu dilakukan pada akhir penelitian.8% dan 228. menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. Sintasan udang windu tertinggi didapatkan pada . Hasil penelitian menunjukkan. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah.7 kg/ha/90 hari). terutama salinitas yang mencapai 56 ppt. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%.7 kg/ha/90 hari). dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau. diikuti perlakuan kombinasi probiotik A (50. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. total bakteri. Balai Riset Perikanan Budidaya Air Payau. production.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. NH 3. Nurbaya. Nurbaya. BL542 bulan III. (D2) kontrol 2. NO2.05% dan 298. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). KATA KUNCI: probiotic bacteria. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. Maros. Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. PO4. Penelitian dilakukan di laboratorium basah. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. survival rate. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT.

11%.perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11. dosis pakan. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial.05) pada akhir penelitian. udang windu . sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0. sintasan. KATA KUNCI: probiotik.

Sampling dilakukan 30 hari sekali selama 90 hari. Maros selama 90 Hari.000 ekor/ha (1 ekor/m2). namun belum mampu menurunkan kandungan amoniak dalam media budidaya.9% dan 33. Tokolan udang windu (PL. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Oleh karena itu.0%.masing adalah 66.7 kg. KATA KUNCI: probiotik.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya. Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari. Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu.4 ha. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. M.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto. produksi. Tjaronge. baik pada air maupun pada dasar tanah tambak. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha).8% dan 63. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81. Sintasan dan produksi udang windu dan ikan bandeng masing. Selama pemeliharan tidak diberi pakan. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. serta 99. Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya.500 m2 dengan kedalaman 80 cm. masing-masing terdiri atas 2 ulangan.5% dengan produksi 19.000 ekor/ha).masing-masing dengan dua kali ulangan. dan pertumbuhan udang serta aman bagi konsumen. Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari.9 kg dan secara finansial memberikan . yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak.000 ek/ha bandeng) menunjukkan hasil yang terbaik.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1. kesehatan. dan kontrol (tanpa aplikasi probiotik). Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha).4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha). Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok. rumput laut dan ikan bandeng adalah perlakuan B (10. 31) yang ditebar pada masing-masing tambak adalah 10.

sintasan. udang windu. KATA KUNCI: multitropik.keuntungan sebesar Rp 11. produksi .000. ikan bandeng. rumput laut.572.-/ha /90 hari.

Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. uji tantang. Promoter dikatakan aktif apabila gen penanda dapat terekspresi. IPB.0%). Komar Sumantadinata**).Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. Selain itu. danAndi Tenriulo*) **) Balai Riset Perikanan Budidaya Air Payau. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR.3% dan tidak berbeda nyata (P>0. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. 12 jam. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia.1%) serta tanpa transfeksi (49.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. Bunga Rante Tampangallo. Sukenda**). Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. EGFP. gen anti virus. 3 hari. transfeksi. udang windu . diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. ekspresi gen. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. Alimuddin**). Maros **) Departemen Budidaya Perairan. 2 hari. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. KATA KUNCI: ekspresi. gen PmAV menunjukkan respons meningkat (up-regulation). Fakultas Perikanan dan Ilmu Kelautan. Ketika ditantang dengan WSSV. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. yang sampai saat ini belum bisa diatasi secara secara tuntas. 4 hari.05) dibandingkan dengan kontrol. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. Aan Fibro Widodo. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. 1 hari. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. KATA KUNCI: promoter. Syarifuddin Tonnek. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi.

Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. antibodi monoklonal . menyeleksi. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. monodon dengan melihat gejala klinis dan studi histopatologi. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. serta berpeluang untuk digunakan secara langsung di lapangan. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. khususnya ELISA. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. serta epidemi penyakit di lapangan. dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). Setelah pengujian. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. Nurhidayah. Penelitian dilakukan untuk membuat. Teknik serologi. karena relatif mudah dan murah. Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. Pewarnaan jaringan menggunakan Hematoxilin eosin. dan disertai ulserasi lapisan mukosa epitel. Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. cepat dan akurat. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. White Spot Syndrome Virus (WSSV). Antibodi monoklonal memiliki kespesifikan yang tinggi. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: White Spot Syndrom Virus (WSSV). KATA KUNCI: ELISA.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya.

829. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei).9). Takalar.257±0. Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun.0±149.7 m sebanyak 9 buah.549±0. Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau. sintasan ( 92. menggunakan 4 petak masing masing berukuran 4.. karena berpengaruh terhadap pertumbuhan.034) berbeda nyata (P<0.234).Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. dan (B) pembesaran dengan tebar tokolan (PL 27). sintasan.05) terhadap pertumbuhan.0328 mg/L) pada akhir penelitian. Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan.05) dengan perlakuan A (1. tokolan. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%. Instalasi BRPBAP. budidaya udang intensif.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10.51). Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah.258). Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei).000 m2/petak. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak.114±0. KATA KUNCI: udang vaname. Riset ini dilaksanakan di tambak Punaga.085±0.31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya.096±0. sintasan (90. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.18235 mg/L) dibandingkan dengan perlakuan A (0.5±88. Budidaya ini berkembang dengan teknologi intensif.Setiap perlakuan dengan 2 ulangan.83±8. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). produksi (1831.45 g/ekor dan ditebar kepadatan 100 ekor/bak. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0. . Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi. dan kepadatan benur dan tokolan adalah 50 ekor/m2.102 CFU/mL. dan efisiensi biaya produksi. dan pemeliharaan berlangsung 80 hari di tambak. sintasan. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%. benur. Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0. namun terbatas pada golongan masyarakat menengah keatas (padat modal). produksi (2087.masing-masing perlakuan diulang tiga kali.120). Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12). RKP pada pembesaran udang vaname teknologi intensif. rasio konversi pakan dan produksi udang vaname. kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0. Selama pemeliharan 85 hari.048). namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari.

and L vannamei . survival rate. feed.KATA KUNCI: growth.

5 kkal GE/g). Penelitian dilakukan di tambak percobaan Punaga Takalar.029–2. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.69%.00. produksi. 5 kali sehari pada pukul 07. rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi . C/P rasio 14. suhu 28°C–30°C. C/P rasio 15.intensif. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. 19. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu. sintasan. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4. 15. Bogor **) Departemen Budidaya Perairan.05). sedangkan ekskresi amonia antara 1.2 kkal GE/g). Litopenaeus vannamei Deisi Heptarina*).7%. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon).017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an.71%–22. dan E atau komersial (protein 40. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI . C/P rasio 11. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0. Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan. Selama pemeliharaan. Jakarta Utara. C/ P rasio 16.1 kkal GE/g). Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media. laju pertumbuhan harian. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN. Perlakuan terdiri atas pakan A (protein 29%. B (protein 31%. Kemudian dilanjutkan uji kecernaan. D (protein 35%. Agus Suprayudi**). dan 23.3%–86. Pakan diberikan at satiation. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB). Hidayat Suryanto Suwoyo. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0. M. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum. dan pH 8. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan.6 kkal GE/g). K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH. C/P rasio 13. Ing Mokoginta**) dan Dedy Yaniharto***) *) Balai Riset Perikanan Tawar.464 mg/kg tubuh/jam. . sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya.00.5. Bobot yuwana yang ditebar rata-rata 0.INTENSIF DI TAMBAK Abdul Mansyur. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. fotoperiod dibuat 12 jam terang–gelap.39%.8 kkal GE/g).5 g/ekor dengan kepadatan 10 ekor per akuarium.00. Sintasan antara 73.000 m2. ekskresi amonia dan stabilitas pakan. C (protein 33%.0– 8.00.00. Fakultas Perikanan dan Ilmu Kelautan.05) terhadap pertambahan berat mutlak. 11. salinitas 24–25 ppt. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7. namun kurang diimbangi dengan penyediaan pakan yang sesuai. sintasan. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan).

7%–1130.8% dan 11. JKP 59. RL dan RP masing-masing 26.Namun. kecernaan protein.9%–79. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0.2%.masing 26.2–78. retensi lemak (RL).4–2. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13.2% serta WS berkisar antara 49. kecernaan total dan kecernaan protein masing.4%. K ATA KUNCI: protein vannamei optimal. pertumbuhan.1% dan 65. FCR 1. yuwana.5%–62.4%–94. Litopenaeus . konversi pakan (FCR).05).4.5%–36. pertumbuhan relatif (PR). PR 532. jumlah konsumsi pakan (JKP).1 g.5%. kecernaan total. retensi protein (RP).9%–68. Kisaran nilai masing-masing parameter tersebut adalah.6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik.

Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. L. EST. Gondol **) Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang.Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. dan Rustidja**) *) Balai Besar Riset Perikanan Budiaya Laut. SOD. Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. Lila Gardenia. Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. SOD. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terusmenerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. Namun demikian. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. SPF. Semua gejala tersebut diduga akibat adanya serangan virus. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. . hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). Untuk mengetahui jenis virus yang menyerang udang tersebut maka. PGM. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . Taura Syndrome Virus. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. PGM. toleran. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. and SP) pada udang yang sehat. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. EST. dan SP. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). protein haemolimph dan ekspresi enzim (GPI. SOD. belum dapat diyakinkan secara pasti bahwa ekspresi EST. toleran. dan moribund. toleran dan terinfeksi TSV. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). KATA KUNCI: enzim. Haryanti*). dan SP mampu berdiri sendiri. SOD.

