Forum Inovasi Teknologi Akuakultur 2010

ABSTRAK PRESENTASI ORAL

Forum Inovasi Teknologi Akuakultur 2010

FF 01
PERFORMA IKAN NILA BEST DALAM MEDIA SALINITAS
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: =2,1±0,23; W = 7,0±0.29; = 139,8±6.72; 7,5ppt = 2,3±0.06; 0ppt 0ppt 0ppt L B L W7,5ppt = 8,2 ± 0,42;7,5ppt = 164.3 ± 8,46; 5ppt = 2.3 ± 0,21; 15ppt 7.8 ± 0,45; B = 155,6 ± 8,95. Pengamatan setelah W B L1 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-5 : 4,0±0,34; 3: 4,8±0,27; 5- : 7,4±0,35; 5: 9,2±0,98. 5 15ppt8 0ppt8 15pptPengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
0ppt 15ppt

KATA KUNCI:

nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
PENGUJIAN LANGSUNG EMPAT STRAIN IKAN NILA (Oreochromis niloticus) PADA SALINITAS 40‰
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen ) dengan 8 ulangan dari masing-masing strain. Analisa 50 (LT data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise

Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata 50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru LT (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT
50

1952 dan jarak genetik antar populasi 0. KATA KUNCI: RAPD. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. ikan nila. dengan menggunakan primer OPA-03.) DENGAN ANALISA SIDIK RAGAM RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD) Iskandariah. Sebagai perlakuan 0 adalah A (tanpa penambagan S. dan A (penambahan S. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. A (penambahan S. cereviceae 3%). dan OPC-15.5797. genetik. dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. cereviceae 2%). lokal Kuningan. dengan nilai heterozigositas 0. Universitas Padjadjaran ABSTRAK Penelitian ditujukan untuk menentukan persentase terbaik dari S. dan lokal Bogor. fermentasi.3333%–46.6667%. cereviceae sebagai perlakuan dan lima kali ulangan. cereviceae 1%).0351–0. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13. nila merah FF 04 ANALISIS KERAGAMAN GENETIK LIMA POPULASI NILA HITAM (Oreochromis sp.1765– 0. Pertumbuhan terbaik diperoleh pada penambahan S. pakan buatan. OPC-14. Oreochromis . Bogor ABSTRAK Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi. populasi. OPA-04. A (penambahan S. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD). cereviceae). Otong Zenal Arifin. 1 2 3 Hasil penelitian menunjukkan penggunaan S. Gesit. Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor.Forum Inovasi Teknologi Akuakultur 2010 FF 03 PENGGUNAAN Saccharomyces Cereviceae PADA FERMENTASI PAKAN BUATAN UNTUK MENINGKATKAN PERTUMBUHAN NILA MERAH (Oreochromis Niloticus) Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan. cereviceae sebesar 2% KATA KUNCI: Saccaromyces cereviceae. Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. Nirwana. Populasi yang diamati meliputi jenis nila BEST.

agalactiae secara intra peritoneal pada ikan uji sebanyak 0. Pada perkembangannya. seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. Tetapi setelah uji tantang. Budidaya Perairan. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. Data sintasan (Survival Rate. Komar Sumantadinata**).1 mL/ekor.81% dan 83. diferensiasi kelamin. Hasil yang diperoleh bahwa sel utuh (whole cell) S. SR).Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. XY. Uni Purwaningsih*). Untuk kontrol. 106. titer antibodi. agalactiae pada tingkat kepadatan 108. ikan nila . agalactiae. KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. Kata kunci : Ikan nila. DAN YY Didik Ariyanto*). Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. S.01%.55% sedangkan genotipe XY dan YY masing-masing sebesar 79. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. 106. KATA KUNCI: vaksin sel utuh. Pada uji tantang setelah minggu keenam. Pada akhir pendederan dilakukan identifikasi jenis kelamin. Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108. pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan. pengukuran bobot individu rata-rata dan penghitungan sintasan. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. Oreochromis niloticus Angela Mariana Lusiastuti*). pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. Sukamandi **) Dept. tidak cukup untuk memberikan protektif terhadap S. yaitu genotype XX. Genotipe XX mencirikan betina dan XY untuk jantan. agalactiae. Selain ditentukan secara genotipe. XY. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. genotipe. limfosit perlakuan tidak berbeda nyata dengan kontrol. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). ikan uji disuntik dengan PBS. dan differensial leukosit dilakukan analisa sidik ragam (Anova). 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga. Perlakuan dengan injeksi sel utuh S. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. dan YY melalui evaluasi nisbah kelamin yang dihasilkan. titer antibodinya menurun. Fakultas Perikanan dan Ilmu Kelautan.

Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). D=102 cfu/mL dan E=kontrol). Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. KATA KUNCI: Streptococcus agalictiae. Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. dengan variasi perbedaan kepadatan bakteri vaksin (A=108. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. pemanasan. Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. terutama dalam hal manajemen pemberian pakan. BOD. adalah septikemia dan meningoencephalitis.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. dan Joni Haryadi Pusat Riset Perikanan Budidaya. serta data status kegiatan 3 2 3 budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. B=106. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. DO. turbiditas. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. total nitrogen. pH. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. Selain itu. Pemberian pakan tidak boleh berlebihan. Selain itu. NO . TDS. NH . Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0.5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. karena pada kondisi perairan yang kurang .5). Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. Angela Mariana Lusiastuti. C=104. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. NO . Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. ortofosfat dan total fosfat. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). kecerahan. Anjang Bangun Prasetio. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih.

keramba jaring apung (KJA).baik akan menyebabkan stres pada ikan. KATA KUNCI: manajemen pakan. lingkungan perairan . Danau Maninjau.

dan sintasan(1.21%). tebal (-1. tidak berbeda nyata (P<0. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat. lebar (0.64% bobot badan (bt)/hari.74%). Sukamandi selama lima bulan. tebal (0.65%). Parameter yang diamati meliputi keragaan pertumbuhan (panjang. tebal. Komar Sumantadinata**).06%). tinggi (3. bobot) dan sintasan. Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.48%).48% bt/hari dan 2. tinggi. bobot ( -2. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.82%).05) bila dibandingkan dengan dua populasi lainya. Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia). Sukamandi **) Dept. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74. SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2. Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49.20%. oreochromis niloticus .87%) dan sintasan (0.53 % bt/hari. persilangan. Nunuk Listiyowati. bobot (-2. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2. IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi. KATA KUNCI: heterosis.94%). Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4. Budidaya Perairan.35% bt/hari.Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*).22%).80%.44%). Fakultas Perikanan dan Ilmu Kelautan. Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (2.

Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin.0678 (1. dan nilai terbesar dimiliki oleh bakteri S. 72.5094 (2. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S. 50 KATA KUNCI: toksisitas. Penelitian dilakukan di Instalasi 50 (LC Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung.8532).8090) dan benih ikan nila 5.9823–4.1100). Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). N17O. pemanasan. 48. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila.0430 (4. 1. Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan. agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik.13 dan 1.0839(2. . agalactiae (N3M.7877–2. 48.08 g. dan sonikasi. dan 96 jam terhadap benih ikan mas adalah 4.5480). Bogor.1295). SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA. 0. benih ikan. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak. Data diolah dengan analisis probit program LC50. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration ) 24. Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp. 3.55±0. Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan.0930).5805).9421 mg/L (1. Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis.6297–0.6904– 5.6578–2. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN. 3.7504). Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran. Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar.81±0. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. 48.6799–13. 50 LD iniae (N2O). dan 96 jam. dan 96 jam.9237(0. NK1) dan 1 isolat S. N14G. uji stabilitas dan LC50–24.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah. iniae (N2O). 72. Hasil penapisan menunjukkan bahwa bakteri S.4227– 4. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1.8101–1. N4M.7138 mg/L (0. Hasil penelitian menunjukan bahwa Nilai LC 24. 0. 2.3354 (3. agalactiae (N4M) memiliki nilai terkecil. Konfirmasi taksonomis hingga level spesies isolat bakteri S.

KATA KUNCI: penapisan. ikan nila . streptococciasis. vaksin.

sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g.53 N/cm atau 138. simetris. Dalam pembesaran.66%. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU.masing mencapai ukuran 127.184. namun sintasannya masih rendah yaitu sekitar 1%–3%. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.46 N/ cm2 atau 222. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. kekuatan regang (kemuluran) 66. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu.00 sampai jam 03. kekuatan tarik 2. KATA KUNCI: bahan penyamak kron. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. 103. dan sebagainya.5 kg. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. Telur yang ada dalam kolektor dapat diambil jam 07. Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek.2 g. Ikan ini relatif sensitif dengan perubahan lingkungan. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat.00–08. Pembenihan ikan ini mulai berkembang di sekitar Gondol. lemas. garmen.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi. kambing dan ikan pari yaitu berisi.94%.76 kg/cm2. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi). kadar abu 2. dan cacing.12 kg/cm. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek.93% dan kadar Cr O 1. dan 102. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya.62%. Waktu pemijahannya sekitar jam 24. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan. tas. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa . dan corak permukaannya spesifik. liat. kekuatan jahit 1. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1. dan 15% . untuk dijadikan kulit tersamak. sarung tangan. kambing.97% sehingga sangat prospektif untuk 2 3 dijadikan barang-barang kerajinan kulit. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20. Nusa Tenggara Timur.354. benedinia. sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. kadar air 13. dan 80 ekor/m3 selama 5 bulan masing. kadar lemak 6. kakap putih.00 pagi hari. suhu kerut 88°C. Selain itu. karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi.5 g.0 g. yang merupakan limbah perikanan dari perusahaan filet ikan. dan Sumatera. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih. Sulawesi. 40. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih.0–3. dompet.00. 10%. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. Ikan ini mudah terserang parasit seperti cryptocarion.

Tenggara Barat. pembesaran. KATA KUNCI: pembenihan. kerapu sunu .

Namun demikian. ikan kerapu tikus . Situbondo **) Fakultas Perikanan dan Kelautan. mikroinjeksi. Cromileptes altivelis Slamet Subyakto*). jumlah kejutan 5. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. mikroinjeksi. Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. KATA KUNCI: transfeksi. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. dan Gemi Triastutik*) *) Balai Budidaya Air Payau. Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. 2. dan 3 detik. Sasmito Jati****). sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. transfer gen. Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. hormon pertumbuhan. lama kejut 30 ms. Metode elektroporasi dilakukan dengan voltase 50 V.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. mikroinjeksi. Komar Sumantadinata***). Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. Alimuddin***). Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. dan 20 µg/ mL.1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). elektroporasi. jarak waktu antar kejutan 0. Ratu Siti Aliah*****). 10 µg/mL. Rustidja**). M. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. Irvan Faizal*****). di antaranya Indonesia. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1.

00%) yang baik bagi benih kerapu sunu.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan. yaitu 5%. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total. C (probiotik). KATA KUNCI: larva kerapu sunu. Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan.42±0. 10%.95 mm). pertumbuhan panjang larva.20 cm.31±0. Materi yang digunakan adalah larva kerapu sunu sebanyak 4.19±0. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. probiotik. KATA KUNCI: benih kerapu sunu. nisbah konversi pakan. serta terakhir perlakuan D (47. D (kontrol). Nilai pertambahan panjang tertinggi A (72.86 mm). Kendala yang dihadapi terutama terjadi pada stadia awal. Pemberian pakan dilakukan tiga kali sehari. dan perlakuan B (63.02%) serta nisbah konversi pakan (1.39±0.90±0. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut.20-4. Sampling dilakukan setiap minggu. dan 15% dari total biomassa benih. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen). laju pertumbuhan spesifik. dan kualitas air.69 mm). pertumbuhan. efisiensi pakan. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan. Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva.19%) dan panjang total spesifik (1. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0.50-0. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus).68 g) dan panjang total (6. B (oksigen).25) dan efisiensi pakan (80.69 g dan panjang total awal 3. optimasi pakan. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal. dan efisiensi pakan pada benih kerapu sunu.35 mm). Pakan yang digunakan adalah pakan pelet komersial.52±0.19%) harian serta laju pertumbuhan bobot badan spesifik (6. Namun. selanjutnya perlakuan C (64. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu.35 cm).73%) dan panjang total (9. Salah satu faktor yang berperan adalah lingkungan pemeliharaan. oksigen . laju pertumbuhan bobot badan harian (10.000 ekor/bak. Peubah yang diamati adalah sintasan. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU. laju pertumbuhan harian. Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan.

Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido.55 mm dan C: 26.03% dan perlakuan C adalah 8. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari. terutama infeksi virus.87 cm dan sintasan setelah diuji tantang sebesar 72. Mulai larva umur 2 hari diberikan Nannochloropsis sp. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol. Perlakuan A dan B tidak berbeda nyata. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan.spesifik ikan kerapu macan.08 ± 1. Perlakuan C: 5 kali/hari pada umur 7-20 hari.62%. imunstimulan.04 ± 0. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut. Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting. indeks fagositik sebesar 1.5 ± 2. KATA KUNCI: pakan buatan. B: 196. Gondol ABSTRAK Ikan kerapu macan. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari. Bejo Slamet. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L. mencapai ukuran panjang total pada perlakuan A: 24.87. Epinephelus fuscoguttatus Irwan Setyadi.20 ± 0. sedangkan kontrol hanya disuntik dengan PBS. serta bobot badan pada perlakuan A: 192. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0.62 ± 2. aktivitas lisosim sebesar 1. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN. perlakuan B adalah 6.1 ± 2. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster.65%.12 mg dan C: 211.00%.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6.81 ± 0. Des Roza.68 mm. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. larva kerapu macan.50%. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. Masing-masing perlakuan diulang 3 kali. kerapu macan .96 mg.08 ± 2. B: 24.57 mm.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN./mL dan mulai umur 17 hari diberikan nauplii Artemia. Perlakuan B: 4 kali/hari pada umur 7-20 hari. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. infeksi. Anak Agung Ketut Alit. KATA KUNCI: Epinephelus fuscoguttatus.5 ± 4. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun non.95 mg. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind.0x105 sell/mL. dengan kepadatan 1. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C.

generasi kedua (F-2). namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah. pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu. KATA KUNCI: efisiensi. Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. dengan sintasan 6. Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir. Setiap bulan dilakukan pengamatan pertumbuhan bobot. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp.72% dan panjang total 18. pembenihan. Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. kerapu bebek (Cromileptes altivelis). Sampai dengan bulan Oktober telah berhasil memijah. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. KATA KUNCI: kerapu bebek (Humpback grouper). konsentrat yang bisa dibeli di pasaran. sedangkan pada bak B : pakan pelet kering. konsentrat mempunyai sintasan 19.86 mm. Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen.10% dan panjang total 21. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja. panjang. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp. perkembangan oosit . dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp. yang kurang baik. Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut. pada bak A : ikan rucah + cumi-cumi + vitamin. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya. dan dilihat perkembangan oositnya.

Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. manajemen air media pemeliharaan dan manajemen pakan. Cromileptes altivelis Yasmina Nirmala Asih. Tangki pemeliharaan yang digunakan ukuran 8-10 m3. 10. KATA KUNCI: pemeliharaan larva. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D15). Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. Tetapi tingkat sintasan yang didapatkan masih rendah. pemeliharaan dilakukan hingga yuwana (2 bulan). Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin. Sampel larva diambil pada umur 1.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. dan 32 hari setelah menetas masing. Ketut Mahardika. Selain itu. mutu benih kerapu. 17. produksi massal . KATA KUNCI: kerapu bebek. 5. organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. 3. 7. 15.8%-41. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan.masing sebanyak 10-20 ekor. Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat. 13. histologi. 25.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. 2. 4. Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri. Indah Mastuti. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. 20.

laju pertumbuhan spesifik. (pakan kontrol). tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155. Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. 15%. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. akibat serangan penyakit dan kondisi media. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. Salah satu sumber protein alternatif adalah protein sel tunggal (PST). 15% (P>0. 10%. di lain pihak hasil tangkapan cenderung menurun. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. Hasil penelitian menunjukkan bahwa nilai bobot akhir. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. Ketut Suwirya. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut.4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. dan ketiga menggunakan larva tanpa kekebalan bawaan. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR).05). KATA KUNCI: innate immunity. Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. catfish seed. KATA KUNCI: protein sel tunggal. survival rate. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity).651 ekor benih untuk setiap induknya. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. Kematian larva umumnya terjadi pada hari keempat. Tingkat kematian larva dapat mencapai 40%–80%. I Nyoman Adiasmara Giri. Oleh karena itu.Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan. Pakan penelitian berupa pelet kering dengan kandungan PST 0%. dan 20% dalam pakan. Oleh karena itu. dan siklus kedua menggunakan larva dengan kekebalan bawaan. Lies Emmawati*).797–457. 10%. perlu alternatif lain sebagai substitusi tepung ikan. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. 5%. siklus pertama. Sumber protein utama pada pakan adalah tepung ikan. Pakan diberikan 2 kali secara “adlibitum”. Pangasius hypophthalmus . pertambahan bobot. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir.

dan A (98.2%).93%) dan terendah salinitas 3‰ (25. ikan patin. C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati.14%). Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase).92 cm).3%) dan pakan D (80. Analisis data dilakukan secara deskriptif. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32. dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor.4%) berbeda nyata lebih tinggi dibanding pakan E (68.46% per hari. (B) 2‰.910±0. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin. Kecernaan protein tertinggi berturut-turut pakan C (82. dan (C) 3‰ dengan tiga kali ulangan.49 cm). Kecernaan P pakan B (98.5 g/ekor. Ikan patin sebayak 15 ekor. pakan C (98.114±0. Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4. Ikan uji yang digunakan berukuran 2 ± 0. dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan.204±0.75±0.1%) berbeda nyata lebih tinggi dibanding pakan D (97. pakan B (82. kemudian salinitas 3‰ (4. Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter.0%).17% per hari menjadi 1. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal.13% per hari. selama 30 hari. Pangasius djambal.4%). Kecernaan protein juga meningkat akibat penambahan enzim fitase. Pangasius hypopthalmus Mohamad Amin.674±2.8%). Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰. diikuti salinitas 2‰ (28.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN.884±2. Data diperoleh dianalisis sidik ragam. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. dan sintasan . Parameter yang diamati adalah laju pertumbuhan panjang badan. dan salinitas 1‰ (3.010±0. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak). benih.00%). Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). pakan A (82. Pakan diberikan 3 kali sehari secara at satiation.25±0. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan. Ade Dwi Sasanti. Dade Jubaedah. sedangkan laju pertumbuhan panjang harian meningkat dari 1.07 cm).764±3.35±0. yang dilanjutkan dengan uji Tukey. Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3.140±0. sintasan serta beberapa parameter kualitas air.3%).223±0. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya.1%) dan pakan E (95.1%). KATA KUNCI: fitase . KATA KUNCI: salinitas. Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan.763±0.32% per hari menjadi 4.

