Forum Inovasi Teknologi Akuakultur 2010


Forum Inovasi Teknologi Akuakultur 2010

FF 01
Muhammad Hunaina Fariduddin Ath-thar dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar, Bogor

Target kenaikan produksi perikanan sampai dengan 353% dan ketersediaan perairan payau telah meningkatkan kesempatan untuk mengembangkan strain baru yang cocok untuk dibudidayakan di perairan tersebut. Penelitian yang dilakukan bertujuan untuk mengetahui performa benih ikan nila BEST (Best Enhanced Strain Tilapia) dalam media salinitas. Hasil yang diperoleh memperlihatkan bahwa larva dapat hidup dengan sintasan di atas 80% pada salinitas 0 hingga 15 ppt. Sedangkan rataan sintasan untuk ikan benih 3-5 cm pada berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 3 jam ikan dipelihara dalam media bersalinitas 21,5 ppt. Pada benih 5-8 cm, sintasan dari berbagai salinitas menunjukkan bahwa LC 50 didapatkan setelah 36 jam ikan dipelihara dalam media bersalinitas 15 ppt. Disimpulkan bahwa larva dan benih ikan nila BEST dapat hidup dengan baik hingga salinitas 15 ppt. Pengamatan pertumbuhan panjang memperlihatkan bahwa hanya salinitas 7,5 ppt yang memberikan perbedaan terhadap kontrol (0 ppt) pada tingkat P <0,05. Untuk pertambahan bobot badan hasil terbaik diperoleh pada salinitas 2,5 ppt dengan perbedaan nyata terhadap 15 ppt (P<0,05) dan sangat nyata terhadap kontrol (P<0,01). Sedangkan pada biomassa, perbedaan nyata hanya terdapat anatara salinitas 7,5 ppt dengan kontrol (P<0,01). Secara berurutan mulai dari salinitas 0; 7,5; dan 15 ppt, pertumbuhan mutlak panjang, bobot badan dan biomassa total adalah sebagai berikut: =2,1±0,23; W = 7,0±0.29; = 139,8±6.72; 7,5ppt = 2,3±0.06; 0ppt 0ppt 0ppt L B L W7,5ppt = 8,2 ± 0,42;7,5ppt = 164.3 ± 8,46; 5ppt = 2.3 ± 0,21; 15ppt 7.8 ± 0,45; B = 155,6 ± 8,95. Pengamatan setelah W B L1 50 hari, secara berurutan mulai dari ukuran 3-5 salinitas 0 dan 5 ppt serta ukuran 5-8 salinitas 0 dan 5 ppt untuk pertumbuhan mutlak bobot adalah sebagai berikut: 3-5 : 4,0±0,34; 3: 4,8±0,27; 5- : 7,4±0,35; 5: 9,2±0,98. 5 15ppt8 0ppt8 15pptPengamatan pertumbuhan bobot badan memperlihatkan bahwa pada kedua ukuran ikan pertumbuhan mutlak menunjukkan hasil terbaik pada salinitas 15 ppt.
0ppt 15ppt


nila BEST, Oreochromis sp., salinitas, pertumbuhan

FF 02
Priadi Setyawan, Adam Robisalmi, dan Nunuk Listiyowati Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

Penelitian ini dilakukan sebagai langkah awal untuk mendapatkan ikan nila toleran salinitas. Kandidat ikan nila tahan salinitas dapat diperoleh dari hasil pemijahan induk nila dalam lingkungan bersalinitas. Penelitian ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi pada bulan Desember 2009-Januari 2010. Ikan yang digunakan adalah calon induk dari empat strain yaitu nila merah (Fed NIFI), Nila Biru (O. aureus), nila BEST (Bogor Enhancement Strain of Tilapia) dan NIRWANA (nila ras wanayasa). Perlakuan yang digunakan berupa pengujian secara langsung dalam media air bersalinitas 40‰ dalam bak fiber. Ikan nila yang digunakan berumur 5 bulan dengan bobot ratarata ikan nila jantan 257,9 g dan betina 187,43 g, sedangkan rata-rata panjang total ikan jantan 23,96 cm dan betina 21,6 cm. Metode yang digunakan adalah metode eksperimen ) dengan 8 ulangan dari masing-masing strain. Analisa 50 (LT data menggunakan analisa keragaman (one-way ANOVA) yang dilanjutkan dengan uji lanjut pembanding Tukey’s Pairwise

Comparisons. Hasil pengujian menunjukkan bahwa keempat strain nila jantan mempunyai nilai LT50 yang berbeda nyata (P<0,05) Nilai rata-rata 50 pada strain nila jantan tertinggi pada strain Red NIFI (116,33±7,77) diikuti Nila biru LT (103,00±0,00), BEST (77,00±4,24) dan NIRWANA (60,50±2,59). Hasil pengujian pada strain nila betina menunjukkan tidak ada perbedaan nyata dari strain NIRWANA, BEST dan nila biru. Nilai rata-rata LT50 tertinggi pada strain Red NIFI (91,60±22,60) diikuti Nila biru (84,25±9,43), BEST (65,63±6,55) dan NIRWANA (65,50±5,01).
Kata kunci: ikan nila, uji langsung, salinitas, LT

cereviceae sebesar 2% KATA KUNCI: Saccaromyces cereviceae. Oreochromis . lokal Kuningan. A (penambahan S. Hasil analisis menunjukkan bahwa persentase polimorfik berkisar antara 13. cereviceae).1765– 0.5797. A (penambahan S. Penelitian menggunakan metode analisis Random Amplified Polymorphism DNA (RAPD). Nirwana. dengan nilai heterozigositas 0. pakan buatan. cereviceae sebagai perlakuan dan lima kali ulangan. dengan menggunakan primer OPA-03. Otong Zenal Arifin.3333%–46. cereviceae 2%). Hasil pengamatan menunjukkan hanya OPA-03 yang dapat menghasilkan amplifikasi dalam jumlah sampel yang memadai. Populasi yang diamati meliputi jenis nila BEST. Bogor ABSTRAK Penelitian mengenai variasi genetik lima populasi nila hitam telah dilakukan di Laboratorium Molekuler Biologi. dan lokal Bogor. fermentasi. populasi. OPA-04. cereviceae pada fermentasi pakan buatan untuk meningkatkan pertumbuhan nila merah. Balai Riset Perikanan Budidaya Air Tawar (BRPBAT) Bogor. Sebagai perlakuan 0 adalah A (tanpa penambagan S. Universitas Padjadjaran ABSTRAK Penelitian ditujukan untuk menentukan persentase terbaik dari S. genetik. 1 2 3 Hasil penelitian menunjukkan penggunaan S.1952 dan jarak genetik antar populasi 0. cereviceae 3%). Pertumbuhan terbaik diperoleh pada penambahan S. dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. nila merah FF 04 ANALISIS KERAGAMAN GENETIK LIMA POPULASI NILA HITAM (Oreochromis sp. cereviceae 1%).Forum Inovasi Teknologi Akuakultur 2010 FF 03 PENGGUNAAN Saccharomyces Cereviceae PADA FERMENTASI PAKAN BUATAN UNTUK MENINGKATKAN PERTUMBUHAN NILA MERAH (Oreochromis Niloticus) Eddy Afrianto Fakultas Perikanan dan Ilmu Kelautan. dan A (penambahan S. Gesit.) DENGAN ANALISA SIDIK RAGAM RANDOM AMPLIFIED POLYMORPHISM DNA (RAPD) Iskandariah. Penelitian dilakukan menggunakan Rancangan Acak Lengkap dengan menggunakan konsentrasi S. dan OPC-15.0351–0. KATA KUNCI: RAPD. cereviceae pada fermentasi pakan buatan berpengaruh terhadap pertumbuhan nila merah. ikan nila.6667%. OPC-14.

tetapi jika dibandingkan minggu-minggu sebelumnya limfosit mengalami peningkatan. IPB *) ABSTRAK Determinasi kelamin ikan tilapia menggunakan sistem XX/XY. titer antibodi. Selain ditentukan secara genotipe. Komar Sumantadinata**). Hasil yang diperoleh bahwa sel utuh (whole cell) S. 106. dan YY melalui evaluasi nisbah kelamin yang dihasilkan. ikan uji disuntik dengan PBS. Hasil penelitian menunjukkan bahwa ikan nila genotipe XX mempunyai persentase kelamin jantan sebesar 7. diferensiasi kelamin. Budidaya Perairan. pembentukan kelamin secara fenotipe juga dipengaruhi oleh kondisi lingkungan. Sukamandi **) Dept. genotipe. Tetapi setelah uji tantang. dan differensial leukosit dilakukan analisa sidik ragam (Anova). DAN YY Didik Ariyanto*). XY. 104 dan 102 cfu/mL pada ikan nila sehat dengan bobot ± 50 g. Data sintasan (Survival Rate. Oreochromis niloticus Angela Mariana Lusiastuti*). KAJIAN INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI FORMALIN (FORMALINKILLED) UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCOSIS PADA IKAN NILA. Wartono Hadie**) *) Balai Riset Perikanan Budidaya Air Tawar. limfosit perlakuan tidak berbeda nyata dengan kontrol. agalactiae.Forum Inovasi Teknologi Akuakultur 2010 FF 05 DIFERENSIASI KELAMIN PADA IKAN NILA GENOTIPE XX. agalactiae sifat immunogenic properties-nya ternyata belum cukup untuk melindungi ikan uji terhadap penyakit Streptococcosis. Pada perkembangannya. Genotipe XX merupakan hasil persilangan antara induk jantan XX dengan betina XX. Kata kunci : Ikan nila. pengukuran bobot individu rata-rata dan penghitungan sintasan. tidak cukup untuk memberikan protektif terhadap S. Untuk kontrol. S. 104 menimbulkan antibodi tertinggi yaitu sampai pengenceran 1:128 pada minggu ketiga. agalactiae. titer antibodinya menurun. XY. Fakultas Perikanan dan Ilmu Kelautan. Setelah tiga minggu vaksinasi dilakukan uji tantang dengan menginjeksi S. genotipe XY merupakan hasil persilangan induk jantan YY dengan betina XX sedangkan genotipe YY merupakan hasil persilangan induk jantan YY dengan betina YY. ikan nila . pada tilapia dikenal juga genotype YY yang direkayasa untuk tujuan produksi masal benih berkelamin jantan.1 mL/ekor. agalactiae secara intra peritoneal pada ikan uji sebanyak 0.01%. 106. Uni Purwaningsih*). Pada uji tantang setelah minggu keenam. Perlakuan dengan injeksi sel utuh S. seks rasio FF 06 VAKSIN Streptococcus agalactiae: I. Penelitian ini bertujuan mengetahui diferensiasi kelamin pada tiga genotipe ikan nila. Bogor **) Pusat Riset Perikanan Budidaya ABSTRAK Riset ini bertujuan untuk mengetahui potensi imunogenik sel utuh (whole cell) dari Streptococcus agalactiae yang diinaktivasi dengan formalin untuk pencegahan penyakit Streptococcosis pada ikan nila (Oreochromis niloticus). Vaksin tersebut disuntikkan secara intra peritoneal dengan 4 tingkat kepadatan yang berbeda yaitu 108.55% sedangkan genotipe XY dan YY masing-masing sebesar 79. KATA KUNCI: vaksin sel utuh. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Larva ikan nila dipelihara selama 1 bulan di dalam hatchery dan dilanjutkan pada tahap pendederan di kolam selama 2 bulan. agalactiae pada tingkat kepadatan 108. Pada akhir pendederan dilakukan identifikasi jenis kelamin. SR).81% dan 83. Genotipe XX mencirikan betina dan XY untuk jantan. yaitu genotype XX.

NH . DO. KATA KUNCI: Streptococcus agalictiae. pH. Anjang Bangun Prasetio. Angela Mariana Lusiastuti.Forum Inovasi Teknologi Akuakultur 2010 FF 07 VAKSIN STREPTOCOCCUS AGALACTIAE: II. di mana persentase kebutuhan pakan menurun dengan semakin bertambahnya bobot ikan. Gejala klinis spesifik dari infeksi bakteri Streptococcus spp. dilakukan juga analisa proksimat terhadap beberapa jenis pakan komersil yang banyak digunakan oleh pembudidaya untuk mengetahui kandungan nutrisi dari pakan yang digunakan. Isolat yang digunakan telah positif terkarakterisasi sebagai bakteri Streptococcus spp. kecerahan. dan Joni Haryadi Pusat Riset Perikanan Budidaya. Pemberantasan penyakit streptococcosis dapat dilakukan dengan menggunakan antibiotik atau zat kimia lainnya. Dari hasil yang diperoleh menunjukan bahwa kondisi kualitas perairan Danau Maninjau secara umum masih baik dan dapat dimanfaatkan untuk kegiatan budidaya ikan. dengan variasi perbedaan kepadatan bakteri vaksin (A=108. Selain itu. ortofosfat dan total fosfat. Analisa kualitas air dilakukan secara insitu dan eksitu (laboratorium). INAKTIVASI SEL UTUH (WHOLE CELL) MELALUI PEMANASAN (HEATKILLED) UNTUK PENCEGAHAN PENYAKIT Streptococcosis PADA IKAN NILA (Oreochromis niloticus) Uni Purwaningsih. Analisis sidik ragam terhadap tingkat sintasn ikan uji menunjukkan tidak berbeda nyata (P>0. D=102 cfu/mL dan E=kontrol). Untuk saat ini metode pemberian pakan yang diterapkan oleh masyarakat masih belum mengikuti prosedur berdasarkan Best Management Practices (Hollingsworth. ikan nila FF 08 KAJIAN MANAJEMEN PAKAN PADA BUDIDAYA IKAN NILA DI KERAMBA JARING APUNG DAN DAMPAKNYA TERHADAP LINGKUNGAN PERAIRAN DANAU MANINJAU Erlania.5). adalah septikemia dan meningoencephalitis. Koleksi data meliputi: data kualitas air yang terdiri dari suhu. Bogor ABSTRAK Streptococcosis adalah salah satu penyakit yang cukup serius menyerang usaha budidaya tilapia yang menyebabkan kerugian yang cukup besar. Jakarta ABSTRAK Terjadinya kasus kematian ikan di Danau Maninjau pada Desember 2008 lalu menimbulkan berbagai pertanyaan dari berbagai pihak tentang faktor yang menjadi penyebab terjadinya musibah tersebut. melalui aplikasi pemberian vaksinasi pada ikan nila (Oreochromis niloticus). NO . Pemberian pakan tidak boleh berlebihan. TDS.5) antara kelompok perlakuan dan kontrol sedangkan hasil pemeriksaan titer antibodi menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun tidak signifikan. Namun penggunaan bahan tersebut apabila diberikan dalam jangka waktu lama akan berdampak negatif. NO . pemanasan. turbiditas. Sebagai langkah antisipatif untuk menghindari hal tersebut adalah dengan peningkatan kekebalan spesifik melalui vaksinasi. serta data status kegiatan 3 2 3 budidaya melalui wawancara langsung dengan 6 kelompok pembudidaya yang mewakili 6 sentra budidaya di danau maninjau. karena pada kondisi perairan yang kurang . Penelitian ini bertujuan mengevaluasi manajemen budidaya KJA yang dilakukan masyarakat saat ini. juga dipengaruhi oleh jenis ikan serta faktor lingkungan terutama suhu. BOD. terutama dalam hal manajemen pemberian pakan. Selain itu. total nitrogen. Penelitian ini menggunakan rancangan acak lengkap dengan 5 perlakuan 3 ulangan. 2006) yaitu pemberian pakan berdasarkan persentase bobot badan ikan. B=106. Hasil pemeriksaan diferensial leukosit menunjukkan kelompok perlakuan memiliki tingkat kekebalan tubuh lebih tinggi dibanding kelompok kontrol walaupun setelah diuji tantang tidak menunjukkan perbedaan yang nyata (P>0. C=104. Vaksin dibuat dengan metode heatkill melalui pemanasan suhu 100°C. Dalam penelitian ini akan dikaji mengenai potensi immunologik vaksin Streptococcus spp. Dalam hal ini sektor perikanan merupakan pihak yang dituding sebagai biang masalah yang menyebabkan terjadinya degradasi lingkungan perairan Danau Maninjau. dan Taukhid Balai Riset Perikanan Budidaya Air Tawar.

keramba jaring apung (KJA). lingkungan perairan .baik akan menyebabkan stres pada ikan. Danau Maninjau. KATA KUNCI: manajemen pakan.

Sukamandi **) Dept. Kegiatan ini bertujuan untuk mengetahui keragaan dan mengestimasi nilai heterosis pertumbuhan pada persilangan strain NIRWANA (Nila Ras Wanayasa) dan BEST (Bogor Enhanced Strain of Tilapia).Forum Inovasi Teknologi Akuakultur 2010 FF 09 EVALUASI PERTUMBUHAN DAN PERKEMBANGAN ORGAN REPRODUKSI TIGA GENOTIPE IKAN NILA Didik Ariyanto*).48% bt/hari dan 2. dan Didik Ariyanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. bobot ( -2.74%). dan sintasan(1.20%. persilangan. KATA KUNCI: heterosis.06%). IPB *) FF 10 EVALUASI KERAGAAN PERTUMBUHAN DAN NILAI HETEROSIS PADA PERSILANGAN DUA STRAIN IKAN NILA (Oreochromis niloticus) Adam Robisalmi.48%).80%. dan Agus Oman Sudrajat**) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Komar Sumantadinata**). bobot (-2. Sukamandi ABSTRAK Persilangan antar strtain merupakan salah satu cara untuk mendapatkan populasi dengan keragaan budidaya yang meningkat. Sintasan dari betina NIRWANA x jantan NIRWANA memiliki nilai terendah yaitu sebesar 49. bobot) dan sintasan. Hasil penelitian menunjukkan laju pertumbuhan spesifik (SGR) tertinggi yaitu pada persilangan galur murni betina BEST x jantan BEST sebesar 2. tinggi (3. Parameter yang diamati meliputi keragaan pertumbuhan (panjang.05) bila dibandingkan dengan dua populasi lainya. Nilai heterosis pertumbuhan dan sintasan pada persilangan betina BEST x jantan NIRWANA masing-masing yaitu panjang (4. Pada persilangan betina NIRWANA X jantan BEST memiliki nilai hetrosis yaitu panjang (2. tebal. tidak berbeda nyata (P<0.87%) dan sintasan (0. SGR populasi betina NIRWANA X jantan BEST dan betina NIRWANA x jantan NIRWANA mempunyai nilai SGR maing-masing sebesar 2.22%).35% bt/hari.94%). oreochromis niloticus . Penelitian dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.44%).21%). Nunuk Listiyowati.65%).64% bobot badan (bt)/hari. Fakultas Perikanan dan Ilmu Kelautan. Budidaya Perairan. tinggi. Sukamandi selama lima bulan. tebal (-1. sedangkan (betina BEST x jantan BEST) memiliki sintasan tertingi yaitu 74.53 % bt/hari.82%). sedangkan persilangan betina BEST x jantan NIRWANA memiliki nilai SGR terendah yaitu 2. lebar (0. tebal (0.

3. Nilai titer antibodi dan sintasan tertinggi diperoleh pada kelompok ikan yang divaksin dengan formalin killed vaccine dibandingkan dengan teknik inaktivasi lainnya (heat killed vaccine dan sonicated vaccine). 48. 50 KATA KUNCI: toksisitas. 1. Hasil penapisan menunjukkan bahwa bakteri S. Wadah pengujian berupa 21 unit akuarium kaca berukuran 40 cm x 20 cm x 20 cm yang dilengkapi aerasi serta saluran pemasukan dan pengeluaran.13 dan 1. dan 96 jam. Median Lethal Concentration FF 12 PENAPISAN ISOLAT BAKTERI Streptococcus spp. uji stabilitas dan LC50–24. dan 96 jam. 48.Forum Inovasi Teknologi Akuakultur 2010 FF 11 TOKSISITAS AMMONIUM HYDROXIDATERHADAP BENIH IKAN MAS (Cyprinus carpio) DAN BENIH IKAN NILA (Oreochromis niloticus) Yosmaniar Balai Riset Perikanan Budidaya Air Tawar.0930). Jumlah ikan uji setiap wadah 10 ekor dengan peubah yang diukur adalah mortalitas ikan. Bogor ABSTRAK Ammonium hydroxida dapat dipergunakan sebagai sumber amoniak.1295). NK1) dan 1 isolat S. Uji patogenisitas dilakukan terhadap 6 isolat yang terdiri atas 5 isolat S.3354 (3. dan sonikasi.9421 mg/L (1. Bogor. Menggunakan benih ikan mas dan ikan nila dengan bobot rataan individu 1. 72.8090) dan benih ikan nila 5. 48.7504).6799–13. SEBAGAI KANDIDAT ANTIGEN DALAM PEMBUATAN VAKSIN. Penelitian dilakukan di Instalasi 50 (LC Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya air Tawar Cibalagung.0430 (4. dan nilai terbesar dimiliki oleh bakteri S. N14G.8532). Isolat bakteri N4M digunakan sebagai sumber antigen dalam pembuatan vaksin anti streptococciasis.0678 (1. Dilanjutkan dengan Koch’s Postulate untuk mengetahui peran bakteri pada kasus streptococciasis pada ikan nila.9823–4.7877–2. 0.1100). Oreochromis niloticus Taukhid dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar.6904– 5.6578–2. .5094 (2.5805). 72.0839(2. agalactiae (N4M) memiliki nilai terkecil. N17O. Vaksin disiapkan dalam bentuk sel utuh dan diinaktivasi dengan formalin. dan 96 jam terhadap benih ikan mas adalah 4. N4M.08 g.5480). SERTA EFIKASINYA UNTUK PENCEGAHAN PENYAKIT STREPTOCOCCIASIS PADA IKAN NILA. 50 LD iniae (N2O). Karakterisasi dilakukan secara biokimia dan API 20 STREP terhadap 15 isolat bakteri Streptococcus spp. benih ikan. Hasil penelitian menunjukan bahwa Nilai LC 24.55±0. Tahapan penelitian terdiri atas penentuan nilai ambang atas-bawah. 0. pemanasan.9237(0. 3.7138 mg/L (0. 2. Data diolah dengan analisis probit program LC50. Penelitian ini bertujuan untuk mengetahui potensi toksisitas letal Ammonium Hydroxida terhadap benih ikan mas (Cyprinus carpio) dan benih ikan nila (Oreochromis niloticus) yang ditunjukkan oleh nilai Median Lethal Concentration ) 24. iniae (N2O). Bogor ABSTRAK Riset dengan tujuan untuk memperoleh isolat kandidat yang imunogenik bagi pembuatan vaksin untuk pengendalian penyakit streptococciosis pada ikan nila telah dilakukan.8101–1. agalactiae (N3M. Konfirmasi taksonomis hingga level spesies isolat bakteri S.6297–0.4227– 4.81±0. agalactiae dilakukan dengan teknik Polymerase Chain Reaction (PCR) dengan menggunakan primer spesifik.

ikan nila . vaksin. streptococciasis.KATA KUNCI: penapisan.

Namun jenis ikan ini relatif lebih sensitif dibandingkan dengan jenis kerapu macan maupun bebek.184. juga untuk mengetahui penggunaan bahan penyamak krom yang optimal pada penyamakan kulit ikan kakap putih.Hasil kulit tersamaknya diuji mutunya berdasarkan Standar Nasional Indonesia dan dibandingkan dengan mutu kulit sapi.76 kg/cm2. Dalam pembesaran. Hal ini dapat dilihat dari sering timbul luka pada tubuhnya dan nafsu makan menurun. Nusa Tenggara Timur. simetris. 40. dan cacing.62%. Menggunakan bahan penyamak krom 5% merupakan penggunaan yang optimal dalam menyamak kulit ikan kakap putih.Forum Inovasi Teknologi Akuakultur 2010 FF 13 PENGARUH VARIASI BAHAN PENYAMAK KROM TERHADAP MUTU KULIT TERSAMAK IKAN KAKAP PUTIH (BARRAMUNDI) Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Proses penyamakan kulit kakap putih ini menggunakan bahan penyamak krom yang divariasi 5%. Kendala yang dihadapi dalam pembenihan adalah pada pemberian pakan pertama karena bukaan mulutnya relatif kecil dibandingkan dengan kerapu yang lainnya. kambing. Telur yang ada dalam kolektor dapat diambil jam 07. Induk yang ada cacing dan mengalami luka pada tubuh direndam pada air laut dengan formalin 100–150 mg/L selama 1 jam. ikan ini mempunyai pertumbuhan yang relatif lebih cepat dibandingkan dengan kerapu bebek. kakap putih. KATA KUNCI: bahan penyamak kron. Gondol ABSTRAK Usaha pengembengan budidaya ikan kerapu sunu (Plectropomus leopardus) perlu dilakukan. Ikan ukuran 15 g dalam bak beton dapat tumbuh sampai ukuran 500 g dalam jangka waktu 9–10 bulan. garmen. Usaha pengembangan budidaya mulai menunjukkan hasil dengan berkembangnya unit pembenihan di Bali. Waktu pemijahannya sekitar jam 24. 103. dompet.00 pagi hari. Ikan ini mudah terserang parasit seperti cryptocarion. kulit FF 14 USAHA PENGEMBANGAN BUDIDAYA IKAN KERAPU SUNU.53 N/cm atau 138. dan 102. tas.5 kg. Plectropomus leopardus DI INDONESIA Ketut Suwirya dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. dan corak permukaannya spesifik. Ikan ini banyak ditangkap antara lain di perairan Nusa Tenggara Barat. Sampai saat ini pengembangan pembenihannya menggunakan sumber ikan induk alam dengan ukuran 1. kadar abu 2. lemas. dan 80 ekor/m3 selama 5 bulan masing.00–08. Penanganan induk yang terserang parasit dan mengalami luka pada tubuh dapat dilakukan dengan menggunakan formalin dan albazu.97% sehingga sangat prospektif untuk 2 3 dijadikan barang-barang kerajinan kulit. Tujuan dari penelitian ini adalah untuk meningkatkan nilai tambah dari kulit ikan kakap putih yang awalnya merupakan limbah perikanan menjadi kulit tersamak. untuk dijadikan kulit tersamak.12 kg/cm. sarung tangan. Jakarta ABSTRAK Telah dicoba memanfaatkan kulit ikan kakap putih (Barramundi).masing mencapai ukuran 127.93% dan kadar Cr O 1.00. benedinia. kekuatan jahit 1. suhu kerut 88°C. kekuatan regang (kemuluran) 66. Pembenihan ikan ini mulai berkembang di sekitar Gondol.66%. dan ikan pari yang terdaftar dalam Standar Nasional Indonesia. dan 15% . dan Sumatera. Percobaan di KJA dengan ukuran benih 7–10 g yang dipelihara pada KJA (2 m x 2 m x 2 m) pada kepadatan 20. liat. 10%. namun sintasannya masih rendah yaitu sekitar 1%–3%. Sulawesi. Ikan ini relatif sensitif dengan perubahan lingkungan. dan pembesaran kerapu sunu dengan menggunakan benih dari pembenihan di Nusa .354. Selain itu.0 g. dan sebagainya.0–3.2 g. sedangkan benih ikan ukuran 200 g yang dipelihara selama 6 bulan dengan kepadatan 10–40 ekor/m3 dapat mencapai ukuran rata-rata 500 g. kambing dan ikan pari yaitu berisi. yang merupakan limbah perikanan dari perusahaan filet ikan. sehingga dapat dimanfaatkan menjadi barang-barang kerajinan kulit seperti sepatu. Induk ikan yang dipelihara dalam bak terkontrol telah berhasil memijah setiap bulan.94%.5 g. kekuatan tarik 2.46 N/ cm2 atau 222.00 sampai jam 03. kadar air 13. kadar lemak 6. karena ikan ini mempunyai pasar luas dan harga yang relatif tinggi. Hasil kulit tersamaknya dapat memenuhi Standar Nasional Indonesia untuk kulit sapi.

pembesaran.Tenggara Barat. KATA KUNCI: pembenihan. kerapu sunu .

Ratu Siti Aliah*****). Dari hasil uji coba ini dapat dikemukan bahwa metode transfeksi. namun metode elektroporasi dinilai sebagai metode transfer gen yang paling efektif dan mudah dilakukan untuk ikan kerapu tikus. jarak waktu antar kejutan 0.Forum Inovasi Teknologi Akuakultur 2010 FF 15 REKAYASA APLIKASI METODE TRANFER GEN HORMON PERTUMBUHAN PADA IKAN KERAPU TIKUS. sedangkan secara in vitro DNA terdeteksi setelah jam ke-48 pada suhu inkubasi 25°C. sementara secara in vivo adalah dengan cara menginjeksi larutan kompleks dan DNA tersebut ke dalam testis ikan kerapu tikus jantan yang telah matang. dan 3 detik.1 µs untuk mengujicobakan berbagai konsentrasi DNA yaitu 5 µg/mL. Cromileptes altivelis Slamet Subyakto*). 10 µg/mL. Kementrian Negara Riset dan Teknologi ABSTRAK Ikan kerapu tikus (Cromileptes altivelis) merupakan jenis ikan budidaya laut yang memiliki nilai ekonomi tinggi di Asia. transfer gen. Tujuan perekasayaan ini adalah untuk mengetahui efektivitas metode transfeksi. M. Dari hasil uji coba ini didapatkan konsentrasi DNA optimum untuk metode elektroporasi adalah 10 µg/mL. KATA KUNCI: transfeksi. salah satu permasalahan yang dihadapi dalam budidaya ikan kerapu tikus adalah pertumbuhannya yang lambat. Situbondo **) Fakultas Perikanan dan Kelautan. Transfast merupakan reagent penghantar DNA yang efektif bagi sperma ikan kerapu tikus. mikroinjeksi. hormon pertumbuhan. DNA dapat dideteksi pada sperma secara in vivo pada jam ke-36 setelah proses transfeksi (hpt). Sasmito Jati****). ikan kerapu tikus . mikroinjeksi. Jumlah embrio hingga fase 4 sel yang berhasil dimikroinjeksi selama 20-30 menit relatif sedikit. jumlah kejutan 5. Alimuddin***). elektroporasi. dan elektroporasi dapat digunakan dalam transfer gen ikan kerapu tikus. dan Gemi Triastutik*) *) Balai Budidaya Air Payau. Secara in vitro metode transfeksi dilakukan dengan menginkubasi sperma dengan larutan kompleks transfektan dan DNA (pktBP-ktGH). Metode mikroinjeksi dengan lama waktu injeksi per embrio 1 detik menghasilkan sintasan embrio paling tinggi walaupun tingkat penetasannya masih rendah. Komar Sumantadinata***). Institut Pertanian Bogor ****) Fakultas Matematika dan Ilmu Pengetahuan Alam. Aplikasi transgenesis diduga dapat menjadi salah satu metode penyelesaian masalah pertumbuhan yang relatif lambat tersebut. Namun demikian. Universitas Brawijaya Malang ***) Departemen Budidaya Perikanan Fakultas Perikanan dan Kelautan. dan elektroporasi pada transfer gen hormon pertumbuhan ikan kerapu tikus. Metode elektroporasi dilakukan dengan voltase 50 V. di antaranya Indonesia. Metode mikroinjeksi dilakukan terhadap embrio fase 1-4 sel menggunakan konsentrasi DNA 25 µg/mL pada lama waktu injeksi 1. dan 20 µg/ mL. lama kejut 30 ms. 2. Analisis DNA menggunakan metode PCR dilakukan untuk menentukan tingkat keberhasilan gen yang ditransfer pada embrio dan sperma ikan kerapu tikus tersebut. Universitas Brawijaya Malang *****) Badan Pengkajian dan Penerapan Teknologi. Rustidja**). mikroinjeksi. Irvan Faizal*****).

pertumbuhan.19%) harian serta laju pertumbuhan bobot badan spesifik (6.73%) dan panjang total (9. Materi yang digunakan adalah larva kerapu sunu sebanyak 4. nisbah konversi pakan. efisiensi pakan. probiotik. Namun. KATA KUNCI: larva kerapu sunu. dan kualitas air.86 mm).69 g dan panjang total awal 3.20-4. Pemberian pakan dilakukan tiga kali sehari.02%) serta nisbah konversi pakan (1.19±0. C (probiotik). Nilai pertambahan panjang tertinggi A (72. Plectopormus leopardus PADA STADIA AWAL Retno Andamari Balai Besar Riset Perikanan Budidaya Laut.52±0. selanjutnya perlakuan C (64.35 cm).69 mm). B (oksigen).39±0. optimasi pakan. Kualitas air selama penelitian layak untuk pemeliharaan larva kerapu sunu (Plectropomus leopardus). laju pertumbuhan spesifik. Penelitian ini bertujuan untuk mengetahui pengaruh perbedaan tingkat pemberian pakan dan tingkat pemberian pakan yang optimum terhadap benih kerapu sunu dengan bobot awal 0. oksigen . Perlakuan yang diujikan adalah perbedaan tingkat pemberian pakan. pertumbuhan panjang larva.Forum Inovasi Teknologi Akuakultur 2010 FF 16 OPTIMASI TINGKAT PEMBERIAN PAKAN TERHADAP BENIH KERAPU SUNU (Plectropomus leopardus) Regina Melianawati dan Ketut Suwirya Balai Besar Riset Perikanan Budidaya Laut.25) dan efisiensi pakan (80. Tingkat pemberian pakan 10% menghasilkan pertumbuhan benih yang optimal dengan bobot badan (3. rasio konversi pakan FF 17 PENGARUH PENAMBAHAN PROBIOTIK DAN OKSIGEN TERHADAP PERKEMBANGAN LARVA KERAPU SUNU. KATA KUNCI: benih kerapu sunu.000 ekor/bak. dan perlakuan B (63.35 mm). Pakan yang digunakan adalah pakan pelet komersial.31±0. laju pertumbuhan bobot badan harian (10. 10%. yaitu 5%.90±0.42±0.95 mm). Kendala yang dihadapi terutama terjadi pada stadia awal. Salah satu faktor yang berperan adalah lingkungan pemeliharaan. Gondol ABSTRAK Tingkat pemberian pakan yang optimum memiliki peranan penting dalam budidaya karena berkaitan erat dengan efektivitas dan efisiensi pemanfaatan pakan serta pertumbuhan ikan. Penelitian ini bertujuan untuk mengetahui pengaruh penambahan oksigen dan probiotik terhadap sintasan dan pertumbuhan larva kerapu sunu (Plectropomus leopardus) pada stadia awal. D (kontrol).50-0. serta terakhir perlakuan D (47.20 cm. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan yaitu perlakuan A (probiotik dan oksigen). Peubah yang diamati adalah sintasan. dan efisiensi pakan pada benih kerapu sunu. dan 15% dari total biomassa benih. Gondol ABSTRAK Budidaya kerapu sunu (Plectropomus leopardus) hingga saat ini belum menunjukkan hasil yang memuaskan. laju pertumbuhan harian.19%) dan panjang total spesifik (1. Hasil penelitian menunjukkan bahwa penambahan oksigen dan probiotik berpengaruh nyata terhadap pertumbuhan dan sintasan. Sampling dilakukan setiap minggu.68 g) dan panjang total (6. Penelitian menggunakan rancangan acak lengkap dengan tiga perlakuan dan tiga ulangan.00%) yang baik bagi benih kerapu sunu. Penelitian dilakukan pada 9 bak fiberglass volume ± 30 L selama 4 minggu. Oksigen terlarut dan probiotik diduga mempunyai peranan penting dalam pertumbuhan dan sintasan larva. Hasil penelitian menunjukkan bahwa perbedaan tingkat pemberian pakan berpengaruh terhadap ukuran bobot badan dan panjang total.

62%.50%. Gondol ABSTRAK Ikan kerapu macan. terutama infeksi virus.5 ± 4. Masing-masing perlakuan diulang 3 kali. Des Roza. dan Achmad Zailani Balai Besar Riset Perikanan Budidaya Laut. Masing-masing sebanyak 100 ekor ikan kerapu ukuran antara 8-10 cm disuntik 0.04 ± 0.95 mg. Perlakuan C: 5 kali/hari pada umur 7-20 hari.12 mg dan C: 211. Epinephelus fuscoguttatus Irwan Setyadi. B: 196. aktivitas lisosim sebesar 1. Epinephelus fuscoguttatus secara intensif dan terkontrol di hatcheri semakin berkembang.Forum Inovasi Teknologi Akuakultur 2010 FF 18 APLIKASI PAKAN BUATAN PADA PEMELIHARAAN LARVA IKAN KERAPU MACAN. Perlakuan aplikasi pakan buatan diberikan pada larva mulai umur 7 hari dengan perbedaan frekuensi yaitu: Perlakuan A: 3 kali/hari pada umur 7-20 hari. Penelitian dilakukan di hatcheri skala rumah tangga (HSRT) di area Kecamatan Gerokgak Kabupaten Buleleng. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas fagositik dan lisosim. 3 kali pada umur 21-29 hari dan 2 kali pada umur 30-40 hari. Epinephelus fuscoguttatus merupakan komoditas perikanan yang bernilai ekonomis penting. 2 kali pada umur 21-29 hari dan 1 kali pada umur 30-40 hari. Epinephelus fuscoguttatus FF 19 APLIKASI IMUNOSTIMULAN UNTUK MENINGKATKAN IMUNITAS NON-SPESIFIK IKAN KERAPU MACAN.20 ± 0. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan.57 mm. infeksi. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang dengan virus irido. mulai umur 2 hari diberikan rotifer dengan kepadatan 10-20 ind. B: 24.55 mm dan C: 26. KATA KUNCI: Epinephelus fuscoguttatus. mencapai ukuran panjang total pada perlakuan A: 24.08 ± 1. kerapu macan . Penelitian bertujuan untuk mendapatkan data sintasan dan pertumbuhan larva kerapu macan yang diberikan pakan buatan. Wadah penelitian menggunakan 6 buah bak beton volume 6 m3 yang ditebar larva kerapu macan yang baru menetas dengan kepadatan 10 ekor/L.68 mm.00%. Gondol ABSTRAK Upaya produksi benih ikan kerapu macan.1 mL/ekor ikan dengan imunostimulan peptidoglikan sebanyak 200 mg/kg BB secara intra muskular.1 ± 2. dengan kepadatan 1.81 ± 0.87 cm dan sintasan setelah diuji tantang sebesar 72. Mulai larva umur 2 hari diberikan Nannochloropsis sp. namun perlu diantisipasi terjadinya infeksi penyakit yang dapat menimbulkan kematian. Hasil penelitian menunjukkan bahwa pemberian imunostimulan peptidoglikan dapat meningkatkan imun respons non-spesifik ikan kerapu macan berupa peningkatan aktivitas fagositik sebesar 19. indeks fagositik sebesar 1.5 m3 masing-masing sebanyak 3 bak untuk perlakuan imunostimulan dan 3 bak untuk kontrol. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI DI HATCHERI Fris Johnny.0x105 sell/mL. larva kerapu macan. sedangkan kontrol hanya disuntik dengan PBS.96 mg. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1.03% dan perlakuan C adalah 8.5 ± 2. Hasil penelitian menunjukkan bahwa sintasan larva sampai umur 41 hari pada perlakuan A adalah 6./mL dan mulai umur 17 hari diberikan nauplii Artemia. Perlakuan B: 4 kali/hari pada umur 7-20 hari. sedangkan perlakuan C berbeda nyata dengan perlakuan A dan C. imunstimulan.65%. 4 kali pada umur 21-29 hari dan 3 kali pada umur 30-40 hari. Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Perlakuan A dan B tidak berbeda nyata. dan Indah Mastuti Balai Besar Riset Perikanan Budidaya Laut. serta bobot badan pada perlakuan A: 192. Suatu percobaan untuk meningkatkan sistem kebal benih ikan kerapu macan terhadap infeksi virus dengan penggunaan imunostimulan peptidoglikan diharapkan mampu untuk meningkatkan imunitas atau respons imun non.08 ± 2.87. perlakuan B adalah 6. Bejo Slamet. KATA KUNCI: pakan buatan.62 ± 2.spesifik ikan kerapu macan. Anak Agung Ketut Alit.

Pemeliharaan calon induk kerapu bebek F-2 dilakukan dalam bak volume 75 m3. Untuk mengantisipasi kelangkaan induk ikan kerapu bebek hasil tangkapan dari laut perlu diupayakan produksi calon induk ikan kerapu yang berasal dari budidaya. kerapu bebek (Cromileptes altivelis). pada bak A : ikan rucah + cumi-cumi + vitamin. Hasil penelitian menunjukkan bahwa ukuran diameter oosit ikan kerapu bebek F-2 yang dipelihara pada bak A dan bak B masing-masing telah mencapai lebih dari 450 mm. generasi kedua (F-2). pemeliharaan larva dilakukan secara massal hingga yuwana umur 45 hari. Gondol ABSTRAK Kerapu bebek (Cromileptes altivelis) merupakan jenis kerapu yang bernilai ekonomis tinggi. Salah satu kendala pada saat pemeliharaan larva adalah kultur fitoplankton (Nannochloropsis sp.) yang tidak stabil yang disebabkan antara lain cuaca yang tidak mendukung dan kualitas bibit Nannochloropsis sp. panjang. dan untuk pembanding pada pemeliharaan larva dengan “green water” Nannochloropsis sp. Pada penelitian ini dicoba untuk efisiensi dengan cara pemeliharaan larva hanya menggunakan rotifer dengan jumlah yang cukup tanpa menggunakan “green water” Nannochloropsis sp. Saat ini pembenihannya sudah berhasil dikembangkan di tingkat petani secara massal. konsentrat mempunyai sintasan 19. plankton FF 21 PENGAMATAN DIAMETER OOSIT CALON INDUK IKAN KERAPU BEBEK (CROMILEPTES ALTIVELIS) TURUNAN KEDUA (F-2) DALAM MENUNJANG TEKNOLOGI PEMBENIHAN IKAN KERAPU Tridjoko dan Gunawan Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Sampai saat ini pembenihan ikan kerapu bebek masih mengandalkan induk dari laut.10% dan panjang total 21. sedangkan pada bak B : pakan pelet kering. Perlakuan pada penelitian ini berupa pemberian pakan yang berbeda yaitu. Padahal induk dari laut sudah sulit didapatkan dan hanya ada di daerah-daerah tertentu saja.Forum Inovasi Teknologi Akuakultur 2010 FF 20 EFISIENSI PENGGUNAAN PLANKTON UNTUK PEMBENIHAN KERAPU BEBEK (Cromileptes altivelis) PADA HATCHERI SKALA RUMAH TANGGA Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. masing-masing diisi 75 ekor dengan kisaran bobot antara 400-550 g/ekor. Setiap bulan dilakukan pengamatan pertumbuhan bobot.86 mm. KATA KUNCI: kerapu bebek (Humpback grouper). Pergantian air pada media pemeliharaan antara 300%-500%/hari dengan cara air mengalir.71 mm sedangkan pada pemeliharaan larva dengan Nannochloropsis sp. yang kurang baik. namun kualitas dan kuantitas telur yang dihasilkan masih relatif rendah. Pada bak pemeliharaan dilengkapi dengan aerasi sebagai sumber oksigen. Induk ikan kerapu bebek dari hasil budidaya (F-1) sudah berhasil dipijahkan dan telah menghasilkan benih turunan kedua (F-2) yang dijadikan calon induk. dengan sintasan 6. Hasil yang diperoleh menunjukkan bahwa: larva kerapu bebek dapat dipelihara tanpa menggunakan Nannochloropsis sp. pembenihan. Tujuan penelitian ini adalah untuk mendapatkan calon induk ikan kerapu bebek turunan kedua (F-2) matang gonad dengan diameter oosit lebih dari 400 mm. Sampai dengan bulan Oktober telah berhasil memijah. perkembangan oosit . dan dilihat perkembangan oositnya. konsentrat yang bisa dibeli di pasaran. KATA KUNCI: efisiensi.72% dan panjang total 18.

Gondol ABSTRAK Pembenihan kerapu bebek Cromileptes altivelis telah berkembang di kalangan masyarakat.2% sedangkan pada pemeliharaan tanpa terkontrol larva mengalami kematian. 5. Ketut Mahardika. 3. KATA KUNCI: pemeliharaan larva. Tangki pemeliharaan yang digunakan ukuran 8-10 m3. 7. 2. Sampel larva diambil pada umur 1. Kendala utamanya adalah produksi benih yang tidak stabil dan masih sering mengalami kegagalan yang disebabkan oleh berbagai faktor.8%-41.Forum Inovasi Teknologi Akuakultur 2010 FF 22 PERKEMBANGAN ORGAN DALAM LARVA KERAPU BEBEK. manajemen air media pemeliharaan dan manajemen pakan. dan Suko Ismi Balai Besar Riset Perikanan Budaidaya Laut. Selain itu. KATA KUNCI: kerapu bebek. Pengamatan mikroskopis menunjukkan bahwa kuning telur telah terserap semua dan larva mulai mengambil makanan dari luar tubuh pada umur 3 hari (D-3). 25. dan 32 hari setelah menetas masing. Gondol ABSTRAK Teknologi pembenihan dan pembesaran ikan kerapu telah dapat dikembangkan. 10. pemeliharaan dilakukan hingga yuwana (2 bulan). Salah satu penyebabnya adalah masa kritis yang terjadi selama proses metamorfosa larva. 4. Tetapi tingkat sintasan yang didapatkan masih rendah. produksi massal . Cromileptes altivelis Yasmina Nirmala Asih. histologi. Penelitian ini bertujuan untuk mengetahui perkembangan organ dalam larva kerapu bebek melalui pengamatan mikroskopis (Histologi). organ dalam FF 23 TEKNIK PEMELIHARAAN LARVA UNTUK PENINGKATAN MUTU BENIH KERAPU PADA PRODUKSI MASSAL SECARA TERKONTROL Suko Ismi dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. mutu benih kerapu. Sedangkan saluran pencernaan dan organ dalam lainnya telah berkembang seperti organ dalam ikan dewasa pada larva diatas umur 15 hari (D15). Sampel larva difiksasi dalam larutan bouin’s selama 4-6 jam dan selanjutnya dipindahkan dalam alkohol 70%. 15. Tujuan dari penelitian ini adalah mendapatkan teknologi pemeliharaan larva yang dapat memproduksi benih kerapu secara stabil sehingga dapat mendukung kebutuhan benih untuk budidaya tepat jumlah dan waktu sehingga dapat menjadi usaha yang menguntungkan. Indah Mastuti. Pada penelitian ini larva kerapu bebek (Cromileptes altivelis) dipelihara secara terkontrol melalui penjagaan/sterilisasi lingkungan hatcheri.masing sebanyak 10-20 ekor. 20. Semua sampel kemudian diproses secara histologi dan diwarnai dengan haematoxylin dan eosin. 13. lapisan penyusun retina mata pada larva D-3 telah terlihat jelas. Hasil yang diperoleh adalah larva yang dipelihara secara terkontrol dengan atau tanpa penambahan klorin dapat menghasilkan produksi yuwana tiga kali ulangan dengan kisaran sintasan 29. 17.

Sumber protein utama pada pakan adalah tepung ikan.797–457. Dari hasil penelitian ini dapat disimpulkan bahwa protein sel tunggal dapat dimanfaatkan sampai 15% dalam formulasi pakan untuk pertumbuhan ikan kerapu pasir (Epinephelus corallicola). Lies Emmawati*). 15%. laju konsumsi pakan tertinggi dicapai pada kandungan protein sel tunggal 0%. perlu alternatif lain sebagai substitusi tepung ikan. tetapi tidak berbeda nyata dengan kandungan protein sel tunggal 5%. Kematian larva umumnya terjadi pada hari keempat. Penelitian untuk pemeliharaan larva dilakukan di UPR selama tiga siklus. Injeksi dilakukan secara intraperitoneal pada tingkat kematangan gonad kedua TKG II. I Nyoman Adiasmara Giri. Pada larva juga terdeteksi adanya antibodi hingga umur larva 4 minggu. dan ketiga menggunakan larva tanpa kekebalan bawaan. Jakarta **) Balai Riset Prikanan Budidaya Air Tawar. Tujuan penelitian ini adalah untuk mengetahui pengaruh pemanfaatan protein sel tunggal sebagai pengganti tepung ikan dalam pakan buatan terhadap pertumbuhan yuwana ikan kerapu pasir. siklus pertama. dan 20% dalam pakan. Bogor ABSTRAK Tingkat keberhasilan pembenihan ikan patin di Indonesia masih berada dalam level yang rendah pada unit pembenihan rakyat (UPR). (pakan kontrol). Pakan diberikan 2 kali secara “adlibitum”.Forum Inovasi Teknologi Akuakultur 2010 FF 24 PEMANFAATAN PROTEIN SEL TUNGGAL SEBAGAI BAHAN PAKAN UNTUK IKAN KERAPU PASIR (Epinephelus corallicola) Muhammad Marzuqi. Pangasius hypophthalmus . Oleh karena itu. pertambahan bobot. 10%. Perkembangan budidaya yang pesat menyebabkan permintaan tepung ikan meningkat. laju pertumbuhan spesifik. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan. di lain pihak hasil tangkapan cenderung menurun. dibutuhkan cara penanggulangan yang baik pada tingkat larva hingga benih. Salah satu sumber protein alternatif adalah protein sel tunggal (PST). survival rate.4 g dipelihara dalam 15 bak fiber dengan volume 200 liter dan kepadatan 15 ekor/bak. 5%. kerapu pasir FF 25 PENINGKATAN PRODUKSI BENIH IKAN PATIN DI UNIT PEMBENIHAN RAKYAT (UPR) MELALUI PENERAPAN KEKEBALAN BAWAAN (MATERNAL IMMUNITY) Wartono Hadie*). Ketut Suwirya. Penelitian ini bertujuan untuk mengetahui efek dari kekebalan bawaan terhadap Aeromonas hydrophila terhadap peningkatan produksi benih ikan patin. Masing-masing bak dilengkapi sistem aerasi dan sistem air mengalir. Gondol ABSTRAK Ikan kerapu merupakan komoditas penting dalam pengembangan budidaya laut di Indonesia. KATA KUNCI: innate immunity. dan siklus kedua menggunakan larva dengan kekebalan bawaan. 15% (P>0. dan Angela Mariana Lusiastuti**) *) Pusat Riset Perikanan Budidaya. Tingkat kematian larva dapat mencapai 40%–80%. Hewan uji ikan diperoleh pada ukuran ± 3 g dan diadaptasikan sampai ikan secara keseluruhan menerima pakan buatan yaitu dengan bobot rata-rata 17. dan Ni Wayan Astuti Balai Besar Riset Perikanan Budidaya Laut. akibat serangan penyakit dan kondisi media. KATA KUNCI: protein sel tunggal. Sintasan benih dari larva yang mendapat kekebalan bawaan mencapai 93% yang berarti 33%–75% lebih baik dibanding penggunaan induk tanpa kekebalan bawaan. dengan cara membuat kekebalan bawaan dari induknya (maternal immunity). Penggunaan kekebalan bawaan juga memberikan tambahan produksi sebesar 155.651 ekor benih untuk setiap induknya. 10%. Keberhasilan usaha budidaya ikan kerapu sangat tergantung dari pakan. Pakan penelitian berupa pelet kering dengan kandungan PST 0%. Oleh karena itu.05). Hasil penelitian menunjukkan bahwa nilai bobot akhir. catfish seed.

dan A (98.204±0.Forum Inovasi Teknologi Akuakultur 2010 FF 26 PENGGUNAAN ENZIM FITASE DALAM PEMBUATAN PAKAN RAMAH LINGKUNGAN UNTUK PAKAN IKAN PATIN. D (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 60 mg/100 g bahan nabati) dan E (pakan tanpa penambahan P anorganik dan enzim fitase). selama 30 hari. Hasil percobaan menunjukkan rata-rata pertumbuhan panjang tubuh tertinggi diperoleh pada salinitas 2‰ (4.49 cm).763±0. dan sintasan . ikan patin.8%).1%).0%).14%). Hasil penelitian menunjukkan bahwa penambahan enzim fitase mampu meningkatkan kecernaan P pakan.140±0. sintasan serta beberapa parameter kualitas air.75±0. (B) 2‰. Nilai derajat sintasan benih tertinggi ditunjukkan pada perlakuan salinitas 1 ‰ (32.17% per hari menjadi 1.2%). dan Amrul Nurman PS Budidaya Perairan Fakultas Pertanian Universitas Sriwijaya ABSTRAK Semakin banyak bahan nabati yang digunakan dalam pakan ternyata akan berpotensi menimbulkan masalah baru yaitu polusi fosfor.46% per hari. dan pengaruhnya terhadap kinerja pertumbuhan serta limbah fosfor dan Nitrogen yang dihasilkan. Parameter yang diamati adalah laju pertumbuhan panjang badan. Kecernaan protein juga meningkat akibat penambahan enzim fitase.25±0. Ade Dwi Sasanti.35±0. KATA KUNCI: fitase . Data diperoleh dianalisis sidik ragam. dan (C) 3‰ dengan tiga kali ulangan.4%). Pangasius hypopthalmus Mohamad Amin. dimasukkan ke dalam akuarium berukuran 50 cm x 40 cm x 35 cm. benih. Pengamatan benih dilakukan tiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. pakan A (82.1%) berbeda nyata lebih tinggi dibanding pakan D (97.1%) dan pakan E (95.910±0. Dade Jubaedah.92 cm). Ikan uji yang digunakan berukuran 2 ± 0.3%). C (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 50 mg/100 g bahan nabati. Ikan patin sebayak 15 ekor. Analisis data dilakukan secara deskriptif.00%).884±2.5 g/ekor.13% per hari. pakan B (82.010±0. sedangkan laju pertumbuhan panjang harian meningkat dari 1.07 cm).3%) dan pakan D (80. kemudian salinitas 3‰ (4.114±0. Pakan diberikan 3 kali sehari secara at satiation. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian enzim fitase terhadap ketersediaan fosfor (P) dari sumber bahan nabati pakan ikan patin. Kecernaan protein tertinggi berturut-turut pakan C (82. Kadar garam yang diamati sebagai perlakuan yaitu: (A) 1‰. dan salinitas 1‰ (3. pakan C (98. Pangasius djambal. B (pakan tanpa P anorganik dengan penambahan enzim fitase sebanyak 40 mg/100 g bahan nabati (tepung bungkil kedelai dan dedak). diikuti salinitas 2‰ (28.674±2.4%) berbeda nyata lebih tinggi dibanding pakan E (68.764±3. Perlakuan yaitu A (pakan kontrol dengan penambahan P anorganik). Penambahan enzim fitase mampu meningkatakan laju pertumbuhan bobot harian 3. yang dilanjutkan dengan uji Tukey. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh salinitas terhadap pertumbuhan dan tingkat sintasan benih patin jambal. KATA KUNCI: salinitas.32% per hari menjadi 4.223±0. Benih dipelihara dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dengan volume air 100 liter. Penelitian ini mengunakan Rancangan Acak Lengkap yang terdiri atas 5 perlakuan dan 3 Ulangan.93%) dan terendah salinitas 3‰ (25. kecernaan fosfor FF 27 PENGARUH PERBEDAAN SALINITAS PADA PEMELIHARAAN BENIH PATIN JAMBAL (Pangasius djambal) DALAM AKUARIUM Nurbakti Listyanto dan Septyan Andriyanto Pusat Riset Perikanan Budidaya. Kecernaan P pakan B (98.