MBV. WSSV. IMNV dan PvNV .KATA KUNCI: Litopenaeus vannamei. IHHNV. TSV.

yang dilakukan selama 5 bulan.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani.25 g. KATA KUNCI: genetik.21 g. Penelitian dilakukan dengan rancangan acak lengkap. KATA KUNCI: mortalitas. pendederan II. beserta persilangannya. Imron. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. pendederan I. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%. dengan sistem resirkulasi.31 mm. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal. Penelitian meliputi pembenihan. reproduksi.5%. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. berturutturut 0. pemijahan. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. berdasarkan nilai heterosis yang didapat. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. Ciasem. Romy Suprapto. dan 13%. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. dan 0. 6. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan.5% berturut-turut untuk perlakuan A. pertumbuhan. udang galah .25 m2/ekor induk. 0. berturut-turut 27%. Musi. 0. dan D. Pada sistem tersebut kematian induk relatif rendah. yang meliputi pertambahan panjang dan bobot. diberikan pada pagi dan sore. 2%. Sebagai perlakuan adalah rasio jantan-betina. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah.20 g.27 mm.42 mm. dengan lama pengujian 8 minggu. dan pembesaran. dan 9. rasio kelamin. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji. diikuti perlakuan D. yaitu 0%. 25%. dan D) 2 J : 4 B. dan tidak berbeda nyata antar perlakuan. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). persilangan. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. C. B) 1 J : 2 B. 0. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. B. A dan B. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. khususnya rasio jantan-betina. 0. Asahan. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro. Namun demikian. Barito. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. C) 2J : 2 B.

45. Dinar Soelistyawati**). desinfektan.93. outbreeding. C. Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya. (0 cfu/mL). (0 cfu/mL). Pada karakter pertumbuhan.4 x 103 cfu/mL) .05) terhadap kelimpahan bakteri.6±21.0%) dan populasi inbreeding (25.0±1.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*). Fakultas Perikanan dan Ilmu Kelautan. (8. Harry Wuwungan**).83% dan 3. crossbreeding.8±7. sirih.93.7 mm) diikuti oleh populasi hasil outbreeding (21. Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah. **) Jurusan Budidaya. .5%. 4.8±1. 47. B. keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24. tanpa penambahan desinfektan). larva udang galah. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan. yaitu inbreeding. sintasan (SR) dan perkembangan larva (LSI). Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. (4. KATA KUNCI: bawang putih.4 mm). Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan.0. 52. Tiga tipe persilangan. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan dioptimalkan. Hewan uji yang digunakan adalah larva udang galah umur dua hari.5±28. dan D. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan D (perendaman dalam larutan ekstrak bawang putih). keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74.92. namun tidak berbeda nyata (P>0. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C.5 x 103). C (perendaman dalam larutan ekstrak daun sirih).05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan. Hasil penelitian menunjukkan bahwa pada karakter sintasan.4%) diikuti oleh populasi hasil crossbreeding (57. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah. formalin.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. Perlakuan yang diberikan yaitu A (kontrol.4 mm) dan populasi inbreeding (21.00% dan 3. Sukamandi. 37. B (perendaman dalam larutan formalin 250 mg/L). B. yaitu A. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan. merupakan langkah bio-security. KATA KUNCI: budidaya dapat inbreeding.0%). dengan nilai sebagai berikut: A. Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0. C. dan D.8±1. Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan.5% dan 3. Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi. keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.

Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. KATA KUNCI: udang galah. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air. Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm. KATA KUNCI: kepadatan. C. dan pakan buatan. dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. (C) 31%.Forum Inovasi Teknologi Akuakultur 2010 K 21 VARIASI FENOTIP UDANG GALAH (Macrobrachium rosenbergii) DARI POPULASI PERAIRAN KARAWANG. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%. Hewan uji ini ditebar dengan kepadatan berbeda. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau. Jakarta ABSTRAK Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. E. D. PELABUHAN RATU. Perlakuan yang diujicobakan adalah: A. Lies Emmawati**). Pelabuhan Ratu.Karawang dengan Pelabuhan Ratu lebih dekat. (D) 16%.05) terhadap laju sintasan dan pertumbuhan larva udang pama. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang). Kepadatan larva 100 ekor/L. Kepadatan larva 50 ekor/L. Sulaeman. Kepadatan larva 150 ekor/L. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu. Kepadatan larva 125 ekor/L. DAN BONE Eni Kusrini*). larva udang pama. semisucatus) dengan kepadatan berbeda. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. artemia. Pemberian pakan dilakukan setiap pagi dan sore (08. (E) 24%.00 wita). dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut. Kepadatan larva 25 ekor/L. Kepadatan larva 75 ekor/L. Andi Tenriulo. Maros dengan panjang awal mysis adalah 100-190 milimikron. dan F. dan Wartono Hadie**) *) Balai Riset Budidaya Perikanan Ikan Hias. Jenis pakan yang diberikan berupa pakan alami chetoceros. dan Bone. B. di mana masing-masing perlakuan di ulang tiga kali. maka ditambahkan pemanas/heater suhu 30°C. lebar 40 cm. dan (F) 10%. Depok *) Pusat Riset Perikanan Budidaya. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap. diameter 15 cm dan Volume 3 L. sintasan dan pertumbuhan . populasi. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. jarak genetik K 22 PEMELIHARAAN LARVA UDANG PAMA (Penaeus semisulcatus) DENGAN KEPADATAN BERBEDA Muslimin. (B) 32%.00 dan 16.

44.58%. estimasi K 24 POLIKULTUR KEPITING BAKAU (Scylla serrata) DAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN METODE TEBAR YANG BERBEDA Sulaeman.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan. dan C (gabungan antara keduanya). yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1. Aan Fibro Widodo.Forum Inovasi Teknologi Akuakultur 2010 K 23 ESTIMASI PADAT TEBAR UDANG PAMA Penaeus semisulcatus BERDASARKAN TINGKAT KONSUMSI OKSIGEN Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar).17 kg/250 m2.26–7. Kisaran kelarutan oksigen pada awal penelitian adalah 3.03–0.446–6. Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0.05) terhadap pertumbuhan bobot mutlak. Maros.1. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66. bobot harian. dengan kisaran tingkat konsumsi oksigen 0.6±0.0235 g adalah 15. 58. disusul perlakuan C: 64. Ver.48 mg/L dan kontrol tetap berkisar 4 mg/L.9±0. dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau.96 %.2. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. 40.27 mg/g/jam. akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. BRPBAP. padat tebar. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan. tetapi berpengaruh nyata (P<0. . Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0.65 g/m3.06. B (metode gantung).1 mm.52 kg/250 m2.9 mg/L dan setelah 1 jam pengukuran 0. Oksigen terlarut diukur dengan alat pengukur (TPSTM Model WP-82 DO meters). Wadah percobaan yang digunakan adalah bentik jar (chamber).03 g. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP).05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. Maros ABSTRAK Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. Data laju respirasi selama 2 O proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit.14–7. panjang karapas 4.18±0. Maros ABSTRAK Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4.1 mm dan lebar karapas 5. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. KATA KUNCI: udang pama.95 kg/250 m2 dan terendah pada perlakuan B: 60. pertumbuhan panjang dan lebar karapas mutlak dan harian.

polikultur. rumput laut .KATA KUNCI: kepiting bakau. metode sebar.

0%./mL).71). Peubah yang diamati adalah laju pemangsaan. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen. dan nitrat (rs = 0. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp. D (250 ind. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau. zoea K 26 ANALISIS DIATOM EPIPELIC SEBAGAI INDIKATOR KUALITAS AIR DAN TANAHUNTUK BUDIDAYA UDANG Supono Budidaya Perairan Universitas Lampung ABSTRAK Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. dan kandungan bahan organik (rs = 0.66). Hasil terbaik diperoleh pada perlakuan A. yaitu kepadatan rotifera 625 ind. Sulawesi Selatan. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping.05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma. B (500 ind.). Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros.Forum Inovasi Teknologi Akuakultur 2010 K 25 LAJU PEMANGSAAN LARVA KEPITING BAKAU (Scylla serrata) TERHADAP PAKAN ALAMI ROTIFERA (Brachionus SP./larva/jam dan sintasan 86. yaitu: A (625 ind. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0. sintasan.1667 ind. kepiting bakau.65)./mL). Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros. C (375 ind.75). Selain diatom epipelic. . rotifera. Karena hidup di dasar tambak. KATA KUNCI: kepadatan. jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang./mL dengan laju pemangsaan sebesar 259. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang.62)./mL). Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton. dan peubah kualitas air. Maros ABSTRAK Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. dan E (125 ind. kandungan liat (rs = 0. Sulaeman. data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan./mL).) Aan Fibro Widodo. dan Muslimin Balai Riset Perikanan Budidaya Air Payau. laju pemangsaan.72). TOM (rs = 0. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang. sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0./mL). Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air.

tambak udang.KATA KUNCI: diatom epipelic. kualitas air. kualitas sedimen .

Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. panjang standar. lokasi .6±10. Pertambahan bobot (71.6-7.47) terbaik adalah benih lobster air tawar asal Tangerang. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda. panjang standar. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang. Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci. Dianalisis dengan Rancangan Acak Lengkap (RAL).74) dan panjang (7. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2. ragam. Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55.9 g. dan panjang total tiap individu. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar. benih. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6.Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini.72). dan Tulung Agung). namun kemampuan produksi para pembudidaya hanya sampai 4 inci. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan.0±0.0 cm dan adanya pertambahan bobot sebesar 58. pertumbuhan. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot.9±9.6-71. dan panjang total). Bogor. simpangan baku. Gleni Hasan Huwoyon. KATA KUNCI: Cherax quadricarinatus.

dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut.56 ± 48.82 µg/hari). pakan (B)= E..02 g.39 g. B. Riani Rahmawati. pakan (B) dengan R² = 0.73 g. KATA KUNCI: Haliotis squamata.16 g dan -86. dan kombinasi keduanya.44 ± 102.06 µg/hari).23 g dan 121. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0. dan pakan (C) dengan R² = 0.26 ± 10. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan. Ulva. Bambang Susanto. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga. dilakukan dengan menerapkan 4 perlakuan pemberian pakan. kombinasi Gracilaria sp.92 g dan 219. (13.80 sampai 31. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi.613.18 mm dan 7. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp. cottonii 37.05). + Ulva sp.44 µm .06 g. (13.50 g dan 217. squamata. (rasio 1:1:1). + Ulva sp. cottoni. Ulva sp. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang. Gracilaria. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir. (C) Sargassum sp.89 µm dan 38.39 m x 0.854. + Sargassum sp. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali.99 mm dan 36.44 µg serta 92. + Sargassum sp. dan C berturut-turut adalah 120.0 ± 0. (B) Ulva sp. 73. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A. Sargassum.1 ± 4. cottonii : 40.. 38.31 m.44 µg.73±2.03 ± 1.06 ± 170.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria. (5. Ibnu Rusdi..59±2. Riani Rahmawati. (7. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon.9 ± 1. I Nyoman Adiasmara Giri. serta pakan (C)= kombinasi Gracilaria + E. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto.68 µg/hari).891. masing-masing 58. sangat sesuai dalam memacu pematangan gonad induk abalon H.19 ± 6. E. Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41. yaitu pada perlakuan pemberian pakan Gracilaria sp.37 mm.00 µm dan 38. + Ulva sp. dan Sargassum sp.58 m x 0. (P<0. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0.05) antar perlakuan. + Sargassum sp. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit.17 ± 2.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0.05 mm dan 10. yaitu: (A) Gracilaria sp.52 µg/hari) dan terendah pemberian pakan Sargassum sp. (D) Kombinasi Gracilaria sp. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. lebar dan bobot cangkang.39 mm dan 10.17 ± 25.

aplikasi teknologi pembesaran . Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir. KATA KUNCI: abalon Haliotis squamata.44 µg.dan 65.