Patin Siam. dan C (613. Akmal. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia.42±0. nila.5). dan sintasan Kata kunci: Intensifikasi.7% rendahnya sintasan ini diduga karena adanya faktor hama. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia.19±0. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo. pemijahan. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan. Pupuk anorganik + organik yang difermentasi + Probiotik.12 g dan 3. komposisi pakan alami kolam.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut.2%). Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. B. Sularto. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. betok. penetasan telur dan pemeliharaan larva di kolam.26 cm. yaitu antara 13.74±0. Jika luas gambut Indonesia adalah 20 juta ha. 0. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A.49±1. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. B (7 ekor/m2). dan Syafrudin Balai Budidaya Air Tawar.27±0.08 g dan 3. predator yaitu antara lain: Ikan liar (gabus. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam. dan C (10 ekor/m2) dengan 3 kali ulangan. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut. Pupuk anorganik + organik. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.37 cm C 16. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam. Larva yang ditebar berumur 20 jam setelah menetas.60±10. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan. namun perlakuan B (7 ekor/m2) . Padat tebar larva yang digunakan adalah 100 ekor/m2. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masingmasing perlakuan: A. sintasan ikan. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4. Pemberian pakan dengan pelet apung sebanyak 5% per hari. pengecekan induk. Pemupukan. Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk. B (660 g). sepat.9%).7. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g). Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah. udang liar) serta jenis serangga air. belut. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2).526. Pupuk anorganik + organik + probiotik dan C. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan ikan.51 g dan 11. Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4.3 g) dan SR perlakuan A (91.5 juta ha (rata-rata 20 juta ha). B (95.5%-9. dan C (95.31 cm B. 0.

2%. lahan marjinal . ikan patin. KATA KUNCI: budidaya.memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95.

di samping itu.74 g) dan 20 ekor/m2 (61. 10. nasutus . Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8.17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3. Evi Tahapari.06%) dan terendah pada kepadatan 20 ekor/m2 (7.5 m. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95.70–20. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin.76 cm dan 2. sedangkan petakan kedua ditebar sebanyak 2. pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela. pertumbuhan. 15 ekor/m2 (70.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES. Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. Percobaan dilakukan selama 100 hari pemeliharaan. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99. Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih. diikuti dengan kepadatan 10 ekor/m2 (92. KATA KUNCI: patin pasupati. 15 dan 20 ekor/m2 dengan bobot awal antara 15. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt.76%). Kata kunci: padat tebar. salinitas. dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3. dan Sularto***) *) Pusat Riset Perikanan Budidaya. Jakarta **) Balai Riset Perikanan Bididaya Air Tawar.000 ekor atau kepadatan 10 ekor/m2.60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2.80%. Zafril Imran Azwar**).30%).52%) dan terendah pada 20 ekor/m2 (91. Evi Tahapari***).43–11. Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1. Sifat biologi pertumbuhannya belum banyak diketahui. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan.10%/hari. Padat tebar yang digunakan adalah 5.45 g). Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. pertumbuhan.09 cm dan 1. JAWA TENGAH Ongko Praseno*).36 cm.000 ekor atau kepadatan 5 ekor/m2.46 g). Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.18) dan terendah pada 10 ekor/m2 (1.54 g dan panjang awal antara 10. Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda.47 g). Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3.71).

dan (C) 0. KATA KUNCI: probiotik. Perlakuan kedua adalah padat tebar: 5 ekor/L. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. Uji tantang dilakukan dengan dua cara. dosis. Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. 107. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Evi Tahapari*).003 mg/L (81. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*).14 cm). benih.002 mg/L (83. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0. 109.49 cm).003 mg/L dengan tiga kali ulangan. dan kontrol. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari.001 mg/L. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal.002 mg/ L. Probiotik diberikan dengan dosis yang berbeda. Kata kunci: uji tantang Aeromonas hydrophila.67%). dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya.001 mg/L (4. sintasan. dan kontrol (placebo).002 mg/L (4.35 cm). intraperitonial. Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*). Angela Mariana Lusiana**).55 ± 0. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air.33%) dan terendah perlakuan dosis 0. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air. (B) 0.35 ± 0. Parameter yang diamati adalah insidensi dan sintasannya. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. dan pertumbuhan . kemudian perlakuan dosis 0. Sukamandi. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar.67%). kemudian dosis 0. yaitu: cara perendaman dan cara penyuntikan intraperitonial. Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. 108.001 mg/L (86. dan 15 ekor/L. 108. Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif. 10 ekor/L. 106. Ikan uji yang digunakan berukuran 1–2 inci. Ikan uji yang digunakan berukuran 3–4 inci. diikuti dosis 0. Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109. Nurbakti Listyanto*). Pengamatan dilakukan selama 15 hari setelah perlakuan.003 mg/L (4. Analisis data dilakukan secara deskriptif. Jakarta **) Balai Besar Riset Perikanan Budidaya Laut. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo. perendaman. sebagai perlakuan yaitu: (A) 0. Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. Bogor ***) Pusat Riset Perikanan Budidaya. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan.60 ± 0. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.

ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad.850 µm. substitusi protein 0% (kontrol) (pakan A).03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129. yakni pengamatan perkembangan gonad dan fertilisasi. Ukuran panjang total larva yang baru menetas berkisar 3.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger.52% (pakan B).000 µm.16%–79. Penelitin ini terdiri atas dua tahap. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus. Aspergillus niger. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu. Derajat penetasan patin nasutus berkisar 44.05% dengan lama inkubasi 22–25 jam. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu. 75% ampas tahu:25% tapioka. larva. Pangasius nasutus . yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm. Zafril Imran Azwar. dan 25% ampas tahu:75% tapioka. hatching. substitusi protein 2. dan tahap 5 (atresis) dengan diameter oosit 300–1.04% (pakan D). tahap 3 (granula kuning telur) dengan diameter oosit 700–1.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11. artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai.250–1. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologireproduksi berkaitan dengan kapasitas produksinya. 50% ampas tahu:50% tapioka. rearing.58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. KATA KUNCI oosit. Perkembangan oosit patin nasutus bersifat sinkronis grup. Bambang Iswanto. Ke dalam wadah ditebar ikan patin ukuran 11.700 µm.700– 4.41±0. dan substitusi protein 6. ampas tahu. substitusi protein 4. KATA KUNCI: fermentasi.900 µm. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur.03% (pakan C).130–22.

67%. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER.58%.08 mm3 yang terserap 50% pada umur 30 jam . 4.1±0. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut. 0. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya. B. 91. 0.47±0. 92. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var.14 mm.43b. berukuran panjang total 3.6±0. 89. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 1. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A. 4. dan D. C.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR.25 g/ekor.30ab. diikuti perlakuan B. 88.03±0. KATA KUNCI: patin albino.01±0. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0. C. 1.10–1. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE.01±0. 88. 75.42. 50% zeolit + 50% bioball dan D.45 g/ekor. biofilter. 75% zeolit + 25% bioball.31ab. 1. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi.98±0.27a. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D. 0. pertumbuhan. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A.69 cm/ekor diikuti B. 25% zeolit + 75% bioball. 2.24) x 103. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D. 2. C. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi.02 g/ekor.34±0.56 cm/ekor. diikuti perlakuan C. 100% zeolit B. 95. dengan kantung kuning telur berukuran 0. dengan kantung kuning telur berukuran 0. 79.60 cm/ekor.42±0. B. berukuran panjang total 3.54 cm). yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus.1. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam. C.33%. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan. B. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A.20 mm.71±0. C. dan D.62 g) dan panjang (2.30a.35 cm/ekor dan A. 1.89±0. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D.20. masing-masing perlakuan diulang sebanyak empat kali. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa.75% dan terendah perlakuan A.) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias.13 mm.64±0.84 g/ekor dan terendah A.

sedangkan patin hibrida siam-jambal sebesar -4.23%.28%. larva. siam. jambal.dan habis terserap pada umur 60 jam. nasutus . tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa. hibrida. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20. Kata kunci: embriogenesis.

Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%. lama ikan bandeng digelondongkan.1% untuk Corganik. padat penebaran udang windu. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur. produksi. Oleh karena itu. Eddy Supriyono**). dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak. ikan bandeng. Oleh karena itu.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. 88. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein .2%–78. Maros **) Fakultas Perikanan dan Ilmu Kelautan.0% untuk protein dan 81. 21% dan 26%. tambak. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. Akhmad Mustafa.6%–90. Pakan tersebut digiling ulang. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar.990 kg/ha/musim dengan rata-rata 292.2% untuk bahan kering. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). dan Anugriati Balai Riset Perikanan Budidaya Air Payau. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah.6%–83. Untuk menentukan 2 3 total limbah N termasuk eksresi amonia. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. Dedi Jusadi**). Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2. dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. Enang Harris**). Hasil penelitian menunjukkan bahwa. Neltje Nobertine Palinggi*). KATA KUNCI: pengelolaan. Jika bioflok terbentuk. lalu ditambahkan kromium oksida (Cr O ) sebagai indikator kecernaan. lama pemeliharaan ikan bandeng. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok.2 kg/ha/musim.

28% untuk pakan berprotein 26%.pakan yaitu 2. milk fish. N waste. Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok).76 g N untuk pakan berprotein 21%.27 g N untuk pakan berprotein 17%. heterotrof bakteria . diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%. 2. dan 3. KATA KUNCI: feed digestibility.

Khususnya di wilayah Pantai Utara yaitu Kendal. Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya. kendala. dan Rasidi Pusat Riset Perikanan Budidaya. DAN PEKALONGAN ) Anjang Bangun Prasetio. bandeng. Molase digunakan sebagai sumber C. Pati. Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*).66% dari tahun-tahun sebelumnya. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. KATA KUNCI: budidaya. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L. Hatim Albasri. Oleh karena itu. Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. Enang Harris**). Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12.975 ha.000 ton dan mengalami kenaikan rata-rata 13. PATI. (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL.) cenderung meningkatkan kandungan asam amino bioflok. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470.726 ha dan yang layak untuk budidaya sekitar 6. (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia.organik. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. Penambahan inokulasi bakteri komersial (Bacillus sp. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS.250 ton. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol.000 ton dan mengalami kenaikan sebesar 14.54% per tahun kurun waktu tahun 2005–2009. Penyusun utama bioflok ini adalah bakteri heterotrof. growing. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng. Eddy Supriyono**). Dedi Jusadi**). Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi. opsi kebijakan . Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: Heterotrofic bakteria. Pada tahun yang sama. Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475. dan Pekalongan.

sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik. Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10.00±1. KATA KUNCI: promoter. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi. Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi.****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan.0%) dan yang terendah â-aktin-GFP (3. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. ikan lele .33±1. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi.65%. dan 15. keratin-GFP (21. 18. Konstruksi gen dalam bentuk plasmid mBA-gfp. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi. HEAT SHOCK DAN KERATIN PADA IKAN LELE. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. Hasil penelitian menunjukkan bahwa DKH-e (63. Fakultas Perikanan dan Ilmu Kelautan. Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA).67%. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20.03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi.0±10.66%) relatif sama. DKH-e yang diinjeksi dengan â-aktin-GFP (25.00±1. sedangkan DP dihitung ketika semua telur telah menetas. Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji. Clarias sp.3±0. Gusrina*). dan Utut Widyastuti***). menyusul heat shock-GFP (10. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp. mikroinjeksi. Alimuddin**). Ekspresi gen gfp tidak tampak lagi pada saat telur menetas. Data dianalisis secara deskriptif.0%). Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. Komar Sumantadinata**). keratin.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur.0±0.65%) dan heat shock-GFP (18. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan. FMIPA.63±10.34%) dan DP (63. dan heat shock-GFP berturutturut adalah 20.GFP.34±1.0%).1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel. DP untuk â-aktin-GFP.66±1.67%).Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN.00±3. DKHe dihitung sebelum telur menetas.33%.33±3. GFP.

23% kadar abu tak larut asam. Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus). Rita Febrianti.39% kadar asiaticosid. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif). 0. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan. Pemberian pakan sebesar 5% dari biomassa per harinya. hydrophila.15%) dibandingkan dengan pakan tenggelam (yakni 79. 5. pakan tenggelam. pegagan Centella asiatical [L] Urb..47±4.53% menjadi 92.34% kadar air. Ikan lele dumbo berukuran 41.623. Feces yang dihasilkan diambil setiap hari. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5.47±4. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani.74±1.25% sehingga tidak berbeda nyata dengan pakan terapung. pagi dan sore.05). dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi. KATA KUNCi: A. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus).83% kadar sari dalam alkohol.30±2. Angela Mariana Lusiastuti. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0. pakan terapung . Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam. 6. 1. Kandungan bahan aktif hasil pengekstrasian pegagan segar. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang. 39. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo. aerasi. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A.53%) (P<0. Bak diisi air sebanyak 100 liter.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak. bahan aktif. pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. Melalui penambahan aerasi. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna.05) dari 79.41 mg/L) dengan dosis efektif 250 mg/L. Taukhid.71±2.33% kadar sari dalam air.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%.37% kadar abu. Pada perlakuan tanpa aerasi. hydrophila menjadi penyakit endemis di Indonesia. ikan lele dumbo (Clarias gariepinus). KATA KUNCI: kecernaan pakan. 24.

Forum Inovasi Teknologi Akuakultur 2010

FF 45
PENINGKATAN KUALITAS TEPUNG MAGGOT MELALUI PENGGUNAAN MIKROBA (Aspergillus niger) DAN PEMANFAATANNYA DALAM PAKAN IKAN LELE DUMBO (Clarias gariepinus)
Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar

ABSTRAK
Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. Wadah percobaan yang digunakan adalah bak beton ukuran 1,0 m x 1,0 m x 0,8 m, dan dirancang sistem resirkulasi. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9,33±0,10 g sebanyak 40 ekor. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol); 7,92%; 13,28%; 19,56%; dan 25,81% dalam formulasi pakan. Setiap perlakuan dengan 3 ulangan. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar, tapioka, dan molase. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11,96%, dan penurunan lemak 61,85%, dari perlakuan kontrol. Laju pertumbuhan spesifik, penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7,90%, namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25,83% tidak memperlihat perbedaan dengan perlakuan kontrol.
KATA KUNCI: maggot, fermentasi, formulasi, lele dumbo

FF 46
ADAPTASI IKAN GURAME COKLAT (Sphaerychthys ophronomides) PADA MEDIA YANG DIBERI DAUN KETAPANG BERBEDA
Tutik Kadarini, Siti Subandiyah, Sulasy Rohmi, dan Darti Satyani Balai Riset Budidaya Ikan Hias

ABSTRAK
Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2,3–3,1 cm. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0, 10, 20, dan 30 g/40 liter masing- masing diulang 3 kali. Jenis pakan berupa cacing tubifex, bloodworm, dan cuk yang diberikan diselang-seling secara adlibitum. Parameter yang diamati sintasan dan pertumbuhan (bobot, panjang, dan perkembangan gonad), kualitas air (suhu, pH, amonia, alkalinitas, oksigen, dan karbondioksida). Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3,8–4,7 cm mencapai TKG III.
KATA KUNCI: gurame coklat, reproduksi, ikan, dan gonad

Forum Inovasi Teknologi Akuakultur 2010

FF 47
APLIKASI DIAGNOSTIK DALAM MONITORING MYCOBACTERIUM PADA IKAN GURAME (Osphrenemus gouramy LAC.) DI JAWA
Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi, Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman, yaitu seperti daun talas. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa, yaitu di Jawa timur (Blitar dan Tukung Agung), Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Dari hasil penelitian menunjukkan bahwa di daerah Blitar, Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan, penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat, sehingga petani tidak mengalami banyak kerugian.
KATA KUNCI: fish TB, Mycobacteriosis, Mycobacterium fortuitum, biokimia, PCR

FF 48
PENGARUH PEMBERIAN PAKAN TAMBAHAN DENGAN KADAR PROTEIN YANG BERBEDA TERHADAP KERAGAAN REPRODUKSI INDUK GURAMI
Bambang Gunadi, Lamanto, dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

ABSTRAK
Ikan gurame termasuk ikan dengan fekunditas rendah. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang, produksi telur per sarang, dan tingkat fertilitas telur yang dihasilkan. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang), dan injuk sebagai bahan pembuat sarang. Induk gurami yang digunakan berbobot 2-3 kg/ekor, dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. Pakan yang diberikan berupa daun sente sebanyak 3,5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. Perlakuan yang diterapkan adalah kadar protein 38%, 33%, dan 14% sesuai dengan label pada kemasan masing-masing. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. Masing-masing perlakuan mempunyai 2 ulangan. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0,09). Pemberian pakan tambahan dengan kadar protein 38%, 33%, dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10.351 butir, 4.546 butir dan 2.730 butir. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2.774 butir per sarang. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92,23% dibandingkan dengan pemberian pakan dengan kadar protein 33%, 14% dan kontrol yakni masing-masing 79,05%, 28,86%, dan 71,94% (P=0,26). Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0,75 buah, lebih rendah dibandingkan dengan yang

diberikan pakan tambahan berkadar protein 33%, yakni 0,88 buah, namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0,13 buah) dan hanya daun sente (0,5 buah).
KATA KUNCI: ikan gurame, pakan buatan, daun sente, keragaan reproduksi

oligosporus yaitu 2. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. Retensi lemak tertinggi (35. dengan ditandai tumbuhnya koloni transforman berwarna putih. retensi lemak. dan polar fermentasi berbeda nyata (P<0. 4. pertambahan bobot relatif. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari. dengan padat penebaran ikan uji 30 ekor per akuarium. Reza Samsudin.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. yang menunjukkan terbentuknya plasmid rekombinan. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. dan 6 hari. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar. dan selanjutnya polar dan dedak padi. protein efisiensi rasio. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen. Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat.28%.14% dan kadar lemaknya turun sebesar 19. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi. Retensi protein dedak padi fermentasi. dan polar fermentasi. Bogor dan terdiri atas dua tahap.47 g/ekor.33%. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan .3’).05) dengan dedak padi tanpa fermentasi. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. dan sintasan. Kandungan protein dedak padi naik 19. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5.02% sedangkan kandungan lemaknya turun 13. Wadah percobaan yang digunakan yaitu akuarium volume 100 L. dedak padi fermentasi. dan pada Silver carp sebesar 1123 bp. mud carp sebesar 1127 bp. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ – GATGAAACTCGAGTAGCCCTTGCTCTTC. Kadar protein polar naik 38. retensi protein. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. polar. polar. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar. dan koloni berwarna biru tidak mengandung DNA sisipan. Parameter yang diuji meliputi bobot akhir rata-rata.

dedak polar. dedak padi. Sintasan ikan uji berkisar antara 96. oligosphorus. KATA KUNCI: R.05) dengan perlakuan lainnya. ikan mas . fermentasi.67%–100%.berbeda nyata (P<0.