Pakan buatan dalam bentuk serbuk dengan kadar protein pakan 40% diberikan mulai hari ke-11.42±0.7. Sifat fisika dan kimia air masih dalam kisaran layak untuk pemeliharaan ikan. Sularto.60±10. maka sekitar 50% gambut tropika dunia yang luasnya sekitar 40 juta ha berada di Indonesia.26 cm.7% rendahnya sintasan ini diduga karena adanya faktor hama.5).31 cm B. B. Pupuk anorganik + organik. Sukamandi ABSTRAK Teknologi pembenihan khususnya pemeliharaan larva ikan patin siam di Indonesia masih dilakukan secara indoor hatchery. Patin Siam.3 g) dan SR perlakuan A (91. nila. Kolam yang digunakan untuk pemeliharaan larva berukuran masing-masing 400 m2/kolam. Lahan gambut merupakan lahan marjinal yang perlu dikelola dan dimanfaatkan untuk mengembangan dan memanfaatkan potensi lahan gambut dalam bidang budidaya perikanan serta untuk menarik minat masyarakat dalam mengembangkan budidaya ikan patin khususnya di Provinsi Kalimantan Tengah. komposisi isi saluran pencernaan ikan dan analisa kualitas air kolam.37 cm C 16. betok. dan Ika Nurlaela Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sebagai perlakuan adalah 3 jenis pemupukan kolam yang berbeda: A. sepat. B (660 g).5%-9. dan C (95. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. Sedangkan sasaran yang ingin dicapai adalah diperoleh sintasan ikan mencapai 60% dengan bobot rerata 600–700 g/ekor serta diperoleh informasi teknologi pembesaran ikan patin di kolam pada lahan gambut. komposisi pakan alami kolam. Kegiatan ini bertujuan untuk mengetahui pertumbuhan dan sintasan ikan patin yang dipelihara dalam kolam di lahan gambut. Akmal. Padat tebar larva yang digunakan adalah 100 ekor/m2.Forum Inovasi Teknologi Akuakultur 2010 FF 28 INTENSIFIKASI PEMUPUKAN PADA PEMELIHARAAN LARVA/BENIH IKAN PATIN SIAM (Pangasianodon hypophthalmus) YANG DILAKUKAN SECARA OUTDOOR DI KOLAM TANAH Evi Tahapari.526. sintasan ikan.08 g dan 3. dan Syafrudin Balai Budidaya Air Tawar.74±0. Pemupukan. penetasan telur dan pemeliharaan larva di kolam.51 g dan 11. Sintasan pada penelitian ini untuk ketiga perlakuan sangat rendah yaitu 4. dan sintasan Kata kunci: Intensifikasi. Pemeliharaan benih dilakukan dalam kolam selama 9 bulan dengan padat penebaran A (4 ekor/m2).9%).49±1. B (7 ekor/m2). dan C (10 ekor/m2) dengan 3 kali ulangan. Pemberian pakan dengan pelet apung sebanyak 5% per hari. Parameter yang diamati meliputi pertumbuhan (bobot dan panjang) ikan. Noktoneta (bebeasan) yang dapat menurunkan pertumbuhan ikan. Mandiangin ABSTRAK Indonesia sesungguhnya merupakan negara dengan kawasan gambut tropika terluas di dunia.27±0. maka dilakukan suatu percontohan budidaya ikan patin di lahan gambut. Ruang lingkup kegiatan meliputi beberapa tahapan pelaksanaan yaitu persiapan kolam. B (95. dan C (613. pemijahan. udang liar) serta jenis serangga air. predator yaitu antara lain: Ikan liar (gabus.19±0. Penelitian ini bertujuan untuk mendapatkan teknologi pemeliharaan larva/benih ikan patin siam secara outdoor di kolam tanah yang dipupuk. Hasil penelitian selama 40 hari pemeliharaan menunjukkan bahwa pemupukan kolam dengan bahan organik (kotoran ayam) yang difermentasi (perlakuan C) memberikan pengaruh yang nyata terhadap keragaan benih ikan. Larva yang ditebar berumur 20 jam setelah menetas. Pupuk anorganik + organik + probiotik dan C. Secara berturut turut didapatkan hasil pertambahan bobot dan panjang untuk masingmasing perlakuan: A. 0. Jika luas gambut Indonesia adalah 20 juta ha. dan 10 ekor/m2 menghasilkan pertumbuhan bobot ikan patin yang tidak jauh berbeda dengan bobot akhir rerata A (605 g). Hasil dari pengamatan menunjukkan bahwa perlakuan padat tebar 4. belut.12 g dan 3. pengecekan induk. 0. namun perlakuan B (7 ekor/m2) . yaitu antara 13. Outdoor FF 29 BUDIDAYA IKAN PATIN (Pangasius hypophthalmus) DI LAHAN MARJINAL DI KABUPATEN PULANG PISAU PROVINSI KALIMANTAN TENGAH Puji Widodo.5 juta ha (rata-rata 20 juta ha).2%). Pupuk anorganik + organik yang difermentasi + Probiotik.

ikan patin. KATA KUNCI: budidaya.memberikan hasil pertumbuhan bobot akhir rerata yang lebih baik sebesar 660 g dan SR 95. lahan marjinal .2%.

15 ekor/m2 (70. Tingkat sintasan untuk kepadatan 10 ekor/m2 mencapai 99. Evi Tahapari***). Penelitian ini bertujuan untuk mengetahui pertumbuhan ikan patin nasutus yang dipelihara dengan padat tebar berbeda. KATA KUNCI: patin pasupati. diikuti dengan kepadatan 10 ekor/m2 (92. salinitas.46 g). Padat tebar yang digunakan adalah 5. dan hasil pengamatan terhadap laju pertumbuhan spesifik ikan dengan kepadatan 10 ekor/m2 mencapai 3.70–20. JAWA TENGAH Ongko Praseno*). Kata kunci: padat tebar. Zafril Imran Azwar**). Petak pertama ditebar benih ukuran rata-rata 30 g/ ekor sebanyak 3. Percobaan dilakukan selama 100 hari pemeliharaan. dan Sularto***) *) Pusat Riset Perikanan Budidaya.60% sedangkan untuk kepadatan 5 ekor/m2 mencapai 97.74 g) dan 20 ekor/m2 (61. Sukamandi ABSTRAK Ikan patin nasutus merupakan patin asli Indonesia yang berdaging putih. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Sedangkan untuk pertambahan panjang dan laju pertumbuhan harian tertinggi pada kepadatan 10 ekor/m2 (8. Selama percobaan ikan diberi pakan komersial dengan kandungan protein 32% dan lemak 5%. Evi Tahapari. Kegiatan ini dilakukan di kolam 6000 m2 dengan menggunakan jaring ukuran 3 m x 2 m x 1. Jakarta **) Balai Riset Perikanan Bididaya Air Tawar.47 g).000 ekor atau kepadatan 10 ekor/m2.71). Lokasi tambak dipilih daerah yang dekat dengan sumber air tawar. pertumbuhan. 15 dan 20 ekor/m2 dengan bobot awal antara 15.76%). 10. Bogor ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.5 m. Nilai sintasan tertinggi pada kepadatan 5 ekor/m2 (98. Sifat biologi pertumbuhannya belum banyak diketahui. sedangkan petakan kedua ditebar sebanyak 2.54 g dan panjang awal antara 10.45 g). Sukamandi ABSTRAK Budidaya pembesaran patin pasupati di lahan tambak dimaksudkan untuk mendapatkan informasi mengenai keragaan pertumbuhan ikan patin pasupati yang dibudidayakan di lahan tambak atau air yang bersalinitas tidak lebih tinggi dari 10 ppt.09 cm dan 1. Dari pemeliharaan selama 90 hari diperoleh hasil bahwa kepadatan 5 ekor/m2 mempunyai pertambahan bobot terbesar (95.52%) dan terendah pada 20 ekor/m2 (91. Pakan yang digunakan adalah pakan buatan dengan kandungan protein kasar 30%–32% dan feeding rate 3% per bobot ikan per hari. salinitas air tambak yang berfluktuasi 1–6 ppt dapat mencegah timbulnya penyakit yang menyerang ikan patin.Forum Inovasi Teknologi Akuakultur 2010 FF 30 PEMBESARAN IKAN PATIN PASUPATI PADA LAHAN TAMBAK BERSALINITAS RENDAH DI KABUPATEN BREBES.17%/hari sedangkan kepadatan 5 ekor/m2 mencapai 3. Pertumbuhan ikan patin yang baik ini karena di tambak banyak ditemukan pakan alami yang berlimpah.30%).000 ekor atau kepadatan 5 ekor/m2.43–11.18) dan terendah pada 10 ekor/m2 (1.36 cm. pertumbuhan.06%) dan terendah pada kepadatan 20 ekor/m2 (7. Luas tambak 600 m2 atau ukuran 40 m x15 m yang disekat dengan kerai bambu agar di peroleh 2 unit petakan percobaan. dengan dosis dinaikkan secara bertahap yaitu sebanyak 5% hingga usia 1 bulan pertama kemudian sebanyak 3% bulan berikutnya. di samping itu. FCR tertinggi diperoleh pada kepadatan 15 ekor/m2 (2. pakan alami FF 31 PERTUMBUHAN IKAN PATIN NASUTUS (Pangasius nasutus) MELALUI PADAT TEBAR BERBEDA Ika Nurlaela. nasutus .76 cm dan 2.10%/hari.80%.

108. Uji tantang dilakukan dengan dua cara. dan (C) 0. Pengamatan benih dilakukan setiap 7 hari sekali dengan cara sampling selama 40 hari pemeliharaan. Angela Mariana Lusiana**). Hasil percobaan menunjukkan sintasan benih tertinggi ditunjukkan pada perlakuan dosis 0. Penelitian ini dilakukan dalam skala laboratorium di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Pemeliharaan dilakukan dalam 9 buah akuarium berukuran 95 m x 45 m x 45 m dan diisi 100 liter air. 108. 106. Rancangan percobaan menggunaan acak lengkap 5 perlakuan dan 3 ulangan.49 cm). Evi Tahapari*).33%) dan terendah perlakuan dosis 0.35 ± 0.Forum Inovasi Teknologi Akuakultur 2010 FF 32 KETAHANAN PENYAKIT BAKTERIAL PADA IKAN PATIN NASUTUS (Pangasius nasutus) Sularto*). Sedangkan untuk cara penyuntikan Perlakuan yang dicobakan adalah biakan bakteri Aeromonas hydrophila dengan kepadatan : 104. benih. Parameter yang diamati adalah insidensi dan sintasannya. Parameter yang diamati adalah sintasan dan laju pertumbuhan panjang tubuh serta beberapa parameter kualitas air.001 mg/L (4. Pada cara perendaman dosis bakteri Aeromonas hydrophila yang digunakan adalah: plasebo.002 mg/L (83. sebagai perlakuan yaitu: (A) 0.003 mg/L dengan tiga kali ulangan.67%). Jakarta *) ABSTRAK Penelitian insidensi dan ketahan penyakit bacterial pada ikan patin nasutus untuk mengetahui sejauh mana tingkat insidensi penyakit bakterial yang menyerang ikan patin nasutus terutama pada ukuran benih serta ketahanannya terhadap penyakit tersebut. dan 15 ekor/L. 107. sintasan. intraperitonial. diikuti dosis 0. kemudian perlakuan dosis 0. Gondol ABSTRAK Percobaan ini dilakukan guna mengetahui pengaruh pemberian probiotik dengan dosis yang berbeda terhadap sintasan dan pertumbuhan benih patin jambal. Titer antibodi pada perlakuan ini menunjukkan respons positif namun relatif rendah. Hasil penelitian uji tantang pada ikan ukuran 1 inci dengan perendaman menunjukkan tingkat kematian benih mencapai 75% pada dosis 109.001 mg/L.35 cm). dan pertumbuhan . dosis. Sukamandi **) Balai Riset Perikanan Budidaya Air Tawar. Kata kunci: uji tantang Aeromonas hydrophila. Selama pemeliharaan diberikan pakan pelet komersial dengan dosis 3% dari total biomassa per hari. yaitu: cara perendaman dan cara penyuntikan intraperitonial. Probiotik diberikan dengan dosis yang berbeda.002 mg/ L. Jakarta **) Balai Besar Riset Perikanan Budidaya Laut. Pengamatan dilakukan selama 15 hari setelah perlakuan.55 ± 0. KATA KUNCI: probiotik. dan Riani Rahmawati**) *) Pusat Riset Perikanan Budidaya.67%). 10 ekor/L. Rata–rata pertumbuhan panjang tubuh tertinggi diperoleh pada pemberian dosis probiotik 0. dan kontrol. Pada uji tantang dengan cara injeksi terhadap benih ikan berukuran 3– 4 inci memberikan respons antibodi yang tinggi dengan sintasan benih >90%. dan kontrol (placebo). Bogor ***) Pusat Riset Perikanan Budidaya.001 mg/L (86. Perlakuan kedua adalah padat tebar: 5 ekor/L. Ikan uji yang digunakan berukuran 3–4 inci. Pangasius nasutus FF 33 PENGARUH PEMBERIAN PROBIOTIK DENGAN DOSIS YANG BERBEDA TERHADAP SINTASAN DAN PERTUMBUHAN BENIH PATIN JAMBAL (Pangasius djambal) Septyan Andriyanto*). 109.002 mg/L (4.60 ± 0. Analisis data dilakukan secara deskriptif.003 mg/L (81. dan Wartono Hadie***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Ikan uji yang digunakan berukuran 1–2 inci.14 cm). perendaman. (B) 0. kemudian dosis 0.003 mg/L (4. Sukamandi. Nurbakti Listyanto*). Data dianalisis dengan menggunakan Anova dan titer antibodi dianalisis menggunakan metode Anderson dan dijelaskan secara deskriptif.

artinya ampas tahu terfermentasi berpeluang untuk menggantikan tepung bungkil kedelai. substitusi FF 35 KERAGAAN REPRODUKSI PATIN NASUTUS (Pangasius nasutus) SEBAGAI KANDIDAT IKAN PATIN BUDIDAYA Evi Tahapari. tahap 4 (migrasi nukleus dan hidrasi) dengan diameter oosit 1. 75% ampas tahu:25% tapioka. tahap 2 (vesikula kuning telur dan alveoli korteks) dengan diameter oosit 125-500 µm. Perkembangan oosit patin nasutus bersifat sinkronis grup. dan 25% ampas tahu:75% tapioka.03% (pakan C) memberikan hasil yang tidak berbeda nyata dengan tepung bungkil kedelai. 50% ampas tahu:50% tapioka.Forum Inovasi Teknologi Akuakultur 2010 FF 34 PEMANFAATAN AMPAS TAHU TERFERMENTASI SEBAGAI SUBTITUSI TEPUNG KEDELAI DALAM FORMULASI PAKAN IKAN PATIN Irma Melati. substitusi protein 0% (kontrol) (pakan A). Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas ampas tahu dengan cara mencampurkan dengan tapioka dengan berbagai perbandingan yaitu 100% ampas tahu. Hasil penelitian menunjukkan bahwa perbandingan 75% ampas tahu dan 25% tapioka memberikan hasil kenaikan protein yang lebih baik (129. Sebagai perlakuan adalah persentase substitusi protein tepung ampas tahu terfermentasi (gizi terbaik dari percobaan pertama) terhadap protein tepung kedelai dengan perincian sebagai berikut.200 µm dan pada saat berumur 10 hari panjang larva mencapai 11. tahap 3 (granula kuning telur) dengan diameter oosit 700–1. yakni tahap 1 (kromatin nukleolar dan perinukleolar) dengan diameter oosit kurang dari 125 µm. substitusi protein 4. dan digunakan sebagai substitusi terhadap tepung bungkil kedelai dalam formulasi pakan ikan patin. Penelitin ini terdiri atas dua tahap. dan Titin Kurniasih Balai Riset Perikanan Budidaya Air Tawar. substitusi protein 2. dan Sularto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. berukuran kecil yang merupakan telur cadangan untuk proses pemijahan berikutnya. Ke dalam wadah ditebar ikan patin ukuran 11.000 µm.03 g/ekor dengan kepadatan ikan 20 ekor/akuarium. Ukuran panjang total larva yang baru menetas berkisar 3.04% (pakan D).52% (pakan B).850 µm. Digunakan 12 unit akuarium ukuran 100 cm x 60 cm x 60 cm dengan sistem air mengalir dan pengatur suhu. hatching. KATA KUNCI: fermentasi. ditandai dengan adanya dua kelompok oosit intraovarian pada ikan yang matang gonad. Zafril Imran Azwar. Upaya pengembangan patin nasutus memerlukan informasi-informasi biologireproduksi berkaitan dengan kapasitas produksinya. Bambang Iswanto.03% (pakan C).58%) dibandingkan perlakuan yang lain dan substitusi protein ampas tahu terfermentasi terhadap protein tepung kedelai sebesar 4. rearing.700 µm. yakni pengamatan perkembangan gonad dan fertilisasi. larva. dan tahap 5 (atresis) dengan diameter oosit 300–1. yakni kelompok oosit matang yang segera dikeluarkan pada saat pemijahan dan kelompok oosit stok yang belum berkuning telur. dan substitusi protein 6.16%–79. Percobaan dilakukan di Balai Riset Perikanan Budidaya Air Tawar.130–22.700– 4.900 µm. Hasil pengamatan perkembangan gonad menunjukkan bahwa oosit intraovarian patin nasutus dapat dibagi dalam lima tahap. Sukamandi ABSTRAK Patin nasutus merupakan salah satu spesies ikan patin Indonesia yang potensial untuk dikembangkan sebagai komoditas baru perikanan budidaya. Derajat penetasan patin nasutus berkisar 44. Bogor ABSTRAK Penelitian ini bertujuan untuk memperbaiki kualitas ampas tahu dengan memanfaatkan mikroba Aspergillus niger. KATA KUNCI oosit. Tujuan dari penelitian ini adalah untuk mengetahui karakteristik perkembangan organ reproduksi dan larva patin nasutus.05% dengan lama inkubasi 22–25 jam. Aspergillus niger. ampas tahu.41±0.250–1. Pangasius nasutus .

diikuti perlakuan B. 1.47±0. Penelitian ini bertujuan untuk mengatahui karakteristik embriogenesis dan perkembangan awal larva patin-patin hibrida tersebut. dan D.71±0. Hasil pengukuran menunjukan pertambahan panjang tertinggi diperoleh perlakuan perlakuan D. B. 50% zeolit + 50% bioball dan D. 4. Hal ini dikarenakan patin siam memiliki keunggulan fekunditas yang tinggi. masing-masing perlakuan diulang sebanyak empat kali.14 mm.03±0. Sistem resirkulasi yang digunakan adalah kombinasi filter yang berbeda yaitu : A.13 mm. Hasil penelitian memberikan nilai penyisihan amonia yang diperoleh tiap filter sebesar A. C. yakni hibridisasi antara betina patin siam dengan jantan patin jambal maupun jantan patin nasutus.54 cm).) Nurhidayat dan Rendy Ginanjar Balai Riset Budidaya Ikan Hias.60 cm/ekor. 100% zeolit B.10–1. Hasil pertumbuhan bobot tertinggi diperoleh perlakuan D. 25% zeolit + 75% bioball.69 cm/ekor diikuti B.42. 4.) Pembesaran benih Patin di dalam sistem biofilter mempunyai tujuan untuk mengetahui peran biofilter terhadap pertumbuhan dan sintasan benih Patin.62 g) dan panjang (2.33%. 1863) Bambang Iswanto dan Evi Tahapari Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dengan kantung kuning telur berukuran 0.1.35 cm/ekor dan A. C. Sukamandi ABSTRAK Pengembangan budidaya patin jambal maupun patin nasutus untuk memenuhi permintaan pasar ekspor patin daging putih sulit direalisasikan karena keterbatasan fekunditasnya.6±0. dan D. B. KATA KUNCI: patin albino. 1.24) x 103.20. 95. B.43b.27a. diikuti perlakuan C. C. Larva patin hibrida siam-jambal mulai menetas 21 jam setelah fertilisasi. sintasan FF 37 EMBRIOGENESIS DAN PERKEMBANGAN AWAL LARVA PATIN HASIL HIBRIDISASI ANTARA BETINA PATIN SIAM (Pangasianodon hypophthalmus SAUVAGE. Embriogenesis patin hibrida siam-jambal dan siam-nasutus serupa. C.02 g/ekor. 88. Salah satu upaya yang dapat dilakukan untuk meningkatkan produktivitas patin daging putih adalah melalui hibridisasi. 0.67%. 1. Penelitian ini menggunakan benih umur 28 hari dengan bobot rata-rata (0. Depok ABSTRAK Biofilter berpern untuk meningkatkan kualitas air dalam sistem resirkulasi dan berdampak pada peningkatan pertumbuhan dan sintasan benih patin albino (Pangasius hipopthalmus var. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan tiga perlakuan.1±0. 2.89±0. berukuran panjang total 3. biofilter. Nilai tersebut didukung dengan jumlah populasi biomassa bakteri non patogen (nitrifikasi) dengan jumlah koloni (A. Kualitas air yang dihasilkan memberikan pengaruh terhadap pertumbuhan panjang dan bobot benih selama penelitian. Hasil penelitian ini menunjukkan bahwa diameter telur patin siam yang difertilisasi dengan sperma patin nasutus dan patin jambal berukuran 1.75% dan terendah perlakuan A. 88.45 g/ekor. Hasil akhir percobaan diperoleh sintasan terbesar di perlakuan D. 79. sedangkan patin jambal maupun patin nasutus memiliki keunggulan daging yang putih.Forum Inovasi Teknologi Akuakultur 2010 FF 36 FUNGSI BIOFILTER DALAM SISTEM RESIRKULASI UNTUK PENDEDERAN BENIH PATIN ALBINO (Pangasius hypophthalmus VAR. 2.08 mm3 yang terserap 50% pada umur 30 jam .56 cm/ekor.25 g/ekor.42±0. pertumbuhan. 1.64±0. berukuran panjang total 3.84 g/ekor dan terendah A. 1878) DENGAN JANTAN PATIN JAMBAL (Pangasius djambal BLEEKER. 89.28 mm3 yang terserap 50% pada umur 24 jam dan relatif habis terserap pada umur 54 jam.34±0. Larva patin hibrida siam-nasutus mulai menetas 20 jam setelah fertilisasi.30ab. tetapi perkembangan patin hibrida siam-nasutus sedikit lebih cepat.20 mm.01±0. 0. C. 75.58%. 75% zeolit + 25% bioball.30a.98±0.31ab. 0. dengan kantung kuning telur berukuran 0. 1846) DAN JANTAN PATIN NASUTUS (Pangasius nasutus BLEEKER. 91.01±0. 92.

Kata kunci: embriogenesis. tetapi patin hibrida siam-nasutus menunjukkan keragaan pertumbuhan yang lebih bagus. hibrida.dan habis terserap pada umur 60 jam. larva. siam. jambal. menghasilkan heterosis berdasarkan pertambahan panjang total selama 10 hari pemeliharaan sebesar 20. sedangkan patin hibrida siam-jambal sebesar -4.23%.28%. Perkembangan awal larva kedua patin hibrida tersebut hingga menyerupai morfologi ikan dewasa juga relatif serupa. nasutus .

Untuk menentukan 2 3 total limbah N termasuk eksresi amonia. dilakukan penelitian yang bertujuan untuk mengetahui faktor pengelolaan tambak yang mempengaruhi produksi ikan bandeng (Chanos chanos) di tambak Kabupaten Bone. Sebagai peubah tidak bebas adalah produksi ikan bandeng dan peubah bebas adalah faktor pengelolaan tambak yang terdiri atas 21 peubah. Hasil penelitian menunjukkan bahwa. penambahan dosis pupuk TSP/SP-36 sebagai pupuk susulan serta menambah lama pemeliharaan ikan bandeng dan sebaiknya menurunkan padat penebaran udang windu yang dipolikultur dengan ikan bandeng. Produksi ikan bandeng di Kabupaten Bone berkisar antara 10 sampai 2. Dedi Jusadi**). ikan bandeng. lalu ditambahkan kromium oksida (Cr O ) sebagai indikator kecernaan. Metode penelitian yang diaplikasikan adalah metode survai untuk mendapatkan data primer dari produksi dan pengelolaan tambak yang dilakukan melalui pengajuan kuisioner kepada responden secara terstruktur. padat penebaran udang windu.990 kg/ha/musim dengan rata-rata 292. dosis pupuk TSP/SP-36 susulan dan lama pengangkutan gelondongan ikan bandeng. Total limbah N per 100 g pakan yang masuk ke perairan meningkat dengan meningkatnya kadar protein .2% untuk bahan kering. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Hasil penelitian menunjukkan bahwa kecernaan ketiga pakan tersebut berbeda tidak nyata yaitu antara 77. Maros ABSTRAK Produktivitas tambak di Kabupaten Bone Provinsi Sulawesi Selatan sangat bervariasi yang dapat disebabkan oleh bervariasinya pengelolaan yang dilakukan oleh pembudidaya tambak. penelitian ini dilakukan untuk mendapatkan informasi tentang kecernaan pakan pada pembesaran ikan bandeng dan untuk menduga beban limbah nitrogen (N) dan karbon organik (C) ke lingkungan yang akan dijadikan acuan untuk penumbuhan bakteri heterotrof (bioflok). dilakukan juga pemeliharaan ikan bandeng selama 45 hari dan menghitung retensi N. Akhmad Mustafa. dan Anugriati Balai Riset Perikanan Budidaya Air Payau. lama ikan bandeng digelondongkan. produksi. Faktor pengelolaan yang mempengaruhi produksi ikan bandeng adalah: padat penebaran ikan bandeng. Enang Harris**). Oleh karena itu. 21% dan 26%.2%–78. 88. Analisis regresi berganda dengan peubah boneka tertentu digunakan untuk memprediksi produksi ikan bandeng. lama pemeliharaan ikan bandeng. Jika bioflok terbentuk. KATA KUNCI: pengelolaan. Pakan tersebut digiling ulang. dapat memperbaiki kualitas air dan sekaligus bioflok tersebut dapat menjadi makanan bagi ikan budidaya. Institut Pertanian Bogor ABSTRAK Limbah N dan C-organik ikan budidaya dapat dikonversi menjadi bioflok.0% untuk protein dan 81. Produksi ikan bandeng ini masih dapat ditingkatkan melalui peningkatan ukuran gelondongan ikan bandeng yang ditebar. Kabupaten Bone FF 39 ANALISIS TINGKAT KECERNAAN PAKAN DAN LIMBAH NITROGEN (N) BUDIDAYA IKAN BANDENG SERTA KEBUTUHAN PENAMBAHAN C-ORGANIK UNTUK PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) Usman*). tambak.1% untuk Corganik. tetapi akibat serangan penyakit berdampak pada kegagalan atau produksi udang windu yang sangat rendah. Maros **) Fakultas Perikanan dan Ilmu Kelautan.6%–83. Eddy Supriyono**).2 kg/ha/musim.Forum Inovasi Teknologi Akuakultur 2010 FF 38 PENENTUAN FAKTOR PENGELOLAAN YANG MEMPENGARUHI PRODUKSI IKAN BANDENG (Chanos chanos) DI TAMBAK KABUPATEN BONE PROVINSI SULAWESI SELATAN Erna Ratnawati. umumnya pembudidaya tambak di Kabupaten Bone melakukan polikultur ikan bandeng dan udang windu (Penaeus monodon) di tambak. Pakan uji yang digunakan adalah pakan komersial yang memiliki kadar protein berbeda yaitu 17%.6%–90. Neltje Nobertine Palinggi*). Oleh karena itu.

2. KATA KUNCI: feed digestibility. heterotrof bakteria .pakan yaitu 2. milk fish. dan 3. diperlukan aplikasi C-organik sebanyak 33 g/100 g pakan yang mengandung protein 26%. Untuk mengkonversi limbah N dari budidaya bandeng ini menjadi bakteri heterotrof (bioflok).28% untuk pakan berprotein 26%.76 g N untuk pakan berprotein 21%.27 g N untuk pakan berprotein 17%. N waste.

Dengan demikian produksi bandeng saat ini masih terbatas untuk memenuhi kebutuhan dalam negeri. Eddy Supriyono**). Lahan yang berpotensi untuk budidaya laut di wilayah ini mencapai 12. Semua data yang diperoleh dianalisis secara deskriptif untuk menentukan alternatif kebijakan dalam pengembangan budidaya bandeng ke depan. dan Munti Yuhana**) *) Balai Riset Perikanan Budidaya Air Payau. Data Ditjen Perikanan Budidaya menunjukkan bahwa produksi bandeng tahun 2009 untuk Jawa Tengah sekitar 86.54% per tahun kurun waktu tahun 2005–2009. Penyusun utama bioflok ini adalah bakteri heterotrof. Oleh karena itu. Penumbuhan bakteri heterotrof dilakukan dengan mempertahankan keseimbangan rasio C/N sekitar 10 dalam media budidaya selama 30 hari. Pada tulisan ini memberikan informasi tentang permasalahan yang berkaitan dengan budidaya bandeng di Pantai Utara Jawa Tengah serta opsi kebijakan pengembangan budidayanya. dan (D) inokulasi bakteri heterotrof sebanyak 106 cfu/mL. Pada tahun yang sama. KATA KUNCI: budidaya. (C) inokulasi bakteri heterotrof sebanyak 104 cfu/mL. Demikian juga produksi nasional untuk komoditas bandeng tahun 2009 mencapai 475.organik.66% dari tahun-tahun sebelumnya. dan Pekalongan. growing.Forum Inovasi Teknologi Akuakultur 2010 FF 40 PENUMBUHAN BAKTERI HETEROTROF (BIOFLOK) DALAM MEDIA BUDIDAYA IKAN BANDENG Usman*). Khususnya di wilayah Pantai Utara yaitu Kendal. kendala. opsi kebijakan . Penambahan inokulasi bakteri komersial (Bacillus sp. bandeng. kebutuhan bandeng untuk konsumsi dalam negeri sekitar 470. DAN PEKALONGAN ) Anjang Bangun Prasetio. Enang Harris**). Dedi Jusadi**).726 ha dan yang layak untuk budidaya sekitar 6. Survai lapangan meliputi wawancara mendalam dengan responden kunci dan observasi kondisi tambak bandeng.) cenderung meningkatkan kandungan asam amino bioflok. Perlakuan yang dicobakan adalah: (A) tanpa inokulasi mikroba (kontrol). KATA KUNCI: Heterotrofic bakteria.000 ton dan mengalami kenaikan rata-rata 13. Maros **) Fakultas Perikanan dan Ilmu Kelautan Institut Pertanian ABSTRAK Bioflok merupakan agregasi dari berbagai jenis mikroorganisme termasuk polimer organik yang dapat berperan dalam memperbaiki kualitas air dan sekaligus dapat menjadi makanan ikan budidaya.250 ton. Sumber nitrogen berasal dari limbah 40 ekor ikan bandeng (bobot rata-rata 75g/ekor) yang dipelihara dalam bak fibre glass berisi air bersalinitas 25 ppt sebanyak 625 L.975 ha.000 ton dan mengalami kenaikan sebesar 14. Pengumpulan data dan informasi dilakukan dengan melakukan desk study dan survai lapangan. Hasil penelitian menunjukkan bahwa penambahan inokulasi bakteri heterotrof sebanyak 106 cfu/mL cenderung lebih meningkatkan laju konversi limbah N menjadi bioflok dibandingkan jumlah inokulasi bakteri yang lebih rendah dan kontrol. Pati. milkfish grow-out FF 41 PERKEMBANGAN BUDIDAYA BANDENG DI PANTAI UTARA JAWA TENGAH (STUDI KASUS: KENDAL. Indikator utamanya dapat dilihat dari pola penurunan konsentrasi TAN dan peningkatan VSS. Hatim Albasri. dan Rasidi Pusat Riset Perikanan Budidaya. (B) inokulasi bakteri heterotrof (komersial) sebanyak 102 cfu/mL. Molase digunakan sebagai sumber C. Ikan uji diberi pakan komersial dengan kadar protein sekitar 26%. Jakarta ABSTRAK Penelitian ini dilakukan di Jawa Tengah yang merupakan salah satu sentra budidaya bandeng di Indonesia. penelitian ini dilakukan untuk mendapatkan informasi metode menumbuhkan bakteri heterotrof (bioflok) dalam media budidaya ikan bandeng intensif. PATI. Desk study dilakukan dengan mengkompilasi dan mensintesa data-data sekunder yang terkait untuk menjawab tujuan studi.

03%) kontrol tidak diinjeksi lebih tinggi dibandingkan dengan perlakuan injeksi.0%).65%. Kesimpulannya adalah bahwa promoter heat shock dari ikan rainbow trout. Gusrina*). Nilai DP juga relatif sama untuk ketiga konstruksi gen yang diuji. KATA KUNCI: promoter. gfp) yang dikontrol oleh setiap promoter tersebut pada embrio hasil mikroinjeksi.67%). FMIPA. Puncak ekspresi gen gfp yang dikendalikan oleh promoter keratin dan â-aktin adalah sama yaitu pada jam ke-10. keratin-GFP (21. Alimuddin**). Penelitian ini dilakukan untuk mengetahui aktivitas promoter â-aktin dari ikan medaka (mBA). Institut Pertanian Bogor ABSTRAK Promoter berperan penting dalam transgenesis sebagai pengatur ekspresi gen yang diintroduksi. Jumlah telur yang diinjeksi untuk setiap konstruksi gen adalah sebanyak 30 embrio dan dilakukan 2 pengulangan. Ekspresi gen gfp diamati menggunakan mikroskop fluoresen (Olympus SZX 16) di mulai pada jam ke-4 setelah fertilisasi dan dilanjutkan setiap 2 jam sekali hingga ekspresi gfp tidak terdeteksi.34±1.0%) dan yang terendah â-aktin-GFP (3.0±0. DP untuk â-aktin-GFP. DKHe dihitung sebelum telur menetas. DKH-e yang diinjeksi dengan â-aktin-GFP (25. HEAT SHOCK DAN KERATIN PADA IKAN LELE. dan Utut Widyastuti***). Fakultas Perikanan dan Ilmu Kelautan. 18.0%).****) *) Mahasiswa Pasca Sarjana Institut Pertanian Bogor **) Departemen Budidaya Perairan. sehingga ketiga promoter tersebut dapat digunakan dalam pembuatan ikan lele transgenik.00±3. Persentase embrio yang mengekspresikan gen gfp tertinggi diperoleh pada keratin-GFP (20.1 M masing-masing diinjeksikan secara terpisah ke dalam blastodisk embrio ikan lele fase 1 sel.66±1. rtHSC-gfp dan fKer-gfp dengan konsentrasi 50 ng/µL KCl 0.33%.67%. menyusul heat shock-GFP (10.34%) dan DP (63. Komar Sumantadinata**).33±3.Forum Inovasi Teknologi Akuakultur 2010 FF 41 AKTIVITAS PROMOTER ß-AKTIN.63±10. Telur diinkubasi pada akuarium dengan suhu air sekitar 28oC. mikroinjeksi.33±1. Ekspresi gen gfp tidak tampak lagi pada saat telur menetas. IPB ***) Pusat Penelitian Sumberdaya Hayati dan Bioteknologi IPB ****) Departemen Biologi.66%) relatif sama.) sebagai langkah awal dalam rangka produksi ikan lele transgenik dengak karakter yang berguna bagi akuakultur. Hasil penelitian menunjukkan bahwa DKH-e (63. dan 15. sedangkan DP dihitung ketika semua telur telah menetas.65%) dan heat shock-GFP (18.GFP.0±10. sedangkan oleh promoter heat shock pada jam ke-12 setelah fertilisasi. Clarias sp. Konstruksi gen dalam bentuk plasmid mBA-gfp. Data dianalisis secara deskriptif. dan heat shock-GFP berturutturut adalah 20.00±1. ikan lele .3±0. Derajat sintasan embrio (DKH-e) dan derajat penetasan (DP) dianalisis sebagai data pendukung. keratin dari ikan flounder Jepang dan â-aktin dari ikan medaka dapat aktif mengendalikan ekspresi gen asing pada ikan lele. GFP. keratin.00±1. heat shock dari ikan rainbow trout (rtHSC) dan keratin dari ikan flounder Jepang (fKer) pada ikan lele (Clarias sp. Aktivitas promoter diketahui dengan cara mengamati ekspresi gen penyandi protein berpendar hijau (green fluorescent protein.

aerasi. dan Lamanto Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar ABSTRAK Nilai kecernaan pakan dapat digunakan sebagai petunjuk tingkat efisiensi pemanfaatan pakan oleh ikan yang dipelihara. Ikan lele dumbo berukuran 41. hydrophila. KATA KUNCi: A. ikan lele dumbo (Clarias gariepinus).05). Angela Mariana Lusiastuti. 24. Pakan yang diberikan berupa pakan apung dan pakan tenggelam dengan kadar protein 31%–33%. Hal ini disebabkan karena obat kemoterapi serta obat kimia lainnya mempunyai efek samping yang mengganggu keseimbangan kesehatan dan alam. pagi dan sore.39% kadar asiaticosid. 5. Feces yang dihasilkan diambil setiap hari.39 g/ekor dipelihara di dalam wadah penelitian dengan kepadatan 20 ekor/bak. Antibakteri pegagan (asiaticosid) Centella asiatical [L] Urb.33% kadar sari dalam air.. 6. pakan terapung mempunyai nilai kecernaan lebih tinggi (yakni 92. Pemberian pakan sebesar 5% dari biomassa per harinya. UNTUK PENYAKIT BERCAK MERAH (Haemorragic septicaemia) AKIBAT INFEKSI Aeromonas hydrophila PADA IKAN LELE (Clarias gariepinus) Desy Sugiani.05) dari 79. 1.25% sehingga tidak berbeda nyata dengan pakan terapung.37% kadar abu. Melalui penambahan aerasi. Kandungan bahan aktif hasil pengekstrasian pegagan segar. Konsentrasi yang efektif menghambat pertumbuhan bakteri untuk kedua bahan herbal sehingga dapat meningkatkan respons immun dan sintasan berada di bawah nilai LC50-24 (5. Herbal therapy harus menjadi kecenderungan bagi upaya pengendalian penyakit ikan di masa mendatang. Bak diisi air sebanyak 100 liter. Usaha pengendalian penyakit bakterial dapat dilakukan dengan cara pencegahan (preventif) dan pengobatan (kuratif).74±1.623. nilai kecernaan pakan tenggelam meningkat secara nyata (P<0. pakan terapung . 39.47±4. dan Uni Purwaningsih Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Semenjak tahun 1980 penyakit bercak merah (haemorragic septicaemia) atau MAS (Motile Aeromonas Septicaemia) akibat infeksi bakteri bakteri A.83% kadar sari dalam alkohol. Taukhid.34% kadar air. KATA KUNCI: kecernaan pakan. pegagan Centella asiatical [L] Urb. Rita Febrianti. Wadah penelitian yang digunakan berupa bak fiberglas dengan dasar berbentuk corong yang dilengkapi pipa pengumpul feses ikan. bahan aktif.15%) dibandingkan dengan pakan tenggelam (yakni 79. Pada perlakuan tanpa aerasi. dosis FF 44 KERAGAAN KECERNAAN PAKAN TENGGELAM DAN TERAPUNG UNTUK IKAN LELE DUMBO (Clarias gariepinus) DENGAN DAN TANPA AERASI Bambang Gunadi. Alternatif yang menjanjikan untuk masa depan adalah tumbuhan berguna.71±2.53%) (P<0.Forum Inovasi Teknologi Akuakultur 2010 FF 43 POTENSI ANTI BAKTERI PEGAGAN Centella asiatical [L] URB.47±4.30±2.41 mg/L) dengan dosis efektif 250 mg/L. pakan tenggelam. 0. Hasil pengamatan selama 5 hari menunjukkan bahwa jenis pakan tenggelam dan terapung dan penambahan aerasi mempengaruhi kecernaan pakan ikan lele dumbo. dapat digunakan untuk menanggulangi penyakit bercak merah (haemorragic septicaemia) akibat infeksi Aeromonas hydrophila pada ikan lele (Clarias gariepinus). Penelitian ini dilaksanakan untuk menganalisis pengaruh jenis pakan (tenggelam dan terapung) dan penambahan aerasi terhadap nilai koefisien kecernaan pakan (KKP) terhadap ikan lele dumbo (Clarias gariepinus).23% kadar abu tak larut asam. hydrophila menjadi penyakit endemis di Indonesia.53% menjadi 92.

Forum Inovasi Teknologi Akuakultur 2010

FF 45
Zafril Imran Azwar dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar

Percobaan perbaikan kualitas tepung maggot dan penggunaannya dalam formulasi pakan ikan lele telah dilakukan sebagai upaya mengurangi pemakaian tepung ikan atau sumber protein impor. Percobaan dilakukan di Laboratorium Balai Riset Perikanan Budidaya Air Tawar Bogor. Wadah percobaan yang digunakan adalah bak beton ukuran 1,0 m x 1,0 m x 0,8 m, dan dirancang sistem resirkulasi. Ke dalam bak ditebar ikan lele ukuran jari dengan kisaran bobot 9,33±0,10 g sebanyak 40 ekor. Sebagai perlakuan adalah substitusi tepung maggot hasil fermentasi sebagai pengganti tepung ikan yaitu 0% (kontrol); 7,92%; 13,28%; 19,56%; dan 25,81% dalam formulasi pakan. Setiap perlakuan dengan 3 ulangan. Sebelum dilakukan uji formulasi dilakukan percobaan upaya perbaikan kualitas tepung maggot dengan penambahan berbagai substrat sebagai sumber karbohidrat yaitu dedak polar sebagai pencampur utama dan sumber karbohidrat gula lontar, tapioka, dan molase. Hasil percobaan memperlihatkan bahwa maggot dicampur dengan dedak polar dan molase sebanyak 10% memberikan perbaikan kualitas lebih baik dengan meningkatnya protein sebesar 11,96%, dan penurunan lemak 61,85%, dari perlakuan kontrol. Laju pertumbuhan spesifik, penambahan bobot ikan lele terbaik pada perlakuan penggunaan tepung maggot sebanyak 7,90%, namun perlakuan lainnya yaitu penggunaan maggot hingga sebanyak 25,83% tidak memperlihat perbedaan dengan perlakuan kontrol.
KATA KUNCI: maggot, fermentasi, formulasi, lele dumbo

FF 46
Tutik Kadarini, Siti Subandiyah, Sulasy Rohmi, dan Darti Satyani Balai Riset Budidaya Ikan Hias

Sintasan dan pertumbuhan ikan gurame coklat masih rendah untuk meningkatkan dengan media pemeliharaan yang diberi daun ketapang. Tujuan penelitian untuk mengetahui sintasan dan pertumbuhan. Ikan berasal dari Kalimantan dan diadaptasikan di laboratorium. Wadah yang digunakan akuarium ukuran 50 cm x 40 cm x 40 cm dengan volume air 40 liter. Ikan ditebar padat penebaran 15 ekor/wadah dengan ukuran ikan 2,3–3,1 cm. Media pemeliharaan yang diberi daun ketapang kering dengan jumlah yang berbeda sekaligus sebagai perlakuan yaitu 0, 10, 20, dan 30 g/40 liter masing- masing diulang 3 kali. Jenis pakan berupa cacing tubifex, bloodworm, dan cuk yang diberikan diselang-seling secara adlibitum. Parameter yang diamati sintasan dan pertumbuhan (bobot, panjang, dan perkembangan gonad), kualitas air (suhu, pH, amonia, alkalinitas, oksigen, dan karbondioksida). Hasil penelitian menunjukkan media yang terbaik untuk pemeliharaan gurame coklat adalah daun ketapang kering 10 gr/40 liter yaitu sintasan 55% dan pertumbuhan panjang total berkisar 3,8–4,7 cm mencapai TKG III.
KATA KUNCI: gurame coklat, reproduksi, ikan, dan gonad

Forum Inovasi Teknologi Akuakultur 2010

FF 47
Hessy Novita dan Hambali Supriyadi Pusat Riset Perikanan Budidaya, Jakarta

Ikan gurame atau yang lebih dikenal dengan Opsrenemus gouramy Lac. adalah ikan kosumsi yang mempunyai nilai ekonomis tinggi, Ikan ini kebanyakan dibudidayakan dalam kolam tanah yang membutuhkan waktu cukup lama karena makanannya masih alami dari tanaman, yaitu seperti daun talas. Penyakit yang sering menyerang ikan gurame ini adalah penyakit bakterial yang dikenal juga dengan Fish TB yang disebabkan oleh Mycobacterium fortuitum. Untuk mendiagnosa penyakit fish TB masih dilakukan secara biokimia dan membutuhkan waktu lama. Tujuan dari penelitian ini adalah untuk mengaplikasikan metode diagnosa untuk mendeteksi Mycobacterium fortuitum pada ikan gurame yang ada disentra budidaya ikan gurame di Jawa, yaitu di Jawa timur (Blitar dan Tukung Agung), Jawa barat (Tasikmalaya) dan di Jawa Tengah (Purwokerto) dengan menggunakan teknik PCR (Polymerase Chain Reaction). Dari hasil penelitian menunjukkan bahwa di daerah Blitar, Tasikmalaya dan Purwokerto positif terserang penyakit Mycobacteriosis berdasarkan diagnosa dengan PCR pada target band 210 Bp. Dengan adanya aplikasi diagnosa dengan PCR ini diharapkan, penyakit pada bakterial pada ikan gurame dapat diketahui dengan cepat dan dapat dilakukan tindakan pencegahan dengan cepat, sehingga petani tidak mengalami banyak kerugian.
KATA KUNCI: fish TB, Mycobacteriosis, Mycobacterium fortuitum, biokimia, PCR

FF 48
Bambang Gunadi, Lamanto, dan Rita Febrianti Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar, Sukamandi

Ikan gurame termasuk ikan dengan fekunditas rendah. Banyak pembenih gurame merasa cukup memberi pakan induk gurame hanya dengan daun sente. Pemberian pakan buatan diduga mampu meningkatkan produktivitas induk gurame. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan buatan dengan kadar protein yang berbeda terhadap keragaan reproduksi induk gurame yang meliputi produksi sarang, produksi telur per sarang, dan tingkat fertilitas telur yang dihasilkan. Kolam pemijahan berupa kolam tanah berukuran 400 m2 yang disekat menjadi 8 bagian sehingga masing-masing bagian mempunyai luasan 50 m2. Setiap petak pemijahan yang dilengkapi songgo (tempat sarang), dan injuk sebagai bahan pembuat sarang. Induk gurami yang digunakan berbobot 2-3 kg/ekor, dengan rasio kelamin pada setiap petak terdiri dari 2 induk jantan dan 2 induk betina. Pakan yang diberikan berupa daun sente sebanyak 3,5% dari bobot biomas induk per hari (diberikan tiap pagi hari) ditambah pakan buatan sebanyak 1% dari bobot biomassa induk per hari (diberikan pagi dan sore hari) dengan kadar protein berbeda sebagai perlakuan. Perlakuan yang diterapkan adalah kadar protein 38%, 33%, dan 14% sesuai dengan label pada kemasan masing-masing. Pemberian pakan hanya daun sente diterapkan sebagai kontrol. Masing-masing perlakuan mempunyai 2 ulangan. Pengecekan sarang dilakukan dua kali per minggu selama 5 bulan. Hasil pengamatan menunjukkan bahwa pemberian tambahan berupa pakan buatan mampu meningkatkan keragaan produksi induk gurame. Pemberian pakan tambahan dengan kadar protein semakin tinggi menghasilkan produksi telur per sarang yang semakin tinggi (P=0,09). Pemberian pakan tambahan dengan kadar protein 38%, 33%, dan 14% masing-masing menghasilkan produksi telur per sarang sebanyak 10.351 butir, 4.546 butir dan 2.730 butir. Sedangkan yang hanya diberikan pakan daun sente menghasil telur sebesar 2.774 butir per sarang. Pemberian pakan dengan kadar protein 38% juga meningkatkan derajat fertilitas (jumlah telur yang hidup) yakni 92,23% dibandingkan dengan pemberian pakan dengan kadar protein 33%, 14% dan kontrol yakni masing-masing 79,05%, 28,86%, dan 71,94% (P=0,26). Produksi sarang per bulan dari 2 ekor induk ikan gurame yang diberi pakan tambahan berkadar protein 38% adalah 0,75 buah, lebih rendah dibandingkan dengan yang

diberikan pakan tambahan berkadar protein 33%, yakni 0,88 buah, namun lebih tinggi dibandingkan dengan yang diberikan pakan berkadar protein 14% (0,13 buah) dan hanya daun sente (0,5 buah).
KATA KUNCI: ikan gurame, pakan buatan, daun sente, keragaan reproduksi

yang menunjukkan terbentuknya plasmid rekombinan. dan koloni berwarna biru tidak mengandung DNA sisipan.02% sedangkan kandungan lemaknya turun 13. Kadar protein polar naik 38. dengan padat penebaran ikan uji 30 ekor per akuarium. polar. KATA KUNCI: kloning – promoter â-actin mas Majalaya – Escherichia coli FF 50 PENINGKATAN KUALITAS BAHAN NABATI (DEDAK PADI DAN DEDAK POLAR) MELALUI PROSES FERMENTASI (Rhyzopus oligosporus) DAN PENGGUNAANNYA DALAM PAKAN IKAN MAS (Cyprinus carpio) Ningrum Suhenda.3’). retensi protein. dan Irma Melati Balai Riset Perikanan Budidaya Air Tawar. dan selanjutnya polar dan dedak padi. Bogor ABSTRAK Penelitian ini dilakukan di Balai Riset Perikanan Budidaya Air Tawar. Hasil penelitian menunjukkan bahwa berdasarkan hasil analisis proksimat ternyata kandungan nutriea tertinggi baik untuk dedak padi maupun polar diperoleh setelah difermentasi dengan lama inkubasi 4 hari. oligosporus yaitu 2.3’) dan primer R (5’ –CGTTCGAATTGATATATGCGAGCTG. mud carp sebesar 1127 bp. Tahap pertama tujuannya adalah untuk menentukan lama inkubasi kapang R. dan pada Silver carp sebesar 1123 bp. Ukuran fragmen DNA insert dari hasil isolasi plasmid pada sel transforman koloni putih sebesar 1126 bp dan tidak jauh berbeda dengan ukuran fragmen promoter â-actin Cyprinus carpio sebesar 1123 bp. retensi lemak.14% dan kadar lemaknya turun sebesar 19. Parameter yang diuji meliputi bobot akhir rata-rata. Elektroforegram hasil isolasi plasmid rekombinan untuk transforman koloni putih menunjukkan adanya DNA sisipan (fragmen promoter â-actin mas Majalaya) dan koloni biru tidak mengandung DNA sisipan (tidak ada fragmen DNA â-actin mas Majalaya). protein efisiensi rasio. Promoter â-actin memiliki aktivitas ekspresi tinggi pada hampir semua sel ikan. Kadar protein semua pakan uji sama yaitu 26% dan kadar lemak 7%. Pada kegiatan tahap satu dilakukan penentuan lama inkubasi R. Retensi protein dedak padi fermentasi.28%. Reza Samsudin.Forum Inovasi Teknologi Akuakultur 2010 FF 49 KLONING PROMOTER Â-ACTIN IKAN MAS MAJALAYA DALAM Escherichia coli Ibnu Dwi Buwono dan Yuniar Mulyani Fakultas Perikanan dan Ilmu Kelautan. Untuk kegiatan tahap 2 digunakan benih ikan mas dengan bobot rata-rata 5. Hasil insersi fragmen promoter â-actin mas Majalaya dapat berintegrasi dengan plasmid pGEM-T. polar. Purifikasi produk PCR tersebut juga menghasilkan ukuran fragmen DNA yang sama. oligosporus yang tepat dalam proses fermentasi dedak padi dan dedak polar. dan polar fermentasi. dedak padi fermentasi.25%) diperoleh pada ikan mas yang diberi pakan mengandung polar fermentasi dan . dan 6 hari. 4. Universitas Padjadjaran ABSTRAK Peranan promoter sangat penting dalam upaya pengembangan teknologi transgenik pada ikan mas Majalaya karena merupakan elemen pengatur aktivitas transkripsi untuk ekspresi transgen. pertambahan bobot relatif.47 g/ekor. Amplifikasi sekuen promoter â-actin mas Majalaya dengan PCR menghasilkan ukuran fragmen DNA sebesar 1126 bp menggunakan primer primer F (5’ – GATGAAACTCGAGTAGCCCTTGCTCTTC. Retensi lemak tertinggi (35. Sebagai perlakuan yaitu pakan uji berupa pakan buatan yang mengandung dedak padi. Bogor dan terdiri atas dua tahap. Kandungan protein dedak padi naik 19. dan sintasan. Pada tahap kedua dilakukan pengujian bahan hasil fermentasi tersebut yang digunakan sebagai penyusun ransum pakan untuk melihat pengaruhnya terhadap pertumbuhan ikan mas. dengan ditandai tumbuhnya koloni transforman berwarna putih.33%. Parameter yang diukur yaitu kadar nutriea dedak dan polar dengan uji proksimat. Wadah percobaan yang digunakan yaitu akuarium volume 100 L. Pertambahan bobot akhir rata-rata tertinggi diperoleh pada ikan yang diberi polar fermentasi.05) dengan dedak padi tanpa fermentasi. dan polar fermentasi berbeda nyata (P<0. Hasil pengujian tahap 2 mengenai pakan yang mengandung bahan yang difermentasi ternyata dedak polar memberikan hasil lebih baik daripada dedak padi.