60/40% memberikan pertumbuhan abalon terbaik.06). Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. Setiap perlakuan terdiri atas 2 ulangan. wild. Est-3*. 100/0% (A). Pakan dengan proporsi Gracilaria sp. Ibnu Rusdi. mengingat permintaannya yang cukup tinggi. pembesaran.7 cm. dan Ulva sp. Est-1*. Untuk itu. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan./Ulva sp. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. Sampel yang digunakan berasal dari Bali dan Banten. Est-2*. KATA KUNCI: abalon Haliotis squamata. Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin.13) lebih tinggi dibandingkan dengan induk asal Bali (0. genetic monitoring. KATA KUNCI: allozyme. proporsi pakan. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. dan Ulva sp. dengan proporsi yang berbeda Gracilaria sp. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. Gondol. dengan bobot awal 2. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut.52. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. dan 60/40% (C) sebagai perlakuan. tinggi 22 cm./Ulva sp.2 g dan panjang cangkang 2. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. Gpi*. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. Abalon diberi pakan rumput laut Gracilaria sp. penjarangan . Tatam Sutarmat. Nilai variasi genetik induk abalone asal Banten (0. Est-4* dan Cah-3*. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. Kepadatan awal benih abalon adalah 450 ekor per wadah. peluang pasar serta teknik budidayanya yang sederhana.6-3. Hirmawan Tirta Yudha. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. 80/20% (B).

01 mm/hari (perlakuan C). 0. KARAKTERISASI.01 mm/hari (perlakuan A). 71. Sintasan yang diperoleh untuk perlakuan A. Bali.44 mm (perlakuan A).05) dibandingkan dengan perlakuan C. dan C berturut-turut 37.16%.01 mm/hari (perlakuan A). Gondol ABSTRAK Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. untuk memperoleh pertumbuhan dan sintasan yang baik. sintasan. Indah Mastuti. 18.33%. dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Karena itu. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0. vibriosis. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. KATA KUNCI: abalon. Haliotis squamata. dan 20. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan.37±0. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis.05 µm).42%. dan 46. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut. Laju pertumbuhan lebar cangkang 0. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan. Gondol ABSTRAK Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan.00 mm/hari (perlakuan C). Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar. Setiap perlakuan diulang 3 kali.4±0. 10. Oleh karena itu. uji patogenisitas M 06 PENDEDERAN TIRAM MUTIARA (Pinctada maxima) DENGAN PERBEDAAN UKURAN TEBAR AWAL Sudewi. Supii. Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0. Vibrio cincinnatiensis.03 mm/hari (perlakuan B) dan 0. ukuran awal spat . DAN UJI PATOGENISITAS BAKTERI VIBRIO YANG DIISOLASI DARI LARVA ABALON SAKIT DI HATCHERI Zafran. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0. Namun. 0.69%. dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut. dan 21. sedangkan mortalitas pada kelompok kontrol hanya 3. B.Forum Inovasi Teknologi Akuakultur 2010 M 05 ISOLASI. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. Parameter yang diamati adalah laju pertumbuhan harian dan sintasan.44±0. Perlakuan yang diberikan adalah ukuran tebar 3. pertumbuhan.46±0. yaitu media spesifik untuk bakteri Vibrio.03 mm/hari (perlakuan B) dan 0.67%.33%.27±0. isolat-2.36±0.44±0.33% . KATA KUNCI: Pinctada maxima. tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya.55 mm (perlakuan C).85±0. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon.30±0. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia. dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13. Gondol. masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. Apri I.1 mm (perlakuan B). penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm.

Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. regional maupun lokal. Pantai Pengambengan khususnya. Gondol **) Fakultas MIPA Universitas Udayana ABSTRAK Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan.Forum Inovasi Teknologi Akuakultur 2010 M 07 KAJIAN POTENSI KELAUTAN UNTUK BUDIDAYA TIRAM MUTIARA (Pinctada maxima) DI WILAYAH PESISIR KABUPATEN JEMBRANA-BALI Apri I. dan Teluk Rabu. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari. akan tetapi jika diinginkan. Supii*). Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara. Teluk Awen. Berdasarkan hasil pengkajian. dan Sudewi*) *) Balai Besar Riset Perikanan Budidaya Laut. Ida Ayu Astarini**). tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Sumber Sari. tiram mutiara. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai. KATA KUNCI: potensi kelautan. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Jembrana . pada tingkat nasional. Pinctada maxima.

Rumput laut dikumpulkan dari Kabupaten Brebes.3 m. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu.42 mm pada botol. 4 m. Pengamatan panjang tunas. 3. 3 m. 2 m. 4 m. K. dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau. kepadatan eksplan.75%).1%.20. Maros ABSTRAK Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan.75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan. 1 m. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masingmasing dengan 3 kali ulangan. metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468. kandungan keraginan.3 m.40 mm pada stoples dan 2. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0. KATA KUNCI: Kappaphycus alvarezii. dan 5 m dari permukaan perairan.70%) daripada botol (90. Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0. Oleh karena itu. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. mengaplikasikan metode long line.1.6 juta ton per tahun pada 2014. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi.Forum Inovasi Teknologi Akuakultur 2010 LL 1 PERFORMANSI PERTUMBUHAN DAN KANDUNGAN KERAGINAN RUMPUT LAUT (Kappaphycus alvarezii) DENGAN APLIKASI METODE BUDIDAYA VERTIKULTUR Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau. Sedangkan jumlah tunas dalam stoples (7. di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan. pertumbuhan. Umumnya pembudidaya rumput laut. vertikultur LL 2 PERBANYAKAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN KULTUR JARINGAN MENGGUNAKAN WADAH YANG BERBEDA Siti Fadilah. Kappaphycus sp. yakni 0. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut. verrucosa. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver. sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker. 2 m. Maros ABSTRAK Produksi rumput laut ditargetkan meningkat dari 2. di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. 1 m. stoples .03). Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2.6 juta ton per tahun sekarang ini menjadi 7.50) lebih banyak dibandingkan dalam botol (7. 3 m. Jawa Tengah. jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. dan 5 m. Rosmiati. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut. KATA KUNCI: botol. Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut.70 dibandingkan dalam botol yang hanya 6. Eksplan diinokulasi ke dalam media cair yang diperkaya PES.

KATA KUNCI: Kappaphycus alvarezii.e dan stabil setelah jam ke9 sampai ke-12 s. promoter.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12. ZPT. mulai berpendar jam pertama – kedua setelah elektroporasi (s. transgenesis.Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT. b-actin. ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT. cytomegalovirus/ CMV. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. Utut Widyastuti***). jumlah kejutan: 4 kali dan interval kejutan: 0. Pola ekspresi keempat promoter relatif sama.e. Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. puncak jam ketiga – keenam s. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. panjang kejutan: 0. dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut.5 mili/second. Kappaphycus alvarezii Muh. Rajamuddin*). Rosmiati. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. Alimuddin**). Balai Riset Perikanan Budidaya Air Payau. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV. persentase sel berpendar rata-rata 10%. daya tahan penyakit. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0. Alias L.e). Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. dan St. Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas.Irvan Faizal****). dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. . Fadilah. Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) . Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. dan sumber karbon yang berbeda. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Sebagai tahap awal dalam rangka produksi rumput laut transgenik. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati. Keratin dan b-actin.1 second. Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%– 10%. Makassar **) Departemen Budidaya Perairan-FPIK.BPPT.

fusi protoplas . kappaphycus alvarezii.KATA KUNCI: mutu genetik. hibridisasi.

I Nyoman Radiarta. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. Kabupaten Pandeglang. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. KATA KUNCI: rumput laut. khususnya di Kecamatan Sumur. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. Pada umumnya. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. Pandeglang . Rekomendasi pencegahan penyakit. Erlania. Untuk itu. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. pembudidaya rumput laut. rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. taman nasional ujung kulon. kondisi sosek-ekonomi. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang. SIG. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. konservasi dan wisata). manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). dan status wilayah kawasan.