Lilis Sofiarsih*). Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. Sedangkan sintasan. salinitas rendah. akuaponik. kemudian ikan mas galur kuningan sebesar 1. Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1. Data setiap sampling dijadikan ulangan.64 kali lebih banyak dengan ukuran panen 1. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. Achmad Sudradjat. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. dengan padat tebar 20 ekor/m3. wildan.25 kali lebih besar dibanding pada kolam konvensional. dengan lokasi penelitian di Desa Kronjo. ukuran panen. sawah. Parameter yang diuji adalah kualitas air terutama kandungan ammonia.akhir ini banyak lahan yang tidak digunakan (marginal). dan parameter kualitas air yang lain dianalisis secara deskriptif. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. Kabupaten Tangerang. Provinsi Banten. Di mana satu di antaranya di desain sebagai kolam akuaponik. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. Penelitian telah dilaksanakan dari bulan Nopember 2009 —Pebruari 2010. Ongko Praseno. Sutrisno*). KATA KUNCI: ikan mas. karena akhir. sintasan. KATA KUNCI: ammonia.15 g/hari. Benih ikan mas ukuran 18. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. sedangkan yang lainnya sebagai kolam konvensional. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan.41 g/hari. serta keramba jaring apung di danau maupun waduk. dan ikan mas galur majalaya sebesar 0.86 g/hari.28 g/ ekor yang digunakan sebagai hewan uji. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. pertumbuhan. ukuran panen. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia.Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). tambak . Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan.

Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam. lasted time feeding . Siti Zuhriyyah. serta mempunyai respons yang baik terhadap pakan buatan. Afifah. Masing-masing perlakuan diulang 3 kali. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien. KATA KUNCI: survival rate. KATA KUNCI: artemia nauplii. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat. kemudian diberikan sebagai pakan larva. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. (B) umur 10 hari dan (C) umur 15 hari. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). cobia larvae. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam. fry performance.067mg) serta kelangsungan hidup (12. dan Afifah Balai Besar Riset Perikanan Budidaya Laut.07%) relatif lebih tinggi dari pada perlakuan B dan C. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik.42%. Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. dapat dikembangkan di bak terkontrol maupun di KJA.58 cm dan 17.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian. Siti Zuhriyyah Musthofa. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi. Hasil penelitian menunjukkan bahwa pertumbuhan panjang.

Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera. KATA KUNCI: ikan hias. termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. plasma nutfah . Lucky Marzuki Nasution*). Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. Stakeholder.Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. Herno Minjoyo*). Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. Lebih dari 100 spesies. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. KATA KUNCI: cobia. Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. budidaya. dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam.

Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*). Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. pakan alami. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. Afrika.. atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh. multifocal granuloma . diam dan kepalanya menyembul tepat di bawah permukaan badan air. peacock bass. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia.778 cm. dengan 6 kali ulangan. Depok ABSTRAK Deformity (dysmorphism. karena belum banyak yang membudidayakannya. Peacock bass ini akhirnya berenangnya jadi terbalik. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. Artemia sp. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. KATA KUNCI: Synodontis nigriventris. dan yang terendah Moina. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. dan selalu berusaha mendekati sumber oksigen (aerator). pertumbuhan. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. diikuti Artemia. Eni Kusrini*). Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata. dan pertambahan panjang total sebesar 1. Deformity dapat disebabkan oleh : mutasi genetic. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. laju pertumbuhan harian sebesar 32. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. bakteri. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. Tubifex sp. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias.226 g.586%. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. KATA KUNCI: deformity. granuloma. virus). infeksi penyakit (cacing.. kondisi daya dukung lingkungan yang terus menurun. dan Tubifex sp. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm.

Sulawesi Tengah. Variabel yang diamati meliputi. KATA KUNCI: banggai cardinal fish.3 cm dan bobot 2. density. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. yaitu : astaxanthin. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. 40 ekor/bak. 60 ekor/bak.Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF). Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. udang jembret (mysids) dan larva nyamuk. Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF. T3. Hewan uji yang digunakan berukuran panjang total 5. Hasil penelitian menunjukkan. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. KATA KUNCI: maggot.50 g.9 ± 0. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. Bastiar Nur. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. dan Ahmad Musa Balai Riset Budidaya Ikan Hias. Jhon Harianto Hutapea. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. 20 ekor/bak. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. wortel dan tepung kepala udang. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. T2. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai .87 ± 0. Selama penelitian. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati. Rainbow Papua . induk diberi pakan berupa naupli artemia/artemia pra dewasa. zat pemicu warna.

0 cm. KF (air kontrol+formalin).5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok.5 m dan tinggi air 40 cm. dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar.67%). I Wayan Subamia.67%). Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2.0 cm dan bobot rata-rata 0. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin. KO (air kontrol+oksitetrasiklin).5 cm dan panjang tertinggi sebesar 3.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. oksitetrasiklin. Sintasan terendah dihasilkan oleh perlakuan KB . Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis). 20. dan blitz ich) akan dilakukan melalui rancangan faktorial.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. 70.05).Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. KATA KUNCI: benih botia. dan Lili Sholichah Balai Riset Budidaya Ikan Hias.6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis. KF (71. KO (76. ukuran ekspor 1 inci (2. AO (aqua+oksitetrasiklin).5 x 0. Masing-masing perlakuan dilakukan dengan 3 ulangan. AF (aqua+formalin). Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. dan 105 dan dianalisis secara deskriptif. Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air.5 x 0. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. Selama pemeliharaan. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich). Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2.67%). Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari.33%.009 gram.5 cm (ukuran ekspor). 55. Pada akhir penelitian (hari ke 105). Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. pertumbuhan panjang. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian. namun tidak berbeda nyata dengan perlakuan AO (81.05). Nina Meilisza. AB (aqua+blitz ich). Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit. 35.

sintasan. media air. larva Tetraodon palembangensis . KATA KUNCI: prophylaksis.67% namun tidak berbeda nyata dengan perlakuan AB (55%).sebesar 51.

75 mL/kg untuk induk betina di bagian intraperitoneal. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan. antara lain sinodontis (Synodontys sp. SR (0-10 hari) 83.4°C.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar.91%.31% dan menghasilkan larva normal sebanyak 218 ekor. Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27. memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan. platidoras (Platydoras sp).6°C–29. penyuntikan hormon. namun belum banyak diketahui data embriologinya. Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari. pembuahan. hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur.). tiger catfish (Platysoma sp. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. Ikan palmas jenis albino (Polypterus senegalus var.).). Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina. inkubasi telur dan perawatan larva. Pemijahan tersebut terdiri atas seleksi induk. dan Bastiar Nur Balai Riset Budidaya Ikan Hias. perkembangan embrio. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0. dan redfin shark (Ephalzeorhynchos sp. daya tetas telur 80.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR.5 ml/kg untuk induk jantan dan 0. Depok ABSTRAK Ikan palmas (Polypterus sp. Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias. albino) masih sulit untuk memijah dalam wadah terkontrol. Asep Permana. Asep Permana.15%. KATA KUNCI: Neocaridina heteropoda. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol. sehingga produksinya masih mengandalkan impor dari luar negeri. KATA KUNCI: palmas albino. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. aligator (Lepisosteus oculatus). polypterus senegalus albino. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. masa inkubasi .

Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka. LHRH 50 mg dan testosteron 50 mg (C). Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air.9 cm dengan bobot 0. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana. Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2. implantasi. Tutik Kadarini.042 pg/mL. KATA KUNCI: Neocaridina heteropoda.5 cm dengan bobot 0.sungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya.7–1.0488–0.0518 g. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. Rina Hirnawati. hormon. Kepadatan 10 ekor induk dengan bobot 65–600 g. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah. Rendy Ginanjar. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. Pada ikan yang baru di domestikasi. Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96.3–2. Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A). matang gonad.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20. panjang 40– 60 cm. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya). murah dan aplikatif. Asep Permana.725 pg/mL. Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai. dipelihara selama 6 bulan.1630 g dan dua ekor induk jantan yang berukuran panjang 1. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana. dan Darti Satyani Balai Riset Budidaya Ikan Hias. sedang induk jantan belum ada yang mengandung sperma. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungai. budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah. dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. KATA KUNCI: induk. Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm. LHRH 100 mg dan testosteron 50 mg (B). Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor. Udang diberi pakan berupa moina beku sekali dalam setiap hari.1272–0. oocyt .

but between treatments not significant different. Based on LSD test.07 ± 9. 50 mL/L. The proportions test showed dose 50 mL/L have significant different to control. guppy fish .05 significant level. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp. The concluded that the optimum dose to produce male guppy is 50 mL/L. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam.000-4. suhu. The research was conducted experimental with completely randomized design. the alternative masculinization application of natural substance like honey. The observation to sexual secondary characteristic guppy can be observed at least two months old. kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan. KATA KUNCI: bunga tai kotok. Therefore.000 mg/kg). Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit.6%). Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. because of residual effects to human caused cancer. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. yeast (30–800 mg/kg) dan sumber lainnya. chrysin. and 75 mL/L. KEYWORDS: honey.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. as the curative effort is not applicable. the treatments gave significant different with control. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method. male. carotenoid.71%. 25 mL/L. kemudian dipisahkan antara tangkai dan kelopaknya. The result showed that the percentage of male guppy at 50 mL/ L is 64. Honey is a natural substance which have crysin. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control).Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias.

Forum Inovasi Teknologi Akuakultur 2010

FF 69
PEMATANGAN GONAD DAN PEMIJAHAN INDUK BERONANG (Siganus guttatus) DENGAN RASIO JANTAN DAN BETINA YANG BERBEDA
Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. Induk dipelihara dalam 8 buah bak berukuran 1,5 m x 1,5 m x 1,0 m dengan kepadatan 24 ekor/bak. Lama penelitian berlangsung selama 6 bulan. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&), 1:2 (B&:@&), 1:3 (B&:@&), dan 2:1(B&:@&). Pada awal percobaan, semua induk secara individu dalam keadaan TKG=O. Peubah biologis yang diamati meliputi: jumlah induk memijah, jumlah telur, diameter telur, dan daya tetas telur. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor, jumlah telur 237.865–335.837 butir/ekor, diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%, rasio (1:2) jumlah induk memijah 30 ekor, jumlah telur 129.534–393.333 butir/ekor, diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%, rasio (1:3) jumlah induk memijah 35 ekor, jumlah telur 272.837–344.975 butir/ekor, diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor, jumlah telur 227.945– 350.140 butir/ekor. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama.pada induk beronang.
KATA KUNCI: Siganus guttatus, pemijahan, jumlah telur, diameter telur, daya tetas telur

FF 70
SUBSTITUSI TEPUNG IKAN DENGAN TEPUNG RUMPUT LAUT (Gracilaria) DALAM PAKAN IKAN BERONANG, Siganus guttatus
Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22,05±6,4 g dengan padat tebar 15 ekor/keramba. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut, B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan, masing- masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0,05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0,05) dengan rasio efisiensi proteinnya.
KATA KUNCI: tepung ikan, tepung rumput laut, substitusi, pakan ikan beronang, S. guttatus

Forum Inovasi Teknologi Akuakultur 2010

FF 71
PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus Monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH
Rusmaedi, Idil Ardi, dan Wartono Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan, yaitu menggunakan tingkat teknologi tradisional plus, memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Dengan teknologi yang diterapkan, diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Penelitian ini dilakukan pada tambak di daerah Betok Mati, Kecamatan Cilebar, Karawang, Empat petak tambak masing-masing berukuran 3.500 m2 digunakan untuk percobaan. Sebelum penebaran, dilakukan pengolahan tanah tambak,n pengapuran sebanyak 175 kg/petak, kemudian dikeringkan sekitar satu minggu. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. Setelah dua hari, pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Pemeliharaan dilakukan selama tiga bulan, pada bulan pertama udang tidak diberi pakan, sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak, penebaran dilakukan setelah satu bulan dari penebaran tokolan. Dari pemeliharaan udang selama tiga bulan, diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34,5 g, produksi 81,1 kg dan sintasan 11,2%. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3, yaitu pertambahan berat rata-rata 230 g, produksi 78,8 kg dan kelangsungan hidup 100%.
KATA KUNCI: Karawang udang windu, salinitas rendah, tokolan,

FF 72
PERBAIKAN TEKNIK PRODUKSI MASSAL PAKAN ALAMI UNTUK MENDUKUNG PERBENIHAN IKAN LAUT
Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1,5–50 m3 dengan rata-rata kepadatan akhir N. oculata 13,1±0,04 juta sel/mL dan rotifer 186±5.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. Pemadatan (flokulasi) N. oculata dengan NaOH dosis 75, 100, dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368, 427, dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. Tingkat total ammonium terlarut dalam air laut produksi masal N. oculata relatif tinggi (4,3–8,2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. oculata relatif rendah (3,6%) dengan rasio DHA/EPA hanya 0,2.
KATA KUNCI: pakan alami, marine chlorella, Nannochloropsis oculata, rotifer Brachionus rotundiformis, semi-continuous system

Forum Inovasi Teknologi Akuakultur 2010

FF 73
PENGARUH PEMBERIAN PAKAN BUATAN DENGAN KADAR LEMAK BERBEDA TERHADAP PERTUMBUHAN DAN SINTASAN IKAN BERONANG (Siganus guttatus)
Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau, Maros

ABSTRAK
Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi, juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). Wadah penelitian yang digunakan adalah jaring berukuran 1,0 m x 1,0 m x 2,0 m, yang ditempatkan pada keramba jaring apung di laut. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19,2 ± 0,67 cm/ ekor dan bobot 155,3 ± 10,79 g/ekor, ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%, (B) 9%, dan (C) 13%, masing- masing terdiri atas 3 ulangan. Pemberian pakan dilakukan 3 kali/hari (pukul 08.00, 11.00, dan 17.00). Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. Hasil penelitian menunjukkan bahwa kadar lemak 5%, 9%, dan 13% dalam pakan berpengaruh tidak nyata (P<0,05) terhadap pertumbuhan dan sintasan ikan beronang.
KATA KUNCI: kadar lemak, pertumbuhan, sintasan, Siganus guttatus

FF 74
ESENSI KONSERVASI DALAM PEMULIAAN DAN PENGEMBANGAN BUDIDAYA IKAN LANGKA
Lies Emmawati Hadie Pusat Riset Perikanan Budidaya, Jakarta

ABSTRAK
Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. Jika tidak ada efek rumah kaca, suhu dipermukaan bumi akan turun secara drastis. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia. Permasalahan ini perlu dipikirkan solusinya, karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Padahal dalam upaya peningkatan produktivitas perikanan budidaya, plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global.
KATA KUNCI: pemuliaan, ikan langka, budidaya, konservasi

dan besi. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. Gyrodatylus spp. KATA KUNCI: kesesuaian lahan. Ektoparasit yang menginfeksi ikan diamati dari organ kulit. fosfat. kecepatan arus. mas koki. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. kapiat albino. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. 2009. Trichodina sp. 98% terinfeksi parasit. (Monogenea). Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. Akhmad Mustafa. Argulus sp. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. cukup sesuai 512.59 ha. neon tetra. cat fish. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. Red Fin Albino.18 ha. penyakit. Dari Sampel yang diperiksa 33. perairan Papalan. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. dan Tanjung Dapuran. kedalaman. (Dinoflagelata). Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. dan platydoras. Oleh karena itu.18 ha yang terdiri dari sangat sesuai seluas 133. Pulau Bekengkeng. parasit . Pulau Kambunong. Kualitas air perairan yang diukur adalah: pH. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. KATA KUNCI: ikan hias air tawar. Trematoda). Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan. perairan Kalukku. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009. (metacercaria. nitrat.Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. dan insang. (Copepoda) dan Centrocestus sp. Chiclidae. budidaya laut. arah arus. salinitas. kecerahan. dan Ichthyophthirius multifiliis (Ciliata). sympilum dan Characidae. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. Sampel ikan hias antara lain dari golongan cyprinidae. dan Dactylogyrus spp. keramba jaring apung. Synodontis. sirip.41 ha dan kurang sesuai 52.

inlet. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. identifikasi dan analisis data serta pelaporan. Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. Cd. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. Perairan Waduk Cirata sudah tercemar oleh parameter Zn. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. muara Sungai Cisokan. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. pencemaran.88 mg/L/kg daging ikan. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. pengambilan contoh. zona 2 Purwakarta. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. batas daerah bahaya. preparasi. dan Karbamat. Organofosfat. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS. dan Zn dalam air dan daging ikan. Tahapan penelitian meliputi: penentuan lokasi. KATA KUNCI: lahan perikanan budidaya. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. muara Sungai Citarum. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. serta debit air dari muara sungai yang masuk ke perairan waduk.98 ton/bulan. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. Piretroid. badan air Sungai Citarum dan Sungai Cimeta. Contoh yang diambil berupa air.86 ton/bulan. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb.8214 ton/bulan dan 1. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. Variabel yang diamati adalah konsentrasi kandungan Pb. residu . Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. pestisida. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. CD. Cd. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet. KATA KUNCI: logam berat. Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. Cd. sedimen (lumpur/tanah).