KATA KUNCI: R. oligosphorus. ikan mas .67%–100%. fermentasi. dedak padi. Sintasan ikan uji berkisar antara 96. dedak polar.berbeda nyata (P<0.05) dengan perlakuan lainnya.

sawah. serta keramba jaring apung di danau maupun waduk. Penelitian telah dilaksanakan dari bulan Nopember 2009 —Pebruari 2010. Salinitas air pada saat pemeliharaan berkisar antara 1—5 mg/L. Provinsi Banten. Di mana satu di antaranya di desain sebagai kolam akuaponik. KATA KUNCI: ammonia. KATA KUNCI: ikan mas. apabila kondisi ini diteruskan akan mempengaruhi kepada produktivitas hasil budidaya. sintasan. Tujuan pelelitian ini adalah mengetahui perkembangan budidaya ikan mas galur kuningan. ukuran panen. Sedangkan sintasan.28 g/ ekor yang digunakan sebagai hewan uji. Pelet diberikan sekenyangnya dengan frekuensi pemberian 3 kali/hari selama 2 bulan pemeliharaan.64 kali lebih banyak dengan ukuran panen 1. Pertambahan berat rata-rata ikan mas strain wildan mencapai 1.25 kali lebih besar dibanding pada kolam konvensional. Kabupaten Tangerang.86 g/hari. pertumbuhan. Analisis data menggunakan uji beda nilai tengah dengan selang kepercayaan 95%. ikan mas FF 52 PERTUMBUHAN BEBERAPA STRAIN IKAN MASYANG DIPELIHARA PADA TAMBAK BERSALINITAS RENDAH Adang Saputra. Sampai saat ini produksi ikan mas dihasilkan dari kegiatan budidaya yang dilakukan di lahan perkolaman. dan Peni Saptarini**) Balai Riset Perikanan Budidaya Air Tawar. ukuran panen. Kepadatan ikan yang di pelihara di kolam penelitian sebanyak 3 ekor per m2. karena akhir. salinitas rendah. Sutrisno*). dan parameter kualitas air yang lain dianalisis secara deskriptif. Benih ikan mas ukuran 18. dan majalaya di tambak bersalinitas rendah serta mengetahui galur ikan mas yang dapat tumbuh lebih baik sehingga dapat meningkatkan target produksi dari budidaya ikan mas. wildan. tambak . Hasil dari pengamatan terhadap pertambahan berat dan panjang ada korelasi positif untuk semua galur ikan mas yang diamati. Parameter yang diuji adalah kualitas air terutama kandungan ammonia. Hasil penelitian menunjukkan sistem akuaponik mampu menurunkan kadar ammonia 91% lebih rendah dengan nilai sintasan ikan mas 1. Jakarta ABSTRAK Ikan mas (Ciprinus carpio Linn) merupakan salah satu dari 10 jenis ikan budidaya air tawar penting yang bisa dibudidayakan di Indonesia. Lilis Sofiarsih*).Forum Inovasi Teknologi Akuakultur 2010 FF 51 EFEKTIVITAS TEKNOLOGI AKUAPONIK TERHADAP PENURUNAN AMONIA PADA PEMBESARAN IKAN MAS (Cyprinus carpio) Nuryadi*). Menggunakan dua kolam ukuran 10 m x 25 m x 1 m. Ongko Praseno.akhir ini banyak lahan yang tidak digunakan (marginal). dengan padat tebar 20 ekor/m3.15 g/hari.41 g/hari. dengan lokasi penelitian di Desa Kronjo. sedangkan yang lainnya sebagai kolam konvensional. kemudian ikan mas galur kuningan sebesar 1. Bogor ABSTRAK Pencemaran perairan terutama oleh limbah organik yang ditandai dengan kandungan amonia yang tinggi dapat mempengaruhi sintasan dan pertumbuhan ikan. akuaponik. Data setiap sampling dijadikan ulangan. Sehingga perlu alternatif lain untuk budidaya ikan mas yaitu di lahan tambak. Tujuan untuk mengkaji efektivitas teknologi akuaponik dalam mempertahankan kualitas air yaitu kemampuan dalam menurunkan kadar amonia di air kolam serta pengaruhnya terhadap sintasan dan ukuran panen ikan mas. dan Anjang Bangun Prasetio Pusat Riset Perikanan Budidaya. Achmad Sudradjat. dan ikan mas galur majalaya sebesar 0.

serta mempunyai respons yang baik terhadap pakan buatan. Rancangan penelitian adalah acak lengkap yang terdiri dari 3 perlakuan yaitu perbedaan waktu awal pemberian artemia yakni pada larva (A) umur 5 hari. memperbaiki kualitas media pemeliharaan larva sehingga sintasan yang diperoleh lebih tinggi. Afifah. dan Agus Priyono Balai Besar Riset Perikanan Budidaya Laut. Masing-masing perlakuan diulang 3 kali. fry performance. Hasil pengamatan menunjukkan bahwa pemeliharaan larva cobia dengan penambahan probiotik yang dicampurkan dalam media pemeliharaan memberikan efek tumbuh dan kelangsungan hidup yang lebih baik dibandingkan tanpa pemberian probiotik yaitu diperoleh panjang total dan sintasan rata-rata 2. KATA KUNCI: artemia nauplii. growth and pro-biotic FF 54 PENUNDAAN PEMBERIAN PAKAN ARTEMIA TERHADAP PERFORMANSI BENIH IKAN COBIA (Rachycentron canadum) YANG DIPELIHARA SECARA TERKONTROL Titiek Aslianti. cobia larvae. berat ataupun kelangsungan hidup diantara perlakuan secara statistik tidak menunjukkan perbedaan yang nyata. Perlakuan meliputi (A) tanpa penambahan probiotik (B) penambahan probiotik langsung dalam bak pemeliharaan larva dan (C) rotifer+artemia diperkaya dengan probiotik selama 1-2 jam.000 butir/bak dan larva dipelihara hingga mencapai ukuran benih (± umur 20 hari). Hasil penelitian menunjukkan bahwa pertumbuhan panjang. Data pertumbuhan dan kelangsungan hidup dianalisis menggunakan sidik ragam.07%) relatif lebih tinggi dari pada perlakuan B dan C. Hasil pengamatan terhadap perkembangan tulang belakang pada semua perlakuan tidak menunjukkan performansi tulang belakang yang abnormal.Forum Inovasi Teknologi Akuakultur 2010 FF 53 PENGGUNAAN PROBIOTIK KOMERSIAL PADA PEMELIHARAAN LARVA COBIA (Rachycentron canadum) SKALA HATCHERI Agus Priyono. Penelitian dilakukan dengan menggunakan wadah berupa bak fiber (1m3) berjumlah 9 unit yang diisi telur cobia sebanyak 3. KATA KUNCI: survival rate. Salah satu alternatif yang dapat dicoba untuk mengatasi kendala di atas yaitu penggunaan probiotik. Namun pemberian artemia pada larva umur 5 hari (perlakuan A) menghasilkan pertumbuhan panjang (28 mm) dan bobot badan (74. Rachycentron canadum telah dilakukan namun besarnya biaya operasional dalam penggunaan artemia sebagai pakan masih menjadi faktor pembatas. Tujuan penelitian adalah untuk mengetahui pengaruh pemberian probiotik untuk mempercepat pertumbuhan larva. (B) umur 10 hari dan (C) umur 15 hari. Siti Zuhriyyah.42%. dapat dikembangkan di bak terkontrol maupun di KJA. Penundaan pemberian artemia lebih dari 5 hari justru menghasilkan benih yang bertumbuh lebih lambat dan banyak mengalami kematian.067mg) serta kelangsungan hidup (12. Siti Zuhriyyah Musthofa. lasted time feeding . dan Afifah Balai Besar Riset Perikanan Budidaya Laut. Gondol ABSTRAK Upaya kontinuitas produksi benih ikan cobia. Gondol ABSTRAK Ikan cobia (Rachycentron canadum) layak menjadi kandidat budidaya karena sifatnya yang tumbuh cepat. kemudian diberikan sebagai pakan larva. Performansi fisik dan perkembangan tulang belakang diamati sebagai data pendukung. Kendala yang masih ditemui dalam budidaya ikan cobia antara lain ketersediaan benih yang tidak kontinu serta jumlahnya yang tidak memadai untuk usaha budidaya.58 cm dan 17. Oleh karenanya perlu dilakukan penelitian penundaan pemberian artemia dengan tujuan untuk mengetahui waktu yang tepat saat awal diberikan artemia sehingga penggunaannya efektif dan efisien.

Pembudidayaan cobia yang tidak serumit budidaya kerapu dan sangat tahan terhadap penyakit menjadikan budidaya cobia komoditas yang diunggulkan dalam pembudidayaan. Banyak jenis yang dieksport yang umumnya berasal dari Indonesia bagian barat khususnya dari Kalimantan dan Sumatera. KATA KUNCI: ikan hias. Stakeholder. Keberhasilan Balai Besar Pengembangan Budidaya Laut Lampung (BBPBL Lampung – Kementerian Kelautan dan Perikanan) yang meliputi pemeliharaan larva dan produksi yuwana baru dalam bak terkendali dengan pembesarannya pada keramba jaring apung. sehingga untuk mencapai bobot 500 g hanya dibutuhkan waktu 5–6 bulan setelah telur menetas dan untuk mencapai ukuran konsumsi 4–6 kg didapatkan dalam 12 bulan dengan efisiensi pakan yang tinggi. Tekstur daging yang putih dan liat dengan kandungan DHA dan asam lemak omega 3 serta sedikit duri merupakan keunggulan lainnya dari ikan tersebut. budidaya. Herno Minjoyo*). Depok ABSTRAK Data yang dikemukakan atau disampaikan oleh para ekportir ikan hias mempunyai kecenderungan adanya eksploitasi ikan hias air tawar dari alam. Lebih dari 100 spesies. komoditas unggul FF 56 PLASMA NUTFAH IKAN HIAS AIR TAWAR SUMATERA Sudarto Balai Riset Budidaya Ikan Hias. Data ini dapat dikumpulkan melalui kompilasi dari para stakeholder ikan hias dan penelusuran ke sentra penangkapan ikan hias melalui survei lokasi khususnya ikan hias air tawar Sumatera. Data ini khususnya merupakan gambaran jenis dan potensi ikan hias asal Sumatera yang dapat dipakai untuk pengembangan di masa mendatang. KATA KUNCI: cobia. Laju Pertumbuhan Cobia yang sangat cepat pada masa yuwana berkisar 50–175 g per bulan. Lampung ABSTRAK Cobia (Rachycentron canadum) merupakan salah satu jenis yang menarik untuk dibudidayakan. Lucky Marzuki Nasution*).Forum Inovasi Teknologi Akuakultur 2010 FF 55 BUDIDAYA COBIA (Rachycentron canadum) KOMODITAS UNGGULAN YANG BELUM BANYAK DIKENAL Suryadi Saputra*). termasuk ke dalam 31 famili telah dikompilasi dari lokasi-lokasi sentra ikan hias. dan Badrudin**) Balai Besar Pengembangan Budidaya Laut. plasma nutfah .

Berdasarkan uji ANOVA pemberian pakan alami menunjukkan perbedaan yang sangat nyata. dysmorphic) adalah cacat atau kelainan atau perbedaan bentuk bagian atau organ tubuh pada hewan atau manusia. Tujuan dari penelitian ini adalah untuk mengetahui penyebab deformity yang terjadi pada ikan Peacock bass yang dipelihara dalam akuarium berukuran 70 cm x 60 cm x 42 cm di ruang showroom. Tubifex sp. laju pertumbuhan harian sebesar 32. pertumbuhan. Penelitian dilakukan di hatcheri Balai Riset Budidaya Ikan Hias selama 3 bulan.586%. Artemia sp. Peacock bass ini akhirnya berenangnya jadi terbalik. bakteri. Depok **) FMIPAUniversitas Negeri Jakarta ABSTRAK Ikan upside-down catfish merupakan ikan domestikasi yang berasal dari Congo. granuloma. KATA KUNCI: Synodontis nigriventris. Kebutuhan pasar untuk ikan upside-down catfish semakin banyak dan sampai saat ini ikan ini belum dapat terpenuhi dari hasil budidaya. dan Tubifex sp. infeksi penyakit (cacing. salah satunya adalah pemberian pakan yang sesuai dengan bukaan mulut terutama larva dan kandungan gizinya. KATA KUNCI: deformity. Setelah dilakukan isolasi ternyata dari hasil uji histologi ditemukan adanya granuloma (multifocal) pada hati dan limpa Peacock bass. Depok yaitu badan/punggung bagian belakang Peacock bass menjadi bengkok sehingga menyebabkan ikan ini tidak mau makan dan akhirnya mati. sedangkan ketiga jenis pakan alami tidak berpengaruh terhadap sintasan larva. dan Toma Megawati**) *) Balai Riset Budidaya Ikan Hias. Afrika. DEPOK Lili Sholichah dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. pakan alami. karena belum banyak yang membudidayakannya.. Faktor-faktor yang mempengaruhi keberhasilan budidaya ikan hias.226 g. Kejadian ini berlangsung selama bulan Desember 2009 dan empat dari enam ekor Peacock bass mati karena kasus yang sama. kondisi daya dukung lingkungan yang terus menurun. diam dan kepalanya menyembul tepat di bawah permukaan badan air.778 cm.Forum Inovasi Teknologi Akuakultur 2010 FF 57 PERLAKUAN BERBAGAI JENIS PAKAN ALAMI UNTUK MENINGKATKAN PERTUMBUHAN DAN SINTASAN LARVA IKAN UPSIDE DOWN CATFISH (Synodontis nigriventris) Agus Priyadi*). dan selalu berusaha mendekati sumber oksigen (aerator). virus). multifocal granuloma . atau disebabkan defisiensi mineral atau vitamin tertentu yang dibutuhkan tubuh. dan yang terendah Moina. Deformity yang ditemui di Balai Riset Budidaya Ikan Hias. dengan menggunakan wadah berupa akuarium berukuran 40 cm x 26 cm x 30 cm. Perlakuan berupa 3 jenis pakan alami yaitu Moina sp. memberikan hasil yang tertinggi terhadap pertumbuhan larva upside-down catfish (Synodontis nigriventris) baik pertambahan bobot sebesar 0. dan pertambahan panjang total sebesar 1. sintasan FF 58 DEFORMITY PADA IKAN PEACOCK BASS (Cichla ocellaris) DI BALAI RISET BUDIDAYA IKAN HIAS. Deformity dapat disebabkan oleh : mutasi genetic. Penelitian ini bertujuan untuk mengetahui jenis pakan alami yang dapat meningkatkan pertumbuhan dan sintasan ikan upside down catfish. diikuti Artemia. dengan 6 kali ulangan. peacock bass.. Depok ABSTRAK Deformity (dysmorphism. Pada kondisi tertentu cacat atau kelainan bentuk tubuh ini dapat menyebabkan kematian. Eni Kusrini*).

40 ekor/bak.Sulawesi Tengah. udang jembret (mysids) dan larva nyamuk. density. Hewan uji yang digunakan berukuran panjang total 5. Wadah yang digunakan berupa tiga bak Fiberglass Reinforce Plastic (FRP) berbentuk bulat berdiameter 250 cm dengan tinggi 100 cm dan diisi air hingga ketinggian 60 cm. 20 ekor/bak. dan Ketut Maha Setiawati Balai Besar Riset Perikanan Budidaya Laut. T2. wortel dan tepung kepala udang. 60 ekor/bak. Perlakuan yang diuji adalah kepadatan induk yang berbeda dengan rasio jenis kelamin 1:1 sebagai berikut: T1. Pengamatan warna ikan dilakukan dengan menggunakan Toka Colour Finder (TCF). Standard penilaian kualitas warna ikan uji dengan mengamati warna yang dominand/ sering muncul pada semua perlakuan baik warna pada tubuh ikan bagian depan (biru-ungu) maupun pada bagian belakang (kuning-orange) dan ditetapkan sebagai warna standard TCF.87 ± 0. Depok ABSTRAK Sebagai pakan alami maggot dari serangga bunga dapat memakai berbagai sumber karotenoid untuk peningkatan kualitas warna ikan hias. Penelitian ini dilakukan untuk mengetahui pengaruh kepadatan induk terhadap keberhasilan pemijahan (produksi benih) pada ikan capungan banggai. T3. Variabel yang diamati meliputi. Kemudian menghitung jumlah ikan (prosentase) dengan warna yang sama/setara dengan warna standard TCF yang selanjutnya ditetapkan sebagai nilai teramati. Penelitian ini bertujuan untuk mengetahui kualitas warna ikan rainbow (Melanotaenia boesemani) yang diberi pakan berupa maggot segar yang telah diperkaya dengan zat pemicu warna (karotenoid) melalui media pengkulturannya. Gondol ABSTRAK Ikan capungan banggai merupakan ikan endemik yang secara alami banyak ditemukan di perairan Kepulauan Banggai .Forum Inovasi Teknologi Akuakultur 2010 FF 59 PEMELIHARAAN INDUK IKAN CAPUNGAN BANGGAI (Pterapogon kauderni) DENGAN KEPADATAN YANG BERBEDA Gunawan. Selama penelitian. induk diberi pakan berupa naupli artemia/artemia pra dewasa. Hasil penelitian menunjukkan bahwa penggunaan wortel dan tepung kepala udang dalam pengkayaan maggot sebagai sumber zat pemicu warna (karotenoid) dapat meningkatkan kualitas warna pada ikan rainbow khususnya warna kuning-orange. frekuensi pemijahan atau frekuensi produksi juvenile dan total produksi yuwana. yaitu : astaxanthin.50 g. KATA KUNCI: maggot.3 cm dan bobot 2. juvenile production FF 60 PEMANFATAN MAGGOT YANG DIPERKAYA DENGAN ZAT PEMICU WARNA SEBAGAI PAKAN UNTUK PENINGKATAN KUALITAS WARNA IKAN HIAS RAINBOW (Melanotaenia boesemani) ASLI PAPUA I Wayan Subamia. Rainbow Papua .9 ± 0. Jhon Harianto Hutapea. Produksi yuwana cenderung menurun seiring dengan peningkatan jumlah induk dalam satu bak. dan Ahmad Musa Balai Riset Budidaya Ikan Hias. rata-rata yuwana yang dihasilkan dan frekuensi produksi yuwana pada perlakuan T1 lebih tinggi dibandingkan perlakuan T2 dan T3. Bastiar Nur. Hasil penelitian menunjukkan. zat pemicu warna. KATA KUNCI: banggai cardinal fish.

5 m dan tinggi air 40 cm. Interaksi antara faktor media air dan jenis prophylaksis ditunjukkan dengan sintasan tertinggi pada larva buntal air tawar pada perlakuan AF sebesar 83. dan Bastiar Nur Loka Riset Budidaya Ikan Hias Air Tawar. KO (air kontrol+oksitetrasiklin). namun dipengaruhi oleh faktor jenis prophylaksis serta interaksi antara media air dan jenis prophylaksis. Penelitian ini bertujuan untuk mengetahui media air dan jenis prophylaksis terbaik untuk menghasilkan sintasan tertinggi pada larva ikan buntal air tawar (Tetraodon palembangensis).6 cm dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. KATA KUNCI: benih botia. 35. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Sintasan pada faktor media air (aqua dan kontrol) tidak berbeda nyata satu sama lain (P>0.33%. oksitetrasiklin. 70.67%). dan Lili Sholichah Balai Riset Budidaya Ikan Hias.05).05).5 cm dan panjang tertinggi sebesar 3. Ikan yang digunakan adalah buntal air tawar dalam stadia larva usia 5 hari pasca menetas. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. KF (71.5 cm (ukuran ekspor). Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2. pertumbuhan panjang. Selama pemeliharaan. Sintasan terendah dihasilkan oleh perlakuan KB . AO (aqua+oksitetrasiklin). AB (aqua+blitz ich). I Wayan Subamia. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok.5 x 0.5 x 0. Penelitian di lakukan di Balai Riset Budidaya Ikan Hias Air Depok selama 16 hari.0 cm dan bobot rata-rata 0. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). namun tidak berbeda nyata dengan perlakuan AO (81. Masing-masing perlakuan dilakukan dengan 3 ulangan. Nina Meilisza. Dua faktor perlakuan berupa 2 macam media air (aqua dan kontrol berupa air sumur) dan 3 jenis prophylaksis (formalin. dan 105 dan dianalisis secara deskriptif. 20.Forum Inovasi Teknologi Akuakultur 2010 FF 61 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. Hasil penelitian menunjukkan bahwa sintasan larva buntal air tawar tidak dipengaruhi oleh faktor media air. Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. hal ini diduga terjadi karena adanya tekanan lingkungan baik dari media air maupun infeksi penyakit.0 cm. ukuran ekspor 1 inci (2.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. Depok ABSTRAK Larva ikan buntal air tawar sering mengalami kematian. AF (aqua+formalin). KF (air kontrol+formalin). ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2. Dari dua faktor tersebut dihasilkan enam perlakuan prophylaksis yang terdiri atas: KB (air kontrol+blitz ich). Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. sedangkan sintasan yang dihasilkan oleh jenis prophylaksis oksitetrasiklin dan formalin lebih baik dibandingkan jenis prophylakisis blitz ich (P<0. KO (76. 55. dan blitz ich) akan dilakukan melalui rancangan faktorial. Pada akhir penelitian (hari ke 105).67%).009 gram.5 cm) FF 62 SINTASAN LARVA IKAN BUNTAL AIR TAWAR (Tetraodon palembangensis) PADA MEDIA AIR DAN JENIS PROPHYLAKSIS YANG BERBEDA Nina Meilisza. Percobaan menggunakan akuarium kecil ukuran 3 liter dengan padat tebar 20 larva per akuarium.67%).

larva Tetraodon palembangensis . sintasan.sebesar 51.67% namun tidak berbeda nyata dengan perlakuan AB (55%). media air. KATA KUNCI: prophylaksis.

Pengamatan perkembangan embrio menggunakan mikroskop Olympus dengan perbesaran 40 kali yang dilakukan setiap dua hari.75 mL/kg untuk induk betina di bagian intraperitoneal.Forum Inovasi Teknologi Akuakultur 2010 FF 63 PEMIJAHAN IKAN PALMAS ALBINO (Polypterus senegalus VAR. masa inkubasi . KATA KUNCI: Neocaridina heteropoda. SR (0-10 hari) 83. platidoras (Platydoras sp).31% dan menghasilkan larva normal sebanyak 218 ekor. Penelitian ini menggunakan metode deskriptif dengan mengamati tahapan perkembangan embrio serta masa inkubasi telur udang hias. aligator (Lepisosteus oculatus). Pemijahan tersebut terdiri atas seleksi induk. polypterus senegalus albino. dan redfin shark (Ephalzeorhynchos sp. inkubasi telur dan perawatan larva. Depok ABSTRAK Udang Neocaridina heteropoda merupakan salah satu spesies udang hias berukuran kecil. Hasil pengamatan menunjukkan bahwa selama masa pengeraman (inkubasi) telur pada kaki renang (pleopoda) induk betina. perkembangan embrio. Sebanyak 9 ekor induk kemudian dimasukkan ke dalam 3 buah akuarium pemijahan berukuran 70 cm x 60 cm x 50 cm yang dilengkapi substrat serabut tali plastik dengan perbandingan 2 ekor jantan dan 1 ekor betina.4°C. Depok ABSTRAK Ikan palmas (Polypterus sp. Asep Permana. Ikan palmas jenis albino (Polypterus senegalus var. Penelitian ini merupakan penelitian dasar yang bertujuan untuk mengetahui tahapan perkembangan embrio serta masa pengeraman (inkubasi) telur udang hias dalam lingkungan terkontrol. Asep Permana. hormon FF 64 PERKEMBANGAN EMBRIO DAN LAMA INKUBASI TELUR UDANG HIAS (Neocaridina heteropoda) Bastiar Nur.15%. tiger catfish (Platysoma sp.5 ml/kg untuk induk jantan dan 0. ALBINO) DENGAN STIMULASI HORMON GONADOTROPIN Sulasy Rohmy.). sehingga produksinya masih mengandalkan impor dari luar negeri. albino) masih sulit untuk memijah dalam wadah terkontrol. telur mengalami perubahan warna berturut-turut : warna hijau – hijau kekuningan – kuning kecoklatan – putih kecoklatan. memiliki warna yang menarik dan banyak diminati oleh para hobiis sehingga sangat potensial untuk dikembangkan.). penyuntikan hormon. KATA KUNCI: palmas albino. pembuahan. Ikan palmas albino memijah pertama kali 12 jam setelah penyuntikan dan memijah sebanyak 3 kali dengan derajat fertilisasi 73.6°C–29. dan Bastiar Nur Balai Riset Budidaya Ikan Hias.) adalah ikan introduksi dari Afrika yang mulai banyak dibudidayakan di Indonesia karena adanya permintaan pasar. antara lain sinodontis (Synodontys sp.). Perkembangan embrio telur udang hias hingga menetas menjadi larva membutuhkan waktu 13 hari (± 288 jam) pada suhu air inkubasi 27. dan I Wayan Subamia Balai Riset Budidaya Ikan Hias. Penyuntikan dilakukan menggunakan hormon gonadotropin F-1 (merk dagang Ovaprim®) masing-masing dengan dosis 0.91%. Tujuan percobaan ini adalah memijahkan palmas albino dalam wadah terkontrol menggunakan stimulasi hormon gonadotropin. Metode penyuntikan hormon sudah mulai diterapkan pada beberapa jenis ikan hias introduksi. daya tetas telur 80. namun belum banyak diketahui data embriologinya.

1272–0. Hasil penelitian berupa keberhasilan semua induk betina memijah dan bertelur selama satu periode pemijahan dengan menghasilkan larva sebanyak 293 ekor. sedang induk jantan belum ada yang mengandung sperma.0518 g.27 pg/mL dan pada perlakuan C (LHRH 50 mg dan testosteron 50 mg) mencapai stadium oocyt II dan kadar estradiol ± 20. Parameter yang diamati berupa ada tidaknya induk yang menggendong telur dan parameter kualitas air. Wadah pemeliharaan adalah kontainer ukuran 1000 liter sebanyak 9 buah yang diisi air ± 600 liter dilengkapi dengan filter dan aerasi. dipelihara selama 6 bulan. murah dan aplikatif. Styrofoam yang digunakan berukuran 50 cm x 35 cm x 30 cm disi air setinggi 20 cm. budidaya FF 66 PENELITIAN IMPLANTASI HORMON TERHADAP KEMATANGAN GONAD IKAN TILAN MERAH (Mastacembelus erythrotaenia) Siti Subandiyah.042 pg/mL. KATA KUNCI: Neocaridina heteropoda. Asep Permana. KATA KUNCI: induk. dan Sawung Cindelaras Balai Riset Budidaya Ikan Hias. Pemijahan udang hias ini telah banyak dilakukan di kalangan petani. matang gonad.sungai Sumatra dan Kalimantan yang belum berhasil dipijahkan di lingkungan budidaya. LHRH 100 mg dan testosteron 50 mg (B). implantasi. hormon. Udang uji yang digunakan sebanyak enam ekor induk terdiri dari empat induk betina yang berukuran panjang 2.9 cm dengan bobot 0. Rendy Ginanjar. LHRH 50 mg dan testosteron 50 mg (C). Tujuan penelitian ini untuk melihat tingkat keberhasilan pemijahan udang hias Neocaridina heteropoda menggunakan wadah sterofoam boks. Udang diberi pakan berupa moina beku sekali dalam setiap hari.Forum Inovasi Teknologi Akuakultur 2010 FF 65 PEMIJAHAN UDANG HIAS (Neocaridina heteropoda) Asep Permana. sinyal lingkungan tidak mampu memicu kelenjar hipofisa mensekresikan hormon gonadotropin yang memadai.725 pg/mL. Pakan yang diberikan adalah cacing tanah secara satiasi (sekenyangnya). Tutik Kadarini.1630 g dan dua ekor induk jantan yang berukuran panjang 1. dilengkapi dengan aerasi dan ditempatkan di luar ruangan yang terkena sinar matahari serta diberi substrat berupa akar pakis dan tanaman air jenis Hydrilla verticillata. Rina Hirnawati. oocyt . Penelitian pematangan gonad dengan cara perlakuan implantasi hormon yaitu LHRH 100 mg dan testosteron 100 mg (A). Hasil penelitian adalah perlakuan A (LHRH 100 mg dan testosteron 100 mg) gonad ikan mencapai stadium oocyt IV dan kadar estradiol ± 96. Kepadatan 10 ekor induk dengan bobot 65–600 g.0488–0.5 cm dengan bobot 0. bertujuan mendapatkan dosis hormon yang tepat untuk kematangan gonad induk tilan merah. dan Darti Satyani Balai Riset Budidaya Ikan Hias. panjang 40– 60 cm. Depok ABSTRAK Ikan Tilan Merah (Mastacembelus erythrotaenia) merupakan ikan hias yang diperoleh dari hasil tangkapan di sungai. Depok ABSTRAK Neocaridina heteropoda adalah udang hias kecil dengan warna menarik yang biasa dipakai para hobiis untuk mempercantik akuarium aquascape mereka. pada perlakuan B (LHRH 100 mg dan testosteron 50 mg) mencapai stadium oocyt III kadar estradiol ± 32. Pada ikan yang baru di domestikasi.3–2. Inovasi tekhnik budidaya harus terus dilakukan untuk mendapatkan tekhnik yang sederhana.7–1.

50 mL/L. The concluded that the optimum dose to produce male guppy is 50 mL/L. as the curative effort is not applicable. suhu. 25 mL/L.000-4. Universitas Lampung ABSTRACT Generally application of 17á-metiltestosteron to masculinization. guppy fish . chrysin. and 75 mL/L. the treatments gave significant different with control. The result showed that the percentage of male guppy at 50 mL/ L is 64.Forum Inovasi Teknologi Akuakultur 2010 FF 67 BUNGA TAI KOTOK SEBAGAI SUMBER CAROTENOID PADA IKAN HIAS Sukarman dan Chumaidi Balai Riset Budidaya Ikan Hias. KATA KUNCI: bunga tai kotok. Therefore.) yang tumbuh liar di Indonesia memiliki kandungan carotenoid sebesar 8000 mg/kg pada kelopak bunganya. The observation to sexual secondary characteristic guppy can be observed at least two months old. The research was conducted experimental with completely randomized design. carotenoid. Based on LSD test. male. tepung FF 68 THE APPLICATION OF HONEY TO PRODUCE MALE GUPPY (Poecillia reticulata) Munti Sarida PS Budidaya Perairan Fakultas Pertanian. The proportions test showed dose 50 mL/L have significant different to control. Kelopak bunga di oven pada suhu 70°C–80°C selama 10–15 menit. Nilai tersebut lebih tinggi dibandingkan tanaman lainnya yang biasa dipakai sebagai sumber carotenoid untuk ikan seperti alga (2. The purpose of this study was to determine the optimum dose from honey to produce male guppy by dipping method.07 ± 9. Honey is a natural substance which have crysin. KEYWORDS: honey. The crysin suspected to inhibited enzyme aromatase to produce estradiol from testosteron. Hasil penelitian pembuatan tepung Bunga Tai kotok dari 120 g kelopak bunga basah setelah dioven didapatkan tepung sebesar 20 g (16. Depok ABSTRAK Bunga Tai Kotok (Tagetes sp. because of residual effects to human caused cancer. the alternative masculinization application of natural substance like honey. The treatments dipping pregnant female guppy in honey for 15 hours in each treatments were 0 mL/L (control). kemudian dihaluskan menggunakan blender serta ditambahkan antioksidan. Proses pembuatan tepung Bunga Tai Kotok dilakukan dengan memetik bunga dari alam.000 mg/kg).6%). The measured was tested with analysis of variance than the post hoc test used least significant difference (LSD) and two proportions test at 0. but between treatments not significant different. kemudian dipisahkan antara tangkai dan kelopaknya.71%. Tujuan penelitian ini adalah memperoleh tepung Bunga Tai kotok sebagai sumber carotenoid untuk peningkatan warna ikan hias.05 significant level. yeast (30–800 mg/kg) dan sumber lainnya.

Forum Inovasi Teknologi Akuakultur 2010

FF 69
Samuel Lante dan Neltje Nobertine Palinggi Balai Riset Perikanan Budidaya Air Payau, Maros

Salah satu faktor yang menyebabkan daya tetas telur ikan rendah adalah tingkat pembuahan sperma terhadap telur yang tidak optimal sebagai akibat dari rasio jantan dan betina yang tidak seimbang. Penelitian ini bertujuan untuk mengetahui rasio jantan dan betina yang optimum pada pematangan dan pemijahan induk beronang (Siganus guttatus). Hewan uji yang digunakan adalah induk dengan berat berkisar 311 ± 71 g/ekor. Induk dipelihara dalam 8 buah bak berukuran 1,5 m x 1,5 m x 1,0 m dengan kepadatan 24 ekor/bak. Lama penelitian berlangsung selama 6 bulan. Hewan uji diberi pakan pellet dengan frekuensi pemberian 3 kali/hari secara satiasi. Sebagai perlakuan adalah rasio jantan dan betina yaitu : 1:1 (B&:@&), 1:2 (B&:@&), 1:3 (B&:@&), dan 2:1(B&:@&). Pada awal percobaan, semua induk secara individu dalam keadaan TKG=O. Peubah biologis yang diamati meliputi: jumlah induk memijah, jumlah telur, diameter telur, dan daya tetas telur. Hasil penelitian menunjukkan bahwa dengan aplikasi rasio jantan dan betina (1:1) diperoleh jumlah induk memijah 28 ekor, jumlah telur 237.865–335.837 butir/ekor, diameter telur 315-560 ìm dan daya tetas telur rata-rata 55%, rasio (1:2) jumlah induk memijah 30 ekor, jumlah telur 129.534–393.333 butir/ekor, diameter telur 312–560 ìm dan daya tetas telur rata-rata 58%, rasio (1:3) jumlah induk memijah 35 ekor, jumlah telur 272.837–344.975 butir/ekor, diameter telur 344–560 ìm dan daya tetas telur rata-rata 55% serta rasio (2:1) jumlah induk memijah 19 ekor, jumlah telur 227.945– 350.140 butir/ekor. diameter telur 312–560 ìm dan daya tetas telur rata-rata 61%. Hasil penelitian mengindikasikan bahwa rasio jantan dan betina yang diterapkan memberikan diameter telur dan daya tetas telur yang relatif sama.pada induk beronang.
KATA KUNCI: Siganus guttatus, pemijahan, jumlah telur, diameter telur, daya tetas telur

FF 70
Neltje Nobertine Palinggi dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau, Maros

Penelitian bertujuan untuk mengetahui pengaruh substitusi tepung ikan dengan tepung rumput laut dalam pakan terhadap pertumbuhan ikan beronang. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22,05±6,4 g dengan padat tebar 15 ekor/keramba. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 20% tepung ikan tanpa tepung rumput laut, B) 10% tepung ikan dan 20% tepung rumput laut dan C) 40% tepung rumput laut dan tanpa tepung ikan, masing- masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Selama 20 minggu pemeliharaan diperoleh substitusi 10% tepung ikan dengan 20% tepung rumput laut (perlakuan B) memberikan nilai pertumbuhan yang tidak berbeda nyata (P>0,05) dengan perlakuan tanpa tepung rumput laut (perlakuan A) demikian pula terhadap nilai efisiensi pakan dan sintasan ikan tetapi berbeda nyata (P<0,05) dengan rasio efisiensi proteinnya.
KATA KUNCI: tepung ikan, tepung rumput laut, substitusi, pakan ikan beronang, S. guttatus

Forum Inovasi Teknologi Akuakultur 2010

FF 71
Rusmaedi, Idil Ardi, dan Wartono Hadie Pusat Riset Perikanan Budidaya, Jakarta

Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan, yaitu menggunakan tingkat teknologi tradisional plus, memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah. Dengan teknologi yang diterapkan, diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. Penelitian ini dilakukan pada tambak di daerah Betok Mati, Kecamatan Cilebar, Karawang, Empat petak tambak masing-masing berukuran 3.500 m2 digunakan untuk percobaan. Sebelum penebaran, dilakukan pengolahan tanah tambak,n pengapuran sebanyak 175 kg/petak, kemudian dikeringkan sekitar satu minggu. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 mg/L. Setelah dua hari, pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2. Pemeliharaan dilakukan selama tiga bulan, pada bulan pertama udang tidak diberi pakan, sedangkan pada dua bulan berikutnya diberi pakan pelet udang. Ikan banding dengan bobot rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak, penebaran dilakukan setelah satu bulan dari penebaran tokolan. Dari pemeliharaan udang selama tiga bulan, diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34,5 g, produksi 81,1 kg dan sintasan 11,2%. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3, yaitu pertambahan berat rata-rata 230 g, produksi 78,8 kg dan kelangsungan hidup 100%.
KATA KUNCI: Karawang udang windu, salinitas rendah, tokolan,

FF 72
Gede Suwarthama Sumiarsa dan Irwan Setiadi Balai Besar Riset Perikanan Budidaya Laut, Gondol

Marine chlorella Nannochloropsis oculata dan rotifer Brachionus rotundiformis merupakan pakan alami utama yang dipergunakan dalam perbenihan ikan-ikan laut di Balai Besar Riset Perikanan Budidaya Laut (BBRPBL) Gondol Bali. Produksi kedua jenis pakan alami tersebut dilakukan secara semi-continuous system dalam bak-bak outdoor berukuran 1,5–50 m3 dengan rata-rata kepadatan akhir N. oculata 13,1±0,04 juta sel/mL dan rotifer 186±5.3 ekor/mL masing-masing meningkat 7% dan 16% dari rata-rata kepadatan pada tahun sebelumnya. Pemadatan (flokulasi) N. oculata dengan NaOH dosis 75, 100, dan 125 mg/L selama 22–24 jam menghasilkan kepadatan masing-masing 368, 427, dan 519 juta sel/mL untuk inokulan dan pakan rotifer namun hanya berlaku pada dosis NaOH terendah dan dosis yang kedua. Tingkat total ammonium terlarut dalam air laut produksi masal N. oculata relatif tinggi (4,3–8,2 mg/L) sedangkan kandungan lemak rotifer produksi masal dengan pakan N. oculata relatif rendah (3,6%) dengan rasio DHA/EPA hanya 0,2.
KATA KUNCI: pakan alami, marine chlorella, Nannochloropsis oculata, rotifer Brachionus rotundiformis, semi-continuous system

Forum Inovasi Teknologi Akuakultur 2010

FF 73
Samuel Lante dan Usman Balai Riset Perikanan Budidaya Air Payau, Maros

Informasi mengenai kebutuhan kadar lemak pakan untuk ikan beronang sangat diperlukan karena selain berfungsi sebagai salah satu sumber energi, juga merupakan sumber asam lemak esensial dan pelarut beberapa vitamin. Penelitian ini bertujuan untuk mendapatkan kadar lemak dalam pakan buatan untuk mendukung pertumbuhan dan sintasan ikan beronang (Siganus guttatus). Wadah penelitian yang digunakan adalah jaring berukuran 1,0 m x 1,0 m x 2,0 m, yang ditempatkan pada keramba jaring apung di laut. Ikan uji yang digunakan adalah yuwana ikan beronang dengan panjang 19,2 ± 0,67 cm/ ekor dan bobot 155,3 ± 10,79 g/ekor, ditebar dengan kepadatan awal 10 ekor/jaring dan dipelihara selama 120 hari. Perlakuan yang dicobakan adalah pemberian kadar lemak pakan yang berbeda yaitu (A) 5%, (B) 9%, dan (C) 13%, masing- masing terdiri atas 3 ulangan. Pemberian pakan dilakukan 3 kali/hari (pukul 08.00, 11.00, dan 17.00). Pengamatan pertumbuhan ikan dilakukan setiap 30 hari sekali. Hasil penelitian menunjukkan bahwa kadar lemak 5%, 9%, dan 13% dalam pakan berpengaruh tidak nyata (P<0,05) terhadap pertumbuhan dan sintasan ikan beronang.
KATA KUNCI: kadar lemak, pertumbuhan, sintasan, Siganus guttatus

FF 74
Lies Emmawati Hadie Pusat Riset Perikanan Budidaya, Jakarta

Efek rumah kaca sebenarnya memegang peranan yang penting dalam memelihara kehidupan di bumi. Jika tidak ada efek rumah kaca, suhu dipermukaan bumi akan turun secara drastis. Problem yang terjadi dewasa ini ialah tingginya gas-gas rumah kaca karena kegiatan manusia yang mempengaruhi iklim di bumi dan menyebabkan pemanasan bumi secara global. Pada umumnya banyak spesies tidak dapat menyesuaikan diri dengan cepat terhadap perubahan suhu bumi yang diakibatkan oleh manusia. Faktor lingkungan seperti pemanasan global dan penangkapan ikan secara berlebihan menjadi salah satu penyebab semakin langkanya spesies tertentu terutama yang mempunyai nilai ekonomi tinggi seperti Arwana dan Botia. Permasalahan ini perlu dipikirkan solusinya, karena jika tidak ada kepedulian maka kekayaan plasma nutfah ikan potensial akan bergerak menuju kepunahan. Padahal dalam upaya peningkatan produktivitas perikanan budidaya, plasma nutfah ikan potensial merupakan asset dasar dalam program pemuliaan ikan. Sehingga dapat dihasilkan strain-strain ikan unggul yang toleran terhadap perubahan iklim global.
KATA KUNCI: pemuliaan, ikan langka, budidaya, konservasi

18 ha yang terdiri dari sangat sesuai seluas 133.59 ha. perairan Papalan. 2009. cat fish. mas koki. Sampel diambil dari beberapa lokasi budidaya ikan hias di sekitar Bogor dan Depok. kapiat albino. hanya sekitar 10% dari potensi perairan laut yang secara efektif dimanfaatkan untuk kegiatan budidaya ikan dalam KJA di perairan Kabupaten Mamuju yaitu 698. Analisis spasial dalam Sistem Informasi Geografis digunakan dalam penentuan kesesuaian lahan untuk budidaya ikan dalam KJA. Oleh karena itu. Trematoda). dan insang. budidaya laut. nitrat. parasit . Synodontis. Gyrodatylus spp. Red Fin Albino. Pulau Bekengkeng. arah arus. Metode survai diaplikasi pada wilayah pesisir Kabupaten Mamuju. Argulus sp. Sampel ikan hias antara lain dari golongan cyprinidae. perairan Kalukku. neon tetra. Untuk pengembangan kegiatan budidaya ikan dalam KJA yang ramah lingkungan dan berkelanjutan.18 ha. kecerahan. Maros ABSTRAK Perairan pesisir Kabupaten Mamuju Provinsi Sulawesi Barat merupakan perairan yang potensial untuk budidaya laut. Bogor ABSTRAK Studi penyakit parasitik pada beberapa jenis ikan hias air tawar telah dilakukan dari bulan Oktober sampai bulan Desember. dan platydoras. dan Ichthyophthirius multifiliis (Ciliata). (metacercaria. kedalaman. dan Dactylogyrus spp. KATA KUNCI: ikan hias air tawar. dan Mudian Paena Balai Riset Perikanan Budidaya Air Payau. salinitas. Ektoparasit yang teridentifikasi antara lain: Oodinium spp. dan Tanjung Dapuran. Namun demikian belum ada data dan informasi kesesuaian lahan untuk budidaya laut termasuk budidaya ikan dalam keramba jaring apung (KJA) di perairan tersebut. Ektoparasit yang menginfeksi ikan diamati dari organ kulit.41 ha dan kurang sesuai 52. 98% terinfeksi parasit. Chiclidae. cukup sesuai 512. Kabupaten Mamuju FF 76 PENYAKIT PARASITIK PADA BEBERAPA JENIS IKAN HIAS AIR TAWAR Tuti Sumiati dan Yani Aryati Balai Riset Perikanan Budidaya Air Tawar. Data lainnya diperoleh dari hasil ekstrak citra ALOS AVNIR-2 akuisisi 28 Juli 2009.Forum Inovasi Teknologi Akuakultur 2010 FF 75 PENENTUAN KESESUAIAN LAHAN UNTUK BUDIDAYA IKAN DALAM KERAMBA JARING APUNG DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Hasnawi. penyakit. keramba jaring apung. Pengamatan dilakukan untuk mengetahui jenis patogen yang menginfeksi. Trichodina sp. dilakukan penelitian yang bertujuan untuk menentukan kesesuaian lahan di perairan pesisir Kabupaten Mamuju untuk budidaya ikan dalam KJA yang diharapkan juga dapat menjadi acuan dalam penentuan tata ruang wilayah pesisir. (Monogenea). kecepatan arus. KATA KUNCI: kesesuaian lahan. sympilum dan Characidae. dan besi. Hasil penelitian menunjukkan bahwa lokasi yang sesuai untuk budidaya ikan dalam KJA di Kabupaten Mamuju tersebar di Pulau Karampuang. Kualitas air perairan yang diukur adalah: pH. (Dinoflagelata). sirip. Akhmad Mustafa. mulai dari perbatasan Kabupaten Majene di bagian selatan sampai perbatasan Kabupaten Mamuju Utara di Utara. (Copepoda) dan Centrocestus sp. fosfat. Pulau Kambunong. Dari Sampel yang diperiksa 33.

Tujuan penelitian adalah untuk mengetahui tingkat pencemaran pestisida pertanian pada lahan perikanan budidaya di wilayah Cianjur – Jawa Barat. Organofosfat. Variabel yang diamati adalah konsentrasi kandungan Pb.86 ton/bulan. muara Sungai Citarum. Residu pestisida yang terdapat dalam contoh terdiri atas golongan Organoklorin. Hasil perhitungan beban pencemaran memperlihatkan bahwa perairan Waduk Cirata belum tercemar oleh parameter Pb dan Cd dengan nilai kapasitas asimilasi 5. Cd. serta biota air (ikan) yang berasal dari beberapa lokasi lahan perikanan di wilayah Cianjur. Tahapan penelitian meliputi: penentuan lokasi. serta debit air dari muara sungai yang masuk ke perairan waduk. identifikasi dan analisis data serta pelaporan. diperoleh dengan cara membuat grafik hubungan antara konsentrasi Pb. Bogor ABSTRAK Penelitian ini bertujuan untuk menghitung daya dukung lingkungan perairan budidaya karamba jaring apung terhadap beban pencemaran dan kapasitas asimilasi logam berat Pb. Waduk Cirata FF 78 TINGKAT PENCEMARAN PESTISIDA PERTANIAN PADA LAHAN PERIKANAN DI CIANJUR – JAWA BARAT Imam Taufik Balai Riset Perikanan Budidaya Air Tawar. dan Zn di waduk dengan total beban pencemaran parameter tersebut di muara sungai. Cd. Bogor ABSTRAK Salah satu sumber pencemar yang potensial bagi sumberdaya dan lingkungan perairan adalah penggunaan pestisida pertanian. Kandungan logam berat Zn dalam daging ikan mas sudah melampaui ambang batas minimum menurut Badan POM yaitu 3-46 mg/L/kg daging ikan. badan air Sungai Citarum dan Sungai Cimeta. Piretroid. muara Sungai Cisokan. DAN ZN DI WADUK CIRATA Ani Widiyati dan Estu Nugroho Balai Riset Perikanan Budidaya Air Tawar. pengambilan contoh. residu .8214 ton/bulan dan 1. pencemaran. Sampel air dan ikan diperoleh dari 8 stasiun yaitu outlet. preparasi. Jenis dan konsentrasi pestisida tersebut yang terdapat dalam air < tanah < ikan. pestisida. CD. walaupun masih di bawah baku mutu dengan kapasitas asimilasi 42. Sedangkan logam berat Pb dan Cd masih di bawah ambang batas minimum yaitu tidak terdeteksi sampai 1. dan Zn dalam air dan daging ikan. Titik perpotongan dengan nilai baku mutu yang berlaku untuk setiap parameter disebut sebagai nilai kapasitas asimilasi. dan Zn di Waduk Cirata serta kandungan logam berat tersebut di dalam ikan. Nilai kapasitas asimilasi digunakan untuk menghitung daya dukung lingkungan. Perairan Waduk Cirata sudah tercemar oleh parameter Zn.98 ton/bulan. Analisis contoh menggunakan alat Gas Chromatograph (GC) serta integrator yang dapat mendeteksi kandungan bahan aktif pestisida pada contoh dan digambarkan dalam bentuk grafik. inlet.Forum Inovasi Teknologi Akuakultur 2010 FF 77 ANALISIS DAYA DUKUNG LINGKUNGAN PERAIRAN BUDIDAYA KERAMBA JARING APUNG TERHADAP BEBAN PENCEMARAN LOGAM BERAT PB. KATA KUNCI: lahan perikanan budidaya. zona 2 Purwakarta. dan Karbamat. KATA KUNCI: logam berat.88 mg/L/kg daging ikan. Analisis kandungan logam berat dalam air dan daging ikan menggunakan metode AAS. Contoh yang diambil berupa air. Cd. sedimen (lumpur/tanah). batas daerah bahaya. Hasil penelitian menunjukkan bahwa penggunaan pestisida pertanian telah berdampak pada lahan perikanan.

SUKABUMI Melta Rini Fahmi dan Rina Hirnawati Balai Riset Budidaya Ikan Hias.75–4887. Pelabuhan Ratu. KATA KUNCI: komunitas. Sampel glass eel ikan sidat dikoleksi dari muara sungai Cimandiri sebanyak 600 ekor selama empat bulan (Agustus–Desember 2009). fitoplankton. Bacillariophyceae. A.17-9. dan sebanyak 150 ekor disimpan dalam alkohol absolut. indeks dominansi (C) = 0.75 ind.31.33.75– 993. Palumbon. Analisa genetik dilakukan dengan mengunakan semi multiplek PCR.072–0. Sebanyak 430 ekor glass eel di simpan dalam formalin untuk pengukuran morfometrik dan meristik. pada region mitokondria 16SRNA. Nilai kelimpahan fitoplankton yang diperoleh berkisar antara 393. dan 4–6 m. Lokasi pengambilan contoh plankton di perairan KJA Waduk Cirata di wilayah Kabupaten Cianjur yaitu di Jangari. Kisaran nilai indeks biologi yang ditemukan adalah indeks keanekaragaman (H‘) = 2. Salah satu daerah yang menjadi tempat penangkapan sidat utama di Indonesia adalah Pelabuha Ratu.7) dikelompokan jenis A.marmorata dan (4. Hasil penelitian memperlihatkan terdapat 5 kelas fitoplankton yaitu Chlorophyceae. bicolor bicolor. nebulosa. zooplankton FF 80 KERAGAMAN IKAN SIDAT TROPIS (Anguilla sp. Hasil yang didapatkan menunjukan bahwa nilai AD yang didapat bekisar antara (0–3. 2–4. Metode penelitian yang dilakukan adalah survai yaitu dengan pengambilan contoh plankton dan air berdasarkan stratifikasi kedalaman 0–2./L. Cyanophyceae. A. PELABUHAN RATU.52) dikelompokan pada jenis A. dan Protozoa. Maleber.35). Copepoda./L dan zooplankton berkisar antara 93.12–3. Proses eutrofikasi tersebut dapat menyebabkan terjadinya ledakan fitoplankton. Ciputri.n. dan Cadas Bodas. Depok ABSTRAK Ikan Sidat merupakan ikan konsumsi ekonomis penting terutama di Jepang dan Eropa. Sukabumi. (13.marmorata.5 ind.) DI PERAIRAN SUNGAI CIMANDIRI. Dinophyceae. dan Desmiceae dari zooplankton ditemukan jenis Rotifer. Meristik dilakukan dengan penghitungan ruas tulang belakang ikan sidat. selanjutnya digunakan untuk analisa genetik. dikelompokan pada jenis A. Namur hasil analisa PCA menunjukan bahwa ikan sidat yang ditemukan terbagi menjadi empat spesies. Sungai Cimandiri. bicolor. Morfometrik dilakukan dengan penghitungan nilai AD (DA = 100 (LD –LA)LT”1) dan struktur pigmentasi ekor. A. Patok Batas.83. KATA KUNCI: Glass eel. Penelitian dilakukan untuk mendapatkan keragaman genetik ikan sidat yang masuk ke muara sungai Cimandiri. dan nilai kemerataan (E) = 0.nebulosa .Forum Inovasi Teknologi Akuakultur 2010 FF 79 KOMUNITAS PLANKTON DI LINGKUNGAN PERAIRAN BUDIDAYA IKAN KERAMBA JARING APUNG WADUK CIRATA DI WILAYAH KABUPATEN CIANJUR Ani Widiyati dan Leny Hotimah Balai Riset Perikanan Budidaya Air Tawar.71–19.65– 0. Bogor ABSTRAK Limbah dari kegiatan budidaya ikan di Keramba Jaring Apung (KJA) diduga dapat meningkatkan unsur hara seperti fosfat dan nitrogen yang jika berlebih akan mempercepat proses eutrofikasi. Penelitian ini dilakukan untuk mendapatkan data komunitas plankton di lingkungan perairan KJA di Waduk Cirata di wilayah Kabupaten Cianjur.