4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm). Pemeliharaan dilakukan selama 8 minggu. Perkembangan selsel embriogenik diamati pada kultur cair. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0. Andi Asdar Jaya*). Ridwan*).0 mg/L. Alias L. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%. adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus.8% dan 1.5 mm dapat dicapai dalam satu bulan kultur.0% menghasilkan persentase induksi kalus tertinggi (90%). 0. pada rasio IAA: kinetin (0.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0. Tahap (2) adalah regenerasi massa sel embriogenik somatik. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau. dan 0. 1.0:0.4 mg/L. kalus. dan 2. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0.5%). Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh. pengggantian media dilakukan setiap minggu dengan komposisi media yang sama.0 mg/L. embrio somatik.5:0. Pada tahap induksi kalus.6%. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati. Pada media cair.6% dan 0.0:0. dan 1. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0. embriogenesis somatik . KATA KUNCI : Kappaphycus alvarezii.6%. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii. Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen. 1. 0.0 mg/L.8%). perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0.0%. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Rajamuddin*). Makassar **) Balai Riset Perikanan Budidaya Air Payau. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya.2 mg/L) dengan konsentrasi agar media induksi (0.8%. morfologi. Pada tahap regenerasi massa sel embriogenik. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid.4%. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan. KATA KUNCI: keragaman.1:1. 0. Rosmiati. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis.1 mg/L) dengan konsentrasi agar (0.0:1.

protein. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau.143. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. A-2 (30% tepung rumput laut dan 70% tepung terigu). abu.780.13 ha dan 3. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. rasa. Hasnawi. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn . Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. 01-2973–1992 dan SII 0177–1990. produksi pada tahun 2008 sebesar 750 ton. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. denga metode budidaya tali panjang (long line). Mery Sukmiwati. kadar abu. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam pengembangan. dan berpengaruh nyata terhadap rupa dan tekstur. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu).Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. A-1 (15% tepung rumput laut dan 85% tepung terigu). Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. dan karbohidrat) dan uji organoleptik. aroma.24 ha. Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. KATA KUNCI: program-program pokok strategi pengembangan. rumput laut. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. Parameter mutunya adalah kandungan zat gizi (air. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. lemak. Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya.

85%. gizi. KATA KUNCI: rumput laut. uji organoleptik . crakers.

32 dan 113.02.30 dan 1. . bahan organik dan berat volume tanah. Maros ABSTRAK Kabupaten Mamuju. KATA KUNCI: kebutuhan kapur. Kebutuhan kapur untuk tambak di Kabupaten Mamuju berkisar antara 1.09 dan 90.15 dan 19. S POS .60 dan 36. Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95. Kapur S P KCl POSpertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur. S . dan Anugriati Balai Riset Perikanan Budidaya Air Payau.78% sehingga memiliki faktor konversi berturutturut sebesar 2.71 g/cm3 dengan rata-rata 0.614%.884 g/cm3 tanah berkisar antara POS dan S 0.28% dengan rata-rata 7. Kebutuhan kapur didasarkan pada tanah dengan POS nilai S mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur. tambak. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra POS S ALOS FOX AVNIR-2 akuisisi 28 Juli 2009.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI S POS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa.2 digunakan untuk pembuatan peta distribusi tanah. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat POS S dan berkelanjutan. pirit. ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0. Adang Saputra. Oleh karena itu. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan. S . Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. tanah.29 ton/ha 3 CaCO dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju. Rachmansyah. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Penelitian ini bertujuan untuk melakukan analisis . Peubah kualitas tanah yang diukur adalah: pH . namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. pH F . Program ArcView 3. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia.02% serta 44.36 dan 3.

Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. Maluku . Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan. inderaja.spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG). infrastruktur (jalan) dan sebaran penduduk. SIG. KATA KUNCI: budidaya laut. analisis spasial. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan. klorofil-a dan suhu permukaan laut).

konversi pakan serta pertumbuhan yang cukup baik. Evi Tahapari***). analisis komoditas unggulan dan andalan. rumput laut. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. udang dan bandeng. dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Jakarta **) Pusat Riset Perikanan Budidaya. Jakarta **) Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. dan Sularto***) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. udang. Hatim Albasri**). Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. Adang Saputra**). Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). Di samping itu. KATA KUNCI: produktivitas tambak. analisis komoditas. tambak terbengkalai. Introduksi kaji terap dilakukan dilahan seluas 2. rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara.400 m2 selama 3 bulan pemeliharaan. ikan patin. Sukamandi ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. peningkatan pendapatan. b a nd en g LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). dan analisis usaha perikanan. analisis location quotient. Kabupaten Brebes . KATA KUNCI: minapolitan. Wartono Hadie**). Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis.

50-0. Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. penutup/penggunaan lahan. Marsambuana Pirzan. Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. dan Kamariah Balai Riset Perikanan Budidaya Air Payau. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). N-total. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). padi (Oryza sativa). campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. pH . pH dan potensial redoks.75 m. tanah. nipah (Nypa fruticans). nipah. kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. tanpa vegetasi. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. nipah.75 m tanah vegetasi api-api. Fe. pirit. Al dan tekstur. bakau. TAA. Oleh karena itu. rumput. sedangkan yang dianalisis di laboratorium adalah pH FOX . Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. TSA. TPA. . masingmasing pada kedalaman tanah 0-0. bakau. pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent. Kualitas tanah yang diukur langsung di lapangan adalah pHF. A. KCl KATA KUNCI: keragaman. bakau (Rhizophora apiculata). 4PO .25 m tanah jenis penutup/penggunaan lahan api-api. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. rumput.50-0. Pada kedalaman 0. S . paku laut (Acrostichum aureum). Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah. Pada kedalaman 0-0.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. pesisir. Kabupaten Mamuju . sagu (Metroxylon sagu). rumput.25 m dan 0. kelapa (Cocos nucifera). OXS P KCl POS karbon organik. Hasil penelitian menunjukkan bahwa. sagu. S .

Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil. Sulawesi Barat .986 ha). Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. nitrat.000. pH. salinitas. amonia.046 dan 22. nitrit. KATA KUNCI: klorofil. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50.272 ha). pH. nitrat. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. tambak. nitrit.819 ha). Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. oksigen terlarut. KALIMANTAN BARAT Utojo. Akhmad Mustafa. amonia. tersebar di wilayah pesisir Kecamatan Sungai Pinyuh.000. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. Data lapangan (fisiko-kimia air dan tanah).047 dengan rata-rata 6. dan fosfat. dan bahan organik total. cukup sesuai (168. data sekunder. Pada umumnya yang tergolong sangat sesuai (114. Data sekunder yang diperoleh berupa data iklim. sedangkan yang kurang sesuai (213. fosfat. Sungai Kunyit.077 ha. KATA KUNCI: kesesuaian lahan. dan data citra satelit digital. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). Penentuan stasiun pengamatan dilakukan secara acak dan sistematik. dianalisis secara spasial dengan metode PATTERN menggunakan SIG. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. kualitas air. walaupun dengan model regresi yang berbeda.398 µg/L. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan. sedangkan peubah bebas adalah suhu. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil. Mempawah Hilir dan Mempawah Timur. Oleh karena itu. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia. tambak. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. terdapat di Kecamatan Segedong dan Siantan.

dan BOD5. Dunaliella. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. BRPBAT. dengan menggunakan cara modifikasi (Banerjee et al. kemudian 6. DO. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp. Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. KATA KUNCI: mikroalga. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya. Jakarta. penghitungan kelimpahan..02–8..00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6. 2006). Tidak terdapat perbedaan nyata (P>0. 2002 dan Dayananda et al. Kultur ini ditempatkan diluar ruangan. KATA KUNCI: makrobentos. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP.75).60% menggunakan perlakuan pelarut hexana. pH. Analisis kandungan minyak nabati Dunaliella sp. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda.. dilakukan di dalam bak. Spesies dominan adalah Limnaea sp. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung. Analisis data dilakukan secara deskriptif untuk komposisi jenis. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0. Parameter kualitas air yang diamati adalah suhu. Bogor. Chironomus sp. 5:4. indeks diversitas dan keseragaman spesies.. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9.5 mg/L. Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. kecerahan. minyak nabati . pupuk. Kultivasi Dunaliella sp. total bahan organik (TOM). ekstraksi. dan penghitungan dilakukan di laboratorium. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5. dan 6:3.0 sel/mL. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Proses pengayakan termasuk penyeleksian. dan Nematoda. identifikasi. kolam.).bak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy.

laju pertumbuhan.25/ hari pada indoor dan 3. rawan pangan. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. KATA KUNCI: ketahanan pangan. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. dan pH. KATA KUNCI: kepadatan. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. braunii.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan.33 sel/mL pada sistem indoor dan 7. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B.37. salinitas. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan.65/hari pada outdoor. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. Metode penelitian menggunakan metode survei. dengan skor 19. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12. Botryococcus braunii . Pengolahan data dilakukan secara deskriptif. Departemen Pertanian. Berdasarkan perhitungan statistik ANOVA. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. 02 sel/mL pada sistem outdoor. salah satunya adalah Desa Merakan di daerah Jawa Timur. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor.

Isti Koesharyani. kemungkinan merupakan strain yang tidak pathogen. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. tes katalase dan oksidase dilakukan sebelum uji PCR. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. Uji awal berupa pengecatan gram. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. penanganan aspek teknis. pengelolaan bisnis.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. penanganan aspek teknis. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. Bakteri merupakan salah satu penyebab penyakit pada ikan. aerolysin dan primer spesifik . Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. dan Balai Budidaya Laut (BBL) Ambon. KATA KUNCI: unit usaha. sehingga AH-26 merupakan isolat yang pathogen. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. KATA KUNCI: Aeromonas hydrophila. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. uji PCR. Sedangkan dengan menggunakan spesifik primer. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. Infeksi bakteri. strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. profitabilitas. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. pembudidayaan.

Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A).81 (ind/cm2) dan 0. Waduk Cirata .masing perlakuan 5 kali ulangan. Masing. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m). yaitu 4423. Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. kedalaman 2 meter (B). Winarlin. KATA KUNCI: kedalaman. Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae.Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti. periphyton. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar.91. Ani Widiyati.Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat.860. kedalaman 3 meter(C) dan kedalaman 4 meter (D).