(13. Maleber. A. indeks dominansi (C) = 0. nebulosa. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa. bicolor bicolor. dan Desmiceae dari zooplankton ditemukan jenis Rotifer. Bacillariophyceae. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies. Patok Batas. Dinophyceae.33./L dan zooplankton berkisar antara 93.35).n. dan 4–6 m. KATA KUNCI: komunitas.072–0.17-9. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor. dikelompokan pada jenis A.31.12–3.65– 0.) DI PERAIRAN SUNGAI CIMANDIRI.75–4887.7) dikelompokan jenis A. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. Cyanophyceae. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR. Pelabuhan Ratu. fitoplankton. Sungai Cimandiri.5 ind. A. bicolor.52) dikelompokan pada jenis A. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur.nebulosa .marmorata dan (4.75 ind. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. KATA KUNCI: Glass eel.83. Ciputri. pada region mitokondria 16SRNA. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. Sukabumi.Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu. dan Cadas Bodas. SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi. 2–4. Palumbon. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat. A. Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik./L.75– 993. dan nilai kemerataan (E) = 0.marmorata. PELABUHAN RATU. dan Protozoa. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri.71–19. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari. dan sebanyak 150 ekor disimpan dalam alkohol absolut. Copepoda. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393. selanjutnya digunakan untuk analisa genetik.

Forum Inovasi Teknologi Akuakultur 2010

FF 81
POLA PEMANGSAAN DAN PERTUMBUHAN LARVA IKAN KUWE (Gnathanodon speciosus) BERDASARKAN JENIS PAKAN AWAL YANG DIBERIKAN
Afifah*), Titiek Aslianti*), dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut, Gondol **) Mahasiswa Universitas Gadjah Mada, Jogjakarta

ABSTRAK
Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL), terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. rotifer, B. gonad kerang, dan C. kuning telur) dan 3 ulangan. Pemberian pakan awal di mulai saat larva berumur D-2—D-10, selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan, selanjutnya secara periodik 5 hari sampai dengan D-30. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan,. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10,99 mm; 27,10 g; dan 21,97%) dibanding perlakuan A (10,27 mm; 21,94 g; dan 1790%) dan C (11,01 mm; 25,20 g; dan 17,17%). Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan, namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.
KATA KUNCI: larva ikan kuwe, pakan awal, pola pemangsaan

FF 82
KARAKTERISTIK MERISTIK IKAN NILEM (Osteochilus hasselti) DI JAWA BARAT
Mulyasari*), Dinar Tri Soelistyowati**), Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya

ABSTRAK
Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan, adalah dengan program pemuliaan. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra- dan inter-populasi ikan nilem di Jawa Barat. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin), sirip dada (pectoral fin), sirip perut (ventral fin), dan sirip anal (anal fin). Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata.
KATA KUNCI: ikan nilem, Osteochilus hasselti, meristik

Forum Inovasi Teknologi Akuakultur 2010

FF 83
EVALUASI PENGGUNAAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN BENIH IKAN NILEM (Osteochillus hasselti)
Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Pakan memegang peranan penting dalam budidaya ikan nilem. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan, Balai Riset Perikanan Budidaya Air Tawar, Bogor. Ikan uji yang digunakan adalah ikan nilem dengan bobot rata- rata 5,0±0,3 g/ekor. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%, 19%, dan 20%. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Ikan dipelihara selama 40 hari. Parameter yang diamati yaitu pertumbuhan spesifik, konversi pakan, serta sintasan ikan. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0,05) yaitu sebesar 1,56%. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0,05).
KATA KUNCI: nilem, protein, pertumbuhan, pakan

FF 84
EFISIENSI USAHA BUDIDAYA IKAN DENGAN PENGGUNAAN PAKAN BUATAN BERBAHAN BAKU LOKAL (STUDI KASUS DI DESA REJOSARI, KABUPATEN BATANG)
Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan, Jakarta

ABSTRAK
Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. Penelitian dilakukan di Kabupaten Brebes dan Batang. Metode penelitian dilakukan secara studi kasus. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Harga pakan hanya Rp 2.800,-–Rp 3.000,-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6.500,-–Rp 7.000,-/kg. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya.
KATA KUNCI: efisiensi usaha, pakan buatan, bahan baku lokal, ikan patin

Forum Inovasi Teknologi Akuakultur 2010

FF 85
PERBAIKAN TEKNIK PENANGANAN CALON INDUK IKAN TUNA SIRIP KUNING PASCA PENANGKAPAN DAN DALAM BAK PENGOBATAN
Jhon Harianto Hutapea, Irwan Setiadi, Gunawan, dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut, Gondol

ABSTRAK
Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg). Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2,5 m3 (diameter 2 m dan tinggi 0,8 m) dan bak fiberglass berbentuk oval volume 2,1 m3 (lebar 1,4 m dengan panjang 2,1 m dan tinggi 0,7 m. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari.
KATA KUNCI: penanganan calon induk, ikan tuna sirip kuning, sintasan

FF 86
KERAGAAN PERTUMBUHAN IKAN TENGADAK ALAM (HITAM) DAN BUDIDAYA (MERAH) (Barbonymus schwanenfeldii) DALAM PEMELIHARAAN BERSAMA PADA KOLAM BETON
Gleni Hasan Huwoyon, Irin Iriana Kusmini, dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar, Bogor

ABSTRAK
Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. Pada beberapa jenis ikan, warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2,1±0,19; hitam: 1,7±0,20), pertumbuhan mutlak (merah: 6,8±1,02; hitam: 5,6±0,30) dan laju pertumbuhan spesifik (merah: 0,65±0,06; hitam: 0,57±0,02).
KATA KUNCI: warna, tengadak, Barbonymus schwanenfeldii, genetika

daun mengkudu. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari.04% khamir laut.06% khamir laut. urea. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu. bahan kering.02% khamir laut.00% khamir laut.01).05). B = Daun mengkudu + 2. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0. KATA KUNCI: khamir laut. gula. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2.5% molasses + 0. Setelah 5 hari dipanen. pupuk .08% khamir laut. dan TSP. dan energi di antara perlakuan berbeda nyata (P<0. BETN. silase. Hasil penelitian menunjukkan bahwa: pH.5% molasses + 0. Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan.05).5% molasses + 0.5% molasses + 0. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia). Jepara. kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. Setelah kering. R4 = Daun mengkudu + 2. R = Daun 3 mengkudu + 2.5% molasses + 0. lemak kasar. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan. Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator. protein kasar. serat kasar. E = Daun mengkudu + 2. dan abu di antara perlakuan tidak berbeda nyata (P>0. Berdasarkan hasil penelitian.

di mana termasuk cara budidaya udang. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10. Sulawesi Selatan. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I.977.000 ind. rumput laut (2 ton/ha) dan tiram (20.000 ekor/ha) dan rumput laut (1 ton/ha).000 ekor/ha. Perlakuan B. udang windu. petak I ditebari bandeng (10. ditebari bandeng (10. MY1112 bulan II. Erfan Andi Hendradjat. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1.48 kg/ha.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59. tambak marjinal .000 ekor/ha). Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. KABUPATEN TAKALAR Muharijadi Atmomarsono. serta manajemen pakan dan air secara benar. BL542 bulan III. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu. penggunaan sarana produksi yang ramah lingkungan.1 ton/ha/16 mg menjadi 1.000 ekor/ha) dan rumput laut (1 ton/ha).46% dengan produksi udang windu sebesar 249. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram.07. KATA KUNCI: udang windu. Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. Brata Pantjara.000.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA.5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar. rumput laut (2 ton/ha) dan tiram (40. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40./ha) dan petak II : bandeng (3.73% dengan produksi sebesar 217. Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram. Pada akhir penelitian diperoleh sintasan 63.000 ind/ha) dan petak II. rumput laut. CBIB. KATA KUNCI: biofilter. bandeng (3.-/musim tanam dengan B/C rasio 2.000 ekor/ha). dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal.

Nurbaya. kandungan BOT di atas 30 mg/L. BL542 bulan III. diikuti perlakuan kombinasi probiotik A (50.8% dan 228. terutama salinitas yang mencapai 56 ppt. Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. Maros. (C2) probiotik komersial dengan dosis pakan 50%. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masingmasing 3 kali dan lama pemeliharaan 10 minggu. NO3. tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani.35% dan 448. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66.05% dan 298. dan C) Kontrol (tanpa probiotik). Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana. Pengamatan sintasan udang windu dilakukan pada akhir penelitian. Penelitian dilaksanakan selama 90 hari.7 kg/ha/90 hari). NH 3. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan 3 selama penelitian relatif lebih tinggi pada perlakuan yang NH tidak menggunakan probiotik dengan dosis pakan 100%. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. MY1112 bulan II. (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). Oleh karena itu.7 kg/ha/90 hari). NO2. production. Sintasan udang windu tertinggi didapatkan pada . air laut salinitas 28 ppt sebanyak 15 L. PO4. Nurbaya. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. Muliani. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%. (C1) probiotik komersial dengan dosis pakan 100%. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. total bakteri. survival rate. dan total Vibrio. Penelitian dilakukan di laboratorium basah. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. KATA KUNCI: probiotic bacteria. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan. menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau.7 kg/ha/90 hari). (D2) kontrol 2. Hasil penelitian menunjukkan. Balai Riset Perikanan Budidaya Air Payau.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. B) Pergiliran probiotik BT951 bulan I.

KATA KUNCI: probiotik. sintasan. dosis pakan.perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60. sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0.05) pada akhir penelitian.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11.11%. Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial. udang windu .

Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu. Selama pemeliharan tidak diberi pakan. M. udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp. baik pada air maupun pada dasar tanah tambak.5% dengan produksi 19.000 ek/ha bandeng) menunjukkan hasil yang terbaik. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. KATA KUNCI: probiotik. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. rumput laut dan ikan bandeng adalah perlakuan B (10.500 m2 dengan kedalaman 80 cm. Sintasan dan produksi udang windu dan ikan bandeng masing. Tokolan udang windu (PL.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13. produksi.masing adalah 66. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. masing-masing terdiri atas 2 ulangan.9 kg dan secara finansial memberikan . kesehatan. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha). Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. Oleh karena itu.masing-masing dengan dua kali ulangan.8% dan 63.4 ha. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. Tjaronge.000 ekor/ha (1 ekor/m2).7 kg. Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu. dan pertumbuhan udang serta aman bagi konsumen. Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1.000 ekor/ha). 31) yang ditebar pada masing-masing tambak adalah 10. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya. Maros selama 90 Hari. dan kontrol (tanpa aplikasi probiotik). Sampling dilakukan 30 hari sekali selama 90 hari. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0.0%. Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau.9% dan 33. Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha). namun belum mampu menurunkan kandungan amoniak dalam media budidaya. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an. serta 99.

ikan bandeng. produksi .572. sintasan. KATA KUNCI: multitropik. rumput laut. udang windu.000.keuntungan sebesar Rp 11.-/ha /90 hari.

EGFP. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. danAndi Tenriulo*) **) Balai Riset Perikanan Budidaya Air Payau.0%).05) dengan perlakuan transfeksi tanpa konstruksi gen (43. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang.3% dan tidak berbeda nyata (P>0. 3 hari.Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. Bunga Rante Tampangallo. Aan Fibro Widodo. 1 hari. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. Selain itu. udang windu .1%) serta tanpa transfeksi (49. Promoter dikatakan aktif apabila gen penanda dapat terekspresi.05) dibandingkan dengan kontrol. Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia. transfeksi. Syarifuddin Tonnek. Maros **) Departemen Budidaya Perairan. uji tantang. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. KATA KUNCI: ekspresi. gen PmAV menunjukkan respons meningkat (up-regulation). IPB. KATA KUNCI: promoter. 2 hari. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. Alimuddin**). Fakultas Perikanan dan Ilmu Kelautan. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. 12 jam. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. 4 hari. Ketika ditantang dengan WSSV. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau. ekspresi gen. Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR. yang sampai saat ini belum bisa diatasi secara secara tuntas. gen anti virus. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. Komar Sumantadinata**). Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter. Sukenda**).

Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). monodon dengan melihat gejala klinis dan studi histopatologi. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. Penelitian dilakukan untuk membuat. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. khususnya ELISA. sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. antibodi monoklonal . dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. White Spot Syndrome Virus (WSSV). Nurhidayah. Pewarnaan jaringan menggunakan Hematoxilin eosin. dan disertai ulserasi lapisan mukosa epitel. KATA KUNCI: White Spot Syndrom Virus (WSSV). cepat dan akurat. Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. KATA KUNCI: ELISA. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. karena relatif mudah dan murah. serta epidemi penyakit di lapangan. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. menyeleksi. serta berpeluang untuk digunakan secara langsung di lapangan. Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. Teknik serologi. Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. Setelah pengujian. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. Antibodi monoklonal memiliki kespesifikan yang tinggi.

Takalar. Selama pemeliharan 85 hari. Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau.18235 mg/L) dibandingkan dengan perlakuan A (0. dan pemeliharaan berlangsung 80 hari di tambak. dan (B) pembesaran dengan tebar tokolan (PL 27). tokolan. sintasan.05) terhadap pertumbuhan.Setiap perlakuan dengan 2 ulangan. sintasan ( 92.Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. RKP pada pembesaran udang vaname teknologi intensif. Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi. produksi (1831. dan efisiensi biaya produksi.120). namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan.085±0. produksi (2087.05) dengan perlakuan A (1.31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya.257±0. Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah. menggunakan 4 petak masing masing berukuran 4. dan kepadatan benur dan tokolan adalah 50 ekor/m2. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.048).000 m2/petak..7 m sebanyak 9 buah.9). Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei). budidaya udang intensif. rasio konversi pakan dan produksi udang vaname.5±88. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11. Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12). Riset ini dilaksanakan di tambak Punaga.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak. Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0. sintasan (90. 829. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%.0328 mg/L) pada akhir penelitian. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0.51).258).0±149. Instalasi BRPBAP. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun. namun terbatas pada golongan masyarakat menengah keatas (padat modal). kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0. KATA KUNCI: udang vaname. benur.096±0. .83±8. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0. Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei).234).102 CFU/mL. Budidaya ini berkembang dengan teknologi intensif.45 g/ekor dan ditebar kepadatan 100 ekor/bak. Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan.masing-masing perlakuan diulang tiga kali. sintasan. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari. karena berpengaruh terhadap pertumbuhan. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1.034) berbeda nyata (P<0.549±0.114±0. Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%.

survival rate. feed. and L vannamei .KATA KUNCI: growth.

3%–86. Litopenaeus vannamei Deisi Heptarina*). C/P rasio 14. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). dan 23. Selama pemeliharaan. C/ P rasio 16. produksi. salinitas 24–25 ppt.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2.intensif. Pakan diberikan at satiation. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7. C/P rasio 13. Agus Suprayudi**). Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an.029–2. Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI .00.INTENSIF DI TAMBAK Abdul Mansyur. . suhu 28°C–30°C.0– 8. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum. Bobot yuwana yang ditebar rata-rata 0. Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname. rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi .2 kkal GE/g). sedangkan ekskresi amonia antara 1. sintasan.05) terhadap pertambahan berat mutlak. sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya. M. Bogor **) Departemen Budidaya Perairan. C/P rasio 11. 11. 5 kali sehari pada pukul 07. Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH. C (protein 33%. Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media.5 g/ekor dengan kepadatan 10 ekor per akuarium. Sintasan antara 73.6 kkal GE/g). Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%. D (protein 35%. namun kurang diimbangi dengan penyediaan pakan yang sesuai. Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. dan pH 8. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Jakarta Utara.69%. laju pertumbuhan harian. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB). fotoperiod dibuat 12 jam terang–gelap.39%. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0. Ing Mokoginta**) dan Dedy Yaniharto***) *) Balai Riset Perikanan Tawar.1 kkal GE/g). Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0.000 m2.71%–22. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan. Fakultas Perikanan dan Ilmu Kelautan.5 kkal GE/g).00. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0. ekskresi amonia dan stabilitas pakan. C/P rasio 15. Perlakuan terdiri atas pakan A (protein 29%. Kemudian dilanjutkan uji kecernaan. Penelitian dilakukan di tambak percobaan Punaga Takalar.00. sintasan.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN. 19. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon).00.464 mg/kg tubuh/jam. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4. 15. Hidayat Suryanto Suwoyo.8 kkal GE/g).00.5.05). B (protein 31%. dan E atau komersial (protein 40.7%.

4%.2%. RL dan RP masing-masing 26.6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik.5%–36.4–2. kecernaan total. Litopenaeus .4%–94. K ATA KUNCI: protein vannamei optimal. FCR 1. pertumbuhan relatif (PR).9%–68.2–78.9%–79. Kisaran nilai masing-masing parameter tersebut adalah.masing 26.1% dan 65.4.Namun. konversi pakan (FCR). dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0. PR 532. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13. retensi protein (RP). pertumbuhan. kecernaan total dan kecernaan protein masing.05). yuwana.1 g.5%.8% dan 11. JKP 59. retensi lemak (RL).5%–62.2% serta WS berkisar antara 49. kecernaan protein. jumlah konsumsi pakan (JKP).7%–1130.

PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. SOD.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. Namun demikian. SOD. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terusmenerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). PGM. and SP) pada udang yang sehat. dan SP. toleran. Taura Syndrome Virus. protein haemolimph dan ekspresi enzim (GPI. SPF. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. dan Rustidja**) *) Balai Besar Riset Perikanan Budiaya Laut. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. penampakan klinis yang abnormal dan organ yang yang tidak sempurna. belum dapat diyakinkan secara pasti bahwa ekspresi EST. KATA KUNCI: enzim. hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun). Untuk mengetahui jenis virus yang menyerang udang tersebut maka. Semua gejala tersebut diduga akibat adanya serangan virus. toleran. SOD. Haryanti*). EST. toleran dan terinfeksi TSV. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. dan SP mampu berdiri sendiri. Gondol **) Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang.Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. Lila Gardenia. SOD. Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. EST. Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. . L. Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. PGM. dan moribund.

MBV. TSV. WSSV.KATA KUNCI: Litopenaeus vannamei. IHHNV. IMNV dan PvNV .

dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan tidak berbeda nyata antar perlakuan. B. Ciasem. 0. rasio kelamin. berturut-turut 27%. KATA KUNCI: mortalitas.5% berturut-turut untuk perlakuan A. B) 1 J : 2 B. C. Penelitian dilakukan dengan rancangan acak lengkap. berturutturut 0.25 m2/ekor induk. Sebagai perlakuan adalah rasio jantan-betina. 25%. Romy Suprapto. 0. yang meliputi pertambahan panjang dan bobot. A dan B. Pada sistem tersebut kematian induk relatif rendah. pemijahan. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. yang dilakukan selama 5 bulan. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. diikuti perlakuan D. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal.5%. 2%. 6.20 g.27 mm. beserta persilangannya. dengan lama pengujian 8 minggu. 0. pendederan I. udang galah . C) 2J : 2 B. Barito. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%.31 mm. pendederan II. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro. Imron. persilangan. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan.21 g. Namun demikian. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. Penelitian meliputi pembenihan. persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). pertumbuhan.42 mm. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan. berdasarkan nilai heterosis yang didapat. dan D) 2 J : 4 B. dan 13%.25 g. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji. dan D. Asahan. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari. KATA KUNCI: genetik. diberikan pada pagi dan sore. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan pembesaran. 0. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. reproduksi. dengan sistem resirkulasi. khususnya rasio jantan-betina. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. Musi. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. dan 9.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. dan 0. Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. yaitu 0%.

83% dan 3.5%.0%). tanpa penambahan desinfektan). yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C. B. 37. **) Jurusan Budidaya. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan dioptimalkan.7 mm) diikuti oleh populasi hasil outbreeding (21. Sukamandi. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan. dan D. larva udang galah.0%) dan populasi inbreeding (25. yaitu A. sirih. namun tidak berbeda nyata (P>0.0±1. sintasan (SR) dan perkembangan larva (LSI). 4. Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan. Dinar Soelistyawati**).5 x 103). Perlakuan yang diberikan yaitu A (kontrol.93. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah. C.4%) diikuti oleh populasi hasil crossbreeding (57. 47. Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi.05) terhadap kelimpahan bakteri. . (0 cfu/mL).4 mm). KATA KUNCI: budidaya dapat inbreeding. (8. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan. 45. dan D (perendaman dalam larutan ekstrak bawang putih). crossbreeding. keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24. yaitu inbreeding. Fakultas Perikanan dan Ilmu Kelautan. Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan. B (perendaman dalam larutan formalin 250 mg/L). Tiga tipe persilangan. C.5±28. Pada karakter pertumbuhan. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74.00% dan 3.92. 52. Hewan uji yang digunakan adalah larva udang galah umur dua hari. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. outbreeding.4 mm) dan populasi inbreeding (21. C (perendaman dalam larutan ekstrak daun sirih). formalin.5% dan 3. merupakan langkah bio-security.6±21.0. Hasil penelitian menunjukkan bahwa pada karakter sintasan.Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. KATA KUNCI: bawang putih.4 x 103 cfu/mL) . Harry Wuwungan**). dengan nilai sebagai berikut: A. (0 cfu/mL).93. keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan. (4.8±7.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*). desinfektan.8±1. dan D. Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah.8±1. Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya. B.

Penelitian ini dirancang dengan menggunakan rancangan acak lengkap. dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut. D. dan (F) 10%. Jakarta ABSTRAK Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. Perlakuan yang diujicobakan adalah: A. (D) 16%. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. (C) 31%. DAN BONE Eni Kusrini*).05) terhadap laju sintasan dan pertumbuhan larva udang pama. Kepadatan larva 75 ekor/L. Kepadatan larva 50 ekor/L. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau. (B) 32%. semisucatus) dengan kepadatan berbeda. C. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm. sintasan dan pertumbuhan . Pelabuhan Ratu. larva udang pama. jarak genetik K 22 PEMELIHARAAN LARVA UDANG PAMA (Penaeus semisulcatus) DENGAN KEPADATAN BERBEDA Muslimin. Sulaeman.Forum Inovasi Teknologi Akuakultur 2010 K 21 VARIASI FENOTIP UDANG GALAH (Macrobrachium rosenbergii) DARI POPULASI PERAIRAN KARAWANG. Kepadatan larva 25 ekor/L. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. artemia. dan Wartono Hadie**) *) Balai Riset Budidaya Perikanan Ikan Hias. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm. populasi. KATA KUNCI: kepadatan. di mana masing-masing perlakuan di ulang tiga kali.00 dan 16. Kepadatan larva 150 ekor/L. Hewan uji ini ditebar dengan kepadatan berbeda. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air. dan F. Lies Emmawati**). Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%. Kepadatan larva 100 ekor/L.Karawang dengan Pelabuhan Ratu lebih dekat. B. Andi Tenriulo. lebar 40 cm.00 wita). maka ditambahkan pemanas/heater suhu 30°C. Kepadatan larva 125 ekor/L. (E) 24%. PELABUHAN RATU. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu. KATA KUNCI: udang galah. diameter 15 cm dan Volume 3 L. E. dan Bone. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. Maros dengan panjang awal mysis adalah 100-190 milimikron. Pemberian pakan dilakukan setiap pagi dan sore (08. Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0. Jenis pakan yang diberikan berupa pakan alami chetoceros. dan pakan buatan. Depok *) Pusat Riset Perikanan Budidaya. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang).

Maros ABSTRAK Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan. KATA KUNCI: udang pama.06. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert. pertumbuhan panjang dan lebar karapas mutlak dan harian. Wadah percobaan yang digunakan adalah bentik jar (chamber).9±0. B (metode gantung).1 mm dan lebar karapas 5.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan.446–6. BRPBAP. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. bobot harian. panjang karapas 4. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan.05) terhadap pertumbuhan bobot mutlak. disusul perlakuan C: 64. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66.65 g/m3. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Oksigen terlarut diukur dengan alat pengukur (TPSTM Model WP-82 DO meters). Data laju respirasi selama 2 O proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit. yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. Maros. dengan kisaran tingkat konsumsi oksigen 0.0235 g adalah 15. Ver. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4. Kisaran kelarutan oksigen pada awal penelitian adalah 3.03 g.14–7.1 mm. 40. 44.1. estimasi K 24 POLIKULTUR KEPITING BAKAU (Scylla serrata) DAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN METODE TEBAR YANG BERBEDA Sulaeman.2.6±0. tetapi berpengaruh nyata (P<0. Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0.Forum Inovasi Teknologi Akuakultur 2010 K 23 ESTIMASI PADAT TEBAR UDANG PAMA Penaeus semisulcatus BERDASARKAN TINGKAT KONSUMSI OKSIGEN Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.18±0. Aan Fibro Widodo. padat tebar.9 mg/L dan setelah 1 jam pengukuran 0. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar). . dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. 58.03–0. Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0.17 kg/250 m2. akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut.48 mg/L dan kontrol tetap berkisar 4 mg/L. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1. Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP).05) terhadap sintasan dan produksi kepiting bakau dan rumput laut.95 kg/250 m2 dan terendah pada perlakuan B: 60.26–7.27 mg/g/jam.58%. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan. dan C (gabungan antara keduanya).96 %.52 kg/250 m2.

rumput laut . metode sebar. polikultur.KATA KUNCI: kepiting bakau.

Forum Inovasi Teknologi Akuakultur 2010 K 25 LAJU PEMANGSAAN LARVA KEPITING BAKAU (Scylla serrata) TERHADAP PAKAN ALAMI ROTIFERA (Brachionus SP. dan nitrat (rs = 0. rotifera. Selain diatom epipelic. jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan. sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0. Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan. Peubah yang diamati adalah laju pemangsaan.65).)./mL).66)./mL dengan laju pemangsaan sebesar 259. yaitu kepadatan rotifera 625 ind. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton. laju pemangsaan./mL)./mL).0%. kandungan liat (rs = 0./larva/jam dan sintasan 86. Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air. Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma./mL). zoea K 26 ANALISIS DIATOM EPIPELIC SEBAGAI INDIKATOR KUALITAS AIR DAN TANAHUNTUK BUDIDAYA UDANG Supono Budidaya Perairan Universitas Lampung ABSTRAK Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. Maros ABSTRAK Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. D (250 ind. Karena hidup di dasar tambak. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0. Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. Hasil terbaik diperoleh pada perlakuan A. sintasan. B (500 ind.72). Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp.) Aan Fibro Widodo. yaitu: A (625 ind. TOM (rs = 0. Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros.1667 ind. kepiting bakau. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros. Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang. Sulawesi Selatan. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen.62). dan E (125 ind. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. . C (375 ind. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0. data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. KATA KUNCI: kepadatan. dan kandungan bahan organik (rs = 0.05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. dan Muslimin Balai Riset Perikanan Budidaya Air Payau. yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang./mL). Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau. dan peubah kualitas air.75).71). Sulaeman.

kualitas air. kualitas sedimen .KATA KUNCI: diatom epipelic. tambak udang.

Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini.72). panjang standar.6-71.47) terbaik adalah benih lobster air tawar asal Tangerang. pertumbuhan. Bogor. Dianalisis dengan Rancangan Acak Lengkap (RAL). dan Tulung Agung). dan panjang total tiap individu. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen. Pertambahan bobot (71. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan. lokasi .0±0. namun kemampuan produksi para pembudidaya hanya sampai 4 inci. ragam. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci.6±10. KATA KUNCI: Cherax quadricarinatus. benih.9 g. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang. panjang standar.0 cm dan adanya pertambahan bobot sebesar 58. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. Gleni Hasan Huwoyon. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda. simpangan baku.6-7. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6.9±9. Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. dan panjang total). Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci.74) dan panjang (7.

(13. (B) Ulva sp. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30. Gracilaria. Ulva.68 µg/hari).613. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga. Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41. dan kombinasi keduanya. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang.891.. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir. (7. E.05). Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp.92 g dan 219. B. yaitu pada perlakuan pemberian pakan Gracilaria sp. + Ulva sp.50 g dan 217.58 m x 0.82 µg/hari)..44 µg. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit. (rasio 1:1:1). I Nyoman Adiasmara Giri. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto. dan pakan (C) dengan R² = 0.80 sampai 31. + Sargassum sp. lebar dan bobot cangkang.06 ± 170.59±2. squamata. KATA KUNCI: Haliotis squamata.44 µm . (5. cottonii 37.39 mm dan 10.89 µm dan 38.17 ± 25. Ulva sp. pakan (B)= E.9 ± 1. masing-masing 58.23 g dan 121.16 g dan -86. Ibnu Rusdi.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON. dan Sargassum sp.52 µg/hari) dan terendah pemberian pakan Sargassum sp. cottoni.39 m x 0. dan C berturut-turut adalah 120. + Sargassum sp.06 g.05 mm dan 10. kombinasi Gracilaria sp.31 m. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali. (C) Sargassum sp. yaitu: (A) Gracilaria sp. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata. Riani Rahmawati. Bambang Susanto. Riani Rahmawati. 38. dilakukan dengan menerapkan 4 perlakuan pemberian pakan. 73.56 ± 48.17 ± 2.39 g. serta pakan (C)= kombinasi Gracilaria + E. (13. + Ulva sp. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi. + Ulva sp. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m.00 µm dan 38. (D) Kombinasi Gracilaria sp.19 ± 6.854.73±2. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0.0 ± 0. (P<0. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A.18 mm dan 7.03 ± 1.99 mm dan 36..73 g.05) antar perlakuan. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. + Sargassum sp. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan.1 ± 4.37 mm.26 ± 10. cottonii : 40. Sargassum. sangat sesuai dalam memacu pematangan gonad induk abalon H.44 ± 102.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria.06 µg/hari).44 µg serta 92.02 g. pakan (B) dengan R² = 0.

dan 65.44 µg. KATA KUNCI: abalon Haliotis squamata. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir. aplikasi teknologi pembesaran .

Ibnu Rusdi. peluang pasar serta teknik budidayanya yang sederhana. Est-3*. Gondol. Est-1*. dengan bobot awal 2. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. genetic monitoring. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. Est-2*. pembesaran.52. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan. 60/40% memberikan pertumbuhan abalon terbaik. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. Hirmawan Tirta Yudha.2 g dan panjang cangkang 2. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. proporsi pakan./Ulva sp. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. wild. Sampel yang digunakan berasal dari Bali dan Banten. Gpi*. KATA KUNCI: allozyme. dan 60/40% (C) sebagai perlakuan.7 cm.6-3. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. Nilai variasi genetik induk abalone asal Banten (0. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air. Kepadatan awal benih abalon adalah 450 ekor per wadah. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. dengan proporsi yang berbeda Gracilaria sp. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. Untuk itu. Est-4* dan Cah-3*.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin. Abalon diberi pakan rumput laut Gracilaria sp. Pada penelitian ini digunakan baskom plastik berdiameter 42 cm.13) lebih tinggi dibandingkan dengan induk asal Bali (0. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. 80/20% (B). dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. mengingat permintaannya yang cukup tinggi. Setiap perlakuan terdiri atas 2 ulangan. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. 100/0% (A). dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. Pakan dengan proporsi Gracilaria sp.06). dan Ulva sp. dan Ulva sp. Tatam Sutarmat./Ulva sp. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. tinggi 22 cm. penjarangan . Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan. KATA KUNCI: abalon Haliotis squamata.

44±0. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0.1 mm (perlakuan B). KATA KUNCI: Pinctada maxima. untuk memperoleh pertumbuhan dan sintasan yang baik. Haliotis squamata. yaitu media spesifik untuk bakteri Vibrio. dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. Setiap perlakuan diulang 3 kali. Indah Mastuti. DAN UJI PATOGENISITAS BAKTERI VIBRIO YANG DIISOLASI DARI LARVA ABALON SAKIT DI HATCHERI Zafran.03 mm/hari (perlakuan B) dan 0.42%. Gondol ABSTRAK Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia.44 mm (perlakuan A). squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut. Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H.67%. ukuran awal spat . vibriosis. Gondol ABSTRAK Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan.36±0. 10.37±0. Laju pertumbuhan lebar cangkang 0. Oleh karena itu. Supii.55 mm (perlakuan C).05) dibandingkan dengan perlakuan C. uji patogenisitas M 06 PENDEDERAN TIRAM MUTIARA (Pinctada maxima) DENGAN PERBEDAAN UKURAN TEBAR AWAL Sudewi. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1. 0. 0.00 mm/hari (perlakuan C).01 mm/hari (perlakuan C). KARAKTERISASI. Gondol. Apri I.44±0. KATA KUNCI: abalon. dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13. B.85±0. Perlakuan yang diberikan adalah ukuran tebar 3. Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0.4±0. masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan. dan 46. dan 20. isolat-2. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis.03 mm/hari (perlakuan B) dan 0.33% . tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya.33%.69%. dan 21. dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut. Karena itu.27±0.05 µm).01 mm/hari (perlakuan A). Vibrio cincinnatiensis. Sintasan yang diperoleh untuk perlakuan A. 71. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0. 18.Forum Inovasi Teknologi Akuakultur 2010 M 05 ISOLASI.01 mm/hari (perlakuan A). Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. Bali. dan C berturut-turut 37.33%. pertumbuhan.30±0. sedangkan mortalitas pada kelompok kontrol hanya 3. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar.16%. sintasan. Parameter yang diamati adalah laju pertumbuhan harian dan sintasan. penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon. Namun.46±0.

Pinctada maxima. dan Teluk Rabu. tiram mutiara. Teluk Awen. Berdasarkan hasil pengkajian.Forum Inovasi Teknologi Akuakultur 2010 M 07 KAJIAN POTENSI KELAUTAN UNTUK BUDIDAYA TIRAM MUTIARA (Pinctada maxima) DI WILAYAH PESISIR KABUPATEN JEMBRANA-BALI Apri I. secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. Ida Ayu Astarini**). budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. Supii*). KATA KUNCI: potensi kelautan. Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara. Pantai Pengambengan khususnya. Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari. Jembrana . akan tetapi jika diinginkan. Sumber Sari. dan Sudewi*) *) Balai Besar Riset Perikanan Budidaya Laut. regional maupun lokal. pada tingkat nasional. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Gondol **) Fakultas MIPA Universitas Udayana ABSTRAK Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai. Pengkajian dilakukan dengan metode eksplorasi dan wawancara.