Forum Inovasi Teknologi Akuakultur 2010

FF 81
Afifah*), Titiek Aslianti*), dan Cindy Silvia Hadi**) *) Balai Besar Riset Perikanan Budidaya Laut, Gondol **) Mahasiswa Universitas Gadjah Mada, Jogjakarta

Pemberian pakan awal yang tepat pada stadia awal pemeliharaan larva akan sangat berpengaruh terhadap sintasan dan kesiapan larva dalam pertumbuhannya menuju stadia selanjutnya. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian jenis pakan awal yang berbeda terhadap pola pemangsaan dan pertumbuhan larva ikan kuwe (Gnathanodon speciosus). Penelitian dilakukan menggunakan Rancangan Acak Lengkap (RAL), terdiri atas 3 perlakuan pemberian pakan awal berbeda (A. rotifer, B. gonad kerang, dan C. kuning telur) dan 3 ulangan. Pemberian pakan awal di mulai saat larva berumur D-2—D-10, selanjutnya diberikan nauplii Artemia dan pakan buatan hingga mencapai fase yuwana (D-30). Pengamatan dilakukan dari mulai D-1—D-10 setelah penetasan, selanjutnya secara periodik 5 hari sampai dengan D-30. Hasil penelitian menunjukkan bahwa aktivitas pemangsaan larva terhadap pakan mulai terjadi pada larva D-2. Pola pemangsaan larva dari ketiga perlakuan pemberian pakan menunjukkan hasil relatif sama. Pengamatan pada lambung menunjukkan jumlah pakan yang berimbang sesuai jenis pakan yang diberikan pada larva hingga D-10 pemeliharaan,. Pada akhir penelitian diketahui bahwa perlakuan B memberikan nilai pertumbuhan dan SR yang lebih tinggi (10,99 mm; 27,10 g; dan 21,97%) dibanding perlakuan A (10,27 mm; 21,94 g; dan 1790%) dan C (11,01 mm; 25,20 g; dan 17,17%). Walaupun dari ketiga perlakuan yang diberikan tidak memberikan hasil yang signifikan, namun pemberian pakan gonad kerang dan kuning telur ternyata mampu menjadi alternatif subtitusi rotifer sebagai pakan awal bagi larva kuwe.
KATA KUNCI: larva ikan kuwe, pakan awal, pola pemangsaan

FF 82
Mulyasari*), Dinar Tri Soelistyowati**), Anang Hari Kristanto***) dan Irin Iriana Kusmini*) *) Balai Riset Perikanan Budidaya Air Tawar **) Institut Pertanian Bogor ***) Pusat Riset Perikanan Budidaya

Nilem (Osteochilus hasselti) merupakan ikan endemik Indonesia yang potensial untuk dikembangkan sebagai komoditas perikanan. Namun produksinya masih relatif rendah sehingga salah satu cara yang dapat dilakukan untuk meningkatkan produksi ikan nilem yang berkelanjutan, adalah dengan program pemuliaan. Dalam rangka penyediaan stok induk dan penyusunan strategi pada program pemuliaan ikan nilem diperlukan data base mengenai status spesifik yang menggambarkan keragaman intra- dan inter-populasi ikan nilem di Jawa Barat. Tujuan penelitian ini adalah melakukan identifikasi meristik dan menelusuri keragaman inter populasi ikan nilem di Jawa Barat. Pengukuran meristrik dilakukan dengan cara menghitung jumlah sirip punggung (dorsal fin), sirip dada (pectoral fin), sirip perut (ventral fin), dan sirip anal (anal fin). Hasil penelitian menunjukkan bahwa keragaman meristik antara populasi cenderung rendah dan hubungan inter-populasi ikan nilem hijau di Jawa Barat tidak berbeda secara nyata.
KATA KUNCI: ikan nilem, Osteochilus hasselti, meristik

Forum Inovasi Teknologi Akuakultur 2010

FF 83
Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar, Bogor

Pakan memegang peranan penting dalam budidaya ikan nilem. Penentuan kadar protein yang tepat dan penggunaan bahan baku lokal dapat menekan biaya pakan ikan nilem. Tujuan penelitian ini yaitu untuk mengevaluasi penggunaan pakan dengan protein yang berbeda terhadap pertumbuhan ikan nilem. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan, Balai Riset Perikanan Budidaya Air Tawar, Bogor. Ikan uji yang digunakan adalah ikan nilem dengan bobot rata- rata 5,0±0,3 g/ekor. Pakan yang digunakan adalah pakan tenggelam dengan kadar protein 18%, 19%, dan 20%. Pemberian pakan diberikan sebanyak 6% dari bobot badan dengan frekuensi pemberian pakan sebanyak 3 kali sehari. Pemeliharaan ikan dilaksanakan pada akuarium yang dilengkapi sistem resirkulasi. Ikan dipelihara selama 40 hari. Parameter yang diamati yaitu pertumbuhan spesifik, konversi pakan, serta sintasan ikan. Rancangan percobaan yang digunakan yaitu Rancang Acak Lengkap (RAL) dengan tiga perlakuan dan empat ulangan. Hasil menunjukkan bahwa pemberian pakan dengan kadar protein pakan 20% memberikan pertumbuhan spesifik terbaik (P<0,05) yaitu sebesar 1,56%. Penggunaan pakan dengan kadar protein yang tidak memberikan pengaruh yang nyata terhadap konversi pakan dan tingkat sintasan benih ikan nilem (P>0,05).
KATA KUNCI: nilem, protein, pertumbuhan, pakan

FF 84
Yayan Hikmayani Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan, Jakarta

Penelitian terkait dengan ujicoba budidaya ikan patin dengan menggunakan pakan berbahan baku lokal telah dilakukan pada tahun 2009. Penelitian dilakukan di Kabupaten Brebes dan Batang. Metode penelitian dilakukan secara studi kasus. Penentuan responden dilakukan secara sensus terhadap pembudidaya yang melakukan uji terhadap penggunaan pakan buatan untuk budidaya patin. Analisis data dilakukan secara deskriptif dan analisis usaha untuk melihat efisiensi biaya usaha dengan penggunaan pakan buatan serta keuntungan yang diperolehnya. Dari hasil penelitian menunjukkan bahwa penggunaan pakan buatan yang menggunakan bahan baku yang tersedia di lokasi budidaya dapat menghemat biaya usaha khususnya dengan biaya pakan hingga 50%. Harga pakan hanya Rp 2.800,-–Rp 3.000,-/kg dibandingkan dengan harga pakan yang dibeli sekitar Rp 6.500,-–Rp 7.000,-/kg. Dari hasil penelitian ini menunjukkan bahwa penggunaan pakan buatan dapat menghemat biaya produksi ikan patin selama pemeliharaan. Penelitian ini diharapkan dapat berguna kepada pemerintah pusat dan daerah dalam mengambil kebijakan dalam pemanfaatan potensi lokal wilayahnya untuk meningkatkan produksi ikan budidaya.
KATA KUNCI: efisiensi usaha, pakan buatan, bahan baku lokal, ikan patin

Forum Inovasi Teknologi Akuakultur 2010

FF 85
Jhon Harianto Hutapea, Irwan Setiadi, Gunawan, dan Gusti Ngurah Permana Balai Besar Riset Perikanan Budidaya Laut, Gondol

Induk-induk ikan tuna sirip kuning hasil tangkapan dalam kurun waktu tahun 2003–2007 yang dipelihara dalam bak pada umumnya sudah mengalami kematian akibat menabrak dinding atau berukuran besar (lebih dari 100 kg). Untuk melanjutkan kegiatan ini perlu dilakukan koleksi calon induk dengan perbaikan teknik penanganan pasca penangkapan calon induk. Perbaikan teknik penanganan di atas boat dilakukan dengan menggunakan bak kanvas bulat volume 2,5 m3 (diameter 2 m dan tinggi 0,8 m) dan bak fiberglass berbentuk oval volume 2,1 m3 (lebar 1,4 m dengan panjang 2,1 m dan tinggi 0,7 m. Kandungan oksigen dalam air di bak penampungan di atas 120 persen selama transportasi. Mengangkat ikan dari laut dan kemudian melepas pancing dalam wadah kanvas atau bahan kulit sintetis. Dalam bak pengobatan kadar oksigen juga di atur di atas 120 persen dan ikan direndam dengan larutan erubazu 100 mg/L selama 60 menit. Sintasan ikan dalam bak pengobatan juga meningkat dari 80 menjadi 100 persen karena tidak ada ikan yang diafkir. Kemudian kesembuhan ikan karena luka oleh pancing dan tali pancing hanya 2–3 hari dari yang sebelumnya dapat mencapai 7–9 hari.
KATA KUNCI: penanganan calon induk, ikan tuna sirip kuning, sintasan

FF 86
Gleni Hasan Huwoyon, Irin Iriana Kusmini, dan Anang Hari Kristanto Balai Riset Perikanan Budidaya Air Tawar, Bogor

Ikan tengadak merupakan jenis ikan endemik yang berasal dari Kalimantan dan Sumatera. Pada beberapa jenis ikan, warna memiliki peranan yang sangat penting terhadap pertumbuhan maupun nilai jual komoditas tersebut. Tujuan penelitian ini adalah untuk menganalisis pertumbuhan ikan tengadak hitam dan merah yang dipelihara secara bersama-sama dalam kolam yang dipisah jaring berukuran 1 m3. Ikan yang digunakan berkisar antara 5-6 cm (3-5 g). Padat tebar yang digunakan sebanyak 20 ekor per wadah (10 ekor ikan tengadak hitam dan 10 ekor ikan tengadak merah) dengan ulangan sebanyak 4 kali. Selama pemeliharaan ikan diberi pakan komersial sebanyak 5% bobot badan per hari. Pengamatan pertumbuhan dilakukan setiap 30 hari selama 150 hari. Pertumbuhan diamati dengan cara menimbang bobot 10 ekor ikan tengadak untuk setiap warna yang berbeda. Hasil yang diperoleh memperlihatkan bahwa ikan tengadak merah lebih baik dibandingkan dengan tengadak hitam untuk pertambahan panjang merah: 2,1±0,19; hitam: 1,7±0,20), pertumbuhan mutlak (merah: 6,8±1,02; hitam: 5,6±0,30) dan laju pertumbuhan spesifik (merah: 0,65±0,06; hitam: 0,57±0,02).
KATA KUNCI: warna, tengadak, Barbonymus schwanenfeldii, genetika

gula. dapat disimpulkan bahwa khamir laut dapat digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu (Morinda citrifolia). Berdasarkan hasil penelitian.02% khamir laut.05).5% molasses + 0. urea. serat kasar. siap digunakan sebagai biokatalisator dalam pembuatan silase daun mengkudu.Forum Inovasi Teknologi Akuakultur 2010 FF 87 PENGGUNAAN KHAMIR LAUT SEBAGAI BIOKATALISATOR DALAM PEMBUATAN SILASE DAUN MENGKUDU (Morinda citrifolia) SEBAGAI SALAH SATU BAHAN PAKAN IKAN ALTERNATIF Mivida Febriani Jurusan Perikanan Fakultas Teknik dan Ilmu Kelautan. daun mengkudu.5% molasses + 0.06% khamir laut. silase. Setelah 5 hari dipanen. dan energi di antara perlakuan berbeda nyata (P<0. Tujuan penelitian ini untuk mengetahui kandungan nutrisi silase daun mengkudu dengan penggunaan khamir laut sebagai biokatalisator. dan abu di antara perlakuan tidak berbeda nyata (P>0.04% khamir laut. pupuk . kemudian dikultur massal dengan media air laut yang telah dipupuk dengan KCl. Hasil penelitian menunjukkan bahwa: pH. Jepara.5% molasses + 0. R = Daun 3 mengkudu + 2. Khamir laut didapatkan dari Balai Besar Pengembangan Budidaya Air Payau.5% molasses + 0. bahan kering.01). B = Daun mengkudu + 2.05).00% khamir laut. KATA KUNCI: khamir laut. khamir laut disaring lalu dikeringkan di bawah sinar matahari selama ± 3 hari. R4 = Daun mengkudu + 2. protein kasar. Setelah kering. E = Daun mengkudu + 2.08% khamir laut. Universitas Hang Tuah Surabaya ABSTRAK Informasi mengenai kandungan nutrisi silase daun mengkudu (Morinda citrifolia) penting diketahui untuk dimanfaatkan sebagai salah satu bahan pakan alternatif untuk pakan ikan. BETN. lemak kasar. dan TSP. Kecernaan protein dan Ca di antara perlakuan berbeda sangat nyata (P<0. Rancangan Penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan 5 perlakuan dan 3 ulangan sebagai berikut: Perlakuan A = Daun mengkudu + 2.5% molasses + 0. sebagai salah satu alternatif bahan pakan untuk pakan ikan dan pembuatan silase pada daun mengkudu dapat meningkatkan kualitas dari daun mengkudu.

dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. petak I ditebari bandeng (10. CBIB. Brata Pantjara.28 kg/ha pada perlakuan A dan dibandingkan perlakuan B yang mencapai sintasan 59.000 ekor/ha. Hasil analisis ekonomi pada pada perlakuan A menghasilkan keuntungan Rp 10. KATA KUNCI: biofilter.000 ind/ha) dan petak II. Benih udang windu yang ditebar berupa tokolan (PL 34) dengan padat penebaran 40. bandeng (3.46% dengan produksi udang windu sebesar 249.000 ind. rumput laut dan bandeng mampu mempertahankan kondisi kualitas air tambak yang baik untuk pertumbuhan udang windu dan menghambat berkembangnya penyakit pathogen.000. udang windu. KATA KUNCI: udang windu. rumput laut (2 ton/ha) dan tiram (20. Penelitian ini bertujuan untuk mengetahui pengaruh biofilter tiram.000 ekor/ha) dan rumput laut (1 ton/ha). di mana termasuk cara budidaya udang.000 ekor/ha) dan rumput laut (1 ton/ha).000 ekor/ha). dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. tambak marjinal . KABUPATEN TAKALAR Muharijadi Atmomarsono. Maros ABSTRAK Produktivitas tambak yang rendah pada budidaya udang windu dapat ditingkatkan produksinya melalui budidaya sistem biofilter dengan memanfaatkan komoditas yang toleran dengan kondisi air payau.Forum Inovasi Teknologi Akuakultur 2010 K 01 PENERAPAN CBIB PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK INTENSIF DESA PUNAGA. BL542 bulan III./ha) dan petak II : bandeng (3. Hasil penelitian menunjukkan bahwa pemanfaatan biofilter tiram. penggunaan sarana produksi yang ramah lingkungan. Pada akhir penelitian diperoleh sintasan 63. Perlakuan yang dicoba adalah A yang terdiri dari 2 petak biofilter yaitu petak biofilter I. rumput laut.73% dengan produksi sebesar 217.000 ekor/ha).07.48 kg/ha.-/musim tanam dengan B/C rasio 2. ditebari bandeng (10. Erfan Andi Hendradjat.5 ton/ha/16 mg di tambak udang windu intensif di Desa Punaga Kabupaten Takalar. dan BT951 bulan IV) terbukti mampu meningkatkan produktivitas tambak dari 1. dan bandeng terhadap produksi udang windu dan keuntungan secara ekonomis di tambak marjinal. Sulawesi Selatan. MY1112 bulan II. Perlakuan B.977. Dengan menggunakan benih udang windu yang ditokolkan secara benar di hatcheri (padat penebaran 20 ekor/m2) dan aplikasi bakteri probiotik secara pergiliran (BT951 bulan I. Penerapan CBIB dalam budidaya udang windu (Penaeus monodon) secara intensif meliputi persiapan tambak dan lingkungan yang baik. rumput laut (2 ton/ha) dan tiram (40. Maros ABSTRAK CBIB adalah cara budidaya ikan yang baik. Sedangkan petak III pada masing-masing perlakuan digunakan untuk budidaya udang windu. serta manajemen pakan dan air secara benar. probiotik K 02 PEMANFAATAN BIOFILTER PADA BUDIDAYA UDANG WINDU DI TAMBAK MARJINAL Brata Pantjara.1 ton/ha/16 mg menjadi 1.

diikuti perlakuan kombinasi probiotik A (50. Penelitian diset dalam Rancangan Acak Lengkap (RAL) dengan pola faktorial yang terdiri atas dua faktor yaitu I) jenis probiotik dan II) dosis pakan.05% dan 298. Maros ABSTRAK Probiotik telah lama diaplikasikan dalam budidaya tambak. (B1) BL542+BT951+ MR55 dengan dosis pakan 100%. namun masih diperlukan informasi mengenai efektivitas berbagai jenis probiotik pada dosis pakan yang berbeda. dan kandungan oksigen terlarut yang seringkali di bawah 1 mg/L pada pagi hari. survival rate. Hasil penelitian menunjukkan. KATA KUNCI: probiotic bacteria. air laut salinitas 28 ppt sebanyak 15 L. Hasil penelitian menunjukkan bahwa konsentrasi BOT dan 3 selama penelitian relatif lebih tinggi pada perlakuan yang NH tidak menggunakan probiotik dengan dosis pakan 100%. kandungan BOT di atas 30 mg/L. dan Bunga Rante Tampangallo Balai Riset Perikanan Budidaya Air Payau. Kombinasi perlakuan yang dicobakan adalah (A1) BL542+BT951+MY1112 dengan dosis pakan 100%. tiger shrimp K 04 PENGGUNAAN PROBIOTIK PADA PEMELIHARAAN UDANG WINDU (Penaeus monodon) DENGAN DOSIS PAKAN YANG BERBEDA Muliani. dan Muharijadi Atmomarsono Balai Riset Perikanan Budidaya Air Payau. NO3. (D2) kontrol 2. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh aplikasi bakteri probiotik terhadap peningkatan sintasan dan produksi udang windu di tambak dengan padat penebaran tokolan 8 ekor/m2. dan C) Kontrol (tanpa probiotik). Balai Riset Perikanan Budidaya Air Payau. (B2) BL542+BT951+ MR55 dengan dosis pakan 50%. dilakukan penelitian yang bertujuan untuk mengetahui efektivitas probiotik untuk memperbaiki kualitas air dan sintasan udang windu dalam bak terkontrol. Sintasan udang windu tertinggi didapatkan pada . Tiga perlakuan yang dicobakan adalah A) Kombinasi probiotik BL542+BR883+MY1112+MR55+BT950 selama penelitian. Rendahnya sintasan dan produksi udang windu pada penelitian ini disebabkan oleh menurunnya kualitas air tambak. Maros.7 kg/ha/90 hari). Muliani.7 kg/ha/90 hari).7 kg/ha/90 hari). (D1) kontrol 1 (tanpa probiotik dengan dosis pakan 100%). Nurbaya. dan total Vibrio. (A2) BL542+BT951+MY1112 dengan dosis pakan 50%. MY1112 bulan II. menggunakan 21 akuarium yang berukuran 40 cm x 30 cm x 27 cm yang diisi tanah dasar tambak setebal 10 cm. (tanpa probiotik dengan dosis pakan 50%) dengan ulangan masingmasing 3 kali dan lama pemeliharaan 10 minggu. Maros untuk tiga perlakuan dan tiga ulangan diaplikasikan dalam penelitian ini.35% dan 448.8% dan 228. terutama salinitas yang mencapai 56 ppt. (C1) probiotik komersial dengan dosis pakan 100%. Oleh karena itu. Penelitian dilakukan di laboratorium basah. BL542 bulan III. bahwa sintasan dan produksi udang windu tertinggi dicapai pada perlakuan pergiliran probiotik B (66. NH 3. total bakteri.Forum Inovasi Teknologi Akuakultur 2010 K 03 APLIKASI BAKTERI PROBIOTIK UNTUK PENINGKATAN SINTASAN DAN PRODUKSI UDANG WINDU (Penaeus monodon) DI TAMBAK Muharijadi Atmomarsono. Penelitian dilaksanakan selama 90 hari. production. (C2) probiotik komersial dengan dosis pakan 50%. NO2. B) Pergiliran probiotik BT951 bulan I. Pengamatan sintasan udang windu dilakukan pada akhir penelitian. Sintasan dan produksi udang windu terendah diperoleh pada perlakuan tanpa probiotik (39. Nurbaya. Pengamatan parameter kualitas air dilakukan setaip 2 minggu yang meliputi: BOT. PO4. dan ditebari benur windu PL-25 sebanyak 30 ekor/wadah. Rancangan acak lengkap (RAL) dengan menggunakan 9 petak tambak berukuran 250 m2 di Instalasi Tambak Percobaan (ITP) Marana.

KATA KUNCI: probiotik. udang windu . Penggunaan probiotik (BL542+BT951+MR55) dapat menurunkan konsentrasi NH3 lebih nyata dibanding dengan (BL542+BT951+MY1112) dan probiotik komersial.11%.33% dan terendah pada perlakuan yang menggunakan probiotik komersil dengan dosis pakan 50% yaitu 11.perlakuan B (BL542+BT951+ MR55 dengan dosis pakan 50%) yaitu 60. dosis pakan.05) pada akhir penelitian. sintasan. sehingga berdampak kepada peningkatan sintasan udang windu yang lebih tinggi (P<0.

5% dengan produksi 19.Forum Inovasi Teknologi Akuakultur 2010 K 05 RISET APLIKASI BAKTERI PROBIOTIK PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nurbaya. Hewan uji yang digunakan berupa tokolan udang windu PL-30 dengan kepadatan 2 ekor/m2 yang dipelihara selama 79 hari. Perlakuan yang dicobakan adalah aplikasi probiotik BRPBAP. Sintasan dan produksi udang windu dan ikan bandeng masing. Persiapan tambak dilakukan sesuai dengan prosedur standar operasional pertambakan. B: Udang windu + rumput laut (1 ton/ha) + Bandeng (1.masing-masing dengan dua kali ulangan. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana. baik pada air maupun pada dasar tanah tambak. namun belum mampu menurunkan kandungan amoniak dalam media budidaya.000 ekor/ha (1 ekor/m2). Penelitian ini bertujuan untuk mengetahui efektivitas probiotik BRPBAP dalam penanggulangan penyakit dan peningkatan produksi udang windu. Aplikasi probiotik ini juga dapat menekan pertumbuhan populasi bakteri Vibrio spp. dan kontrol (tanpa aplikasi probiotik).9 kg dan secara finansial memberikan . kesehatan.500 m2 dengan kedalaman 80 cm. produksi. masing-masing terdiri atas 2 ulangan. Penelitian ini dilakukan di tambak rakyat di Kabupaten Barru Provinsi Sulawesi Selatan menggunakan 4 petak tambak. 31) yang ditebar pada masing-masing tambak adalah 10. Data yang diperoleh dihitung dan diuji menggunakan analisis ragam dengan pola rancangan acak kelompok.4 ha.4% pada tambak yang diaplikasikan probiotik BRPBAP sedangkan kontrol hanya 13. Sebagai perlakuan adalah A: Udang windu + rumput laut (1 ton/ha) + Bandeng (500 ekor/ha).7 kg. Selama pemeliharan tidak diberi pakan. Probiotik BRPBAP layak untuk dikembangkan dan diaplikasikan di tambak udang windu pola ekstensif (trdisional plus). Hasil penelitian menunjukkan bahwa budidaya multitropik yang optimal antara udang windu. serta 99. Maros ABSTRAK Penelitian budidaya multitropik krustase dan ikan sudah berkembang sejak tahun 1980-an.0%. Delapan tambak yang digunakan masing-masing berukuran 25 m x 100 m/2. Oleh karena itu. rumput laut dan ikan bandeng adalah perlakuan B (10.000 ek/ha bandeng) menunjukkan hasil yang terbaik. D: Udang windu + rumput laut (2 ton/ha) + Bandeng (1000 ekor/ha). Maros selama 90 Hari.masing adalah 66. Muliani dan Arifuddin Tompo Balai Riset Perikanan Budidaya Air Payau. dan pertumbuhan udang serta aman bagi konsumen. Sampling dilakukan 30 hari sekali selama 90 hari.000 ekor/ha). udang windu K 06 BUDIDAYA MULTITROPIK MELALUI OPTIMASI UDANG WINDU (Penaeus monodon) DENGAN KEPADATAN RUMPUT LAUT (Gracilaria sp. Hasil penelitian menunjukkan bahwa sintasan udang windu 36% dengan produksi 81. C: Udang windu + rumput laut (2 ton/ha) + Bandeng (500 ekor/ha). Tjaronge. dilakukan penelitian yang bertujuan untuk mendapatkan data dan informasi produksi dan keuntungan secara finansial budidaya multitropik di tambak.000 ek/ha Udang windu + 1 ton/ha rumput laut + 1. dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: probiotik.9% dan 33. M.8% dan 63. Maros ABSTRAK Salah satu alternatif dalam upaya penanggulangan penyakit pada budidaya udang adalah penggunaan probiotik yang dapat memperbaiki kualitas lingkungan budidaya. yang terdiri atas 2 petak berukuran 1 ha dan 2 petak berukuran 0. Tokolan udang windu (PL.) DAN IKAN BANDENG (Chanos chanos) YANG BERBEDA DI TAMBAK Suharyanto. Namun demikian masih diperlukan informasi mengenai peningkatan produksi dan pemanfaatan relung ekologi melalui penebaran organisme budidaya yang optimal yang berkaitan dengan fluktuasi oksigen terutama pada malam hari.

udang windu. sintasan.keuntungan sebesar Rp 11. produksi .000.572. ikan bandeng. rumput laut. KATA KUNCI: multitropik.-/ha /90 hari.

uji tantang. 3 hari.05) dibandingkan dengan kontrol. Sukenda**). Larva udang windu ditantang dengan WSSV dengan konsentrasi 2 mL/L media pemeliharaan. Alimuddin**). termasuk gen anti virus PmAV (Penaeus monodon anti viral gene). yang sampai saat ini belum bisa diatasi secara secara tuntas. Sebagai langkah awal dalam penanggulangan penyakit udang windu dilakukan analisis ekspresi gen yang berperan dalam pertahanan tubuh udang windu. dan 5 hari setelah uji tantang dengan menggunakan semi-kuantitatif PCR. ekspresi gen. Selain itu. EGFP. Ekspresi gen PmAV mulai terlihat peningkatannya sejak 6 jam dan sedikit menurun pada hari ke-2 serta kembali meningkat sampai dengan akhir penelitian. Bunga Rante Tampangallo. promoter ProAV udang windu dapat aktif dan mampu mengendalikan ekspresi sementara gen EGFP pada embrio dan larva. Pola ekspresi sementara gen EGFP mulai terlihat 12 jam setelah transfeksi. 1 hari. IPB. KATA KUNCI: ekspresi. Uji konfirmasi masuknya gen EGFP dan ekspresi sementarnya diamati pada embrio dan larva. 12 jam. Promoter dikatakan aktif apabila gen penanda dapat terekspresi.3% dan tidak berbeda nyata (P>0. Hasil penelitian tersebut berimplikasi bahwa promoter ProAV dapat digunakan dalam upaya pengembangan trangenik udang windu dengan menggunakan gen target yang diinginkan. Penaeus monodon MENGGUNAKAN GEN EGFP SEBAGAI PENANDA Andi Parenrengi*). 4 hari. Bogor ABSTRAK Untuk melihat aktivitas suatu promoter.0%). Maros **) Departemen Budidaya Perairan. dan Andi Parenrengi Balai Riset Perikanan Budidaya Air Payau.1%) serta tanpa transfeksi (49. 2 hari. Hasil penelitian menunjukkan bahwa derajat penetasan telur udang windu hasil transfeksi adalah 39. Kasus penyakit virus merupakan salah satu kendala utama yang dihadapi pembudidaya udang tersebut. diperlukan adanya suatu gen penanda yang disambungkan dengan promoter dalam konstruksi gen. udang windu . Pengamatan ekspresi gen PmAV pada hepatopankreas dilakukan pada 6 jam. Penelitian ini bertujuan untuk mengetahui ekspresi gen PmAV khususnya pada udang windu yang ditantang dengan virus WSSV. Hal ini berindikasi bahwa larutan transfeksi jetPEI dan gen EGFP tidak memberikan efek yang membahayakan embrio udang. Hasil penelitian menunjukkan bahwa introduksi WSSV dapat menyebabkan penurunan kelangsungan hidup larva yang nyata (P<0. transfeksi. KATA KUNCI: promoter. Aan Fibro Widodo. Fakultas Perikanan dan Ilmu Kelautan. Maros ABSTRAK Udang windu Penaeus monodon merupakan salah satu spesies lokal krustase yang telah dibudidayakan di Indonesia. Komar Sumantadinata**). gen PmAV menunjukkan respons meningkat (up-regulation).Forum Inovasi Teknologi Akuakultur 2010 K 07 UJI AKTIVITAS PROMOTER ANTI VIRUS PADA UDANG WINDU. Syarifuddin Tonnek.05) dengan perlakuan transfeksi tanpa konstruksi gen (43. danAndi Tenriulo*) **) Balai Riset Perikanan Budidaya Air Payau. Penelitian ini bertujuan untuk mengetahui aktivitas promoter anti virus (ProAV) pada udang windu Penaeus monodon dengan menggunakan EGFP (enhanced green fluorescent protein) sebagai penanda. Hasil penelitian ini berimplikasi bahwa gen PmAV berperan aktif dalam merespons infeksi virus WSSV yang nantinya akan berguna dalam pengendalian penyakit virus pada udang. udang windu K 08 ANALISIS EKSPRESI GEN ANTI VIRUS PmAV PADA UDANG WINDU Penaeus monodon YANG DITANTANG DENGAN WSSV Andi Tenriulo. dan mencapai puncak ekspresi pada 24 jam setelah tranfeksi dan selanjutnya ekspresi menurun pada 30 jam setelah transfeksi. gen anti virus. ProAV digabungkan dengan EGFP dalam vektor pEGFP-N1 sehingga terbentuk konstruksi gen ProAV-EGFP-PolyA. Ketika ditantang dengan WSSV. Transfer konstruksi gen dilakukan dengan menggunakan metode transfeksi kepada telur udang yang telah terbuahi.

KATA KUNCI: ELISA. Delapan nomor hibridoma yang potensial menghasilkan AbMo WSSV telah diperoleh melalui seleksi dengan teknik ELISA dan disimpan secara kriogenik. sebagai sumber untuk produksi AbMo WSSV secara massal dan berkesinambungan. karena relatif mudah dan murah. Sejumlah sampel jaringan udang dari kabupaten Sidoarjo yang menunjukkan abnormalitas dan gejala klinis WSSV dan IHHNV dikoleksi untuk diketahui agen penyebab perubahan patologisnya kemudian disimpan dalam larutan Davidson. hibridoma penghasil AbMo spesifik WSSV dapat disimpan dalam waktu lama.Forum Inovasi Teknologi Akuakultur 2010 K 09 MULTIINFEKSI ALAMI WHITE SPOT SYNDROM VIRUS DAN INVECTIOUS HYPODERMAL HAEMATOPOETIC NECROSIS PADA Penaeus monodon : KAJIAN HISTOPATOLOGI Tatik Mufidah dan Isti Koesharyani Pusat Riset Perikanan Budidaya. Nurhidayah. Dari sampel jaringan udang yang di warnai dapat dilihat bahwa pada epidermal tissue dari cephalothorax terdapat banyak badan inklusi yang bersifat basofilik intra nuklear. serta berpeluang untuk digunakan secara langsung di lapangan. Produksi hibridoma dilakukan melalui fusi sel mieloma SP2 dengan limposit mencit hibrida Balb/c yang telah diimunisasi dengan antigen WSSV. Jakarta ABSTRAK White Spot Syndrom Virus (WSSV) dan Invectious Hypodermal Haematopoetic Necrosis (IHHNV) merupakan penyakit viral yang banyak menyebabkan kerugian pada usaha budidaya udang. monodon dengan melihat gejala klinis dan studi histopatologi. Kepekaan teknik serologi sangat tergantung pada kespesifikan reaksi antibodi yang digunakan. dan Nurbaya Balai Riset Perikanan Budidaya Air Payau. Uji kespesifikan reaksi telah dilakukan pengujian lebih lanjut. khususnya ELISA. dan disertai ulserasi lapisan mukosa epitel. menyeleksi. merupakan salah satu teknik yang menjanjikan untuk keperluan tersebut. antibodi monoklonal . Penelitian dilakukan untuk membuat. Pewarnaan jaringan menggunakan Hematoxilin eosin. White Spot Syndrome Virus (WSSV). sedangkan pada udang yang terserang IHHNV dapat dilihat pertumbuhan udang yang terhambat serta deformitas pada tubuh udang. dan mengkarakterisasi sel hibridoma penghasil antibodi monoklonal White Spot Syndrome Virus (AbMo WSSV). Maros ABSTRAK Komponen dasar yang penting dan menentukan keberhasilan pengendalian suatu penyakit dalam bidang perikanan adalah informasi tentang patogen secara dini. cepat dan akurat. Invectious Hypodermal Haematopoetic Necrosis (IHHNV) dan histopatologi K 10 TEKNIK PRODUKSI ANTIBODI MONOKLONAL WHITE SPOT SYNDROME VIRUS (WSSV) Mun Imah Madeali. Penelitian ini bertujuan untuk mengetahui adanya serangan WSSV dan IHHNV pada udang P. Teknik serologi. serta epidemi penyakit di lapangan. Antibodi monoklonal memiliki kespesifikan yang tinggi. pengamatan mikroskopik dilakukan untuk melihat kelainan pada jaringan. KATA KUNCI: White Spot Syndrom Virus (WSSV). Pada infeksi WSSV gejala patognomonis yang timbul adalah bintik putih pada karapas. Setelah pengujian.

Kesimpulan memperlihatkan bahwa (B) penggunaan tokolan (PL-27) menghasilkan produksi yang tinggi dan RKP yang rendah. tokolan. Hal ini disebabkan waktu panen yang berbeda sesuai dengan kondisi musim (air sumber) semakin menurun.085±0. Kondisi musim air sumber yang menurun ini diikuti oleh meningkatnya total vibrio di air laut mencapai 433104 CFU/mL dibandingkan dalam air tambak (B). menggunakan 4 petak masing masing berukuran 4. budidaya udang intensif. Riset ini bertujuan untuk mendapatkan data dan informasi pengaruh pengunaan tokolan terhadap produksi.0±149.549±0.257±0. Hasil yang diperoleh pada perlakuan B memperlihatkan pertumbuhan mutlak (11.034) berbeda nyata (P<0. Budidaya ini berkembang dengan teknologi intensif. RKP pada pembesaran udang vaname teknologi intensif.102 CFU/mL. produksi (1831.05) dengan perlakuan A (1. Parameter kualitas air memperlihatkan sebaran kisaran yang merata untuk ke-2 perlakuan. namun ke-3 parameter ini tidak berbeda nyata antara ke-2 perlakuan. sintasan (90.246) lebih tinggi dari pada perlakuan A yaitu : pertumbuhan mutlak (10. sintasan ( 92.7 m sebanyak 9 buah.31 g dan 86% diperoleh pada perlakuan B bila dibanding perlakuan lainnya. produksi (2087. produksi K12 PERTUMBUHAN DAN SINTASAN UDANG VANAME (Litopenaeus vannamei) DENGAN KOMBINASI PAKAN BERBEDA DALAM WADAH TERKONTROL Suwardi Tahe dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau.05) terhadap pertumbuhan.Setiap perlakuan dengan 2 ulangan.Forum Inovasi Teknologi Akuakultur 2010 K 11 BUDIDAYA UDANG VANAME (Litopenaeus vannamei) TEKNOLOGI INTENSIF MENGGUNAKAN BENIH TOKOLAN Markus Mangampa dan Hidayat Suryanto Suwoyo Balai Riset Perikanan Budidaya Air Payau. karena berpengaruh terhadap pertumbuhan.120).234). rasio konversi pakan dan produksi udang vaname.83±8.18235 mg/L) dibandingkan dengan perlakuan A (0. Penelitian ini bertujuan untuk mengetahui kombinasi pakan yang tepat terhadap pertumbuhan dan sintasan udang vaname (Litopenaeus vannamei).45 g/ekor dan ditebar kepadatan 100 ekor/bak. Selama pemeliharan 85 hari. Penelitian ini dilaksanakan di Instalasi Perbenihan Balai Riset Perikanan Budidaya Air Payau. sintasan. Maros ABSTRAK Pakan merupakan satu di antara faktor yang perlu diperhatikan dalam sistem budidaya udang di tambak. udang diberi pakan dosis 50%-5% dari total berat biomassa/hari. Riset ini dilaksanakan di tambak Punaga.51). Setiap bak diisi air laut salinitas 32 ppt sebanyak 500 L dan dilengkapi 1 buah aerasi Hewan uji yang digunakan adalah tokolan udang vaname dengan bobot rata-rata 0. (B) Pakan PV75% + pakan EB25% dan (C) Pakan PV50% + EB50%. KATA KUNCI: udang vaname. Rasio konversi pakan (RKP) lebih rendah pada perlakuan B (1. Maros ABSTRAK Salah satu jenis udang yang cukup potensial untuk dikembangkan adalah udang vaname (Litopenaeus vannamei). namun terbatas pada golongan masyarakat menengah keatas (padat modal).114±0. Pertumbuhan dan sintasan udang vaname terbaik yaitu masing-masing 6.048).000 m2/petak. Hewan uji adalah udang vaname dengan perlakuan: (A) pembesaran dgn tebar benur (PL 12).5±88. dan efisiensi biaya produksi.. . Hasil penelitian yang diperoleh menunjukkan bahwa kombinasi pakan berpengaruh nyata (P<0. kecuali Nitrit (NO2-N) memperlihatkan kisaran yang tinggi pada perlakuan B (0. dan pemeliharaan berlangsung 80 hari di tambak. Wadah yang digunakan adalah bak fiber glass ukuran 1 m x 1 m x 0.096±0. dan (B) pembesaran dengan tebar tokolan (PL 27).masing-masing perlakuan diulang tiga kali.258). Takalar. Penelitian diset menggunakan Rancangan Acak Lengkap dengan 3 perlakuan yaitu: (A) Pakan PV100%. 829.9).0328 mg/L) pada akhir penelitian. Instalasi BRPBAP. sintasan. benur. dan kepadatan benur dan tokolan adalah 50 ekor/m2.

feed. and L vannamei . survival rate.KATA KUNCI: growth.

Jakarta Utara. Penelitian dilakukan di tambak percobaan Punaga Takalar.6 kkal GE/g). C/P rasio 14. K 14 PENGARUH PEMBERIAN PAKAN DENGAN KADAR PROTEIN BERBEDA TERHADAP PERTUMBUHAN YUWANA UDANG PUTIH. 19. 15. Litopenaeus vannamei Deisi Heptarina*). Percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. Sintasan (SR) dan ekskresi amonia tidak berbeda nyata (P>0. Selama pemeliharaan. menggunakan 6 petak pembesaran udang vaname masing-masing berukuran 4.00. Tujuan penelitian adalah mengetahui pengaruh pengurangan ransum pakan secara periodik terhadap pertumbuhan.5 g/ekor dengan kepadatan 10 ekor per akuarium. Perlakuan yang diujicobakan adalah pengurangan ransum pakan (pemuasaan) secara periodik yaitu: A) pengurangan ransum pakan 30%. sintasan. 5 kali sehari pada pukul 07. Bobot yuwana yang ditebar rata-rata 0. SINTASAN DAN PRODUKSI UDANG VANAME (Litopenaeus vannamei) POLA SEMI . Maros ABSTRAK Biaya pakan merupakan biaya produksi tertinggi dalam budidaya udang vaname.464 mg/kg tubuh/jam. C/P rasio 11. sehingga diperlukan informasi pengurangan ransum pakan dalam budidaya.5.5 kkal GE/g). B (protein 31%.00. C/ P rasio 16. sedangkan ekskresi amonia antara 1.INTENSIF DI TAMBAK Abdul Mansyur. Pakan buatan untuk udang putih umumnya menggunakan pakan buatan berprotein tinggi untuk udang windu (Penaeus monodon). fotoperiod dibuat 12 jam terang–gelap. Agus Suprayudi**). Penghematan penggunaan pakan untuk udang vaname dapat dilakukan dengan pengurangan ransum pakan hingga 60% bobot badan/hari/minggu. Fakultas Perikanan dan Ilmu Kelautan. Institut Pertanian Bogor ***) Badan Pengkajian dan Penerapan Teknologi ABSTRAK Budidaya udang putih (Litopenaeus vannamei) intensif di Indonesia meningkat sejak diintroduksi tahun 2000-an. D (protein 35%. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. Hidayat Suryanto Suwoyo.029–2. Perlakuan terdiri atas pakan A (protein 29%.017 g yang ditebar pada tambak dengan kepadatan 20 ekor/m2. dan pH 8. suhu 28°C–30°C.05).7%. Pakan berprotein terlalu tinggi mengakibatkan inefisiensi dan pencemaran media. Pakan diberikan at satiation. Penelitian dilakukan di Pusat Studi Ilmu Kelautan IPB (PSIK–IPB). ekskresi amonia dan stabilitas pakan. produksi dan rasio konversi pakan bahkan mampu meningkatkan efisiensi pakan sekitar 7.05) terhadap pertambahan berat mutlak. . Bogor **) Departemen Budidaya Perairan.1 kkal GE/g). Penelitian ini bertujuan menentukan kadar protein optimal bagi pertumbuhan yuwana udang putih. laju pertumbuhan harian. produksi.000 m2. C/P rasio 13. salinitas 24–25 ppt.39%. Yuwana udang putih dipelihara selama 70 hari dalam sistem resirkulasi dengan 15 akuarium berukuran 60 cm x 40 cm x 50 cm dan berisi air laut sebanyak 80% dari total volum.3%–86.00. Hewan uji adalah pasca larva udang vaname dengan bobot awal rata-rata 0. M. sintasan. dan E atau komersial (protein 40.2 kkal GE/g). C/P rasio 15. 11. C (protein 33%. B) pengurangan ransum pakan 60% dan C) kontrol (tanpa pengurangan ransum pakan). rasio konversi pakan dan efesiensi pakan pada budi daya udang vaname pola semi .intensif. Sintasan antara 73.71%–22.8 kkal GE/g). dan 23.Forum Inovasi Teknologi Akuakultur 2010 K 13 PENGARUH PENGURANGAN RANSUM PAKAN SECARA PERIODIK TERHADAP PERTUMBUHAN. Hasil penelitian menunjukkan bahwa pengurangan ransum pakan secara periodik berpengaruh tidak nyata (P>0.0– 8.69%. namun kurang diimbangi dengan penyediaan pakan yang sesuai.00. Kemudian dilanjutkan uji kecernaan. Rancangan penelitian adalah rancangan acak lengkap dengan tiga perlakuan yang masing-masing perlakuan terdiri atas dua ulangan. Ing Mokoginta**) dan Dedy Yaniharto***) *) Balai Riset Perikanan Tawar.00.

05). JKP 59. retensi protein (RP). FCR 1.8% dan 11.5%–62.9%–79.4–2.2–78. RL dan RP masing-masing 26. yuwana. pertumbuhan relatif (PR).9%–68. retensi lemak (RL). Litopenaeus .4%–94.2%. kecernaan total dan kecernaan protein masing. PR 532.Namun.5%–36. jumlah konsumsi pakan (JKP). pertumbuhan.2% serta WS berkisar antara 49. kecernaan protein.1 g.5%. kecernaan total. K ATA KUNCI: protein vannamei optimal.1% dan 65. dan stabilitas pakan (WS) menunjukkan respons berbeda (P<0.7%–1130. Kisaran nilai masing-masing parameter tersebut adalah.4.masing 26. Pemberian pakan berprotein 35% atau lebih dengan C/P rasio 13.6 kkal GE/gr protein menghasilkan pertumbuhan yuwana udang putih dan konversi pakan terbaik. konversi pakan (FCR).4%.

protein haemolimph dan ekspresi enzim (GPI. Sampel udang yang sehat dan yang abnormal diambil dan disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisa di Laboratorium dengan metode yang sudah dikembangkan oleh Pusat Riset Perikanan Budidaya. Hasil penelitian ini juga mengindikasikan bahwa udang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan akibatnya FCR tinggi dan tidak efesien. and SP) pada udang yang sehat. L. belum dapat diyakinkan secara pasti bahwa ekspresi EST. toleran. Hasilnya menunjukan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus (IHHNV: Infectious hypodermal and haematopoetic necrosi dan IMNV: infectious myonecrosis). Hasil dari penelitian ini terlihat adanya perubahan keragaan histologi hepatopankreas dan protein haemolymp menunjukkan perbedaan pada kelompok udang turunan pertama (F-1) yang toleran terhadap infeksi TSV dengan udang SPF. maka beberapa jenis virus kemungkinan sudah masuk ke indonesia. dan SP. Taura Syndrome Virus. SOD. dan Hambali Supriyadi Pusat Riset Perikanan Budidaya. Tujuan dari penelitian ini adalah mendapatkan informasi secara seluler dan enzimatik dari perubahan performansi dari pada udang vaname yang sehat. Untuk mengetahui jenis virus yang menyerang udang tersebut maka. Semua gejala tersebut diduga akibat adanya serangan virus. tetapi diduga oleh adanya pengaruh interaksi dengan tekanan stres serta kondisi lingkungan. dan Rustidja**) *) Balai Besar Riset Perikanan Budiaya Laut. hal ini kemungkinan akibat dari mekanisme pertahanan dari udang dalam melawan infeksi TSV yang terekspresi sebagai interaksi kebal (imun).Forum Inovasi Teknologi Akuakultur 2010 K 15 PERUBAHAN HISTOLOGI. vannamei K 16 MULTI INFEKSI PADA PADA UDANG Litopenaeus vannamei : DETEKSI DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR) Isti Koesharyani. toleran. dan SP mampu berdiri sendiri. dan moribund. Haryanti*). Lila Gardenia. EST.Polymerase Chain Reactin RT-PCR menggunakan berbagai jenis spesifik primer. PGM. PGM. . KATA KUNCI: enzim. Hal yang sama juga terlihat dari perbedaan pola ekspresi enzim EST. SOD. Namun demikian. DAN SP) PADA UDANG Litopenaeus vannamei SELAMA INFEKSI TAURA SYNDROME VIRUS (TSV) Gusti Ngurah Permana*). Kenyataan adanya sifat toleran terhadap respons infeksi TSV tersebut mendorong untuk dilakukan penelitian tentang performansi histologi. SPF. Gondol **) Fakultas Perikanan Dan Ilmu Kelautan Universitas Brawijaya Malang ABSTRAK Kasus infeksi virus terutama TSV (Taura Syndrome Virus) pada pemeliharaan udang vaname masih merupakan kendala utama dalam keberhasilan produksi udang. EST. Dampak diijinkannya pemasukan induk vaname dan kurangnya antisipasi pengembangan teknologi penangkal. Sedangkan udang yang diserang IMNV urat daging ditubuh memutih dan dapat menimbulkan kematian. SOD. Introduksi udang ini dimaksudkan untuk mengganti udang monodon yang secara terusmenerus mengalami kegagalan akibat serangan virus White Spot Syndrome Virus (WSSV). Jakarta ABSTRAK Budidaya Udang Litopenaeus vannamei sudah berkembang di Indonesia sejak tahun 2002 setelah disetujuinya introduksi dari USA. dilakukan analisa Polymerase Chain Reactin (PCR) dan Reverse Transcriptase . toleran dan terinfeksi TSV. PROTEIN HAEMOLIMP DAN EKSPRESI ALLOZYME (GPI. SOD. Penelitian ini dilakukan berawal dari masalah yang ditemukan di lapangan seperti pertumbuhan udang yang tidak seragam (blantik). penampakan klinis yang abnormal dan organ yang yang tidak sempurna.

KATA KUNCI: Litopenaeus vannamei. MBV. WSSV. IHHNV. TSV. IMNV dan PvNV .

persilangan yang telah dilakukan belum memperlihatkan perbaikan atas keragaan pertumbuhan udang galah. Penelitian dilakukan dengan rancangan acak lengkap.31 mm. Hasil yang diperoleh menunjukkan bahwa perlakuan C memberikan hasil terbaik dengan tingkat fertilitas mencapai 46%. dengan lama pengujian 8 minggu.42 mm. A dan B. terdiri atas 4 perlakuan dan 3 ulangan pada masing-masing perlakuan. Berdasarkan keragaan pertumbuhan harian selama pembesaran uji. yang dilakukan selama 5 bulan. Sukamandi ABSTRAK Pola pemijahan dengan variasi rasio kelamin dan jumlah pasangan disinyalir berpengaruh terhadap keragaan reproduksi induk udang galah selama pemijahan. B. dan 9. pemijahan.25 m2/ekor induk. dan pembesaran. terhadap keragaan reproduksi dan mortalitas induk udang galah guna mendukung program pemuliaan. yaitu 0%. Romy Suprapto. berdasarkan nilai heterosis yang didapat. 0.21 g. udang galah K 18 PENGARUH POLA PEMIJAHAN TERHADAP KERAGAAN REPRODUKSI DAN MORTALITAS INDUK UDANG GALAH Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. B) 1 J : 2 B. Ciasem.5%. Pada masing-masing sekat ditempatkan shelter plastik dan eceng gondok sebagai sarana berlindung udang yang ganti kulit. Wadah pemijahan berupa bak tembok yang disekat dengan luasan 0. diikuti perlakuan D. Musi. Imron. yang terdiri atas A) 1 Jantan (J) : 1 betina (B). C) 2J : 2 B. dikuti populasi Barito-Musi (BM) dan Gimacro Asahan (GA). Parameter kualitas air selama pengujian masih dalam kondisi optimal bagi kehidupan induk udang galah. 6. 25%. 0. C. populasi udang galah hasil persilangan betina Gimacro dengan jantan Musi (GM) tampak paling menonjol. pendederan I. pendederan II. 2%. Penelitian meliputi pembenihan. Sebagai perlakuan adalah rasio jantan-betina.Forum Inovasi Teknologi Akuakultur 2010 K 17 KERAGAAN PERTUMBUHAN UDANG GALAH (Macrobrachium rosenbergii) DARI BEBERAPA SUMBER POPULASI DAN PERSILANGANNYA Ikhsan Khasani. KATA KUNCI: mortalitas. dengan sistem resirkulasi. 0. Pada sistem tersebut kematian induk relatif rendah. dan 0. dan D) 2 J : 4 B. Namun demikian. dan 13%. KATA KUNCI: genetik. dan Yogi Himawan Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. berturut-turut 27%. dan tidak berbeda nyata antar perlakuan.5% berturut-turut untuk perlakuan A. pertumbuhan.25 g. Monitoring jumlah induk yang memijah dan kematian induk dilakukan setiap 2 minggu. yang meliputi pertambahan panjang dan bobot. 0. khususnya rasio jantan-betina. udang galah . Barito. diberikan pada pagi dan sore. rasio kelamin. Studi pengaruh pola pemijahan induk udang galah dilakukan dengan tujuan untuk mengetahui pola pemijahan induk yang optimal. reproduksi. persilangan. Sukamandi ABSTRAK Keragaan pertumbuhan yang optimum akan muncul bila genotip (strain) yang dipelihara sesuai dengan lingkungannya. Perbedaan asal induk udang galah diduga berpengaruh terhadap performa anakan yang dihasilkan.20 g. Asahan. beserta persilangannya. berturutturut 0. dan D.27 mm. Dalam rangka meningkatkan keragaman genetik dan peluang mendapatkan kandidat udang galah unggul dilakukan evaluasi performa populasi udang galah yang telah didomestikasi yaitu GiMacro. Pakan yang diberikan berupa kombinasi pelet dengan kandungan protein 30% sebanyak 3% bobot per hari dan udang rucah sebanyak 2% per hari.

KATA KUNCI: bawang putih. (0 cfu/mL). dan D. Tiga tipe persilangan.4 mm) dan populasi inbreeding (21.00% dan 3. Parameter yang diamati adalah kelangsungan hidup dan pertumbuhan. keragaan terbaik ditunjukkan oleh populasi hasil outbreeding (74. Keragaan pendederan dari ketiga populasi diuji melalui pemeliharaan dalam hapa di kolam secara outdoor selama satu bulan. yaitu inbreeding.92. Dinar Soelistyawati**). Hasil yang diperoleh menunjukkan bahwa ekstrak daun sirih prospektif sebagai bahan desinfektasi larva udang galah. outbreeding dan crossbreeding dilakukan untuk menghasilkan tiga populasi uji berupa pascalarva (PL) umur 1 bulan. (0 cfu/mL). Harry Wuwungan**). Tingkat inbreeding populasi dapat berdampak pada keragaan populasi tersebut dalam kegiatan budidaya.8±1.05) terhadap kelimpahan bakteri. Penelitian ini bertujuan untuk mengevalusi pengaruh perbedaan tipe persilangan pada populasi tetua terhadap keragaan benih udang galah pada fase pendederan. Hewan uji yang digunakan adalah larva udang galah umur dua hari. Sukamandi ABSTRAK Desinfektasi larva merupakan salah satu langkah bisecurity guna mencegah masuknya organisme pathogen dan parasit melalui larva udang galah. Pada karakter pertumbuhan. Hasil penelitian menunjukkan bahwa perlakuan perendaman ekstrak daun sirih dan formalin berpengaruh nyata (P<0. C.83% dan 3. Hasil penelitian menunjukkan bahwa pada karakter sintasan. .4 mm). Sukamandi. crossbreeding. yang ditempatkan di dalam akuarium dengan ketinggian air 40 cm dan dipasang pemanas dengan suhu 29°C.0%). (8.5 x 103).Penelitian bertujuan untuk mengetahui efektivitas ekstrak daun sirih dan ekstrak bawang putih sebagai bahan alternatif desinfektasi larva udang galah. KATA KUNCI: budidaya dapat inbreeding. sintasan (SR) dan perkembangan larva (LSI). Perlakuan yang diberikan yaitu A (kontrol. yaitu A. desinfektan.93. larva udang galah. keragaan pendederan K 20 UJI EFEKTIVITAS EKSTRAK DAUN SIRIH DAN EKSTRAK BAWANG PUTIH SEBAGAI BAHAN DESINFEKTASI LARVA UDANG GALAH (Macrobrachium rosernbergii) Ikhsan Khasani dan Asep Sopian Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 4. Larva dipelihara dengan kepadatan 50 ekor per stoples berisi 800 mL media 10‰. (4. dan D. C (perendaman dalam larutan ekstrak daun sirih). keragaan terbaik ditunjukkan oleh populasi hasil crossbreeding (24.5±28.8±7.5% dan 3. 37. Parameter utama yang diamati adalah kelimpahan bakteri pada larva yang telah didesinfektasi.7 mm) diikuti oleh populasi hasil outbreeding (21. Hasil ini menunjukkan bahwa tipe persilangan harus didesain dengan tepat sehingga tingkat inbreeding dapat dikendalikan dan keragaan dioptimalkan.4%) diikuti oleh populasi hasil crossbreeding (57. 47. Fakultas Perikanan dan Ilmu Kelautan.5%. B.Forum Inovasi Teknologi Akuakultur 2010 K 19 PENGARUH TIPE PERSILANGAN TERHADAP SINTASAN DAN PERTUMBUHAN POPULASI BENIH UDANG GALAH (Macrobrachium rosenbergii) PADA FASE PENDEDERAN Imron*).8±1. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. dan Komar Sumantadinata**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. namun tidak berbeda nyata (P>0.0.0±1. sirih. C.05) terhadap sintasan dan nilai LSI larva selama 3 hari pemeliharaan. Institut Pertanian Bogor ABSTRAK Variasi tipe persilangan pada kegiatan breeding program dapat berimplikasi pada perbedaan tingkat inbreeding dari populasi hasil persilangan. 52. merupakan langkah bio-security. formalin. 45. B (perendaman dalam larutan formalin 250 mg/L).4 x 103 cfu/mL) .93. dengan nilai sebagai berikut: A. dan D (perendaman dalam larutan ekstrak bawang putih). B. **) Jurusan Budidaya.0%) dan populasi inbreeding (25. tanpa penambahan desinfektan). outbreeding.6±21.

Kepadatan larva 150 ekor/L. dan Wartono Hadie**) *) Balai Riset Budidaya Perikanan Ikan Hias. Jakarta ABSTRAK Udang galah (Macrobrachium rosenbergii) merupakan plasma nutfah yang tersebar di perairan Indonesia mulai dari Sumatera sampai Papua. dan pakan buatan. Jenis pakan yang diberikan berupa pakan alami chetoceros.Karawang dengan Pelabuhan Ratu lebih dekat. Hewan uji yang digunakan adalah larva udang pama (stadia mysis) yang berasal dari hasil perbenihan Balai Riset Perikanan Budidaya Air Payau. jarak genetik K 22 PEMELIHARAAN LARVA UDANG PAMA (Penaeus semisulcatus) DENGAN KEPADATAN BERBEDA Muslimin.Forum Inovasi Teknologi Akuakultur 2010 K 21 VARIASI FENOTIP UDANG GALAH (Macrobrachium rosenbergii) DARI POPULASI PERAIRAN KARAWANG. (D) 16%. (C) 31%. (E) 24%. dan Bone. Sintasan larva tertinggi didapatkan pada padat penebaran secara berurut: (A) 57%. lebar 40 cm. Hibridisasi antara Bone x Pelabuhan Ratu dan Bone x Karawang akan lebih baik menghasilkan variasi genetik yang tinggi dibandingkan Karawang x Pelabuhan Ratu. Metode yang digunakan adalah survai dengan analisis diskriminan untuk mengatahui hubungan kekerabatan di antara ketiga populasi tersebut. di mana masing-masing perlakuan di ulang tiga kali.05) terhadap laju sintasan dan pertumbuhan larva udang pama. Lies Emmawati**). larva udang pama. Hasil analisis diskriminan didapatkan jarak kekerabatan antara populasi udang galah dari Tanjung Air. KATA KUNCI: udang galah. Kepadatan larva 125 ekor/L. maka ditambahkan pemanas/heater suhu 30°C. Penelitian ini dirancang dengan menggunakan rancangan acak lengkap. sintasan dan pertumbuhan . dan F. semisucatus) dengan kepadatan berbeda. Hasil penelitian menunjukkan bahwa kepadatan larva yang berbeda berpengaruh nyata (P<0. (B) 32%. Kepadatan larva 50 ekor/L.00 dan 16. B. Sulaeman. Pemberian pakan dilakukan setiap pagi dan sore (08. Maros dengan panjang awal mysis adalah 100-190 milimikron. KATA KUNCI: kepadatan. Perlakuan yang diujicobakan adalah: A. Kepadatan larva 25 ekor/L. DAN BONE Eni Kusrini*). dan (F) 10%. Pelabuhan Ratu. D. C. Andi Tenriulo. PELABUHAN RATU. Depok *) Pusat Riset Perikanan Budidaya. dan Suwardi Tahe Balai Riset Perikanan Budidaya Air Payau. artemia. Kepadatan larva 100 ekor/L. Masing-masing populasi alam diambil contoh sebanyak 50 ekor dan diukur beberapa variable sebagai pembeda untuk menentukan jarak genetic secara fenotip. Pengaruh lingkungan yang kuat menyebabkan ekspresi gen yang dimilikinya berubah jumlah dan jenisnya untuk bertahan hidup. E. Penelitian ini bertujuan untuk mengetahui variasi fenotip dari beberapa populasi sungai yang dianggap berbeda kondisi lingkungan yaitu Tanjung Air (Karawang). Kepadatan larva 75 ekor/L. Hewan uji ini ditebar dengan kepadatan berbeda. Wadah ini diletakkan dalam sterofoam berukuran panjang 75 cm. Wadah pemeliharaan yang digunakan dalam penelitian ini adalah toples berbahan kaca dengan ukuran tinggi 22 cm. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui sintasan dan pertumbuhan udang pama (P. diameter 15 cm dan Volume 3 L. populasi.00 wita). dan tinggi 30 cm Untuk mempertahankan suhu dalam wadah tersebut.