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

dan Achmad Sudradjat*) Pusat Riset Perikanan Budidaya. 8 ppt (6–10 ppt).Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. telah banyak menginfeksi ikan nila. KATA KUNCI: strain. Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. sintasan. dan 12 ppt (11–15 ppt). Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). lebar 40 cm. KATA KUNCI: streptococcosis. Sidi Asih***). Jakarta **) Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. dan Sutisna Kuningan. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. ikan mas. Bogor *) ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. pertumbuhan . Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. salinitas.masing perlakuan menggunakan 2 ulangan. dan tinggi 40 cm dengan ketinggian air 15 cm. ikan nila. Hary Krettiawan*). perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. Majalaya. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas. Masing. Cianjur Wildan. sintasan terendah didapatkan pada salinitas 12 ppt. Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. Akuarium yang digunakan berukuran panjang 60 cm. responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*).

ikan belida yang banyak hidup di perairan umum Sumatera. termasuk jenis ikan karnivor. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan September. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. ekonomi. Jakarta ABSTRAK Ikan karnivor. KATA KUCI: ikan belida. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. KATA KUNCI: budidaya. dan kalimantan.36. Dalam hal dukungan dana permodalan.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan. anakan ikan nila . Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september .November 2009. Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya. dengan jangka waktu pengembalian modal selama 3. pakan. yang diberi sekat jaring nilon hita.20 siklus dan nilai RC ratio sebesar 1. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan.64 sedangkan FCR total sebesar 1. Pemeliharaan ikan belida dilakukan di kolam. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1.53. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain. Jawa. Iwan Malhani Al’Wazan.

Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva. Budidaya ikan nila dapat dilakukan di kolam. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. KATA KUNCI: ikan belida. yang dikenal dengan nama PKM (palm kernel meal). Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) Pusat Riset Perikanan Budidaya. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. Jakarta **) Balai Riset Perikanan Budidaya Air Tawar. kurang lebih 60% pengeluaran berasal dari pakan. jaring tancap dan keramba jaring apung. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. pelet maggot . palm kernal meal. Untuk menguasai teknologi domestikasinya. Dalam kegiatan budidaya ikan. Selama proses adaptasi pada kolam pemeliharaan. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. KATA KUNCI: ikan nila. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim.

25 – 1. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. Rasio konversi pakan 1.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. bakteri maupun berbagai jenis parasit.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. 05) tidak mempengaruhi sintasan. Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). sintasan. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. sedangkan kontrol hanya disuntik dengan PBS. Padat penebaran yang digunakan sebagai perlakuan adalah 100. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. 95 – 2. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan. Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. penyakit infeksi . dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. dan 200 ekor/m³.150. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1.bak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. baik disebabkan oleh infeksi virus. KATA KUNCI: pertumbuhan. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bak. 05. KATA KUNCI: vaksin bakteri. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. 65 g/ ekor. Masingmasing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Fris Johnny. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. Masing-masing perlakuan diulang 3 kali. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. Pendederan ikan kerapu macan. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. dan Zafran Balai Besar Riset Perikanan Budidaya Laut. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). Epinephelus fuscoguttatus.

Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 . Apri I.20.80.240.25-4. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. Ketut Suwirya. aspek biologi reproduksi .004. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. indeks somatik gonad dan diameter oocytnya. Supii.000 butir.520 µm. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut.000 butir. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. dan pada induk asal alam 20-92 % dengan SAI 2. Plectropoma laevis. Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. Tridjoko. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3. dan (B) Induk asal alam. dengan jumlah 8% biomass/hari.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. Kualitas telur yang dihasilkan relatif masih fluktuatif. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. KATA KUNCI: kerapu raja sunu. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2.450. Agus Priyono.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma.

Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. Himawan Tirta Yudha. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. tengadak albino. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). pertambahan berat. Kata kunci : Jaring apung. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi. dengan periode pemeliharaan120 hari. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya.A.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. tawes . Peubah yang diamati adalah sintasan. dibandingkan dengan perlakuan lainnya. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. pertumbuhan. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. total biomass dan biaya pakan. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. ikan tengadak. pertambahan berat. (1988). dan N. konversi pakan. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. Giri Balai Besar Riset Perikanan Budidaya Laut. Hasil penelitian menunjukkan bahwa laju pertumbuhan. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. Rudy Gustiano. KATA KUNCI: truss morfometrik. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan.

05).58%). Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi.14%–92. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan.8 mg/L).82%). dan Scirpus sp.86%–85. yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air).681mg/L) dan nitrat (0.82%). yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat). Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya. amonia (0. dan nitrat (37. Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen.lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8. nitrogen. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar. dan nitrat (11. karbofuran. tumbuhan air.32 %).05) dibandingkan kolam ikan kontrol (82.081–0.5 mg/L). KATA KUNCI: substrat. Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air. amonia (42. Kisaran persentase efektivitas penyisihan TN (28%– 58. akut.3 mg/L).5–14. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7. Perlakuan pada penelitian ini terdiri atas dua perlakuan. kronis . amonia (20.33%). khususnya ikan. Typha sp.). Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi. produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan. kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur.Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar.4%) pada kolam substrat 1 (pasir. juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut.7–1.4–0. Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0.5 mg/L).67%). amonia (0.5%–66. KATA KUNCI: toksisitas. yaitu TN (42. karena di samping harus efektif terhadap hama tanaman padi. Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat.36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0.11%–44. Untuk itu.849 mg/L) dan nitrat (0. Sintasan (93.5%–90. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan. pemakaian insektisida perlu dilakukan secara selektif.303–1.

limpa. 39 M1: T T dan primer M2: PreT (AATGGGCGCAAGCCTGATG) dan (ACCGCTACACCAGGAAT) digunakan pada penelitian 43 531 T ini.00 mg/L dan garam 4.000. yaitu (GCGAACGGGTGAGTAACACG) dan (TGCACACAGGCCACAAGGGA). namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. KATA KUNCI: ekstoparasit. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. Sensitivitas teknik diagnosa terhadap bakteri target. (f) garam 6. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis. (c) biji teh 20. (d) garam 4. Mycobacterium fortuitum PADA IKAN GURAME. Trichodina.00 mg/L (g) kontrol.00 mg/L. dan darah. dan Quadriacanthus kobiensis serta menimbulkan kematian. selanjutnya dibandingkan dengan teknik diagnosa melalui uji bio.00 mg/L. Dactylogyrus.kimia dan histopatologis. dan limpa. dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp.00 mg/L efektif untuk memberantas Trichodina dan monogenea.00–20.000.00 mg/L. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy). Ada beberapa bahan nabati dan alami yang dapat digunakan. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. Gyrodactylus. sedangkan preparat histopatologi diambil dari organ hati. serbuk biji teh dan garam. (e) garam 5. yang telah dikembangkan oleh 13 beberapa peneliti. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati.00 mg/ L. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain– Jenssen. (b) biji teh 15. Dua pasang primer. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar. Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar.00 mg/L.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar. Ketujuh perlakuan itu yaitu: (a) biji teh 10. ginjal. Hasil penelitian . Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit.000. Oleh karena itu. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya.00–6. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. Pada riset ini. sehingga upaya pengendaliannya sering terlambat. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut.

Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies. dan Polymerase Chain Reactio n . KATA KUNCI: mycobacteriosis. gurame.menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi. Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum. Mycobacterium fortuitum.

Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. masing.45 g/ekor.05). Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: fitase. B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. efisiensi pakan. rasio efisiensi protein. substitusi. namun nilai ini tidak berbeda nyata dengan 1. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang. Bogor. Cijeruk dengan bobot rata-rata 8.000. tepung bungkil kopra. KATA KUNCI: tepung bungkil kedelai. nilem.500 dan 2. efisiensi pakan.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0. dan tingkat sintasan. pakan ikan beronang. Balai Riset Perikanan Budidaya Air Tawar. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau.15±5.000 unit/kg pakan. Parameter yang diamati yaitu laju pertumbuhan spesifik. dan sintasan ikan beronang. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG. 1. 1.V. C.05) terhadap pertumbuhan.masing diulang tiga kali dan di desain dengan rancangan acak lengkap.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti.500. pertumbuhan.60±0. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra.000 unit fitase/kg pakan. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. S. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap. guttatu s . Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. 500. dan 2. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan.73 g dengan padat tebar 15 ekor/keramba. Hasil penelitian menunjukkan bahwa penggunaan fitase 1.

pelet. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif. Tjaronge Balai Riset Perikanan Budidaya Air Payau. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak. Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass.526.02 g.-/tahun/ha. pertumbuhan.2 mm dan bobot 0.05) dengan perlakuan yang lain. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur). Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. rajungan.04 ± 0. 100% ikan rucah jenis ikan tembang (Clupea sp. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap.). B.850. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus). Maros selama 40 Hari. Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan. 50% ikan rucah + 50% pelet. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis.2 ± 0. lebar karapas dan sintasan (P>0. sintasan . KATA KUNCI: budidaya bandeng. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut. KATA KUNCI: pakan rucah. Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. tambak. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot. 100% pakan buatan/pelet dan C. bobot dan sintasan serta kualitas air.Variabel yang diamati adalah pertumbuhan lebar karapas.

Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2.100. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B).9 dan 1154 kg/ha. Erfan Andi Hendradjat. Selama pemeliharaan.467. B/C rasio 1. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. ampas tahu. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1.masing perlakuan adalah 15. 55.-. masing-masing dengan dosis 2.98 g/ekor menjadi 232. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. 70.5 cm dan panjang tertinggi sebesar 3. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa).5 x 0. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran. 35. Pada akhir penelitian (hari ke 105). Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. masing-masing mencapai 986.5 cm (ukuran ekspor). KATA KUNCI: pupuk organik.0 cm.625% dan 60.5 x 0.6 cm . pupuk kandang dan dedak.816%.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara.5 m dan tinggi air 40 cm. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B).009 gram. masing-masing mencapai 56. Oleh karena itu.5 ton/ha. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2.0 cm dan bobot rata-rata 0. Nina Meilisza. Padat penebaran bandeng pada masing. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. bandeng. Sintasan bandeng pada perlakuan A dan B. produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. Produksi bandeng pada perlakuan A dan B. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. 20.43. dan 105 dan dianalisis secara deskriptif.

KATA KUNCI: benih botia. ukuran ekspor 1 inchi (2.5 cm) . pertumbuhan panjang.dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.

Depok **) Pusat Riset Perikanan Budidaya. ikan diberi perlakuan pemberian pakan alami yang berbeda. dan Irsyaphiani Insan**) Balai Riset Budidaya Ikan Hias.) Eni Kusrini*). Gigih Setia Wibawa*). pH 6. Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal.5 – 5.. Agus Priyadi*).0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar. Hasil penelitian menunjukkan bahwa perlakuan pH 7. pH pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur.00 dengan metode pemberian sekenyangnya (adlibitum).) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya. (B) Culex sp.01 g dan panjang total rata-rata 3.98 ± 0. Depok. Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5.05) terhadap pertambahan bobot rata-rata ikan. Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali.00. KATA KUNCI: air Melanotaenia sp. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp. gonad. Rendy Ginanjar. 12. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya. dan (C) Tubifex sp. namun tidak berbeda nyata (P>0.85 ± 0. memberikan pengaruh yang berbeda nyata (P<0. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi. Pakan diberikan tiga kali sehari yaitu pada pukul 8. (A) Chironomus sp. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. dan Culex sp.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar.0 – 6.0-8.50 ± 0.00 dan 16.0 – 8.32 ± 0. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula. dengan pertambahan bobot rata-rata sebesar 0.05) .Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP.8 (sebagai kontrol).0. memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp. Selama 45 hari pemeliharaan. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp.9 dan pH 7... Jakarta *) ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua.24 cm.09 g dan pertambahan panjang total ratarata sebesar 0.

pakan alami. pendederan. sintasan . pertumbuhan. KATA KUNCI: Benih ikan pelangi.terhadap rata-rata pertambahan panjang total dan sintasannya.

Rendy Ginanjar*) Asep Permana*).22% dan E. 25 ekor/liter.02 g. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara. Indonesia **) Institute Recherche Pour Le Developpement.05) terhadap pertumbuhan. 96.67%. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi. Depok **) Universitas Diponegoro. Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan.07%. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi. 30 ekor/liter dan E. Ikan uji yang digunakan adalah benih berukuran panjang 2. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia. Lili Sholichah*). padat tebar.81%. resirkulasi. 15 ekor/liter. B. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. D. Prancis *) ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. Marendra Gladiyakti**) *) Balai Riset Budidaya Ikan Hias. Pakan yang diberikan selama penelitian adalah nauplii artemia. Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan. . C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. Balai Riset Budidaya Ikan Hias Depok.13±0. 35 ekor/liter. 95.45%. 97. dan Jacques Slembrouck**) . sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). 20 ekor/liter. D. C. Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*). 96.67 mm. Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. pertumbuhan. B (2 ekor/L). 96.22±0. B. C. ketersediaan pakan dan padat penebaran. Sintasan dari masing-masing perlakuan adalah sebagai berikut: A.02 cm dengan bobot 0. KATA KUNCI: Metynnis hypsauchen. tetapi berpengaruh nyata (p<0. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A.

sintasan.KATA KUNCI: ikan botia. padat tebar .

Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. Migrasi terbagi menjadi migrasi vertical dan horizontal. temperature. memiliki mesin pelet. lunar. air tersedia dalam jumah yang cukup. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. salinitas dan arus. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. ketersediaan pakan dan pemasaran. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. dan homing atau reproduksi. Unit pengolah pakan memiliki prasyarat sebagai berikut. Kawasan Mina Pakan Mandiri. area penjemuran atau alat pengeringan pakan (drying). fisiologi dan tingkah laku dalam merespon perubahan lingkungan. memiliki bak kultur. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi.) . propinsi Jambi. Ikan Sidat (Anguilla sp. Unit produksi maggot memiliki prasyaratan sebagai berikut. biokonversi. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. KATA KUNCI: maggot. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. KATA KUNCI: Phenotipic plasticity. 2) unit pengolahan pakan dan 3) unit budidaya. Ikan migrasi. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). sedangkan factor eksternal yaitu. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. bahan pakan seperti vitamin dan dedak. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. Unit budidaya ikan memiliki prasyarat sebagai berikut. makanan. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. kolam budidaya dan manajement budidaya yang baik. memiliki bak untuk restokin.

Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik.40 mM dan 0. Jarak genetik 15 populasi persilangan berkisar (0. Aktivitas reduksi nitrat terjadi dari awal inkubasi. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri.mossambicus). Persilangan.26% – 63. nila BEST (Bogor Enhancement Strain of Tilapia). tetapi yang menghasilkan benih hanya 15 populasi. untuk mengamati variasi genetik benih persilangan ikan nila. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan. Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi. Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi. Sukamandi.15%).mossambicus). Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD). sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST. terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O.28 mM. Ikan yang di gunakan adalah hasil persilangan 4 strain. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif.h-1 dan 0.560). Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. Oreochromis niloticus . Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Didik Ariyanto.16 mM. dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.17 mM. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan . Hasil dari persentase polimorfik (berkisar 5. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*). Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. mujair (O. terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&). Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi. Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. mossambicus) Nunuk Listiyowati. jarak genetik.Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. NIRWANA (nila ras wanayasa). Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. Kata kunci: Randomly Amplified Polymorphic DNA (RAPD). juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut.236 – 0. Iman Rusmana**).h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. Selain itu. nila merah (Red NIFI).

nitrogen anorganik.dengan Pseudomonas aeruginosa. reduksi nitrat . Kata kunci: denitrifikasi.

Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.09% menjadi 4. bungkil sawit. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral. Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. 6 hari (D3).91% menjadi 15. UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma. KATA KUNCI: Bacillus sp. Osphronemus goramy. rasio inti sel:sitoplasma yang besar.37% setelah proses fermentasi. Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. KATA KUNCI: PGC. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi. Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). 4 hari (D2). Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia.) Priadi Setyawan1). Pada tahap pembentukan mata. Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. sebagai bahan baku pakan ikan patin. migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. fermentasi. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis.8%. Sukamandi **) Universitas Jenderal Soedirman.74% menjadi 5. distibusi. PGC terdistribusi secara berkelompok di bagian ventral. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia..37% dan meningkatkan kadar protein dari 13.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. Isdy Sulistyo2). nutrisi dan serat kasar . menurunkan lemak bungkil sawit dari 14.

) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil . integrasi. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor. dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal. kluster penetasan telur. Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. Jakarta ***) . Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. dan Labuan (Merak). Eni Kusrini****). salah satunya melalui Catfish Club Indonesia.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP. Wartono Hadie**). Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik. Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. demikian juga ditinjau dari segi higienis dan kesehatan benih. Depok ABSTRAK Ikan patin (Pangasius sp. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). Angela M. Lusiastuti***). pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. di antaranya daerah Bogor dan Subang. dan kluster pemeliharaan larva dan benih. patin.1994). Bogor ****) Balai Riset Budidaya Ikan Hias. dkk.Balai Riset Perikanan Budidaya Air Tawar. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi. dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk.. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. KATA KUNCI: UPR. Subang. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. Perbedaan dari kedua sistem ini adalah sifat produksinya. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. dengan masing-masing hatchery terpisah lokasinya. Tipe integrasi bersifat soliter. Jakarta **) Pusat Riset Perikanan Budidaya. Pengambilan data melalui responden dilakukan dengan cara purposive sampling. Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan.

sebagai materi kegiatan tahun mendatang. jantan fungsional. betina homogamet . sex reversal.persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. KATA KUNCI: ikan nilem.

Diketahui estimasi nilai heritabilitas rata-rata h²( + ) = 0. 10 butir/liter (perlakuan H). Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia. 15 butir/ liter perlakuan (I).27 pada ukuran konsumsi S D dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19. intensitas cahaya. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui. M H Fariddudin A. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva). kepadatan. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. KATA KUNCI: seleksi generasi. pH. sintasan dan kualitas air (meliputi suhu. Agus Priyono. larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih. Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar.57 % dalam satu generasi. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva. KATA KUNCI: sintasan. ikan mas strain rajadanu .1. oksigen terlarut/DO. Anang H K. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). amonia.2 gram. pertumbuhan. salinitas. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. dan nitrit).

penanggulangan. karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik.dan Tasikmalaya. dan Lila Gardenia Pusat Riset Perikanan Budidaya. bakteri probiotik. Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. Hambali Supriyadi.Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. penyakit streptococcosis . Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus). KATA KUNCI: antibakteri. Survei dilakukan di beberapa daerah yaitu Cianjur. eksplorasi. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). Klaten.

Kabupaten Pandeglang. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). Erlania.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. di perairan Panimbang Kabupaten Pandeglang. Teluk Lada. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. Secara umum. Provinsi Banten. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. Untuk menjamin keberlangsungan usaha budidaya kerang hijau. SIG. Kabupaten Pandeglang. Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. Pandeglang . dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. Hatim Albasri. budidaya laut. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. KATA KUNCI: kerang hijau. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang.

Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro.UPU Probolinggo (Jatim). Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*).Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. serta UPR yang mengembangkan usaha perbenihan udang galah. dan Spiranura sp. dan Jatim. dan kelompok ketiga ialah pembudidaya. Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan diferensial hemosit. Retna Utami**). Imron**).).. Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP.Forum Inovasi Teknologi Akuakultur 2010 pK 01 1. . Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol. Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan.Wartono Hadie*). Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP SamasYogyakarta. Jateng. BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. manajemen. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76..) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar.. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. Bali. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya. Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan..Bali. sedangkan dari kelompok protozoa adalah Epistylis sp. tingkat kesembuhan. Bali. BBAP Samas-Yogya(Jateng). KATA KUNCI: udang. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya. Ikhsan Khasani**). Carchecium sp. kelompok kedua adalah penghasil benih. kelompok kedua adalah penghasil benih..42%. dan kelompok ketiga ialah pembudidaya. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro. kelompok kedua adalah BBU Pamarican (Jabar). BBUG Klungkung. induk. Zoopthalmium sp. tingkat sintasan. Parameter yang diamati meliputi pemeriksaan parasit. Vorticella sp. padahal permintaan cukup besar. Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp. dan Opercularia plikatilis.

).KATA KUNCI: huna (Cherax sp. tembakau (Tobacum nikotiana) .

salinitas rendah.2 %. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Pemeliharaan dilakukan selama tiga bulan. Hewan uji yang digunakan adalah udang vaname PL-48. yaitu menggunakan tingkat teknologi tradisional plus. dan Wartono Hadie Pusat Riset Perikanan Budidaya. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. produksi 81. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. tokolan.n pengapuran sebanyak 175 kg/petak. Idil Ardi.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35. KATA KUNCI: vaname. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. produksi 78. Kecamatan Cilebar. produksi . namun polikultur udang vaname dan rumput laut masih kurang informasinya. namun berbeda tidak nyata (P>0. Gracilaria verrucosa. KATA KUNCI: udang windu. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang.500 m2 digunakan untuk percobaan. Karawang. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2.66% dan 108. pemberantasan hama. masing-masing dengan dua ulangan. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. Penelitian ini dilakukan pada tambak di daerah Betok Mati. penebaran dilakukan setelah satu bulan dari penebaran tokolan. pengeringan.22% dan 72.1 kg dan kelangsungan hidup 11. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. Setelah dua hari.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi.6 kg/ha. pada bulan pertama udang tidak diberi pakan. dilakukan pengolahan tanah tambak.000 kg/ha rumput laut. Dari pemeliharaan udang selama tiga bulan. pengapuran dan pemupukan. Empat petak tambak masing-masing berukuran 3. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. yaitu pertambahan berat rata-rata 230 g.5 g. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak.8 kg dan kelangsungan hidup 100 %. polikultur. sedangkan pada dua bulan berikutnya diberi pakan pellet udang.84 kg/ha. Sebelum penebaran. survival rate. Dengan teknologi yang diterapkan. kemudian dikeringkan sekitar satu minggu.

masing-masing dengan 3 ulangan. Pada budidaya udang vaname pola tradisional plus.6 m sebanyak 12 buah. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. Polychaeta. Dinophyceae. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. Pada budidaya udang windu intensif.3 g dengan padat tebar 50 ekor/bak. pola intensif. dan Cyanophyceae. indeks keseragaman menunjukkan komunitas plankton pada . Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0. dan perlakuan D = tanpa sumber karbohidrat. dan Rotatoria. kotoran. 25.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. perlakuan C = tapioka. pola tradisional. pelakuan B = sagu. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. Hal tersebut perlu mendapat dukungan dari penelitian. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. dan metabolit udang. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. KATA KUNCI: tepung tapioka. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. menggunakan bak kayu ukuran 1 m x 1 m x 0. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus.05) terhadap kelimpahan dan jumlah jenis plankton.

udang windu . indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil. KATA KUNCI: plankton. probiotik.perlakuan D relatif lebih merata dibanding perlakuan lainnya.

Nitzschia. NO .05) terhadap jmlah jenis dan kelimpahan plankton. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol.000 ekor/petak). indeks keragaman. suhu. namun berpengaruh tidak nyata (P>0. Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing- . Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. setiap 15 hari.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton.05) pada sintasan dan produksi udang vaname. oksigen terlarut. Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin. dan indeks dominasi plankton selama pemeliharaan udang windu. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. dan perlakuan C = dedak padi halus. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. pertumbuhan. B = 2 mg/L. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea. serta Oscillatoria dari kelas Cyanophyceae. indeks keseragaman. pH. Abdul Malik Tangko. dan produksi udang vaname. sintasan. dan Pleurosigma dari Kelas Bacillariophyceae. Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. PO . NO . Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas. sintasan. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. perlakuan B = kotoran sapi. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0. KATA KUNCI: probiotik.5 m dengan volume air 400 L.05) terhadap pertumbuhan udang vaname. C = 4 mg/L. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. BOT. Hasil penelitian menunjukkan perlakuan berpengaruh tidak 4 2 3 nyata (P>0.

199–1.362). pupuk organik.427).masing: indeks keragaman (1.324– 0. udang windu. indeks keseragaman (0. KATA KUNCI: dinamika plankton. tambak .689–0.780) dan indeks dominansi (0.

Perlakuan yang diujicobakan dalam penelitian ini adalah A. Substrak tanah tambak.8±0. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak. masing-masing dengan dua ulangan.sedangkan pada perlakuan A dan B masing-masing 2. substrak tanah sawah. Penelitian dilaksanakan pada tambak ukuran luas 4.14 dan 2. dan substak tanah lumpur.. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan. biaya produksi.6.650.0±5. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak.01 g.24. Substrak tanah sawah. KATA KUNCI: substrak. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0.. biaya pakan pada perlakuan A dan B masing-masing Rp 11. umur pemeliharaan.. budidaya.239.03±0. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak). Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau.634. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak.3±1. di mana masing-masing perlakuan diulang tiga kali.05) antara perlakuan substrak tanah tambak.2 cm dan bobot awal 0.5 dan 21. udang pama. B. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A). Substrak tanah lumpur. Machluddin Amin.984.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2. udang windu .dan Rp 19. Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan. dan C. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau. KATA KUNCI: efisiensi.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru.875. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka.

15%. dengan rata-rata berat 11. dengan rata-rata berat 12.28-13. B).61%.86 g/ekor.5 m dan 1 m.3 ± 7. namun tidak berakibat terjadi kematian massal.6813.7 kg/500 m2 = 320 kg/ha. Maros.45 kg/bak atau rata-rata 12.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. kisaran produksi 9.7%. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar. 1. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali.7%. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang.767. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2.235 kg/ha).4 ± 0. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan.92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90.2 ± 13. Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48.86 kg/bak (8. kisaran produksi 12. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60.975 dan lebih .6 kg/500 m2 = 406 kg/ha. ukuran 80 sampai dengan 96 ekor/kg). Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25.2 kg/500 m2 = 506 kg/ha. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C).1 ± 13. lebih tinggi daripada perlakuan B = 41. pertumbuhan udang. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91.998. ukuran 84 sampai dengan 89 ekor/kg) dan C (16. di mulai setelah satu minggu penebaran.3 ± 5.64 kg/bak atau rata-rata 11.66 g/ekor. Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah. Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.66 kg/bak (7. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20.masing bak mempunyai ukuran panjang. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. Namun demikian. Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B).7% dan perlakuan C = 36. masing. fermentasi probiotik. KATA KUNCI: tepung tapioka.0 ± 2. lebar dan kedalaman secara berurutan adalah 10 m.

rendah dibandingkan perlakuan B yang mencapai 1. salinitas rendah . udang vaname.325. KATA KUNCI: molase.

yaitu probiotik A (mengandung bakteri Bacillus sp. Pemberian probiotik A memberikan pengaruh terhadap rata-rata . Q. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6. 10 ‰. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah.) dan probiotik B (mengandung bakteri Bacillus polimyxa. karena secara alamiah larva hidup di periran bersalinitas. Pemberian bakteri dengan konsentrasi 0. 85%. Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang.Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.. Nitrosomonas sp. Dengan meneliti dua jenis probiotik. Pemberian probiotik A dengan konsentrasi 0. 1995). Masing-masing perlakuan diulang sebanyak empat kali. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol).003 mL/L.75%. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F. Parameter yang diukur adalah kualitas air.75%–68. Pemberian probiotik B dengan konsentrasi 2.). dan R. Pengaruh perlakuan terhadap sintasan.001 mL/L. 85%.5 mg/L. sintasan. C.50%.) yang berukuran PL-20. dan kontrol 66. B. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan.001 mL/L menghasilkan sintasan sebesar 81.. Penelitian II pengujian probiotik B. 88%. sebagai dasar perbaikan sistem penyediaan larva udang galah. sedangkan juvenil dan udang dewasa hidup diperairan tawar.6±0. Pemberian bakteri probiotik A (Bacillus sp.25%. KATA KUNCI: salinitas. waktu inkubasi.3±1. laterosporus. sebelum diaplikasikan di tambak. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. dan D. diikuti perlakuan 5‰ sebesar 10±0.15. 5 ‰. Pemberian probiotik B dengan konsentrasi 5. Kontrol (tanpa pemberian probiotik B). Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata.25%. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. Rhodococcus sp. dan Rhodobacter sp. dan tiga ulangan. Penelitian I adalah pengujian probiotik A. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji.0 mg/L.57 hari . Nitrobacter sp. Tingkat sintasan yang diberi probiotik B berkisar antara 63.. Pemberian probiotik B dengan konsentrasi 7.002 mL/L. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab. dan pertumbuhan udang. Kontrol (tanpa pemberian probiotik A). apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz. P.. sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. terdiri atas: O. Pemberian probiotik A dengan konsentrasi 0. Universitas Padjadjaran. terdiri atas: A.5 mg/L. Aplikasi probiotik setiap tiga hari sekali. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter). Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL).) berpengaruh nyata terhadap sintasan benih udang windu. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62.0 hari. udang galah. dan 0‰ sebesar 11. B. Pemberian probiotik A dengan konsentrasi 0.

udang windu. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. KATA KUNCI: probiotik. sintasan.pertumbuhan mutlak benih udang windu. kualitas air. pemberian dengan konsentrasi 0.4255–0.8935 g).3660 g.4440 g dan kontrol 0. Ratarata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0.001 mL/L menghasilkan pertumbuhan tertinggi (0. pertumbuhan .

pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi.05). diantaranya karakteristik templat DNA genom yang meliputi kemurnian. 20 ppt. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. PCR. 15 ppt. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0.09 cm. dan 20 ppt sintasan dari post larva udang galah mencapai 100%. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau. Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3). Selain itu. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. sedangkan sintasan pada perlakuan 25 ppt mencapai 61. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sukamandi. salinitas. yaitu templat dengan berat molekul tinggi (1). Hasil yang diperoleh adalah pada salinitas 5 ppt. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 15 ppt. konsentrasi. KATA KUNCI: Macrobrachium rosenbergii. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor. 10 ppt (kontrol). Guna mendukung prgoram revitalisasi tambak. KATA KUNCI: pertumbuhan.67%.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH.33±0. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 25 ppt. udang galah . Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. Ditinjau dari keragaan pertumbuhan. dan ukuran templat. 10 ppt.92±0.13 cm dan 1.

66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. Pakan diberikan dua kali sehari selama penelitian. Dari pencapaian bobot ini. pemberian pakan. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. Sintasan yang diperoleh pada penelitian ini yakni 52%–54. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan. Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. baik pertumbuhan bobot. kepiting lunak . kepiting bakau. maupun lebar karapas (P>0. Oleh karena itu. KATA KUNCI: pergantian kulit.5%. KATA KUNCI: kepiting bakau. Sulaeman.Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. manipulasi lingkungan.05). Berdasarkan persentase. dan gabungan keduanya (C). panjang. ikan rucah (B). Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen. perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet.

data yang diperoleh dibahas secara deskriptif. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. rumput laut dengan kepadatan 1.5 bulan dengan panjang dan bobot masing-masing adalah 8. Peubah yang diamati adalah pertumbuhan lebar karapas. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. sehingga perlu riset budidaya rajungan pada musim kemarau. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1. sintasan. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya.000–1. Ikan bandeng yang digunakan adalah gelondongan umur 1. produksi .05±0. dan produksi serta parameter kualitas air.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh.573. tambak bersalinitas tinggi. Hasnawi.7 cm dan 4. pertumbuhan.000 m2. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari).Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa.02 g dengan kepadatan 1 ind. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. Tambak yang digunakan berukuran 10. KATA KUNCI: rajungan.100 pohon/ha.2 ± 2. Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan. sintasan. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi.2 mm dan 0.2 g. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰— 4 9‰) mengakibatkan sintasan dan produksi rendah./m2. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan. dan pelestarian alam.0 ± 2. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. KATA KUNCI: kerapatan hutan mangrove.04 ha. jumlah permudaan 450–500 pohon/ ha. Tambak ditebari benih rajungan. perlindungan. restoking kepiting bakau.1±0. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1. Dibalik manfaat mangrove yang demikian banyaknya. bobot. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi.000 ekor/ha ukuran crablet-30.300 pohon/ha dengan rata-rata 1.

Provinsi Gorontalo. Untuk memfokuskan kegiatan budidaya rumput laut. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. SIG. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0. DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. KATA KUNCI: Danau Maninjau. Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). KATA KUNCI: minapolitan. Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. Adang Saputra. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). rumput laut. logam berat . Secara umum. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. Kappaphycus alvarezii. kondisi perairan sangat mendukung pengembangan budidaya rumput laut. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. I Nyoman Radiarta.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT.03 mg/L.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. layak. Anjang Bangun Prasetio. Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya. Secara umum. bioakumulasi. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. cukup layak dan tidak layak. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut.

mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. inlet. indeks keseragaman berkisar antara E=0. TSS. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. Subang. dan plankton dilakukan seminggu sekali.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. Perifiton yang terdapat di Tambak Blanakan. Adi Hanafi. Nitzschia sigma. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. Subang. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet. Indeks keanekaragaman berkisar antara H’=2. dan Erlania*) *) Pusat Riset Perikanan Budidaya. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom. kimia. Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. Kualitas kimia air untuk pH. Sampling air secara regular untuk pengamatan fisika.962. 20 dan 30. sedangkan indeks dominansi berkisar antara D=0. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. alga hijau biru dan alga hijau). Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling.853. GONDOL-BALI Apri I. Supii. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. SUBANG Joni Haryadi*). Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah.0760. BBRPBL Gondol .7112.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. KATA KUNCI: kualitas air. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. DO. nitrit. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air.814-0. KATA KUNCI: alga perifiton. N. Dara Kasih**). tambak. outlet.085.

Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP. Perlakuan adalah pemupukan dengan perbandingan N. volume air 500 L.dengan produksi Moina sp. Pengukuran N dan P dilakukan pada ikan dan pakan. yang terdiri atas: 9 jenis pakan untuk ikan mas. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan.89. P. Parameter yang diamati adalah jenis.21%). KATA KUNCI: limbah. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g.16 g. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp. ikan nila (3. Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan.96 ±1. KATA KUNCI: konversi pakan. dan 1. dan 3). dan bawal adalah 1.88–1. Ani Widiyati. yaitu: ikan mas (5. Bogor. 1. indek dominasi. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi. nila (Oreochromis niloticus) dan bawal (Colossoma sp.58%–13. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP.23%–6.63% dan 10. dan keanekaragaman plankton.78%).900 g sedimen + 20 g TSP. limbah hara N dan P .53%–15. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio).89% dan 11. akuaponik.89%–17. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp.83– 1. Panen Moina sp. K = 16:20:0.48%–9. 1. dilakukan pada hari ke-8 sejak dilakukannya penebaran. Data dianalisis secara deskriptif.) di laboratorium.73–1. 2). Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung.87.. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur. Kusdiarti. kelimpahan.90. ikan nila. serta produksi Moina sp. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP .53%) dan ikan bawal (8.71%– 10.17% dan 8.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin. 9. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm.

diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. N14G (3). Taukhid*) Balai Riset Perikanan Budidaya Air Tawar.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*). agalactiae. . sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. Budidaya rumput laut khususnya Kappaphycus sp. Oreochromis niloticus. namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya.1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. 4. Oleh karena itu. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya.6 juta ton per tahun pada 2014. agalactiae setelah dilakukan uji Postulat Koch. Postulat Koch. Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit.6 juta ton per tahun sekarang ini menjadi 7. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian. Hasil yang diperoleh. dan NK1 (5) yang berasal dari organ otak. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S. N17O (4). Sukenda***). sehingga dapat meminimasi kegagalan panen. Isolat 1. Bogor **) Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir. KATA KUNCI: Streptococcus agalactiae. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani PongMasak Balai Riset Perikanan Budidaya Air Payau. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. N4M (2). Produksi rumput laut ditargetkan meningkat dari 2. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. di laut dan Gracillaria sp. khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. mata. dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah. Esti Handayani Hardi**).

pencegahan . hama.KATA KUNCI: rumput laut. penyakit.

Petrus Rani Pong-Masak. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian. dan Makmur Balai Riset Perikanan Buddidaya Air Payau. Mudian Paena. bahan organik total 37. Syarifuddin Tonnek. karakteristik. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka.95 ha. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1. analisis hierarki proses.30 ha dan tidak sesuai 3.09 mg/L. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara. suhu 29.0008–0.90 ppt. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang.Indra Jaya Asaad. nitrat 0.10– 36.0032–0.039–0. Pengumpulan data primer dilakukan dengan cara wawancara mendalam.02–9. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka.32 ha. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar.3 meter.85 mg/L. Penelitian ini bertujuan untuk mengetahui potensi. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya.695. .57°C–30. fosfat 0.0037 mg/L. kurang sesuai 2. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. dan total suspensi <25–80 mg/L.01169 mg/L.81–6.820. dengan tingkat kesesuaian lahan sesuai 21. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau.1113 mg/L. oksigen terlarut 5. Kabupaten Kepulauan Selayar.0267–0.66°C.685 mg/L.33 ha. Kata kunci : Opsi pemanfaatan wilayah pesisir. KATA KUNCI: potensi. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27.38–44. demikian pula dengan karakteristik físika dan kimia oseanografinya. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis. nitrit <0. Rachman Syah. kedalaman 1–40 meter. Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir. besi 0.095. pH antara 6. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan.1–8. kesesuaian rumput laut. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden.610. salinitas 36.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI.37. KARAKTERISTIK.

kandungan oksigen telarut. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. Kata kunci : kualitas perairan. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. faktor teknologi budidaya. pH. PO4 dan Fe. KATA KUNCI: keramba jaring apung. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. Makmur. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. NO2. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. A. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. Rachman Syah. salinitas. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. NO3. tambak. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor. yaitu : faktor infrastruktur dan kondisi perairan. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. Cakupan wilayah penelitian meliputi Teluk Hurun.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. NH3.Indra Jaya Asaad. Parameter kualitas perairan yang diamati adalah suhu. konduktivitas. Utoyo.Indra Jaya Asaad. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. Muhammad Chaidir Undu. analisis faktor. Kabupaten Pontianak . dan faktor pasar. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat.

analisis fisika-kimia . dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15.44%.1% selama 60 menit. rasa.0%.25% dan dendeng dengan bumbu ekstrak sebesar 59. 28. natrium alginat. setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. TVB. dan tekstur) menggunakan skala hedonik. kapang) dan rendemen. kadar abu. KATA KUNCI: pengeringan.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. bau. dan protein masing-masing sebesar 14. KATA KUNCI: ikan sidat. abu. Rumput laut coklat setelah dipanen. Kadar air. 7. dan pH). abu. lemak.04 mgN% dan 6. dan dijemur di bawah sinar matahari selama 18 jam. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air. dan viskositas natrium alginat).26%. dan 28. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya.32%.97%. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. dan rendemennya 37.663 cps. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). Selanjutnya. dendeng.1%. Jakarta **) Pusat Riset Perikanan Budidaya. protein lemak. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna.46%. dan mutu natrium alginatnya mempunyai kadar air 19. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat.4%. Sedangkan nilai TVB dan pH masing-masing sebesar 21. kemudian direndam dalam larutan KOH 0. mikrobiologi (Angka Lempeng Total/ALT. kadar abu 19. dicuci dengan air bersih. rendemen. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk. kimiawi (kadar air.41%. terbuka di atas lantai pada suhu ruang (sekitar 30°C). rumput laut coklat. dan dijemur di bawah sinar matahari selama 18 jam. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempahrempah kasar dan halus (ekstrak). Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik. Kelompok kedua ditebar di atas lantai dengan beralaskan waring. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. Rumput laut coklat dibagi menjadi dua kelompok. viskositas 8.0%. Rendemen dendeng sidat dengan bumbu kasar sebesar 57.

Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. polusi air. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. Identifikasi faktor-faktor pendorong maupun faktorfaktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya. Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. kelembagaan yang menunjang. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. agribisnis perikanan . Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. prasarana fisik yang kurang mendukung. pengalaman petani ikan dan Kebijakan Pemerintah. serta ketersediannya dalam skala kecil. Metode yang digunakan adalah studi kasus. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. kekurangan modal. Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. Faktor pendorong yaitu ketersediaan air yang melimpah. KATA KUNCI: potensi desa. harga ikan yang tergantung pembeli dan cuaca.

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->