40 mm pada stoples dan 2. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81.42 mm pada botol. Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26.50) lebih banyak dibandingkan dalam botol (7. sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi. verrucosa. 4 m.75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan. 2 m. Umumnya pembudidaya rumput laut. stoples . dan 5 m dari permukaan perairan. 2 m. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver.03). Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut. Kappaphycus sp. vertikultur LL 2 PERBANYAKAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN KULTUR JARINGAN MENGGUNAKAN WADAH YANG BERBEDA Siti Fadilah. Rosmiati. KATA KUNCI: botol.Forum Inovasi Teknologi Akuakultur 2010 LL 1 PERFORMANSI PERTUMBUHAN DAN KANDUNGAN KERAGINAN RUMPUT LAUT (Kappaphycus alvarezii) DENGAN APLIKASI METODE BUDIDAYA VERTIKULTUR Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0.20. KATA KUNCI: Kappaphycus alvarezii. 3. kepadatan eksplan. dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut. Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masingmasing dengan 3 kali ulangan.6 juta ton per tahun sekarang ini menjadi 7. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan. 1 m. K. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut. sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya.70%) daripada botol (90. dan 5 m. Pengamatan panjang tunas. Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). Maros ABSTRAK Produksi rumput laut ditargetkan meningkat dari 2. pertumbuhan. 3 m. di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. kandungan keraginan.3 m. 4 m. 3 m. mengaplikasikan metode long line.70 dibandingkan dalam botol yang hanya 6. Jawa Tengah.3 m. yakni 0.1%. Eksplan diinokulasi ke dalam media cair yang diperkaya PES. Oleh karena itu. metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468. Maros ABSTRAK Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan. 1 m. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. Rumput laut dikumpulkan dari Kabupaten Brebes.1. Sedangkan jumlah tunas dalam stoples (7. jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian.6 juta ton per tahun pada 2014. di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0. Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2.75%).

Rosmiati.e dan stabil setelah jam ke9 sampai ke-12 s. panjang kejutan: 0. mulai berpendar jam pertama – kedua setelah elektroporasi (s. CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. Keratin dan b-actin.Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT.1 second. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati.BPPT. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. daya tahan penyakit. Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV. cytomegalovirus/ CMV. promoter. Alias L.Irvan Faizal****). Alimuddin**). . Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. Makassar **) Departemen Budidaya Perairan-FPIK. Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) . transgenesis. Balai Riset Perikanan Budidaya Air Payau.5 mili/second. b-actin. dan St. Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. ZPT. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. Sebagai tahap awal dalam rangka produksi rumput laut transgenik. dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. dan sumber karbon yang berbeda. KATA KUNCI: Kappaphycus alvarezii. Fadilah. Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas.e.e).4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%– 10%. puncak jam ketiga – keenam s. persentase sel berpendar rata-rata 10%. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT. Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. Rajamuddin*). Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. Kappaphycus alvarezii Muh. Utut Widyastuti***). jumlah kejutan: 4 kali dan interval kejutan: 0. Pola ekspresi keempat promoter relatif sama.

kappaphycus alvarezii. fusi protoplas . hibridisasi.KATA KUNCI: mutu genetik.

Untuk itu. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. Rekomendasi pencegahan penyakit. rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. Pandeglang . konservasi dan wisata). parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut. khususnya di Kecamatan Sumur. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. I Nyoman Radiarta. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. pembudidaya rumput laut. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG). dan status wilayah kawasan. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. Pada umumnya. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. SIG. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. Erlania. KATA KUNCI: rumput laut. kondisi sosek-ekonomi. taman nasional ujung kulon. Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. Kabupaten Pandeglang.Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir.

Pada media cair. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%.8%).5%). ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0.6%.8% dan 1.0:0. Pada tahap regenerasi massa sel embriogenik. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0.0%. Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan.4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm).0 mg/L. Makassar **) Balai Riset Perikanan Budidaya Air Payau. Alias L. morfologi. embrio somatik. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan. KATA KUNCI : Kappaphycus alvarezii. Pemeliharaan dilakukan selama 8 minggu.0:1. Pada tahap induksi kalus. 0.1 mg/L) dengan konsentrasi agar (0.6% dan 0. dan 1. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis.1:1. Perkembangan selsel embriogenik diamati pada kultur cair.4%. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Rajamuddin*). pengggantian media dilakukan setiap minggu dengan komposisi media yang sama.0 mg/L. dan 0.8%. Andi Asdar Jaya*).4 mg/L. Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen. 0. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. embriogenesis somatik . Tahap (2) adalah regenerasi massa sel embriogenik somatik. KATA KUNCI: keragaman.0:0.0% menghasilkan persentase induksi kalus tertinggi (90%).5:0. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau. 0.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati. kalus.2 mg/L) dengan konsentrasi agar media induksi (0. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid. Ridwan*). Rosmiati. dan 2.6%.5 mm dapat dicapai dalam satu bulan kultur.0 mg/L. 1. adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus. 1. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0. pada rasio IAA: kinetin (0. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii.

Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan.13 ha dan 3. Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn . A-1 (15% tepung rumput laut dan 85% tepung terigu). dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. abu. rasa. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air. dan berpengaruh nyata terhadap rupa dan tekstur. aroma. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. 01-2973–1992 dan SII 0177–1990. Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. denga metode budidaya tali panjang (long line). Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). dan karbohidrat) dan uji organoleptik. rumput laut. Hasnawi. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau.780. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam pengembangan. protein.24 ha. Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. KATA KUNCI: program-program pokok strategi pengembangan. produksi pada tahun 2008 sebesar 750 ton. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. kadar abu. Parameter mutunya adalah kandungan zat gizi (air. A-2 (30% tepung rumput laut dan 70% tepung terigu).143. Mery Sukmiwati. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. lemak.

KATA KUNCI: rumput laut.85%. gizi. crakers. uji organoleptik .

02% serta 44.78% sehingga memiliki faktor konversi berturutturut sebesar 2.09 dan 90.15 dan 19. . namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya. Kebutuhan kapur untuk tambak di Kabupaten Mamuju berkisar antara 1.28% dengan rata-rata 7. Rachmansyah. Peubah kualitas tanah yang diukur adalah: pH . Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat POS S dan berkelanjutan. S POS . Penelitian ini bertujuan untuk melakukan analisis . bahan organik dan berat volume tanah.02. KATA KUNCI: kebutuhan kapur. Program ArcView 3. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0. pH F . Kapur S P KCl POSpertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur.2 digunakan untuk pembuatan peta distribusi tanah. S . tanah.884 g/cm3 tanah berkisar antara POS dan S 0. dan Anugriati Balai Riset Perikanan Budidaya Air Payau.71 g/cm3 dengan rata-rata 0. Adang Saputra. Kebutuhan kapur didasarkan pada tanah dengan POS nilai S mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI S POS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa.30 dan 1.32 dan 113. Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta.29 ton/ha 3 CaCO dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya. tambak. Oleh karena itu. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia.614%. S . berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra POS S ALOS FOX AVNIR-2 akuisisi 28 Juli 2009. Maros ABSTRAK Kabupaten Mamuju. pirit.60 dan 36. ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting.36 dan 3.

SIG. Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan. analisis spasial. inderaja. Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut. infrastruktur (jalan) dan sebaran penduduk. Maluku .spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG). Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan. KATA KUNCI: budidaya laut. klorofil-a dan suhu permukaan laut).

dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Adang Saputra**). Sukamandi ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. Wartono Hadie**). Jakarta **) Pusat Riset Perikanan Budidaya. konversi pakan serta pertumbuhan yang cukup baik. KATA KUNCI: minapolitan. Evi Tahapari***). hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya.Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*). udang. Jakarta **) Pusat Riset Perikanan Budidaya. peningkatan pendapatan. dan analisis usaha perikanan. rumput laut. tambak terbengkalai. analisis komoditas. analisis location quotient. Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara.400 m2 selama 3 bulan pemeliharaan. KATA KUNCI: produktivitas tambak. analisis komoditas unggulan dan andalan. Kabupaten Brebes . Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. Introduksi kaji terap dilakukan dilahan seluas 2. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. b a nd en g LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Di samping itu. Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut. udang dan bandeng. dan Sularto***) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Hatim Albasri**). ikan patin. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak.

Hydraquent dan Sulfihemits untuk kategori Kelompok Besar. rumput. pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent. nipah (Nypa fruticans). kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. paku laut (Acrostichum aureum). pirit.25 m dan 0. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). OXS P KCl POS karbon organik. S . TPA.50-0. campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. Pada kedalaman 0-0. dan Kamariah Balai Riset Perikanan Budidaya Air Payau. pH dan potensial redoks. kelapa (Cocos nucifera). nipah. penutup/penggunaan lahan. N-total. sagu (Metroxylon sagu). rumput. sagu. TAA.75 m. KCl KATA KUNCI: keragaman. . nipah. Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah. Marsambuana Pirzan. pesisir. Oleh karena itu.25 m tanah jenis penutup/penggunaan lahan api-api.75 m tanah vegetasi api-api. A. Kabupaten Mamuju . Hasil penelitian menunjukkan bahwa. Al dan tekstur. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. bakau. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). Fe. bakau. Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. sedangkan yang dianalisis di laboratorium adalah pH FOX . padi (Oryza sativa). 4PO . rumput. bakau (Rhizophora apiculata).50-0. masingmasing pada kedalaman tanah 0-0.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. tanpa vegetasi. S . Pada kedalaman 0. sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. Kualitas tanah yang diukur langsung di lapangan adalah pHF. tanah. Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. pH . TSA.

tersebar di wilayah pesisir Kecamatan Sungai Pinyuh.272 ha). Data lapangan (fisiko-kimia air dan tanah). nitrit. Oleh karena itu. cukup sesuai (168. walaupun dengan model regresi yang berbeda. sedangkan peubah bebas adalah suhu. Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik. amonia. dan data citra satelit digital. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat. KATA KUNCI: klorofil.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. amonia. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. salinitas. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). nitrit. KALIMANTAN BARAT Utojo. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200. pH. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497.046 dan 22. kualitas air.819 ha). Data sekunder yang diperoleh berupa data iklim. tambak. oksigen terlarut. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil. sedangkan yang kurang sesuai (213.000. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia. Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil. data sekunder.986 ha). nitrat.047 dengan rata-rata 6. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50.077 ha. tambak. dianalisis secara spasial dengan metode PATTERN menggunakan SIG. terdapat di Kecamatan Segedong dan Siantan.398 µg/L. pH. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. KATA KUNCI: kesesuaian lahan. nitrat. Sungai Kunyit. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. dan bahan organik total. Mempawah Hilir dan Mempawah Timur. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. fosfat. Pada umumnya yang tergolong sangat sesuai (114.000. dan fosfat. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. Akhmad Mustafa. Sulawesi Barat .

Jakarta. Kultivasi Dunaliella sp. 5:4. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP. Dunaliella. dilakukan di dalam bak. kolam. penghitungan kelimpahan.. dan BOD5. 2002 dan Dayananda et al. Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9.bak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. total bahan organik (TOM). pupuk. minyak nabati . Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5. Tidak terdapat perbedaan nyata (P>0. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya.5 mg/L. Kultur ini ditempatkan diluar ruangan. indeks diversitas dan keseragaman spesies.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6. Spesies dominan adalah Limnaea sp. Bogor. ekstraksi. Analisis kandungan minyak nabati Dunaliella sp.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar. Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. KATA KUNCI: mikroalga.. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp.0 sel/mL. BRPBAT. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung.). Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. dengan menggunakan cara modifikasi (Banerjee et al. dan penghitungan dilakukan di laboratorium. 2006). Parameter kualitas air yang diamati adalah suhu. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0. dan Nematoda.. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda.60% menggunakan perlakuan pelarut hexana. Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8. DO. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda.75). pH. dan 6:3.02–8. kemudian 6. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan. Analisis data dilakukan secara deskriptif untuk komposisi jenis.. KATA KUNCI: makrobentos. kecerahan. Chironomus sp. Proses pengayakan termasuk penyeleksian. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan. identifikasi.

Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. Berdasarkan perhitungan statistik ANOVA. dan pH. dengan skor 19. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. Departemen Pertanian. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. salinitas. braunii. 02 sel/mL pada sistem outdoor. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. KATA KUNCI: kepadatan. laju pertumbuhan. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut.25/ hari pada indoor dan 3. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. Metode penelitian menggunakan metode survei. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. KATA KUNCI: ketahanan pangan. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. Pengolahan data dilakukan secara deskriptif.65/hari pada outdoor.37. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. rawan pangan.33 sel/mL pada sistem indoor dan 7. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3. Botryococcus braunii . salah satunya adalah Desa Merakan di daerah Jawa Timur.

tes katalase dan oksidase dilakukan sebelum uji PCR.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. pembudidayaan. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. kemungkinan merupakan strain yang tidak pathogen. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. Infeksi bakteri. penanganan aspek teknis. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. uji PCR. Isti Koesharyani. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. KATA KUNCI: unit usaha. profitabilitas. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. Sedangkan dengan menggunakan spesifik primer. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. KATA KUNCI: Aeromonas hydrophila. penanganan aspek teknis. pengelolaan bisnis. aerolysin dan primer spesifik . strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. dan Balai Budidaya Laut (BBL) Ambon. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. Bakteri merupakan salah satu penyebab penyakit pada ikan. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Uji awal berupa pengecatan gram. sehingga AH-26 merupakan isolat yang pathogen.

masing perlakuan 5 kali ulangan. yaitu 4423. Masing. Winarlin. Waduk Cirata .91. namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar.860. Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat. Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A).81 (ind/cm2) dan 0. kedalaman 2 meter (B). Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman. periphyton.Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti.Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat. KATA KUNCI: kedalaman. kedalaman 3 meter(C) dan kedalaman 4 meter (D). Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m). Ani Widiyati.

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. sintasan terendah didapatkan pada salinitas 12 ppt.masing perlakuan menggunakan 2 ulangan. KATA KUNCI: streptococcosis. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*). Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. dan 12 ppt (11–15 ppt). Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). Cianjur Wildan. Jakarta **) Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. ikan nila. sintasan. pertumbuhan . Sidi Asih***). Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. salinitas. 8 ppt (6–10 ppt). responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. lebar 40 cm. telah banyak menginfeksi ikan nila. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. dan Sutisna Kuningan. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. ikan mas. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur.Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. Masing. Hary Krettiawan*). Bogor *) ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium. Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. Akuarium yang digunakan berukuran panjang 60 cm. dan Achmad Sudradjat*) Pusat Riset Perikanan Budidaya. Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. Majalaya. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. dan tinggi 40 cm dengan ketinggian air 15 cm. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas. KATA KUNCI: strain.

Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan September. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. ikan belida yang banyak hidup di perairan umum Sumatera. yang diberi sekat jaring nilon hita. Iwan Malhani Al’Wazan. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4. pakan. dan kalimantan. dengan jangka waktu pengembalian modal selama 3.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. anakan ikan nila . KATA KUNCI: budidaya. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september . Dalam hal dukungan dana permodalan.36.53.November 2009. KATA KUCI: ikan belida. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan.64 sedangkan FCR total sebesar 1. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan. Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. Pemeliharaan ikan belida dilakukan di kolam. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. Jakarta ABSTRAK Ikan karnivor.20 siklus dan nilai RC ratio sebesar 1. Jawa. termasuk jenis ikan karnivor. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. ekonomi.

Dalam kegiatan budidaya ikan. pelet maggot . pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma. Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. yang dikenal dengan nama PKM (palm kernel meal). KATA KUNCI: ikan belida. adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. Selama proses adaptasi pada kolam pemeliharaan. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. Jakarta **) Balai Riset Perikanan Budidaya Air Tawar. jaring tancap dan keramba jaring apung. Untuk menguasai teknologi domestikasinya. palm kernal meal.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) Pusat Riset Perikanan Budidaya. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya. kurang lebih 60% pengeluaran berasal dari pakan. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. KATA KUNCI: ikan nila. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva. Budidaya ikan nila dapat dilakukan di kolam.

sintasan. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan. Fris Johnny. 05) tidak mempengaruhi sintasan.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. Padat penebaran yang digunakan sebagai perlakuan adalah 100. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi. Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia. 05. 65 g/ ekor. baik disebabkan oleh infeksi virus. 25 – 1. ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. sedangkan kontrol hanya disuntik dengan PBS. dan 200 ekor/m³. Pendederan ikan kerapu macan. Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. KATA KUNCI: vaksin bakteri. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster.150. Masingmasing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bak. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. Epinephelus fuscoguttatus. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. KATA KUNCI: pertumbuhan. penyakit infeksi .1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. bakteri maupun berbagai jenis parasit. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. 95 – 2. dan Zafran Balai Besar Riset Perikanan Budidaya Laut. Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. Rasio konversi pakan 1.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol.bak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). Masing-masing perlakuan diulang 3 kali. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga.

KATA KUNCI: kerapu raja sunu. dan pada induk asal alam 20-92 % dengan SAI 2. dengan jumlah 8% biomass/hari. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2. Supii.80. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut.240. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 .25-4. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³. Agus Priyono. Kualitas telur yang dihasilkan relatif masih fluktuatif. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya. dan (B) Induk asal alam. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. Plectropoma laevis. Ketut Suwirya. Apri I. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh. Tridjoko. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan.000 butir. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya.000 butir. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet.20.520 µm. aspek biologi reproduksi .450.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. indeks somatik gonad dan diameter oocytnya. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad.004.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya. Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam.

dengan periode pemeliharaan120 hari. dan N. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. Peubah yang diamati adalah sintasan. Rudy Gustiano. Hasil penelitian menunjukkan bahwa laju pertumbuhan. Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. pertambahan berat. Himawan Tirta Yudha. dibandingkan dengan perlakuan lainnya.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. Kata kunci : Jaring apung. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. tawes . sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). total biomass dan biaya pakan. konversi pakan. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi. pertambahan berat. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA. Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. (1988).A. tengadak albino. Giri Balai Besar Riset Perikanan Budidaya Laut. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. KATA KUNCI: truss morfometrik. ikan tengadak. pertumbuhan. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini.