Maros ABSTRAK Penelitian bertujuan untuk melakukan estimasi padat tebar optimum udang pama (Penaeus semisulcatus) berdasarkan tingkat konsumsi oksigen. panjang karapas 4. Estimasi padat tebar udang pama dengan asumsi bobot rata-rata 4. pertumbuhan panjang dan lebar karapas mutlak dan harian. Laju konsumsi oksigen udang pama semakin besar pada ukuran benih yang kecil dan berkurang sejalan dengan pertambahan bobot badan. Maros ABSTRAK Penelitian polikultur kepiting bakau (Scylla serrata) dan rumput laut (Gracilaria verrucosa) telah dilakukan.03 g.17 kg/250 m2. Wadah percobaan yang digunakan adalah bentik jar (chamber). B (metode gantung). Penelitian dilakukan selama 90 hari di Instalasi Tambak Percobaan (ITP).Forum Inovasi Teknologi Akuakultur 2010 K 23 ESTIMASI PADAT TEBAR UDANG PAMA Penaeus semisulcatus BERDASARKAN TINGKAT KONSUMSI OKSIGEN Herlinah dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. dengan kisaran tingkat konsumsi oksigen 0. Aan Fibro Widodo.18±0. Hewan uji yang digunakan diperoleh dari tambak budidaya dengan kisaran rata-rata bobot benih 1. Maros.48 mg/L dan kontrol tetap berkisar 4 mg/L. 58.65 g/m3. Padat tebar rumput laut yang diaplikasikan adalah 2 ton/ha.0235 g adalah 15.05) terhadap sintasan dan produksi kepiting bakau dan rumput laut. Penelitian ini menggunakan sembilan petak tambak berukuran 250 m2. Data hasil pengukuran konsumsi oksigen udang pama dianalisis regresi dan korelasi untuk menentukan pola hubungan antara bobot udang pama dengan konsumsi oksigen menggunakan program Curve Expert.95 kg/250 m2 dan terendah pada perlakuan B: 60. Data laju respirasi selama 2 O proses inkubasi diperoleh dari data loger yang merekam dinamika kandungan oksigen terlarut diukur setiap lima menit. Kisaran kelarutan oksigen pada awal penelitian adalah 3.14–7. akan tetapi masih diperlukan pengkajian tentang metode tebar yang tepat dalam polikultur tersebut. Oksigen terlarut diukur dengan alat pengukur (TPSTM Model WP-82 DO meters). 40. dan C (gabungan antara keduanya). bobot harian.06.1 mm.26–7.58%. 44.96 %. dan Herlina Jompa Balai Riset Perikanan Budidaya Air Payau. KATA KUNCI: udang pama.52 kg/250 m2.9 mg/L dan setelah 1 jam pengukuran 0.2. Hasil penelitian menunjukkan bahwa perbedaan metode penebaran rumput laut menunjukkan pengaruh tidak nyata (P>0.27 mg/g/jam. Hasil penelitian menunjukkan bahwa terdapat korelasi antara laju konsumsi oksigen dengan ukuran bobot tubuh udang pama. padat tebar. estimasi K 24 POLIKULTUR KEPITING BAKAU (Scylla serrata) DAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN METODE TEBAR YANG BERBEDA Sulaeman.6±0. disusul perlakuan C: 64.1 mm dan lebar karapas 5. Perlakuan yang diujikan adalah metode tebar rumput laut yang berbeda yaitu: A (metode lepas dasar).05) terhadap pertumbuhan bobot mutlak. . Penelitian ini bertujuan untuk mendapatkan informasi tentang metode tebar rumput laut yang tepat pada polikultur kepiting bakau dengan rumput laut di tambak. Benih yang ditebar adalah krablet-30 dengan padat tebar 1 ekor/ m2 dengan bobot rata-rata 0. tetapi berpengaruh nyata (P<0.9±0. Sintasan dan produksi tertinggi kepiting bakau didapatkan pada perlakuan A: 66. yakni alat yang terbuat dari kaca volume 1 L sebanyak 4 unit. Ver. Keseluruhan bentik jar diinkubasikan selama 1 jam dalam wadah yang menggunakan air tambak bersalinitas 35 ppt sebagai media percobaan.1.03–0.601 g/ekor umur tokolan 2 bulan selama 4 minggu pemeliharaan.446–6. BRPBAP.

rumput laut .KATA KUNCI: kepiting bakau. polikultur. metode sebar.

Permasalahan penting yang perlu diketahui dalam pemberian pakan rotifera adalah laju pemangsaan larva kepiting bakau terhadap pakan rotifera yang diberikan. kepiting bakau. Maros ABSTRAK Pemberian rotifera sebagai pakan alami dalam pembenihan kepiting bakau telah banyak dilakukan. dan nitrat (rs = 0.). Sulawesi Selatan. Pengembangan studi tentang diatom epipelic sebagai indikator kualitas air dan kesuburan suatu ekosistem budidaya masih terbatas jika dibandingkan dengan plankton.) Aan Fibro Widodo. Keragaman diatom epipelic dipengaruhi oleh alkalinitas (rs = 0. KATA KUNCI: kepadatan. rotifera./mL). Perlakuan yang diujikan adalah kepadatan rotifera yang diberikan sebagai pakan zoea-1 kepiting bakau. Penelitian ini bertujuan untuk mengetahui laju pemangsaan larva kepiting bakau (Scylla serrata) terhadap pakan rotifera (Brachionus sp. data yang dikumpulkan antara lain kualitas air dan kualitas sedimen tambak. jenis dan kelimpahannya sangat dipengaruhi kondisi dasar perairan.62). dan kandungan bahan organik (rs = 0. Hasil penelitian menunjukkan bahwa kepadatan rotifera yang diberikan sebagai pakan berpengaruh nyata (P<0. Diatom epipelic merupakan salah satu microalgae yang banyak ditemui di sedimen tambak dan keberadaannya dipengaruhi oleh kualitas air maupun sedimen. Karena hidup di dasar tambak.66)./mL)./mL). Dari hasil penelitian menunjukkan bahwa diatom epipelic di lokasi tambak budidaya udang didominasi oleh Nitzschia dan Pleurosigma. B (500 ind./mL). Penelitian dilaksanakan di Balai Riset Perikanan Budidaya Air Payau (BRPBAP) Maros. Hal ini dapat dilihat dari hubungan diatom epipelic dengan kualitas air dan sedimen. Selain diatom epipelic.71). Pengumpulan data dilakukan terhadap 12 unit tambak udang pada masa persiapan air (pratebar) dengan letak tambak yang berbeda dari pintu masuk air.1667 ind. Sulaeman. yaitu kepadatan rotifera 625 ind. Penelitian ini bertujuan untuk mengevaluasi kemungkinan pemanfaatan diatom epipelic sebagai indikator kualitas lingkungan tambak untuk budidaya udang. Penelitian menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan dan 3 ulangan.0%. yaitu dengan cara: (1) menganalisis keberadaan diatom epipelic yang ada di tambak budidaya udang dan (2) menganalisis hubungan antara berbagai parameter kualitas air dan kualitas sedimen dengan kelimpahan dan keragaman diatom epipelic pada tambak udang. yaitu: A (625 ind. Hewan uji yang digunakan adalah kepiting bakau stadia zoea-1 yang berasal dari satu cohor hasil pembenihan dari induk kepiting bakau yang dilakukan oleh Instalasi Perbenihan BRPBAP Maros.05) terhadap laju pemangsaan dan sintasan larva kepiting bakau. kandungan liat (rs = 0.72). TOM (rs = 0.Forum Inovasi Teknologi Akuakultur 2010 K 25 LAJU PEMANGSAAN LARVA KEPITING BAKAU (Scylla serrata) TERHADAP PAKAN ALAMI ROTIFERA (Brachionus SP.75)./larva/jam dan sintasan 86. Hasil terbaik diperoleh pada perlakuan A. D (250 ind.65). Pengumpulan data epipelic algae dilakukan dengan metode lens tissue trapping. Diatom epipelic dapat dijadikan indikator kualitas lingkungan tambak untuk budidaya udang. sedangkan kualitas sedimen yang berpengaruh terhadap keragaman diatom epipelic antara lain: KPK tanah (rs = 0. dan E (125 ind. laju pemangsaan. dan Muslimin Balai Riset Perikanan Budidaya Air Payau./mL). zoea K 26 ANALISIS DIATOM EPIPELIC SEBAGAI INDIKATOR KUALITAS AIR DAN TANAHUNTUK BUDIDAYA UDANG Supono Budidaya Perairan Universitas Lampung ABSTRAK Manajemen kualitas air dan dasar tambak mempunyai peran yang sangat penting pada keberhasilan budidaya udang. dan peubah kualitas air. sintasan./mL dengan laju pemangsaan sebesar 259. C (375 ind. Peubah yang diamati adalah laju pemangsaan. . Penelitian ini merupakan penelitian eksploratif untuk mempelajari struktur diatom epipelic yang ada di tambak udang.

kualitas air.KATA KUNCI: diatom epipelic. kualitas sedimen . tambak udang.

Forum Inovasi Teknologi Akuakultur 2010 K 27 KERAGAAN PERTUMBUHAN BENIH Cherax quadricarinatus DARI BERBAGAI LOKASI UNTUK MENCAPAI UKURAN 5-6 INCI Irin Iriana Kusmini. panjang standar.72).9±9. Adapun parameter yang diukur meliputi: rata-rata pertumbuhan individu (bobot. serta sintasan lobster air tawar dari masing-masing lokasi yang berbeda. dan Tulung Agung). dan panjang total). Penelitian ini bertujuan untuk mengetahui keragaan pertumbuhan lobster air tawar (Cherax quadricarinatus) hingga mencapai ukuran 5-6 inci. Pertambahan bobot (71. namun kemampuan produksi para pembudidaya hanya sampai 4 inci.0±0. Dianalisis dengan Rancangan Acak Lengkap (RAL). pertumbuhan. dan panjang total tiap individu. ragam. Benih-benih Cherax quadricarinatus ukuran 3 inci dari 3 lokasi yang berbeda (dari Tangerang. Bogor. simpangan baku. dan Iskandariah Balai Riset Perikanan Budidaya Air Tawar. panjang standar. benih.6±10. Bogor ABSTRAK Perkembangan pembenihan lobster air tawar tidak dibarengi dengan peningkatan teknologi budidaya yang menyebabkan terhambatnya produksi lobster untuk kebutuhan konsumen.6-7. dipelihara dengan kepadatan sama dan dalam waktu yang sama dengan menggunakan 3 ulangan. Diberi pakan pelet udang kandungan protein 40% sebanyak 3%-10% dari bobot biomassa/ hari dan diamati populasi mana yang paling cepat mencapai ukuran 5-6 inci. Sampling dilakukan dua minggu sekali untuk mendapatkan data bobot badan. Ukuran lobster yang dikehendaki konsumen adalah ukuran 5-6 inci.6-71.74) dan panjang (7.47) terbaik adalah benih lobster air tawar asal Tangerang. sebanyak 25 ekor betina dan 25 ekor jantan dipelihara di kolam ukuran 5 m2. Sintasan terbaik adalah benih lobster air tawar asal Bogor (55. Hasil pengamatan selama 3 bulan dari ketiga lokasi menunjukkan adanya pertambahan panjang sebesar 6.0 cm dan adanya pertambahan bobot sebesar 58. KATA KUNCI: Cherax quadricarinatus.9 g. Gleni Hasan Huwoyon. lokasi .

squamata. dilakukan dengan menerapkan 4 perlakuan pemberian pakan. Sargassum. dan Sargassum sp. yaitu: (A) Gracilaria sp. KATA KUNCI: Haliotis squamata. (P<0.16 g dan -86. Perpaduan kandungan asam lemak pakan kombinasi antara Gracillaria sp.05) antar perlakuan.52 µg/hari) dan terendah pemberian pakan Sargassum sp. Hasil penelitian menunjukkan bahwa rata-rata pertumbuhan bobot mutlak dan laju pertumbuhan bobot harian berbeda nyata (P<0..82 µg/hari). masing-masing 58. Hubungan panjang-bobot abalon dengan pemberian pakan (A) menghasilakan R² = 0.05 mm dan 10. (D) Kombinasi Gracilaria sp.50 g dan 217.07 mm dan Jenis rumput laut yang digunakan sebagai pakan abalon adalah Gracilaria. (5.59±2. dan C berturut-turut adalah 120.99 mm dan 36.Forum Inovasi Teknologi Akuakultur 2010 M 01 PEMATANGAN GONAD INDUK ABALON. Gondol ABSTRAK Teknologi pembesaran abalon telah dilakukan dengan memanfaatkan rumput laut hasil budidaya masyarakat pesisir. Pergantian air menggunakan sistem sirkulasi dengan debit 5-6 liter per menit.06 µg/hari). Hasil yang dicapai pada akhir ujicoba untuk pertumbuhan panjang dan bobot yuwana abalon adalah dengan pakan (A)= Gracilaria: 41.18 mm dan 7. Tujuan ujicoba ini adalah agar dapat memanfaatkan rumput laut yang telah dibudidaya masyarakat pesisir dalam pembesaran yuwana abalon..68 µg/hari). Bambang Susanto. 73.56 ± 48. Penelitian bertujuan untuk mengetahui pengaruh berbagai makroalga sebagai pakan terhadap perkembangan gonad abalon Haliotis squamata.06 ± 170. Induk abalon dipelihara dalam unit-unit percobaan menggunakan 12 buah kontainer plastik berlubang ukuran 0.0 ± 0.613. cottonii : 40.39 g. Ibnu Rusdi.31 m. + Ulva sp. serta pakan (C)= kombinasi Gracilaria + E.73 g.9 ± 1.03 ± 1.39 mm dan 10. (13.23 g dan 121.854. Ulva.00 µm dan 38. E. perkembangan gonad M 02 APLIKASI TEKNOLOGI PEMBESARAN ABALON (Haliotis squamata) DALAM MENUNJANG PEMBERDAYAAN MASYARAKAT PESISIR Bambang Susanto.1 ± 4. Laju pertumbuhan panjang dan bobot harian untuk ujicoba A. (13. I Nyoman Adiasmara Giri. dan pakan (C) dengan R² = 0. Digunakan yuwana abalon dengan ukuran panjang cangkang awal 30. cottoni.44 µm .19 ± 6.17 ± 2.58 m x 0.39 m x 0. Setiap kontainer berisi abalon sebanyak 10 ekor dengan ukuran rata-rata panjang.73±2.44 µg serta 92. Riani Rahmawati.02 g.06 g. dan kombinasi keduanya.37 mm. yaitu pada perlakuan pemberian pakan Gracilaria sp. Semua kontainer ditempatkan dalam sebuah bak semen ukuran 3 m x 2 m x 1 m.05). + Ulva sp. Biota uji dari masing-masing perlakuan diberi pakan dengan dosis 15%–20% dari bobot biomassa diberikan setiap 2 hari sekali.92 g dan 219. (C) Sargassum sp.17 ± 25. + Sargassum sp. sangat sesuai dalam memacu pematangan gonad induk abalon H. Haliotis squamata MELALUI PENGELOLAAN PAKAN Ibnu Rusdi.44 µg.891.44 ± 102. Penelitian dirancang menggunakan rancangan acak lengkap masing-masing dengan 3 ulangan. B. dan I Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. (rasio 1:1:1).89 µm dan 38. Riani Rahmawati. kombinasi Gracilaria sp. + Ulva sp. Gondol ABSTRAK Abalon bersifat herbivora yang di alam memakan berbagai jenis makroalga. 38. Ulva sp. cottonii 37. + Sargassum sp. Tingkat kematangan gonad (TKG) induk abalon pada hari ke-70 diperoleh TKG III tertinggi dihasilkan pada perlakuan kombinasi Gracilaria + Ulva sp..80 sampai 31. Gracilaria.26 ± 10. (B) Ulva sp. (7. lebar dan bobot cangkang. pakan (B)= E. dan Tatam Sutarmat Balai Besar Riset Perikanan Budidaya Laut. pakan (B) dengan R² = 0. + Sargassum sp.

KATA KUNCI: abalon Haliotis squamata.dan 65. aplikasi teknologi pembesaran .44 µg. Pembesaran abalon dapat memanfaatkan jenis rumput laut yang dibudidaya oleh masyarakat pesisir.

dan 60/40% (C) sebagai perlakuan.Forum Inovasi Teknologi Akuakultur 2010 M 03 EVALUASI KERAGAMAN GENETIK ABALON (Haliotis squamata) INDUK ALAM DAN TURUNANNYA Fahrudin./Ulva sp. dan Bambang Susanto Balai Besar Riset Perikanan Budidaya Laut. dan Ulva sp. Tatam Sutarmat. hal ini disebabkan oleh adanya genetic drift (penghanyutan gen) yang terjadi pada dalam proses pembenihan di hatchery. Setelah 3 bulan pemeliharaan dilakukan penjarangan sehingga kepadatan abalon menjadi 190 ekor per unit percobaan. wild. dalam pakan meningkatkan pertumbuhan abalon dan menurunkan konversi pakannya. mengingat permintaannya yang cukup tinggi. 80/20% (B). Pada penelitian ini digunakan baskom plastik berdiameter 42 cm. Kepadatan awal benih abalon adalah 450 ekor per wadah. Nilai variasi genetik induk abalone asal Banten (0. Gondol ABSTRAK Abalon merupakan salah satu spesies laut yang memiliki prospek cukup baik untuk dikembangkan. peluang pasar serta teknik budidayanya yang sederhana.2 g dan panjang cangkang 2. Setiap perlakuan terdiri atas 2 ulangan. Setiap bulan dilakukan pengukuran bobot dan panjang cangkang sebanyak 25 ekor contoh abalon dari setiap unit percobaan. Untuk mendukung kegiatan tersebut perlu pula diketahui tentang data variasi genetik dalam budidaya abalon itu sendiri. Gpi*. genetic monitoring. pembesaran. Ibnu Rusdi. Hasil penelitian menunjukan bahwa dari 8 enzim yang dianalisa terdeteksi 15 lokus dan 7 lokus diantaranya bersifat polimorfik yaitu Pgm*. offsprings M 04 PEMBESARAN ABALON Haliotis squamata DI KARAMBA JARING APUNG DENGAN PROPORSI PAKAN RUMPUT LAUT YANG BERBEDA DAN SISTEM PENJARANGAN I Nyoman Adiasmara Giri. Benih abalon yang digunakan berasal dari pembenihan di hatcheri yang telah diadaptasikan pada lingkungan karamba dengan pakan Gracilaria sp. Usaha budidaya abalon mempunyai prospek yang baik terkait dengan harga. Gusti Ngurah Permana dan Haryanti Balai Besar Riset Perikanan Budidaya Laut. dilakukan penelitian yang bertujuan untuk mengetahui teknik budidaya abalon yang efektif dan efesien terkait dengan pemanfaatan pakan dan kepadatan. Penelitian dilakukan di Laboratorium Bioteknologi Balai Besar Riset Perikanan Budidaya Laut. dengan proporsi yang berbeda Gracilaria sp.52. 60/40% memberikan pertumbuhan abalon terbaik. Est-4* dan Cah-3*. Sampel yang digunakan berasal dari Bali dan Banten. Pakan dengan proporsi Gracilaria sp. tinggi 22 cm. Untuk itu. Tujuan penelitian adalah untuk mengetahui keragaman genetik abalon induk alam dan turunannya. KATA KUNCI: allozyme. Est-2*. Hasil percobaan menunjukkan bahwa meningkatnya proporsi Ulva sp. KATA KUNCI: abalon Haliotis squamata. Analisa sampel dilakukan dengan teknik allozyme elektroforesis dengan 8 enzim. Hirmawan Tirta Yudha. dan Ulva sp. Tingkat reduksi hetrosigositas turunan dari kedua induk alam tersebut berkisar antara 42 dan 53 %. Abalon diberi pakan rumput laut Gracilaria sp. Gondol ABSTRAK Abalon merupakan hewan laut bersifat herbivora dan memanfaatkan rumput laut sebagai makanannya. 100/0% (A). dengan bobot awal 2.06). Est-1*. Gondol. Satu wadah percobaan terdiri atas 3 buah baskom yang disusun vertikal. proporsi pakan. Est-3*. penjarangan . Penurunan kepadatan abalon dalam wadah percobaan setelah 3 bulan pemeliharaan juga memberikan respons meningkatnya laju pertumbuhan./Ulva sp.6-3. dimasukkan dalam kantong jaring dan digantung pada rakit sehingga wadah berada pada kedalaman 4 m di bawah permukaan air.13) lebih tinggi dibandingkan dengan induk asal Bali (0.7 cm.

Vibrio cincinnatiensis. Dari penelitian diperoleh 3 isolat vibrio dan berdasarkan karakternya ketiga isolat diidentifikasi sebagai Vibrio cincinnatiensis.55 mm (perlakuan C). Suatu penelitian untuk mengetahui tingkat patogenisitas bakteri Vibrio terhadap yuwana abalon (H. Sintasan yang diperoleh untuk perlakuan A.69%.33%. dan 46.05) dibandingkan dengan perlakuan C. Gondol.42%. 0. Gondol ABSTRAK Pembenihan abalon dari spesies Haliotis squamata baru di mulai beberapa tahun belakangan ini. Oleh karena itu. DAN UJI PATOGENISITAS BAKTERI VIBRIO YANG DIISOLASI DARI LARVA ABALON SAKIT DI HATCHERI Zafran.37±0.46±0.Forum Inovasi Teknologi Akuakultur 2010 M 05 ISOLASI. Apri I.05 µm). Indah Mastuti. dan C berturut-turut 37.33% .03 mm/hari (perlakuan B) dan 0. Bali. Perlakuan A dan B menghasilkan pertumbuhan yang lebih tinggi (P<0. Haliotis squamata. uji patogenisitas M 06 PENDEDERAN TIRAM MUTIARA (Pinctada maxima) DENGAN PERBEDAAN UKURAN TEBAR AWAL Sudewi. sedangkan mortalitas pada kelompok kontrol hanya 3. pertumbuhan. untuk memperoleh pertumbuhan dan sintasan yang baik.01 mm/hari (perlakuan C). 0. Supii.44 mm (perlakuan A). vibriosis. squamata) telah dilakukan di laboratorium patologi Balai Besar Riset Perikanan Budidaya Laut. Namun.30±0. Gondol ABSTRAK Kesuksesan budidaya tiram mutiara (Pinctada maxima) ditunjukkan dengan tingginya sintasan.44±0. Parameter yang diamati adalah laju pertumbuhan harian dan sintasan. sintasan. KATA KUNCI: abalon.36±0. dan Ibnu Rusdi Balai Besar Riset Perikanan Budidaya Laut. 71. dan Yasmina Nirmala Asih Balai Besar Riset Perikanan Budidaya Laut. KARAKTERISASI. penebaran spat ke laut sebaiknya pada ukuran panjang cangkang ±10 mm. 18. Uji virulensi dilakukan dengan cara menginfeksikan isolat bakteri dengan berbagai kepadatan (konsentrasi akhir 103–106 CFU/mL) terhadap masing-masing 20 ekor yuwana abalon yang dipelihara dalam stoples kaca berisi 1 L air laut yang sudah disaring dengan ultra-membran filter (0. Setiap perlakuan diulang 3 kali. KATA KUNCI: Pinctada maxima. yaitu media spesifik untuk bakteri Vibrio. Rata-rata mortalitas setelah tiga hari pemeliharaan untuk isolat-1. B. Tahap pertama dari peneltian ini adalah mengisolasi bakteri Vibrio dari yuwana abalon sakit menggunakan media Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar.01 mm/hari (perlakuan A).1 mm (perlakuan B). tidak heran masih sering terjadi kematian abalon secara massal tanpa diketahui penyebabnya. 10. Hasil penelitian menunjukkan bahwa laju pertumbuhan panjang cangkang 0.16%. Penelitian ini bertujuan untuk mengetahui pengaruh ukuran tebar awal terhadap pertumbuhan dan sintasan tiram mutiara pada masa pendederan. masih terdapat kendala yaitu sintasan benih yang lebih rendah daripada tiram mutiara dewasa. Laju pertumbuhan lebar cangkang 0.67%. Karena itu.03 mm/hari (perlakuan B) dan 0. Hasil uji virulensi menunjukkan bahwa ketiga isolat patogen pada yuwana abalon.44±0.4±0. Bakteri yang tumbuh dominan selanjutnya dimurnikan dan diidentifikasi berdasarkan uji biologis dan biokimia. Pengamatan dilakukan terhadap kematian larva selama 3 hari pemeliharaan.01 mm/hari (perlakuan A).00 mm/hari (perlakuan C).27±0. dan 20. dan 21. Penelitian ini menggunakan Rancangan Acak Lengkap (RAL) dengan tiga perlakuan dan tiga ulangan.33%.85±0. ukuran awal spat . Perlakuan yang diberikan adalah ukuran tebar 3. dan isolat-3 pada perlakuan kepadatan bakteri 106 CFU/mL adalah 13. isolat-2.

Lokasi usaha budidaya yang sangat baik adalah Teluk Dedari. tiram mutiara. Pemilihan lokasi harus menghindari muara sungai untuk menghindari pencemaran serta fluktuasi sifat–sifat fisika air laut yang ekstrim akibat pengaruh aliran sungai.Forum Inovasi Teknologi Akuakultur 2010 M 07 KAJIAN POTENSI KELAUTAN UNTUK BUDIDAYA TIRAM MUTIARA (Pinctada maxima) DI WILAYAH PESISIR KABUPATEN JEMBRANA-BALI Apri I. pada tingkat nasional. budidaya dapat dilakukan pada jarak minimal 1 km dari bibir pantai. Gondol **) Fakultas MIPA Universitas Udayana ABSTRAK Ketersediaan data dan peta tentang potensi kelautan dan perikanan di wilayah pesisir Kabupaten Jembrana dapat digunakan sebagai dasar dalam merumuskan strategi dan kebijaksanaan pembangunan. Ida Ayu Astarini**). dan Teluk Rabu. akan tetapi jika diinginkan. tidak disarankan untuk pengembangan usaha tiram mutiara karena merupakan kawasan industri pengalengan ikan. Supii*). Tujuan umum dari kajian ini adalah mengidentifikasi wilayah pesisir Kabupaten Jembrana yang berpotensi untuk pengembangan tiram mutiara. Pantai Pengambengan khususnya. secara umum daerah pesisir Jembrana dari Teluk Rening ke arah barat hingga Teluk Rabu layak untuk usaha budidaya tiram mutiara. Sumber Sari. regional maupun lokal. KATA KUNCI: potensi kelautan. Pengkajian dilakukan dengan metode eksplorasi dan wawancara. Jembrana . Teluk Awen. dan Sudewi*) *) Balai Besar Riset Perikanan Budidaya Laut. Lokasi pesisir Jembrana dari Perancak ke arah timur kurang baik untuk pembudidayaan tiram mutiara karena merupakan samudera lepas (ocean) dengan arus dan ombak yang kuat. Lokasi Munduk Asem dan Tanjung Pasir kurang sesuai untuk lokasi budidaya tiram mutiara. Berdasarkan hasil pengkajian. Pinctada maxima.

verrucosa. alvarezii yang dibudidayakan dengan metode vertikultur tidak berbeda antar perlakuan kedalaman 0. kandungan keraginan.1%. Tujuan penelitian ini adalah mengetahui performansi pertumbuhan dan kandungan keraginan rumput laut. Hasil penelitian menunjukkan bahwa pertumbuhan dan kandungan keraginan rumput laut. Kappaphycus alvarezii dengan aplikasi metode budidaya vertical line (vertikultur). 3 m. Sedangkan jumlah tunas dalam stoples (7. dan Emma Suryati Balai Riset Perikanan Budidaya Air Payau.50) lebih banyak dibandingkan dalam botol (7. jumlah tunas dan jumlah cabang dilakukan pada akhir penelitian. yakni 0. sedangkan stoples diisi eksplan dengan kepadatan 500/1000 mL dan diberi aerasi. KATA KUNCI: Kappaphycus alvarezii. Jawa Tengah.6 juta ton per tahun sekarang ini menjadi 7. kepadatan eksplan.Forum Inovasi Teknologi Akuakultur 2010 LL 1 PERFORMANSI PERTUMBUHAN DAN KANDUNGAN KERAGINAN RUMPUT LAUT (Kappaphycus alvarezii) DENGAN APLIKASI METODE BUDIDAYA VERTIKULTUR Petrus Rani Pong-Masak dan Muhammad Tjaronge Balai Riset Perikanan Budidaya Air Payau. Botol diisi eksplan dengan kepadatan 100/200 mL dan diletakkan di atas shaker.70%) daripada botol (90.20. dan 5 m dari permukaan perairan.70 dibandingkan dalam botol yang hanya 6. KATA KUNCI: botol.75% dibandingkan dengan metode long line dengan tidak mempengaruhi kandungan keraginan. Rosmiati. Maros ABSTRAK Produksi rumput laut ditargetkan meningkat dari 2. 2 m. sehingga sangat dibutuhkan dukungan paket teknologi budidaya yang dapat diadopsi dan secara signifikan dapat meningkatkan produktivitas usaha masyarakat pembudidaya. Maros ABSTRAK Perbanyakan rumput laut (Gracilaria verrucosa) dengan kultur jaringan telah dilakukan.03). 4 m. vertikultur LL 2 PERBANYAKAN RUMPUT LAUT (Gracilaria verrucosa) DENGAN KULTUR JARINGAN MENGGUNAKAN WADAH YANG BERBEDA Siti Fadilah. 1 m. pertumbuhan. di mana setiap perlakuan dilakukan pengulangan sebanyak 3 kali.40 mm pada stoples dan 2.3 m. Perlakuan adalah kedalaman penanaman bibit secara vertikal bertingkat dari permukaan perairan.6 juta ton per tahun pada 2014. Media diganti setiap minggu selama 8 minggu dan kelangsungan hidup diamati setiap minggu. metode vertikultur rumput prospektif diaplikasikan untuk meningkatkan produktivitas lahan budidaya sampai dengan 468. stoples . Rumput laut juga dianalisis kandungan keraginannya pada setiap perlakuan masingmasing dengan 3 kali ulangan. Kappaphycus sp. Penelitian ini bertujuan untuk mengetahui pengaruh penggunaaan wadah yang berbeda dalam kultur jaringan rumput laut G. dan 5 m. Umumnya pembudidaya rumput laut. Rumput laut pada setiap kedalaman perlakuan diukur pertumbuhannya pada awal dan setiap interval waktu 15 hari selama 75 hari pemeliharaan. Tetapi belum ada informasi mengenai penggunaan wadah yang berbeda dalam kultur jaringan rumput laut.3 m. 3 m. Pengamatan panjang tunas.1. Hasil penelitian menunjukkan bahwa sintasan eksplan pada stoples lebih rendah (81.42 mm pada botol. K. mengaplikasikan metode long line. Rumput laut dikumpulkan dari Kabupaten Brebes. 1 m. Talus rumput laut yang berukuran 1 cm disterilisasi dengan Betadine 1% dan campuran antibiotik 0. Jumlah cabang lebih banyak dalam stoples yaitu mencapai 26. 3. 4 m.75%). 2 m. Oleh karena itu. Data yang diperoleh dianalisis ragam dengan bantuan perangkat lunak statistik ver. Panjang tunas pada kedua wadah tidak berbeda jauh yaitu 2. di mana hanya bagian permukaan perairan saja yang menjadi lahan budidaya. Eksplan diinokulasi ke dalam media cair yang diperkaya PES.

Serpong ABSTRAK Transgenesis adalah rekayasa genetik melalui transfer gen yang bertujuan untuk mengintroduksikan gen penyandi protein yang mengkodekan suatu karakter seperti perbaikan pertumbuhan. Aktivitas promoter ditentukan dengan menganalisis tingkat ekspresi gen GFP menggunakan mikroskop fluoresen. Institut Pertanian Bogor ***) Departemen Biologi Tumbuhan-FMIPA. Rosmiati.Irvan Faizal****). dan perbaikan kualitas daging ikan/udang atau karagenan rumput laut. Fadilah. Kappaphycus alvarezii (DOTY) MELALUI HIBRIDISASI DAN FUSI PROTOPLAS SECARA IN VITRO Emma Suryati.5 mili/second. daya tahan penyakit. . mulai berpendar jam pertama – kedua setelah elektroporasi (s. cytomegalovirus/ CMV. KATA KUNCI: Kappaphycus alvarezii. Fusi protoplas dilakukan dengan cara kimia yaitu melalui mediasi dengan PEG 6000 dalton yang dipelihara pada media kultur cair dan semi solid. panjang kejutan: 0. persentase sel berpendar rata-rata 10%. dan keratin) ditransfer ke embriogenik somatik rumput laut dengan metoda elektroporasi menggunakan gen pulsher (BIO RAD) dengan voltase: 300 V/cm. Maros ABSTRAK Upaya perbaikan mutu genetika rumput laut dilakukan dalam rangka menunjang program pemerintah untuk meningkatkan kualitas dan produksi rumput laut pada umumnya. transgenesis. Isolasi protoplas dilakukan dengan cara kimia yaitu dengan melisis jaringan rumput laut dengan campuran enzim selulase dan macerozim dengan beberapa perbandingan. Promoter CMV dan metode elektroporasi dapat digunakan untuk produksi rumput laut transgenik. Sebagai tahap awal dalam rangka produksi rumput laut transgenik. Pola ekspresi keempat promoter relatif sama. ZPT. Fusan yang diperoleh memperlihatkan pertumbuhan yang optimum pada media yang diperkaya dengan IAA dengan konsentrasi 0.e dan stabil setelah jam ke9 sampai ke-12 s. Hasil penelitian menunjukkan bahwa CaMV memperlihatkan intensitas pendaran kuat. intensitas pendaran sedang dengan jumlah sel berpendar rata-rata 5%– 10%. penelitian ini bertujuan menguji aktivitas dan keberhasilan transfer gen GFP (green fluorescent protein) sebagai penanda. Utut Widyastuti***).1 second. Balai Riset Perikanan Budidaya Air Payau. puncak jam ketiga – keenam s. Rajamuddin*). Alimuddin**). promoter. Makassar **) Departemen Budidaya Perairan-FPIK. Institut Pertanian Bogor ****) Laboratoria Pengembangan Teknologi Industri Agro dan Biomedika (LAPTIAB) . ekspresi gen LL 4 PERBAIKAN MUTU GENETIKA RUMPUT LAUT.e). CMV jumlah sel berpendar rata-rata 40% dengan intensitas pendaran sedang dan lemah. dan Komar Sumantadinata**) *) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Empat jenis konstruksi gen yang dikendalikan oleh 4 jenis promoter berbeda (cauliflower mosaicvirus/CaMV. Kappaphycus alvarezii Muh. jumlah kejutan: 4 kali dan interval kejutan: 0. Keratin dan b-actin.e.4 mg/L dengan perbandingan penetrasi cahaya L:D = 12:12. b-actin. Hibridisasi merupakan salah satu cara yang dapat digunakan untuk menggabungkan dua varietas rumput laut yang berbeda dapat dilakukan melalui fusi protoplas. dan sumber karbon yang berbeda.Forum Inovasi Teknologi Akuakultur 2010 LL 3 AKTIVITAS PROMOTER DAN KEBERHASILAN TRANSFER GEN PADA RUMPUT LAUT. Larutan pencuci dan media kultur yang digunakan antara lain media conwy yang diperkaya dengan senyawa kalsium. Alias L. dan St.BPPT.

hibridisasi.KATA KUNCI: mutu genetik. kappaphycus alvarezii. fusi protoplas .

Erlania. Pandeglang . tujuan dari penelitian ini adalah mengkaji tingkat kelayakan wilayah pesisir Kecamatan Sumut. Buffering analisis dilakukan untuk membatasi areal budidaya pada kedalaman tertentu dan jarak terhadap kawasan konservasi dan kawasan wisata dan feature-feature pesisir unik lainnya. konservasi dan wisata). dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Penelitian telah dilakukan pada bulan Maret 2010 dimana pengumpulan data mencakup sampling kualitas air. kondisi sosek-ekonomi. Di kawasan peyangga (traditional use zone) Taman Nasisonal Ujung Kulon (TNUK). SIG. pembudidaya rumput laut. Untuk menjawab permasalahan budidaya dan konflik penggunaan ruang pesisir. wisata dan konservasi menjadi keluaran dari penelitian ini sebagai rekomendasi kepada pemerintah daerah Pandeglang. Provinsi Banten dan juga meminimalkan dampak negatif masing-masing aspek (budidaya rumput laut. rumput laut telah dikembangkan secara skala besar namun masih tradisional oleh masyarakat pesisir di Indonesia. Kabupaten Pandeglang. dan status wilayah kawasan. KATA KUNCI: rumput laut. Untuk itu. I Nyoman Radiarta. KAWASAN TAMAN NASIONAL UJUNG KULON MENGGUNAKAN SISTIM INFORMASI GEOGRAFIS Hatim Albasri. Pandeglang untuk pengembangan budidaya rumput laut dengan mengaitkan keberadaan kawasan konservasi dan kawasan wisata. Data primer diperoleh dengan pengukuran in situ dimana sampling stasiun ditentukan dengan menggunakan grid sampling sistem secara acak sehingga didapatkan 10 titik sampling. taman nasional ujung kulon. Data yang dikumpulkan kemudian dianalisis secara spasial dengan Sistem Informasi Geografis (SIG).Forum Inovasi Teknologi Akuakultur 2010 LL 5 STUDI KELAYAKAN BUDIDAYA RUMPUT LAUT DAN HUBUNGANNYA DENGAN EXISTENSI KAWASAN KONSERVASI DI KECAMATAN SUMUR. manajemen pengelolaan kawasan budidaya rumput laut menjadi hal yang penting dilakukan untuk menjamin keberlangsungan aktifitas budidaya rumput laut di Kecamatan Sumur. usaha budidaya rumput laut menjadi salah satu andalan bagi masyarakat lokal sebagai salah satu mata pencaharian tambahan. Rekomendasi pencegahan penyakit. Jakarta ABSTRAK Sebagai salah satu produk unggulan di sektor perikanan budidaya. khususnya di Kecamatan Sumur. dan pihak terkait lainnya untuk pemanfaatan kawasan ini yang memenuhi asas keberlanjutan dan ramah lingkungan. Permasalahan utama yang saat ini dialami di tingkat pembudidaya rumput laut adalah serangan penyakit rumput laut dan konflik spasial yang berkaitan dengan kawasan wisata dan kawasan konservasi TNUK. Pada umumnya. klasifikasi kesesuaian kawasan budidaya rumput laut dan manajemen ruang budidaya. parameter-parameter yang diukur menunjukkan kondisi yang optimal untuk rumput laut.

Induksi kalus dan embrio terjadi pada eksplan rumput laut pada minggu pertama yang ditandai dengan tumbuhnya filamen transparan.6%. Makassar **) Balai Riset Perikanan Budidaya Air Payau.0 mg/L.0 mg/L. dan 0. Maros ABSTRAK Pekembangan embrio somatik rumput laut Kappaphycus alvarezii (Doty) memperlihatkan keragaman morfologi yang berbeda pada setiap fase pertumbuhan sejak induksi hingga menjadi globular embrio yang dipelihara pada media semi solid.0%. Pembentukan anakan diawali dari filamen yang menyatu membentuk globular kemudian memajang dan menyatu menjadi embrio. dan Siti Fadilah Balai Riset Perikanan Budidaya Air Payau.Forum Inovasi Teknologi Akuakultur 2010 LL 6 KERAGAMAN MORFOLOGI EMBRIO SOMATIK PADA RUMPUT LAUT Kappaphycus lavarezii (DOTY) SELAMA PEMELIHARAAN PADA MEDIA CAIR DAN SEMI SOLID YANG DIPERKAYA DENGAN IAA Emma Suryati.8% agar yang diperkaya dengan zat perangsang tumbuh Indol acetic acid (IAA) 0. Pada tahap induksi kalus. Rajamuddin*).5:0. KATA KUNCI: keragaman. dan 1.4 mg/L.0% menghasilkan persentase induksi kalus tertinggi (90%). Rosmiati. Maros *) ABSTRAK Salah satu pendekatan yang dapat dilakukan untuk mengatasi permasalahan bibit yang tidak berkesinambungan pada budidaya rumput laut Kappaphycus alvarezii.8%).4% memperlihatkan perkembangan lebih tinggi (rata-rata diameter massa sel 4-5 mm).6%. Persentase sintasan eksplan pada induksi kalus masih rendah hanya sekitar 30%-40%.2 mg/L) dengan konsentrasi agar media induksi (0. 1.8% dan 1.0 mg/L. ZPT tidak berpengaruh signifikan terhadap perkembangan massa sel embriogenik tetapi pada konsentrasi agar 0. Pemeliharaan dilakukan selama 8 minggu. Pada media cair.0:1. kalus.0:0. Ridwan*).5 mm dapat dicapai dalam satu bulan kultur.1:1. dan 2. Tahap (2) adalah regenerasi massa sel embriogenik somatik. atau berwarna merah kecoklatan yang timbul pada permukaan jaringan atau kadang-kadang membentuk organ yang belum sempurna pada bagian lainnya. perkembangan sel-sel embriogenik somatik dari single cell ukuran 3-4 mm menjadi filamen-filamen ukuran rata-rata 0. Pada tahap regenerasi massa sel embriogenik. embriogenesis somatik . 0.6% dan 0. dan Emma Suryati**) Jurusan Budidaya Perikanan Politeknik Pertanian Negeri Pangkep. Penelitian ini terdiri atas dua tahap yaitu: Tahap (1) adalah induksi kalus dengan rasio ZPT asam indol asetat (IAA) : kinetin terdiri (0. embrio somatik.5%).8%. pada rasio IAA: kinetin (0. Alias L.1 mg/L) dengan konsentrasi agar (0. Andi Asdar Jaya*). Penelitian ini bertujuan untuk mengkaji kemampuan jaringan rumput laut membentuk kalus dan laju pertumbuhan kalus dengan beberapa konsentrasi agar media induksi dan rasio zat pengatur tumbuh (ZPT) serta mengevaluasi perkembangan sel sampai menjadi filamen. Keberhasilan produksi sel embriogenik somatik rumput laut dapat dijadikan acuan dalam menghasilkan rumput laut muda dan pada fase ini dapat dijadikan agen introduksi gen pada teknologi transgenesis. 0. Embrio dan filamen dapat dipindahkan pada media kultur yang baru agar dapat berkembang dengan baik. morfologi. adalah penyediaan benih hasil kultur jaringan melalui produksi embriogenesis somatik dari induksi kalus. 1. KATA KUNCI : Kappaphycus alvarezii. Perkembangan selsel embriogenik diamati pada kultur cair. Medium kultur yang digunakan adalah media Conwy semi solid dengan kepadatan 0. pengggantian media dilakukan setiap minggu dengan komposisi media yang sama. Kappaphycus alvarezii LL 7 KAJIAN INDUKSI KALUS RUMPUT LAUT Kappaphycus alvarezii UNTUK PRODUKSI EMBRIOGENESIS SOMATIK Muh. namun filamen dan embrio yang terbentuk dapat diperbanyak hingga menghasilkan anakan yang seragam dalam waktu yan bersamaan. 0.4%. rasio IAA : kinetin = 1:1 mg/L dengan konsentrasi agar media 0.0:0.

Metode yang digunakan dalam penelitian ini adalah metode eksperimen yaitu melakukan serangkaian percobaan pembuatan crakers serta menyusun formula crakers dengan berbagai tingkat penambahan tepung rumput laut. Produk crakers kesemua perlakuan pada umumnya memenuhi persyaratan SNI No. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. kadar abu. Kabupaten Mamuju LL 9 PENGARUH PERBANDINGAN KOMBINASI TEPUNG RUMPUT LAUT (KARAGENAN) DAN TEPUNG TERIGU DALAM PEMBUATAN PRODUK CRAKERS Dewita. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju dan peralatan survai lainnya. sedangkan strategi pengembangan budidaya rumput laut di Kabupaten Mamuju dituangkan dalam pengembangan.143. rasa.24 ha. Sedangkan manfaat penelitian ini adalah diharapkan dapat meningkatkan penggunaan tepung rumput laut dalam keanekaragaman konsumsi pangan dan meningkatkan kandungan gizi dari crakers. yaitu: perlakuannya A-0 (0% tepung rumput laut dan 100% tepung terigu). dan berpengaruh nyata terhadap rupa dan tekstur. denga metode budidaya tali panjang (long line). Pemanfaatan sistem informasi geografis dan survai lapangan merupakan metode pada penelitian ini. Dan berdasarkan uji organoleptik penambahan tepung rumput laut berpengaruh sangat nyata pada warna. Maros ABSTRAK Kabupaten Mamuju sebagai salah satu wilayah yang memiliki daerah pesisir pantai yang cukup luas. 01-2973–1992 dan SII 0177–1990. Mery Sukmiwati. Hasil penelitian menunjukkan bahwa luas areal budidaya rumput laut eksisitng dan potensi pengembangan di perairan Kabupaten Mamuju masing-masing 5. dan karbohidrat) dan uji organoleptik.13 ha dan 3. Produk crakers yang paling disukai oleh konsumen adalah crakers dengan penambahan tepung rumput laut 15% (A-1)dengan komposisi tepung rumput laut dan tepung terigu 15% dqn . Hasnawi.Forum Inovasi Teknologi Akuakultur 2010 LL 8 ANALISIS DATA DUKUNG STRATEGI PENGEMBANGAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. produksi pada tahun 2008 sebesar 750 ton. A-1 (15% tepung rumput laut dan 85% tepung terigu). A-2 (30% tepung rumput laut dan 70% tepung terigu). rumput laut. Tujuan penelitian ini adalah mengidentifikasi data dukung pengembangan rumput laut. lemak. KATA KUNCI: program-program pokok strategi pengembangan. Namun demikain kelembagaan masyarakat dan keuangan serta sarana prasarana masih perlu ditingkatkan. dan kadar karbohidrat) dan tidak berpengaruh nyata pada kadar protein. Parameter mutunya adalah kandungan zat gizi (air. menganalisisnya dan merekomendasikan suatu strategi pengembangan rumput laut di Kabupaten Mamuju. A-3 (45% tepung rumput laut dan 55% tepung terigu) dengan ulangan sebanyak tiga kali. memiliki potensi yang besar untuk dimanfaatkan sebagai wilayah pengembangan perikanan termasuk perikanan budidaya rumput laut (Kappaphycus alvarezii) guna menunjang kehidupan ekonomi masyarakat setempat. aroma.780. abu. dan Muamar Khadafi Universitas Riau ABSTRAK Penelitian ini bertujuan untuk mengetahui cara pembuatan crakers dengan penambahan tepung rumput laut serta pengaruhnya terhadap mutu crakers dan penerimaan konsumen terhadap crakers ini. protein. Namun demikian pembangunan perikanan budidaya rumput laut tersebut harus dilakukan dengan strategi yang tepat sebagai pedoman dalam upaya pengembangan budidaya rumput laut di Kabupaten Mamuju. Rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap (RAL) faktorial dengan satu faktor dengan empat taraf. Sehubungan dengan hal tersebut maka dalam menyusun strategi yang benar dan tepat dibutuhkan data dukung dan hasil analisisnya. Berdasarkan hasil penelitian didapat bahwa penambahan tepung rumput laut memberikan pengaruh yang sangat nyata pada kandungan gizi dari crakers (kadar air.

uji organoleptik . gizi.85%. KATA KUNCI: rumput laut. crakers.

pirit.28% dengan rata-rata 7.78% sehingga memiliki faktor konversi berturutturut sebesar 2. KATA KUNCI: kebutuhan kapur. Rachmansyah. Adang Saputra. Program ArcView 3. dilakukan penelitian yang bertujuan untuk menentukan distribusi kebutuhan kapur berdasarkan nilai tanah tambak agar produktivitas tambak di Kabupaten Mamuju dapat meningkat POS S dan berkelanjutan. Provinsi Sulawesi Barat telah ditetapkan sebagai salah satu Wilayah Pengembangan Kawasan Minapolitan di Indonesia. tambak. dan Anugriati Balai Riset Perikanan Budidaya Air Payau.36 dan 3. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya.15 dan 19.2 digunakan untuk pembuatan peta distribusi tanah.71 g/cm3 dengan rata-rata 0. pH F . Nilai netralisasi dan efisiensi netralisasi dolomit dan kaptan yang beredar di pasaran masing-masing 95. Perkembangan terknologi penginderaan jauh (inderaja) semakin memberikan peluang sekaligus tantangan untuk dimanfaatkan secara maksimal bagi pengelolaan sumberdaya perikanan budidaya.Forum Inovasi Teknologi Akuakultur 2010 LL 10 DISTRIBUSI KEBUTUHAN KAPUR BERDASARKAN NILAI S POS TANAH UNTUK TAMBAK TANAH SULFAT MASAM DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa.09 dan 90.29 ton/ha 3 CaCO dimana kebutuhan kapur yang tinggi dijumpai di bagian utara dan selatan Kabupaten Mamuju. S . bahan organik dan berat volume tanah. Penelitian ini bertujuan untuk melakukan analisis .614%.32 dan 113. Oleh karena itu. S . namun tanah tambaknya yang tergolong tanah sulfat masam yang dicirikan oleh pH tanah yang rendah serta potensi kemasaman dan unsur toksik yang tinggi dapat menjadi faktor pembatas dalam peningkatan produktivitas tambaknya.60 dan 36. Maros ABSTRAK Kabupaten Mamuju. Peubah kualitas tanah yang diukur adalah: pH . Kabupaten Mamuju LL 11 ANALISIS KELAYAKAN PERAIRAN UNTUK BUDIDAYA LAUT DI PROVINSI MALUKU: SUATU KAJIAN GLOBAL DENGAN MEMANFAATKAN DATA PENGINDERAAN JAUH DAN SISTEM INFORMASI GEOGRAFI I Nyoman Radiarta. Jakarta ABSTRAK Untuk mendukung peningkatan produksi budidaya laut yang berkelanjutan. tanah. Kapur S P KCl POSpertanian (kaptan) dan dolomit yang ada di pasaran diuji nilai netralisasi dan efisiensi netralisasinya untuk dipertimbangkan dalam penentuan faktor konversi dan kebutuhan kapur.02.30 dan 1. Kebutuhan kapur didasarkan pada tanah dengan POS nilai S mempertimbangkan berat volume tanah serta nilai netralisasi dan efisiensi netralisasi kapur. Hasil penelitian menunjukkan bahwa tanah tambak di Kabupaten Mamuju dicirikan oleh berat volume tanah berkisar antara 0. ketersediaan data dan informasi mengenai tingkat kelayakan perairan merupakan data dasar yang sangat penting. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju dengan metode survei. S POS . Kebutuhan kapur untuk tambak di Kabupaten Mamuju berkisar antara 1. .884 g/cm3 tanah berkisar antara POS dan S 0. berat volume tanah dan kebutuhan kapur dengan memanfaatkan citra POS S ALOS FOX AVNIR-2 akuisisi 28 Juli 2009.02% serta 44.

Hasil analisis menampilkan tingkat kelayakan perairan untuk tiga kategori budidaya laut yaitu: budidaya rumput laut. analisis spasial. budidaya ikan dalam keramba jaring apung (KJA) dan budidaya kekerangan. Analisis spasial dengan menggunakan SIG dilakukan dengan menggabungkan seluruh parameter penting yang mempengaruhi kegiatan budidaya laut.spasial potensi kawasan budidaya laut dengan menggunakan data penginderaan jauh (inderaja) dan sistem informasi geografis (SIG). KATA KUNCI: budidaya laut. klorofil-a dan suhu permukaan laut). Hasil penelitian ini diharapkan menjadi data dasar perencanaan lebih lanjut untuk mendukung pengembangan budidaya laut di Provinsi Maluku. Kajian global dalam penelitian ini dilakukan dengan memanfaatkan ketersediaan data yang diperoleh secara gratis melalui internet. SIG. inderaja. infrastruktur (jalan) dan sebaran penduduk. Maluku . Data utama yang digunakan meliputi: kondisi lingkungan perairan (kedalaman perairan.

analisis komoditas. Sukamandi ABSTRAK Kegiatan Iptekmas yang dilakukan pada tahun 2009 melalui kegiatan kaji terap yaitu Introduksi teknologi budidaya patin di tambak bersalinitas rendah telah dilakukan di Kabupaten Brebes. Namun demikian hasil dari beberapa identifikasi dengan menggunakan alat analisis. Tulisan ini bertujuan untuk mengidentifikasi potensi wilayah Kabupaten Gorontalo Utara dalam rangka pengembangan kawasan minapolitan. analisis komoditas unggulan dan andalan. hasil perhitungan analisa usaha dari kajiterap lebih baik dibanding budidaya udang dan bandeng yang saat ini diusahakan oleh pembudidaya. Metode analisis yang digunakan dalam penelitian ini analisis Location Quotient (LQ). dan analisis usaha perikanan. udang dan bandeng. Jakarta **) Pusat Riset Perikanan Budidaya. Dalam hal ini termasuk di wilayah Kabupaten Gorontalo Utara yang sebagian besar didominasi oleh sektor perikanan dengan mengembangkan kawasan minapolitan. rumput laut merupakan komoditas unggulan wilayah Kabupaten Gorontalo Utara. KATA KUNCI: produktivitas tambak. Introduksi kaji terap dilakukan dilahan seluas 2. Jakarta **) Pusat Riset Perikanan Budidaya. analisis location quotient. Wartono Hadie**). Adang Saputra**). udang. Jakarta ABSTRAK Dalam rangka mencapai visi dan misi Kementerian Kelautan dan Perikanan yaitu menjadi negara produsen perikanan terbesar di dunia pada tahun 2014 dan mensejahterakan masyarakat maka perlu dilakukan percepatan pembangunan perikanan dan pedesaan. Hasil dari kaji terap tersebut menunjukkan bahwa sintasan. ikan patin. Diharapkan dari hasil kegiatan ini dapat ditindaklanjuti dengan upaya pengembangan usaha budidaya minimal dalam satu siklus usaha dalam satu tahun dengan memilih ikan patin sebagai salah satu alternatif komoditas budidaya di tambak. Jakarta ***) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Untuk mengembangkan kawasan minapolitan perlu mengidentifikasi potensi wilayah tersebut. dan I Nyoman Radiarta**) *)Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan.Forum Inovasi Teknologi Akuakultur 2010 LL 12 IDENTIFIKASI POTENSI WILAYAH DALAM RANGKA PENGEMBANGAN MINAPOLITAN DI KABUPATEN GORONTALO UTARA Siti Hajar Suryawati*).400 m2 selama 3 bulan pemeliharaan. b a nd en g LL 13 PELUANG PENINGKATAN PENDAPATAN DENGAN PENINGKATAN PRODUKTIVITAS TAMBAK TERBENGKALAI (STUDI KASUS DI DESA BANGSRI KABUPATEN BREBES) Yayan Hikmayani*). dan Sularto***) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. Di samping itu. Hatim Albasri**). Kabupaten Brebes . Evi Tahapari***). peningkatan pendapatan. KATA KUNCI: minapolitan. tambak terbengkalai. rumput laut. konversi pakan serta pertumbuhan yang cukup baik. Hasil kajian menunjukkan bahwa wilayah Kabupaten Gorontalo Utara merupakan basis beberapa komoditas perikanan seperti: rumput laut.

4PO . nipah (Nypa fruticans). Marsambuana Pirzan. bakau. Hasil penelitian menunjukkan bahwa. Kualitas tanah yang diukur langsung di lapangan adalah pHF. bakau. Kabupaten Mamuju .75 m. A. N-total. . pada berbagai jenis penutup/penggunaan lahan di kawasan pesisir Kabupaten Mamuju dijumpai tanah sulfat masam yang diklasifikasikan sebagai Sulfaquent. tanah. TSA. Pengukuran dan pengambilan contoh tanah di kawasan pesisir Kabupaten Mamuju. Provinsi Sulawesi Barat dilakukan pada penutup/penggunaan lahan api-api (Avicennia alba). kelapa (Cocos nucifera).25 m dan 0. pH . pesisir. campuran vegetasi mangrove dan tanpa vegetasi (bekas vegetasi mangrove atau tambak). sagu (Metroxylon sagu). Maros ABSTRAK Lahan rawa di kawasan pesisir memiliki kondisi ekstrem sehingga jenis penutup/penggunaan lahan dapat bervariasi dan memiliki keragaman kualitas tanah. S .75 m tanah vegetasi api-api.50-0. Pada kedalaman 0-0. tanpa vegetasi. dan Kamariah Balai Riset Perikanan Budidaya Air Payau. penutup/penggunaan lahan. S . nipah. kelapa dan campuran memiliki kesamaan tetapi jenis-jenis penutup/penggunaan lahan tersebut memiliki ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut dan padi. Al dan tekstur. KCl KATA KUNCI: keragaman. campuran dan padi (Kelompok III) juga memiliki kesamaan akan tetapi kedua kelompok tersebut memiliki ketidaksamaan dan juga ketidaksamaan dengan jenis penutup/penggunaan lahan paku laut. rumput. nipah. TAA. masingmasing pada kedalaman tanah 0-0. kelapa dan tanpa vegetasi (Kelompok I) memiliki kesamaan dan tanah jenis penutup/penggunaan lahan sagu. sagu. pH dan potensial redoks. padi (Oryza sativa). sedangkan tanah jenis penutup/ penggunaan lahan paku dan padi juga memiliki ketidaksamaan atau keragaman. Pada kedalaman 0. rumput. bakau (Rhizophora apiculata). Oleh karena itu.Forum Inovasi Teknologi Akuakultur 2010 LL 14 KERAGAMAN KUALITAS TANAH BERDASARKAN JENIS PENUTUP/PENGGUNAAN LAHAN DI KAWASAN PESISIR KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Akhmad Mustafa. Analisis Kluster dengan Metode Hirarki atau Berjenjang digunakan untuk mengelompokkan jenis penutup/penggunaan lahan berdasarkan beberapa peubah kualitas tanah. pirit. TPA. Fe. OXS P KCl POS karbon organik. dilakukan penelitian yang bertujuan mengetahui keragaman kualitas tanah pada jenis penutup/penggunaan lahan berbeda yang didasarkan pada sekumpulan peubah kualitas tanah yang dianalisis statistik secara simultan. Hydraquent dan Sulfihemits untuk kategori Kelompok Besar.50-0. sedangkan yang dianalisis di laboratorium adalah pH FOX .25 m tanah jenis penutup/penggunaan lahan api-api. rumput. paku laut (Acrostichum aureum).

Maros ABSTRAK Klorofil memegang posisi kunci dalam reaksi fotosintesis yang menentukan produktivitas suatu perairan. fosfat. terdapat di Kecamatan Segedong dan Siantan. Pelaksanaan penelitian dengan melakukan pengukuran langsung di lapangan dan pengambilan contoh air untuk dianalisis di laboratorium. tersebar di wilayah pesisir Kecamatan Sungai Pinyuh. KATA KUNCI: kesesuaian lahan. amonia. Sungai Kunyit. dianalisis secara spasial dengan metode PATTERN menggunakan SIG.986 ha).000. tambak. Terdapat hubungan yang nyata antara kandungan klorofil-a dan oksigen terlarut. Sebagai peubah tidak bebas dalam penelitian ini adalah kandungan klorofil. nitrat. Berdasarkan hasil survei dan evaluasi kesesuaian budidaya tambak di wilayah pesisir Kabupaten Pontianak seluas 497. dan bahan organik total. kualitas air. Maros ABSTRAK Penelitian ini memanfaatkan teknologi Sistem Informasi Geografis (SIG) untuk menentukan lokasi yang layak bagi pengembangan budidaya tambak di Kabupaten Pontianak Kalimantan Barat. data sekunder.819 ha). nitrit. nitrat. Pontianak LL 16 HUBUNGAN ANTARA KUALITAS AIR DAN KANDUNGAN KLOROFIL DI TAMBAK KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Andi Marsambuana Pirzan dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. KALIMANTAN BARAT Utojo. dilakukan penelitian yang bertujuan untuk menelaah hubungan antara kualitas air dan klorofil-a. Tingkat produktivitas perairan dipengaruhi oleh bebagai faktor lingkungan baik yang bersifat fisik maupun yang bersifat kimia. sedangkan yang kurang sesuai (213. salinitas. pH. Oleh karena itu. dan data citra satelit digital. Penentuan stasiun pengamatan dilakukan secara acak dan sistematik.046 dan 22. walaupun dengan model regresi yang berbeda.398 µg/L. Sulawesi Barat . Pemilihan model regresi “terbaik” didasarkan pada metode kuadrat terkecil. peta Rupabumi Indonesia kawasan Pontianak skala 1 : 50. Akhmad Mustafa.000. dan fosfat. Pada umumnya yang tergolong sangat sesuai (114. Data sekunder yang diperoleh berupa data iklim. Data lapangan (fisiko-kimia air dan tanah). sedangkan peubah bebas adalah suhu. Data primer diperoleh dengan metode survei di lokasi penelitian yaitu kualitas air dan tanah serta pasang surut. Hasil penelitian menunjukkan bahwa kandungan klorofil-a di tambak Kabupaten Mamuju berkisar antara 0. nitrit. Setiap lokasi pengambilan contoh ditentukan posisi koordinatnya dengan alat Global Positioning System (GPS). oksigen terlarut. KATA KUNCI: klorofil.077 ha. cukup sesuai (168. pH. Mempawah Hilir dan Mempawah Timur. citra digital ALOS AVNIR-2 dan peta batimetri skala 1 : 200.272 ha). tambak. Penelitian dilaksanakan di kawasan pertambakan Kabupaten Mamuju Provinsi Sulawesi Barat.Forum Inovasi Teknologi Akuakultur 2010 LL 15 KESESUAIAN LOKASI PENGEMBANGAN BUDIDAYA TAMBAK DI KAWASAN PESISIR KABUPATEN PONTIANAK. dan Hasnawi Balai Riset Perikanan Budidaya Air Payau.047 dengan rata-rata 6. amonia.

. Jakarta. Jakarta ABSTRAK Penelitian umur dan kandungan minyak nabati mikroalga jenis Dunaliella sp. dan Nematoda. minyak nabati . dan BOD5. total bahan organik (TOM). Bogor ABSTRAK Penelitian menggunakan kolam berukuran 20 m2 dengan dasar berlumpur berjumlah 9. kecerahan.5 mg/L. Proses pengayakan termasuk penyeleksian. Perlakuan adalah perbandingan komposisi pupuk N:P yang berbeda yaitu 4:5. Sebagai perlakuan analisis kandungan minyak nabati digunakan cara ekstraksi minyak menggunakan pelarut hexana dan petroleumeter. Percobaan dirancang secara acak lengkap dengan 3 perlakuan dan 3x ulangan. pH. Pengamatan pertumbuhan sel dihitung kepadatan selnya setiap 2 hari sekali kemudian biomassa dipanen setiap 5 hari sekali untuk dianalisa kandungan minyaknya. Kultur ini ditempatkan diluar ruangan. Dunaliella... dengan menggunakan cara modifikasi (Banerjee et al. Indeks diversitas rendah (H’<1) dan komunitas makrobentos tidak beragam (E<0. Tidak terdapat perbedaan nyata (P>0.05) dari jenis dan jumlah makrobenthos dari kolam ikan dengan komposisi pupuk berbeda. 2006).. Chironomus sp. pupuk. telah dilakukan dilaboratorium Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan. Hasil identifikasi diperoleh 3 jenis makrobentos yaitu Limnaea sp. KATA KUNCI: makrobentos. Uji t digunakan untuk melihat perbedaan jenis dan jumlah spesies yang ditemukan.02–8. KATA KUNCI: mikroalga. Sampel makrobentos diambil dari setiap kolam secara mingguan dari masa persiapan sampai dengan masa pemeliharaan benih ikan Mas (Cyprinus carpio L. 5:4.). dilakukan di dalam bak. penghitungan kelimpahan.0 sel/mL. Spesies dominan adalah Limnaea sp. di Instalasi Riset Lingkungan Perikanan Budidaya Air Tawar dan Toksikologi di Cibalagung.bak ukuran 100 liter dengan 3 kali ulangan dengan menggunakan media air laut yang berkadar garam 25 ppt dan diberi pupuk Conwy. DO. Tujuan penelitian ini adalah mengetahui komposisi dan kelimpahan jenis makrobentos dalam kolam ikan dengan komposisi pupuk yang berbeda. Analisis kandungan minyak nabati Dunaliella sp. BERDASARKAN UMUR PERTUMBUHANNYA Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. diaerasi terus-menerus dan cahaya yang dibutuhkan digunakan sinar matahari sebagai proses fotosintesis. 2002 dan Dayananda et al. Hasil penelitian menununjukkan kandungan minyak tertinggi terdapat pada umur pertumbuhan 5 hari yaitu 4.75). dan 6:3. kolam. Analisis data dilakukan secara deskriptif untuk komposisi jenis. komposisi berbeda LL 18 PENELITIAN KANDUNGAN MINYAK NABATI MIKROALGAE JENIS Dunaliella SP. Secara uji statistik ekstraksi minyak nabati menggunakan perlakuan pelarut hexana dan petroleum menunjukkan hasil yang berbeda nyata. ekstraksi. Bogor. identifikasi. dan penghitungan dilakukan di laboratorium. Aplikasi pupuk dengan komposisi 6N:3P perlu diwaspadai karena memiliki kadar BOD5 8. indeks diversitas dan keseragaman spesies.00% dengan pelarut petroleumeter dengan pertumbuhan kepadatan sel = log 6. BRPBAT. Parameter kualitas air yang diamati adalah suhu. kemudian 6. Kultivasi Dunaliella sp.60% menggunakan perlakuan pelarut hexana.Forum Inovasi Teknologi Akuakultur 2010 LL 17 KOMPOSISI DAN KELIMPAHAN MAKROBENTOS DI KOLAM YANG DIPUPUK DENGAN KOMPOSISI BERBEDA Yohanna Retnaning Widyastuti dan Dewi Puspaningsih Balai Riset Perikanan Budidaya Air Tawar.

37.33 sel/mL pada sistem indoor dan 7. Pengambilan responden dilakukan secara purposive sampling terhadap masyarakat. artinya perlakukan perbedaan tersebut tidak memberikan pengaruh nyata pada faktor kelimpahan dan laju pertumbuhan biomassa mikroalgae spesies B. Dari hasil penelitian menunjukkan bahwa di Desa Merakan ketahanan pangan ikani masih rentan. Topografi Desa Merakan yang berada di dataran tinggi menyebabkan desa tersebut mendapatkan kesulitan untuk memperoleh sumber air.25/ hari pada indoor dan 3. dan pH. Penelitian ini bertujuan untuk mengetahui ketahanan pangan di desa rawan pangan dilihat dari konsumsi ikan.Forum Inovasi Teknologi Akuakultur 2010 LL 19 KETAHANAN PANGAN DI DESA RAWAN PANGAN DILIHAT DARI KONSUMSI IKAN STUDI KASUS DESA MERAKAN Rani Hafsaridewi dan Yayan Hikmayani Balai Besar Riset Sosial Ekononomi Kelautan dan Perikanan. sehingga untuk menjaga ketersediaan pangan ikani bergantung pada dearah lain. Jakarta ABSTRAK Beberapa daerah di Indonesia masih berstatus daerah rawan pangan. Penelitian dilakukan di lokasi yang dinyatakan rawan pangan oleh Badan Ketahanan Pangan. KATA KUNCI: ketahanan pangan. salinitas. laju pertumbuhan. Berdasarkan perhitungan statistik ANOVA. dengan skor 19. Kondisi lingkungan kultur diamati setiap hari yang meliputi suhu. braunii. Departemen Pertanian. Metode penelitian menggunakan metode survei. Pengolahan data dilakukan secara deskriptif. Upaya yang harus dilakukan agar Desa Merakan ini menjadi tahan pangan adalah dengan menjaga ketersediaan pangan dan juga stbilitas pangan di daerah tersebut. Selama pemeliharaan kelimpahan dan laju pertumbuhan dihitung setiap hari sampai mencapai fase konstan yaitu pada hari ke-12. konsumsi ikan LL 20 MEDIA KULTIVASI Botryococcus braunii DENGAN SISTEM INDOOR DAN OUTDOOR Rini Susilowati dan Sri Amini Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan Perikanan. Botryococcus braunii . salah satunya adalah Desa Merakan di daerah Jawa Timur. kedua faktor kelimpahan dan laju pertumbuhan yang dikultur pada kedua sistem media yaitu indoor dan outdoor tidak menunjukkan perbedaan yang nyata. Dari hasil penelitian ini diharapkan dapat menjadi masukan terutama kepada pemerintah daerah di lokasi untuk melihat potensi pengembangan usaha perikanan sebagai langkah keluar dari kondisi rawan pangan terutama dari sisi pemenuhan protein hewani dengan pemenuhannnya dari ikan. Jakarta ABSTRAK Kultur mikroalga spesies Botryococcus braunii telah dilakukan di dalam sistem indoor dan outdoor. rawan pangan. Sedangkan laju pertumbuhan tertinggi pada hari kedua berkisar 3.65/hari pada outdoor. Kelimpahan biomassa tertinggi pada hari ke-11 berkisar 7. Kultur pada sistem indoor dilakukan pada media berukuran 40 L dan 80 L pada sistem outdoor. 02 sel/mL pada sistem outdoor. KATA KUNCI: kepadatan.

pengelolaan bisnis. Isti Koesharyani. uji PCR. yaitu Balai Besar Pengembangan Budidaya Air Tawar (BBPBAT) Sukabumi. Dua isolate Aeromonas hydrophila lainnya tidak memiliki gen aerolysin. kemungkinan merupakan strain yang tidak pathogen. penanganan aspek teknis. Hambali Supriyadi dan Tatik Mufidah Pusat Riset Perikanan Budidaya. Jakarta ABSTRAK Berbagai UPT budidaya KKP mengembangkan unit usaha dengan berbagai tujuan diantaranya adalah melaksanakan pengembangan dan penerapan teknik perbenihan. gurame dan patin) yang menunjukkan gejala terinfeksi bakteri tersebut. Uji awal berupa pengecatan gram. Termasuk pengembangan model-model usaha yang dapat dicontoh dan diterapkan oleh masyarakat pada berbagai skala usaha. aerolysin dan primer spesifik . strategi pemasaran LL 22 APLIKASI DETEKSI Aeromonas hydrophila PENGHASIL AEROLYSIN DENGAN MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR) Lila Gardenia. hanya isolate AH-26 yang mempunyai gen aerolysin penghasil toksin. KATA KUNCI: unit usaha. Infeksi bakteri. Hasil analisa PCR dengan menggunakan universal primer menunjukkan 3 isolat merupakan bakteri Aeromonas hydrophila. Sampel bakteri diambil dari beberapa jenis ikan budidaya yang rentan terhadap infeksi Aeromonas hydrophila (lele. Sedangkan dengan menggunakan spesifik primer. sehingga AH-26 merupakan isolat yang pathogen. pembudidayaan. selain dapat menyebabkan kematian masal juga merusak mutu ikan yang terinfeksi dan sangat merugikan pembudidaya. Penelitian dilakukan dengan pendekatan studi kasus pada tahun 2009 di beberapa lokasi UPT lingkup Direktorat Jenderal Perikanan Budidaya. penanganan aspek teknis. profitabilitas. Hasil kajian menunjukkan bahwa dengan mempertimbangkan berbagai aspek seperti profitabilitas. Dari pelaksanaan unit-unit usaha tersebut dapat dipetik berbagai pelajaran penting. Pada penelitian ini dilakukan uji PCR dengan primer universal 16S rDNA Aero-1/Aero-2 dan primer spesifik untuk identifikasi gen aerolysin AeroFd/AeroRs. pengelolaan bisnis dan strategi pemasaran yang dilakukan ternyata pengembangan perikanan yang diarahkan pada kegiatan budidaya memiliki potensi ekonomi berupa keunggulan komparatif dan kompetitif yang menjanjikan dan dapat memberikan kontribusi besar dalam pelestarian lingkungan. yang dapat digunakan sebagai acuan untuk strategi pengembangan usaha di kalangan masyarakat budidaya. Tujuan penelitian ini adalah mengaplikasikan metode deteksi cepat dan tepat dengan teknik PCR untuk mendiagnosa penyakit yang disebabkan oleh infeksi bakteri Aeromonas hydrophila penghasil aerolysin. tes katalase dan oksidase dilakukan sebelum uji PCR. pengelolaan kesehatan ikan dan pelestarian perlindungan budidaya ikan. Balai Layanan Usaha Produksi Perikanan Budidaya (BLUPPB) Karawang. Bakteri merupakan salah satu penyebab penyakit pada ikan. Jakarta ABSTRAK Meningkatnya kegiatan intensifikasi budidaya telah menimbulkan dampak negatif antara lain munculnya berbagai kasus infeksi penyakit.Forum Inovasi Teknologi Akuakultur 2010 LL 21 POTENSI EKONOMI SEGMEN-SEGMEN USAHA BUDIDAYA – PELAJARAN DARI KOMERSIALISASI BERBAGAI UNIT USAHA UPT KEMENTERIAN KELAUTAN DAN PERIKANAN Siti Hajar Suryawati dan Agus Heri Purnomo Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. dan Balai Budidaya Laut (BBL) Ambon. KATA KUNCI: Aeromonas hydrophila.

860. periphyton. Bogor ABSTRAK Penelitian ini bertujuan untuk mendapatkan data kelimpahan dan keanekaragaman jenis periphyton pada kedalaman optimal di waduk Cirata Jawa Barat.91. Rata-rata total kelimpahan komunitas perifiton dan indeks keragaman Simpson tertinggi diperoleh pada perlakuan C (Perendaman substrat dengan kedalaman 3m).81 (ind/cm2) dan 0. Perlakuan yang digunakan di dalam penelitian ini adalah kedalaman 1 meter(A). Ani Widiyati.Penelitian di laksanakan selama 15 hari pada bulan agustus 2009 di waduk cirata jawa barat. Waduk Cirata . yaitu 4423. Winarlin. KATA KUNCI: kedalaman. namun pada kedalaman 3 m hingga 4 m menunjukkan adanya perbedaan yang nyata untuk kelas Chlorophyceae.masing perlakuan 5 kali ulangan. Hasil penelitian yang dilakukan pada musim kemarau menunjukkan bahwa kelimpahan total perifiton tidak berbeda nyata pada setiap kedalaman.Forum Inovasi Teknologi Akuakultur 2010 LL 23 PENGARUH PERBEDAAN KEDALAMAN SUBSTRAT TERHADAP KELIMPAHAN DAN KEANEKA RAGAMAN JENIS PERIPHYTON DI WADUK CIRATA JAWA BARAT Kusdiarti. dan Reza Samsudin Balai Riset Perikanan Budidaya Air Tawar. kedalaman 3 meter(C) dan kedalaman 4 meter (D). kedalaman 2 meter (B). Masing.

Forum Inovasi Teknologi Akuakultur 2010 ABSTRAK PRESENTASI POSTER .

Majalaya. Strain Sutisna Kuningan secara umum memiliki sintasan yang baik. lebar 40 cm. Sidi Asih***). Jakarta **) Loka Riset Pemuliaan dan Teknologi Budidaya Periakanan Air Tawar. dan 12 ppt (11–15 ppt). Ikan uji berupa 4 strain ikan mas yaitu Rajadanu. Bogor *) ABSTRAK Uji ketahanan salinitas beberapa strain ikan mas di akuarium.masing perlakuan menggunakan 2 ulangan. Cianjur Wildan. Data primer diperoleh degan cara wawancara dengan menggunakan questioner yang tersetruktur. teknik seperti ini akan menimbulkan resiko cepatnya timbulnya wabah penyakit ikan. Jakarta ABSTRAK Usaha budidaya ikan di danau Maninjau telah mencapai tahapan intensifikasi. ikan nila. Sukamandi ***) Balai Riset Perikanan Budidaya Air Tawar. Danau Maninjau pFF 02 UJI KETAHANAN SALINITAS BEBERAPA STRAIN IKAN MAS YANG DIPELIHARA DI AKUARIUM Ongko Praseno*). dan tinggi 40 cm dengan ketinggian air 15 cm. KATA KUNCI: strain. perlakuan salinitas maupun strain tidak memberikan pengaruh yang nyata terhadap pertumbuhan mutlak ikan mas. Survey telah dilakukan dengan mengambil baik data primer maupun data dari hasil analisis sampel. ikan mas. KATA KUNCI: streptococcosis. dan Sutisna Kuningan. perbedaan strain tidak memberikan pengaruh nyata pada sintasan ikan mas. dan Achmad Sudradjat*) Pusat Riset Perikanan Budidaya. responden yang diambil adalah para pembudidaya ikan yang merupakan anggota kelompok budidaya. Selama percobaan ikan diberi pakan komersial dengan kandungan protein minimal 28% sejumlah 5%–7% bobot badan per hari. Akuarium yang digunakan berukuran panjang 60 cm. 8 ppt (6–10 ppt). sintasan. Selama 34 hari pemeliharaan didapatkan hasil bahwa perlakuan salinitas memberikan pengaruh yang nyata terhadap sintasan ikan mas. Kegiatan dilaksanakan di laboratorium Loka Riset Pemuliaan dan Teknologi Budidaya Air Tawar Sukamandi pada bulan Juni–Juli 2009. Hary Krettiawan*). salinitas. dimaksudkan untuk mengetahui ketahanan ikan terhadap beberapa tingkatan salinitas. telah banyak menginfeksi ikan nila. Salinitas yang digunakan adalah salinitas 4 ppt (0–5 ppt). Penelitian ini bertujuan untuk mengetahui keragaan penyakit streptococcosis yang ada diareal budidaya di danau Maninjau. sintasan terendah didapatkan pada salinitas 12 ppt.Forum Inovasi Teknologi Akuakultur 2010 pFF 01 STREPTOCOCCOSIS PADA IKAN NILA (Oreochromis niloticus) BUDIDAYA DI DANAU MANINJAU Hambali Supriyadi dan Lila Gardenia Pusat Riset Perikanan Budidaya. pertumbuhan . Hasil penelitian mengindikasikan bahwa penyakit Streptococcosis yang disebabkan oleh infeksi bakteri Streptococcus iniae. Masing.

termasuk jenis ikan karnivor. berdasarkan analisis usaha usaha budidaya ikan dalam KJA ganda cukup menguntungkan dan layak untuk dikembangkan. Upaya untuk memelihara ikan belida diluar habitat aslinya terkendala oleh penyediaan pakannnya. Berdasarkan hasil analisis data hasil dari wawancara dengan pembudidaya menunjukkan FCR ikan mas sebesar 1. pakan. ekonomi. KATA KUNCI: budidaya. Penebaran ikan nila dilakukan 3 bulan sebelum ikan belida ditempatkan. Jakarta ABSTRAK Ikan karnivor. Dari analisis usaha diketahui budidaya ikan dalam KJA ganda memerlukan investasi yang cukup tinggi. dan kalimantan.November 2009. Jawa. Budidaya ikan dalam KJA ganda perlu dikembangkan di Danau Maninjau untuk meningkatkan pendapatan pembudidaya dan mendukung budidaya berkelanjutan.53.64 sedangkan FCR total sebesar 1. dengan jangka waktu pengembalian modal selama 3. dan KJA ganda pFF 04 PEMELIHARAAN IKAN BELIDA BERBASIS PAKAN ANAKAN IKAN NILA Anang Hari Kristanto Pusat Riset Perikanan Budidaya. ikan belida yang banyak hidup di perairan umum Sumatera. Iwan Malhani Al’Wazan. adalah ikan yang mengkonsumsi ikan lain sebagai mangsanya.36. dan Dede Kurniawan Pusat Riset Perikanan Budidaya. perlu peran serta lembaga keuangan yang menyediakan dana untuk investasi awal. Budidaya dengan sistem KJA ganda ini terbukti mampu memberikan nilai tambahan produksi sebesar 4.Forum Inovasi Teknologi Akuakultur 2010 pFF 03 KAJIAN ASPEK TEKNIS DAN EKONOMIS BUDIDAYA IKAN DALAM KERAMBA JARING APUNG GANDA DI DANAU MANINJAU Rasidi. KATA KUCI: ikan belida. Budidaya ikan di KJA ganda merupakan salah satu alternatif budidaya yang dapat menekan biaya pakan. Persetanse ikan belida yang matang gonad terbanyak dijumpai di bulan september . Dalam hal dukungan dana permodalan. Jakarta ABSTRAK Kajian aspek teknis dan eknomis budidaya ikan dalam KJA di danau Maninjau telah dilakukan pada bulan September. Selama pemeliharaan diamati perkembangan tingkat kematangan gonadnya setiap bulan. Tujuan penelitian ini adalah untuk mengetahui kemampuan anakan ikan nila dalam mendukung perkembangan gonad ikan belida yang dipelihara dalam wadah budidaya. Pemeliharaan ikan belida dilakukan di kolam. yang diberi sekat jaring nilon hita.27% yang berasal dari ikan pada jaring bawah yang tidak diberi pakan selama pemeliharaan. Kegiatan ini bertujuan untuk mendapatkan gambaran teknis budidaya dan analisa usahanya sehingga dapat dirumuskan opsi kebijakan yang diperlukan dalam rangka pengembangannya. anakan ikan nila .20 siklus dan nilai RC ratio sebesar 1. Ikan nila dengan berat 40 kg (200 ekor) dengan rataan bobot 200 g ditempatkan dalam kolam bagian tengah dan ikan belida jantan dan betina dipelihara di bagian yang lain.

yang dikenal dengan nama PKM (palm kernel meal). adaptasi induk pada lingkungan kolam dan pemberian pakannya untuk pematangan induk. Induk yang memijah berjumlah 4 ekor jumlah telur yang diovulasikan berjumlah 111 butir dan berhasil di fertilisasi akan tetapi belum menghasilkan larva. Maggot dapat digunakan dalam campuran pelet ikan dan diberikan baik dalam bentuk pelet kering atau basah. Untuk menguasai teknologi domestikasinya. pelet maggot . Penggunaan pakan maggot dalam budidaya ikan nila akan dapat menekan biaya produksi sehingga produksi perikanan air tawar dapat ditingkatkan. Selama proses adaptasi pada kolam pemeliharaan. Budidaya ikan nila dapat dilakukan di kolam. Dalam kegiatan budidaya ikan. jaring tancap dan keramba jaring apung. hormon pemijahan pFF 06 PROSPEK BUDIDAYA IKAN NILA DENGAN PAKAN PELET MAGGOT Irsyaphiani Insan dan Anang Hari Kristanto Pusat Riset Perikanan Budidaya.Forum Inovasi Teknologi Akuakultur 2010 pFF 05 RESPONS INDUK IKAN BELIDA TERHADAP HORMON PEMIJAHAN Anang Hari Kristanto*) dan Jojo Subagja**) Pusat Riset Perikanan Budidaya. Jakarta **) Balai Riset Perikanan Budidaya Air Tawar. Bogor *) ABSTRAK Upaya untuk mendomestikasi ikan belida dimulai dari kegiatan pengumpulan calon induk yang berasal dari alam. pada penelitian ini dilakukan upaya penyuntikan menggunakan hormon ovarim. Budidaya maggot telah dikembangkan di daerah Jambi dengan menggunakan bahan baku hasil pengolahan kelapa sawit. Induk yang matang dipilih dan dilakukan pemijahan secara buatan. KATA KUNCI: ikan belida. Jakarta ABSTRAK Ikan nila merupakan komoditas air tawar yang mudah dibudidayakan dan juga mempunyai rasa yang cukup digemari oleh masyarakat. KATA KUNCI: ikan nila. kurang lebih 60% pengeluaran berasal dari pakan. palm kernal meal. pakan ikan merupakan komponen yang mempunyai biaya terbesar dalam skala usaha. Ikan nila termasuk ikan yang bersifat omnifora yang dapat memakan ikan-ikan kecil lainnya dan tumbuhan. pengecekan bulanan terhadap masing-masing induk diperoleh telur dan sperma.

ternyata juga diikuti oleh berjangkitnya berbagai jenis penyakit. 05) tidak mempengaruhi sintasan.5 m3 masing-masing sebanyak 3 bak untuk perlakuan vaksinasi vaksin bakteri dan 3 bak untuk kontrol. 25 – 1. Hasil penelitian menunjukkan bahwa pertambahan bobot tidak beda nyata (P>0. Hasil penelitian menunjukkan bahwa titer antibodi kelompok ikan yang divaksin lebih tinggi (1/64) dibanding kontrol (1/4). Gondol ABSTRAK Kerapu macan (Epinephelus fuscoguttatus) merupakan salah satu ikan ekonomis penting yang sampai saat ini masih banyak dibudidayakan oleh petani hatchery skala rumah tangga karena harga cukup tinggi. Ikan dipelihara selama 60 hari dan pada akhir percobaan dilakukan uji tantang. KATA KUNCI: vaksin bakteri. Sintasan ikan hasil uji tantang adalah 87% dan kontrol 66%. Epinephelus fuscoguttatus telah dilakukan penelitian di hatchery skala rumah tangga dengan menggunakan bak. penyakit infeksi . Pada hari ke-30 dilakukan penyuntikan ulang sebagai booster. Berat awal benih kerapu macan digunakan adalah pada tiap perlakuan sekitar 1. dan Zafran Balai Besar Riset Perikanan Budidaya Laut. 05. Gondol ABSTRAK Perkembangan pesat budidaya berbagai spesies ikan laut di Indonesia.1 mL/ekor ikan dengan vaksin anti bakteri secara intra muskular. Epinephelus fuscoguttatus TERHADAP PENYAKIT INFEKSI Des Roza. Masingmasing sebanyak 100 ekor ikan kerapu ukuran antara 6-8 cm disuntik 0. Pendederan ikan kerapu macan. Padat penebaran yang digunakan sebagai perlakuan adalah 100. dan 200 ekor/m³. dan yuwana kerapu macan Epinephelus fuscoguttatus pFF 08 PENGEMBANGAN VAKSIN BAKTERI UNTUK MENINGKATKAN IMUNITAS IKAN KERAPU MACAN. bakteri maupun berbagai jenis parasit. Masing-masing perlakuan diulang 3 kali. sedangkan kontrol hanya disuntik dengan PBS. Epinephelus fuscoguttatus DENGAN PADAT PENEBARAN BERBEDA DI HATCHERI Anak Agung Alit Balai Besar Riset Perikanan Budidaya Laut. Selanjutnya ikan dipelihara dalam bak beton volume 2 m3 berisikan air sebanyak 1. Rasio konversi pakan 1. Pengamatan dilakukan terhadap tingkat imunitas dan sintasan. Hasil ini membuktikan bahwa vaksin yang diberikan efektif meningkatkan kekebalan spesifik yuwana kerapu macan. Fris Johnny. 95 – 2. KATA KUNCI: pertumbuhan. sintasan. baik di pembenihan maupun pembesaran di keramba jaring apung (KJA). Padat penebaran yang terbaik adalah perlakuan B dengan padat penebaran 150 ekor/m³ dapat digunakan sebagai rekomendasi untuk pendederan di hatchery skala rumah tangga. Epinephelus fuscoguttatus.bak semen dengan ukuran 2 x 3 x 1 m³ selama 2 bulan. Suatu penelitian untuk mengetahui efektivitas vaksin bakteri untuk meningkatkan kekebalan spesifik yuwana kerapu macan telah dilakukan. Pada hari ke-60 dilakukan sampling darah untuk dilakukan uji aktivitas titer antibodi.Forum Inovasi Teknologi Akuakultur 2010 pFF 07 PENDEDERAN KERAPU MACAN. Tujuan penelitian ini adalah untuk memperoleh data dan informasi padat penebaran yang terbaik pada pendederan di hatchery. Begitu juga dengan sintasan dimana sintasan rata-rata pada kelompok yang divaksin lebih tinggi (80%) dibanding kontrol (56%). 65 g/ ekor.150. Pemberian pakan berupa pakan komersial dan jembret diberikan sampai panjang total kerapu macan 4 cm. baik disebabkan oleh infeksi virus.

dan Irwan Setyadi Balai Besar Riset Perikanan Budidaya Laut. Hasil pengamatan perkembangan gonad induk ikan diameter oocyte mencapai 150 .000 butir.520 µm. Jenis pakan yang diberikan adalah ikan dan cumi ditambahkan vitamin mix. pada induk asal budidaya mempunyai daya tetas sekitar 35-95 % dengan SAI 2. Hasil penelitian menunjukkan bahwa pemijahan dan kualitas telur induk ikan hasil budidaya lebih baik dari induk asal alam. Kualitas telur yang dihasilkan relatif masih fluktuatif. Supii. aspek biologi reproduksi . dan Nyoman Adiasmara Giri Balai Besar Riset Perikanan Budidaya Laut. dan pada induk asal alam 20-92 % dengan SAI 2.7 cm atau berat badan 2350 g untuk betina serta panjang total 76 cm atau berat badan 6500 g untuk jantan. dan (B) Induk asal alam. Sampel ikan kerapu raja sunu yang didapat diukur panjang dan beratnya kemudian diambil gonadnya melalui pembedahan dan ditimbang untuk menghitung indeks somatik gonadnya. Pengamatan ini bertujuan untuk mengetahui beberapa aspek biologi reproduksi yang terdiri dari hubungan panjang berat tubuh.240. Ketut Suwirya. Hasil pengamatan menunjukkan bahwa ukuran minimal kedewasaan ikan kerapu raja sunu adalah ukuran panjang total 56. Gondol ABSTRAK Ikan kerapu raja sunu (Plectropoma laevis) merupakan salah satu jenis ikan kerapu yang bernilai ekonomis tinggi di pasar Asia. Pada induk hasil budidaya memijah sebanyak 128 kali dengan jumlah total telur 11.004. KATA KUNCI: kerapu raja sunu. Sampel oocyt diambil dan diperiksa di bawah mikroskop untuk mengetahui jenis kelamin serta diameter oocytnya untuk mengetahui tingkat kematangan gonadnya.25-4. Agus Priyono. indeks somatik gonad dan diameter oocytnya. Perlakuan dalam penelitian adalah (A) Induk hasil budidaya.20. Pemijahan terjadi sepanjang tahun pada terang dan gelap bulan. Pemijahan induk ikan dirancang dengan menggunakan dua bak beton dengan volume sekitar 30 m³. Gondol ABSTRAK Penelitian ini dilakukan untuk mengetahui performance pematangan gonad.450. sedang induk asal alam memijah sebanyak 20 kali dengan jumlah total telur yang dibuahi 3.000 butir. Tridjoko. KATA KUNCI: pFF 10 BEBERAPA ASPEK BIOLOGI REPRODUKSI IKAN KERAPU RAJA SUNU (Plectropoma laevis) Bejo Slamet. dengan jumlah 8% biomass/hari. Plectropoma laevis. Apri I. sedang kondisi sperm untuk induk jantan pada positif 1 dan 2.80. pemijahan dan kualitas telur induk ikan kuwe macan hasil budidaya dan asal alam dalam mendukung diversifikasi usaha budidaya. Pemijahan berpengaruh terhadap jumlah dan kualitas telur yang dihasilkan.Forum Inovasi Teknologi Akuakultur 2010 pFF 09 EVALUASI PEMIJAHAN DAN KUALITAS TELUR INDUK IKAN GOLDEN TREVALLY Gnathanodon speciosus (FORSSKALL) HASIL BUDIDAYA (F1) DAN ASAL ALAM (F0) Tony Setiadharma.

tengadak albino. Bogor ABSTRAK Ikan tengadak merupakan ikan perairan umum asli Kalimantan yang potensial untuk dikembangkan. Rudy Gustiano. pertambahan berat.Forum Inovasi Teknologi Akuakultur 2010 pFF 11 PENGEMBANGAN DAN APLIKASI PAKAN BUATAN UNTUK BUDIDAYA IKAN KERAPU MACAN. KATA KUNCI: truss morfometrik. Giri Balai Besar Riset Perikanan Budidaya Laut.A. konversi pakan. Hasil penelitian menunjukkan bahwa laju pertumbuhan. (1988). ikan tengadak. Himawan Tirta Yudha. Kata kunci : Jaring apung. Total biaya pakan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi. Gondol ABSTRAK Penelitian managemen pakan pada ikan kerapu macan telah dilakukan dalam keramba jaring apung. produksi dan sintasan dengan pemberian pakan pelet GR dengan kelompok A lebih tinggi dibandingkan dengan perlakuan lainnya. berdasarkan metode Strauss & Bookstein (1982) yang dimodifikasi dalam Corti et al. Penelitian karakterisasi ikan tengadak adalah untuk mengetahui data base (karakter morfometrik dan genetik) serta kekerabatannya dengan ikan sejenis yang ada di Jawa Barat. dan Mulyasari Balai Riset Perikanan Budidaya Air Tawar. Epinephelus fuscoguttatus DI KERAMBA JARING APUNG Tatam Sutarmat. Konversi pakan terendah pada pemberian pellet GR pada kelompok A. pertambahan berat. dengan periode pemeliharaan120 hari. Hasil analisis menunjukkan adanya sedikit kesamaan morfologi antara tengadak asal Kalimantan dengan tengadak albino asal Jawa Barat. Percobaan dirancang dengan rancangan acak lengkap pola faktorial 2 jenis pelet (SB dan GR) serta 2 kelompok ukuran ikan (A dan B). Untuk melihat penyebaran karakter morfologi ikan dilakukan dengan analisis kanonikal. tawes . analisis sharing component atau indeks kesamaan dilakukan dengan analisis diskriminan. dibandingkan dengan perlakuan lainnya. dan N. pertumbuhan. sedangkan dengan tawes jauh berbeda di mana karakter morfometrik tidak saling bersinggungan. sedangkan biaya pakan per kg ikan sama pada perlakuan pellet GR dan SB pada kelompok A. total biomass dan biaya pakan. Pengukuran morfometrik dilakukan menggunakan metode truss morfometrik. biaya pakan dan kerapu macan pFF 12 KARAKTERISASI TRUSS MORFOMETRIK IKAN TENGADAK (Barbonymus schwanenfeldii) ASAL KALIMANTAN BARAT DENGAN IKAN TENGADAK ALBINO DAN IKAN TAWES ASAL JAWA BARAT Irin Iriana Kusmini. Peubah yang diamati adalah sintasan. Benih ikan ditebar dalam 12 buah jaring ukuran 2x2x2 m dengan kepadatan 60 ekor/m3. Tujuan penelitian untuk mendapatkan informasi manajemen pakan yang tepat pada budidaya ikan kerapu macan di KJA.

303–1. Typha sp. Namun demikian insektisida mempunyai pengaruh negatif terhadap kehidupan perairan. Sintasan (93. amonia (0. Hasil penelitian menunjukkan bahwa kisaran kualitas air seperti konsentrasi TN (5–7. Bogor ABSTRAK Pemakaian insektisida untuk penanggulangan hama tanaman padi telah terbukti mempunyai peranan penting dalam peningkatan produksi. dan nitrat (11. juga harus aman dan tidak berdampak negatif bagi usaha perikanan di perairan tersebut. KATA KUNCI: substrat.67%).05) dibandingkan kolam ikan kontrol (82. Kisaran persentase efektivitas penyisihan TN (28%– 58. tumbuhan air.32 %). produktivitas kolam pFF 14 TOKSISITAS AKUT INSEKTISIDA KARBOFURAN TERHADAP IKAN MAS DAN IKAN NILA SERTA PENGARUHNYA PADA BUDIDAYA MINA PADI Sutrisno Balai Riset Perikanan Budidaya Air Tawar.681mg/L) dan nitrat (0. karbofuran.11%–44.86%–85. yakni insektisida antikolinesterase yang mempunyai efek sistem saraf (perifer dan pusat). kerikil dan eceng gondok) dan pada kolam substrat 2 (lumpur. amonia (20. yaitu kolam ikan yang dilengkapi substrat dan tumbuhan air sebagai biofilter dan kolam kontrol (kolam ikan tanpa dilengkapi substrat dan tumbuhan air). meningkatkan produktivitas kolam dan menjaga eksistensi kawasan budidaya tetap berkelanjutan. dan Scirpus sp. Karbofuran adalah salah satu jenis bahan aktif insektisida dari golongan karbamat.849 mg/L) dan nitrat (0.081–0.5 mg/L). Substrat dan tumbuhan air merupakan salah satu solusi yang efektif dan murah untuk memperbaiki kualitas air. akut. Penelitian ini dilakukan dengan tujuan untuk mengetahui toksisitas akut insektisida ini di laboratorium dan lapangan serta pengaruhnya terhadap sintasan dan produktivitas benih ikan mas dan ikan nila yang dipelihara dengan sistem usaha tani mina padi.7–1. khususnya ikan. Pertumbuhan ikan pada kolam ikan dilengkapi substrat dan tumbuhan air lebih tinggi dibandingkan dengan kolam ikan kontrol (P<0.8 mg/L). amonia (0.5 mg/L). Untuk itu. Perlakuan pada penelitian ini terdiri atas dua perlakuan.5%–66. KATA KUNCI: toksisitas. nitrogen.5–14. karena di samping harus efektif terhadap hama tanaman padi.4–0.14%–92.33%).Forum Inovasi Teknologi Akuakultur 2010 pFF 13 PEMANFAATAN SUBSTRAT DAN TUMBUHAN AIR TERHADAP HARA NITROGEN UNTUK PENINGKATAN PRODUKTIVITAS KOLAM IKAN Lies Setijaningsih dan Eri Setiadi Balai Riset Perikanan Budidaya Air Tawar. pemakaian insektisida perlu dilakukan secara selektif.82%).).05).lebih rendah pada kolam ikan yang dilengkapi substrat dan tumbuhan air dibandingkan dengan kolam kontrol TN (8.36%) pada kolam ikan yang dilengkapi substrat dan tumbuhan air lebih baik (P<0. kronis . yaitu TN (42.5%–90.82%). dan nitrat (37. sehingga dapat digunakan dalam memperbaiki kualitas air yang tidak layak menjadi menjadi layak untuk perikanan.58%). Bogor ABSTRAK Meningkatnya pencemaran perairan sungai sebagai sumber air untuk budidaya kolam ikan air tawar mengakibatkan terjadinya penurunan produktivitas yang disebabkan oleh kualitas air yang tidak layak lagi bagi peruntukkannya.4%) pada kolam substrat 1 (pasir.3 mg/L). Dengan demikian substrat dan tumbuhan air memiliki kemampuan sebagai biofilter dalam mengurangi konsentrasi hara nitrogen. Tujuan penelitian adalah untuk mengetahui efektivitas penyisihan kontaminan hara nitrogen dengan substrat dan tumbuhan air pada budidaya kolam ikan air tawar. amonia (42.

Osphronemus gouramy DENGAN TEKNIK POLYMERASE CHAIN REACTION (PCR) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Hasil penelitian .00 mg/L efektif untuk memberantas Trichodina dan monogenea.000. serbuk biji teh dan garam.00 mg/L. Oleh karena itu. dan Quadriacanthus kobiensis serta menimbulkan kematian. Ketujuh perlakuan itu yaitu: (a) biji teh 10. Kesulitan utama dalam upaya pengendalian penyakit tersebut antara lain adalah teknik diagnosa yang memerlukan waktu selama 3–4 minggu untuk mengetahui patogen penyebab secara definitif. 39 M1: T T dan primer M2: PreT (AATGGGCGCAAGCCTGATG) dan (ACCGCTACACCAGGAAT) digunakan pada penelitian 43 531 T ini. yang telah dikembangkan oleh 13 beberapa peneliti. Pengembangan teknik diagnosa penyakit tersebut dengan teknik polymerase chain reaction (PCR) diharapkan dapat digunakan sebagai perangkat diagnosa yang cepat dan tepat. Hasil penelitian menunjukan bahwa biji teh konsentrasi 10. hasilnya diharapkan dapat dipakai untuk memberantas ektoparasit tersebut. Bogor ABSTRAK Ektoparasit terutama protozoa dan monogenea trematoda masih merupakan parasit yang sering menimbulkan kematian yang relatif tinggi pada perbenihan ikan air tawar. limpa. dalam upaya peningkatan produksi benih perlu dilakukan upaya menurunkan tingkat kematian benih melalui pemberantasan ektoparasit yang mungkin menginfeksinya.000. selanjutnya dibandingkan dengan teknik diagnosa melalui uji bio. Dua pasang primer.00 mg/L dan garam 4.00–6. Gyrodactylus. (f) garam 6. KATA KUNCI: ekstoparasit. Dactylogyrus. sehingga upaya pengendaliannya sering terlambat.kimia dan histopatologis.00 mg/L. namun demikian kedua bahan pada konsentrasi tersebut tidak efektif untuk Ichthyophthirius multifiliis. sedangkan preparat histopatologi diambil dari organ hati. (b) biji teh 15. dan limpa. ginjal. Isolasi dilakukan dengan menggunakan media selektif Shouten Agar dan Lowenstain– Jenssen. Deteksi DNA bakteri target dilakukan terhadap sampel yang diambil dari organ hati. Pada riset ini. (d) garam 4.Forum Inovasi Teknologi Akuakultur 2010 pFF 15 EFEKTIVITAS SERBUK BIJI TEH DAN GARAM PADA Trichodina DAN Monogenea TERHADAP IKAN LELE DUMBO Clarias gariepinus Oman Komarudin dan Sutrisno Balai Riset Penelitian Budidaya Air Tawar.000.00 mg/ L. Ada beberapa bahan nabati dan alami yang dapat digunakan.00–20.00 mg/L (g) kontrol.00 mg/L. yaitu (GCGAACGGGTGAGTAACACG) dan (TGCACACAGGCCACAAGGGA). mengakibatkan kematian secara persisten hingga mencapai 40% dengan pola kronik. Mycobacterium fortuitum PADA IKAN GURAME. ikan lele dumbo pFF 16 DIAGNOSA PENYAKIT MYCOBACTERIOSIS. Akhir-akhir ini ada beberapa bahan kimia yang sebelumnya dapat digunakan sebagai pembasmi ektoparasit tersebut namun karena berbagai pertimbangan baik menyangkut keamanan konsumen dan pengaruh sampingan terhadap lingkungan sehingga bahan-bahan kimia tersebut dilarang digunakan dalam proses budidaya ikan air tawar.00 mg/L. (e) garam 5. Trichodina. Ada beberapa jenis ektoparasit yang sering menginfeksi benih ikan air tawar seperti Ichthyophthirius multifiliis. dan darah. Penelitian ini menguji efektivitas serbuk biji teh dan garam terhadap ektoparasit. Bogor ABSTRAK Penyakit mycobacteriosis (terutama yang disebabkan oleh infeksi bakteri Mycobacterium fortuitum) merupakan salah satu penyakit potensial pada budidaya ikan gurame (Osphronemus gouramy). dilakukan modifikasi terhadap teknik deteksi DNA bakteri Mycobacterium spp. (c) biji teh 20. Tujuh perlakuan diuji di laboratorium patologi dengan menggunakan rancangan acak lengkap dan tiga ulangan. Sensitivitas teknik diagnosa terhadap bakteri target.

dan Polymerase Chain Reactio n . Hasil analisis sekuensing dengan gen 16S rRNA menunjukkan similarity 99% dengan Mycobacterium fortuitum. Dengan metode PCR penyakit mycobacteriosis dapat diketahui secara definitif dalam waktu 2–4 hari hingga level spesies. gurame. KATA KUNCI: mycobacteriosis. Mycobacterium fortuitum.menunjukkan bahwa metode deteksi dengan PCR memiliki tingkat sensitivitas lebih tinggi dari metode isolasi maupun histopatologi.

000 unit/kg pakan memberikan laju pertumbuhan yang terbaik (P<0. Selama 20 minggu pemeliharaan diperoleh hasil substitusi tepung bungkil kedelai dengan tepung bungkil kopra tidak memberikan pengaruh yang nyata (P>0. Tujuan penelitian ini untuk mengetahui kadar fitase yang tepat untuk mendukung pertumbuhan dan efisiensi pakan benih ikan nilem.000 unit/kg pakan. masing. efisiensi pakan pFF 18 SUBSTITUSI TEPUNG BUNGKIL KEDELAI DENGAN TEPUNG BUNGKIL KOPRA DALAM PAKAN IKAN BERONANG.500. S. dan sintasan ikan beronang. Parameter yang diamati yaitu laju pertumbuhan spesifik.000.) Reza Samsudin dan Ningrum Suhenda Balai Riset Perikanan Budidaya Air Tawar. namun nilai ini tidak berbeda nyata dengan 1. Ikan uji yang digunakan adalah ikan nilem yang diperoleh dari Instalasi Riset Plasma Nutfah Perikanan Budidaya.45 g/ekor.73 g dengan padat tebar 15 ekor/keramba. Rancangan percobaan yang digunakan adalah rancangan acak lengkap dengan lima perlakuan dengan masing-masing perlakuan terdiri atas tiga ulangan. Penelitian ini dilaksanakan di Laboratorium Basah Nutrisi Ikan. rasio efisiensi protein. 1. C) 27% tepung bungkil kopra dan tanpa tepung bungkil kedelai. dan tingkat sintasan. 1. Ikan uji yang digunakan adalah yuwana ikan beronang ukuran 22. pertumbuhan.000 unit fitase/kg pakan. guttatu s .60±0.05). tepung bungkil kopra. Pakan yang digunakan isoprotein dan isolipid dengan kadar fitase 0. dan 2. Bogor. KATA KUNCI: fitase. efisiensi pakan. KATA KUNCI: tepung bungkil kedelai.Forum Inovasi Teknologi Akuakultur 2010 pFF 17 PENENTUAN KADAR ENZIM FITASE DALAM PAKAN UNTUK MENDUKUNG PERTUMBUHAN DAN EFISIENSI PAKAN BENIH IKAN NILEM (Osteochillus hasselti. Penggunaan fitase diharapkan mampu meningkatkan pemanfaatan protein untuk mendukung pertumbuhan dan efisien pakan.15±5.05) terhadap pertumbuhan. Cijeruk dengan bobot rata-rata 8. Balai Riset Perikanan Budidaya Air Tawar. Siganus guttatus Neltje Nobertine Palinggi dan Samuel Lante Balai Riset Perikanan Budidaya Air Payau. Maros ABSTRAK Penelitian ini bertujuan untuk mengetahui pengaruh substitusi tepung bungkil kedelai dengan bungkil kopra dalam pakan terhadap pertumbuhan ikan beronang.masing diulang tiga kali dan di desain dengan rancangan acak lengkap. Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan Ikan uji diberi pakan uji berupa pelet kering dengan perlakuan A) 17% tepung bungkil kedelai dan tanpa tepung bungkil kopra. 500. Hasil penelitian menunjukkan bahwa penggunaan fitase 1. efisiensi pakan. B) 22 % tepung bungkil kopra dan tanpa tepung bungkil kedelai.V. nilem. C. pakan ikan beronang. Bogor ABSTRAK Ikan nilem merupakan ikan herbivora yang mampu memanfaatkan protein nabati sebagai sumber proteinnya. Ikan uji dipelihara selama 40 hari dalam akuarium yang dilengkapi dengan sistem resirkulasi. Penelitian dilakukan dalam keramba jaring apung dengan menggunakan jaring ukuran 1 m x 1 m x 2 m sebanyak 15 buah.500 dan 2. masing-masing diulang tiga kali dan di desain dengan rancangan acak lengkap. substitusi.

Perlakuan yang diaplikasikan adalah jenis pakan ikan rucah dan pelet yakni A.526. Krablet yang digunakan dalam penelitian ini adalah krablet 9 berukuran lebar karapas rata-rata 5. Hasil penelitian menunjukkan pakan buatan (pelet) dengan kadar protein 42% dapat digunakan sebagai pakan dalam pemeliharaan rajungan dan hasilnya tidak berbeda nyata terhadap pertumbuhan bobot. Budidaya di tambak air payau yang dapat dikombinasikan dengan komoditas lainnya (polikultur). lebar karapas dan sintasan (P>0. 50% ikan rucah + 50% pelet. Sulawesi Selatan pFF 20 PENGARUH PEMBERIAN KOMBINASI PAKAN IKAN RUCAH DAN PAKAN BUATAN (PELET) TERHADAP PERTUMBUHAN DAN SINTASAN RAJUNGAN (Portunus pelagicus) Suharyanto dan M. 100% ikan rucah jenis ikan tembang (Clupea sp. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang pengaruh pemberian pakan ikan rucah dan pellet terhadap pertumbuhan dan sintasan rajungan (Portunus pelagicus). Maros ABSTRAK Budidaya ikan bandeng (Chanos chanos) di tambak telah berkembang secara pesat hampir di seluruh Indonesia dengan memanfaatkan perairan payau atau surut. Pemberian pakan dilakukan 3 kali sehari dengan dosis 15% dari total biomass. KATA KUNCI: budidaya bandeng.04 ± 0. bobot dan sintasan serta kualitas air. pelet. B. maka estimasi laba bersih yang diperoleh adalah sekitar Rp 100.-/tahun/ha.2 mm dan bobot 0. Maros selama 40 Hari. Aplikasi teknologi budidaya bandeng sudah meliputi teknologi budidaya secara tradisional hingga intensif.Forum Inovasi Teknologi Akuakultur 2010 pFF 19 TEKNOLOGI BUDIDAYA IKAN BANDENG DI SULAWESI SELATAN Nur Ansari Rangka dan Andi Indra Jaya Asaad Balai Riset Perikanan dan Budidaya Air Payau. tambak. Tjaronge Balai Riset Perikanan Budidaya Air Payau.Variabel yang diamati adalah pertumbuhan lebar karapas.05) dengan perlakuan yang lain. Media percobaan yang digunakan adalah akuarium berukuran 60 cm x 40 cm x 40 cm. Untuk mengatasi masalah ikan rucah diupayakan pakan buatan sebagai salah satu alternatif pengganti ikan rucah dalam pemeliharaan rajungan di tambak.850. Penentuan lokasi tambak perlu didukung dengan memperhatikan aspek teknis dan non teknis. KATA KUNCI: pakan rucah.02 g. Untuk menganalisis data pertumbuhan dan sintasan digunakan analisis ragam dengan pola rancangan acak lengkap. 100% pakan buatan/pelet dan C. pertumbuhan. Studi kasus pada beberapa Kabupaten di Sulawesi Selatan menunjukkan prospek dan perkembangan budidaya bandeng yang meningkat dan menjadi sumber ekonomi bagi masyarakat petambak. sintasan . Maros ABSTRAK Kendala penggunaan ikan rucah sebagai pakan antara lain kesegaran dan ketersediaan terbatas selama pemeliharaan.2 ± 0. Penelitian ini dilaksanakan di Instalasi tambak percobaan Balai Riset Perikanan Budidaya Air Payau Marana.). Berdasarkan perhitungan ekonomi usaha budidaya bandeng konsumsi di tambak. rajungan.

100. Ekspor bandeng ke beberapa negara seperti Uni Eropa dan Amerika Serikat sangat prospektif. Pupuk organik yang dicoba dalam penelitian ini adalah pupuk organik komersial (A) dan pupuk organik non komersial (B).4 g/ekor pada aplikasi pupuk organik komersial (A) dan menjadi 253 g/ekor pada aplikasi pupuk organik buatan (B). Penelitian menggunakan 4 (empat) kali ulangan dengan melakukan pengamatan pada hari ke 0. ampas tahu. Hapa diisi ikan dengan padat tebar 5 ekor per liter (500 ekor per hapa). Perlakuan B memberikan keuntungan lebih tinggi per siklus yaitu sebesar Rp 10. Selama pemeliharaan. masing-masing mencapai 56.masing perlakuan adalah 15. dan Lili Sholichah Balai Riset Budidaya Ikan Hias.5 x 0. Produksi bandeng pada perlakuan A dan B.9 dan 1154 kg/ha.-. semi intensif pFF 22 GAMBARAN PERTUMBUHAN PANJANG BENIH IKAN BOTIA (Chromobotia macracanthus) HASIL BUDIDAYA PADA PEMELIHARAAN DALAM SISTEM HAPA DENGAN PADAT PENEBARAN 5 EKOR PER LITER Darti Satyani.816%.43. Pengamatan dilakukan terhadap panjang total rata-rata benih ikan botia dan digunakan untuk menghitung laju pertumbuhan panjang harian benih ikan botia. Pupuk organik non komersial dibuat dengan cara memfermentasi dari bahan campuran limbah sayuran. Ikan ditempatkan dalam bak fiber berkapasitas 200 liter diisi dengan hapa berupa etabol berwarna coklat yang berukuran 0. 35. Depok ABSTRAK Penelitian yang bertujuan untuk mengetahui gambaran pertumbuhan panjang pada benih ikan botia hasil budidaya hingga ukuran ekspor 1 inchi (2. dan 105 dan dianalisis secara deskriptif. masing-masing dengan dosis 2. 70.5 cm) dari seluruh total populasi pada setiap ulangan tercapai pada lama pemeliharaan sekitar 80 hari. 20. Padat penebaran bandeng pada masing. produk bandeng organik semakin meningkat karena banyaknya permintaan produk makanan tersebut.000 ekor/ha Pemberian pakan dilakukan setelah bandeng berumur 2 bulan di tambak dengan dosis pakan 2-4 % dari bobot ikan/hari. dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau. 55.98 g/ekor menjadi 232. Hasil penelitian menunjukkan bahwa pertumbuhan bandeng selama 7 bulan mencapai berat dari 1.5 x 0.625% dan 60. KATA KUNCI: pupuk organik.5 m dan tinggi air 40 cm.5 cm) telah dilakukan di Balai Riset Budidaya Ikan Hias Depok. Lama pemeliharaan mengikuti target pasar untuk ukuran panjang ikan yaitu 2. ikan diberi pakan berupa cacing darah dan ditambahkan pelet sesudah ikan berukuran panjang rata-rata 2.5 cm (ukuran ekspor).5 ton/ha. lebih dari 90% total populasi ikan botia yang dipelihara telah mencapai ukuran > 2. Maros ABSTRAK Bandeng (Chanos chanos) merupakan salah satu komoditas unggulan di sektor perikanan yang berkontribusi dalam memenuhi produksi nasional.0 cm dan bobot rata-rata 0. masing-masing mencapai 986. Panjang rata-rata benih ikan botia di awal penelitian berukuran 1. bandeng. Pada akhir penelitian (hari ke 105).Forum Inovasi Teknologi Akuakultur 2010 pFF 21 APLIKASI PUPUK ORGANIK PADA BUDIDAYA BANDENG (Chanos chanos) SEMI-INTENSIF Brata Pantjara.5 cm dan panjang tertinggi sebesar 3. Sintasan bandeng pada perlakuan A dan B. namun sering bandeng asal Indonesia kurang disukai karena ada indikasi mengandung zat kimia yang bisa mengganggu kesehatan tubuh. Oleh karena itu. B/C rasio 1. Erfan Andi Hendradjat.009 gram. Nina Meilisza. Tujuan penelitian ini adalah untuk mengetahui pengaruh pupuk organik pada budidaya bandeng semi intensif. Berdasarkan grafik hasil penelitian diketahui bahwa target panjang rata-rata ukuran ekspor 1 inchi (2.467. pupuk kandang dan dedak.6 cm .0 cm.

KATA KUNCI: benih botia. pertumbuhan panjang.dengan laju pertumbuhan panjang harian benih ikan botia adalah 1% per hari. ukuran ekspor 1 inchi (2.5 cm) .

pH pFF 24 PENDEDERAN BENIH IKAN PELANGI (Melanotaenia boesemani) DENGAN PEMBERIAN PAKAN ALAMI YANG BERBEDA Bastiar Nur. Pakan diberikan tiga kali sehari yaitu pada pukul 8. gonad.0.00 dengan metode pemberian sekenyangnya (adlibitum). Tujuan penelitian mengenai pengaruh pH air media dalam perkembangan gonad rainbow untuk memperbaiki atau meningkatkan produksinya. Kondisi media pemeliharaan terutama pH yang amat berpengaruh terhadap perkembangan gonad merupakan faktor yang amat penting untuk diketahui nilai optimalnya.0 memberikan hasil yang terbaik terhadap perkembangan gonad ikan rainbow Sawiat. Benih ikan pelangi yang digunakan berumur ± 1 bulan dengan bobot rata-rata 0.5 – 5. Permintaan yang tinggi terutama pasar ekspor dituntut untuk dapat memproduksi dalam jumlah yang besar pula..Forum Inovasi Teknologi Akuakultur 2010 pFF 23 PENGARUH PH TERHADAP PERKEMBANGAN GONAD IKAN RAINBOW SAWIAT (Melanotaenia SP.32 ± 0. dan Culex sp.50 ± 0.00.. dan Irsyaphiani Insan**) Balai Riset Budidaya Ikan Hias. Pemeliharaan dilakukan selama 6 bulan dengan pemberian pakan berupa blood worm secara ad libitum sehari 2 kali. Selama 45 hari pemeliharaan. memberikan pertumbuhan (bobot dan panjang) lebih baik dibandingkan Chironomus sp.9 dan pH 7. Depok ABSTRAK Ikan pelangi Melanotaenia boesemani merupakan ikan hias yang berasal dari Papua dan telah berhasil dibudidayakan di Loka Riset Budidaya Ikan Hias Air Tawar Riset Budidaya Ikan Hias Air Tawar. memberikan pengaruh yang berbeda nyata (P<0. Hasil analisa statistik menunjukkan bahwa pemberian Tubifex sp. (A) Chironomus sp.24 cm.01 g dan panjang total rata-rata 3. ikan diberi perlakuan pemberian pakan alami yang berbeda. dan I Wayan Subamia Loka Riset Budidaya Ikan Hias Air Tawar.0 – 6. Agus Priyadi*). dengan pertambahan bobot rata-rata sebesar 0. Gigih Setia Wibawa*). Pengamatan pH dilakukan setiap hari dan histologi gonad dilakukan pada awal dan akhir penelitian.) Eni Kusrini*). namun tidak berbeda nyata (P>0. Hasil penelitian menunjukkan bahwa perlakuan pH 7. KATA KUNCI: air Melanotaenia sp.09 g dan pertambahan panjang total ratarata sebesar 0. Penelitian ini bertujuan untuk mengetahui pengaruh pemberian pakan alami yang berbeda pada pendederan benih ikan pelangi. Depok **) Pusat Riset Perikanan Budidaya.05) . Produktivitas yang optimal akan menuntut kondisi lingkungan yang optimal. Hasil penelitian diperoleh bahwa pemberian pakan alami berupa Tubifex sp.0 – 8. (B) Culex sp.0-8.5 cm dipelihara dalam 9 unit akuarium dengan padat tebar 20 ekor/akuarium dan diaerasi. Calon induk dipelihara dalam 3 perlakuan yaitu dalam air dengan pH 5. 12. Sebanyak 378 ekor calon induk ikan rainbow Sawiat (Melanotaenia sp. pH 6.) dipelihara dalam 18 akuarium berukuran 50 x 40 x 35 cm3 dengan kepadatan 21 ekor.85 ± 0.05) terhadap pertambahan bobot rata-rata ikan. Jakarta *) ABSTRAK Ikan rainbow (ikan pelangi) merupakan ikan yang cantik dan terkenal dari Indonesia bagian timur terutama Papua. dan (C) Tubifex sp.98 ± 0. Depok.00 dan 16. Rendy Ginanjar..8 (sebagai kontrol).

pendederan.terhadap rata-rata pertambahan panjang total dan sintasannya. sintasan . pakan alami. KATA KUNCI: Benih ikan pelangi. pertumbuhan.

Perlakuan yang diberikan dalam penelitian ini adalah padat penebaran yang berbeda yaitu : A. padat tebar. dan Jacques Slembrouck**) .22% dan E. Masing-masing perlakuan diulang sebanyak tiga kali dan rancangan percobaan yang digunakan adalah Rancangan Acak Lengkap. resirkulasi.07%. Semarang ABSTRAK Silver Dollar (Metynnis hypsauchen) merupakan salah satu ikan hias air tawar yang berasal dari perairan Amerika Selatan. Rendy Ginanjar*) Asep Permana*).22±0.67%. Design penelitian menggunakan rancangan acak lengkap (RAL) dengan perlakuan A (1 ekor/L). KATA KUNCI: Metynnis hypsauchen. Hasil penelitian menunjukkan bahwa padat penebaran tidak memberikan pengaruh yang nyata terhadap sintasan. Sistem resirkulasi dalam pembenihan dapat meningkatkan padat tebar serta sintasan dan pertumbuhan benih ikan silver dollar. 96. 96. 30 ekor/liter dan E. ketersediaan pakan dan padat penebaran. C (3 ekor/L) dan D (4 ekor/L) dan masing-masing diulang sebanyak 3 kali.67 mm.02 cm dengan bobot 0. tetapi berpengaruh nyata (p<0. sintasan pFF 26 OPTIMALISASI PADAT TEBAR BERBEDA TERHADAP SINTASAN LARVA BOTIA (Chromobotia macracanthus) YANG DIPELIHARA DALAM SISTEM RESIRKULASI Agus Priyadi*). 15 ekor/liter. Depok **) Universitas Diponegoro. C. Ikan uji yang digunakan adalah benih berukuran panjang 2. Marendra Gladiyakti**) *) Balai Riset Budidaya Ikan Hias. 35 ekor/liter. Tujuan penelitian ini adalah untuk mengetahui pengaruh padat penebaran terhadap sintasan dan pertumbuhan ikan Silver Dollar (Metynnis hypsauchen) dalam sistem resirkulasi. D. B. B. Pertumbuhan panjang larva botia tertinggi dihasilkan pada padat penebaran 15 ekor/L yaitu 9. Larva botia dipelihara selama 31 hari dalam akuarium berukuran 30 x 20 x 20 cm3 yang dilengkapi dengan sistem resirkulasi yang diisi air sebanyak 5 liter. Balai Riset Budidaya Ikan Hias Depok. C. pertumbuhan.81%. namun memberikan pengaruh terhadap pertumbuhan panjang larva botia. Tujuan dari penelitian ini adalah untuk mengetahui padat penebaran optimal pemeliharaan dalam sistem resirkulasi yang dapat menghasilkan sintasan larva botia tertinggi.Forum Inovasi Teknologi Akuakultur 2010 pFF 25 PENGARUH PADAT PENEBARAN TERHADAP SINTASAN DAN PERTUMBUHAN BENIH IKAN HIAS SILVER DOLLAR (Metynnis hypsauchen) DALAM SISTEM RESIRKULASI Tutik Kadarini*). 95.02 g. 25 ekor/liter. Pertumbuhan dan sintasan terbaik adalah perlakuan A (kepadatan 1 ekor/L). Prancis *) ABSTRAK Rendahnya sintasan larva dipengaruhi oleh beberapa faktor diantaranya kualitas air. Lili Sholichah*). Hasil penelitian menunjukkan bahwa perlakuan perbedaan kepadatan tidak memberikan pengaruh terhadap sintasan.45%. 20 ekor/liter.05) terhadap pertumbuhan. .13±0. D. Sintasan dari masing-masing perlakuan adalah sebagai berikut: A. Indonesia **) Institute Recherche Pour Le Developpement. 96. Padat tebar larva memberikan pengaruh terhadap pertumbuhan dan produksi dari ikan yang dipelihara. Pakan yang diberikan selama penelitian adalah nauplii artemia. Ikan dipelihara dalam akuarium resirkulasi berukuran 40 x 25 x 40 cm3 dan diberi pakan pellet sebanyak 5% biomass dengan frekuensi pemberian pakan 3x/hari. 97. B (2 ekor/L).

padat tebar .KATA KUNCI: ikan botia. sintasan.

Kawasan Mina Pakan Mandiri. KATA KUNCI: Phenotipic plasticity.Forum Inovasi Teknologi Akuakultur 2010 pFF 27 MANAJEMEN PENGEMBANGAN MAGGOT MENUJU KAWASAN PAKAN MINA MANDIRI Melta Rini Fahmi Balai Riset Budidaya Ikan Hias. Depok ABSTRAK Migrasi atau dalam dunia perikanan lebih dikenal juga dengan istilah ruaya merupakan pergerakan suatu spesies pada stadia tertentu dalam jumlah banyak ke suatu wilayah untuk bereproduksi. biokonversi. air tersedia dalam jumah yang cukup. Migrasi horizontal lebih dikenal dengan diadromus yaitu pergerakan ikan dari air tawar menuju air payau. Sehingga respon suatu gen terhadap perubahan lingkungan bisa menggambarkan polymorphism gen tersebut. Proses fisiologi yang berperan penting dalam kesuksesan migrasi adalah mekanisme osmoregulasi dan metabolisme. Perubahan selama proses migrasi meliputi perubahan perilaku dan morfologi. KATA KUNCI: maggot. Faktor-faktor yang mempengaruhi migrasi adalah faktor internal yang meliputi genetic atau insting. Pemilihan lokasi Sarolangun didasarkan pada lokasi pabrik sawit yang terdapat didaerah tersebut. lunar. Input yang diterima oleh ikan akan menghasilkan tanggapan atau perubahan pada perilaku dan morfologi. Beberapa unit kegiatan yang dilakukan untuk mengembangkan maggot dalam kawasan Mina Pakan Mandiri adalah 1) adanya unit produksi maggot.) . Unit budidaya ikan memiliki prasyarat sebagai berikut. Migrasi terbagi menjadi migrasi vertical dan horizontal. 2) unit pengolahan pakan dan 3) unit budidaya. memiliki mesin pelet. Sarolangun pFF 28 PHENOTYPIC PLATISITY KUNCI SUKSES ADAPTASI IKAN MIGRASI Melta Rini Fahmi Balai Riset Budidaya IkanHias. Beberapa pertimbangan dalam membentuk suatu kawasan budidaya adalah suplai benih. dan homing atau reproduksi. Kegiatan produksi massal ini dilaksanakan di Kabupaten Sarolangun. Perubahan lingkungan selama migrasi akan memberikan respon terhadap tingkah laku ikan (karakter phenotipik). Perlu diperhatikan bahwa produksi massal maggot hanya dapat dilakukan jika bahan baku berupa PKM tersedia dalam jumlah banyak atau produksi dilakukan disekitar perkebunan untuk memperpendek jarak transportasi. Unit produksi maggot memiliki prasyaratan sebagai berikut. memiliki bak untuk restokin. Depok ABSTRAK Sebagai sumber protein altenatif maggot telah mampu diproduksi secara masal pada tingkat petani. Ikan migrasi. lokasi berada pada fegetasi hutan atau perkebunan dan dekat dari pabrik Palm Kerenel Oil (PKO). propinsi Jambi. temperature. makanan. menemukan makanan serta tempat yang memiliki iklim tepat untuk kelangsungan hidupnya. Proses migrasi pada ikan merupakan respon fisiologis terhadap input internal maupun eksternal yang diterima. Phenotypic plasticity adalah kemampuan suatu genotypic untuk menghasilkan lebih dari satu karakter morfology. memiliki bak kultur. bahan pakan seperti vitamin dan dedak. ketersediaan pakan dan pemasaran. Unit pengolah pakan memiliki prasyarat sebagai berikut. Ikan Sidat (Anguilla sp. salinitas dan arus. kolam budidaya dan manajement budidaya yang baik. fisiologi dan tingkah laku dalam merespon perubahan lingkungan. area penjemuran atau alat pengeringan pakan (drying). Pengembangan maggot dalam satu kawasan budidaya memiliki nilai yang sangat strategis selanjutnya dikenal istilah Kawasan Pakan Mina Mandiri. sedangkan factor eksternal yaitu.

Berdasarkan hasil seleksi didapatkan isolat HNF5 dan LNF mempunyai kemampuan reduksi nitrat yang tinggi. Penelitian ini bertujuan untuk mengisolasi dan mengkarakterisasi isolat bakteri denitrifikasi sebagai agen bioremediasi senyawa nitrogen anorganik. Hasil dari persentase polimorfik (berkisar 5. Oreochromis niloticus . Iman Rusmana**). Isolat HNF5 dan LNF memiliki kecepatan maksimum reduksi nitrat (Vmaks) 0. Jarak genetik 15 populasi persilangan berkisar (0. Persilangan dilakukan secara dua arah penuh (full diallel crossing) sehingga dihasilkan 16 populasi.28 mM. dimana aktivitas paling cepat terjadi pada fase eksponensial pertumbuhan bakteri. pFF 30 ISOLASI DAN KARAKTERISASI BAKTERI DENITRIFIKASI SEBAGAI AGEN BIOREMEDIASI NITROGEN ANORGANIK Khairul Syahputra*).mossambicus). terdekat adalah antara populasi 3 (BEST x Nirwana) dangan populasi 2 (BEST x Red NIFI) dan terjauh antara populasi 14 (Nirwana x Nirwana) dengan populasi 11 (Red NIFI x Mujair). Ikan yang di gunakan adalah hasil persilangan 4 strain.40 mM dan 0.h-1 dengan nilai konstanta Michaelis-Menten (Km) 0. NIRWANA (nila ras wanayasa). juga untuk mengetahuii efek domnansi tetua terhadap anakan hasil persilangan tersebut. Sebanyak 6 isolat merupakan kelompok bakteri denitrifikasi (fermentatif negatif) dan 15 isolat termasuk kelompok bakteri fermentatif. mujair (O.236 – 0. Aktivitas reduksi nitrat terjadi dari awal inkubasi. Sukamandi ABSTRAK Kegiatan hibridisasi (persilangan)antar strain dan species ikan tilapia diharapkan mampu meningkatkan variasi genetik populasi. Identifikasi dengan sekuen 16S-rRNA memperlihatkan bahwa isolat HNF5 dan LNF mempunyai kemiripan . Penelitian ini bertujuan untuk mengetahui variasi genetik serta hubungan kekerabatan antar benih persilangan 3 strain ikan nila (Oreochromis niloticus) dengan mujair (O. dan Erma Primanita Hayuningtyas Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. tetapi yang menghasilkan benih hanya 15 populasi. Kekerabatan terjauh adalah pada persilangan yang menggunakan induk betina Ikan Mujair dan NIRWANA. Proses ini dapat digunakan untuk mengatasi kelebihan senyawa nitrogen anorganik yang tinggi di kolam budidaya perikanan.mossambicus). untuk mengamati variasi genetik benih persilangan ikan nila.h-1 dan 0. dan Utut Widyastuti**) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. terendah pada populasi 14 (Nirwana @& x Nirwana B&) dan tertinggi pada populasi 7 (Mujair @& x Mujair B&).16 mM. Didik Ariyanto. Hubungan kekerabatan 15 populasi persilangan cukup jauh dan membentuk beberapa cluster berdasarkan induk betina sebagai penurun gen dominan. Sebanyak 21 isolat bakteri pereduksi nitrat berhasil diisolasi dari medium pengkayaan dengan konsentrasi nitrat 100 µM dan 1500 µM. Sukamandi. Kata kunci: Randomly Amplified Polymorphic DNA (RAPD).560). Sukamandi **) Institut Pertanian Bogor ABSTRAK Denitrifikasi merupakan salah satu proses utama yang mengurangi kandungan senyawa nitrogen anorganik di perairan. mossambicus) Nunuk Listiyowati. nila BEST (Bogor Enhancement Strain of Tilapia). sedangkan hubungan kekerabatan terdekat adalah pada persilangan nila BEST. Penelitian ini di ini dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.15%). Persilangan.17 mM. nila merah (Red NIFI).26% – 63. jarak genetik. Parameter tersebut dianalisis menggunakan program TFPGA (Tools for Population Genetic Analysis) untuk menghitung polimorfisme dan jarak genetik. Selain itu. Metode yang digunakan adalah Randomly Amplified Polimorphic DNA (RAPD).Forum Inovasi Teknologi Akuakultur 2010 pFF 29 VARIASI GENETIK PERSILANGAN 3 STRAIN IKAN NILA (Oreochromis niloticus) DENGAN IKAN MUJAIR (O.

reduksi nitrat .dengan Pseudomonas aeruginosa. nitrogen anorganik. Kata kunci: denitrifikasi.

kemudian menuju dorsal di sekitar tubulus renalis dan melewati mesenterium dorsal. PGC pada larva gurami umur 20 hari sudah berada pada gonad primordia.09% menjadi 4. Purwokerto ABSTRAK Primordial germ cells (PGC) merupakan bentuk awal dari pekembangan sel germinal yang akan berdiferensiasi menjadi oogonia dan spermatogonia. KATA KUNCI: PGC.37% dan meningkatkan kadar protein dari 13. Bahan pakan yang digunakan adalah bungkil kelapa sawit dan inokulan yang digunakan adalah jenis Bacillus sp. Penelitian dirancang dengan menggunakan rancangan acak lengkap 5 perlakuan dengan tiga ulangan. Pada tahap pembentukan mata. Hasil penelitian menunjukkan PGC gurami memiliki karakteristik ukuran sel lebih besar dibandingkan sel somatis.74% menjadi 5. PGC dapat ditransfer ke dalam alogenik maupun xenogenik resipien dan dapat berkembang menjadi gamet fungsional. ventro-lateral serta bagian lateral embrio pada lapisan diantara saccus vitellinus dengan ektoderma. KATA KUNCI: Bacillus sp. dan Gratiana Eka Wijayanti3) *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. Osphronemus goramy. 4 hari (D2). Migrasi dilanjutkan menuju bagian lateral intestinum kemudian menuju gonad primordia. Isolasi dan manipulasi dapat dilakukan apabila diketahui lokasi keberadaan PGC. Penelitian ini bertujuan untuk menyediakan informasi dasar dalam pemanfaatan PGC khususnya mengenai lokasi keberadaannya. fermentasi. PGC terdistribusi secara berkelompok di bagian ventral. distibusi. sebagai bahan baku pakan ikan patin. Isdy Sulistyo2). 6 hari (D3). Migrasi PGC pada larva gurami melalui lapisan di antara saccus vitellinus dengan lapisan ektoderma dari ventral menuju lateral.91% menjadi 15. Hasil penelitian menunjukkan bahwa lama waktu fermentasi selama 2 hari dapat menurunkan kadar serat kasar dari 17. bungkil sawit.Forum Inovasi Teknologi Akuakultur 2010 pFF 31 DISTRIBUSI DAN MIGRASI PRIMORDIAL GERM CELL PADA IKAN GURAMI (Osphronemus goramy LAC. Identifikasi secara morfologi dilakukan dengan pewarnaan haematoxylin-eosin mengacu pada CSIRO (1996) yang dimodifikasi. Tujuan dari penelitian adalah untuk mengevaluasi efektivitas penggunaan Bacillus sp sebagai inokulan dalam fermentasi untuk meningkatkan nilai nutrisi bungkil kelapa sawit. nutrisi dan serat kasar .37% setelah proses fermentasi. Sedangkan secara histokimia dilakukan dengan pewarnaan alkaline phosphatase yang mengacu pada metode Gomori (1952). UNTUK MENINGKATKAN NILAI NUTRISI BUNGKIL KELAPA SAWIT MELALUI FERMENTASI Wahyu Pamungkas dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. inti sel bersifat metakromatik serta diameter sel besar antara 7-11 µm. Perlakuan yang diberikan adalah lama waktu fermentasi bungkil sawit yaitu 2 hari (D1). rasio inti sel:sitoplasma yang besar.) Priadi Setyawan1). Sukamandi **) Universitas Jenderal Soedirman. Sukamandi ABSTRAK Penelitian efektifitas Bacillus sp untuk meningkatkan nilai nutrisi bungkil kelapa sawit melalui fermentasi dilakukan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 8 hari (D4) dan 10 hari (D5) dengan dosis inokulum 2%. Metode yang digunakan adalah observasi preparat histologis yang dilanjutkan dengan identifikasi secara morfologi maupun histokimia.8%. menurunkan lemak bungkil sawit dari 14. migrasi (footnotes) pFF 32 UJI PENDAHULUAN: EFEKTIVITAS Bacillus SP..

Di Jawa Barat terdapat beberapa unit pembenihan rakyat (UPR) Patin yang berkembang baik. dan kluster pemeliharaan larva dan benih. Penelitian ini bertujuan untuk mengetahui sistem budidaya di UPR di Jawa Barat. KATA KUNCI: UPR. Hasil penelitian yang diperoleh menunjukkan bahwa sistem budidaya benih di UPR Jawa Barat dan Banten menggunakan dua sistem yang berbeda yaitu sistem terintegrasi dan sistem kluster. kluster penetasan telur. dan Labuan (Merak). Kedua sistem tersebut memiliki kekhususan dalam pengembangan dan pembinaannya. benih hasil perlakuan hormon tersebut dipelihara dan di besarkan untuk dijadikan pejantan fungsional. Tipe integrasi bersifat soliter. Produksi benih pada sistem kluster lebih tinggi daripada sistem terintegrasi. Subang. salah satunya melalui Catfish Club Indonesia. Depok ABSTRAK Ikan patin (Pangasius sp. patin. Bogor ABSTRAK Penelitian perbanyakan pejantan fungsioanal ikan nilem (Osteochilus hasselti) telah dilakukan melalui persilangan antara kelompok jantan fungsional hasil penelitian 2008 (8 ekor jantan fungsional) dengan betina normal. Metode penelitian yang digunakan adalah metode survai dan analisis data secara deskriptif. Bogor ****) Balai Riset Budidaya Ikan Hias. dan Hertria Maharani*) *) Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. di antaranya daerah Bogor dan Subang. Sedangkan sistem produksi tipe kluster bersifat kelompok yang terdiri atas tiga bagian yaitu kluster induk. Lusiastuti***). Ada perbedaan hasil kelangsungan hidup antara kelompok anakan hasil treatmen hormon yang di berikan melalui perendaman dan metode oral via pakan. Perlakuan hormon testosteron untuk pengalihan kelamin dibedakan atas dua metode yaitu melalui perendaman saat embrio dengan dosis 500 ug/L (Subagja. Sebagian benih hasil perlakuan hormon sebanyak 30 ekor. Wartono Hadie**). dkk.) DI JAWA BARAT DALAM MENDUKUNG PENGEMBANGANNYA Rani Hafsaridewi*). pemijahan dan penetasan telur serta pemeliharaan larva dan benih sampai siap jual. Budidaya ikan patin memiliki tahapan unit pembenihan dan pembesaran. integrasi. kluster pFF 34 PRODUKSI JANTAN FUNGSIONAL IKAN NILEM (Osteochilus hasselti): MELALUI PENGALIHAN KELAMIN SECARA HORMONAL PADA IKAN HASIL PERSILANGAN JANTAN FUNGSIONAL Jojo Subagja dan Rudhy Gustiano Balai Riset Perikanan Budidaya Air Tawar. Jakarta ***) . Dilain pihak dilakukan pengamatan pertumbuhan dari anakan hasil . Pengambilan data melalui responden dilakukan dengan cara purposive sampling. pemberian melalui oral menghasilkan kelangsungan hidup lebih tinggi 20% dibanding dengan cara perendaman. Penelitian ini dilakukan pada bulan Juli sampai dengan Desember 2009 meliputi daerah Bogor.) merupakan salah satu komoditas perikanan yang mempunyai nilai ekonomis tinggi di Indonesia. Eni Kusrini****). Jakarta **) Pusat Riset Perikanan Budidaya. Perbedaan dari kedua sistem ini adalah sifat produksinya. demikian juga ditinjau dari segi higienis dan kesehatan benih. setelah mencapai ukuran 3-5 cm dilakukan pemeriksaan gonadnya (penentuan jenis kelamin) dengan metode preparat ulas menggunakan aceto-charmin.1994). dalam satu unit produksi terdapat keseluruhan sistem yang mencakup pemeliharaan induk. 2007) serta melalui oral dengan dosis 60 mg/kg pakan (Popma. dengan masing-masing hatchery terpisah lokasinya. Angela M..Forum Inovasi Teknologi Akuakultur 2010 pFF 33 FITUR UNIT PEMBENIHAN RAKYAT (UPR) PATIN (Pangasius SP.Balai Riset Perikanan Budidaya Air Tawar. anakan yang di peroleh adalah homogametik betina kemudian di lakukan sex reversal (jantanisasi) secara massal dengan metode perendaman embrio dan melalui oral menggunakan metiltestosteron (MT).

KATA KUNCI: ikan nilem.persilangan dengan jantan fungsional yang tidak dilakukan sex reversal. betina homogamet . jantan fungsional. sex reversal. sebagai materi kegiatan tahun mendatang. kelompok ini sebagai materi untuk melihat ferforma perkembangan gonad hingga dewasa.

Forum Inovasi Teknologi Akuakultur 2010 pFF 35 PEMELIHARAAN LARVA IKAN COBIA (Rachycentron canadum) DENGAN KEPADATAN YANG BERBEDA Siti Zuhriyyah Musthofa. KATA KUNCI: sintasan.1. dan Afifah Balai Besar Riset Perikanan Budidaya Laut. salinitas. Anang H K. amonia. Parameter yang diamati meliputi pertumbuhan (panjang total tubuh dan bobot larva).2 gram. Agus Priyono. M H Fariddudin A. ikan mas strain rajadanu . dan nitrit). Gondol ABSTRAK Ikan cobia yang merupakan satu-satuya spesies dalam family Rachycentridae memiliki keunggulan tumbuh cepat. memiliki rasio konversi pakan yang rendah dan dapat dibudidayakan di bak terkontrol dan keramba jaring apung (KJA) sehingga potensial untuk kandidat budidaya laut. Kepadatan 5 butir/liter menghasilkan pertumbuhan dan sintasan yang lebih tinggi dibandingkan kepdatan 10 butir/liter dan 15 butir/liter. oksigen terlarut/DO. 15 butir/ liter perlakuan (I). Informasi mengenai kepadatan larva yang optimum belum banyak diketahui. Bogor ABSTRAK Seleksi ikan mas rajadanu pada ukuran konsumsi telah dilakukan pada ukuran rata-rata populasi mencapai bobot individu 431. Tujuan penelitian adalah untuk mengetahui pengaruh kepadatan terhadap pertumbuhan dan sintasan larva cobia. terutama pengaruhnya terhadap pertumbuhan dan sintasan larva. intensitas cahaya. 10 butir/liter (perlakuan H). pH.57 % dalam satu generasi. Diketahui estimasi nilai heritabilitas rata-rata h²( + ) = 0. Rancangan percobaan menggunakan rancangan acak lengkap dengan 3 ulangan. Telur cobia yang berasal dari pemijahan secara alami di pelihara dalam bak fiber ukuran 1 m3 dengan kepadatan 5 butir/liter (perlakuan G). KATA KUNCI: seleksi generasi. Diperoleh ikan induk 34 ekor jantan dan 84 ekor betina yang terseleksi dengan rataan 744. larva cobia Rachycentron canadum pFF 36 SELEKSI GENERASI SATU TRAIT PERTUMBUHAN IKAN MAS STRAIN RAJADANU Sidi Asih.37 gram selama pemeliharaan 11 bulan dari usia menetas dengan pemberian pakan yang mengadung protein 27 % dan ransum harian 3 % dari bobot biomas serta nilai FCR 2. dan Gleni H H Balai Riset Perikanan Budidaya Air Tawar. kepadatan. pertumbuhan. sintasan dan kualitas air (meliputi suhu.27 pada ukuran konsumsi S D dan prediksai terhadap kemajuan Respon seleksi (R) pertumbuhan sebesar 19.

Survei dilakukan di beberapa daerah yaitu Cianjur.Forum Inovasi Teknologi Akuakultur 2010 pFF 37 EKSPLORASI BAKTERI PROBIOTIK SEBAGAI ANTIBAKTERI UNTUK PENANGGULANGAN PENYAKIT STREPTOCOCCOSIS Yani Aryati. penanggulangan. Klaten. Hambali Supriyadi. karena mampu menghambat pertumbuhan bakteri Streptococcus iniae. penyakit streptococcosis . Metode yang digunakan dalam penelitian ini adalah metode survei untuk mendapatkan berbagai jenis ikan nila untuk diisolasi diisolasi pada organ pencernaan (usus). dan Lila Gardenia Pusat Riset Perikanan Budidaya. bakteri probiotik. Dari uji daya hambat didapatkan bahwa 3 bakteri merupakan bakteri yang bisa dijadikan kandidat bakteri probiotik.dan Tasikmalaya. Isolasi bakteri pada organ pencernaan (usus) mendapatkan 97 isolat bakteri. KATA KUNCI: antibakteri. eksplorasi. Jakarta ABSTRAK Isolasi bakteri probiotik dilakukan dengan tujuan untuk mendapatkan kandidat bakteri probiotik yang akan digunakan sebagai antibakteri untuk menanggulangi penyakit streptococcosis pada ikan nila (Osphronemus niloticus).

Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data tingkat kelayakan perairan guna mendukung keberlanjutan usaha budidaya kerang hijau. SIG. Parameter penting yang mempengaruhi budidaya kerang hijau telah dikumpulkan selama penelitian lapangan pada bulan Maret 2010. Pandeglang . KATA KUNCI: kerang hijau. pemilihan lokasi yang sesuai merupakan perencanaan awal yang sangat penting. dan sebanyak 20 titik pengamatan telah berhasil dikumpulkan. budidaya laut. Namun hambatan utama dalam keberlanjutan budidaya kerang hijau dilokasi ini adalah kondisi gelombang dan angin pada musim barat (Desember-Maret) yang cukup besar sehingga menyebabkan rusaknya media budidaya yang ada. Pengumpulan data lapangan dirancang secara acak dengan menggunakan sistem informasi geografis (SIG). Hatim Albasri. di perairan Panimbang Kabupaten Pandeglang. Tujuan dari penelitian ini adalah untuk mengkaji tingkat kelayakan perairan untuk pengembangan budidaya kerang hijau di Perairan Panimbang. Untuk menjamin keberlangsungan usaha budidaya kerang hijau. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Teluk Lada. Secara umum. Data yang dikumpulkan kemudian dianalisis secara spasial dengan SIG. Erlania. Provinsi Banten. Kabupaten Pandeglang. Jakarta ABSTRAK Budidaya kekerangan (kerang hijau) telah memberikan konstribusi yang cukup nyata bagi peningkatan pendapatan nelayan sekitar perairan Pantai Panimbang. Kabupaten Pandeglang. karakteristik perairan cukup mendukung bagi pengembangan budidaya kerang hijau.Forum Inovasi Teknologi Akuakultur 2010 pM 01 ANALISIS SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA KERANG HIJAU DI TELUK LADA KABUPATEN PANDEGLANG PROVINSI BANTEN I Nyoman Radiarta*.

Berdasarkan hasil pemeriksaan darah menunjukkan bahwa tembakau tidak bersifat sebagai immunostimulan terhadap peningkatan respons kekebalan non-spesifik pada huna hal ini ditunjukkan dengan tidak beda nyata antara kelompok perlakuan dan kontrol. dan Opercularia plikatilis. serta UPR yang mengembangkan usaha perbenihan udang galah. kelompok kedua adalah penghasil benih. Metoda Analisis data dengan Metode Perbandingan Eksponensial (MPE). padahal permintaan cukup besar. tingkat sintasan. Ikhsan Khasani**). STRATEGI PENGEMBANGAN BUDIDAYA UDANG GALAH GIMACRO Lies Emmawati Hadie*). kelompok kedua adalah BBU Pamarican (Jabar).UPU Probolinggo (Jatim). Sistem yang dapat dikembangkan adalah dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk.Forum Inovasi Teknologi Akuakultur 2010 pK 01 1. dan Nurbakti Listyanto*) *) Pusat Riset Perikanan Budidaya. Institusi yang berperan sebagai kelompok utama adalah LRPTBPAT-Sukamandi. dan Jatim.Wartono Hadie*). Pengelolaan induk yang dimaksud perlu dirancang dan dibentuk dalam suatu sistem produksi yang dapat beroperasi secara berkelanjutan. sistem piramida pK 02 PENGGUNAAN EKSTRAK TEMBAKAU (Tobacum nicotiana) SEBAGAI BAHAN HERBAL ALTERNATIF UNTUK MENANGGULANGI PENYAKIT PARASITIC PADA HUNA (Cherax SPP. BBAP Samas-Yogya(Jateng).. . Vorticella sp. KATA KUNCI: udang.42%. Jateng. dan Spiranura sp. Namun kendala dalam usaha tersebut adalah keterbatasan dalam supply udang konsumsi secara kontinyu. Masing-masing pengujian menggunakan Rancangan Acak Lengkap (RAL) dengan 5 perlakuan 3 ulangan. Bali. Bali. Oleh karena itu diperlukan upaya untuk menanggulangi masalah tersebut dengan membentuk net working dalam mengelola parents stock udang galah GIMacro.. Kendala teknis pada tingkat pembudidaya adalah keterbatasan dalam penyediaan induk yang bermutu dan keterbatasan dalam mengadopsi hasil-hasil riset. Jakarta *) Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. kelompok kedua adalah penghasil benih.).) Uni Purwaningsih dan Taukhid Balai Riset Perikanan Budidaya Air Tawar. Parameter yang diamati meliputi pemeriksaan parasit. Tingkat prevalensi menunjukkan bahwa parasit yang dominan menginfeksi huna yaitu dari kelompok monogenea trematode adalah Craspedella sp. BBUG Klungkung (Bali) dan kelompok ketiga ialah pembudidaya di wilayah Jabar. Penelitian dilakukan dengan sistem pengembangan udang galah GIMacro yang dirancang dengan sistim piramida yang terdiri dari kelompok utama yaitu penghasil induk. dan kelompok ketiga ialah pembudidaya. Zoopthalmium sp. Jatim dan Ciamis Jabar memperlihatkan hasil bahwa peluang usaha masih terbuka luas. sedangkan dari kelompok protozoa adalah Epistylis sp. tingkat kesembuhan.. dan diferensial hemosit. Bogor ABSTRAK Penelitian ini bertujuan untuk mengetahui efektivitas penggunaan ekstrak tembakau untuk menanggulangi penyakit parasitik pada Huna (Cherax sp.Bali.. dan kelompok ketiga ialah pembudidaya. Retna Utami**). induk. Imron**). Hasil riset memberikan rekomendasi bahwa sistem pemuliaan berbasis pembudidaya ternyata efektif untuk pengembangan udang galah GIMacro. Carchecium sp.Metode MPE merupakan suatu tipe analisis guna menentukan urutan prioritas alternatif keputusan dengan kriteria jamak. BBUG Klungkung. manajemen.. Berdasarkan survey pada tahun 2008 keterbatasan induk udang galah yang berkualitas baik juga menjadi kendala bagi UPT seperti di BBAP SamasYogyakarta. Sukamandi ABSTRAK Berdasarkan kajian sosial dan ekonomi mengenai usaha budidaya udang galah pada sentra produksi udang di Yogya. Sistem piramida ini akan memberikan dampak terhadap berkembangnya sistem budidaya udang galah GIMacro secara berkelanjutan. Dari hasil penelitian diperoleh bahwa konsentrasi 200 mg/L adalah dosis terbaik di mana pada dosis ini mampu mengurangi jumlah parasit hingga 76.

tembakau (Tobacum nikotiana) .).KATA KUNCI: huna (Cherax sp.

500 m2 digunakan untuk percobaan.Forum Inovasi Teknologi Akuakultur 2010 pK 03 PENGEMBANGAN BUDIDAYA UDANG WINDU (Penaeus monodon) DENGAN TEKNOLOGI PENTOKOLAN BENUR DAN TAMBAK BERSALINITAS RENDAH Rusmaedi. Maros ABSTRAK Polikultur di tambak telah banyak dilakukan. masing-masing dengan dua ulangan.66% dan 108. Maros dengan menggunakan tambak ukuran 5000 m2/petak sebanyak 4 petak. Dari pemeliharaan udang selama tiga bulan. KATA KUNCI: udang windu. Tambak kemudian diisi air setinggi sekitar 20 cm dan pemberantasan hama dilakukan menggunakan saponin dengan dosis 20 ppm. dilakukan pengolahan tanah tambak. Jakarta ABSTRAK Budidaya Udang windu di sawah tambak maupun tambak dengan air bersalinitas rendah mempunyai peluang yang cukup baik untuk dikembangkan. sedangkan pada dua bulan berikutnya diberi pakan pellet udang. Hewan uji yang digunakan adalah udang vaname PL-48. Selanjutnya tambak dipupuk dengan urea 150 kg dan TSP 75 kg dan pupuk kandang sebanyak 400 kg perpetak. memanfaatkan pentokolan benur dan dilakukan pada tambak bersalinitas rendah.000 kg/ha rumput laut.2 %. Sebelum penebaran. Ikan banding dengan berat rata-rata 30 kg ditebar sebanyak 300 ekor setiap petak.84 kg/ha.05) dengan perlakuan A di mana sintasan dan produksinya masing-masing 35. produksi 81. Dengan teknologi yang diterapkan. tokolan. pemberantasan hama. pengeringan. kemudian dikeringkan sekitar satu minggu.8 kg dan kelangsungan hidup 100 %.1 kg dan kelangsungan hidup 11. Setelah dua hari. Karawang pK 04 POLIKULTUR UDANG VANAME (Litopenaeus vannamei) DAN RUMPUT LAUT (Gracilaria verrucosa) Erfan Andi Hendrajat dan Brata Pantjara Balai Riset Perikanan Budidaya Air Payau. produksi 78. diharapkan dapat menghindari terjadinya resiko gagal panen akibat serangan penyakit pada udang dan dapat mempersingkat masa pemeliharaan. yaitu pertambahan berat rata-rata 230 g. namun berbeda tidak nyata (P>0. Gracilaria verrucosa. yaitu menggunakan tingkat teknologi tradisional plus. polikultur. Empat petak tambak masing-masing berukuran 3. pengapuran dan pemupukan. Sintasan dan produksi udang vaname tertinggi diperoleh pada perlakuan B yaitu masing-masing 54.6 kg/ha. penebaran dilakukan setelah satu bulan dari penebaran tokolan. KATA KUNCI: vaname. Sebagai perlakuan adalah: (A) monokultur 2 ekor/m2 udang vaname dan (B) polikultur 2 ekor/m2 udang vaname + 2. diperoleh hasil pertumbuhan tertinggi pada petak C2 yaitu rata-rata 34. Pemeliharaan dilakukan selama tiga bulan. survival rate.n pengapuran sebanyak 175 kg/petak. produksi .5 g. salinitas rendah. Penelitian ini dilakukan pada tambak di daerah Betok Mati.22% dan 72. Sebelum penebaran dilakukan persiapan tambak meliputi perbaikan pematang. namun polikultur udang vaname dan rumput laut masih kurang informasinya. Penelitian polikultur udang vaname (Litopenaeus vannamei) dan rumput laut Gracilaria verrucosa dilaksanakan di Instalasi Tambak Percobaan Balai Riset Perikanan Budidaya Air Payau di Marana. pada bulan pertama udang tidak diberi pakan. dan Wartono Hadie Pusat Riset Perikanan Budidaya. Kecamatan Cilebar. Karawang. Idil Ardi. Pemeliharaan ikan banding selama dua bulan diperoleh hasil tertinggi pada petak C3. pengisian air dilanjutkan sampai ketinggian 40 cm dan dibiarkan sekitar satu minggu untuk siap tebar tokolan dengan kepadatan 6 ekor/m2.

6 m sebanyak 12 buah. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 40% dari total pakan yang diberikan setiap hari. indeks keseragaman menunjukkan komunitas plankton pada . pola tradisional. Pada penelitian lainnya enam petak tambak masing-masing ukuran 4. Hasil penelitian menunjukkan perlakuan aplikasi berbagai sumber karbohidrat untuk perbanyakan probiotik berpengaruh tidak nyata (P>0. Pada budidaya udang windu pola intensif penambahan tepung tapioka belum memberikan peningkatan produksi udang windu secara nyata. perlakuan C = tapioka. dan metabolit udang. dan Cyanophyceae. Hewan uji yang digunakan adalah benur udang windu ukuran bobot 0. Tujuan penelitian adalah untuk mendapatkan teknik sederhana dalam upaya peningkatan produksi udang dari budidaya. 25.000 m2 digunakan untuk budidaya udang windu (Penaeus monodon) pola intensif. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya (tambak) seperti mengurangi limbah organik pada tambak udang intensif yang berasal dari sisa pakan. Maros ABSTRAK Program pemerintah hingga 2014 memproyeksikan produksi perikanan budidaya rata-rata sebesar 353% dan khusus dari udang 201%. sehingga populasi bakteri heterotrof bisa dimanfaatkan secara efektif oleh udang windu.3 g dengan padat tebar 50 ekor/bak. Perlakuan yang diuji adalah sumber karbohidrat untuk perbanyakan probiotik yaitu perlakuan A = dedak. udang penaeid pK 06 PERTUMBUHAN PLANKTON PADA APLIKASI PROBIOTIK DALAM PEMELIHARAAN UDANG WINDU (Penaeus monodon ) DI BAK TERKONTROL Machluddin Amin dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. Hal tersebut kemungkinan dipengaruhi oleh sifat udang windu yang lebih karnivora sehingga kurang memanfaatkan bakteri heterotrof yang terbentuk. pelakuan B = sagu. Pada budidaya udang windu intensif.Forum Inovasi Teknologi Akuakultur 2010 pK 05 PENAMBAHAN TEPUNG TAPIOKA PADA BUDIDAYA UDANG PENAEID DI TAMBAK Gunarto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau. menggunakan bak kayu ukuran 1 m x 1 m x 0. pola intensif. kemungkinan lainnya yaitu apakah seharusnya perlu lebih sering lagi frekuensi pemberian tepung tapioka. Pengamatan plankton dilakukan sebanyak 3 kali setiap 2 minggu dengan menyaring dan memadatkan air contoh media sebanyak 50 L menjadi 100 mL dengan plankton net no. Polychaeta. dan perlakuan D = tanpa sumber karbohidrat. Hasil penelitian menunjukkan bahwa pada budidaya udang vaname pola tradisional plus dengan penambahan tepung tapioka diperoleh produksi udang lebih tinggi yaitu sebanyak 58% dari produksi udang yang diperoleh pada perlakuan tanpa penambahan tepung tapioka. sedangkan jenis zooplankton diwakili oleh Kelas Crustacea. Komposisi jenis plankton yang ditemukan terdiri atas fitoplankton diwakili oleh Kelas Bacillariophyceae. Indeks keragaman menunjukkan komunitas plankton semua perlakuan tidak stabil. penambahan tepung tapioka dilakukan setiap selang waktu 3–5 hari sekali selama masa pemeliharaan dengan dosis sebanyak 62% dari total pakan yang diberikan setiap hari. Probiotik yang telah diperbanyak dengan menggunakan komposisi perlakuan diberikan sebanyak 5 mg/L setiap 7 hari ke wadah pemeliharaan udang windu. dan Rotatoria. Hal tersebut perlu mendapat dukungan dari penelitian.05) terhadap kelimpahan dan jumlah jenis plankton. kotoran. Dinophyceae. KATA KUNCI: tepung tapioka. Tujuan penelitian adalah mendapatkan data informasi tentang pertumbuhan plankton pada aplikasi berbagai sumber karbohidrat untuk perbanyakan bakteri probiotik dalam pemeliharaan udang windu (Penaeus monodon). masing-masing dengan 3 ulangan. Enam petak tambak masing-masing ukuran 500 m2 digunakan untuk penelitian penambahan sumber karbohidrat (tepung tapioka) pada budidaya udang vaname (Litopenaeus vannamei) pola tradisional plus. Pada budidaya udang vaname pola tradisional plus.

indeks dominansi menunjukkan komunitas plankton semua perlakuan dalam keadaan labil. KATA KUNCI: plankton.perlakuan D relatif lebih merata dibanding perlakuan lainnya. probiotik. udang windu .

perlakuan B = kotoran sapi. B = 2 mg/L. Selama pemeliharaan benur diberi pakan komersial sebanyak 15%–3% dari total biomassa dengan frekuensi 2 kali/hari. Maros ABSTRAK Penggunaan probiotik sebagai upaya untuk memperbaiki lingkungan budidaya dan menekan penyakit ternyata terbukti dapat membantu mengatasi sebagian masalah dalam budidaya udang. Kisaran Indeks biologi plankton yang diperoleh selama penelitian masing- . oksigen terlarut. Maros ABSTRAK Pupuk organik merupakan salah satu jenis pupuk yang mengandung unsur hara makro dan mikro yang dapat dimanfaatkan untuk pertumbuhan pakan alami di tambak seperti plankton. dan produksi udang vaname. Wadah yang digunakan adalah 6 petak tambak masing-masing ukuran luas 500 m2/petak yang ditebari tokolan udang windu ukuran PL-30 dengan padat tebar 2 ekor/m2 (1. Setiap bak ditebari pasca larva udang vaname (PL-12) dengan padat tebar 150 ekor/m2. KATA KUNCI: probiotik. NO . Abdul Malik Tangko. sintasan. setiap 15 hari.000 ekor/petak). dan perlakuan C = dedak padi halus. Penelitian ini bertujuan untuk mengetahui konsentrasi probiotik yang tepat pada pemeliharaan udang vaname dan melihat efeknya terhadap kualitas air. serta Oscillatoria dari kelas Cyanophyceae. namun berpengaruh tidak nyata (P>0.Forum Inovasi Teknologi Akuakultur 2010 pK 07 APLIKASI PROBIOTIK DENGAN KONSENTRASI BERBEDA PADA PEMELIHARAAN UDANG VANAME (Litopenaeus vannamei) Hidayat Suryanto Suwoyo dan Markus Mangampa Balai Riset Perikanan Budidaya Air Payau. dan D = kontrol (tanpa pemberian probiotik hasil fermentasi) yang di set dalam Rancangan Acak Lengkap (RAL) dengan 4 perlakuan dan 3 ulangan. Sedangkan genera dari zooplankton yang memiliki individu paling banyak adalah Kopepoda dari Kelas Crustascea.5 m dengan volume air 400 L. Perlakuan yang dicobakan adalah penggunan jenis pupuk organik yaitu perlakuan A = kotoran ayam. Genus fitoplankton yang memilki jumlah individu banyak antara lain Navicula. Nitzschia. BOT. Peubah penunjang yang dilakukan adalah pengamatan kualitas air yang meliputi salinitas.05) terhadap pertumbuhan udang vaname. Jenis fitoplankton didominasi oleh Kelas Bacillariophyceae dan zooplankton didominasi oleh Kelas Crustacea. Kualitas air yang diperoleh masih dalam kisaran yang layak untuk kehidupan udang vaname. Hasil penelitian menunjukkan bahwa penambahan probiotik hasil fermentasi pada media pemeliharaan berpengaruh nyata (P<0. dan Pleurosigma dari Kelas Bacillariophyceae.05) pada sintasan dan produksi udang vaname. sintasan. NO . Penelitian ini bertujuan untuk mengetahui dinamika plankton pada budidaya udang windu (Penaeus monodon) yang menggunakan jenis pupuk organik.05) terhadap jmlah jenis dan kelimpahan plankton. Peubah yang diamati meliputi komposisi jenis dan jumlah individu plankton. dan indeks dominasi plankton selama pemeliharaan udang windu. Hasil penelitian menunjukkan perlakuan berpengaruh tidak 4 2 3 nyata (P>0. Terdapat kecenderungan bahwa sintasan dan produksi udang vaname lebih tinggi pada perlakuan yang menggunakan probiotik hasil fermentasi dibandingkan kontrol. suhu. pH. C = 4 mg/L. Probiotik hasil fermentasi diberikan sekali/minggu sekali ke wadah pemeliharaan udang vaname dengan konsentrasi sesuai perlakuan yaitu A = 1 mg/L. dan Erfan Andi Hendrajat Balai Riset Perikanan Budidaya Air Payau. indeks keseragaman. indeks keragaman. pertumbuhan. PO . Litopenaeus vannamei pK 08 DINAMIKA PLANKTON PADA BUDIDAYA UDANG WINDU (Penaeus monodon ) YANG MENGGUNAKAN JENIS PUPUK ORGANIK DI TAMBAK Machluddin Amin. Penelitian dilakukan skala laboratorium dengan menggunakan 12 bak fiberglass yang berukuran 1 m x 1 m x 0.

324– 0.780) dan indeks dominansi (0. pupuk organik. indeks keseragaman (0.689–0.199–1. KATA KUNCI: dinamika plankton.362).masing: indeks keragaman (1. udang windu. tambak .427).

substrak tanah sawah. Analisis usaha budidaya udang menunjukkan B/C ratio 1d” 1 (tidak layak).3±1.0±5.000 m2 Hewan uji yang digunakan adalah udang windu ukuran PL-10—PL-12 dengan padat tebar 20 ekor/m2. Substrak tanah tambak. Perlakuan yang diujicobakan dalam penelitian ini adalah A. dan Abdul Mansyur Balai Riset Perikanan dan Budidaya Air Payau. KATA KUNCI: efisiensi. di mana masing-masing perlakuan diulang tiga kali. Hasil penelitian menunjukkan produksi udang windu pada perlakuan A dan B masing-masing 397 dan 623 kg/petak.6. Maros ABSTRAK Penelitian ini bertujuan untuk memberikan informasi tentang sintasan dan pertumbuhan benih udang pama dengan perlakuan substrak yang berbeda. KATA KUNCI: substrak.. Wadah yang digunakan dalam penelitian ini adalah bak fiberglass berukuran diameter dan tinggi serta volume 55 L. Hasil penelitian menujukkan bahwa sintasan dan pertumbuhan bobot benih udang pama berbeda nyata (P<0. Dengan nilai efisiensi penggunaan pakan antara petak A dan B sebesar Rp 28.05) antara perlakuan substrak tanah tambak. budidaya.dan Rp 19. Substrak tanah lumpur. sehingga diperlukan upaya untuk mengefisienkan penggunaan pakan buatan dengan mengoptimalkan lama pemeliharaan. Penelitian ini dilakukan pada bulan Oktober-Desember 2009 di Instalasi Balai Riset Perikanan Budidaya Air Payau. Penelitian dilaksanakan pada tambak ukuran luas 4.01 g. B.2 cm dan bobot awal 0. biaya produksi. Dusun Lawallu Kecamatan Mangkoso Kabupaten Barru.5 dan 21.24. umur pemeliharaan. dan substak tanah lumpur. Pertumbuhan panjang benih udang pama tidak berpengaruh nyata terhadap perbedaan substrak. masing-masing dengan dua ulangan. udang windu . Penelitian ini di desain dengan rancangan acak lengkap dengan tiga perlakuan.artinya pemeliharaan udang windu dengan pemberian pakan selama 120 hari (petak B) lebih efisien dibandingkan dengan pemeliharaan selama 90 hari (petak A). biaya pakan pada perlakuan A dan B masing-masing Rp 11..sedangkan pada perlakuan A dan B masing-masing 2.650.984. Perlakuan yang dicobakan adalah waktu pemeliharaan udang windu ditambak yaitu perlakuan A = 90 hari dan perlakuan B = 120 hari. Hewan uji yang digunakan dalam penelitian adalah benih udang pama (Post Larva 25) dengan panjang 1.03±0. sintasan dan pertumbuhan pK 10 EFISIENSI BIAYA PRODUKSI DENGAN OPTIMASI UMUR PEMELIHARAAN PADA BUDIDAYA UDANG WINDU (Penaeus monodon) DI TAMBAK Nur Ansari Rangka. Substrak tanah sawah. Peubah yang diamati secara teknis adalah pertumbuhan berat mutlak setiap 15 hari dan penghitungan rasio konversi pakan pada waktu pemeliharaan.239.. di mana sintasan dan pertubuhan bobot tertinggi diperoleh pada perlakuan substrak tanah lumpur sebesar 71. Penelitian ini bertujuan untuk mengetahui optimasi umur pemeliharaan terhadp efisiensi biaya produksi udang windu di tambak.634. Machluddin Amin.Forum Inovasi Teknologi Akuakultur 2010 pK 09 SINTASAN DAN PERTUMBUHAN BENIH UDANG PAMA (Penaeus semisulcatus) DENGAN PERLAKUAN SUBSTRAK BERBEDA Muslimin dan Sulaeman Balai Riset Perikanan Budidaya Air Payau. udang pama.14 dan 2. dan C. Maros ABSTRAK Penggunaan pakan buatan merupakan komponen terbesar dari biaya produksi udang windu (Penaeus monodon) di tambak.8±0.875.

lebar dan kedalaman secara berurutan adalah 10 m. Pakan diberikan dengan dosis 100%–2% dari total biomassa udang. tanpa penambahan tepung tapioka atau fermentasi probiotik selama masa pemeliharaan. namun tidak berakibat terjadi kematian massal.7%.2 ± 13.Forum Inovasi Teknologi Akuakultur 2010 pK 11 UPAYA PENINGKATAN PRODUKSI PADA BUDIDAYA UDANG VANAME (Litopenaeus vannamei) POLA TRADISIONAL PLUS DENGAN PENAMBAHAN TEPUNG TAPIOKA Gunarto dan Nurbaya Balai Riset Perikanan Budidaya Air Payau.3 ± 7.61%. rasio konfersi pakan (RKP) pada perlakuan A mencapai 0. ukuran 80 sampai dengan 96 ekor/kg).7%. produksi pK 12 EFISIENSI PAKAN MELALUI PENAMBAHAN MOLASE PADA BUDIDAYA UDANG VANAME SALINITAS RENDAH Brata Pantjara dan Rachmansyah Balai Riset Perikanan Budidaya Air Payau.4 ± 0. Namun demikian.2 kg/500 m2 = 506 kg/ha. Maros. B). Hasil penelitian menunjukkan bahwa sintasan udang di perlakuan A = 48.6 kg/500 m2 = 406 kg/ha.767. dengan rata-rata berat 12.975 dan lebih . Tambak ukuran 500m2 sebanyak enam petak ditebari udang vaname PL-10 dengan padat penebaran 8 ekor/m2.6813.15%. Maros ABSTRAK Penambahan tepung tapioka pada budidaya udang vaname pola tradisional plus di tambak bertujuan untuk menumbuhkan bakteri heterotrof agar dapat dimanfaatkan sebagai subsitusi pakan bagi udang yang dibudidayakan. Pada hari ke-84 udang telah sehat kembali dan dilakukan pemanenan.66 kg/bak (7. Perlakuan yang diuji yaitu: A) penambahan tepung tapioka ke air tambak dengan dosis sebanyak 40% dari total pakan yang diberikan/hari dilakukan setiap 3–5 hari sekali.64 kg/bak atau rata-rata 11. masing. ukuran 75 sampai dengan 78 ekor/kg) dibanding di perlakuan B (20. kisaran produksi 9. di mulai setelah satu minggu penebaran. Meskipun udang terserang White Spot Syndrome Virus (WSSV) pada hari ke-55–60. fermentasi probiotik.92 kg/ha) dan tanpa molase memperoleh sintasan sebesar 90. penambahan fermentasi probiotik ke air tambak sebanyak 5 mg/L/minggu selama masa pemeliharaan dan C). Perlakuan yang dicoba adalah budidaya udang vaname pada salinitas rendah dengan penambahan molase (A) dan tanpa penambahan molase (B).998.0 ± 2. Produksi udang di perlakuan A lebih tinggi dengan ukuran udang yang lebih besar (25. ukuran 84 sampai dengan 89 ekor/kg) dan C (16. Tujuan penelitian ini adalah untuk mengetahui produksi udang vanamei yang dipelihara pada salinitas rendah. Penelitian dilakukan di Balai Riset perikanan Budidaya Air payau. dengan rata-rata berat 11.3 ± 5.86 kg/bak (8.235 kg/ha). Maros ABSTRAK Budidaya udang vaname pada salinitas rendah mempunyai prospek cukup baik dan berpeluang dikembangkan.7% dan perlakuan C = 36.1 ± 13. KATA KUNCI: tepung tapioka. Kolam percobaan berupa bak beton dan digunakan sebanyak 4 buah. Kolam tersebut juga dilengkapi dengan aerasi sebanyak 10 buah.45 kg/bak atau rata-rata 12. lebih tinggi daripada perlakuan B = 41. Hasil penelitian menunjukkan bahwa perlakuan A memperoleh sintasan sebesar 91.66 g/ekor. Nilai konversi pakan yang paling efisien diperoleh pada perlakuan A.7 kg/500 m2 = 320 kg/ha. kisaran produksi 12.masing bak mempunyai ukuran panjang. karena selain harga jual udang vaname cukup tinggi juga budidayanya dapat dilakukan pada kolam air tawar. pertumbuhan udang.28-13. 1.86 g/ekor.5 m dan 1 m. Ukuran tokolan udang vaname yang dicoba adalah Post Larva (PL-34) dengan padat penebaran masing-masing perlakuan adalah 75 ekor/m2.

325.rendah dibandingkan perlakuan B yang mencapai 1. udang vaname. KATA KUNCI: molase. salinitas rendah .

Bandung ABSTRAK Tujuan dari penelitian ini adalah untuk mengidentifikasi dan memahami penggunaan probiotik dalam memperbaiki kualitas air pada budidaya udang. Wadah yang digunakan berupa corong fiber volume 50 L yang dilengkapi aerasi dan eceng gondok sebagai pelindung (shelter). Pemberian probiotik A dengan konsentrasi 0. daya tetas pK 14 PEMANFATAAN PROBIOTIK UNTUK PERBAIKAN KUALITAS AIR MEDIA PEMELIHARAAN DALAM RANGKA PENINGKATAN PRODUKSI UDANG WINDU Iskandar Fakultas Perikanan dan Ilmu Kelautan. sedangkan juvenil dan udang dewasa hidup diperairan tawar.0 hari. 85%. apabila terdapat perbedaan antara perlakuan dilanjutkan dengan Uji Jarak Berganda Duncan dengan taraf kepercayaan 5% (Gaspertz. sebagai dasar perbaikan sistem penyediaan larva udang galah. Parameter yang diukur adalah kualitas air. laterosporus.75%.5 mg/L.). 1995).57 hari .001 mL/L menghasilkan sintasan sebesar 81. Sedangkan pada pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata.0 mg/L. dan pertumbuhan udang. Pemberian probiotik A memberikan pengaruh terhadap rata-rata . Penelitian ini merupakan penelitian pendahuluan yang dilakukan di laboratorium selama satu bulan. Universitas Padjadjaran.) yang berukuran PL-20.. Nitrosomonas sp.) berpengaruh nyata terhadap sintasan benih udang windu. Ikan uji yang digunakan dalam penelitian ini adalah benih udang windu (Penaeus monodon Fab. Penelitian I adalah pengujian probiotik A. Penelitian menggunakan Rancangan Acak Lengkap (RAL) dengan 3 perlakuan salinitas media penetasan terdiri atas 0 ‰ (kontrol). Keragaan larva yang diperoleh pada media penetasan 0‰ dan 10‰ menunjukkan hasil yang tidak berbeda nyata. B. 5 ‰. pertumbuhan udang dianalisis dengan menggunakan analisis sidik ragam dengan uji F. Kontrol (tanpa pemberian probiotik A).Forum Inovasi Teknologi Akuakultur 2010 pK 13 PENGARUH SALINITAS MEDIA TERHADAP LAMA WAKTU INKUBASI DAN DAYA TETAS TELUR UDANG GALAH (Macrobrachium rosenbergii) Yogi Himawan dan Ikhsan Khasani Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. dan Rhodobacter sp.5 mg/L. Rhodococcus sp. Pemberian bakteri dengan konsentrasi 0. 10 ‰.75%–68. Metode yang dipergunakan pada penelitian ini adalah metode eksperimen dengan menggunakan Rancangan Acak Lengkap (RAL). sebelum diaplikasikan di tambak. terdiri atas: O.. dan tiga ulangan.25%.6±0. diikuti perlakuan 5‰ sebesar 10±0.002 mL/L. P. sehingga permasalahan limbah sisa pakan dan metabolit yang menjadi kendala dalam budidaya udang bisa ditanggulangi. Pemberian probiotik B dengan konsentrasi 5. dan R. udang galah. Q. Pemberian bakteri probiotik A (Bacillus sp. Penelitian II pengujian probiotik B. waktu inkubasi.003 mL/L. Sukamandi ABSTRAK Fase kehidupan udang galah sangat dipengaruhi salinitas lingkungan.15. dan 0‰ sebesar 11.) dan probiotik B (mengandung bakteri Bacillus polimyxa.3±1.. 88%. dan D. Pemberian probiotik B dengan konsentrasi 7. Induk udang galah dengan bobot rata-rata 20 g yang sedang mengerami telur selama 5 hari pasca pembuahan ditampatkan dalam media uji. karena secara alamiah larva hidup di periran bersalinitas. Pemberian probiotik A dengan konsentrasi 0. Kontrol (tanpa pemberian probiotik B). Dengan meneliti dua jenis probiotik. B. C.50%. Masing-masing perlakuan diulang sebanyak empat kali. Nitrobacter sp. yaitu probiotik A (mengandung bakteri Bacillus sp. Penelitian bertujuan untuk mengetahui pengaruh salinitas terhadap lama waktu pengeraman dan daya tetas telur udang galah. Tingkat sintasan yang diberi probiotik B berkisar antara 63.25%.001 mL/L. dan kontrol 66. terdiri atas: A. Hasil pengamatan menunjukkan bahwa media bersalinitas 10‰ memberikan hasil terbaik dengan lama inkubasi dan daya tetas 6. 85%. Pemberian probiotik A dengan konsentrasi 0. Pemberian probiotik B dengan konsentrasi 2. dan tanpa pemberian probiotik menghasilkan sintasan sebesar 62. Pengaruh perlakuan terhadap sintasan. KATA KUNCI: salinitas. Aplikasi probiotik setiap tiga hari sekali. sintasan..

pemberian dengan konsentrasi 0. Pemberian probiotik B menunjukkan hasil yang tidak berbeda nyata. udang windu.4440 g dan kontrol 0.8935 g). pertumbuhan . kualitas air.pertumbuhan mutlak benih udang windu.4255–0. KATA KUNCI: probiotik. Ratarata pertumbuhan mutlak individu yang diberi probiotik B berkisar antara 0. sintasan.3660 g.001 mL/L menghasilkan pertumbuhan tertinggi (0.

33±0. Penelitian ini bertujuan untuk mengetahui konsentrasi dan ukuran templat DNA genom udang galah yang optimal untuk analisis RAPD. Sukamandi ABSTRAK Ketersediaan tambak payau bersalinitas rendah merupakan potensi besar guna meningkatkan produksi udang galah nasional. 10 ppt. Penelitian ini bertujuan untuk mengetahui pengaruh perubahan salinitas terhadap sintasan dan keragaan dari postlarva (PL) udang galah (Macrobrachium rosenbergii) sebagai salah satu upaya pembesaran udang galah pada media air payau.09 cm. diantaranya karakteristik templat DNA genom yang meliputi kemurnian. Optimasi ukuran templat dilakukan dengan menguji sampel-sampel DNA genom yang komposisi ukurannya bervariasi. populasi yang memiliki rata-rata panjang total dan panjang standar tertinggi diperoleh pada perlakuan 5 ppt masing-masing sebesar 3. RAPD pK 16 PENGARUH PERUBAHAN SALINITAS TERHADAP SINTASAN DAN KERAGAAN PERTUMBUHAN POST LARVA UDANG GALAH (Macrobrachium rosenbergii) POPULASI CIASEM PADA SKALA LABORATORIUM Rommy Suprapto dan Dadan Sunandar Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.05). dibutuhkan benih udang galah dengan daya toleransi tinggi terhadap perubahan salinitas media. PCR. Sukamandi. 20 ppt. Hasil analisis menunjukkan adanya tingkat konsentrasi dan komposisi templat DNA genom yang optimal untuk menghasilkan profil RPAD udang galah yang konsisten. Optimasi konsentrasi dilakukan dengan menguji sampel-sampel dengan konsentrasi templat yang berbeda mulai dari 5 ng – 2000 nano gram (ng) per rekasi PCR. dan 20 ppt sintasan dari post larva udang galah mencapai 100%. Ditinjau dari keragaan pertumbuhan. 15 ppt. Selain itu. Guna mendukung prgoram revitalisasi tambak. Konsentrasi dna 500 ng/reaksi mampu menghasilkan amplifikasi DNA yang optimal. KATA KUNCI: Macrobrachium rosenbergii. Templat DNA dengan berat molekul rendah tidak dapat diamplifikasi sedangkan tempat DNA dengan komposisi campuran dapat diamplifikasi tetapi tidak konsisten. Sukamandi ABSTRAK Keberhasilan analisis RAPD-PCR sangat dipengaruhi oleh beberapa faktor. 15 ppt.92±0. Hasil analisis sidik ragam (ANOVA) menunjukkan bahwa keragaan pertumbuhan dari post larva udang galah tidak berbeda nyata pada setiap perlakuan (P < 0. template dengan berat molekul rendah (2) dan templat dengan berat molekul kombinasi tinggi dan rendah (3). Populasi yang digunakan pada penelitian ini adalah populasi Ciasem yang sebelumnya dipelihara pada salinitas 10 ppt dari larva hingga PL 29. KATA KUNCI: pertumbuhan. Penelitian ini dilakukan pada corong pemeliharaan volume 50 liter selama 25 hari secara indoor dengan 6 perlakuan yaitu 5 ppt. konsentrasi. sedangkan sintasan pada perlakuan 25 ppt mencapai 61.13 cm dan 1. sedangkan pada konsentrasi rendah (5 ng) dan tinggi (2000 ng) tidak menghasilkan band dna. 10 ppt (kontrol). salinitas. pita-pita RAPD yang konsisten juga diperoleh apabila template yang digunakan merupakan templat yang memiliki berat molekul tinggi.Forum Inovasi Teknologi Akuakultur 2010 pK 15 OPTIMASI TEMPLAT DNA GENOM UDANG GALAH. dan gradual dengan masing-masing 3 ulangan di Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar. 25 ppt. dan ukuran templat. Hasil yang diperoleh adalah pada salinitas 5 ppt. udang galah .67%. yaitu templat dengan berat molekul tinggi (1). Macrobrachium rosenbergii DALAM PROSES PCR – RAPD Dadan Sunandar dan Imron Loka Riset Pemuliaan dan Teknologi Budidaya Perikanan Air Tawar.

pemberian pakan. kepiting yang mampu mencapai bobot 80 g yakni 58%–90%. Pakan diberikan dua kali sehari selama penelitian. dan Andi Tenriulo Balai Riset Perikanan Budidaya Air Payau. Sintasan yang diperoleh pada penelitian ini yakni 52%–54. tambak pK 18 PEMACUAN PERGANTIAN KULIT KEPITING BAKAU MELALUI MANIPULASI LINGKUNGAN UNTUK MENGHASILKAN KEPITING LUNAK Nur Ansari Rangka dan Sulaeman Balai Riset Perikanan dan Budidaya Air Payau. KATA KUNCI: pergantian kulit. kepiting lunak .66 g/ekor ditebar dengan kepadatan 200 ekor/petak dan dipelihara selama 3 bulan. baik pertumbuhan bobot. Kontroversi terhadap penolakan produk kepiting lunak akibat pemotongan kaki kepiting sebagai upaya mempercepat pergantian kulit sudah merebak hingga ke manca negara sehingga perlu dicari jalan lain yang dapat mempercepat pergantian kulit tanpa dilakukan pemotongan kaki. Maros ABSTRAK Penelitian dilakukan di tambak percobaan Marana dengan menggunakan enam petak tambak berukuran luas 250 m2. kesimpulan dari penelitian ini adalah pemberian pakan berupa ikan rucah atau campuran antara ikan rucah dan pelet lebih baik dibandingkan dengan pelet saja. kepiting bakau. Berdasarkan persentase. perlakuan pemberian pelet berbeda nyata dengan kedua perlakuan lainnya dan perlakuan pemberian ikan rucah dan pemberian pakan gabungan pelet dan rucah tidak berbeda nyata dan lebih tinggi dibanding pemberian pelet. Penelitian ini bertujuan untuk melihat kelayakan pembesaran kepiting bakau di tambak dengan menggunakan 3 perlakuan pakan yakni berupa pelet udang (A). Benih kepiting crablet-30 (C-30) dengan bobot rataan 0. Hasil penelitian menunjukkan bahwa manipulasi salinitas dinilai lebih aman daripada rangsangan pergantian kulit dengan manipulasi hormon yang akan mempengaruhi penerimaan konsumen.Forum Inovasi Teknologi Akuakultur 2010 pK 17 PEMBESARAN KEPITING BAKAU (Scylla serrata) DI TAMBAK DENGAN PEMBERIAN PAKAN BERBEDA Herlinah. Sulaeman. ikan rucah (B).5%. Petakan tambak dilengkapi dengan pagar dari waring yang dipasang tertancap pada sekeliling bagian dalam pematang tambak untuk mencegah kepiting keluar. panjang. maupun lebar karapas (P>0. Penelitian akan dilakukan di laboratorium BRPBAP selama tiga bulan untuk mendapatkan informasi tentang pemacuan molting kepiting bakau melalui manipulasi salinitas media pemeliharaan.05). Maros ABSTRAK Kepiting lunak merupakan produk dari budidaya kepiting bakau yang permintaan baik lokal maupun ekspornya belum dapat dipenuhi. masing-masing dua kali ulangan dan dirancang dengan Rancangan Acak Lengkap (RAL). manipulasi lingkungan. Hasil penelitian menunjukkan bahwa tidak terdapat pengaruh yang nyata antar perlakuan terhadap sintasan dan pertumbuhan. KATA KUNCI: kepiting bakau. Oleh karena itu. Dari pencapaian bobot ini. dan gabungan keduanya (C).

000 m2. rumput laut dengan kepadatan 1. Ikan bandeng yang digunakan adalah gelondongan umur 1. Tambak yang digunakan berukuran 10. sintasan.04 ha. sintasan. Tambak ditebari benih rajungan. Bahan yang digunakan adalah citra ALOS akuisisi tahun 2009. dan Akhmad Mustafa Balai Riset Perikanan Budidaya Air Payau. tambak bersalinitas tinggi.1±0. sehingga perlu riset budidaya rajungan pada musim kemarau. restoking kepiting bakau. Benih rajungan yang digunakan adalah krablet 10 dengan lebar karapas dan bobot masing-masing adalah 4. Kabupaten Mamuju pK 20 BUDIDAYA RAJUNGAN (Portunus pelagicus) PADA TAMBAK BERSALINITAS TINGGI Suharyanto dan Abdul Mansyur Balai Riset Perikanan Budidaya Air Payau.02 g dengan kepadatan 1 ind.Forum Inovasi Teknologi Akuakultur 2010 pK 19 KERAPATAN HUTAN MANGROVE SEBAGAI DASAR REHABILITASI DAN RESTOCKING KEPITING BAKAU DI KABUPATEN MAMUJU PROVINSI SULAWESI BARAT Mudian Paena. Hasnawi.000 kg sebagai selter dan 500 ekor ikan bandeng untuk mengendalikan lumut yang tumbuh.573. Dibalik manfaat mangrove yang demikian banyaknya. Peubah yang diamati adalah pertumbuhan lebar karapas. merupakan suatu ekosistem yang sangat unik yaitu sebagai penyeimbang antara ekosistem daratan dengan ekosistem lautan. peta digital Rupa bumi Indonesia wilayah Kabupaten Mamuju serta peralatan survai lainnya. Penelitian ini dilaksanakan di Desa Taipa Kecamatan Mapakkasunggu Kabupaten Takalar mulai Tanggal 26 September sampai dengan 24 Desember 2009 (90 Hari). Selama penelitian diberi makan ikan rucah 2 kali sehari dengan dosis 15%—5% dari total biomasa.2 g. KATA KUNCI: rajungan. pertumbuhan. KATA KUNCI: kerapatan hutan mangrove./m2.2 mm dan 0. Hasil penelitian menunjukkan bahwa kerapatan mangrove di wilayah pesisir Kabupaten Mamuju berkisar 1.0 ± 2. produksi . perlindungan. Metode penelitian adalah pemanfaatan penginderaan jauh dan sistem informasi geografis serta survai lapangan. serta luas hutan mangrove di Kabupaten Mamuju mencapai 1. bobot.5 bulan dengan panjang dan bobot masing-masing adalah 8.2 ± 2. Tujuan penelitian ini adalah untuk mendapatkan data dan informasi tentang laju pertumbuhan sintasan dan produksi rajungan yang dibudidayakan pada tambak bersalinitas tinggi. Hasil penelitian menunjukkan bahwa pertumbuhan rajungan lambat pada salinitas tinggi (41‰— 4 9‰) mengakibatkan sintasan dan produksi rendah.100 pohon/ha.000 ekor/ha ukuran crablet-30. Dengan luasan tersebut dapat dilakukan restocking sebanyak 1. jumlah permudaan 450–500 pohon/ ha. Penelitian ini bertujuan untuk mengetahui kerapatan dan luas sebaran hutan mangrove di Kabupaten Mamuju serta kemungkinan restocking kepiting bakau.7 cm dan 4. dan pelestarian alam.000–1. pengrusakan mangrove juga terus berlangsung oleh berbagai alasan. Maros ABSTRAK Hutan mangrove merupakan salah satu sumberdaya alam daerah pantai yang mempunyai arti penting berupa fungsi produksi. Budidaya rajungan tidak disarankan pada tambak bersalinitas tinggi. dan produksi serta parameter kualitas air. Maros ABSTRAK Pada musim kemarau banyak tambak tidak dimanfaatkan petambak karena salinitas cukup tinggi yakni di atas 40‰ sehingga tambak tidak dapat berproduksi.300 pohon/ha dengan rata-rata 1. sehingga upaya rehabilitasi saat sekarang sangat penting untuk dilakukan tentunya dengan dukungan informasi mengenai sebaran dan kerapatannya. data yang diperoleh dibahas secara deskriptif.05±0.

Penelitian ini bertujuan untuk melakukan kajian kelayakan perairan untuk pengembangan budidaya rumput laut di Kabupaten Gorontalo Utara. dan I Nyoman Radiarta Pusat Riset Perikanan Budidaya. Dukungan data dasar mengenai potensi wilayah (perairan) tentunya sangat diperlukan untuk mendukung program nasional tersebut. DI KABUPATEN GORONTALO UTARA PROVINSI GORONTALO Hatim Albasri. Hasil tersebut memperlihatkan bahwa kadar semua logam berat yang diamati masih sesuai dengan nilai ambang batas baku mutu air tawar yang ditetapkan oleh pemerintah pada kelas III (untuk perikanan). Hal ini terbukti dengan telah banyaknya kegiatan budidaya rumput laut yang berkembang terutama di Kecamatan Angrek (kawasan inti minapolitan).Forum Inovasi Teknologi Akuakultur 2010 pLL 01 KAJIAN SPASIAL KELAYAKAN PERAIRAN UNTUK PENGEMBANGAN BUDIDAYA RUMPUT LAUT. Pengumpulan data lapangan telah dilakukan pada bulan Maret 2010. Jakarta ABSTRAK Pengamatan terhadap kandungan logam berat dalam air dan sedimen telah dilakukan di perairan Danau Maninjau pada bulan September dan Oktober 2009. Tingkat kelayakan perairan dikategorikan dalam empat kategori yaitu sangat layak. Sebanyak 28 titik pengamatan yang tersebar secara acak telah dikumpulkan selama survei lapangan. bioakumulasi. Secara umum. Budidaya rumput laut (Kappaphycus alvarezii) merupakan satu komoditas unggulan untuk mendukung program nasional minapolitan dikabupaten ini. dan Achmad Sudradjat Pusat Riset Perikanan Budidaya. Akumulasi logam berat dalam air Danau Maninjau lebih rendah dibandingkan di dalam sedimen. Distribusi kandungan logam Cd dan Pb tidak terdeteksi baik pada pengamatan bulan September dan Oktober 2009. KATA KUNCI: minapolitan. selain itu ada indikasi bahwa logam berat tersebut terakumulasi dalam sedimen. Untuk memfokuskan kegiatan budidaya rumput laut. logam berat . SIG.03 mg/L. I Nyoman Radiarta. Kandungan logam Cu pada pengamatan bulan September hasilnya tidak terdeteksi. Kandungan Hg pada pengamatan bulan September rata-rata sebesar 0. Seluruh data yang dikumpulkan kemudian dianalisis secara spasial dengan sistem informasi geografis (SIG) yang digabunggan dengan multi-criteria analysis (MCA). layak. Secara umum. Hasil dari penelitian ini diharapkan dapat memberikan masukan berupa data dasar potensi wilayah guna mendukung program nasional minapolitan di Kabupaten Gorontalo Utara. tetapi pada pengamatan bulan Oktober 2009 hasilnya masih di bawah 0.136 mg/L dan pada pengamatan bulan Oktober 2009 tidak terdeteksi. Adang Saputra. Jakarta ABSTRAK Kabupaten Gorontalo Utara telah ditetapkan sebagai salah satu kawasan pengembangan minapolitan. KATA KUNCI: Danau Maninjau. Provinsi Gorontalo. cukup layak dan tidak layak. kondisi perairan sangat mendukung pengembangan budidaya rumput laut. analisis spasial hanya dibatasi pada kedalaman kurang dari 50 m. rumput laut. Anjang Bangun Prasetio. Kappaphycus alvarezii. Kajian dilakukan secara spasial dengan menggabungkan data lapangan dan data penginderaan jauh (inderaja). Distribusi logam Hg pada bulan September lebih tinggi dibandingkan pada bulan Oktober 2009 dengan kadar tertinggi ditemukan di dekat lokasi pertanian dan saluran pengeluaran (outlet). Gorontalo Utara pLL 02 DISTRIBUSI LOGAM BERAT DALAM AIR DAN SEDIMEN DI PERAIRAN DANAU MANINJAU PROVINSI SUMATERA BARAT Adang Saputra. kandungan logam berat di lokasi penelitian masih dalam batas ambang yang ditoleransi untuk kegiatan budidaya ikan.

Kelimpahan alga perifiton berkisaran antara 172 individu/cm2-414 individu/cm2. mangrove pLL 04 STUDI KUALITAS AIR PADA INLET DAN OUTLET DI BALAI BESAR RISET PERIKANAN BUDIDAYA LAUT.Forum Inovasi Teknologi Akuakultur 2010 pLL 03 KELIMPAHAN DAN STRUKTUR KOMUNITAS ALGA PERIFITON PADA KERAPATAN VEGETASI MANGROVE YANG BERBEDA DI TAMBAK BLANAKAN. Analisis Variansi menunjukkan adanya perbedaan yang nyata di setiap stasiun. Penelitian ini bertujuan untuk mengetahui mutu air laut sebagai sumber utama kegiatan budidaya di sekitar BBRPBL Gondol-Bali. indeks keseragaman berkisar antara E=0. nitrit. tambak. Supii. Penelitian ini dilakukan pada bulan Februari – Maret 2009 dengan menggunakan metode survey dan random sampling. KATA KUNCI: kualitas air.7112. DO. dan Erlania*) *) Pusat Riset Perikanan Budidaya. Tujuan penelitian ini adalah untuk mengetahui kelimpahan dan struktur komunitas alga perifiton pada kerapatan vegetasi mangrove yang berbeda di tambak Blanakan. Adi Hanafi. Hasil penelitian menunjukkan bahwa kualitas fisika air inlet yang meliputi suhu. Pengambilan sampel alga perifiton dilakukan setelah perendaman kantung serasah daun pada hari ke-10. 20 dan 30. Sementara untuk konsentrasi nitrat dan fosfat berada di atas ambang baku mutu yang ditetapkan. dan salinitas masih berada dalam kisaran yang normal untuk kehidupan biota laut. Daerah penelitian dibagi menjadi 3 stasiun berdasarkan vegetasi mangrove yang berada pada Tambak Blanakan. dan plankton dilakukan seminggu sekali. Subang. TSS. Sampling air secara regular untuk pengamatan fisika.962. Indeks keanekaragaman berkisar antara H’=2. Kualitas kimia air untuk pH.0760. Hasil penelitian selama Agustus hingga Oktober 2009 tidak menunjukkan adanya fluktuasi mutu air inlet dan outlet. BBRPBL Gondol . Berdasarkan hasil penelitian ditemukan 38 spesies alga perifiton. inlet. dan amoniak masih pada kisaran yang sesuai dengan baku mutu yang ditetapkan oleh pemerintah.814-0. dan Sudewi Balai Besar Riset Perikanan Budidaya Laut. outlet. Perifiton yang terdapat di Tambak Blanakan. Berdasarkan indeks keragaman plankton dapat dinyatakan kondisi air tidak tercemar hingga tercemar sedang. Dara Kasih**). Nitzschia sigma. Kelimpahan tertinggi alga perifiton terdapat pada stasiun II adalah 414 individu/cm2. Subang.085. KATA KUNCI: alga perifiton.vermicularis dan Pleurosigma angulatum merupakan spesies yang melimpah. SUBANG Joni Haryadi*). Subang mempunyai peranan yang sangat penting dalam jaring-jaring makanan. N. Gondol ABSTRAK Keberhasilan usaha budidaya laut baik perbenihan maupun pembesaran sangat ditentukan oleh pengaruh kualitas air. sedangkan indeks dominansi berkisar antara D=0. GONDOL-BALI Apri I.853. alga hijau biru dan alga hijau). kimia. Jakarta **) Universitas Islam Negeri-Syarif Hidayatullah. Jakarta ABSTRAK Luruhan daun mangrove yang jatuh diperairan menyediakan substrat untuk menempel bagi alga perifiton (diatom.

21%). kelimpahan. Ani Widiyati. KATA KUNCI: limbah. 2 jenis untuk ikan nila dan 3 jenis pakan untuk ikan bawal.58%–13.) di laboratorium. Wadah percobaan adalah fiber glass diameter 1 m dan tinggi 80 cm. akuaponik. volume air 500 L. dilakukan pada hari ke-8 sejak dilakukannya penebaran.17% dan 8. Wadah pengujian berupa 14 unit akuarium kaca berukuran 70 cm x 50 cm x 60 cm yang dilengkapi aerasi. dan 1. KATA KUNCI: konversi pakan.16 g. 2). Jumlah ikan uji setiap wadah 10 ekor dengan bobot rataan 10 g. 1.48%–9. Bogor.dengan produksi Moina sp.89%–17. Panen Moina sp. Perlakuan adalah pemupukan dengan perbandingan N. 1. nila (Oreochromis niloticus) dan bawal (Colossoma sp.83– 1. Nilai kisaran limbah hara N dan P yang dibuang ke air pemeliharaan.53%–15. Penelitian ini bertujuan untuk mengetahui dosis limbah (sedimen) hasil budidaya ikan dengan sistem akuaponik untuk produksi pakan alami Moina sp. Hasil penelitian menunjukkan bahwa sedimen limbah budidaya ikan sistem akuaponik dapat digunakan sebagai pupuk untuk produksi Moina sp. dan Nuryadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Keberadaan kandungan N dan P dalam limbah budidaya ikan dengan sistem akuaponik diduga dapat dimanfaatkan sebagai pupuk organik untuk menumbuhkan plankton sebagai pakan alami bagi ikan. Tujuan dari penelitian ini adalah untuk mendapatkan konversi pakan dan limbah hara N dan P yang dibuang ke air pemeliharaan dari pakan ikan mas (Cyprinus carpio). 250 g pupuk kandang/kotoran ayam + 950 g sedimen + 30 g TSP. ikan nila (3.89% dan 11.88–1.78%). Rancangan percobaan menggunakan rancangan acak lengkap (RAL) dengan 3 perlakuan dan 3 ulangan. ikan nila. dan keanekaragaman plankton. Menggunakan 14 jenis pakan ikan komersial yang beredar di pembudidaya ikan karamba jaring apung (KJA) di Waduk Cirata dan Jatiluhur.. dan 3). Kusdiarti.73–1. Data dianalisis secara deskriptif.87.53%) dan ikan bawal (8.Forum Inovasi Teknologi Akuakultur 2010 pLL 05 P E M A N FA ATAN LIMBAH BUDIDAYA AKUAPONIK UNTUK PERTUMBUHAN PAKAN ALAMI Winarlin. yaitu: ikan mas (5. serta produksi Moina sp. Parameter yang diamati adalah jenis. dengan mencampur 950 g sedimen + 250 g pupuk kandang/kotoran ayam + 30 g TSP. Hasil Penelitian menunjukkan bahwa nilai kisaran konversi pakan untuk ikan mas. 9. P. setara dengan dosis pupuk sebagai berikut: 1) 500 g pupuk kandang/kotoran ayam + 40 g TSP . yang terdiri atas: 9 jenis pakan untuk ikan mas.96 ±1.900 g sedimen + 20 g TSP. Penelitian dilakukan di Instalasi Riset Lingkungan Perikanan Budidaya dan Toksikologi Balai Riset Perikanan Budidaya Air Tawar Cibalagung.63% dan 10. dan bawal adalah 1. Pengukuran N dan P dilakukan pada ikan dan pakan. indek dominasi.71%– 10. limbah hara N dan P .23%–6.90. pakan alami pLL 06 HUBUNGAN KONVERSI PAKAN DENGAN BEBAN LIMBAH HARA N DAN P YANG DIBUANG KE AIR PEMELIHARAAN Yosmaniar dan Fatuchri Sukadi Balai Riset Perikanan Budidaya Air Tawar ABSTRAK Pentingnya manajemen pakan dalam budidaya perikanan karena berkaitan dengan beban limbah N dan P yang dihasilkan berupa sisa pakan yang tidak termakan dan sisa metabolit (feces) ikan.89. K = 16:20:0.

Sukenda***). agalactiae setelah dilakukan uji Postulat Koch. agalactiae. Tujuan penelitian ini untuk mengetahui tingkat keganasan atau virulensi dari beberapa jenis isolat S. dan NK1 (5) yang berasal dari organ otak. mata. Hasil yang diperoleh. tingkat keganasan pLL 08 PENCEGAHAN HAMA DAN PENYAKIT RUMPUT LAUT Petrus Rani PongMasak Balai Riset Perikanan Budidaya Air Payau. namun masih sering terjadi kegagalan panen dan kerugian akibat beberapa kendala dan hambatan dalam operasional budidaya. khususnya dalam pencapaian visi Kementerian Kelautan dan Perikanan. Maros ABSTRAK Komoditas rumput laut menjadi salah satu pilihan utama dalam bidang perikanan budidaya pada berbagai program pemerintah maupun LSM. Pada Postulat Koch ke-3 terjadi exophthalmus dan abses pada kulit. dan ginjal ikan Nila dari daerah Jawa Barat dan Jawa Tengah.6 juta ton per tahun sekarang ini menjadi 7. diperlukan identifikasi masalah hama dan penyakit pada rumput laut serta usaha pencegahannya. Oreochromis niloticus. di tambak telah berkembang pesat di beberapa sentra pengembangan budidaya.6 juta ton per tahun pada 2014. Bakteri teridentifikasi digunakan kembali untuk pengujian Postulat Koch sampai 3 kali pengujian. dan 5 muncul gejala whirling setelah 5 hari pasca injeksi dan otak dalam keadaan hancur. yakni Indonesia penghasil produk kelautan dan perikanan terbesar pada tahun 2015.1 mL intra peritoneal pada 20 ekor ikan dan diamati gejala klinis serta kematian yang muncul. sedangkan dari hasil uji Postulat Koch ke-2 mata mulai mengkerut dan tampak adanya clear operculum. di laut dan Gracillaria sp. Produksi rumput laut ditargetkan meningkat dari 2. Makalah ini merupakan tulisan review berdasarkan hasil penelitian dan pengalaman di lapangan selama beberapa tahun terakhir. KATA KUNCI: Streptococcus agalactiae. Budidaya rumput laut khususnya Kappaphycus sp. N17O (4). N14G (3).Forum Inovasi Teknologi Akuakultur 2010 pLL 07 POTENSI UJI POSTULAT KOCH TERHADAP TINGKAT KEGANASAN Streptococcus agalactiae Angela Mariana Lusiastuti*). pada uji Postulat Koch I gejala klinis yang nampak warna tubuh ikan Nila menghitam dan garis vertikal tubuh juga menghitam. N4M (2). Metode budidaya cukup sederhana dan secara teknis dapat diadopsi serta dikembangkan oleh masyarakat pembudidaya. Esti Handayani Hardi**). Bogor **) Mahasiswa S3 Program Studi Ilmu Akuakultur Institut Pertanian Bogor ***) Dosen Budidaya Perairan Sekolah Pascasarjana Institut Pertanian Bogor *) ABSTRAK Penyakit Streptococcosis yang disebabkan oleh Streptococcus agalactiae adalah penyakit yang menyerang ikan Nila. Kelima isolat bakteri tersebut masing-masing diinjeksikan 0. Isolat 1. Tulisan isi bertujuan untuk mengidentifikasi hama dan penyakit yang sering menyebabkan kegagalan budidaya serta uraian cara pencegahan dan penanganan hama dan penyakit rumput laut. sehingga dapat meminimasi kegagalan panen. Isolat yang digunakan merupakan koleksi BRPBAT Bogor yaitu isolat N3M (1). 4. Ikan yang menunjukkan gejala klinis diisolasi kembali untuk memperoleh kepastian infeksi akibat S. Oleh karena itu. Postulat Koch. Taukhid*) Balai Riset Perikanan Budidaya Air Tawar. sehingga sangat dibutuhkan manajemen budidaya yang dapat meminimasi kegagalan produksi. . Salah satu faktor yang paling merugikan pembudidaya adalah terjadinya serangan hama dan penyakit.

KATA KUNCI: rumput laut. hama. pencegahan . penyakit.

57°C–30.1113 mg/L. fosfat 0.10– 36.095. kedalaman 1–40 meter.Indra Jaya Asaad. Pengumpulan data primer dilakukan dengan cara wawancara mendalam. dan Makmur Balai Riset Perikanan Buddidaya Air Payau. analisis hierarki proses. Opsi selanjutnya berdasarkan nilai bobot gabungan tertinggi yaitu transplantasi karang.0008–0.33 ha. pengisian formulir penilaian (skoring) dan kuisioner kepada masing-masing kelompok responden.66°C. Kabupaten Kolaka pLL 10 OPSI PEMANFAATAN WILAYAH PESISIR DI KABUPATEN KEPULAUAN SELAYAR SULAWESI SELATAN A. Metode penelitian yang dilakukan adalah survai lapangan dan pemanfaatan sistem informasi geografis.81–6.90 ppt.039–0. Penelitian ini bertujuan untuk mengetahui potensi. Metode penelitian menggunakan metode survei yang meliputi pengumpulan data primer dan sekunder. Analisa data menggunakan analisa hierarki proses dengan bantuan perangkat expert choice 11 untuk menentukan opsi pemanfaatan wilayah pesisir. bahan organik total 37. KARAKTERISTIK. Maros ABSTRAK Kabupaten Kolaka sejak tahun 2000 merupakan salah satu kabupaten sentra produksi rumput laut di Provinsi Sulawesi Tenggara. Hasil penelitian menunjukkan bahwa potensi lahan budidaya rumput laut di Kabupaten Kolaka mencapai 27.37. dan total suspensi <25–80 mg/L. Maros ABSTRAK Penelitian untuk mengkaji opsi pemanfaatan wilayah pesisir dan pengelolaan terumbu karang di Kabupaten Kepulauan Selayar telah dilakukan bulan Oktober – November 2009.1–8.01169 mg/L. suhu 29.32 ha. karakteristik. KATA KUNCI: potensi. Pengumpulan data sekunder dilakukan dari laporan berbagai instansi yang disesuaikan dengan tujuan penelitian.38–44.09 mg/L. DAN KESESUAIAN LAHAN BUDIDAYA RUMPUT LAUT DI PERAIRAN PESISIR KABUPATEN KOLAKA SULAWESI TENGGARA Mudian Paena dan Kamariah Balai Riset Perikanan Budidaya Air Payau.685 mg/L. Bahan yang digunakan adalah peta digital Rupa bumi Indonesia wilayah Kabupaten Kolaka dan peralatan survai lainnya. kurang sesuai 2.02–9. dengan tingkat kesesuaian lahan sesuai 21.Forum Inovasi Teknologi Akuakultur 2010 pLL 09 POTENSI. salinitas 36. nitrat 0. Karakter perairan pesisir Kabupaten Kolaka dicirikan dengan kecerahan 1.0032–0. Kabupaten Kepulauan Selayar. Syarifuddin Tonnek.820.3 meter. kesesuaian rumput laut. Hasil penelitian menunjukkan bahwa aktivitas akuabisnis berupa budidaya rumput laut menjadi opsi utama pemanfaatan wilayah pesisir. Petrus Rani Pong-Masak. Rachman Syah.30 ha dan tidak sesuai 3. Kata kunci : Opsi pemanfaatan wilayah pesisir. Mudian Paena.610.95 ha.0037 mg/L. besi 0. Sampai saat ini belum ada informasi yang memadai tentang potensi dan tingkat kesesuaian lahan budidaya rumput laut di perairan pesisir Kabupaten Kolaka. oksigen terlarut 5. . demikian pula dengan karakteristik físika dan kimia oseanografinya. Selain itu dilakukan observasi lapangan sebagai alat untuk triangulasi data di lapangan. dan kesesuaian lahan di perairan pesisir Kabupaten Kolaka.695.85 mg/L. aktivitas pengembangan ekowisata dan aktivitas budaya/pemuda bahari. pH antara 6.0267–0. nitrit <0. Penelitian ini difokuskan pada Kecamatan Bontomatene Kabupaten Kepulauan Selayar.

salinitas. Teluk Lampung pLL 12 KARAKTERISTIK KUALITAS PERAIRAN TAMBAK DI KABUPATEN PONTIANAK Makmur. kandungan oksigen telarut. Ketiga faktor tersebut merupakan hasil pengelompokkan faktor-faktor yang memiliki kedekatan dalam kuadran. Muhammad Chaidir Undu. analisis faktor. Sebanyak 43 titik sampel telah ditentukan secara acak pada perairan tambak yang meliputi tambak tradisional dan intensif serta pada perairan sungai dan pesisir. faktor teknologi budidaya. konduktivitas. dan faktor pasar. Utoyo. Hal yang sama ditemukan pada perairan sungai dan pesisir Kabupaten Pontianak. yaitu : faktor infrastruktur dan kondisi perairan.Indra Jaya Asaad. NH3. dan Muawanah Balai Riset Perikanan Buddidaya Air Payau. Sedangkan untuk tambak intensif beberapa parameter kimia seperti kandungan N dan P menunjukkan nilai yang melebihi kisaran optimal pada perairan tambak. PO4 dan Fe. Maros ABSTRAK Penelitian mengenai faktor-faktor kondisi yang mendukung kontinuitas aktivitas budidaya Keramba Jaring Apung (KJA) di Teluk Lampung telah dilakukan pada Bulan Agustus 2009. dan Hasnawi Balai Riset Perikanan Buddidaya Air Payau. NO2. Sasaran penelitian adalah pengusaha KJA sebagai key responden yang berada pada kawasan tersebut.Indra Jaya Asaad. Makmur. Analisa data dilakukan secara statistik analisis multivariat dengan pendekatan analisis faktor.Forum Inovasi Teknologi Akuakultur 2010 pLL 11 ANALISIS FAKTOR KONDISI KONTINUITAS BUDIDAYA KERAMBA JARING APUNG DI TELUK LAMPUNG A. Hasil penelitian menunjukkan bahwa terdapat 3 faktor utama yang menjadi alasan kontinuitas usaha budidaya KJA bagi para pengusaha. NO3. Parameter kualitas perairan yang diamati adalah suhu. Hasil penelitian menunjukkan bahwa kualitas perairan pada tambak tradisional menunjukkan kondisi yang kurang sesuai untuk kegiatan budidaya perikanan. Maros ABSTRAK Penelitian mengenai kualitas perairan tambak di Kabupaten Pontianak telah dilakukan pada Bulan Agustus 2009 di Kabupaten Pontianak Provinsi Kalimantan Barat. Rachman Syah. Kabupaten Pontianak . lama berusaha dalam kurun waktu lebih dari 3 – 5 tahun dan masih aktif sebagai pengusaha KJA. Metode penelitian menggunakan metode wawancara mendalam dan pengisian kuisioner oleh key responden. tambak. pH. Cakupan wilayah penelitian meliputi Teluk Hurun. KATA KUNCI: keramba jaring apung. Teluk Ringgung dan Pulau Puhawang di Kawasan Teluk Lampung. A. Kata kunci : kualitas perairan. Sebanyak 10 key responden telah ditentukan secara purposif berdasarkan kepemilikan KJA.

Hasil penelitian menunjukkan bahwa dendeng sidat dengan bumbu kasar mempunyai nilai yang lebih tinggi dibandingkan dengan bumbu halus terutama dari segi organoleptik.97%. Jakarta ABSTRAK Dalam rangka meningkatkan daya terima masyarakat dan peningkatan nilai tambah ikan sidat telah dilakukan penelitian pengolahan dendeng ikan sidat (Anguilla bocolor) hasil budidaya. Selanjutnya. abu. dan protein masing-masing sebesar 14.26%. Sedangkan nilai TVB dan pH masing-masing sebesar 21. kadar abu 19.663 cps. dan dijemur di bawah sinar matahari selama 18 jam.0%. analisis fisika-kimia . dan tekstur) menggunakan skala hedonik. Kadar air. dan dijemur di bawah sinar matahari selama 18 jam. Pada setiap bulan dilakukan pengambilan contoh untuk dilakukan analisis fisiko-kimia (kadar air rumput laut kering dan juga kadar air. mikrobiologi (Angka Lempeng Total/ALT. 28. setiap kelompok dikumpulkan dan dibagi menjadi dua bagian. viskositas 8. kimiawi (kadar air. natrium alginat. dan pH). Kelompok pertama ditebar di atas para-para pada ketinggian 1 m dari lantai. Perlakuan yang digunakan adalah pengolahan dendeng dengan penambahan bumbu yang terdiri atas rempahrempah kasar dan halus (ekstrak). kadar abu.44%. rasa.Forum Inovasi Teknologi Akuakultur 2010 pLL 13 PENINGKATAN NILAI TAMBAH MELALUI PENGOLAHAN DENDENG IKAN SIDAT (Anguilla bicolor) HASIL BUDIDAYA Murniyati*) dan Rusmaedi**) *) Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.41%. lemak. kemudian direndam dalam larutan KOH 0. Rendemen dendeng sidat dengan bumbu kasar sebesar 57. 7.46%. Penelitian dilakukan dengan tujuan untuk mendapatkan nilai tambah ikan sidat dan mendapatkan informasi mengenai kualitas dendeng ikan sidat.1%. dan penyimpanan dengan ditumpuk terbuka di atas lantai pada suhu ruang lebih baik daripada dikemas di dalam karung plastik (polietilen) dengan hasil analisis dari kadar air rumput laut coklat kering sekitar 15. rendemen. dan rendemennya 37. Rumput laut coklat dibagi menjadi dua kelompok. dan 28. KATA KUNCI: ikan sidat. terbuka di atas lantai pada suhu ruang (sekitar 30°C). dicuci dengan air bersih. rumput laut coklat. kapang) dan rendemen. Jakarta ABSTRAK Telah dilakukan penelitian pembuatan natrium alginat dari rumput laut coklat (Sargassum filipendulla). Jakarta **) Pusat Riset Perikanan Budidaya. dan mutu natrium alginatnya mempunyai kadar air 19.0%. KATA KUNCI: pengeringan. protein lemak. Kelompok kedua ditebar di atas lantai dengan beralaskan waring. abu. dan viskositas natrium alginat). bau. dendeng. Bagian pertama dikemas dalam karung plastik (polietilen) dan disimpan pada suhu ruang (sekitar 30°C) dan bagian kedua dibiarkan menumpuk.25% dan dendeng dengan bumbu ekstrak sebesar 59. TVB.4%. Hasil penelitian menunjukkan bahwa teknik pengeringan rumput laut coklat menggunakan para-para memberikan hasil yang lebih baik daripada dihampar di atas lantai. Rumput laut coklat setelah dipanen. Pengamatan yang dilakukan meliputi organoleptik (rupa dan warna.32%.1% selama 60 menit. nilai tambah pLL 14 PENGARUH TEKNIK PENGERINGAN DAN PENYIMPANAN RUMPUT LAUT COKLAT (Sargassum filipendula) TERHADAP MUTU NATRIUM ALGINAT YANG DIHASILKAN Nurul Hak Balai Besar Riset Pengolahan Produk dan Bioteknologi Kelautan dan Perikanan.04 mgN% dan 6.

kelembagaan yang menunjang. agribisnis perikanan . Data primer didapatkan dari wawancara mendalam dengan beberapa tokoh petani budidaya. Sedangkan faktor-faktor yang menghambat adalah teknologi budidaya yang masih tradisional. Penelitian dilakukan pada bulan Nopember 2006 di Desa Mekarjaya dan Desa Rancapaku. Hasil penelitian menunjukkan bahwa kedua desa memiliki potensi perikanan budidaya yang perlu dikembangkan sebagai kawasan agribisnis perikanan dalam rangka pemanfaatan potensi desa. serta ketersediannya dalam skala kecil.Forum Inovasi Teknologi Akuakultur 2010 pLL 15 MENGOPTIMALKAN PENDAYAGUNAAN POTENSI DESA DALAM PENGEMBANGAN AGRIBISNIS PERIKANAN (STUDI KASUS SENTRA PERIKANAN BUDIDAYA KOLAM DI KABUPATEN TASIKMALAYA) Maharani Yulisti dan Rani Hafsaridewi Balai Besar Riset Sosial Ekonomi Kelautan dan Perikanan. pengalaman petani ikan dan Kebijakan Pemerintah. Pola dan jenis komoditas yang lebih menguntungkan untuk dikembangkan di Kabupaten Tasikmalaya yaitu: pertama sistem minapadi. kedua sistem kolam air deras dan ketiga sistem longyam (balong ayam = integrasi antara kolam dan ayam). Faktor pendorong yaitu ketersediaan air yang melimpah. hubungan antar kelembagaan pada tingkat desa masih sederhana dan belum efektif dengan baik. harga ikan yang tergantung pembeli dan cuaca. KATA KUNCI: potensi desa. Identifikasi faktor-faktor pendorong maupun faktorfaktor penghambat dan upaya optimalisasi pengembangan agribisnis perikanan telah dilakukan di kabupaten Tasikmalaya. dan inkontinuitas produksi yang disebabkan daerah budidaya yang terpencar dan berjauhan. Jakarta ABSTRAK Penelitian ini bertujuan untuk mengetahui potensi desa. kekurangan modal. Metode yang digunakan adalah studi kasus. Kecamatan Padakembang Kabupaten Tasikmalaya yang merupakan sentra perikanan budidaya di Jawa Barat. polusi air. Analisis data dilakukan dengan deskriptif analisis menggunakan sumber data berupa data primer dan sekunder. prasarana fisik yang kurang mendukung.

Sign up to vote on this title
UsefulNot useful