33%). dan Scirpus sp.5%–90.5 mg/L). nitrogen.7–1. akut.82%). pemakaian insektisida perlu dilakukan secara selektif. amonia (20. dan nitrat (37. khususnya ikan.lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8. Perlakuan pada penelitian ini terdiri atas dua perlakuan.849 mg/L) dan nitrat (0. Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen. Sintasan (93. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan. juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut.4%) pada kolam substrat 1 (pasir. Untuk itu.14%–92. meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan.5%–66. Typha sp. karbofuran. KATA KUNCI: substrat. amonia (0.11%–44. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7. kronis .Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar. yaitu TN (42. karena di samping harus efektif terhadap hama tanaman padi.36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0.5 mg/L).82%).303–1. produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar.58%). Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan. Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat.5–14. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar.05). KATA KUNCI: toksisitas.86%–85.8 mg/L). Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi. Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi. yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air).67%).681mg/L) dan nitrat (0. Kisaran persentase efektivitas penyisihan TN (28%– 58. dan nitrat (11.081–0.4–0. kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat). tumbuhan air.32 %). Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0. amonia (0.05) dibandingkan kolam ikan kontrol (82.). amonia (42. Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya.3 mg/L).

dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp.00–20. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain– Jenssen.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar. (d) garam 4. Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar. sehingga upaya pengendaliannya sering terlambat. limpa. Oleh karena itu. 39 M1: T T dan primer M2: PreT (AATGGGCGCAAGCCTGATG) dan (ACCGCTACACCAGGAAT) digunakan pada penelitian 43 531 T ini. selanjutnya dibandingkan dengan teknik diagnosa melalui uji bio. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya. yaitu (GCGAACGGGTGAGTAACACG) dan (TGCACACAGGCCACAAGGGA).00 mg/L. Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan. yang telah dikembangkan oleh 13 beberapa peneliti.kimia dan histopatologis.000. dan Quadriacanthus kobiensis serta menimbulkan kematian. mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. Gyrodactylus.00 mg/L (g) kontrol. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. sedangkan preparat histopatologi diambil dari organ hati.00 mg/L.00 mg/L efektif untuk memberantas Trichodina dan monogenea.00 mg/ L. ginjal. (b) biji teh 15.00 mg/L dan garam 4. KATA KUNCI: ekstoparasit. (f) garam 6. serbuk biji teh dan garam. Hasil penelitian . hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. Ada beberapa bahan nabati dan alami yang dapat digunakan. (c) biji teh 20. dan darah. Ketujuh perlakuan itu yaitu: (a) biji teh 10. Mycobacterium fortuitum PADA IKAN GURAME. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar.000.000. Dua pasang primer. Dactylogyrus. (e) garam 5. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Trichodina. dan limpa. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy).00–6.00 mg/L.00 mg/L. Pada riset ini. Sensitivitas teknik diagnosa terhadap bakteri target. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10.

Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum.menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi. Mycobacterium fortuitum. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies. dan Polymerase Chain Reactio n . gurame. KATA KUNCI: mycobacteriosis.

Parameter yang diamati yaitu laju pertumbuhan spesifik. Bogor. substitusi.000 unit fitase/kg pakan. rasio efisiensi protein. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya. dan tingkat sintasan. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. pakan ikan beronang. namun nilai ini tidak berbeda nyata dengan 1. guttatu s . masing. efisiensi pakan.500 dan 2. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar.15±5. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. S.73 g dengan padat tebar 15 ekor/keramba. KATA KUNCI: tepung bungkil kedelai.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti.05).000. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap.masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem.60±0.000 unit/kg pakan. nilem. Balai Riset Perikanan Budidaya Air Tawar.000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0. dan 2. efisiensi pakan. KATA KUNCI: fitase. 1. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra.05) terhadap pertumbuhan. C. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0.500. 1.V. dan sintasan ikan beronang. Hasil penelitian menunjukkan bahwa penggunaan fitase 1. tepung bungkil kopra. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan.45 g/ekor. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG. Cijeruk dengan bobot rata-rata 8. pertumbuhan. 500. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang.

Variabel yang diamati adalah pertumbuhan lebar karapas.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak. B. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. 100% pakan buatan/pelet dan C. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif.).02 g. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap.2 mm dan bobot 0.850. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis. pelet. pertumbuhan. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus). KATA KUNCI: budidaya bandeng. 100% ikan rucah jenis ikan tembang (Clupea sp. KATA KUNCI: pakan rucah. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100. sintasan .05) dengan perlakuan yang lain. lebar karapas dan sintasan (P>0. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur). Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot.04 ± 0. rajungan. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. Tjaronge Balai Riset Perikanan Budidaya Air Payau. Maros selama 40 Hari. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. tambak. bobot dan sintasan serta kualitas air.-/tahun/ha. Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut.2 ± 0. 50% ikan rucah + 50% pelet.526. Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan. Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M.

5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. ampas tahu. Erfan Andi Hendradjat.100. pupuk kandang dan dedak.5 x 0.-. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). dan 105 dan dianalisis secara deskriptif. Produksi bandeng pada perlakuan A dan B. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1. 20. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran. Sintasan bandeng pada perlakuan A dan B.5 cm dan panjang tertinggi sebesar 3.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari. Selama pemeliharaan. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B). Pada akhir penelitian (hari ke 105). bandeng. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0.5 cm (ukuran ekspor).5 ton/ha.5 x 0.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Padat penebaran bandeng pada masing. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.467. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. 55.625% dan 60. masing-masing mencapai 986. produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2.6 cm . B/C rasio 1.816%. dan Lili Sholichah Balai Riset Budidaya Ikan Hias. Oleh karena itu. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional.43. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Nina Meilisza. masing-masing dengan dosis 2.98 g/ekor menjadi 232. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0.Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara. 70. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif.5 m dan tinggi air 40 cm.4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B). masing-masing mencapai 56.9 dan 1154 kg/ha. Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2.0 cm dan bobot rata-rata 0. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.009 gram. 35. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. KATA KUNCI: pupuk organik.0 cm.masing perlakuan adalah 15.

pertumbuhan panjang. KATA KUNCI: benih botia.5 cm) . ukuran ekspor 1 inchi (2.dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari.

dan (C) Tubifex sp.32 ± 0. Selama 45 hari pemeliharaan. Pakan diberikan tiga kali sehari yaitu pada pukul 8. dan Culex sp. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar. gonad. ikan diberi perlakuan pemberian pakan alami yang berbeda.00.Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP. memberikan pengaruh yang berbeda nyata (P<0. dengan pertambahan bobot rata-rata sebesar 0. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp. Rendy Ginanjar.0-8. Jakarta *) ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua.24 cm. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula. Depok.9 dan pH 7. Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp.8 (sebagai kontrol). Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal. Hasil penelitian menunjukkan bahwa perlakuan pH 7.00 dan 16.05) terhadap pertambahan bobot rata-rata ikan..01 g dan panjang total rata-rata 3. Depok **) Pusat Riset Perikanan Budidaya. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor.) Eni Kusrini*). Agus Priyadi*). memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp.0.98 ± 0.0 – 6. Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali.. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0. (A) Chironomus sp.05) ..5 – 5. Gigih Setia Wibawa*).09 g dan pertambahan panjang total ratarata sebesar 0. Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5. dan Irsyaphiani Insan**) Balai Riset Budidaya Ikan Hias. pH 6.00 dengan metode pemberian sekenyangnya (adlibitum).0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya. pH pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur.0 – 8. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar. KATA KUNCI: air Melanotaenia sp.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi. (B) Culex sp. 12. namun tidak berbeda nyata (P>0.85 ± 0.50 ± 0. Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya.

pakan alami.terhadap rata-rata pertambahan panjang total dan sintasannya. KATA KUNCI: Benih ikan pelangi. pendederan. pertumbuhan. sintasan .

Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari. D.13±0. Rendy Ginanjar*) Asep Permana*).67 mm. Prancis *) ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. Pakan yang diberikan selama penelitian adalah nauplii artemia. . ketersediaan pakan dan padat penebaran.22% dan E. 96.02 g. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). 96. C. KATA KUNCI: Metynnis hypsauchen. B.02 cm dengan bobot 0. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi. Indonesia **) Institute Recherche Pour Le Developpement.45%. padat tebar. D. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). 25 ekor/liter. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia. 97. Sintasan dari masing-masing perlakuan adalah sebagai berikut: A. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi. Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan.67%. B (2 ekor/L).05) terhadap pertumbuhan. 96. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). tetapi berpengaruh nyata (p<0.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*).07%.81%. 30 ekor/liter dan E. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali. Lili Sholichah*). Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap. Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan.22±0. Marendra Gladiyakti**) *) Balai Riset Budidaya Ikan Hias. Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. resirkulasi. 35 ekor/liter. 20 ekor/liter. Ikan uji yang digunakan adalah benih berukuran panjang 2. B. dan Jacques Slembrouck**) . 15 ekor/liter. pertumbuhan. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan. C. 95. Balai Riset Budidaya Ikan Hias Depok. Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. Depok **) Universitas Diponegoro.

padat tebar . sintasan.KATA KUNCI: ikan botia.

salinitas dan arus. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. air tersedia dalam jumah yang cukup. biokonversi. Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. Ikan Sidat (Anguilla sp.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. sedangkan factor eksternal yaitu. memiliki bak kultur. Unit produksi maggot memiliki prasyaratan sebagai berikut. fisiologi dan tingkah laku dalam merespon perubahan lingkungan. makanan. Kawasan Mina Pakan Mandiri. dan homing atau reproduksi. area penjemuran atau alat pengeringan pakan (drying). Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. memiliki bak untuk restokin. KATA KUNCI: Phenotipic plasticity. KATA KUNCI: maggot. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. 2) unit pengolahan pakan dan 3) unit budidaya. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. ketersediaan pakan dan pemasaran. Migrasi terbagi menjadi migrasi vertical dan horizontal. memiliki mesin pelet. Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. lunar. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. bahan pakan seperti vitamin dan dedak. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. Unit budidaya ikan memiliki prasyarat sebagai berikut. kolam budidaya dan manajement budidaya yang baik. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot. Unit pengolah pakan memiliki prasyarat sebagai berikut. propinsi Jambi. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri.) . Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). Ikan migrasi. temperature.

Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*). Oreochromis niloticus . Sukamandi. untuk mengamati variasi genetik benih persilangan ikan nila.15%). Persilangan. sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST. Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. nila merah (Red NIFI). Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan . Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD). jarak genetik. Selain itu. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.mossambicus).mossambicus). Iman Rusmana**).236 – 0. dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. mujair (O.40 mM dan 0. terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&).h-1 dan 0. NIRWANA (nila ras wanayasa).28 mM. Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. Jarak genetik 15 populasi persilangan berkisar (0. dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. Didik Ariyanto.Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan. Ikan yang di gunakan adalah hasil persilangan 4 strain. terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair).26% – 63. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. tetapi yang menghasilkan benih hanya 15 populasi. Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik. Kata kunci: Randomly Amplified Polymorphic DNA (RAPD). Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi. Aktivitas reduksi nitrat terjadi dari awal inkubasi.h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. mossambicus) Nunuk Listiyowati. dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.16 mM. nila BEST (Bogor Enhancement Strain of Tilapia). juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut. Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi.560). Hasil dari persentase polimorfik (berkisar 5. Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan.17 mM. Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi.

reduksi nitrat .dengan Pseudomonas aeruginosa. Kata kunci: denitrifikasi. nitrogen anorganik.

sebagai bahan baku pakan ikan patin. nutrisi dan serat kasar .74% menjadi 5. distibusi. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. 6 hari (D3). Pada tahap pembentukan mata. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. Osphronemus goramy. fermentasi. Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia.91% menjadi 15. UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan.8%. rasio inti sel:sitoplasma yang besar. Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia. KATA KUNCI: Bacillus sp.) Priadi Setyawan1). menurunkan lemak bungkil sawit dari 14. Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma. migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP.37% dan meningkatkan kadar protein dari 13. Sukamandi **) Universitas Jenderal Soedirman. Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral. 4 hari (D2). 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17.37% setelah proses fermentasi. Isdy Sulistyo2). Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. PGC terdistribusi secara berkelompok di bagian ventral. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. bungkil sawit.09% menjadi 4.. KATA KUNCI: PGC.

Tipe integrasi bersifat soliter. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. salah satunya melalui Catfish Club Indonesia. dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). Eni Kusrini****). Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. Jakarta **) Pusat Riset Perikanan Budidaya.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. patin. dkk. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. Angela M. Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT). Lusiastuti***). 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. dan kluster pemeliharaan larva dan benih. setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. Depok ABSTRAK Ikan patin (Pangasius sp. integrasi. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. Pengambilan data melalui responden dilakukan dengan cara purposive sampling. demikian juga ditinjau dari segi higienis dan kesehatan benih. pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. dengan masing-masing hatchery terpisah lokasinya. kluster penetasan telur. di antaranya daerah Bogor dan Subang. Jakarta ***) . Subang. Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja.Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP.Balai Riset Perikanan Budidaya Air Tawar. Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil . KATA KUNCI: UPR. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi.. kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. Bogor ****) Balai Riset Budidaya Ikan Hias. Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik.1994). Perbedaan dari kedua sistem ini adalah sifat produksinya. dan Labuan (Merak). Wartono Hadie**). Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran.

kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa. sebagai materi kegiatan tahun mendatang. KATA KUNCI: ikan nilem. jantan fungsional. betina homogamet . sex reversal.persilangan dengan jantan fungsional yang tidak dilakukan sex reversal.

KATA KUNCI: seleksi generasi. salinitas. oksigen terlarut/DO. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. Agus Priyono. Diketahui estimasi nilai heritabilitas rata-rata h²( + ) = 0. kepadatan. Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744.1. ikan mas strain rajadanu . 10 butir/liter (perlakuan H). amonia. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar. 15 butir/ liter perlakuan (I). KATA KUNCI: sintasan. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. dan nitrit). larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. Informasi mengenai kepadatan larva yang optimum belum banyak diketahui.Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. M H Fariddudin A. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva).2 gram. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. sintasan dan kualitas air (meliputi suhu. intensitas cahaya. Anang H K. memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut.27 pada ukuran konsumsi S D dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19.57 % dalam satu generasi. pertumbuhan. pH.

bakteri probiotik. Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik. Klaten.dan Tasikmalaya. penyakit streptococcosis . KATA KUNCI: antibakteri. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus).Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. Survei dilakukan di beberapa daerah yaitu Cianjur. dan Lila Gardenia Pusat Riset Perikanan Budidaya. Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. penanggulangan. Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. eksplorasi. Hambali Supriyadi.

Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). Untuk menjamin keberlangsungan usaha budidaya kerang hijau. Erlania. KATA KUNCI: kerang hijau. di perairan Panimbang Kabupaten Pandeglang. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. budidaya laut. Kabupaten Pandeglang. Teluk Lada. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. Pandeglang . Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. Secara umum. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau. Provinsi Banten. Kabupaten Pandeglang. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. Hatim Albasri. SIG.

padahal permintaan cukup besar. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP. kelompok kedua adalah penghasil benih. . Bali. tingkat kesembuhan.Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. Imron**). dan diferensial hemosit. dan Jatim.) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk.. Carchecium sp. Jateng.. kelompok kedua adalah BBU Pamarican (Jabar). Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro. Retna Utami**).Wartono Hadie*). STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*). Zoopthalmium sp.. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). serta UPR yang mengembangkan usaha perbenihan udang galah. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76. Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP SamasYogyakarta. BBUG Klungkung. Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. induk. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya.. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas. Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol. Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp.. BBAP Samas-Yogya(Jateng).42%.UPU Probolinggo (Jatim). dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya.Bali. dan kelompok ketiga ialah pembudidaya. dan Spiranura sp. Parameter yang diamati meliputi pemeriksaan parasit. dan Opercularia plikatilis. BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset. Ikhsan Khasani**).Forum Inovasi Teknologi Akuakultur 2010 pK 01 1. Vorticella sp. manajemen.). Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. dan kelompok ketiga ialah pembudidaya. kelompok kedua adalah penghasil benih. KATA KUNCI: udang. tingkat sintasan. Bali. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. sedangkan dari kelompok protozoa adalah Epistylis sp. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan.

KATA KUNCI: huna (Cherax sp.). tembakau (Tobacum nikotiana) .

5 g.8 kg dan kelangsungan hidup 100 %. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. Pemeliharaan dilakukan selama tiga bulan.6 kg/ha. KATA KUNCI: vaname. pemberantasan hama. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. Sebelum penebaran.1 kg dan kelangsungan hidup 11. Karawang. Dengan teknologi yang diterapkan. salinitas rendah. penebaran dilakukan setelah satu bulan dari penebaran tokolan. KATA KUNCI: udang windu. yaitu menggunakan tingkat teknologi tradisional plus. produksi 81. tokolan. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang.22% dan 72. pengapuran dan pemupukan. produksi 78. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak.500 m2 digunakan untuk percobaan. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. Idil Ardi. namun polikultur udang vaname dan rumput laut masih kurang informasinya.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. Empat petak tambak masing-masing berukuran 3. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54.n pengapuran sebanyak 175 kg/petak. Dari pemeliharaan udang selama tiga bulan. Kecamatan Cilebar. Gracilaria verrucosa. masing-masing dengan dua ulangan.2 %. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan.000 kg/ha rumput laut. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2. polikultur. survival rate. pengeringan. dan Wartono Hadie Pusat Riset Perikanan Budidaya.66% dan 108. yaitu pertambahan berat rata-rata 230 g. Penelitian ini dilakukan pada tambak di daerah Betok Mati.84 kg/ha. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. kemudian dikeringkan sekitar satu minggu. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35. sedangkan pada dua bulan berikutnya diberi pakan pellet udang. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. pada bulan pertama udang tidak diberi pakan. produksi . namun berbeda tidak nyata (P>0. dilakukan pengolahan tanah tambak. Setelah dua hari. Hewan uji yang digunakan adalah udang vaname PL-48.

05) terhadap kelimpahan dan jumlah jenis plankton. pola intensif. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. Hal tersebut perlu mendapat dukungan dari penelitian. 25. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. menggunakan bak kayu ukuran 1 m x 1 m x 0. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. pola tradisional. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. kotoran. dan Rotatoria. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon).000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. Dinophyceae. Pada budidaya udang vaname pola tradisional plus. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. indeks keseragaman menunjukkan komunitas plankton pada . dan metabolit udang. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. pelakuan B = sagu.6 m sebanyak 12 buah. dan perlakuan D = tanpa sumber karbohidrat. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. KATA KUNCI: tepung tapioka. masing-masing dengan 3 ulangan. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus.3 g dengan padat tebar 50 ekor/bak. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. dan Cyanophyceae. perlakuan C = tapioka. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka. Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. Pada budidaya udang windu intensif. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. Polychaeta.

perlakuan D relatif lebih merata dibanding perlakuan lainnya. KATA KUNCI: plankton. udang windu . indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil. probiotik.

Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. sintasan. serta Oscillatoria dari kelas Cyanophyceae. KATA KUNCI: probiotik. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. indeks keseragaman. pH. B = 2 mg/L.000 ekor/petak). sintasan. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0. BOT. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau.05) terhadap pertumbuhan udang vaname.5 m dengan volume air 400 L. Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. NO . Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname.05) terhadap jmlah jenis dan kelimpahan plankton. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea.05) pada sintasan dan produksi udang vaname. perlakuan B = kotoran sapi. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. PO . Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin. pertumbuhan. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. NO .Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. dan Pleurosigma dari Kelas Bacillariophyceae. Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing- . Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. indeks keragaman. Nitzschia. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik. dan perlakuan C = dedak padi halus. Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas. namun berpengaruh tidak nyata (P>0. C = 4 mg/L. Abdul Malik Tangko. setiap 15 hari. dan produksi udang vaname. Hasil penelitian menunjukkan perlakuan berpengaruh tidak 4 2 3 nyata (P>0. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0. oksigen terlarut. dan indeks dominasi plankton selama pemeliharaan udang windu. suhu. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula.

pupuk organik. udang windu.362).427).masing: indeks keragaman (1.199–1.780) dan indeks dominansi (0. KATA KUNCI: dinamika plankton. tambak .324– 0.689–0. indeks keseragaman (0.

udang windu .2 cm dan bobot awal 0. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau.. Substrak tanah tambak. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak. Substrak tanah lumpur.. biaya pakan pada perlakuan A dan B masing-masing Rp 11. umur pemeliharaan.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A).984.0±5.05) antara perlakuan substrak tanah tambak.14 dan 2. KATA KUNCI: substrak. dan substak tanah lumpur.8±0. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari. B.dan Rp 19.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2. Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan.650. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan. substrak tanah sawah. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda. biaya produksi.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau.875. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan. budidaya. di mana masing-masing perlakuan diulang tiga kali..sedangkan pada perlakuan A dan B masing-masing 2. Substrak tanah sawah. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak.3±1.239. Perlakuan yang diujicobakan dalam penelitian ini adalah A.5 dan 21.634. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28.24. masing-masing dengan dua ulangan.6.01 g. dan C. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak). udang pama. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak. Machluddin Amin.03±0. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka. KATA KUNCI: efisiensi. Penelitian dilaksanakan pada tambak ukuran luas 4. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0.

kisaran produksi 12.7% dan perlakuan C = 36.64 kg/bak atau rata-rata 11. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau.4 ± 0.0 ± 2. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan.7%. Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48.998. di mulai setelah satu minggu penebaran.7 kg/500 m2 = 320 kg/ha.235 kg/ha).3 ± 7. Namun demikian. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2.86 kg/bak (8. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah. Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan. ukuran 84 sampai dengan 89 ekor/kg) dan C (16. lebar dan kedalaman secara berurutan adalah 10 m. lebih tinggi daripada perlakuan B = 41. pertumbuhan udang.15%. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C). Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan.7%. namun tidak berakibat terjadi kematian massal. Maros.767. Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2. Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B).6 kg/500 m2 = 406 kg/ha.86 g/ekor.92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90. kisaran produksi 9. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah. KATA KUNCI: tepung tapioka. B). dengan rata-rata berat 11.61%. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25. masing. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah.66 g/ekor.5 m dan 1 m.masing bak mempunyai ukuran panjang. ukuran 80 sampai dengan 96 ekor/kg).28-13.6813.2 kg/500 m2 = 506 kg/ha. dengan rata-rata berat 12. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar.975 dan lebih .3 ± 5. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.66 kg/bak (7. 1. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91.2 ± 13. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan.1 ± 13. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20. fermentasi probiotik.45 kg/bak atau rata-rata 12.

325. salinitas rendah .rendah dibandingkan perlakuan B yang mencapai 1. udang vaname. KATA KUNCI: molase.

C. Penelitian II pengujian probiotik B. sedangkan juvenil dan udang dewasa hidup diperairan tawar. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol). Nitrosomonas sp. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F. sebagai dasar perbaikan sistem penyediaan larva udang galah. Q. yaitu probiotik A (mengandung bakteri Bacillus sp. 1995). Masing-masing perlakuan diulang sebanyak empat kali.) dan probiotik B (mengandung bakteri Bacillus polimyxa. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab. dan kontrol 66. Pemberian probiotik A dengan konsentrasi 0.001 mL/L. dan D.. Dengan meneliti dua jenis probiotik. 85%.). Kontrol (tanpa pemberian probiotik B). Universitas Padjadjaran. Pengaruh perlakuan terhadap sintasan. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter). Pemberian probiotik B dengan konsentrasi 7. dan pertumbuhan udang. Pemberian probiotik A dengan konsentrasi 0. Pemberian bakteri probiotik A (Bacillus sp.5 mg/L. Pemberian probiotik B dengan konsentrasi 2. Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang. karena secara alamiah larva hidup di periran bersalinitas. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62. KATA KUNCI: salinitas. dan R.) berpengaruh nyata terhadap sintasan benih udang windu. 88%.0 mg/L. dan Rhodobacter sp. laterosporus. 5 ‰. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL). sebelum diaplikasikan di tambak. terdiri atas: A. Aplikasi probiotik setiap tiga hari sekali. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz.57 hari . Tingkat sintasan yang diberi probiotik B berkisar antara 63.6±0. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. Penelitian I adalah pengujian probiotik A. dan 0‰ sebesar 11. 10 ‰. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji.002 mL/L. 85%.. Rhodococcus sp.001 mL/L menghasilkan sintasan sebesar 81. Nitrobacter sp.75%–68. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. P. diikuti perlakuan 5‰ sebesar 10±0.003 mL/L. dan tiga ulangan. sintasan. Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata.25%. Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan.5 mg/L.25%.75%. B. waktu inkubasi. Pemberian probiotik A dengan konsentrasi 0. Pemberian probiotik A memberikan pengaruh terhadap rata-rata .0 hari. udang galah. Kontrol (tanpa pemberian probiotik A)..50%. B. Pemberian probiotik B dengan konsentrasi 5..3±1.Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Parameter yang diukur adalah kualitas air. Pemberian bakteri dengan konsentrasi 0. terdiri atas: O.) yang berukuran PL-20.15.

001 mL/L menghasilkan pertumbuhan tertinggi (0. kualitas air.3660 g. pertumbuhan .8935 g). sintasan.4255–0. pemberian dengan konsentrasi 0. KATA KUNCI: probiotik. udang windu. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata.pertumbuhan mutlak benih udang windu. Ratarata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0.4440 g dan kontrol 0.

sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. 15 ppt. 20 ppt. KATA KUNCI: pertumbuhan.09 cm. Ditinjau dari keragaan pertumbuhan. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi.05). Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. 10 ppt. 10 ppt (kontrol). PCR. salinitas. Sukamandi. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. udang galah . dan ukuran templat. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3). pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3.33±0. Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. konsentrasi. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau. 25 ppt. diantaranya karakteristik templat DNA genom yang meliputi kemurnian. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.67%. Hasil yang diperoleh adalah pada salinitas 5 ppt. KATA KUNCI: Macrobrachium rosenbergii. Selain itu.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. dan 20 ppt sintasan dari post larva udang galah mencapai 100%. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. sedangkan sintasan pada perlakuan 25 ppt mencapai 61. dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor. 15 ppt. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. yaitu templat dengan berat molekul tinggi (1).92±0.13 cm dan 1. Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. Guna mendukung prgoram revitalisasi tambak.

kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. manipulasi lingkungan. maupun lebar karapas (P>0. Pakan diberikan dua kali sehari selama penelitian. Sintasan yang diperoleh pada penelitian ini yakni 52%–54. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen. kepiting lunak . baik pertumbuhan bobot. Oleh karena itu. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. KATA KUNCI: pergantian kulit. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan.66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. panjang. dan gabungan keduanya (C).5%. Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau.Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. KATA KUNCI: kepiting bakau. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. kepiting bakau. ikan rucah (B). Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. Dari pencapaian bobot ini.05). pemberian pakan. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). Sulaeman. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). Berdasarkan persentase. Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet.

pengrusakan mangrove juga terus berlangsung oleh berbagai alasan. sintasan. bobot. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰— 4 9‰) mengakibatkan sintasan dan produksi rendah. Hasnawi.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. sehingga perlu riset budidaya rajungan pada musim kemarau./m2.000–1. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi. Dibalik manfaat mangrove yang demikian banyaknya. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009.2 mm dan 0. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.5 bulan dengan panjang dan bobot masing-masing adalah 8. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau. dan produksi serta parameter kualitas air. jumlah permudaan 450–500 pohon/ ha. Tambak ditebari benih rajungan.7 cm dan 4. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi. tambak bersalinitas tinggi.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1. Tambak yang digunakan berukuran 10. KATA KUNCI: kerapatan hutan mangrove.02 g dengan kepadatan 1 ind. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1.100 pohon/ha. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. Ikan bandeng yang digunakan adalah gelondongan umur 1. rumput laut dengan kepadatan 1. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan.2 g.573.1±0. sintasan.000 ekor/ha ukuran crablet-30. dan pelestarian alam. restoking kepiting bakau. KATA KUNCI: rajungan. Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa.05±0. produksi . peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya. Peubah yang diamati adalah pertumbuhan lebar karapas.2 ± 2.300 pohon/ha dengan rata-rata 1. data yang diperoleh dibahas secara deskriptif. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari).0 ± 2. pertumbuhan. perlindungan.04 ha. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1.000 m2. Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan.

dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. cukup layak dan tidak layak. kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan. Adang Saputra. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). bioakumulasi. Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. KATA KUNCI: Danau Maninjau. SIG. Secara umum. rumput laut. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. kondisi perairan sangat mendukung pengembangan budidaya rumput laut. Kappaphycus alvarezii. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. Anjang Bangun Prasetio. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. I Nyoman Radiarta. Provinsi Gorontalo. Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara.Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan). DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010. layak. Secara umum. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0.03 mg/L. logam berat . Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. KATA KUNCI: minapolitan. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. Untuk memfokuskan kegiatan budidaya rumput laut.

Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. dan plankton dilakukan seminggu sekali. BBRPBL Gondol . outlet.0760. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet.853. Supii. Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. Subang. DO. alga hijau biru dan alga hijau). GONDOL-BALI Apri I. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT. Sampling air secara regular untuk pengamatan fisika. dan Erlania*) *) Pusat Riset Perikanan Budidaya. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan.962. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. Dara Kasih**). inlet. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air.7112. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. KATA KUNCI: alga perifiton. Nitzschia sigma. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. indeks keseragaman berkisar antara E=0. Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. nitrit. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut. Subang. Kualitas kimia air untuk pH.814-0. TSS. N. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. tambak. SUBANG Joni Haryadi*). sedangkan indeks dominansi berkisar antara D=0. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. Perifiton yang terdapat di Tambak Blanakan. kimia. Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. Indeks keanekaragaman berkisar antara H’=2. Adi Hanafi. 20 dan 30. KATA KUNCI: kualitas air.085.

yaitu: ikan mas (5. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp. dan 1. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur. 1. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi.900 g sedimen + 20 g TSP. Data dianalisis secara deskriptif.96 ±1. P. volume air 500 L. KATA KUNCI: limbah. dan bawal adalah 1.48%–9.17% dan 8.53%) dan ikan bawal (8.. Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g. Bogor. Pengukuran N dan P dilakukan pada ikan dan pakan.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin.88–1. serta produksi Moina sp.78%).73–1. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan. kelimpahan. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP. nila (Oreochromis niloticus) dan bawal (Colossoma sp. ikan nila. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp. dan keanekaragaman plankton.89%–17. yang terdiri atas: 9 jenis pakan untuk ikan mas. Ani Widiyati. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan. limbah hara N dan P .23%–6. Parameter yang diamati adalah jenis. dan 3). 1. 2). dilakukan pada hari ke-8 sejak dilakukannya penebaran.83– 1. Perlakuan adalah pemupukan dengan perbandingan N. akuaponik.89% dan 11. K = 16:20:0.71%– 10. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio). Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan. Kusdiarti. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan. indek dominasi.90. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP .58%–13. ikan nila (3. 9. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas. 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP.) di laboratorium. Panen Moina sp. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm.89. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal.63% dan 10.87.dengan produksi Moina sp.53%–15.16 g.21%). KATA KUNCI: konversi pakan.

4. Postulat Koch. Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit. KATA KUNCI: Streptococcus agalactiae. Oreochromis niloticus. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani PongMasak Balai Riset Perikanan Budidaya Air Payau. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S. Isolat 1. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015. namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. Bogor **) Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. Sukenda***). Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. dan NK1 (5) yang berasal dari organ otak. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. . Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah.6 juta ton per tahun sekarang ini menjadi 7. Oleh karena itu. Hasil yang diperoleh. mata. Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian. N17O (4). Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S.Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*). sehingga dapat meminimasi kegagalan panen. Esti Handayani Hardi**). dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur. khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. Produksi rumput laut ditargetkan meningkat dari 2. agalactiae setelah dilakukan uji Postulat Koch. Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. agalactiae. di laut dan Gracillaria sp. N14G (3). Budidaya rumput laut khususnya Kappaphycus sp. Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir.1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. N4M (2).6 juta ton per tahun pada 2014.

pencegahan . hama.KATA KUNCI: rumput laut. penyakit.

Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009.1113 mg/L.32 ha.33 ha. Rachman Syah. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. demikian pula dengan karakteristik físika dan kimia oseanografinya.90 ppt. pH antara 6. Syarifuddin Tonnek. kurang sesuai 2. oksigen terlarut 5.85 mg/L.0032–0. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI.039–0. suhu 29.57°C–30.695. salinitas 36. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya.610.09 mg/L. .0267–0.0037 mg/L. KATA KUNCI: potensi. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara. besi 0. dan total suspensi <25–80 mg/L. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir.10– 36. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian.0008–0. fosfat 0.685 mg/L. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari.820. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau. kedalaman 1–40 meter. Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27. nitrat 0. nitrit <0. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka. KARAKTERISTIK.Indra Jaya Asaad.81–6. karakteristik. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka.30 ha dan tidak sesuai 3.02–9. Petrus Rani Pong-Masak. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan. Pengumpulan data primer dilakukan dengan cara wawancara mendalam. kesesuaian rumput laut.37.095. analisis hierarki proses.95 ha. dan Makmur Balai Riset Perikanan Buddidaya Air Payau.38–44. Mudian Paena. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden.01169 mg/L. bahan organik total 37. Penelitian ini bertujuan untuk mengetahui potensi. dengan tingkat kesesuaian lahan sesuai 21.3 meter.1–8. Kabupaten Kepulauan Selayar.66°C. Kata kunci : Opsi pemanfaatan wilayah pesisir.

lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. Kata kunci : kualitas perairan. yaitu : faktor infrastruktur dan kondisi perairan. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau.Indra Jaya Asaad. Cakupan wilayah penelitian meliputi Teluk Hurun. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. Utoyo. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. konduktivitas.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA. PO4 dan Fe. dan faktor pasar. pH. tambak. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. Makmur. faktor teknologi budidaya. NH3. NO2. KATA KUNCI: keramba jaring apung. Muhammad Chaidir Undu. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. salinitas. A. Rachman Syah. NO3. Parameter kualitas perairan yang diamati adalah suhu. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor.Indra Jaya Asaad. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. kandungan oksigen telarut. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. analisis faktor. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. Kabupaten Pontianak . Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir.

viskositas 8.0%. Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. TVB. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air. mikrobiologi (Angka Lempeng Total/ALT.25% dan dendeng dengan bumbu ekstrak sebesar 59.32%. kadar abu. natrium alginat. setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. Selanjutnya. dicuci dengan air bersih.4%.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. abu.46%.04 mgN% dan 6. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. dan dijemur di bawah sinar matahari selama 18 jam. KATA KUNCI: ikan sidat. lemak. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). Jakarta **) Pusat Riset Perikanan Budidaya.663 cps.1% selama 60 menit. kimiawi (kadar air. Rumput laut coklat dibagi menjadi dua kelompok. dan viskositas natrium alginat). kadar abu 19. Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik. dan mutu natrium alginatnya mempunyai kadar air 19. dan dijemur di bawah sinar matahari selama 18 jam. 28. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna. kapang) dan rendemen. dendeng. dan 28. kemudian direndam dalam larutan KOH 0. dan tekstur) menggunakan skala hedonik. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15. abu. Kadar air. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk. Rendemen dendeng sidat dengan bumbu kasar sebesar 57. Rumput laut coklat setelah dipanen.1%. Kelompok kedua ditebar di atas lantai dengan beralaskan waring. dan protein masing-masing sebesar 14. analisis fisika-kimia . dan rendemennya 37. bau. Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. terbuka di atas lantai pada suhu ruang (sekitar 30°C).41%. Sedangkan nilai TVB dan pH masing-masing sebesar 21. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat. KATA KUNCI: pengeringan.44%. rasa. dan pH).26%. rendemen. rumput laut coklat. protein lemak. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempahrempah kasar dan halus (ekstrak).0%. 7.97%.

agribisnis perikanan . Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. prasarana fisik yang kurang mendukung. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat. pengalaman petani ikan dan Kebijakan Pemerintah. Metode yang digunakan adalah studi kasus. serta ketersediannya dalam skala kecil. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. Faktor pendorong yaitu ketersediaan air yang melimpah. Identifikasi faktor-faktor pendorong maupun faktorfaktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya. Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. kekurangan modal. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). polusi air. KATA KUNCI: potensi desa. Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. kelembagaan yang menunjang. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. harga ikan yang tergantung pembeli dan cuaca.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan.